Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
TMEM61	199964	broad.mit.edu	37	1	55457654	55457654	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5208-01	TCGA-28-5208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:55457654G>A	uc001cyd.2	+	3	785	c.511G>A	c.(511-513)GCC>ACC	p.A171T		NM_182532	NP_872338	Q8N0U2	TMM61_HUMAN	transmembrane protein 61	171						integral to membrane					0						CACCCAGCCCGCCTGGCCTCC	0.642													112	147	---	---	---	---	capture	Missense_Mutation	SNP	55457654	55457654	TMEM61	1	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	16071	217
TTF2	8458	broad.mit.edu	37	1	117638845	117638845	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5208-01	TCGA-28-5208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:117638845C>T	uc001egy.2	+	20	3130	c.3110C>T	c.(3109-3111)GCC>GTC	p.A1037V		NM_003594	NP_003585	Q9UNY4	TTF2_HUMAN	transcription termination factor, RNA polymerase	1037	Helicase C-terminal.				mRNA processing|regulation of transcription, DNA-dependent|RNA splicing|termination of RNA polymerase II transcription	cytoplasm|spliceosomal complex|transcription elongation factor complex	ATP binding|ATP-dependent helicase activity|DNA binding|DNA-dependent ATPase activity|protein binding|zinc ion binding			ovary(1)	1	Lung SC(450;0.225)	all_cancers(81;4.23e-06)|all_epithelial(167;3.65e-07)|all_lung(203;2.81e-06)|Lung NSC(69;1.98e-05)		Lung(183;0.0553)|Colorectal(144;0.179)|LUSC - Lung squamous cell carcinoma(189;0.19)		CTGACTTATGCCACCATCGAT	0.458													4	160	---	---	---	---	capture	Missense_Mutation	SNP	117638845	117638845	TTF2	1	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	16601	217
PI4KB	5298	broad.mit.edu	37	1	151271347	151271347	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5208-01	TCGA-28-5208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:151271347C>T	uc001ext.2	-	9	2367	c.1952G>A	c.(1951-1953)CGC>CAC	p.R651H	PI4KB_uc001exr.2_Missense_Mutation_p.R663H|PI4KB_uc001exs.2_Missense_Mutation_p.R636H|PI4KB_uc001exu.2_Missense_Mutation_p.R636H|PI4KB_uc010pcw.1_Missense_Mutation_p.R319H	NM_002651	NP_002642	Q9UBF8	PI4KB_HUMAN	catalytic phosphatidylinositol 4-kinase beta	651	PI3K/PI4K.				phosphatidylinositol biosynthetic process|phosphatidylinositol-mediated signaling|receptor-mediated endocytosis	endosome|Golgi apparatus|mitochondrial outer membrane|perinuclear region of cytoplasm|rough endoplasmic reticulum membrane	1-phosphatidylinositol 4-kinase activity|ATP binding|protein binding			ovary(2)|skin(2)	4	Lung SC(34;0.00471)|Ovarian(49;0.0147)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			CACAAAATTGCGCTGTGCACT	0.502													230	297	---	---	---	---	capture	Missense_Mutation	SNP	151271347	151271347	PI4KB	1	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	11777	217
HRNR	388697	broad.mit.edu	37	1	152188049	152188049	+	Missense_Mutation	SNP	T	G	G			TCGA-28-5208-01	TCGA-28-5208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152188049T>G	uc001ezt.1	-	3	6132	c.6056A>C	c.(6055-6057)CAT>CCT	p.H2019P		NM_001009931	NP_001009931	Q86YZ3	HORN_HUMAN	hornerin	2019	22.				keratinization		calcium ion binding|protein binding			skin(2)|ovary(1)	3	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TGCAGAACCATGTTGCCCATG	0.552													72	647	---	---	---	---	capture	Missense_Mutation	SNP	152188049	152188049	HRNR	1	T	G	G	G	1	0	0	0	0	1	0	0	0	663	51	4	4	7284	217
LCE5A	254910	broad.mit.edu	37	1	152484251	152484251	+	Nonsense_Mutation	SNP	C	T	T			TCGA-28-5208-01	TCGA-28-5208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152484251C>T	uc001ezy.2	+	2	417	c.241C>T	c.(241-243)CGA>TGA	p.R81*	CRCT1_uc001ezz.2_5'Flank	NM_178438	NP_848525	Q5TCM9	LCE5A_HUMAN	late cornified envelope 5A	81	Cys-rich.				keratinization					ovary(1)	1	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			CCTCCGACGCCGACCTCAGAG	0.677													28	33	---	---	---	---	capture	Nonsense_Mutation	SNP	152484251	152484251	LCE5A	1	C	T	T	T	1	0	0	0	0	0	1	0	0	295	23	5	1	8595	217
ITLN1	55600	broad.mit.edu	37	1	160851913	160851913	+	Missense_Mutation	SNP	G	T	T			TCGA-28-5208-01	TCGA-28-5208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:160851913G>T	uc001fxc.2	-	4	355	c.239C>A	c.(238-240)ACC>AAC	p.T80N		NM_017625	NP_060095	Q8WWA0	ITLN1_HUMAN	intelectin precursor	80	Fibrinogen C-terminal.				positive regulation of glucose import|positive regulation of protein phosphorylation|response to nematode|signal transduction	anchored to membrane|brush border membrane|extracellular region|membrane raft	receptor binding|sugar binding			ovary(2)|skin(2)|upper_aerodigestive_tract(1)|pancreas(1)|central_nervous_system(1)	7	all_cancers(52;2.99e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00737)			GGCCACCAGGGTCCAGCCGCC	0.592													48	77	---	---	---	---	capture	Missense_Mutation	SNP	160851913	160851913	ITLN1	1	G	T	T	T	1	0	0	0	0	1	0	0	0	572	44	4	4	7833	217
C1orf125	126859	broad.mit.edu	37	1	179354443	179354443	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5208-01	TCGA-28-5208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:179354443G>A	uc001gmo.2	+	9	939	c.812G>A	c.(811-813)CGA>CAA	p.R271Q	C1orf125_uc009wxg.2_RNA|C1orf125_uc001gmn.1_Missense_Mutation_p.R59Q|C1orf125_uc010pnl.1_RNA|C1orf125_uc001gmp.2_Missense_Mutation_p.R271Q	NM_144696	NP_653297	Q5T1B0	AXDN1_HUMAN	hypothetical protein LOC126859 isoform 1	271											0						GAACTTATTCGACAAGTCAGT	0.358													66	136	---	---	---	---	capture	Missense_Mutation	SNP	179354443	179354443	C1orf125	1	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	1975	217
WNT9A	7483	broad.mit.edu	37	1	228112065	228112065	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5208-01	TCGA-28-5208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:228112065G>A	uc001hri.2	-	3	477	c.389C>T	c.(388-390)TCG>TTG	p.S130L		NM_003395	NP_003386	O14904	WNT9A_HUMAN	wingless-type MMTV integration site family,	130					anterior/posterior pattern formation|axis specification|canonical Wnt receptor signaling pathway|cell-cell signaling|cellular response to retinoic acid|cornea development in camera-type eye|embryonic arm morphogenesis|embryonic skeletal joint morphogenesis|endoderm development|iris morphogenesis|mitotic cell cycle G1/S transition checkpoint|negative regulation of cell proliferation|negative regulation of chondrocyte differentiation|neuron differentiation|positive regulation of smoothened signaling pathway|Wnt receptor signaling pathway, calcium modulating pathway	extracellular space|plasma membrane|proteinaceous extracellular matrix	extracellular matrix structural constituent|G-protein-coupled receptor binding|signal transducer activity			central_nervous_system(1)|pancreas(1)	2		Prostate(94;0.0405)				CAGGCCAGCCGAGGAGATGGC	0.662													59	61	---	---	---	---	capture	Missense_Mutation	SNP	228112065	228112065	WNT9A	1	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	17279	217
NLRP3	114548	broad.mit.edu	37	1	247587155	247587155	+	Missense_Mutation	SNP	G	A	A	rs138946894	byFrequency	TCGA-28-5208-01	TCGA-28-5208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:247587155G>A	uc001icr.2	+	5	548	c.410G>A	c.(409-411)CGT>CAT	p.R137H	NLRP3_uc001ics.2_Missense_Mutation_p.R137H|NLRP3_uc001icu.2_Missense_Mutation_p.R137H|NLRP3_uc001icw.2_Missense_Mutation_p.R137H|NLRP3_uc001icv.2_Missense_Mutation_p.R137H|NLRP3_uc010pyw.1_Missense_Mutation_p.R135H|NLRP3_uc001ict.1_Missense_Mutation_p.R135H	NM_001079821	NP_001073289	Q96P20	NALP3_HUMAN	NLR family, pyrin domain containing 3 isoform a	137					detection of biotic stimulus|induction of apoptosis|inflammatory response|negative regulation of NF-kappaB import into nucleus|negative regulation of NF-kappaB transcription factor activity|positive regulation of interleukin-1 beta secretion|protein oligomerization|signal transduction	cytoplasm	ATP binding|peptidoglycan binding|protein binding			lung(8)|skin(8)|ovary(7)|upper_aerodigestive_tract(1)|breast(1)|pancreas(1)	26	all_cancers(71;9.66e-05)|all_epithelial(71;1.85e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0172)	OV - Ovarian serous cystadenocarcinoma(106;0.0141)			GTAGATTACCGTAAGAAGTAC	0.507													22	25	---	---	---	---	capture	Missense_Mutation	SNP	247587155	247587155	NLRP3	1	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	10385	217
