Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
KIAA0562	9731	broad.mit.edu	37	1	3761888	3761888	+	Missense_Mutation	SNP	C	G	G			TCGA-28-5211-01	TCGA-28-5211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:3761888C>G	uc001aky.2	-	5	813	c.454G>C	c.(454-456)GGA>CGA	p.G152R	KIAA0562_uc010nzm.1_RNA|KIAA0562_uc001akz.2_Missense_Mutation_p.G152R	NM_014704	NP_055519	O60308	CE104_HUMAN	glycine-, glutamate-,	152						centriole	binding				0	all_cancers(77;0.0395)|Ovarian(185;0.0634)|all_lung(157;0.222)|Lung NSC(156;0.227)	all_epithelial(116;3.96e-21)|all_lung(118;2.74e-08)|Lung NSC(185;6.4e-06)|Breast(487;0.00066)|Renal(390;0.00121)|Hepatocellular(190;0.00335)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.031)|Lung SC(97;0.0548)|Medulloblastoma(700;0.212)		Epithelial(90;6.85e-39)|OV - Ovarian serous cystadenocarcinoma(86;1.59e-22)|GBM - Glioblastoma multiforme(42;3.16e-16)|Colorectal(212;2.01e-05)|COAD - Colon adenocarcinoma(227;7.99e-05)|BRCA - Breast invasive adenocarcinoma(365;0.000389)|Kidney(185;0.000513)|STAD - Stomach adenocarcinoma(132;0.00709)|KIRC - Kidney renal clear cell carcinoma(229;0.00714)|Lung(427;0.137)		GCAGGGTCTCCAATGATATTT	0.289													5	155	---	---	---	---	capture	Missense_Mutation	SNP	3761888	3761888	KIAA0562	1	C	G	G	G	1	0	0	0	0	1	0	0	0	273	21	4	4	8106	219
ABCA4	24	broad.mit.edu	37	1	94466600	94466600	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5211-01	TCGA-28-5211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:94466600C>T	uc001dqh.2	-	46	6448	c.6344G>A	c.(6343-6345)AGC>AAC	p.S2115N		NM_000350	NP_000341	P78363	ABCA4_HUMAN	ATP-binding cassette, sub-family A member 4	2115	ABC transporter 2.|Cytoplasmic.				phototransduction, visible light|visual perception	integral to plasma membrane|membrane fraction	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(4)|skin(4)|central_nervous_system(2)|upper_aerodigestive_tract(1)|breast(1)	12		all_lung(203;0.000757)|Lung NSC(277;0.00335)		all cancers(265;0.00432)|GBM - Glioblastoma multiforme(16;0.00715)|Epithelial(280;0.171)		TCTGATGATGCTCACGATGAC	0.632													10	39	---	---	---	---	capture	Missense_Mutation	SNP	94466600	94466600	ABCA4	1	C	T	T	T	1	0	0	0	0	1	0	0	0	364	28	2	2	34	219
PPM1J	333926	broad.mit.edu	37	1	113252867	113252867	+	Missense_Mutation	SNP	C	T	T	rs113935705	byFrequency	TCGA-28-5211-01	TCGA-28-5211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:113252867C>T	uc001ect.1	-	10	1463	c.1436G>A	c.(1435-1437)CGT>CAT	p.R479H	RHOC_uc001ecq.1_5'Flank|RHOC_uc001ecr.1_5'Flank|RHOC_uc009wgk.1_5'Flank|PPM1J_uc009wgl.1_Intron|PPM1J_uc001ecs.1_Missense_Mutation_p.R273H	NM_005167	NP_005158	Q5JR12	PPM1J_HUMAN	protein phosphatase 1J (PP2C domain containing)	479	PP2C-like.									breast(2)|central_nervous_system(1)	3	Lung SC(450;0.246)	all_cancers(81;1.44e-07)|all_epithelial(167;7.64e-07)|all_lung(203;2.16e-05)|Lung NSC(69;3.86e-05)		Lung(183;0.0234)|all cancers(265;0.0246)|Epithelial(280;0.0342)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		GTTGGGGAGACGCCAGCCACG	0.622													11	49	---	---	---	---	capture	Missense_Mutation	SNP	113252867	113252867	PPM1J	1	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	12243	219
