Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
NOL9	79707	broad.mit.edu	37	1	6589196	6589196	+	Missense_Mutation	SNP	G	T	T			TCGA-28-5207-01	TCGA-28-5207-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:6589196G>T	uc001ans.2	-	10	1702	c.1683C>A	c.(1681-1683)CAC>CAA	p.H561Q	NOL9_uc010nzs.1_RNA	NM_024654	NP_078930	Q5SY16	NOL9_HUMAN	nucleolar protein 9	561					maturation of 5.8S rRNA	nucleolus	ATP binding|polynucleotide 5'-hydroxyl-kinase activity|RNA binding			skin(1)	1	Ovarian(185;0.0212)|all_lung(157;0.154)	all_cancers(23;2.46e-35)|all_epithelial(116;1.41e-22)|all_lung(118;7.59e-07)|Lung NSC(185;4.28e-06)|Colorectal(325;4.52e-05)|Breast(487;0.000353)|Renal(390;0.0007)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0443)		Colorectal(212;1.47e-07)|COAD - Colon adenocarcinoma(227;1.47e-05)|Kidney(185;5.27e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000971)|BRCA - Breast invasive adenocarcinoma(365;0.00113)|STAD - Stomach adenocarcinoma(132;0.0017)|READ - Rectum adenocarcinoma(331;0.0649)		CGACATCAGAGTGGGTAATCC	0.463													24	53	---	---	---	---	capture	Missense_Mutation	SNP	6589196	6589196	NOL9	1	G	T	T	T	1	0	0	0	0	1	0	0	0	464	36	4	4	10435	216
MACF1	23499	broad.mit.edu	37	1	39800817	39800817	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5207-01	TCGA-28-5207-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:39800817C>T	uc010oiu.1	+	1	4008	c.3877C>T	c.(3877-3879)CGT>TGT	p.R1293C	MACF1_uc010ois.1_Intron|MACF1_uc001cda.1_Intron|MACF1_uc001cdc.1_Intron|MACF1_uc001cdb.1_Intron	NM_033044	NP_149033	Q9UPN3	MACF1_HUMAN	microfilament and actin filament cross-linker	2858					cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding			ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			CAAGGATCAACGTAAGCCAAG	0.398													15	97	---	---	---	---	capture	Missense_Mutation	SNP	39800817	39800817	MACF1	1	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	9059	216
HYI	81888	broad.mit.edu	37	1	43917642	43917642	+	Missense_Mutation	SNP	T	C	C			TCGA-28-5207-01	TCGA-28-5207-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:43917642T>C	uc001cjo.2	-	4	639	c.469A>G	c.(469-471)ACT>GCT	p.T157A	KIAA0467_uc001cjk.1_3'UTR|KIAA0467_uc001cjl.1_3'UTR|HYI_uc001cjm.2_Missense_Mutation_p.T84A|HYI_uc001cjn.2_Missense_Mutation_p.T157A|HYI_uc001cjp.2_Missense_Mutation_p.T84A	NM_031207	NP_112484	Q5T013	HYI_HUMAN	hydroxypyruvate isomerase homolog	157							hydroxypyruvate isomerase activity			ovary(1)	1	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				TGGGGGTCAGTGATGCGGGTG	0.587													30	53	---	---	---	---	capture	Missense_Mutation	SNP	43917642	43917642	HYI	1	T	C	C	C	1	0	0	0	0	1	0	0	0	767	59	3	3	7393	216
FCRL2	79368	broad.mit.edu	37	1	157740305	157740305	+	Silent	SNP	A	T	T			TCGA-28-5207-01	TCGA-28-5207-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:157740305A>T	uc001fre.2	-	3	263	c.204T>A	c.(202-204)CTT>CTA	p.L68L	FCRL2_uc001frd.2_5'Flank|FCRL2_uc010phz.1_Silent_p.L68L|FCRL2_uc009wsp.2_Silent_p.L68L|FCRL2_uc010pia.1_Silent_p.L68L	NM_030764	NP_110391	Q96LA5	FCRL2_HUMAN	Fc receptor-like 2 precursor	68	Ig-like C2-type 1.|Extracellular (Potential).				cell-cell signaling	integral to membrane|plasma membrane|soluble fraction	receptor activity|SH3/SH2 adaptor activity			ovary(1)|pancreas(1)	2	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			CACTTTGGATAAGGAAATCTG	0.338													7	237	---	---	---	---	capture	Silent	SNP	157740305	157740305	FCRL2	1	A	T	T	T	1	0	0	0	0	0	0	0	1	158	13	4	4	5741	216
ZBTB37	84614	broad.mit.edu	37	1	173840057	173840057	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5207-01	TCGA-28-5207-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:173840057C>T	uc009wwp.1	+	3	970	c.694C>T	c.(694-696)CGG>TGG	p.R232W	GAS5_uc001gjj.2_5'Flank|GAS5_uc001gjk.2_5'Flank|ZBTB37_uc001gjp.1_Missense_Mutation_p.R232W|ZBTB37_uc001gjq.3_Missense_Mutation_p.R232W|ZBTB37_uc001gjr.2_Missense_Mutation_p.R232W	NM_001122770	NP_001116242	Q5TC79	ZBT37_HUMAN	zinc finger and BTB domain containing 37 isoform	232					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						CCGTGGGGGTCGGAGTGATGA	0.522													8	96	---	---	---	---	capture	Missense_Mutation	SNP	173840057	173840057	ZBTB37	1	C	T	T	T	1	0	0	0	0	1	0	0	0	399	31	1	1	17418	216
HMCN1	83872	broad.mit.edu	37	1	186099745	186099745	+	Silent	SNP	G	A	A			TCGA-28-5207-01	TCGA-28-5207-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:186099745G>A	uc001grq.1	+	85	13375	c.13146G>A	c.(13144-13146)CAG>CAA	p.Q4382Q	HMCN1_uc001grs.1_Translation_Start_Site	NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN	hemicentin 1 precursor	4382	Ig-like C2-type 43.				response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)|skin(1)	23						CAACCATCCAGTGGAACAGAA	0.488													62	153	---	---	---	---	capture	Silent	SNP	186099745	186099745	HMCN1	1	G	A	A	A	1	0	0	0	0	0	0	0	1	464	36	2	2	7145	216
ASPM	259266	broad.mit.edu	37	1	197062332	197062332	+	Silent	SNP	G	C	C			TCGA-28-5207-01	TCGA-28-5207-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:197062332G>C	uc001gtu.2	-	21	9401	c.9144C>G	c.(9142-9144)GTC>GTG	p.V3048V	ASPM_uc001gtv.2_Silent_p.V1463V|ASPM_uc001gtw.3_Silent_p.V896V	NM_018136	NP_060606	Q8IZT6	ASPM_HUMAN	asp (abnormal spindle)-like, microcephaly	3048	IQ 36.				mitosis	cytoplasm|nucleus	calmodulin binding			ovary(4)|central_nervous_system(2)	6						GCCGAAGAAAGACCTGCCTTC	0.348													342	226	---	---	---	---	capture	Silent	SNP	197062332	197062332	ASPM	1	G	C	C	C	1	0	0	0	0	0	0	0	1	418	33	4	4	1047	216
USH2A	7399	broad.mit.edu	37	1	216465647	216465647	+	Missense_Mutation	SNP	G	C	C			TCGA-28-5207-01	TCGA-28-5207-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:216465647G>C	uc001hku.1	-	10	2097	c.1710C>G	c.(1708-1710)TTC>TTG	p.F570L	USH2A_uc001hkv.2_Missense_Mutation_p.F570L	NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	570	Laminin EGF-like 1.|Extracellular (Potential).				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		GTTTACAATTGAAAGCGTAAA	0.413										HNSCC(13;0.011)			44	81	---	---	---	---	capture	Missense_Mutation	SNP	216465647	216465647	USH2A	1	G	C	C	C	1	0	0	0	0	1	0	0	0	581	45	4	4	16918	216
OR2T27	403239	broad.mit.edu	37	1	248814129	248814129	+	Missense_Mutation	SNP	G	T	T			TCGA-28-5207-01	TCGA-28-5207-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:248814129G>T	uc010pzo.1	-	1	57	c.57C>A	c.(55-57)AGC>AGA	p.S19R		NM_001001824	NP_001001824	Q8NH04	O2T27_HUMAN	olfactory receptor, family 2, subfamily T,	19	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1	all_cancers(71;1.15e-05)|all_epithelial(71;5.29e-06)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.089)|Lung NSC(105;0.0969)|Melanoma(84;0.199)	all_cancers(173;0.237)	OV - Ovarian serous cystadenocarcinoma(106;0.0265)			AACGGGCGTTGCTGAACAAAC	0.468													8	104	---	---	---	---	capture	Missense_Mutation	SNP	248814129	248814129	OR2T27	1	G	T	T	T	1	0	0	0	0	1	0	0	0	594	46	4	4	10925	216
NEBL	10529	broad.mit.edu	37	10	21124444	21124444	+	Nonsense_Mutation	SNP	C	A	A			TCGA-28-5207-01	TCGA-28-5207-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:21124444C>A	uc001iqi.2	-	14	1844	c.1447G>T	c.(1447-1449)GAG>TAG	p.E483*	NEBL_uc001iqj.2_RNA|NEBL_uc001iqk.2_Intron|NEBL_uc001iql.1_RNA	NM_006393	NP_006384	O76041	NEBL_HUMAN	nebulette sarcomeric isoform	483	Nebulin 13.				regulation of actin filament length		actin binding|structural constituent of muscle			ovary(2)	2						CTACTAACCTCACTCGCTATC	0.423													5	209	---	---	---	---	capture	Nonsense_Mutation	SNP	21124444	21124444	NEBL	10	C	A	A	A	1	0	0	0	0	0	1	0	0	377	29	5	4	10210	216