ODF3	113746	broad.mit.edu	37	11	197577	197577	+	Silent	SNP	G	A	A			TCGA-28-5208-01	TCGA-28-5208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:197577G>A	uc001lob.2	+	3	420	c.126G>A	c.(124-126)ACG>ACA	p.T42T	ODF3_uc010qvk.1_Silent_p.T42T|ODF3_uc001loc.2_Silent_p.T42T	NM_053280	NP_444510	Q96PU9	ODF3A_HUMAN	outer dense fiber of sperm tails 3	42					cell differentiation|multicellular organismal development|spermatogenesis	cytoplasm		p.T42T(1)		ovary(1)	1		all_cancers(49;9.23e-07)|all_epithelial(84;0.000315)|Breast(177;0.00122)|Ovarian(85;0.0202)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;3.95e-27)|Epithelial(43;2.66e-26)|OV - Ovarian serous cystadenocarcinoma(40;5.55e-21)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.105)|LUSC - Lung squamous cell carcinoma(625;0.122)		TGAAGCACACGCCCACCAAGC	0.652													26	56	---	---	---	---	capture	Silent	SNP	197577	197577	ODF3	11	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	10734	217
KRTAP5-4	387267	broad.mit.edu	37	11	1642827	1642827	+	Missense_Mutation	SNP	G	C	C			TCGA-28-5208-01	TCGA-28-5208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:1642827G>C	uc009ycy.1	-	4	722	c.635C>G	c.(634-636)TCC>TGC	p.S212C		NM_001012709	NP_001012727	Q6L8H1	KRA54_HUMAN	keratin associated protein 5-4	226	9 X 4 AA repeats of C-C-X-P.					keratin filament					0		all_epithelial(84;0.00819)|Breast(177;0.00832)|Ovarian(85;0.0256)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		ACCTGAGGAGGAGCAGCAGGG	0.607													4	269	---	---	---	---	capture	Missense_Mutation	SNP	1642827	1642827	KRTAP5-4	11	G	C	C	C	1	0	0	0	0	1	0	0	0	533	41	4	4	8483	217
APBB1	322	broad.mit.edu	37	11	6423823	6423823	+	Missense_Mutation	SNP	A	G	G			TCGA-28-5208-01	TCGA-28-5208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:6423823A>G	uc001mdb.1	-	7	1337	c.1237T>C	c.(1237-1239)TCT>CCT	p.S413P	APBB1_uc001mcz.1_Missense_Mutation_p.S34P|APBB1_uc001mdd.3_Missense_Mutation_p.S193P|APBB1_uc001mda.2_Intron|APBB1_uc001mdc.1_Missense_Mutation_p.S413P|APBB1_uc010rab.1_5'Flank|APBB1_uc010rac.1_5'Flank|APBB1_uc010rad.1_Missense_Mutation_p.S34P|APBB1_uc010rae.1_Missense_Mutation_p.S178P|APBB1_uc010raf.1_Missense_Mutation_p.S154P|APBB1_uc009yfa.2_Missense_Mutation_p.S154P|APBB1_uc009yey.2_Missense_Mutation_p.S154P|APBB1_uc010rag.1_Missense_Mutation_p.S154P|APBB1_uc009yfb.2_Missense_Mutation_p.S154P|APBB1_uc001mde.2_Missense_Mutation_p.S154P|APBB1_uc010rah.1_Missense_Mutation_p.S154P	NM_001164	NP_001155	O00213	APBB1_HUMAN	amyloid beta A4 precursor protein-binding,	413	PID 1.				apoptosis|axonogenesis|cell cycle arrest|histone H4 acetylation|negative regulation of cell growth|negative regulation of S phase of mitotic cell cycle|negative regulation of thymidylate synthase biosynthetic process|positive regulation of apoptosis|positive regulation of transcription, DNA-dependent|response to DNA damage stimulus|signal transduction|transcription, DNA-dependent	cytoplasm|growth cone|lamellipodium|nucleus|plasma membrane|synapse	beta-amyloid binding|chromatin binding|histone binding|proline-rich region binding|transcription factor binding			breast(2)	2		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;6.49e-08)|BRCA - Breast invasive adenocarcinoma(625;0.194)		CAGCCCCCAGACATGGGGTCA	0.582													90	110	---	---	---	---	capture	Missense_Mutation	SNP	6423823	6423823	APBB1	11	A	G	G	G	1	0	0	0	0	1	0	0	0	130	10	3	3	752	217
OR4C12	283093	broad.mit.edu	37	11	50003266	50003266	+	Missense_Mutation	SNP	G	A	A	rs148765699	byFrequency;by1000genomes	TCGA-28-5208-01	TCGA-28-5208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:50003266G>A	uc010ria.1	-	1	772	c.772C>T	c.(772-774)CGC>TGC	p.R258C		NM_001005270	NP_001005270	Q96R67	OR4CC_HUMAN	olfactory receptor, family 4, subfamily C,	258	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3						GTCACTGAGCGCAGATACACA	0.433													45	73	---	---	---	---	capture	Missense_Mutation	SNP	50003266	50003266	OR4C12	11	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	10950	217
OR5D16	390144	broad.mit.edu	37	11	55606713	55606713	+	Silent	SNP	G	A	A			TCGA-28-5208-01	TCGA-28-5208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:55606713G>A	uc010rio.1	+	1	486	c.486G>A	c.(484-486)GCG>GCA	p.A162A		NM_001005496	NP_001005496	Q8NGK9	OR5DG_HUMAN	olfactory receptor, family 5, subfamily D,	162	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(4)|skin(1)	5		all_epithelial(135;0.208)				TGACACTCGCGTGCTCTGCTT	0.453													70	125	---	---	---	---	capture	Silent	SNP	55606713	55606713	OR5D16	11	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	11060	217
OR8H3	390152	broad.mit.edu	37	11	55890211	55890211	+	Missense_Mutation	SNP	T	G	G			TCGA-28-5208-01	TCGA-28-5208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:55890211T>G	uc001nii.1	+	1	363	c.363T>G	c.(361-363)GAT>GAG	p.D121E		NM_001005201	NP_001005201	Q8N146	OR8H3_HUMAN	olfactory receptor, family 8, subfamily H,	121	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2	Esophageal squamous(21;0.00693)					TGGCCTATGATCGCTATGCAG	0.468													225	322	---	---	---	---	capture	Missense_Mutation	SNP	55890211	55890211	OR8H3	11	T	G	G	G	1	0	0	0	0	1	0	0	0	647	50	4	4	11143	217
TCN1	6947	broad.mit.edu	37	11	59630133	59630133	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5208-01	TCGA-28-5208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:59630133C>T	uc001noj.2	-	3	420	c.322G>A	c.(322-324)GCT>ACT	p.A108T		NM_001062	NP_001053	P20061	TCO1_HUMAN	transcobalamin I precursor	108					cobalamin metabolic process|cobalamin transport|cobalt ion transport	extracellular region	cobalamin binding			ovary(2)	2		all_epithelial(135;0.198)			Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	TTTTCCTCAGCGTTACGACAT	0.358													96	159	---	---	---	---	capture	Missense_Mutation	SNP	59630133	59630133	TCN1	11	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	15591	217
AHNAK	79026	broad.mit.edu	37	11	62284308	62284308	+	Nonsense_Mutation	SNP	G	A	A			TCGA-28-5208-01	TCGA-28-5208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:62284308G>A	uc001ntl.2	-	5	17881	c.17581C>T	c.(17581-17583)CGA>TGA	p.R5861*	AHNAK_uc001ntk.1_Intron	NM_001620	NP_001611	Q09666	AHNK_HUMAN	AHNAK nucleoprotein isoform 1	5861					nervous system development	nucleus	protein binding			ovary(10)|pancreas(4)|skin(4)|upper_aerodigestive_tract(1)	19		Melanoma(852;0.155)				GAGGACAGTCGGGACTTCTTA	0.522													153	235	---	---	---	---	capture	Nonsense_Mutation	SNP	62284308	62284308	AHNAK	11	G	A	A	A	1	0	0	0	0	0	1	0	0	506	39	5	1	414	217
TECTA	7007	broad.mit.edu	37	11	120983846	120983846	+	Silent	SNP	C	T	T	rs148364865	byFrequency	TCGA-28-5208-01	TCGA-28-5208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:120983846C>T	uc010rzo.1	+	4	552	c.552C>T	c.(550-552)TAC>TAT	p.Y184Y		NM_005422	NP_005413	O75443	TECTA_HUMAN	tectorin alpha precursor	184	NIDO.				cell-matrix adhesion|sensory perception of sound	anchored to membrane|plasma membrane|proteinaceous extracellular matrix				breast(6)|ovary(2)|skin(2)	10	all_hematologic(175;0.208)	Breast(109;0.000766)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;8.04e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.166)		TCAATTATTACGAAATCAACT	0.567											OREG0021430	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	48	61	---	---	---	---	capture	Silent	SNP	120983846	120983846	TECTA	11	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	15632	217
OR4D5	219875	broad.mit.edu	37	11	123811110	123811110	+	Missense_Mutation	SNP	C	T	T	rs141929562		TCGA-28-5208-01	TCGA-28-5208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:123811110C>T	uc001pzk.1	+	1	787	c.787C>T	c.(787-789)CGG>TGG	p.R263W		NM_001001965	NP_001001965	Q8NGN0	OR4D5_HUMAN	olfactory receptor, family 4, subfamily D,	263	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0399)		AAGGCCTTTTCGGACATTCCC	0.512													122	198	---	---	---	---	capture	Missense_Mutation	SNP	123811110	123811110	OR4D5	11	C	T	T	T	1	0	0	0	0	1	0	0	0	399	31	1	1	10961	217
ATN1	1822	broad.mit.edu	37	12	7047759	7047759	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5208-01	TCGA-28-5208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:7047759C>T	uc001qrw.1	+	7	2870	c.2633C>T	c.(2632-2634)CCT>CTT	p.P878L	ATN1_uc001qrx.1_Missense_Mutation_p.P878L	NM_001007026	NP_001007027	P54259	ATN1_HUMAN	atrophin-1	878					cell death|central nervous system development	cytoplasm|nucleus	protein domain specific binding			ovary(2)|breast(2)|pancreas(1)|skin(1)	6						TACCTGGGTCCTGACACTCCA	0.632											OREG0021641	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	85	106	---	---	---	---	capture	Missense_Mutation	SNP	7047759	7047759	ATN1	12	C	T	T	T	1	0	0	0	0	1	0	0	0	312	24	2	2	1102	217