TCHH	7062	broad.mit.edu	37	1	152082812	152082812	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5211-01	TCGA-28-5211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152082812G>A	uc001ezp.2	-	2	2881	c.2881C>T	c.(2881-2883)CGG>TGG	p.R961W	TCHH_uc009wne.1_Missense_Mutation_p.R961W	NM_007113	NP_009044	Q07283	TRHY_HUMAN	trichohyalin	961	4-2.|10 X 30 AA tandem repeats.				keratinization	cytoskeleton	calcium ion binding			ovary(3)|kidney(1)|central_nervous_system(1)	5	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			ttatccttcCGATATTGCCTT	0.289													42	219	---	---	---	---	capture	Missense_Mutation	SNP	152082812	152082812	TCHH	1	G	A	A	A	1	0	0	0	0	1	0	0	0	480	37	1	1	15585	219
FLG	2312	broad.mit.edu	37	1	152278705	152278705	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5211-01	TCGA-28-5211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152278705C>T	uc001ezu.1	-	3	8693	c.8657G>A	c.(8656-8658)CGC>CAC	p.R2886H		NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	2886	Ser-rich.|Filaggrin 17.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GGATCCCTGGCGCCTGCTTCT	0.562									Ichthyosis				35	283	---	---	---	---	capture	Missense_Mutation	SNP	152278705	152278705	FLG	1	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	5867	219
USH2A	7399	broad.mit.edu	37	1	216595382	216595382	+	Silent	SNP	G	A	A			TCGA-28-5211-01	TCGA-28-5211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:216595382G>A	uc001hku.1	-	2	684	c.297C>T	c.(295-297)GCC>GCT	p.A99A	USH2A_uc001hkv.2_Silent_p.A99A	NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	99	Extracellular (Potential).				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding	p.A99V(1)		ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		CTGAGAAAAGGGCAGTGTAGG	0.453										HNSCC(13;0.011)			4	52	---	---	---	---	capture	Silent	SNP	216595382	216595382	USH2A	1	G	A	A	A	1	0	0	0	0	0	0	0	1	548	43	2	2	16918	219
OR2G2	81470	broad.mit.edu	37	1	247752222	247752222	+	Silent	SNP	C	A	A			TCGA-28-5211-01	TCGA-28-5211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:247752222C>A	uc010pyy.1	+	1	561	c.561C>A	c.(559-561)CTC>CTA	p.L187L		NM_001001915	NP_001001915	Q8NGZ5	OR2G2_HUMAN	olfactory receptor, family 2, subfamily G,	187	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.017)			TCCCTGTGCTCATCAAGCTGG	0.537													19	77	---	---	---	---	capture	Silent	SNP	247752222	247752222	OR2G2	1	C	A	A	A	1	0	0	0	0	0	0	0	1	366	29	4	4	10902	219
BMI1	648	broad.mit.edu	37	10	22615480	22615480	+	Missense_Mutation	SNP	T	G	G			TCGA-28-5211-01	TCGA-28-5211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:22615480T>G	uc001irh.2	+	2	741	c.102T>G	c.(100-102)TGT>TGG	p.C34W	BMI1_uc009xkg.2_Missense_Mutation_p.C177W	NM_005180	NP_005171	P35226	BMI1_HUMAN	BMI1 polycomb ring finger oncogene	34	RING-type.				hemopoiesis|negative regulation of transcription from RNA polymerase II promoter|positive regulation of fibroblast proliferation|positive regulation of ubiquitin-protein ligase activity|segment specification|transcription, DNA-dependent	cytoplasm|nucleolus|PcG protein complex|ubiquitin ligase complex	RING-like zinc finger domain binding|zinc ion binding			ovary(1)|skin(1)	2						TAATAGAATGTCTACATTCCT	0.413													21	36	---	---	---	---	capture	Missense_Mutation	SNP	22615480	22615480	BMI1	10	T	G	G	G	1	0	0	0	0	1	0	0	0	751	58	4	4	1443	219