COL17A1	1308	broad.mit.edu	37	10	105798222	105798222	+	Silent	SNP	C	A	A			TCGA-28-5207-01	TCGA-28-5207-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:105798222C>A	uc001kxr.2	-	45	3181	c.3012G>T	c.(3010-3012)CCG>CCT	p.P1004P		NM_000494	NP_000485	Q9UMD9	COHA1_HUMAN	alpha 1 type XVII collagen	1004	Extracellular (Potential).|Triple-helical region.				cell-matrix adhesion|epidermis development|hemidesmosome assembly	basement membrane|cell-cell junction|collagen|hemidesmosome|integral to plasma membrane	protein binding			ovary(4)|pancreas(1)	5		Colorectal(252;0.103)|Breast(234;0.122)		Epithelial(162;2.5e-09)|all cancers(201;7.94e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0165)		TGATAGAGCCCGGAGGCCCAG	0.607													4	194	---	---	---	---	capture	Silent	SNP	105798222	105798222	COL17A1	10	C	A	A	A	1	0	0	0	0	0	0	0	1	288	23	4	4	3639	216
CTSF	8722	broad.mit.edu	37	11	66334786	66334786	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5207-01	TCGA-28-5207-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:66334786G>A	uc001oip.2	-	4	628	c.538C>T	c.(538-540)CCT>TCT	p.P180S		NM_003793	NP_003784	Q9UBX1	CATF_HUMAN	cathepsin F precursor	180					proteolysis	lysosome	cysteine-type endopeptidase activity				0						ATCTTCACAGGCAAGTCCTGG	0.522													4	194	---	---	---	---	capture	Missense_Mutation	SNP	66334786	66334786	CTSF	11	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	3995	216
SLCO2B1	11309	broad.mit.edu	37	11	74904384	74904384	+	Silent	SNP	G	A	A			TCGA-28-5207-01	TCGA-28-5207-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:74904384G>A	uc001owb.2	+	9	1584	c.1197G>A	c.(1195-1197)GAG>GAA	p.E399E	SLCO2B1_uc010rrq.1_Silent_p.E144E|SLCO2B1_uc010rrr.1_Silent_p.E255E|SLCO2B1_uc010rrs.1_Silent_p.E283E|SLCO2B1_uc001owc.2_Silent_p.E172E|SLCO2B1_uc001owd.2_Silent_p.E377E	NM_007256	NP_009187	O94956	SO2B1_HUMAN	solute carrier organic anion transporter family,	399	Extracellular (Potential).				sodium-independent organic anion transport	integral to membrane	sodium-independent organic anion transmembrane transporter activity			ovary(1)|breast(1)	2					Ergoloid mesylate(DB01049)	AGTTCCTGGAGCGCCAGTTTT	0.612													51	65	---	---	---	---	capture	Silent	SNP	74904384	74904384	SLCO2B1	11	G	A	A	A	1	0	0	0	0	0	0	0	1	438	34	2	2	14619	216
C11orf63	79864	broad.mit.edu	37	11	122756720	122756720	+	Missense_Mutation	SNP	A	G	G			TCGA-28-5207-01	TCGA-28-5207-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:122756720A>G	uc001pym.2	+	2	460	c.163A>G	c.(163-165)ATG>GTG	p.M55V	C11orf63_uc001pyl.1_Missense_Mutation_p.M55V	NM_024806	NP_079082	Q6NUN7	CK063_HUMAN	hypothetical protein LOC79864 isoform 1	55										ovary(3)	3		Breast(109;0.00249)|Lung NSC(97;0.0177)|all_lung(97;0.018)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.34e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0311)		GCAAGAGATTATGTGCCATTC	0.488													62	111	---	---	---	---	capture	Missense_Mutation	SNP	122756720	122756720	C11orf63	11	A	G	G	G	1	0	0	0	0	1	0	0	0	208	16	3	3	1640	216
ATP5B	506	broad.mit.edu	37	12	57033894	57033894	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5207-01	TCGA-28-5207-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:57033894G>A	uc001slr.2	-	8	1262	c.1157C>T	c.(1156-1158)TCG>TTG	p.S386L		NM_001686	NP_001677	P06576	ATPB_HUMAN	mitochondrial ATP synthase beta subunit	386					angiogenesis|ATP hydrolysis coupled proton transport|regulation of intracellular pH|respiratory electron transport chain	cell surface|mitochondrial nucleoid|mitochondrial proton-transporting ATP synthase, catalytic core|plasma membrane	ATP binding|eukaryotic cell surface binding|hydrogen ion transporting ATP synthase activity, rotational mechanism|hydrogen-exporting ATPase activity, phosphorylative mechanism|MHC class I protein binding|proton-transporting ATPase activity, rotational mechanism			ovary(1)	1						AATGGCACGCGACAGTACAGT	0.512													15	90	---	---	---	---	capture	Missense_Mutation	SNP	57033894	57033894	ATP5B	12	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	1139	216
FLT1	2321	broad.mit.edu	37	13	28877307	28877307	+	Missense_Mutation	SNP	G	C	C			TCGA-28-5207-01	TCGA-28-5207-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:28877307G>C	uc001usb.3	-	30	4299	c.4014C>G	c.(4012-4014)ATC>ATG	p.I1338M	FLT1_uc010aap.2_Missense_Mutation_p.I343M|FLT1_uc010aaq.2_Missense_Mutation_p.I463M|FLT1_uc001usa.3_Missense_Mutation_p.I556M	NM_002019	NP_002010	P17948	VGFR1_HUMAN	fms-related tyrosine kinase 1 isoform 1	1338	Cytoplasmic (Potential).				cell differentiation|female pregnancy|positive regulation of vascular endothelial growth factor receptor signaling pathway	extracellular space|Golgi apparatus|integral to plasma membrane|nucleus	ATP binding|growth factor binding|vascular endothelial growth factor receptor activity			lung(10)|central_nervous_system(5)|ovary(3)|stomach(2)|skin(2)|urinary_tract(1)|breast(1)	24	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0262)|Breast(139;0.188)	Colorectal(13;0.000674)	all cancers(112;0.0301)|Epithelial(112;0.155)|GBM - Glioblastoma multiforme(144;0.184)|OV - Ovarian serous cystadenocarcinoma(117;0.205)|Lung(94;0.207)	Sunitinib(DB01268)	TCAAACTCTAGATGGGTGGGG	0.488													7	126	---	---	---	---	capture	Missense_Mutation	SNP	28877307	28877307	FLT1	13	G	C	C	C	1	0	0	0	0	1	0	0	0	421	33	4	4	5885	216
NALCN	259232	broad.mit.edu	37	13	101742235	101742235	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5207-01	TCGA-28-5207-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:101742235C>T	uc001vox.1	-	29	3541	c.3352G>A	c.(3352-3354)GTG>ATG	p.V1118M		NM_052867	NP_443099	Q8IZF0	NALCN_HUMAN	voltage gated channel like 1	1118	Extracellular (Potential).					integral to membrane	sodium channel activity|voltage-gated ion channel activity			ovary(8)|breast(4)|skin(2)|pancreas(1)|central_nervous_system(1)	16	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					CTCACTTCCACCCAGCCTTTC	0.453													223	360	---	---	---	---	capture	Missense_Mutation	SNP	101742235	101742235	NALCN	13	C	T	T	T	1	0	0	0	0	1	0	0	0	234	18	2	2	10057	216
HERC1	8925	broad.mit.edu	37	15	63970125	63970125	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5207-01	TCGA-28-5207-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:63970125C>T	uc002amp.2	-	37	7137	c.6989G>A	c.(6988-6990)CGC>CAC	p.R2330H		NM_003922	NP_003913	Q15751	HERC1_HUMAN	hect domain and RCC1-like domain 1	2330					protein modification process|transport	cytosol|Golgi apparatus|membrane	acid-amino acid ligase activity|ARF guanyl-nucleotide exchange factor activity			ovary(6)|breast(6)|lung(5)|central_nervous_system(2)	19						CGTGGCATGGCGCCCAGTTTG	0.527													66	189	---	---	---	---	capture	Missense_Mutation	SNP	63970125	63970125	HERC1	15	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	6983	216
A2BP1	54715	broad.mit.edu	37	16	7629900	7629900	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5207-01	TCGA-28-5207-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:7629900C>T	uc002cys.2	+	6	1380	c.392C>T	c.(391-393)CCG>CTG	p.P131L	A2BP1_uc010buf.1_Missense_Mutation_p.P131L|A2BP1_uc002cyr.1_Missense_Mutation_p.P130L|A2BP1_uc002cyt.2_Missense_Mutation_p.P131L|A2BP1_uc010uxz.1_Missense_Mutation_p.P174L|A2BP1_uc010uya.1_Intron|A2BP1_uc002cyv.1_Missense_Mutation_p.P131L|A2BP1_uc010uyb.1_Missense_Mutation_p.P131L|A2BP1_uc002cyw.2_Missense_Mutation_p.P151L|A2BP1_uc002cyy.2_Missense_Mutation_p.P151L|A2BP1_uc002cyx.2_Missense_Mutation_p.P151L|A2BP1_uc010uyc.1_Missense_Mutation_p.P151L	NM_018723	NP_061193	Q9NWB1	RFOX1_HUMAN	ataxin 2-binding protein 1 isoform 4	131	RRM.				mRNA processing|RNA splicing|RNA transport	nucleus|trans-Golgi network	nucleotide binding|protein C-terminus binding|RNA binding				0		all_cancers(2;4.54e-52)|Colorectal(2;6.95e-44)|all_epithelial(2;1.15e-37)|Lung NSC(2;0.000289)|all_lung(2;0.00148)|Myeloproliferative disorder(2;0.0122)|Medulloblastoma(2;0.0354)|all_neural(2;0.0381)|all_hematologic(2;0.0749)|Renal(2;0.0758)|Melanoma(2;0.211)		Colorectal(1;3.55e-51)|COAD - Colon adenocarcinoma(2;1.92e-46)|all cancers(1;5.36e-16)|Epithelial(1;3.98e-15)|READ - Rectum adenocarcinoma(2;3.71e-05)|GBM - Glioblastoma multiforme(1;0.0499)		TTCCGGGATCCGGACCTCAGA	0.537													4	112	---	---	---	---	capture	Missense_Mutation	SNP	7629900	7629900	A2BP1	16	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	3	216