SLC26A10	65012	broad.mit.edu	37	12	58014190	58014190	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5208-01	TCGA-28-5208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:58014190G>A	uc001spe.2	+	1	498	c.187G>A	c.(187-189)GTC>ATC	p.V63I	uc001spc.2_5'Flank|SLC26A10_uc001spf.2_RNA	NM_133489	NP_597996	Q8NG04	S2610_HUMAN	solute carrier family 26, member 10	63	Helical; (Potential).					integral to membrane	antiporter activity			large_intestine(1)|central_nervous_system(1)	2	Melanoma(17;0.122)					TTTCTTCCCCGTCCTCATCTA	0.537													368	509	---	---	---	---	capture	Missense_Mutation	SNP	58014190	58014190	SLC26A10	12	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	14407	217
NOS1	4842	broad.mit.edu	37	12	117723944	117723944	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5208-01	TCGA-28-5208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:117723944G>A	uc001twm.1	-	6	1941	c.1255C>T	c.(1255-1257)CGC>TGC	p.R419C		NM_000620	NP_000611	P29475	NOS1_HUMAN	nitric oxide synthase 1, neuronal	419					multicellular organismal response to stress|myoblast fusion|negative regulation of calcium ion transport into cytosol|neurotransmitter biosynthetic process|nitric oxide biosynthetic process|platelet activation|positive regulation of vasodilation|regulation of cardiac muscle contraction|response to heat|response to hypoxia	cytoskeleton|cytosol|dendritic spine|perinuclear region of cytoplasm|photoreceptor inner segment|sarcolemma|sarcoplasmic reticulum	arginine binding|cadmium ion binding|calmodulin binding|flavin adenine dinucleotide binding|FMN binding|heme binding|NADP binding|nitric-oxide synthase activity|tetrahydrobiopterin binding			ovary(3)|skin(3)|pancreas(1)	7	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0561)	L-Citrulline(DB00155)	CCCACACAGCGCGAGGCATTC	0.557													71	120	---	---	---	---	capture	Missense_Mutation	SNP	117723944	117723944	NOS1	12	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	10448	217
KDM2B	84678	broad.mit.edu	37	12	121890960	121890960	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5208-01	TCGA-28-5208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:121890960C>T	uc001uat.2	-	13	2026	c.1922G>A	c.(1921-1923)CGC>CAC	p.R641H	KDM2B_uc001uaq.2_Missense_Mutation_p.R81H|KDM2B_uc010szy.1_Missense_Mutation_p.R81H|KDM2B_uc001uar.2_Missense_Mutation_p.R232H|KDM2B_uc001uas.2_Missense_Mutation_p.R610H|KDM2B_uc001uau.2_Missense_Mutation_p.R524H	NM_032590	NP_115979	Q8NHM5	KDM2B_HUMAN	F-box and leucine-rich repeat protein 10 isoform	641	CXXC-type.				embryonic camera-type eye morphogenesis|fourth ventricle development|histone H2A monoubiquitination|initiation of neural tube closure|lateral ventricle development|midbrain development|midbrain-hindbrain boundary morphogenesis|negative regulation of neural precursor cell proliferation|negative regulation of neuron apoptosis|negative regulation of transcription from RNA polymerase II promoter|spermatogenesis|third ventricle development|transcription, DNA-dependent	nucleolus	DNA binding|histone demethylase activity (H3-K36 specific)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|rRNA binding|zinc ion binding			ovary(1)|skin(1)	2						CTGCTTCATGCGCCCGGGGCC	0.706													10	31	---	---	---	---	capture	Missense_Mutation	SNP	121890960	121890960	KDM2B	12	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	8047	217
KBTBD6	89890	broad.mit.edu	37	13	41705212	41705212	+	Missense_Mutation	SNP	A	G	G			TCGA-28-5208-01	TCGA-28-5208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:41705212A>G	uc001uxu.1	-	1	1725	c.1436T>C	c.(1435-1437)CTA>CCA	p.L479P	KBTBD6_uc010ace.1_Intron|KBTBD6_uc010tfe.1_Missense_Mutation_p.L413P|uc001uxv.1_5'Flank	NM_152903	NP_690867	Q86V97	KBTB6_HUMAN	kelch repeat and BTB (POZ) domain-containing 6	479	Kelch 2.						protein binding			ovary(1)|skin(1)	2		Lung NSC(96;4.52e-06)|Breast(139;0.00123)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(98;0.114)		all cancers(112;4.08e-09)|Epithelial(112;4.74e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000131)|GBM - Glioblastoma multiforme(144;0.000876)|BRCA - Breast invasive adenocarcinoma(63;0.0673)		AATTACCATTAGGTCAAAGGA	0.433													3	160	---	---	---	---	capture	Missense_Mutation	SNP	41705212	41705212	KBTBD6	13	A	G	G	G	1	0	0	0	0	1	0	0	0	195	15	3	3	7919	217
TSHR	7253	broad.mit.edu	37	14	81610025	81610025	+	Silent	SNP	C	T	T			TCGA-28-5208-01	TCGA-28-5208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:81610025C>T	uc001xvd.1	+	10	1779	c.1623C>T	c.(1621-1623)ATC>ATT	p.I541I		NM_000369	NP_000360	P16473	TSHR_HUMAN	thyroid stimulating hormone receptor isoform 1	541	Helical; Name=4; (Potential).				cell-cell signaling|positive regulation of cell proliferation	integral to plasma membrane	protein binding|thyroid-stimulating hormone receptor activity			thyroid(289)|ovary(5)|lung(3)|kidney(1)|skin(1)	299				BRCA - Breast invasive adenocarcinoma(234;0.0402)	Thyrotropin Alfa(DB00024)	CATGTGCCATCATGGTTGGGG	0.587			Mis		toxic thyroid adenoma	thyroid  adenoma	Hereditary nonautoimmune hyperthyroidism; subclinical hypothyroidism 						86	121	---	---	---	---	capture	Silent	SNP	81610025	81610025	TSHR	14	C	T	T	T	1	0	0	0	0	0	0	0	1	369	29	2	2	16505	217
ASB2	51676	broad.mit.edu	37	14	94404157	94404157	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5208-01	TCGA-28-5208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:94404157G>A	uc001ycc.1	-	7	2003	c.1514C>T	c.(1513-1515)GCG>GTG	p.A505V	ASB2_uc001ycb.1_Missense_Mutation_p.A199V|ASB2_uc001ycd.2_Missense_Mutation_p.A553V|ASB2_uc001yce.1_Missense_Mutation_p.A451V	NM_016150	NP_057234	Q96Q27	ASB2_HUMAN	ankyrin repeat and SOCS box-containing protein	505					intracellular signal transduction					ovary(1)|pancreas(1)	2		all_cancers(154;0.13)		COAD - Colon adenocarcinoma(157;0.217)|Epithelial(152;0.232)		GATGGGCCCCGCCCAGCGGCT	0.597													23	31	---	---	---	---	capture	Missense_Mutation	SNP	94404157	94404157	ASB2	14	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	1014	217
MGA	23269	broad.mit.edu	37	15	42058284	42058284	+	Silent	SNP	C	T	T			TCGA-28-5208-01	TCGA-28-5208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:42058284C>T	uc010ucy.1	+	24	8185	c.8004C>T	c.(8002-8004)GGC>GGT	p.G2668G	MGA_uc010ucz.1_Silent_p.G2459G	NM_001164273	NP_001157745	Q8IWI9	MGAP_HUMAN	MAX-interacting protein isoform 1	2629						MLL1 complex	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(6)|kidney(3)|upper_aerodigestive_tract(1)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	12		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)		ATATGGGTGGCAGCAAATATC	0.393													62	104	---	---	---	---	capture	Silent	SNP	42058284	42058284	MGA	15	C	T	T	T	1	0	0	0	0	0	0	0	1	314	25	2	2	9452	217
EIF3J	8669	broad.mit.edu	37	15	44849840	44849840	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5208-01	TCGA-28-5208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:44849840G>A	uc001ztv.2	+	6	690	c.563G>A	c.(562-564)TGT>TAT	p.C188Y	EIF3J_uc010ueg.1_Intron|EIF3J_uc001ztw.2_Missense_Mutation_p.C139Y	NM_003758	NP_003749	O75822	EIF3J_HUMAN	eukaryotic translation initiation factor 3,	188						cytosol|eukaryotic translation initiation factor 3 complex	protein binding|translation initiation factor activity				0		all_cancers(109;2.81e-14)|all_epithelial(112;2.8e-12)|Lung NSC(122;1.66e-07)|all_lung(180;1.47e-06)|Melanoma(134;0.0122)		all cancers(107;3.13e-20)|GBM - Glioblastoma multiforme(94;9.81e-07)|COAD - Colon adenocarcinoma(120;0.0754)|Colorectal(105;0.0758)		CGAGATGTGTGTATTTCATGT	0.313													82	119	---	---	---	---	capture	Missense_Mutation	SNP	44849840	44849840	EIF3J	15	G	A	A	A	1	0	0	0	0	1	0	0	0	624	48	2	2	4975	217
MORF4L1	10933	broad.mit.edu	37	15	79183885	79183885	+	Missense_Mutation	SNP	A	G	G			TCGA-28-5208-01	TCGA-28-5208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:79183885A>G	uc002bel.2	+	8	714	c.526A>G	c.(526-528)AGG>GGG	p.R176G	MORF4L1_uc010bli.1_3'UTR|MORF4L1_uc010blj.1_Missense_Mutation_p.R110G|MORF4L1_uc002bem.2_Missense_Mutation_p.R137G|MORF4L1_uc010une.1_Missense_Mutation_p.R49G	NM_206839	NP_996670	Q9UBU8	MO4L1_HUMAN	MORF-related gene 15 isoform 2	176	Sufficient for interaction with SIN3A.|Interaction with RB1-1.				double-strand break repair via homologous recombination|histone deacetylation|histone H2A acetylation|histone H4 acetylation|regulation of growth|regulation of transcription, DNA-dependent|transcription, DNA-dependent	NuA4 histone acetyltransferase complex|Sin3 complex	protein N-terminus binding				0						TCGGAAGAAAAGGGCCCGGGT	0.448													3	194	---	---	---	---	capture	Missense_Mutation	SNP	79183885	79183885	MORF4L1	15	A	G	G	G	1	0	0	0	0	1	0	0	0	36	3	3	3	9618	217