WDR11	55717	broad.mit.edu	37	10	122622305	122622305	+	Silent	SNP	A	G	G			TCGA-28-5211-01	TCGA-28-5211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:122622305A>G	uc010qtf.1	+	5	823	c.585A>G	c.(583-585)TCA>TCG	p.S195S	WDR11_uc010qte.1_Intron|WDR11_uc001lfd.1_5'UTR	NM_018117	NP_060587	Q9BZH6	WDR11_HUMAN	bromodomain and WD repeat domain containing 2	195						integral to membrane					0						AGCCTCCCTCAGGCCCTGGGA	0.443													4	176	---	---	---	---	capture	Silent	SNP	122622305	122622305	WDR11	10	A	G	G	G	1	0	0	0	0	0	0	0	1	80	7	3	3	17154	219
LRP1	4035	broad.mit.edu	37	12	57603612	57603612	+	Missense_Mutation	SNP	T	C	C			TCGA-28-5211-01	TCGA-28-5211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:57603612T>C	uc001snd.2	+	80	12866	c.12400T>C	c.(12400-12402)TCT>CCT	p.S4134P		NM_002332	NP_002323	Q07954	LRP1_HUMAN	low density lipoprotein-related protein 1	4134	Extracellular (Potential).				aorta morphogenesis|apoptotic cell clearance|negative regulation of platelet-derived growth factor receptor-beta signaling pathway|negative regulation of smooth muscle cell migration|negative regulation of Wnt receptor signaling pathway|positive regulation of cholesterol efflux|regulation of actin cytoskeleton organization|regulation of phospholipase A2 activity	coated pit|integral to plasma membrane|nucleus	apolipoprotein E binding|calcium ion binding|lipoprotein transporter activity|protein complex binding|receptor activity			ovary(8)|lung(3)|breast(3)|large_intestine(2)|central_nervous_system(2)|skin(2)|pancreas(2)	22				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Alteplase(DB00009)|Anistreplase(DB00029)|Antihemophilic Factor(DB00025)|Becaplermin(DB00102)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	GAGCCACGCCTCTGACGTGGT	0.572													5	26	---	---	---	---	capture	Missense_Mutation	SNP	57603612	57603612	LRP1	12	T	C	C	C	1	0	0	0	0	1	0	0	0	702	54	3	3	8867	219
LUM	4060	broad.mit.edu	37	12	91498030	91498030	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5211-01	TCGA-28-5211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:91498030C>T	uc001tbm.2	-	3	1318	c.929G>A	c.(928-930)CGT>CAT	p.R310H	LUM_uc001tbn.2_RNA	NM_002345	NP_002336	P51884	LUM_HUMAN	lumican precursor	310	LRR 11.				collagen fibril organization|visual perception	extracellular space|fibrillar collagen	collagen binding|extracellular matrix structural constituent			central_nervous_system(2)	2						GCCATCCAAACGCAAATGCTT	0.373													15	59	---	---	---	---	capture	Missense_Mutation	SNP	91498030	91498030	LUM	12	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	9000	219