LCAT	3931	broad.mit.edu	37	16	67976842	67976842	+	Missense_Mutation	SNP	C	T	T	rs28940886		TCGA-28-5207-01	TCGA-28-5207-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:67976842C>T	uc002euy.1	-	3	360	c.349G>A	c.(349-351)GCC>ACC	p.A117T		NM_000229	NP_000220	P04180	LCAT_HUMAN	lecithin-cholesterol acyltransferase precursor	117					cholesterol esterification|cholesterol homeostasis|cholesterol metabolic process|high-density lipoprotein particle remodeling|phosphatidylcholine biosynthetic process|reverse cholesterol transport|very-low-density lipoprotein particle remodeling	high-density lipoprotein particle	apolipoprotein A-I binding|phosphatidylcholine-sterol O-acyltransferase activity				0		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00418)|Epithelial(162;0.0183)|all cancers(182;0.12)		ACACCAGGGGCGTTGGACACG	0.642													59	99	---	---	---	---	capture	Missense_Mutation	SNP	67976842	67976842	LCAT	16	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	8578	216
USP6	9098	broad.mit.edu	37	17	5037198	5037198	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5207-01	TCGA-28-5207-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:5037198G>A	uc002gau.1	+	15	2631	c.401G>A	c.(400-402)GGC>GAC	p.G134D	USP6_uc002gav.1_Missense_Mutation_p.G134D|USP6_uc010ckz.1_5'UTR|USP6_uc002gaw.2_Missense_Mutation_p.G195D|uc002gay.1_5'Flank|uc002gba.2_5'Flank|uc002gbb.2_5'Flank	NM_004505	NP_004496	P35125	UBP6_HUMAN	ubiquitin specific protease 6	134	Rab-GAP TBC.				protein deubiquitination|regulation of vesicle-mediated transport|ubiquitin-dependent protein catabolic process	lysosome|plasma membrane|recycling endosome	calmodulin binding|cysteine-type endopeptidase activity|nucleic acid binding|protein binding|Rab GTPase activator activity|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			skin(2)|upper_aerodigestive_tract(1)|lung(1)|breast(1)	5						AAGGAGAGGGGCAAGAGGTCA	0.552			T	COL1A1|CDH11|ZNF9|OMD	aneurysmal bone cysts								30	221	---	---	---	---	capture	Missense_Mutation	SNP	5037198	5037198	USP6	17	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	16968	216
TP53	7157	broad.mit.edu	37	17	7577141	7577141	+	Missense_Mutation	SNP	C	A	A			TCGA-28-5207-01	TCGA-28-5207-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7577141C>A	uc002gim.2	-	8	991	c.797G>T	c.(796-798)GGA>GTA	p.G266V	TP53_uc002gig.1_Intron|TP53_uc002gih.2_Missense_Mutation_p.G266V|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.G134V|TP53_uc010cng.1_Missense_Mutation_p.G134V|TP53_uc002gii.1_Missense_Mutation_p.G134V|TP53_uc010cnh.1_Missense_Mutation_p.G266V|TP53_uc010cni.1_Missense_Mutation_p.G266V|TP53_uc002gij.2_Missense_Mutation_p.G266V	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	266	|Interaction with E4F1.|Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		G -> R (in sporadic cancers; somatic mutation).|G -> V (in sporadic cancers; somatic mutation).|G -> E (in sporadic cancers; somatic mutation).|G -> A (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.G266E(45)|p.G266R(42)|p.G266V(32)|p.G266*(12)|p.0?(7)|p.G266fs*79(5)|p.?(3)|p.G262_F270delGNLLGRNSF(2)|p.G266A(2)|p.G266G(2)|p.G266_E271delGRNSFE(2)|p.G262_S269delGNLLGRNS(2)|p.G266fs*4(1)|p.G266T(1)|p.L265_K305del41(1)|p.E258fs*71(1)|p.G266fs*9(1)|p.L265_R267delLGR(1)|p.G266_N268delGRN(1)|p.G262fs*2(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		GCTGTTCCGTCCCAGTAGATT	0.517		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			15	23	---	---	---	---	capture	Missense_Mutation	SNP	7577141	7577141	TP53	17	C	A	A	A	1	0	0	0	0	1	0	0	0	390	30	4	4	16264	216
KRT40	125115	broad.mit.edu	37	17	39135111	39135111	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5207-01	TCGA-28-5207-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:39135111G>A	uc010cxh.1	-	8	1302	c.1141C>T	c.(1141-1143)CGG>TGG	p.R381W	KRT40_uc002hvq.1_RNA	NM_182497	NP_872303	Q6A162	K1C40_HUMAN	type I hair keratin KA36	381	Rod.|Coil 2.					intermediate filament	structural molecule activity				0		Breast(137;0.00043)				CCCTCCAGCCGGGCCTTCACG	0.582													39	174	---	---	---	---	capture	Missense_Mutation	SNP	39135111	39135111	KRT40	17	G	A	A	A	1	0	0	0	0	1	0	0	0	506	39	1	1	8398	216
SP6	80320	broad.mit.edu	37	17	45925367	45925367	+	Silent	SNP	G	A	A			TCGA-28-5207-01	TCGA-28-5207-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:45925367G>A	uc002img.1	-	2	761	c.429C>T	c.(427-429)GGC>GGT	p.G143G	SP6_uc002imh.1_Silent_p.G143G	NM_199262	NP_954871	Q3SY56	SP6_HUMAN	Sp6 transcription factor	143					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(1)	1						CCCCCGGGTGGCCAGGTGAGG	0.706													10	18	---	---	---	---	capture	Silent	SNP	45925367	45925367	SP6	17	G	A	A	A	1	0	0	0	0	0	0	0	1	535	42	2	2	14860	216
OTOP2	92736	broad.mit.edu	37	17	72926423	72926423	+	Silent	SNP	C	T	T			TCGA-28-5207-01	TCGA-28-5207-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:72926423C>T	uc010wrp.1	+	7	782	c.693C>T	c.(691-693)GCC>GCT	p.A231A		NM_178160	NP_835454	Q7RTS6	OTOP2_HUMAN	otopetrin 2	231						integral to membrane				ovary(3)|large_intestine(1)	4	all_lung(278;0.172)|Lung NSC(278;0.207)					GCAGCACGGCCGTCTGCCAGA	0.562													112	188	---	---	---	---	capture	Silent	SNP	72926423	72926423	OTOP2	17	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	11210	216
PRPSAP1	5635	broad.mit.edu	37	17	74326154	74326154	+	Missense_Mutation	SNP	A	G	G			TCGA-28-5207-01	TCGA-28-5207-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:74326154A>G	uc010wta.1	-	6	1051	c.605T>C	c.(604-606)ATT>ACT	p.I202T	PRPSAP1_uc010wtb.1_Missense_Mutation_p.I99T	NM_002766	NP_002757	Q14558	KPRA_HUMAN	phosphoribosyl pyrophosphate	173					nucleotide biosynthetic process		enzyme inhibitor activity|identical protein binding|magnesium ion binding|ribose phosphate diphosphokinase activity			ovary(1)	1						CTTAGCTACAATGACTGCATT	0.393													76	181	---	---	---	---	capture	Missense_Mutation	SNP	74326154	74326154	PRPSAP1	17	A	G	G	G	1	0	0	0	0	1	0	0	0	52	4	3	3	12477	216
COLEC12	81035	broad.mit.edu	37	18	335090	335090	+	Missense_Mutation	SNP	C	G	G			TCGA-28-5207-01	TCGA-28-5207-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:335090C>G	uc002kkm.2	-	6	1683	c.1468G>C	c.(1468-1470)GCT>CCT	p.A490P		NM_130386	NP_569057	Q5KU26	COL12_HUMAN	collectin sub-family member 12	490	Collagen-like 2.|Extracellular (Potential).				carbohydrate mediated signaling|innate immune response|phagocytosis, recognition|protein homooligomerization	collagen|integral to membrane	galactose binding|low-density lipoprotein particle binding|metal ion binding|pattern recognition receptor activity|scavenger receptor activity			ovary(1)|pancreas(1)	2		all_cancers(4;0.0442)|Myeloproliferative disorder(11;0.0426)				GGGGGACCAGCTGGTCCAATT	0.677													35	72	---	---	---	---	capture	Missense_Mutation	SNP	335090	335090	COLEC12	18	C	G	G	G	1	0	0	0	0	1	0	0	0	364	28	4	4	3677	216