GRIN2A	2903	broad.mit.edu	37	16	9943716	9943716	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5208-01	TCGA-28-5208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:9943716C>T	uc002czo.3	-	5	1773	c.1225G>A	c.(1225-1227)GTC>ATC	p.V409I	GRIN2A_uc010uym.1_Missense_Mutation_p.V409I|GRIN2A_uc010uyn.1_Missense_Mutation_p.V252I|GRIN2A_uc002czr.3_Missense_Mutation_p.V409I	NM_001134407	NP_001127879	Q12879	NMDE1_HUMAN	N-methyl-D-aspartate receptor subunit 2A isoform	409	Extracellular (Potential).				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding			skin(32)|NS(5)|ovary(4)|large_intestine(1)|lung(1)|breast(1)|kidney(1)	45					Felbamate(DB00949)|Glycine(DB00145)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)	TCCAGGGTGACGATGCTGAGA	0.582													88	145	---	---	---	---	capture	Missense_Mutation	SNP	9943716	9943716	GRIN2A	16	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	6712	217
CPNE7	27132	broad.mit.edu	37	16	89649923	89649923	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5208-01	TCGA-28-5208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:89649923C>T	uc002fnp.2	+	4	699	c.569C>T	c.(568-570)ACG>ATG	p.T190M	CPNE7_uc002fnq.2_Intron	NM_014427	NP_055242	Q9UBL6	CPNE7_HUMAN	copine 7 isoform b	190					lipid metabolic process		transporter activity				0		all_hematologic(23;0.0748)		all cancers(4;3.63e-08)|OV - Ovarian serous cystadenocarcinoma(4;1.7e-06)|BRCA - Breast invasive adenocarcinoma(80;0.0147)		GGTGGCCACACGCAGGGATGG	0.522													8	4	---	---	---	---	capture	Missense_Mutation	SNP	89649923	89649923	CPNE7	16	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	3782	217
NF1	4763	broad.mit.edu	37	17	29533378	29533378	+	Nonsense_Mutation	SNP	C	T	T			TCGA-28-5208-01	TCGA-28-5208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:29533378C>T	uc002hgg.2	+	12	1714	c.1381C>T	c.(1381-1383)CGA>TGA	p.R461*	NF1_uc002hge.1_Nonsense_Mutation_p.R461*|NF1_uc002hgf.1_Nonsense_Mutation_p.R461*|NF1_uc002hgh.2_Nonsense_Mutation_p.R461*|NF1_uc010csn.1_Nonsense_Mutation_p.R321*	NM_001042492	NP_001035957	P21359	NF1_HUMAN	neurofibromin isoform 1	461					actin cytoskeleton organization|adrenal gland development|artery morphogenesis|camera-type eye morphogenesis|cerebral cortex development|collagen fibril organization|forebrain astrocyte development|forebrain morphogenesis|heart development|liver development|MAPKKK cascade|metanephros development|myelination in peripheral nervous system|negative regulation of cell migration|negative regulation of endothelial cell proliferation|negative regulation of MAP kinase activity|negative regulation of MAPKKK cascade|negative regulation of neuroblast proliferation|negative regulation of oligodendrocyte differentiation|negative regulation of transcription factor import into nucleus|osteoblast differentiation|phosphatidylinositol 3-kinase cascade|pigmentation|positive regulation of adenylate cyclase activity|positive regulation of neuron apoptosis|Ras protein signal transduction|regulation of blood vessel endothelial cell migration|regulation of bone resorption|response to hypoxia|smooth muscle tissue development|spinal cord development|sympathetic nervous system development|visual learning|wound healing	axon|cytoplasm|dendrite|intrinsic to internal side of plasma membrane|nucleus	protein binding|Ras GTPase activator activity	p.R461*(2)|p.?(2)		soft_tissue(159)|central_nervous_system(56)|lung(28)|large_intestine(27)|haematopoietic_and_lymphoid_tissue(18)|ovary(18)|autonomic_ganglia(12)|breast(3)|skin(3)|stomach(2)|thyroid(1)|prostate(1)|kidney(1)|pancreas(1)	330		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		CCCAGCAATACGAATGGCACC	0.383			D|Mis|N|F|S|O		neurofibroma|glioma	neurofibroma|glioma			Neurofibromatosis_type_1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)			100	154	---	---	---	---	capture	Nonsense_Mutation	SNP	29533378	29533378	NF1	17	C	T	T	T	1	0	0	0	0	0	1	0	0	243	19	5	1	10263	217
NF1	4763	broad.mit.edu	37	17	29552132	29552132	+	Missense_Mutation	SNP	G	T	T			TCGA-28-5208-01	TCGA-28-5208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:29552132G>T	uc002hgg.2	+	17	2198	c.1865G>T	c.(1864-1866)TGT>TTT	p.C622F	NF1_uc002hgh.2_Missense_Mutation_p.C622F|NF1_uc010csn.1_Missense_Mutation_p.C482F|NF1_uc002hgi.1_5'UTR	NM_001042492	NP_001035957	P21359	NF1_HUMAN	neurofibromin isoform 1	622					actin cytoskeleton organization|adrenal gland development|artery morphogenesis|camera-type eye morphogenesis|cerebral cortex development|collagen fibril organization|forebrain astrocyte development|forebrain morphogenesis|heart development|liver development|MAPKKK cascade|metanephros development|myelination in peripheral nervous system|negative regulation of cell migration|negative regulation of endothelial cell proliferation|negative regulation of MAP kinase activity|negative regulation of MAPKKK cascade|negative regulation of neuroblast proliferation|negative regulation of oligodendrocyte differentiation|negative regulation of transcription factor import into nucleus|osteoblast differentiation|phosphatidylinositol 3-kinase cascade|pigmentation|positive regulation of adenylate cyclase activity|positive regulation of neuron apoptosis|Ras protein signal transduction|regulation of blood vessel endothelial cell migration|regulation of bone resorption|response to hypoxia|smooth muscle tissue development|spinal cord development|sympathetic nervous system development|visual learning|wound healing	axon|cytoplasm|dendrite|intrinsic to internal side of plasma membrane|nucleus	protein binding|Ras GTPase activator activity	p.?(2)		soft_tissue(159)|central_nervous_system(56)|lung(28)|large_intestine(27)|haematopoietic_and_lymphoid_tissue(18)|ovary(18)|autonomic_ganglia(12)|breast(3)|skin(3)|stomach(2)|thyroid(1)|prostate(1)|kidney(1)|pancreas(1)	330		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		AGAAGTTCCTGTCACTTTCTC	0.373			D|Mis|N|F|S|O		neurofibroma|glioma	neurofibroma|glioma			Neurofibromatosis_type_1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)			144	211	---	---	---	---	capture	Missense_Mutation	SNP	29552132	29552132	NF1	17	G	T	T	T	1	0	0	0	0	1	0	0	0	624	48	4	4	10263	217
TMEM132E	124842	broad.mit.edu	37	17	32956104	32956104	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5208-01	TCGA-28-5208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:32956104C>T	uc002hif.2	+	5	1277	c.949C>T	c.(949-951)CGG>TGG	p.R317W		NM_207313	NP_997196	Q6IEE7	T132E_HUMAN	transmembrane protein 132E precursor	317	Extracellular (Potential).					integral to membrane				central_nervous_system(1)	1				BRCA - Breast invasive adenocarcinoma(366;0.231)		GTCAGTCAAGCGGAGGATCAT	0.612													56	77	---	---	---	---	capture	Missense_Mutation	SNP	32956104	32956104	TMEM132E	17	C	T	T	T	1	0	0	0	0	1	0	0	0	347	27	1	1	15932	217
C17orf46	124783	broad.mit.edu	37	17	43333267	43333267	+	Silent	SNP	G	A	A			TCGA-28-5208-01	TCGA-28-5208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:43333267G>A	uc002iis.1	-	4	378	c.282C>T	c.(280-282)AAC>AAT	p.N94N	LOC100133991_uc010dah.2_Intron|C17orf46_uc010wjk.1_Silent_p.N73N	NM_152343	NP_689556	Q96LK8	CQ046_HUMAN	hypothetical protein LOC124783	94										large_intestine(1)|ovary(1)	2						CAGACTCCTCGTTCGAGTTGG	0.542													130	182	---	---	---	---	capture	Silent	SNP	43333267	43333267	C17orf46	17	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	1842	217
LRRC37A3	374819	broad.mit.edu	37	17	62893283	62893283	+	Missense_Mutation	SNP	C	G	G			TCGA-28-5208-01	TCGA-28-5208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:62893283C>G	uc002jey.2	-	3	624	c.93G>C	c.(91-93)TGG>TGC	p.W31C	LRRC37A3_uc010wqg.1_Intron|LRRC37A3_uc010wqf.1_Intron	NM_199340	NP_955372	O60309	L37A3_HUMAN	leucine rich repeat containing 37, member A3	31						integral to membrane					0						TGACTAGTAGCCACAATAGTT	0.622													39	172	---	---	---	---	capture	Missense_Mutation	SNP	62893283	62893283	LRRC37A3	17	C	G	G	G	1	0	0	0	0	1	0	0	0	338	26	4	4	8908	217
ZNF532	55205	broad.mit.edu	37	18	56587257	56587257	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5208-01	TCGA-28-5208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:56587257G>A	uc002lho.2	+	4	2285	c.1738G>A	c.(1738-1740)GTG>ATG	p.V580M	ZNF532_uc002lhp.2_Missense_Mutation_p.V578M|ZNF532_uc010xeg.1_Missense_Mutation_p.V578M|ZNF532_uc002lhr.2_Missense_Mutation_p.V578M|ZNF532_uc002lhs.2_Missense_Mutation_p.V578M	NM_018181	NP_060651	Q9HCE3	ZN532_HUMAN	zinc finger protein 532	580					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(1)|skin(1)	2						GCAGAGTTCTGTGGTGGAAGC	0.522													29	39	---	---	---	---	capture	Missense_Mutation	SNP	56587257	56587257	ZNF532	18	G	A	A	A	1	0	0	0	0	1	0	0	0	624	48	2	2	17851	217