SYNE2	23224	broad.mit.edu	37	14	64497733	64497733	+	Splice_Site	SNP	G	A	A			TCGA-28-5211-01	TCGA-28-5211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:64497733G>A	uc001xgm.2	+	45	7110	c.6880_splice	c.e45-1	p.E2294_splice	SYNE2_uc001xgl.2_Splice_Site_p.E2294_splice	NM_015180	NP_055995	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2						centrosome localization|cytoskeletal anchoring at nuclear membrane|nuclear migration along microfilament|positive regulation of cell migration	cytoskeleton|filopodium membrane|focal adhesion|integral to membrane|lamellipodium membrane|mitochondrial part|nuclear outer membrane|nucleoplasm|sarcoplasmic reticulum membrane|SUN-KASH complex|Z disc	actin binding|protein binding			ovary(8)|breast(4)|central_nervous_system(1)|pancreas(1)	14				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		TCCACTCGTAGGAACTAGAGA	0.353													15	46	---	---	---	---	capture	Splice_Site	SNP	64497733	64497733	SYNE2	14	G	A	A	A	1	0	0	0	0	0	0	1	0	455	35	5	2	15334	219
GJD2	57369	broad.mit.edu	37	15	35045227	35045227	+	Nonsense_Mutation	SNP	G	A	A			TCGA-28-5211-01	TCGA-28-5211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:35045227G>A	uc001zis.1	-	2	418	c.418C>T	c.(418-420)CGA>TGA	p.R140*	uc001zit.1_5'Flank	NM_020660	NP_065711	Q9UKL4	CXD2_HUMAN	gap junction protein, delta 2, 36kDa	140	Cytoplasmic (Potential).				synaptic transmission	connexon complex|integral to membrane	gap junction channel activity				0		all_lung(180;9.67e-07)		all cancers(64;2.75e-18)|GBM - Glioblastoma multiforme(113;1.9e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0156)		TTATCTTCTCGTTTGCCCCCA	0.532													40	127	---	---	---	---	capture	Nonsense_Mutation	SNP	35045227	35045227	GJD2	15	G	A	A	A	1	0	0	0	0	0	1	0	0	519	40	5	1	6354	219
ADAMTSL3	57188	broad.mit.edu	37	15	84651232	84651232	+	Missense_Mutation	SNP	G	A	A	rs147113160		TCGA-28-5211-01	TCGA-28-5211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:84651232G>A	uc002bjz.3	+	21	3076	c.2852G>A	c.(2851-2853)CGT>CAT	p.R951H	ADAMTSL3_uc010bmt.1_Missense_Mutation_p.R951H|ADAMTSL3_uc010bmu.1_Missense_Mutation_p.R951H	NM_207517	NP_997400	P82987	ATL3_HUMAN	ADAMTS-like 3 precursor	951	Ig-like C2-type 1.					proteinaceous extracellular matrix	metallopeptidase activity|zinc ion binding			ovary(6)|central_nervous_system(5)|lung(5)|large_intestine(4)|breast(3)|skin(2)|kidney(1)|pancreas(1)	27			BRCA - Breast invasive adenocarcinoma(143;0.211)			AAGGATGGCCGTTGCCTGCAG	0.532													16	56	---	---	---	---	capture	Missense_Mutation	SNP	84651232	84651232	ADAMTSL3	15	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	276	219
MCTP2	55784	broad.mit.edu	37	15	94943189	94943189	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5211-01	TCGA-28-5211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:94943189C>T	uc002btj.2	+	15	1995	c.1930C>T	c.(1930-1932)CGC>TGC	p.R644C	MCTP2_uc010boj.2_Missense_Mutation_p.R373C|MCTP2_uc010bok.2_Missense_Mutation_p.R644C|MCTP2_uc002btk.3_Missense_Mutation_p.R232C|MCTP2_uc002btl.2_Missense_Mutation_p.R232C	NM_018349	NP_060819	Q6DN12	MCTP2_HUMAN	multiple C2 domains, transmembrane 2 isoform 1	644					calcium-mediated signaling	integral to membrane|membrane fraction	calcium ion binding			ovary(1)|pancreas(1)|skin(1)	3	Lung NSC(78;0.0821)|all_lung(78;0.148)		BRCA - Breast invasive adenocarcinoma(143;0.0323)|OV - Ovarian serous cystadenocarcinoma(32;0.0593)			CCGGGAAAAGCGCTTTGTTGA	0.458													21	95	---	---	---	---	capture	Missense_Mutation	SNP	94943189	94943189	MCTP2	15	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	9314	219