ICAM1	3383	broad.mit.edu	37	19	10394791	10394791	+	Silent	SNP	C	T	T	rs143689328	byFrequency	TCGA-28-5207-01	TCGA-28-5207-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:10394791C>T	uc002mnq.2	+	4	1039	c.720C>T	c.(718-720)GAC>GAT	p.D240D	ICAM1_uc010xle.1_Intron|ICAM4_uc002mnr.1_5'Flank|ICAM4_uc002mns.1_5'Flank|ICAM4_uc002mnt.1_5'Flank	NM_000201	NP_000192	P05362	ICAM1_HUMAN	intercellular adhesion molecule 1 precursor	240	Ig-like C2-type 3.|Extracellular (Potential).				adhesion to symbiont|heterophilic cell-cell adhesion|interferon-gamma-mediated signaling pathway|leukocyte cell-cell adhesion|leukocyte migration|membrane to membrane docking|positive regulation of cellular extravasation|regulation of immune response|regulation of leukocyte mediated cytotoxicity|T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell|virion attachment, binding of host cell surface receptor	extracellular space|integral to plasma membrane	integrin binding|transmembrane receptor activity			ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(20;1.39e-09)|Epithelial(33;2.81e-06)|all cancers(31;6.56e-06)		Natalizumab(DB00108)|Simvastatin(DB00641)	GTTCCCTGGACGGGCTGTTCC	0.637													33	71	---	---	---	---	capture	Silent	SNP	10394791	10394791	ICAM1	19	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	7404	216
SMARCA4	6597	broad.mit.edu	37	19	11132404	11132404	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5207-01	TCGA-28-5207-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:11132404C>T	uc002mqf.3	+	19	2904	c.2620C>T	c.(2620-2622)CGT>TGT	p.R874C	SMARCA4_uc010dxp.2_Missense_Mutation_p.R874C|SMARCA4_uc010dxo.2_Missense_Mutation_p.R874C|SMARCA4_uc002mqg.1_Missense_Mutation_p.R874C|SMARCA4_uc010dxq.2_Missense_Mutation_p.R874C|SMARCA4_uc010dxr.2_Missense_Mutation_p.R874C|SMARCA4_uc002mqj.3_Missense_Mutation_p.R874C|SMARCA4_uc010dxs.2_Missense_Mutation_p.R874C|SMARCA4_uc010dxt.1_Missense_Mutation_p.R94C|SMARCA4_uc002mqh.3_5'UTR|SMARCA4_uc002mqi.1_Missense_Mutation_p.R77C	NM_003072	NP_003063	P51532	SMCA4_HUMAN	SWI/SNF-related matrix-associated	874	Helicase ATP-binding.				chromatin remodeling|negative regulation of androgen receptor signaling pathway|negative regulation of cell growth|negative regulation of S phase of mitotic cell cycle|negative regulation of transcription from RNA polymerase II promoter|nervous system development|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nBAF complex|npBAF complex|nuclear chromatin|SWI/SNF complex|WINAC complex	androgen receptor binding|ATP binding|DNA binding|DNA-dependent ATPase activity|helicase activity|histone acetyl-lysine binding|identical protein binding|p53 binding|protein N-terminus binding|transcription corepressor activity	p.?(1)		lung(29)|ovary(8)|pancreas(7)|large_intestine(5)|central_nervous_system(5)|skin(3)|prostate(3)|breast(2)|adrenal_gland(1)|stomach(1)|liver(1)|autonomic_ganglia(1)|kidney(1)	67		all_lung(6;0.0512)|Lung NSC(9;0.0568)				CCCGCAGATCCGTTGGAAGTA	0.632			F|N|Mis		NSCLC				Rhabdoid_Predisposition_syndrome				9	17	---	---	---	---	capture	Missense_Mutation	SNP	11132404	11132404	SMARCA4	19	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	14662	216
ZNF625	90589	broad.mit.edu	37	19	12256527	12256527	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5207-01	TCGA-28-5207-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:12256527C>T	uc002mth.2	-	4	856	c.506G>A	c.(505-507)CGA>CAA	p.R169Q	ZNF20_uc002mtg.1_Intron|ZNF625_uc010dyn.1_RNA|ZNF625_uc010dyo.1_Missense_Mutation_p.R203Q	NM_145233	NP_660276	Q96I27	ZN625_HUMAN	zinc finger protein 625	169	C2H2-type 5.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						TTCATGTATTCGAAGGCTACC	0.408													4	185	---	---	---	---	capture	Missense_Mutation	SNP	12256527	12256527	ZNF625	19	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	17927	216
B3GNT3	10331	broad.mit.edu	37	19	17922705	17922705	+	Missense_Mutation	SNP	T	C	C			TCGA-28-5207-01	TCGA-28-5207-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:17922705T>C	uc002nhk.1	+	3	978	c.893T>C	c.(892-894)GTC>GCC	p.V298A	B3GNT3_uc002nhl.1_Missense_Mutation_p.V298A|B3GNT3_uc010ebd.1_Missense_Mutation_p.V298A|B3GNT3_uc010ebe.1_Missense_Mutation_p.V298A	NM_014256	NP_055071	Q9Y2A9	B3GN3_HUMAN	UDP-GlcNAc:betaGal	298	Lumenal (Potential).				protein glycosylation	Golgi membrane|integral to plasma membrane	galactosyltransferase activity			upper_aerodigestive_tract(1)	1						ATTGATGATGTCTTCCTGGGT	0.632													30	297	---	---	---	---	capture	Missense_Mutation	SNP	17922705	17922705	B3GNT3	19	T	C	C	C	1	0	0	0	0	1	0	0	0	754	58	3	3	1247	216
JAK3	3718	broad.mit.edu	37	19	17943330	17943330	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5207-01	TCGA-28-5207-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:17943330G>A	uc002nhn.3	-	19	2778	c.2678C>T	c.(2677-2679)CCG>CTG	p.P893L	JAK3_uc010ebh.2_Intron|JAK3_uc002nho.2_Missense_Mutation_p.P893L	NM_000215	NP_000206	P52333	JAK3_HUMAN	Janus kinase 3	893	Protein kinase 2.				B cell differentiation|cytokine-mediated signaling pathway|enzyme linked receptor protein signaling pathway|intracellular protein kinase cascade|negative regulation of dendritic cell cytokine production|negative regulation of FasL biosynthetic process|negative regulation of interleukin-10 production|negative regulation of interleukin-12 production|negative regulation of T-helper 1 cell differentiation|negative regulation of thymocyte apoptosis|peptidyl-tyrosine phosphorylation|positive regulation of anti-apoptosis|response to interleukin-15|response to interleukin-2|response to interleukin-4|response to interleukin-9|T cell homeostasis	cytoskeleton|cytosol|endomembrane system|membrane	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein binding			haematopoietic_and_lymphoid_tissue(40)|lung(5)|breast(5)|ovary(3)|stomach(2)|upper_aerodigestive_tract(1)	56						TGGCTCACCCGGGCCATAGCT	0.542		2	Mis		acute megakaryocytic leukemia|								62	101	---	---	---	---	capture	Missense_Mutation	SNP	17943330	17943330	JAK3	19	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	7862	216
ZNF792	126375	broad.mit.edu	37	19	35449589	35449589	+	Silent	SNP	G	A	A			TCGA-28-5207-01	TCGA-28-5207-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:35449589G>A	uc002nxh.1	-	4	1557	c.1170C>T	c.(1168-1170)GGC>GGT	p.G390G		NM_175872	NP_787068	Q3KQV3	ZN792_HUMAN	zinc finger protein 792	390					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	all_lung(56;4.18e-08)|Lung NSC(56;6.62e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0849)			GGGCACTTCTGCCCGTATGAA	0.468													20	58	---	---	---	---	capture	Silent	SNP	35449589	35449589	ZNF792	19	G	A	A	A	1	0	0	0	0	0	0	0	1	587	46	2	2	18040	216
FCGBP	8857	broad.mit.edu	37	19	40360855	40360855	+	Splice_Site	SNP	C	A	A			TCGA-28-5207-01	TCGA-28-5207-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:40360855C>A	uc002omp.3	-	33	15560	c.15552_splice	c.e33+1	p.P5184_splice		NM_003890	NP_003881	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein precursor							extracellular region	protein binding			ovary(4)|skin(4)|central_nervous_system(1)	9	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			CCCCTACTCACCGGCAAGTAT	0.577													29	54	---	---	---	---	capture	Splice_Site	SNP	40360855	40360855	FCGBP	19	C	A	A	A	1	0	0	0	0	0	0	1	0	234	18	5	4	5724	216
C19orf48	84798	broad.mit.edu	37	19	51301380	51301380	+	Missense_Mutation	SNP	C	A	A			TCGA-28-5207-01	TCGA-28-5207-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:51301380C>A	uc002ptf.2	-	5	1248	c.326G>T	c.(325-327)AGA>ATA	p.R109I	C19orf48_uc002pte.2_RNA|C19orf48_uc002ptg.2_Missense_Mutation_p.R109I	NM_199249	NP_954857	Q6RUI8	CS048_HUMAN	multidrug resistance-related protein	109										ovary(1)	1		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00531)|GBM - Glioblastoma multiforme(134;0.0145)		CCCCAGGATTCTGGCCTGCTT	0.627													99	145	---	---	---	---	capture	Missense_Mutation	SNP	51301380	51301380	C19orf48	19	C	A	A	A	1	0	0	0	0	1	0	0	0	416	32	4	4	1914	216