ZNF236	7776	broad.mit.edu	37	18	74680222	74680222	+	Missense_Mutation	SNP	G	T	T			TCGA-28-5208-01	TCGA-28-5208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:74680222G>T	uc002lmi.2	+	31	5663	c.5465G>T	c.(5464-5466)AGC>ATC	p.S1822I	ZNF236_uc002lmj.2_RNA	NM_007345	NP_031371	Q9UL36	ZN236_HUMAN	zinc finger protein 236	1822					cellular response to glucose stimulus	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(4)	4		Prostate(75;0.0405)|Esophageal squamous(42;0.129)|Melanoma(33;0.132)		OV - Ovarian serous cystadenocarcinoma(15;4.36e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0686)		GAGGAGCTGAGCCGGACCCTC	0.602													93	135	---	---	---	---	capture	Missense_Mutation	SNP	74680222	74680222	ZNF236	18	G	T	T	T	1	0	0	0	0	1	0	0	0	442	34	4	4	17669	217
ACTL9	284382	broad.mit.edu	37	19	8808430	8808430	+	Missense_Mutation	SNP	C	T	T	rs139329295		TCGA-28-5208-01	TCGA-28-5208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:8808430C>T	uc002mkl.2	-	1	743	c.622G>A	c.(622-624)GTC>ATC	p.V208I		NM_178525	NP_848620	Q8TC94	ACTL9_HUMAN	actin-like 9	208						cytoplasm|cytoskeleton				large_intestine(2)|pancreas(1)	3						CCCTGGAAGACGGGCACTGTG	0.667													59	100	---	---	---	---	capture	Missense_Mutation	SNP	8808430	8808430	ACTL9	19	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	203	217
PVR	5817	broad.mit.edu	37	19	45153152	45153152	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5208-01	TCGA-28-5208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:45153152G>A	uc002ozm.2	+	3	798	c.499G>A	c.(499-501)GTC>ATC	p.V167I	PVR_uc010ejs.2_Missense_Mutation_p.V167I|PVR_uc010xxb.1_Missense_Mutation_p.V167I|PVR_uc010xxc.1_Missense_Mutation_p.V167I|PVR_uc002ozn.2_Missense_Mutation_p.V112I	NM_006505	NP_006496	P15151	PVR_HUMAN	poliovirus receptor isoform alpha	167	Extracellular (Potential).|Ig-like C2-type 1.				adherens junction organization|cell adhesion|cell junction assembly|interspecies interaction between organisms|positive regulation of natural killer cell mediated cytotoxicity directed against tumor cell target|susceptibility to natural killer cell mediated cytotoxicity|susceptibility to T cell mediated cytotoxicity	cell junction|cell surface|cytoplasm|extracellular space|integral to membrane|nucleus	cell adhesion molecule binding|receptor activity				0	Lung NSC(12;0.00608)|all_lung(12;0.0148)	Medulloblastoma(540;0.0425)|Ovarian(192;0.0728)|Prostate(69;0.081)|all_neural(266;0.112)		Epithelial(262;0.000601)		GGCCCGCTGCGTCTCCACAGG	0.617													19	325	---	---	---	---	capture	Missense_Mutation	SNP	45153152	45153152	PVR	19	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	12732	217
NTF4	4909	broad.mit.edu	37	19	49564639	49564639	+	Missense_Mutation	SNP	G	A	A	rs121918427		TCGA-28-5208-01	TCGA-28-5208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:49564639G>A	uc002pmf.3	-	2	757	c.616C>T	c.(616-618)CGG>TGG	p.R206W	CGB7_uc010yah.1_Intron	NM_006179	NP_006170	P34130	NTF4_HUMAN	neurotrophin 5 preproprotein	206			R -> Q (in a patient with primary open- angle glaucoma; uncertain pathological significance).|R -> W (in patients with primary open- angle glaucoma and normal pressure glaucoma; uncertain pathological significance; impaired ligand-mediated TRKB signaling and reduced neurite outgrowth).		adult locomotory behavior|epidermis development|ganglion mother cell fate determination|long-term memory|sensory organ boundary specification	endoplasmic reticulum lumen|extracellular region	growth factor activity				0		all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_epithelial(76;3.83e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		all cancers(93;0.000371)|OV - Ovarian serous cystadenocarcinoma(262;0.000503)|GBM - Glioblastoma multiforme(486;0.00518)|Epithelial(262;0.0427)		CGGCCAGTCCGGCTGAGGAGT	0.602													31	93	---	---	---	---	capture	Missense_Mutation	SNP	49564639	49564639	NTF4	19	G	A	A	A	1	0	0	0	0	1	0	0	0	506	39	1	1	10604	217
ZNF813	126017	broad.mit.edu	37	19	53994271	53994271	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5208-01	TCGA-28-5208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:53994271G>A	uc002qbu.2	+	4	913	c.785G>A	c.(784-786)CGT>CAT	p.R262H	ZNF813_uc010eqq.1_Intron	NM_001004301	NP_001004301	Q6ZN06	ZN813_HUMAN	zinc finger protein 813	262	C2H2-type 2.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			large_intestine(1)	1				GBM - Glioblastoma multiforme(134;0.00619)		GTGTGCCATCGTAGATGTCAC	0.413													65	209	---	---	---	---	capture	Missense_Mutation	SNP	53994271	53994271	ZNF813	19	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	18051	217
SNTG2	54221	broad.mit.edu	37	2	1168837	1168837	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5208-01	TCGA-28-5208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:1168837G>A	uc002qwq.2	+	8	687	c.559G>A	c.(559-561)GGT>AGT	p.G187S	SNTG2_uc010ewi.2_Intron	NM_018968	NP_061841	Q9NY99	SNTG2_HUMAN	syntrophin, gamma 2	187					central nervous system development	cytoplasm|cytoskeleton|sarcolemma|syntrophin complex	actin binding|PDZ domain binding			ovary(1)|large_intestine(1)|breast(1)	3	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.00469)		all cancers(51;0.0178)|OV - Ovarian serous cystadenocarcinoma(76;0.07)|Epithelial(75;0.0864)|GBM - Glioblastoma multiforme(21;0.173)		CTTTGACAGCGGTTTGCATCT	0.468													152	233	---	---	---	---	capture	Missense_Mutation	SNP	1168837	1168837	SNTG2	2	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	14767	217
ABCG5	64240	broad.mit.edu	37	2	44051252	44051252	+	Missense_Mutation	SNP	A	G	G			TCGA-28-5208-01	TCGA-28-5208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:44051252A>G	uc002rtn.2	-	9	1264	c.1124T>C	c.(1123-1125)GTG>GCG	p.V375A	ABCG5_uc002rtm.2_5'UTR|ABCG5_uc002rto.2_Missense_Mutation_p.V204A|ABCG5_uc002rtp.2_5'UTR	NM_022436	NP_071881	Q9H222	ABCG5_HUMAN	ATP-binding cassette sub-family G member 5	375	Cytoplasmic (Potential).				cholesterol efflux|cholesterol homeostasis|excretion|lipid metabolic process|negative regulation of intestinal cholesterol absorption|negative regulation of intestinal phytosterol absorption	apical plasma membrane|integral to membrane	ATP binding|ATPase activity|protein heterodimerization activity			ovary(1)|skin(1)	2		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)				GTTTCTTGTCACTCTCCTGAA	0.433													62	69	---	---	---	---	capture	Missense_Mutation	SNP	44051252	44051252	ABCG5	2	A	G	G	G	1	0	0	0	0	1	0	0	0	78	6	3	3	71	217
KLRAQ1	129285	broad.mit.edu	37	2	48692078	48692078	+	Missense_Mutation	SNP	T	G	G			TCGA-28-5208-01	TCGA-28-5208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:48692078T>G	uc002rwm.2	+	8	882	c.697T>G	c.(697-699)TAT>GAT	p.Y233D	KLRAQ1_uc002rwi.1_Missense_Mutation_p.Y233D|KLRAQ1_uc002rwj.2_Missense_Mutation_p.Y233D|KLRAQ1_uc002rwl.2_Missense_Mutation_p.Y187D|KLRAQ1_uc002rwk.2_Missense_Mutation_p.Y233D|KLRAQ1_uc010yok.1_Missense_Mutation_p.Y233D	NM_001135629	NP_001129101	Q6ZMI0	KLRAQ_HUMAN	KLRAQ motif containing 1 isoform 1	233										ovary(1)	1						TTCTGTAGAATATAGTCAGTA	0.318													50	82	---	---	---	---	capture	Missense_Mutation	SNP	48692078	48692078	KLRAQ1	2	T	G	G	G	1	0	0	0	0	1	0	0	0	637	49	4	4	8333	217
APLF	200558	broad.mit.edu	37	2	68729870	68729870	+	Missense_Mutation	SNP	C	G	G			TCGA-28-5208-01	TCGA-28-5208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:68729870C>G	uc002sep.2	+	3	349	c.176C>G	c.(175-177)ACA>AGA	p.T59R	APLF_uc010fdf.2_Missense_Mutation_p.T35R	NM_173545	NP_775816	Q8IW19	APLF_HUMAN	aprataxin and PNKP like factor	59	FHA-like.				double-strand break repair|single strand break repair	cytosol|nucleus	3'-5' exonuclease activity|DNA-(apurinic or apyrimidinic site) lyase activity|endodeoxyribonuclease activity|metal ion binding|nucleotide binding|protein binding			ovary(2)	2						TAGATACACACAAATCCATGT	0.254													90	106	---	---	---	---	capture	Missense_Mutation	SNP	68729870	68729870	APLF	2	C	G	G	G	1	0	0	0	0	1	0	0	0	221	17	4	4	769	217
ALPPL2	251	broad.mit.edu	37	2	233274393	233274393	+	Silent	SNP	C	T	T			TCGA-28-5208-01	TCGA-28-5208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:233274393C>T	uc002vss.3	+	11	1463	c.1410C>T	c.(1408-1410)GGC>GGT	p.G470G		NM_031313	NP_112603	P10696	PPBN_HUMAN	placental-like alkaline phosphatase	470					phosphorylation	anchored to membrane|plasma membrane	alkaline phosphatase activity|metal ion binding			skin(1)	1		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;4.45e-22)|Kidney(3;4.42e-11)|KIRC - Kidney renal clear cell carcinoma(3;1.9e-09)|BRCA - Breast invasive adenocarcinoma(100;0.000767)|Lung(119;0.00566)|LUSC - Lung squamous cell carcinoma(224;0.00746)|STAD - Stomach adenocarcinoma(3;0.0181)|GBM - Glioblastoma multiforme(43;0.196)	Amifostine(DB01143)|Levamisole(DB00848)	TGGTTCACGGCGTGCAGGAGC	0.716													20	21	---	---	---	---	capture	Silent	SNP	233274393	233274393	ALPPL2	2	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	549	217