ABCC6	368	broad.mit.edu	37	16	16272807	16272807	+	Missense_Mutation	SNP	C	T	T	rs72653787		TCGA-28-5211-01	TCGA-28-5211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:16272807C>T	uc002den.3	-	18	2300	c.2263G>A	c.(2263-2265)GGA>AGA	p.G755R	ABCC6_uc010bvo.2_RNA	NM_001171	NP_001162	O95255	MRP6_HUMAN	ATP-binding cassette, sub-family C, member 6	755	ABC transporter 1.|Cytoplasmic (By similarity).				response to drug|visual perception	integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			skin(2)|ovary(1)	3				UCEC - Uterine corpus endometrioid carcinoma (3;0.123)		TTCTGGCCTCCGGAGAGATTC	0.627													9	17	---	---	---	---	capture	Missense_Mutation	SNP	16272807	16272807	ABCC6	16	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	57	219
C16orf93	90835	broad.mit.edu	37	16	30770347	30770347	+	Missense_Mutation	SNP	G	C	C			TCGA-28-5211-01	TCGA-28-5211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:30770347G>C	uc002dzm.2	-	8	1134	c.803C>G	c.(802-804)CCA>CGA	p.P268R	C16orf93_uc002dzn.2_Missense_Mutation_p.P333R|C16orf93_uc002dzo.2_Missense_Mutation_p.P231R	NM_001014979	NP_001014979	A1A4V9	CP093_HUMAN	hypothetical protein LOC90835	268											0						CTCTGGCTCTGGTGGGGCCAC	0.522													4	192	---	---	---	---	capture	Missense_Mutation	SNP	30770347	30770347	C16orf93	16	G	C	C	C	1	0	0	0	0	1	0	0	0	611	47	4	4	1831	219
MYH10	4628	broad.mit.edu	37	17	8390908	8390908	+	Missense_Mutation	SNP	C	A	A			TCGA-28-5211-01	TCGA-28-5211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:8390908C>A	uc002gll.2	-	34	4892	c.4796G>T	c.(4795-4797)CGG>CTG	p.R1599L	MYH10_uc002glm.2_Missense_Mutation_p.R1630L|MYH10_uc010cnx.2_Missense_Mutation_p.R1608L	NM_005964	NP_005955	P35580	MYH10_HUMAN	myosin, heavy polypeptide 10, non-muscle	1599	Potential.				actin filament-based movement|axon guidance|cytokinesis after mitosis|regulation of cell shape	cell cortex|cleavage furrow|midbody|myosin complex|stress fiber	actin filament binding|actin-dependent ATPase activity|ADP binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(2)	2						CTCGAGCTCCCGCACCTAATG	0.542													11	191	---	---	---	---	capture	Missense_Mutation	SNP	8390908	8390908	MYH10	17	C	A	A	A	1	0	0	0	0	1	0	0	0	299	23	4	4	9940	219
GLP2R	9340	broad.mit.edu	37	17	9792806	9792806	+	Silent	SNP	G	A	A			TCGA-28-5211-01	TCGA-28-5211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:9792806G>A	uc002gmd.1	+	13	1446	c.1446G>A	c.(1444-1446)TCG>TCA	p.S482S		NM_004246	NP_004237	O95838	GLP2R_HUMAN	glucagon-like peptide 2 receptor precursor	482	Cytoplasmic (Potential).				G-protein signaling, coupled to cAMP nucleotide second messenger|positive regulation of cell proliferation	integral to membrane|plasma membrane				lung(2)|ovary(1)	3					Glucagon recombinant(DB00040)	AGAAGCTCTCGGAAGGAGATG	0.597													20	59	---	---	---	---	capture	Silent	SNP	9792806	9792806	GLP2R	17	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	6389	219