SIGLEC8	27181	broad.mit.edu	37	19	51960480	51960480	+	Missense_Mutation	SNP	G	C	C			TCGA-28-5207-01	TCGA-28-5207-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:51960480G>C	uc002pwt.2	-	3	806	c.739C>G	c.(739-741)CCT>GCT	p.P247A	SIGLEC8_uc010yda.1_Intron|SIGLEC8_uc002pwu.2_RNA|SIGLEC8_uc010eox.2_Missense_Mutation_p.P154A	NM_014442	NP_055257	Q9NYZ4	SIGL8_HUMAN	sialic acid binding Ig-like lectin 8 precursor	247	Extracellular (Potential).|Ig-like C2-type 2.				cell adhesion	integral to membrane	sugar binding|transmembrane receptor activity			ovary(2)|kidney(1)|central_nervous_system(1)|skin(1)	5		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000627)|OV - Ovarian serous cystadenocarcinoma(262;0.00979)		AAGTTCCAAGGAGGGTCTGGG	0.557													68	90	---	---	---	---	capture	Missense_Mutation	SNP	51960480	51960480	SIGLEC8	19	G	C	C	C	1	0	0	0	0	1	0	0	0	533	41	4	4	14207	216
SNTG2	54221	broad.mit.edu	37	2	1271233	1271233	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5207-01	TCGA-28-5207-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:1271233G>A	uc002qwq.2	+	14	1302	c.1174G>A	c.(1174-1176)GTG>ATG	p.V392M	SNTG2_uc010ewi.2_Missense_Mutation_p.V265M	NM_018968	NP_061841	Q9NY99	SNTG2_HUMAN	syntrophin, gamma 2	392	PH.				central nervous system development	cytoplasm|cytoskeleton|sarcolemma|syntrophin complex	actin binding|PDZ domain binding			ovary(1)|large_intestine(1)|breast(1)	3	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.00469)		all cancers(51;0.0178)|OV - Ovarian serous cystadenocarcinoma(76;0.07)|Epithelial(75;0.0864)|GBM - Glioblastoma multiforme(21;0.173)		CTTCAGCATCGTGGCCGGCCA	0.522													4	42	---	---	---	---	capture	Missense_Mutation	SNP	1271233	1271233	SNTG2	2	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	14767	216
STRN	6801	broad.mit.edu	37	2	37152302	37152302	+	Missense_Mutation	SNP	T	C	C			TCGA-28-5207-01	TCGA-28-5207-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:37152302T>C	uc002rpn.2	-	2	293	c.284A>G	c.(283-285)AAG>AGG	p.K95R	STRN_uc010ezx.2_Missense_Mutation_p.K95R	NM_003162	NP_003153	O43815	STRN_HUMAN	striatin, calmodulin binding protein	95	Potential.				dendrite development|locomotory behavior|negative regulation of cell proliferation|tight junction assembly|Wnt receptor signaling pathway	cytoplasm|dendritic spine|neuronal cell body|postsynaptic density|postsynaptic membrane|tight junction	armadillo repeat domain binding|calmodulin binding|estrogen receptor binding|protein complex binding|protein phosphatase 2A binding			skin(1)	1		Ovarian(717;0.0129)|all_hematologic(82;0.21)				AAGATCCTTCTTCAAATTTTC	0.353													8	177	---	---	---	---	capture	Missense_Mutation	SNP	37152302	37152302	STRN	2	T	C	C	C	1	0	0	0	0	1	0	0	0	728	56	3	3	15219	216
SOCS5	9655	broad.mit.edu	37	2	46987001	46987001	+	Silent	SNP	G	T	T			TCGA-28-5207-01	TCGA-28-5207-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:46987001G>T	uc002rvf.2	+	2	1496	c.1332G>T	c.(1330-1332)CCG>CCT	p.P444P	SOCS5_uc010yoe.1_Silent_p.P413P|SOCS5_uc002rvg.2_Silent_p.P444P	NM_014011	NP_054730	O75159	SOCS5_HUMAN	suppressor of cytokine signaling 5	444	SH2.				cell growth|cytokine-mediated signaling pathway|intracellular signal transduction|negative regulation of signal transduction|negative regulation of T-helper 2 cell differentiation|positive regulation of T-helper 1 cell differentiation|regulation of growth					ovary(1)|lung(1)|central_nervous_system(1)	3		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	LUSC - Lung squamous cell carcinoma(58;0.114)			CCCATGACCCGTGTGTATTTC	0.443													87	170	---	---	---	---	capture	Silent	SNP	46987001	46987001	SOCS5	2	G	T	T	T	1	0	0	0	0	0	0	0	1	509	40	4	4	14809	216
IL1R1	3554	broad.mit.edu	37	2	102793083	102793083	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5207-01	TCGA-28-5207-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:102793083C>T	uc002tbq.2	+	12	1892	c.1574C>T	c.(1573-1575)TCT>TTT	p.S525F	IL1R1_uc010fix.2_Missense_Mutation_p.S494F|IL1R1_uc002tbr.2_Missense_Mutation_p.S525F	NM_000877	NP_000868	P14778	IL1R1_HUMAN	interleukin 1 receptor, type I precursor	525	TIR.|Cytoplasmic (Potential).				innate immune response	integral to plasma membrane	interleukin-1, Type I, activating receptor activity|platelet-derived growth factor receptor binding			skin(1)	1					Anakinra(DB00026)	GGACCACAGTCTGCAAAGACA	0.468													24	48	---	---	---	---	capture	Missense_Mutation	SNP	102793083	102793083	IL1R1	2	C	T	T	T	1	0	0	0	0	1	0	0	0	416	32	2	2	7581	216
LCT	3938	broad.mit.edu	37	2	136558294	136558294	+	Silent	SNP	G	A	A			TCGA-28-5207-01	TCGA-28-5207-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:136558294G>A	uc002tuu.1	-	12	4760	c.4749C>T	c.(4747-4749)AAC>AAT	p.N1583N		NM_002299	NP_002290	P09848	LPH_HUMAN	lactase-phlorizin hydrolase preproprotein	1583	Extracellular (Potential).|4.|4 X approximate repeats.				carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|integral to plasma membrane|membrane fraction	cation binding|glycosylceramidase activity|lactase activity			ovary(7)|central_nervous_system(2)|skin(2)|pancreas(1)|lung(1)	13				BRCA - Breast invasive adenocarcinoma(221;0.169)		GGTACACATCGTTGTACAGAT	0.537													57	58	---	---	---	---	capture	Silent	SNP	136558294	136558294	LCT	2	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	8613	216
ARHGAP15	55843	broad.mit.edu	37	2	144381721	144381721	+	Silent	SNP	C	T	T	rs138120208		TCGA-28-5207-01	TCGA-28-5207-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:144381721C>T	uc002tvm.3	+	12	1174	c.1023C>T	c.(1021-1023)GAC>GAT	p.D341D	ARHGAP15_uc002tvn.2_Silent_p.D107D	NM_018460	NP_060930	Q53QZ3	RHG15_HUMAN	ARHGAP15	341	Rho-GAP.				regulation of cell shape|small GTPase mediated signal transduction	cytosol|membrane	protein binding|Rac GTPase activator activity			ovary(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(221;0.151)		TGAATTTGGACGACAGCCAGT	0.448													28	62	---	---	---	---	capture	Silent	SNP	144381721	144381721	ARHGAP15	2	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	859	216
TTN	7273	broad.mit.edu	37	2	179647001	179647001	+	Silent	SNP	G	A	A	rs141768043		TCGA-28-5207-01	TCGA-28-5207-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179647001G>A	uc010zfg.1	-	20	3542	c.3318C>T	c.(3316-3318)GGC>GGT	p.G1106G	TTN_uc010zfh.1_Silent_p.G1060G|TTN_uc010zfi.1_Silent_p.G1060G|TTN_uc010zfj.1_Silent_p.G1060G|TTN_uc002unb.2_Silent_p.G1106G	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	1106							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTGGGTTGCCGCCAACTTGGC	0.488													5	141	---	---	---	---	capture	Silent	SNP	179647001	179647001	TTN	2	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	16617	216
ADRBK2	157	broad.mit.edu	37	22	26117315	26117315	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5207-01	TCGA-28-5207-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:26117315G>A	uc003abx.3	+	20	2003	c.1856G>A	c.(1855-1857)TGC>TAC	p.C619Y	ADRBK2_uc003aby.3_RNA	NM_005160	NP_005151	P35626	ARBK2_HUMAN	beta-adrenergic receptor kinase 2	619	PH.						ATP binding|beta-adrenergic receptor kinase activity|signal transducer activity			lung(3)|ovary(2)|stomach(1)|central_nervous_system(1)	7					Adenosine triphosphate(DB00171)	GACAAAAAATGCATTTTGTTC	0.274													44	35	---	---	---	---	capture	Missense_Mutation	SNP	26117315	26117315	ADRBK2	22	G	A	A	A	1	0	0	0	0	1	0	0	0	598	46	2	2	344	216
DDX17	10521	broad.mit.edu	37	22	38883964	38883964	+	Missense_Mutation	SNP	T	C	C			TCGA-28-5207-01	TCGA-28-5207-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:38883964T>C	uc003avy.3	-	12	1707	c.1604A>G	c.(1603-1605)AAA>AGA	p.K535R	DDX17_uc003avw.3_5'UTR|DDX17_uc010gxp.2_5'UTR|DDX17_uc003avx.3_Missense_Mutation_p.K535R	NM_001098504	NP_001091974	Q92841	DDX17_HUMAN	DEAD box polypeptide 17 isoform 3	456	Helicase C-terminal.				RNA processing	nucleus	ATP binding|ATP-dependent helicase activity|RNA binding|RNA helicase activity|RNA-dependent ATPase activity			skin(3)|upper_aerodigestive_tract(1)	4	Melanoma(58;0.0286)					TTCCAGCACTTTGATAAGCTC	0.547													20	169	---	---	---	---	capture	Missense_Mutation	SNP	38883964	38883964	DDX17	22	T	C	C	C	1	0	0	0	0	1	0	0	0	832	64	3	3	4302	216