ZNF335	63925	broad.mit.edu	37	20	44587938	44587938	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5208-01	TCGA-28-5208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:44587938G>A	uc002xqw.2	-	15	2278	c.2155C>T	c.(2155-2157)CGC>TGC	p.R719C	ZNF335_uc010zxk.1_Missense_Mutation_p.R564C	NM_022095	NP_071378	Q9H4Z2	ZN335_HUMAN	zinc finger protein 335	719					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(3)|ovary(1)	4		Myeloproliferative disorder(115;0.0122)				GGGCGACGGCGGGAGGGGGGC	0.657													54	87	---	---	---	---	capture	Missense_Mutation	SNP	44587938	44587938	ZNF335	20	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	17732	217
UCKL1	54963	broad.mit.edu	37	20	62571758	62571758	+	Silent	SNP	C	T	T			TCGA-28-5208-01	TCGA-28-5208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:62571758C>T	uc010gkn.2	-	13	1426	c.1383G>A	c.(1381-1383)GCG>GCA	p.A461A	UCKL1_uc002yhj.2_Silent_p.A104A|UCKL1_uc011abm.1_Silent_p.A446A|UCKL1_uc011abn.1_RNA	NM_017859	NP_060329	Q9NWZ5	UCKL1_HUMAN	uridine-cytidine kinase 1-like 1	461					interspecies interaction between organisms	endoplasmic reticulum|nucleus	ATP binding|phosphotransferase activity, alcohol group as acceptor|protein binding|uridine kinase activity				0	all_cancers(38;2.14e-11)|all_epithelial(29;3.41e-13)|Lung NSC(23;3.41e-09)|all_lung(23;1.06e-08)					CCATCATGGCCGCCGCGCCCG	0.642													9	33	---	---	---	---	capture	Silent	SNP	62571758	62571758	UCKL1	20	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	16807	217
TPTE	7179	broad.mit.edu	37	21	10942995	10942995	+	Nonsense_Mutation	SNP	G	A	A	rs147014138	byFrequency;by1000genomes	TCGA-28-5208-01	TCGA-28-5208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:10942995G>A	uc002yip.1	-	12	960	c.592C>T	c.(592-594)CGA>TGA	p.R198*	TPTE_uc002yis.1_RNA|TPTE_uc002yiq.1_Nonsense_Mutation_p.R180*|TPTE_uc002yir.1_Nonsense_Mutation_p.R160*|TPTE_uc010gkv.1_Nonsense_Mutation_p.R60*	NM_199261	NP_954870	P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology	198					signal transduction	integral to membrane	ion channel activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(2)|lung(1)|breast(1)|skin(1)	5			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		ATAATAAGTCGTAGAAGTCGA	0.299													31	95	---	---	---	---	capture	Nonsense_Mutation	SNP	10942995	10942995	TPTE	21	G	A	A	A	1	0	0	0	0	0	1	0	0	519	40	5	1	16313	217
KLHL22	84861	broad.mit.edu	37	22	20819524	20819524	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5208-01	TCGA-28-5208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:20819524G>A	uc002zsl.1	-	4	842	c.733C>T	c.(733-735)CGG>TGG	p.R245W	KLHL22_uc011ahr.1_Missense_Mutation_p.R102W|KLHL22_uc002zsm.1_Missense_Mutation_p.R245W	NM_032775	NP_116164	Q53GT1	KLH22_HUMAN	kelch-like	245					cell division	Cul3-RING ubiquitin ligase complex				lung(1)	1	Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0221)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)			AGCGGAAACCGCACTGTCTCA	0.607													3	35	---	---	---	---	capture	Missense_Mutation	SNP	20819524	20819524	KLHL22	22	G	A	A	A	1	0	0	0	0	1	0	0	0	493	38	1	1	8297	217
RFPL2	10739	broad.mit.edu	37	22	32586994	32586994	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5208-01	TCGA-28-5208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:32586994C>T	uc003amg.3	-	5	1838	c.902G>A	c.(901-903)CGC>CAC	p.R301H	RFPL2_uc003ame.3_Missense_Mutation_p.R240H|RFPL2_uc003amf.3_Missense_Mutation_p.R211H|RFPL2_uc003amh.3_Missense_Mutation_p.R211H	NM_001098527	NP_001091997	O75678	RFPL2_HUMAN	ret finger protein-like 2 isoform 2	301	B30.2/SPRY.						zinc ion binding			skin(1)	1						CTGTAACTTGCGGTCTACGAA	0.512													3	41	---	---	---	---	capture	Missense_Mutation	SNP	32586994	32586994	RFPL2	22	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	13149	217
SETD2	29072	broad.mit.edu	37	3	47098909	47098909	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5208-01	TCGA-28-5208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:47098909C>T	uc003cqs.2	-	15	6418	c.6365G>A	c.(6364-6366)CGG>CAG	p.R2122Q	SETD2_uc003cqv.2_Missense_Mutation_p.R2189Q|SETD2_uc003cqt.1_RNA	NM_014159	NP_054878	Q9BYW2	SETD2_HUMAN	SET domain containing 2	2122	Potential.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleus	DNA binding|histone-lysine N-methyltransferase activity|oxidoreductase activity|transition metal ion binding			kidney(24)|ovary(5)|skin(1)|central_nervous_system(1)|breast(1)	32		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		AAACAACTTCCGGCGTTCCTC	0.423			N|F|S|Mis		clear cell renal carcinoma								79	115	---	---	---	---	capture	Missense_Mutation	SNP	47098909	47098909	SETD2	3	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	14024	217
ABHD14A	25864	broad.mit.edu	37	3	52014464	52014464	+	Silent	SNP	G	A	A			TCGA-28-5208-01	TCGA-28-5208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:52014464G>A	uc003dco.2	+	4	563	c.453G>A	c.(451-453)GCG>GCA	p.A151A	ABHD14B_uc003dcn.2_Intron|ACY1_uc011bea.1_Intron	NM_015407	NP_056222	Q9BUJ0	ABHEA_HUMAN	abhydrolase domain containing 14A	151						cytoplasm|integral to membrane	hydrolase activity				0				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000541)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		GGCGGGCAGCGCTGCTGGAGC	0.652													24	28	---	---	---	---	capture	Silent	SNP	52014464	52014464	ABHD14A	3	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	79	217
CACNA2D3	55799	broad.mit.edu	37	3	55107854	55107854	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5208-01	TCGA-28-5208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:55107854C>T	uc003dhf.2	+	37	3199	c.3151C>T	c.(3151-3153)CGC>TGC	p.R1051C		NM_018398	NP_060868	Q8IZS8	CA2D3_HUMAN	calcium channel, voltage-dependent, alpha	1051	Extracellular (Potential).					integral to membrane	calcium channel activity|metal ion binding|voltage-gated ion channel activity			large_intestine(3)|ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	7				KIRC - Kidney renal clear cell carcinoma(284;0.00287)|Kidney(284;0.00327)		GATCAGAAGGCGCCCAGAATC	0.448													24	42	---	---	---	---	capture	Missense_Mutation	SNP	55107854	55107854	CACNA2D3	3	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	2526	217
SENP7	57337	broad.mit.edu	37	3	101136587	101136587	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5208-01	TCGA-28-5208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:101136587C>T	uc003dut.2	-	5	443	c.332G>A	c.(331-333)CGA>CAA	p.R111Q	SENP7_uc003duu.2_Missense_Mutation_p.R111Q|SENP7_uc003duv.2_Missense_Mutation_p.R78Q|SENP7_uc003duw.2_Intron|SENP7_uc003dux.2_Intron	NM_020654	NP_065705	Q9BQF6	SENP7_HUMAN	sentrin/SUMO-specific protease 7 isoform 1	111					proteolysis	nucleus	cysteine-type peptidase activity			ovary(3)|lung(2)	5						TCTGAATTTTCGTCCTAAATC	0.378													80	99	---	---	---	---	capture	Missense_Mutation	SNP	101136587	101136587	SENP7	3	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	13944	217
ANKRD56	345079	broad.mit.edu	37	4	77817817	77817817	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5208-01	TCGA-28-5208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:77817817C>T	uc003hki.2	-	1	1186	c.1186G>A	c.(1186-1188)GAC>AAC	p.D396N		NM_001029870	NP_001025041	A6NEL2	ANR56_HUMAN	ankyrin repeat domain 56	396											0						TCCACAAAGTCATCCAGATCT	0.572													135	191	---	---	---	---	capture	Missense_Mutation	SNP	77817817	77817817	ANKRD56	4	C	T	T	T	1	0	0	0	0	1	0	0	0	377	29	2	2	677	217
MMRN1	22915	broad.mit.edu	37	4	90857233	90857233	+	Missense_Mutation	SNP	A	C	C			TCGA-28-5208-01	TCGA-28-5208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:90857233A>C	uc003hst.2	+	6	2473	c.2402A>C	c.(2401-2403)CAA>CCA	p.Q801P	MMRN1_uc010iku.2_Intron|MMRN1_uc011cds.1_Missense_Mutation_p.Q543P	NM_007351	NP_031377	Q13201	MMRN1_HUMAN	multimerin 1	801					cell adhesion|platelet activation|platelet degranulation	extracellular region|platelet alpha granule lumen				ovary(4)	4		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;6.96e-05)		TTTGTTTTGCAAGTCGCCAAG	0.378													69	102	---	---	---	---	capture	Missense_Mutation	SNP	90857233	90857233	MMRN1	4	A	C	C	C	1	0	0	0	0	1	0	0	0	65	5	4	4	9582	217
PCDHA1	56147	broad.mit.edu	37	5	140167729	140167729	+	Silent	SNP	G	A	A			TCGA-28-5208-01	TCGA-28-5208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140167729G>A	uc003lhb.2	+	1	1854	c.1854G>A	c.(1852-1854)GCG>GCA	p.A618A	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lgz.2_Silent_p.A618A	NM_018900	NP_061723	Q9Y5I3	PCDA1_HUMAN	protocadherin alpha 1 isoform 1 precursor	618	Cadherin 6.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	extracellular region|integral to plasma membrane	calcium ion binding|protein binding			skin(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CAGGCGGCGCGCGCATCCCGT	0.667													84	75	---	---	---	---	capture	Silent	SNP	140167729	140167729	PCDHA1	5	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	11422	217
PCDHB12	56124	broad.mit.edu	37	5	140590288	140590288	+	Silent	SNP	G	A	A			TCGA-28-5208-01	TCGA-28-5208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140590288G>A	uc003liz.2	+	1	1998	c.1809G>A	c.(1807-1809)TCG>TCA	p.S603S	PCDHB12_uc011dak.1_Silent_p.S266S	NM_018932	NP_061755	Q9Y5F1	PCDBC_HUMAN	protocadherin beta 12 precursor	603	Extracellular (Potential).|Cadherin 6.				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding			skin(2)|ovary(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CCTGGCTGTCGTACCAGCTGC	0.721													20	240	---	---	---	---	capture	Silent	SNP	140590288	140590288	PCDHB12	5	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	11440	217
PCDHGA4	56111	broad.mit.edu	37	5	140736435	140736435	+	Silent	SNP	C	T	T			TCGA-28-5208-01	TCGA-28-5208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140736435C>T	uc003ljq.1	+	1	1668	c.1668C>T	c.(1666-1668)AAC>AAT	p.N556N	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljp.1_Silent_p.N556N	NM_018917	NP_061740	Q9Y5G9	PCDG4_HUMAN	protocadherin gamma subfamily A, 4 isoform 1	556	Extracellular (Potential).|Cadherin 5.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGGACCAGAACGACAATGTCC	0.577													218	282	---	---	---	---	capture	Silent	SNP	140736435	140736435	PCDHGA4	5	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	11459	217
NOTCH4	4855	broad.mit.edu	37	6	32172007	32172007	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5208-01	TCGA-28-5208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:32172007C>T	uc003obb.2	-	19	3164	c.3025G>A	c.(3025-3027)GAG>AAG	p.E1009K	NOTCH4_uc003oba.2_5'Flank|NOTCH4_uc011dpu.1_RNA|NOTCH4_uc011dpv.1_RNA	NM_004557	NP_004548	Q99466	NOTC4_HUMAN	notch4 preproprotein	1009	Extracellular (Potential).|EGF-like 26.				cell fate determination|embryo development|hemopoiesis|mammary gland development|negative regulation of endothelial cell differentiation|Notch receptor processing|Notch signaling pathway|patterning of blood vessels|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cell surface|cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to plasma membrane|nucleoplasm	calcium ion binding|protein heterodimerization activity|receptor activity			lung(8)|ovary(5)|breast(4)|central_nervous_system(3)|upper_aerodigestive_tract(1)|skin(1)	22						TCCAGACACTCGTCCACGTCT	0.612													28	39	---	---	---	---	capture	Missense_Mutation	SNP	32172007	32172007	NOTCH4	6	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	10458	217
ANLN	54443	broad.mit.edu	37	7	36459856	36459856	+	Missense_Mutation	SNP	A	G	G			TCGA-28-5208-01	TCGA-28-5208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:36459856A>G	uc003tff.2	+	11	2152	c.1948A>G	c.(1948-1950)AGA>GGA	p.R650G	ANLN_uc011kaz.1_Missense_Mutation_p.R562G|ANLN_uc003tfg.2_Missense_Mutation_p.R613G|ANLN_uc010kxe.2_Missense_Mutation_p.R612G	NM_018685	NP_061155	Q9NQW6	ANLN_HUMAN	anillin, actin binding protein	650	Interaction with F-actin.				cytokinesis|mitosis|regulation of exit from mitosis|septin ring assembly	actomyosin contractile ring|nucleus	actin binding			ovary(2)|skin(1)	3						AAAATTCCAAAGAACTCGTGT	0.433													230	218	---	---	---	---	capture	Missense_Mutation	SNP	36459856	36459856	ANLN	7	A	G	G	G	1	0	0	0	0	1	0	0	0	36	3	3	3	688	217
CACNA2D1	781	broad.mit.edu	37	7	81799924	81799924	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5208-01	TCGA-28-5208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:81799924C>T	uc003uhr.1	-	4	552	c.296G>A	c.(295-297)CGC>CAC	p.R99H		NM_000722	NP_000713	P54289	CA2D1_HUMAN	calcium channel, voltage-dependent, alpha	99	Extracellular (Potential).			R -> S (in Ref. 1; AAA51903).		voltage-gated calcium channel complex	metal ion binding			ovary(5)|pancreas(1)	6					Felodipine(DB01023)|Gabapentin(DB00996)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nifedipine(DB01115)	CAATGCCAGGCGCTGAAAAAC	0.348													40	378	---	---	---	---	capture	Missense_Mutation	SNP	81799924	81799924	CACNA2D1	7	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	2524	217
PCLO	27445	broad.mit.edu	37	7	82784341	82784341	+	Missense_Mutation	SNP	G	T	T			TCGA-28-5208-01	TCGA-28-5208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:82784341G>T	uc003uhx.2	-	2	1905	c.1616C>A	c.(1615-1617)CCC>CAC	p.P539H	PCLO_uc003uhv.2_Missense_Mutation_p.P539H	NM_033026	NP_149015	Q9Y6V0	PCLO_HUMAN	piccolo isoform 1	485	Gln-rich.|Pro-rich.|10 X 10 AA tandem approximate repeats of P-A-K-P-Q-P-Q-Q-P-X.				cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity			ovary(7)	7						TTGAGCTGAGGGTTTTGCTGA	0.547													257	365	---	---	---	---	capture	Missense_Mutation	SNP	82784341	82784341	PCLO	7	G	T	T	T	1	0	0	0	0	1	0	0	0	559	43	4	4	11486	217
SAMD9L	219285	broad.mit.edu	37	7	92763758	92763758	+	Nonsense_Mutation	SNP	A	C	C			TCGA-28-5208-01	TCGA-28-5208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:92763758A>C	uc003umh.1	-	5	2743	c.1527T>G	c.(1525-1527)TAT>TAG	p.Y509*	SAMD9L_uc003umj.1_Nonsense_Mutation_p.Y509*|SAMD9L_uc003umi.1_Nonsense_Mutation_p.Y509*|SAMD9L_uc010lfb.1_Nonsense_Mutation_p.Y509*|SAMD9L_uc003umk.1_Nonsense_Mutation_p.Y509*|SAMD9L_uc010lfc.1_Nonsense_Mutation_p.Y509*|SAMD9L_uc010lfd.1_Nonsense_Mutation_p.Y509*|SAMD9L_uc011khx.1_Intron	NM_152703	NP_689916	Q8IVG5	SAM9L_HUMAN	sterile alpha motif domain containing 9-like	509										ovary(4)	4	all_cancers(62;4.15e-11)|all_epithelial(64;2.29e-10)|Breast(17;0.000675)|Lung NSC(181;0.0755)|all_lung(186;0.0989)		STAD - Stomach adenocarcinoma(171;0.000302)			CTAGAGGTTTATATGTCTCGC	0.378													126	189	---	---	---	---	capture	Nonsense_Mutation	SNP	92763758	92763758	SAMD9L	7	A	C	C	C	1	0	0	0	0	0	1	0	0	206	16	5	4	13719	217
TAS2R41	259287	broad.mit.edu	37	7	143175728	143175728	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5208-01	TCGA-28-5208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:143175728G>A	uc003wdc.1	+	1	763	c.763G>A	c.(763-765)GCA>ACA	p.A255T	uc003wda.2_Intron	NM_176883	NP_795364	P59536	T2R41_HUMAN	taste receptor, type 2, member 41	255	Helical; Name=6; (Potential).				sensory perception of taste	integral to membrane	G-protein coupled receptor activity			pancreas(1)|skin(1)	2	Melanoma(164;0.15)					CATTGATGCCGCAAAATTTAT	0.493													6	225	---	---	---	---	capture	Missense_Mutation	SNP	143175728	143175728	TAS2R41	7	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	15467	217
TPD52L3	89882	broad.mit.edu	37	9	6328761	6328761	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5208-01	TCGA-28-5208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:6328761C>T	uc003zjw.2	+	1	387	c.166C>T	c.(166-168)CGC>TGC	p.R56C	TPD52L3_uc003zjv.2_Missense_Mutation_p.R56C|TPD52L3_uc003zjx.1_Missense_Mutation_p.R56C	NM_033516	NP_277051	Q96J77	TPD55_HUMAN	protein kinase NYD-SP25 isoform 1	56	Potential.						protein binding				0		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.0198)|Lung(218;0.1)		CAAAGAGAGACGCTGTGGGGA	0.512													56	29	---	---	---	---	capture	Missense_Mutation	SNP	6328761	6328761	TPD52L3	9	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	16283	217
TMEM215	401498	broad.mit.edu	37	9	32784670	32784670	+	Silent	SNP	C	T	T			TCGA-28-5208-01	TCGA-28-5208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:32784670C>T	uc003zri.3	+	2	854	c.489C>T	c.(487-489)GAC>GAT	p.D163D		NM_212558	NP_997723	Q68D42	TM215_HUMAN	transmembrane protein 215	163						integral to membrane					0						GATACCTGGACGGCTACTGCC	0.602													42	9	---	---	---	---	capture	Silent	SNP	32784670	32784670	TMEM215	9	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	16021	217
TRPM6	140803	broad.mit.edu	37	9	77423011	77423011	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5208-01	TCGA-28-5208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:77423011C>T	uc004ajl.1	-	14	1815	c.1577G>A	c.(1576-1578)CGC>CAC	p.R526H	TRPM6_uc004ajk.1_Missense_Mutation_p.R521H|TRPM6_uc010mpb.1_RNA|TRPM6_uc010mpc.1_Missense_Mutation_p.R526H|TRPM6_uc010mpd.1_Intron|TRPM6_uc010mpe.1_Intron	NM_017662	NP_060132	Q9BX84	TRPM6_HUMAN	transient receptor potential cation channel,	526	Cytoplasmic (Potential).				response to toxin	integral to membrane	ATP binding|calcium channel activity|metal ion binding|protein binding|protein serine/threonine kinase activity			lung(3)|stomach(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|skin(1)	8						GTAGTTGCTGCGATATGCTCT	0.388													104	191	---	---	---	---	capture	Missense_Mutation	SNP	77423011	77423011	TRPM6	9	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	16473	217