LRIG1	26018	broad.mit.edu	37	3	66432740	66432740	+	Missense_Mutation	SNP	C	A	A			TCGA-28-5207-01	TCGA-28-5207-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:66432740C>A	uc003dmx.2	-	16	2588	c.2574G>T	c.(2572-2574)AGG>AGT	p.R858S	SLC25A26_uc011bft.1_Intron|LRIG1_uc011bfu.1_Missense_Mutation_p.R478S|LRIG1_uc003dmw.2_Missense_Mutation_p.R524S|LRIG1_uc010hnz.2_Missense_Mutation_p.R574S|LRIG1_uc010hoa.2_Missense_Mutation_p.R835S	NM_015541	NP_056356	Q96JA1	LRIG1_HUMAN	leucine-rich repeats and immunoglobulin-like	858	Cytoplasmic (Potential).					integral to membrane				skin(3)|ovary(2)	5		Lung NSC(201;0.0101)		BRCA - Breast invasive adenocarcinoma(55;0.00047)		CACCCTCGGTCCTGACCACGG	0.552													76	171	---	---	---	---	capture	Missense_Mutation	SNP	66432740	66432740	LRIG1	3	C	A	A	A	1	0	0	0	0	1	0	0	0	389	30	4	4	8860	216
STXBP5L	9515	broad.mit.edu	37	3	120957900	120957900	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5207-01	TCGA-28-5207-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:120957900C>T	uc003eec.3	+	13	1407	c.1267C>T	c.(1267-1269)CCG>TCG	p.P423S	STXBP5L_uc011bji.1_Missense_Mutation_p.P423S	NM_014980	NP_055795	Q9Y2K9	STB5L_HUMAN	syntaxin binding protein 5-like	423	WD 8.				exocytosis|protein transport	cytoplasm|integral to membrane|plasma membrane				ovary(7)|skin(2)	9				GBM - Glioblastoma multiforme(114;0.0694)		AGATTGTCCTCCGGATTTGAT	0.308													40	74	---	---	---	---	capture	Missense_Mutation	SNP	120957900	120957900	STXBP5L	3	C	T	T	T	1	0	0	0	0	1	0	0	0	390	30	2	2	15247	216
SLC25A36	55186	broad.mit.edu	37	3	140692641	140692641	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5207-01	TCGA-28-5207-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:140692641G>A	uc003etr.2	+	6	771	c.536G>A	c.(535-537)GGC>GAC	p.G179D	SLC25A36_uc003ets.2_Missense_Mutation_p.G179D|SLC25A36_uc003etq.2_Missense_Mutation_p.G22D|SLC25A36_uc011bmz.1_Missense_Mutation_p.G153D	NM_001104647	NP_001098117	Q96CQ1	S2536_HUMAN	solute carrier family 25, member 36 isoform a	179	Solcar 2.				response to estradiol stimulus|transmembrane transport	integral to membrane|mitochondrial inner membrane	binding				0						TTTTATAGGGGCATGTCTGCT	0.368													4	110	---	---	---	---	capture	Missense_Mutation	SNP	140692641	140692641	SLC25A36	3	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	14392	216
BOD1L	259282	broad.mit.edu	37	4	13603517	13603517	+	Missense_Mutation	SNP	T	G	G			TCGA-28-5207-01	TCGA-28-5207-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:13603517T>G	uc003gmz.1	-	10	5124	c.5007A>C	c.(5005-5007)AGA>AGC	p.R1669S	BOD1L_uc010idr.1_Missense_Mutation_p.R1006S	NM_148894	NP_683692	Q8NFC6	BOD1L_HUMAN	biorientation of chromosomes in cell division	1669							DNA binding			ovary(5)|breast(1)	6						TTTCTGAGTCTCTACTTAAAG	0.373													164	284	---	---	---	---	capture	Missense_Mutation	SNP	13603517	13603517	BOD1L	4	T	G	G	G	1	0	0	0	0	1	0	0	0	699	54	4	4	1471	216
PAQR3	152559	broad.mit.edu	37	4	79856373	79856373	+	Missense_Mutation	SNP	A	G	G			TCGA-28-5207-01	TCGA-28-5207-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:79856373A>G	uc003hlp.1	-	2	454	c.250T>C	c.(250-252)TTC>CTC	p.F84L	PAQR3_uc003hlm.2_RNA|PAQR3_uc003hln.2_Intron|PAQR3_uc003hlq.1_Intron	NM_001040202	NP_001035292	Q6TCH7	PAQR3_HUMAN	progestin and adipoQ receptor family member III	84	Helical; (Potential).					Golgi membrane|integral to membrane	receptor activity				0						CCCAGGGTGAAGAAGAGAAAG	0.368													46	103	---	---	---	---	capture	Missense_Mutation	SNP	79856373	79856373	PAQR3	4	A	G	G	G	1	0	0	0	0	1	0	0	0	39	3	3	3	11340	216
APC	324	broad.mit.edu	37	5	112175591	112175591	+	Missense_Mutation	SNP	A	G	G			TCGA-28-5207-01	TCGA-28-5207-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:112175591A>G	uc010jby.2	+	16	4680	c.4300A>G	c.(4300-4302)AGC>GGC	p.S1434G	APC_uc011cvt.1_Missense_Mutation_p.S1416G|APC_uc003kpz.3_Missense_Mutation_p.S1434G|APC_uc003kpy.3_Missense_Mutation_p.S1434G|APC_uc010jbz.2_Missense_Mutation_p.S1151G|APC_uc010jca.2_Missense_Mutation_p.S734G	NM_001127511	NP_001120983	P25054	APC_HUMAN	adenomatous polyposis coli	1434	Ser-rich.				canonical Wnt receptor signaling pathway|cell adhesion|cell cycle arrest|cell migration|cellular component disassembly involved in apoptosis|cytokinesis after mitosis|mitotic cell cycle spindle assembly checkpoint|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cyclin-dependent protein kinase activity|negative regulation of microtubule depolymerization|positive regulation of apoptosis|positive regulation of cell migration|positive regulation of pseudopodium assembly|protein complex assembly|regulation of attachment of spindle microtubules to kinetochore|response to DNA damage stimulus|tight junction assembly	adherens junction|APC-Axin-1-beta-catenin complex|Axin-APC-beta-catenin-GSK3B complex|beta-catenin destruction complex|centrosome|cytosol|kinetochore|lamellipodium|lateral plasma membrane|nucleus|ruffle membrane|tight junction	beta-catenin binding|gamma-catenin binding|microtubule plus-end binding|protein kinase binding|protein kinase regulator activity	p.S1434I(1)|p.P1424fs*19(1)|p.K1192fs*3(1)|p.?(1)		large_intestine(2123)|stomach(123)|soft_tissue(55)|small_intestine(34)|breast(26)|pancreas(25)|urinary_tract(20)|lung(19)|thyroid(18)|liver(13)|central_nervous_system(10)|ovary(9)|skin(7)|upper_aerodigestive_tract(6)|adrenal_gland(6)|bone(6)|NS(5)|prostate(4)|endometrium(3)|kidney(1)|oesophagus(1)|biliary_tract(1)	2515		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		CATGCCACCAAGCAGAAGTAA	0.483		12	D|Mis|N|F|S		colorectal|pancreatic|desmoid|hepatoblastoma|glioma|other CNS	colorectal|pancreatic|desmoid|hepatoblastoma|glioma|other CNS			Hereditary_Desmoid_Disease|Familial_Adenomatous_Polyposis|Turcot_syndrome	TSP Lung(16;0.13)			34	61	---	---	---	---	capture	Missense_Mutation	SNP	112175591	112175591	APC	5	A	G	G	G	1	0	0	0	0	1	0	0	0	39	3	3	3	756	216
PCDHGA8	9708	broad.mit.edu	37	5	140773167	140773167	+	Missense_Mutation	SNP	A	G	G			TCGA-28-5207-01	TCGA-28-5207-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140773167A>G	uc003lkd.1	+	1	1685	c.787A>G	c.(787-789)ACT>GCT	p.T263A	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkb.3_Missense_Mutation_p.T263A	NM_032088	NP_114477	Q9Y5G5	PCDG8_HUMAN	protocadherin gamma subfamily A, 8 isoform 1	263	Cadherin 3.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCGGCTGCTTACTGTAACAGC	0.473													10	168	---	---	---	---	capture	Missense_Mutation	SNP	140773167	140773167	PCDHGA8	5	A	G	G	G	1	0	0	0	0	1	0	0	0	182	14	3	3	11463	216
SPRY4	81848	broad.mit.edu	37	5	141694230	141694230	+	Silent	SNP	G	A	A			TCGA-28-5207-01	TCGA-28-5207-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:141694230G>A	uc003lml.2	-	2	703	c.444C>T	c.(442-444)GTC>GTT	p.V148V	SPRY4_uc010jgi.1_Silent_p.V171V	NM_001127496	NP_001120968	Q9C004	SPY4_HUMAN	sprouty homolog 4 isoform 2	148					multicellular organismal development	cytoplasm|ruffle membrane	protein binding			ovary(1)|lung(1)	2		all_hematologic(541;0.118)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCTCGGGTGGGACCGCCGGGC	0.652									Testicular_Cancer_Familial_Clustering_of				53	79	---	---	---	---	capture	Silent	SNP	141694230	141694230	SPRY4	5	G	A	A	A	1	0	0	0	0	0	0	0	1	522	41	2	2	15000	216