FGD3	89846	broad.mit.edu	37	9	95792189	95792189	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5208-01	TCGA-28-5208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:95792189C>T	uc004asw.2	+	15	2219	c.1591C>T	c.(1591-1593)CGT>TGT	p.R531C	FGD3_uc004asx.2_Missense_Mutation_p.R531C|FGD3_uc004asz.2_Missense_Mutation_p.R531C|FGD3_uc011luc.1_Missense_Mutation_p.R134C	NM_001083536	NP_001077005	Q5JSP0	FGD3_HUMAN	FYVE, RhoGEF and PH domain containing 3	531					actin cytoskeleton organization|apoptosis|filopodium assembly|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Cdc42 GTPase activity|regulation of cell shape|small GTPase mediated signal transduction	cytoskeleton|cytosol|Golgi apparatus|lamellipodium|ruffle	metal ion binding|Rho guanyl-nucleotide exchange factor activity|small GTPase binding			ovary(1)|breast(1)	2						TAAGACCAGACGTGACAAGGA	0.537													56	62	---	---	---	---	capture	Missense_Mutation	SNP	95792189	95792189	FGD3	9	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	5780	217
TLR7	51284	broad.mit.edu	37	X	12906487	12906487	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5208-01	TCGA-28-5208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:12906487G>A	uc004cvc.2	+	3	2999	c.2860G>A	c.(2860-2862)GTG>ATG	p.V954M		NM_016562	NP_057646	Q9NYK1	TLR7_HUMAN	toll-like receptor 7 precursor	954	TIR.|Cytoplasmic (Potential).				cellular response to mechanical stimulus|defense response to virus|I-kappaB phosphorylation|inflammatory response|innate immune response|positive regulation of chemokine production|positive regulation of interferon-alpha biosynthetic process|positive regulation of interferon-beta biosynthetic process|positive regulation of interferon-gamma biosynthetic process|positive regulation of interleukin-8 biosynthetic process|positive regulation of interleukin-8 production|positive regulation of NF-kappaB import into nucleus	early phagosome|endoplasmic reticulum membrane|endosome membrane|integral to membrane|lysosome|plasma membrane	double-stranded RNA binding|single-stranded RNA binding|siRNA binding|transmembrane receptor activity			ovary(2)|lung(2)|breast(1)	5					Imiquimod(DB00724)	CAAAAAGACAGTGTTTGTGAT	0.388													228	37	---	---	---	---	capture	Missense_Mutation	SNP	12906487	12906487	TLR7	23	G	A	A	A	1	0	0	0	0	1	0	0	0	468	36	2	2	15841	217
CHRDL1	91851	broad.mit.edu	37	X	109922646	109922646	+	Silent	SNP	G	A	A			TCGA-28-5208-01	TCGA-28-5208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:109922646G>A	uc004eou.3	-	11	1513	c.1164C>T	c.(1162-1164)CTC>CTT	p.L388L	CHRDL1_uc004eov.2_Silent_p.L377L|CHRDL1_uc004eow.2_Silent_p.L386L|CHRDL1_uc010nps.2_Silent_p.L387L|CHRDL1_uc004eot.2_Silent_p.L307L|CHRDL1_uc011mss.1_Silent_p.L302L	NM_001143981	NP_001137453	Q9BU40	CRDL1_HUMAN	chordin-like 1 isoform 1 precursor	380					BMP signaling pathway|cell differentiation|nervous system development|ossification	extracellular region					0						GGAAGTGCTGGAGAATGCCTA	0.453													74	16	---	---	---	---	capture	Silent	SNP	109922646	109922646	CHRDL1	23	G	A	A	A	1	0	0	0	0	0	0	0	1	522	41	2	2	3338	217
AFF2	2334	broad.mit.edu	37	X	148039907	148039907	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5208-01	TCGA-28-5208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:148039907G>A	uc004fcp.2	+	12	3088	c.2609G>A	c.(2608-2610)CGC>CAC	p.R870H	AFF2_uc004fcq.2_Missense_Mutation_p.R860H|AFF2_uc004fcr.2_Missense_Mutation_p.R831H|AFF2_uc011mxb.1_Missense_Mutation_p.R835H|AFF2_uc004fcs.2_Missense_Mutation_p.R837H|AFF2_uc011mxc.1_Missense_Mutation_p.R511H	NM_002025	NP_002016	P51816	AFF2_HUMAN	fragile X mental retardation 2	870					brain development|mRNA processing|regulation of RNA splicing|RNA splicing	nuclear speck	G-quadruplex RNA binding|protein binding			ovary(3)|pancreas(2)	5	Acute lymphoblastic leukemia(192;6.56e-05)					AAGAAGCAGCGCCTGGAGGAG	0.512													287	48	---	---	---	---	capture	Missense_Mutation	SNP	148039907	148039907	AFF2	23	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	357	217
L1CAM	3897	broad.mit.edu	37	X	153130576	153130576	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5208-01	TCGA-28-5208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:153130576C>T	uc004fjb.2	-	21	2947	c.2839G>A	c.(2839-2841)GTG>ATG	p.V947M	L1CAM_uc004fjc.2_Missense_Mutation_p.V947M|L1CAM_uc010nuo.2_Missense_Mutation_p.V942M	NM_000425	NP_000416	P32004	L1CAM_HUMAN	L1 cell adhesion molecule isoform 1 precursor	947	Extracellular (Potential).|Fibronectin type-III 4.		Missing (in HSAS).		axon guidance|blood coagulation|cell death|leukocyte migration	integral to membrane		p.V947M(1)		ovary(8)|central_nervous_system(1)	9	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					CCGGTGAGCACGCCGTTGTGG	0.716													22	6	---	---	---	---	capture	Missense_Mutation	SNP	153130576	153130576	L1CAM	23	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	8508	217
AVPR2	554	broad.mit.edu	37	X	153171843	153171843	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5208-01	TCGA-28-5208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:153171843G>A	uc004fjh.3	+	2	954	c.883G>A	c.(883-885)GCG>ACG	p.A295T	AVPR2_uc004fjg.3_Missense_Mutation_p.A84T|AVPR2_uc004fji.2_Missense_Mutation_p.A295T	NM_000054	NP_000045	P30518	V2R_HUMAN	arginine vasopressin receptor 2 isoform 1	295	Extracellular (Potential).				activation of adenylate cyclase activity|excretion|G-protein signaling, coupled to cAMP nucleotide second messenger|hemostasis|positive regulation of gene expression|transmembrane transport|water transport	endoplasmic reticulum|endosome|Golgi apparatus|integral to plasma membrane	vasopressin receptor activity			breast(1)	1	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)				Conivaptan(DB00872)|Terlipressin(DB02638)|Vasopressin(DB00067)	GCTGTGGGCCGCGTGGGACCC	0.647													12	127	---	---	---	---	capture	Missense_Mutation	SNP	153171843	153171843	AVPR2	23	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	1223	217
MYO6	4646	broad.mit.edu	37	6	76599857	76599858	+	Frame_Shift_Ins	INS	-	A	A			TCGA-28-5208-01	TCGA-28-5208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:76599857_76599858insA	uc003pih.1	+	26	3021_3022	c.2742_2743insA	c.(2740-2745)CAGAAAfs	p.Q914fs	MYO6_uc003pig.1_Frame_Shift_Ins_p.Q914fs|MYO6_uc003pii.1_Frame_Shift_Ins_p.Q914fs	NM_004999	NP_004990	Q9UM54	MYO6_HUMAN	myosin VI	914_915	Potential.				actin filament-based movement|DNA damage response, signal transduction by p53 class mediator|endocytosis|intracellular protein transport|positive regulation of transcription from RNA polymerase II promoter|regulation of secretion|sensory perception of sound|synaptic transmission	cell cortex|clathrin coated vesicle membrane|coated pit|cytosol|DNA-directed RNA polymerase II, holoenzyme|filamentous actin|Golgi apparatus|nuclear membrane|perinuclear region of cytoplasm|ruffle membrane|unconventional myosin complex	actin filament binding|ADP binding|ATP binding|calmodulin binding|minus-end directed microfilament motor activity|protein binding			kidney(1)|pancreas(1)	2		all_hematologic(105;0.189)		BRCA - Breast invasive adenocarcinoma(397;0.223)		GTGCATTACAGAAAAAAAAACA	0.381													7	194	---	---	---	---	capture_indel	Frame_Shift_Ins	INS	76599857	76599858	MYO6	6	-	A	A	A	1	0	1	1	0	0	0	0	0	425	33	5	5	9991	217
QKI	9444	broad.mit.edu	37	6	163899821	163899821	+	Frame_Shift_Del	DEL	G	-	-			TCGA-28-5208-01	TCGA-28-5208-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:163899821delG	uc003qui.2	+	3	846	c.295delG	c.(295-297)GTTfs	p.V99fs	QKI_uc003que.2_Frame_Shift_Del_p.V99fs|QKI_uc003quf.2_Frame_Shift_Del_p.V99fs|QKI_uc003qug.2_Frame_Shift_Del_p.V99fs|QKI_uc003quh.2_Frame_Shift_Del_p.V99fs|QKI_uc003quj.2_Frame_Shift_Del_p.V99fs	NM_006775	NP_006766	Q96PU8	QKI_HUMAN	quaking homolog, KH domain RNA binding isoform	99	KH.				mRNA processing|mRNA transport|regulation of translation|RNA splicing	cytoplasm|nucleus|plasma membrane	RNA binding|SH3 domain binding			large_intestine(1)|ovary(1)	2		Breast(66;5e-05)|Prostate(117;0.0235)|all_neural(5;0.0416)|Ovarian(120;0.0448)|Glioma(2;0.203)		all cancers(1;4.4e-46)|OV - Ovarian serous cystadenocarcinoma(33;6.91e-23)|GBM - Glioblastoma multiforme(1;2.94e-19)|BRCA - Breast invasive adenocarcinoma(81;1.49e-06)|Kidney(3;0.000199)|KIRC - Kidney renal clear cell carcinoma(3;0.000234)		GTTTAATTTTGTTGGGAGAAT	0.358													68	136	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	163899821	163899821	QKI	6	G	-	-	-	1	0	1	0	1	0	0	0	0	624	48	5	5	12768	217