HLA-DOA	3111	broad.mit.edu	37	6	32974898	32974898	+	Silent	SNP	G	A	A			TCGA-28-5207-01	TCGA-28-5207-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:32974898G>A	uc003ocr.2	-	4	784	c.708C>T	c.(706-708)ACC>ACT	p.T236T	HLA-DOA_uc010juj.2_Intron|HLA-DOA_uc010jui.2_3'UTR	NM_002119	NP_002110	P06340	DOA_HUMAN	major histocompatibility complex, class II, DO	236	Helical; (Potential).				antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|interferon-gamma-mediated signaling pathway|T cell costimulation|T cell receptor signaling pathway	endosome membrane|integral to membrane|lysosomal membrane|MHC class II protein complex	MHC class II receptor activity				0						TGATGAGGACGGTGCCCACGA	0.627													58	82	---	---	---	---	capture	Silent	SNP	32974898	32974898	HLA-DOA	6	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	7125	216
PLA2G7	7941	broad.mit.edu	37	6	46678392	46678392	+	Silent	SNP	G	T	T			TCGA-28-5207-01	TCGA-28-5207-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:46678392G>T	uc010jzf.2	-	8	936	c.667C>A	c.(667-669)CGG>AGG	p.R223R	PLA2G7_uc010jzg.1_Silent_p.R223R|PLA2G7_uc011dwd.1_Silent_p.R178R|PLA2G7_uc011dwe.1_Silent_p.R96R	NM_005084	NP_005075	Q13093	PAFA_HUMAN	phospholipase A2, group VII	223					inflammatory response|lipid catabolic process	extracellular space	1-alkyl-2-acetylglycerophosphocholine esterase activity|phospholipid binding				0			Lung(136;0.192)			GCTCTTTGCCGTACCTAATAT	0.323													56	103	---	---	---	---	capture	Silent	SNP	46678392	46678392	PLA2G7	6	G	T	T	T	1	0	0	0	0	0	0	0	1	519	40	4	4	11912	216
EGFR	1956	broad.mit.edu	37	7	55221821	55221821	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5207-01	TCGA-28-5207-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:55221821G>A	uc003tqk.2	+	7	1111	c.865G>A	c.(865-867)GCC>ACC	p.A289T	EGFR_uc003tqh.2_Missense_Mutation_p.A289T|EGFR_uc003tqi.2_Missense_Mutation_p.A289T|EGFR_uc003tqj.2_Missense_Mutation_p.A289T|EGFR_uc010kzg.1_Missense_Mutation_p.A244T|EGFR_uc011kco.1_Missense_Mutation_p.A236T|EGFR_uc011kcp.1_5'Flank|EGFR_uc011kcq.1_5'Flank	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	289	Approximate.|Extracellular (Potential).				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	p.A289V(20)|p.V30_R297>G(5)|p.A289T(3)|p.A289D(3)		lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	CAGCTTTGGTGCCACCTGCGT	0.592		8	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			81	104	---	---	---	---	capture	Missense_Mutation	SNP	55221821	55221821	EGFR	7	G	A	A	A	1	0	0	0	0	1	0	0	0	598	46	2	2	4922	216
HYAL4	23553	broad.mit.edu	37	7	123508443	123508443	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5207-01	TCGA-28-5207-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:123508443G>A	uc003vlc.2	+	3	754	c.116G>A	c.(115-117)CGA>CAA	p.R39Q	HYAL4_uc011knz.1_Missense_Mutation_p.R39Q	NM_012269	NP_036401	Q2M3T9	HYAL4_HUMAN	hyaluronoglucosaminidase 4	39	Extracellular (Potential).				fusion of sperm to egg plasma membrane|glycosaminoglycan catabolic process	integral to membrane	hyalurononglucosaminidase activity			skin(1)	1						AAACCTGCTCGACTTCCAATT	0.323													17	299	---	---	---	---	capture	Missense_Mutation	SNP	123508443	123508443	HYAL4	7	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	7391	216
PLXNA4	91584	broad.mit.edu	37	7	131859666	131859666	+	Silent	SNP	C	T	T			TCGA-28-5207-01	TCGA-28-5207-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:131859666C>T	uc003vra.3	-	21	4117	c.3888G>A	c.(3886-3888)CTG>CTA	p.L1296L		NM_020911	NP_065962	Q9HCM2	PLXA4_HUMAN	plexin A4 isoform 1	1296	Cytoplasmic (Potential).					integral to membrane|intracellular|plasma membrane				ovary(1)	1						TGTCCGTCTGCAGCTCGGCAA	0.562													66	134	---	---	---	---	capture	Silent	SNP	131859666	131859666	PLXNA4	7	C	T	T	T	1	0	0	0	0	0	0	0	1	314	25	2	2	12025	216
CHRM2	1129	broad.mit.edu	37	7	136700324	136700324	+	Missense_Mutation	SNP	G	C	C			TCGA-28-5207-01	TCGA-28-5207-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:136700324G>C	uc003vtf.1	+	4	1335	c.712G>C	c.(712-714)GGA>CGA	p.G238R	CHRM2_uc003vtg.1_Missense_Mutation_p.G238R|CHRM2_uc003vtj.1_Missense_Mutation_p.G238R|CHRM2_uc003vtk.1_Missense_Mutation_p.G238R|CHRM2_uc003vtl.1_Missense_Mutation_p.G238R|CHRM2_uc003vtm.1_Missense_Mutation_p.G238R|CHRM2_uc003vti.1_Missense_Mutation_p.G238R|CHRM2_uc003vto.1_Missense_Mutation_p.G238R|CHRM2_uc003vtn.1_Missense_Mutation_p.G238R|uc003vtp.1_Intron	NM_001006630	NP_001006631	P08172	ACM2_HUMAN	cholinergic receptor, muscarinic 2	238	Cytoplasmic (By similarity).				activation of phospholipase C activity by muscarinic acetylcholine receptor signaling pathway|G-protein signaling, coupled to cAMP nucleotide second messenger|nervous system development|regulation of heart contraction|response to virus	cell junction|integral to plasma membrane|postsynaptic membrane	muscarinic acetylcholine receptor activity|protein binding			ovary(4)|central_nervous_system(1)	5					Anisotropine Methylbromide(DB00517)|Atropine(DB00572)|Benzquinamide(DB00767)|Carbachol(DB00411)|Cryptenamine(DB00785)|Cyclizine(DB01176)|Desipramine(DB01151)|Diphenidol(DB01231)|Doxacurium(DB01334)|Doxacurium chloride(DB01135)|Flavoxate(DB01148)|Gallamine Triethiodide(DB00483)|Homatropine Methylbromide(DB00725)|Hyoscyamine(DB00424)|Ipratropium(DB00332)|Methotrimeprazine(DB01403)|Metixene(DB00340)|Metocurine(DB01336)|Mivacurium(DB01226)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Pilocarpine(DB01085)|Procyclidine(DB00387)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Rocuronium(DB00728)|Thiethylperazine(DB00372)|Tolterodine(DB01036)|Tridihexethyl(DB00505)|Triflupromazine(DB00508)	TCTGGTACAAGGAAGGATAGT	0.507													21	76	---	---	---	---	capture	Missense_Mutation	SNP	136700324	136700324	CHRM2	7	G	C	C	C	1	0	0	0	0	1	0	0	0	455	35	4	4	3342	216
TNKS	8658	broad.mit.edu	37	8	9620738	9620738	+	Missense_Mutation	SNP	A	G	G			TCGA-28-5207-01	TCGA-28-5207-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:9620738A>G	uc003wss.2	+	22	3361	c.3356A>G	c.(3355-3357)CAG>CGG	p.Q1119R	TNKS_uc011kww.1_Missense_Mutation_p.Q882R	NM_003747	NP_003738	O95271	TNKS1_HUMAN	tankyrase, TRF1-interacting ankyrin-related	1119	PARP catalytic.				mitotic spindle organization|mRNA transport|negative regulation of DNA binding|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of telomere maintenance via telomerase|protein auto-ADP-ribosylation|protein localization to chromosome, telomeric region|protein poly-ADP-ribosylation|protein polyubiquitination|protein transport|spindle assembly|transmembrane transport|Wnt receptor signaling pathway	chromosome, centromeric region|Golgi membrane|microsome|nuclear chromosome, telomeric region|nuclear membrane|nuclear pore|pericentriolar material	NAD+ ADP-ribosyltransferase activity|protein binding|zinc ion binding			lung(4)|ovary(2)|kidney(1)	7				COAD - Colon adenocarcinoma(149;0.0467)		AAAGAATATCAGTCAGTGGAA	0.358													3	75	---	---	---	---	capture	Missense_Mutation	SNP	9620738	9620738	TNKS	8	A	G	G	G	1	0	0	0	0	1	0	0	0	91	7	3	3	16202	216
GSDMC	56169	broad.mit.edu	37	8	130762682	130762682	+	Missense_Mutation	SNP	T	C	C			TCGA-28-5207-01	TCGA-28-5207-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:130762682T>C	uc003ysr.2	-	11	1960	c.1078A>G	c.(1078-1080)AAC>GAC	p.N360D		NM_031415	NP_113603	Q9BYG8	GSDMC_HUMAN	melanoma-derived leucine zipper, extra-nuclear	360						mitochondrion				ovary(2)|skin(1)	3						CTCACCATGTTCATCAGGTCC	0.468													4	138	---	---	---	---	capture	Missense_Mutation	SNP	130762682	130762682	GSDMC	8	T	C	C	C	1	0	0	0	0	1	0	0	0	806	62	3	3	6750	216
PYCRL	65263	broad.mit.edu	37	8	144690265	144690265	+	Silent	SNP	A	G	G			TCGA-28-5207-01	TCGA-28-5207-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:144690265A>G	uc003yyy.2	-	2	169	c.159T>C	c.(157-159)AGT>AGC	p.S53S	PYCRL_uc011lkm.1_Silent_p.S53S|PYCRL_uc011lkn.1_RNA	NM_023078	NP_075566	Q53H96	P5CR3_HUMAN	pyrroline-5-carboxylate reductase-like	41					proline biosynthetic process		pyrroline-5-carboxylate reductase activity				0	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.17e-38)|Epithelial(56;7.17e-37)|all cancers(56;2.46e-32)|Colorectal(110;0.134)|BRCA - Breast invasive adenocarcinoma(115;0.239)			CTGTTGGTGCACTGGCCAGTA	0.532													12	69	---	---	---	---	capture	Silent	SNP	144690265	144690265	PYCRL	8	A	G	G	G	1	0	0	0	0	0	0	0	1	76	6	3	3	12752	216
MPDZ	8777	broad.mit.edu	37	9	13107002	13107002	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5207-01	TCGA-28-5207-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:13107002G>A	uc010mhy.2	-	45	6139	c.6088C>T	c.(6088-6090)CGG>TGG	p.R2030W	MPDZ_uc003zkx.3_Missense_Mutation_p.R254W|MPDZ_uc003zky.3_Missense_Mutation_p.R593W|MPDZ_uc010mib.2_Missense_Mutation_p.R764W|MPDZ_uc010mhx.2_Missense_Mutation_p.R881W|MPDZ_uc011lmm.1_Missense_Mutation_p.R918W|MPDZ_uc003zkz.3_Missense_Mutation_p.R752W|MPDZ_uc010mhz.2_Missense_Mutation_p.R2026W|MPDZ_uc011lmn.1_Missense_Mutation_p.R1997W|MPDZ_uc003zlb.3_Missense_Mutation_p.R2030W	NM_003829	NP_003820	O75970	MPDZ_HUMAN	multiple PDZ domain protein	2059	PDZ 13.				interspecies interaction between organisms	apical plasma membrane|dendrite|postsynaptic density|postsynaptic membrane|synaptosome|tight junction	protein C-terminus binding			ovary(5)|central_nervous_system(1)	6				GBM - Glioblastoma multiforme(50;2.03e-06)		CCTTTTGTCCGTTTAAGGATG	0.483													81	208	---	---	---	---	capture	Missense_Mutation	SNP	13107002	13107002	MPDZ	9	G	A	A	A	1	0	0	0	0	1	0	0	0	519	40	1	1	9634	216
ZCCHC6	79670	broad.mit.edu	37	9	88967843	88967843	+	Missense_Mutation	SNP	T	C	C			TCGA-28-5207-01	TCGA-28-5207-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:88967843T>C	uc004aoq.2	-	2	487	c.272A>G	c.(271-273)AAT>AGT	p.N91S	ZCCHC6_uc011ltf.1_RNA|ZCCHC6_uc004aor.2_RNA|ZCCHC6_uc004aos.2_RNA|ZCCHC6_uc004aot.2_Missense_Mutation_p.N91S|ZCCHC6_uc004aou.2_Missense_Mutation_p.N91S|ZCCHC6_uc004aov.2_Missense_Mutation_p.N91S|ZCCHC6_uc004aow.2_Missense_Mutation_p.N91S|ZCCHC6_uc010mqf.1_Missense_Mutation_p.N91S	NM_024617	NP_078893	Q5VYS8	TUT7_HUMAN	zinc finger, CCHC domain containing 6	91					RNA 3'-end processing		nucleic acid binding|RNA uridylyltransferase activity|zinc ion binding			ovary(2)	2						GTGGCTGTCATTCATCCAAGC	0.438													131	191	---	---	---	---	capture	Missense_Mutation	SNP	88967843	88967843	ZCCHC6	9	T	C	C	C	1	0	0	0	0	1	0	0	0	676	52	3	3	17472	216
PHF8	23133	broad.mit.edu	37	X	54037681	54037681	+	Missense_Mutation	SNP	C	G	G			TCGA-28-5207-01	TCGA-28-5207-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:54037681C>G	uc004dsu.2	-	8	1001	c.928G>C	c.(928-930)GCC>CCC	p.A310P	PHF8_uc004dst.2_Missense_Mutation_p.A274P|PHF8_uc004dsv.2_Missense_Mutation_p.A140P|PHF8_uc004dsw.2_Missense_Mutation_p.A274P|PHF8_uc004dsx.2_Missense_Mutation_p.A38P|PHF8_uc004dsy.2_Missense_Mutation_p.A274P	NM_015107	NP_055922	Q9UPP1	PHF8_HUMAN	PHD finger protein 8	310	JmjC.				brain development|G1/S transition of mitotic cell cycle|negative regulation of chromatin silencing at rDNA|positive regulation of transcription from RNA polymerase I promoter|transcription, DNA-dependent	nucleolus	chromatin binding|histone demethylase activity (H3-K27 specific)|histone demethylase activity (H3-K36 specific)|histone demethylase activity (H3-K9 specific)|histone demethylase activity (H4-K20 specific)|iron ion binding|methylated histone residue binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding			ovary(3)	3						GTCAGATTGGCATTTGTTGGG	0.448													3	61	---	---	---	---	capture	Missense_Mutation	SNP	54037681	54037681	PHF8	23	C	G	G	G	1	0	0	0	0	1	0	0	0	325	25	4	4	11743	216
MAGEE1	57692	broad.mit.edu	37	X	75649443	75649443	+	Missense_Mutation	SNP	G	C	C			TCGA-28-5207-01	TCGA-28-5207-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:75649443G>C	uc004ecm.1	+	1	1327	c.1120G>C	c.(1120-1122)GAT>CAT	p.D374H		NM_020932	NP_065983	Q9HCI5	MAGE1_HUMAN	melanoma antigen family E, 1	374	Pro-rich.					dendrite|nucleus|perinuclear region of cytoplasm|postsynaptic membrane				breast(3)|ovary(1)|pancreas(1)|skin(1)	6						CACCGCCTCTGATGGATCGGA	0.677													2	18	---	---	---	---	capture	Missense_Mutation	SNP	75649443	75649443	MAGEE1	23	G	C	C	C	1	0	0	0	0	1	0	0	0	585	45	4	4	9099	216
RPA4	29935	broad.mit.edu	37	X	96139742	96139742	+	Missense_Mutation	SNP	A	G	G			TCGA-28-5207-01	TCGA-28-5207-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:96139742A>G	uc004efv.3	+	1	731	c.433A>G	c.(433-435)ATT>GTT	p.I145V	DIAPH2_uc004eft.3_Intron|DIAPH2_uc004efu.3_Intron|DIAPH2_uc004efs.2_Intron	NM_013347	NP_037479	Q13156	RFA4_HUMAN	replication protein A4, 34kDa	145					DNA damage checkpoint|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|nucleotide-excision repair	DNA replication factor A complex|nucleoplasm	single-stranded DNA binding				0						GGTATTGAAAATTCATGTCCT	0.453								Other_identified_genes_with_known_or_suspected_DNA_repair_function					69	24	---	---	---	---	capture	Missense_Mutation	SNP	96139742	96139742	RPA4	23	A	G	G	G	1	0	0	0	0	1	0	0	0	52	4	3	3	13431	216
MARS	4141	broad.mit.edu	37	12	57883052	57883053	+	Frame_Shift_Ins	INS	-	T	T	rs11540808		TCGA-28-5207-01	TCGA-28-5207-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:57883052_57883053insT	uc001sog.2	+	3	226_227	c.203_204insT	c.(202-204)TATfs	p.Y68fs	ARHGAP9_uc001sod.2_5'Flank|ARHGAP9_uc001soe.1_5'Flank|MARS_uc001sof.1_RNA|MARS_uc010srp.1_Intron|MARS_uc010srq.1_5'UTR	NM_004990	NP_004981	P56192	SYMC_HUMAN	methionyl-tRNA synthetase	68					methionyl-tRNA aminoacylation	cytosol	ATP binding|methionine-tRNA ligase activity|protein binding|tRNA binding			ovary(3)|central_nervous_system(1)|pancreas(1)	5			GBM - Glioblastoma multiforme(3;4.27e-41)		L-Methionine(DB00134)	CTGGGCAGATATTTTTTTTTGT	0.485													11	932	---	---	---	---	capture_indel	Frame_Shift_Ins	INS	57883052	57883053	MARS	12	-	T	T	T	1	0	1	1	0	0	0	0	0	208	16	5	5	9229	216
C6orf154	221424	broad.mit.edu	37	6	43475289	43475291	+	In_Frame_Del	DEL	TCC	-	-			TCGA-28-5207-01	TCGA-28-5207-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:43475289_43475291delTCC	uc003ovk.1	-	5	1684_1686	c.783_785delGGA	c.(781-786)GAGGAA>GAA	p.261_262EE>E	C6orf154_uc003ovj.1_In_Frame_Del_p.70_71EE>E	NM_001012974	NP_001012992	Q5JTD7	CF154_HUMAN	hypothetical protein LOC221424	261_262	Poly-Glu.										0	all_cancers(18;3.79e-05)|Lung NSC(15;0.00217)|all_lung(25;0.00536)		Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00736)|OV - Ovarian serous cystadenocarcinoma(102;0.0711)			TCCTGCCACTTCCTCCTCCTCCT	0.631													11	990	---	---	---	---	capture_indel	In_Frame_Del	DEL	43475289	43475291	C6orf154	6	TCC	-	-	-	1	0	1	0	1	0	0	0	0	806	62	5	5	2316	216
QKI	9444	broad.mit.edu	37	6	163984582	163984585	+	Frame_Shift_Del	DEL	CAGA	-	-			TCGA-28-5207-01	TCGA-28-5207-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:163984582_163984585delCAGA	uc003qui.2	+	6	1316_1319	c.765_768delCAGA	c.(763-768)ATCAGAfs	p.I255fs	QKI_uc003que.2_Frame_Shift_Del_p.I255fs|QKI_uc003quf.2_Frame_Shift_Del_p.I255fs|QKI_uc003qug.2_Frame_Shift_Del_p.I255fs|QKI_uc003quh.2_Frame_Shift_Del_p.I247fs|QKI_uc003quj.2_Frame_Shift_Del_p.I247fs	NM_006775	NP_006766	Q96PU8	QKI_HUMAN	quaking homolog, KH domain RNA binding isoform	255_256					mRNA processing|mRNA transport|regulation of translation|RNA splicing	cytoplasm|nucleus|plasma membrane	RNA binding|SH3 domain binding			large_intestine(1)|ovary(1)	2		Breast(66;5e-05)|Prostate(117;0.0235)|all_neural(5;0.0416)|Ovarian(120;0.0448)|Glioma(2;0.203)		all cancers(1;4.4e-46)|OV - Ovarian serous cystadenocarcinoma(33;6.91e-23)|GBM - Glioblastoma multiforme(1;2.94e-19)|BRCA - Breast invasive adenocarcinoma(81;1.49e-06)|Kidney(3;0.000199)|KIRC - Kidney renal clear cell carcinoma(3;0.000234)		TGCCTTTGATCAGACAAATACAGA	0.554													30	36	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	163984582	163984585	QKI	6	CAGA	-	-	-	1	0	1	0	1	0	0	0	0	369	29	5	5	12768	216