KRT35	3886	broad.mit.edu	37	17	39633981	39633981	+	Silent	SNP	A	G	G			TCGA-28-5211-01	TCGA-28-5211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:39633981A>G	uc002hws.2	-	6	1052	c.1009T>C	c.(1009-1011)TTG>CTG	p.L337L		NM_002280	NP_002271	Q92764	KRT35_HUMAN	keratin 35	337	Rod.|Coil 2.				anatomical structure morphogenesis	intermediate filament	protein binding|structural molecule activity			ovary(1)|skin(1)	2		Breast(137;0.000286)				GTGGATTCCAAAGCATCTCTC	0.577													3	27	---	---	---	---	capture	Silent	SNP	39633981	39633981	KRT35	17	A	G	G	G	1	0	0	0	0	0	0	0	1	11	1	3	3	8392	219
ENGASE	64772	broad.mit.edu	37	17	77073856	77073856	+	Missense_Mutation	SNP	A	G	G			TCGA-28-5211-01	TCGA-28-5211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:77073856A>G	uc002jwv.2	+	3	334	c.326A>G	c.(325-327)GAG>GGG	p.E109G	ENGASE_uc002jwu.1_Missense_Mutation_p.E109G|ENGASE_uc010wtz.1_5'UTR|ENGASE_uc002jww.2_5'Flank	NM_001042573	NP_001036038	Q8NFI3	ENASE_HUMAN	endo-beta-N-acetylglucosaminidase	109						cytosol	mannosyl-glycoprotein endo-beta-N-acetylglucosaminidase activity			skin(1)	1						GTGGCCCTGGAGCCCCTGGCG	0.592													11	57	---	---	---	---	capture	Missense_Mutation	SNP	77073856	77073856	ENGASE	17	A	G	G	G	1	0	0	0	0	1	0	0	0	143	11	3	3	5073	219
SLC1A6	6511	broad.mit.edu	37	19	15067457	15067457	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5211-01	TCGA-28-5211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:15067457C>T	uc002naa.1	-	6	1008	c.1000G>A	c.(1000-1002)GTC>ATC	p.V334I	SLC1A6_uc010dzu.1_Intron|SLC1A6_uc010xod.1_Missense_Mutation_p.V270I	NM_005071	NP_005062	P48664	EAA4_HUMAN	solute carrier family 1 (high affinity	334					synaptic transmission	integral to plasma membrane|membrane fraction	high-affinity glutamate transmembrane transporter activity|L-aspartate transmembrane transporter activity|sodium:dicarboxylate symporter activity	p.V334I(1)		pancreas(3)|ovary(2)|skin(1)	6					L-Glutamic Acid(DB00142)	CCCCCCAGGACGGCCATGTCT	0.582													13	49	---	---	---	---	capture	Missense_Mutation	SNP	15067457	15067457	SLC1A6	19	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	14329	219
PTPRH	5794	broad.mit.edu	37	19	55698964	55698964	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5211-01	TCGA-28-5211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:55698964G>A	uc002qjq.2	-	14	2556	c.2483C>T	c.(2482-2484)TCC>TTC	p.S828F	PTPRH_uc010esv.2_Missense_Mutation_p.S650F|uc002qjr.2_5'Flank	NM_002842	NP_002833	Q9HD43	PTPRH_HUMAN	protein tyrosine phosphatase, receptor type, H	828	Cytoplasmic (Potential).|Tyrosine-protein phosphatase.				apoptosis	cytoplasm|integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(2)|large_intestine(1)|skin(1)	4		Renal(1328;0.245)	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0479)		GCCCACCAGGGAGAGTTGCTG	0.587													5	41	---	---	---	---	capture	Missense_Mutation	SNP	55698964	55698964	PTPRH	19	G	A	A	A	1	0	0	0	0	1	0	0	0	533	41	2	2	12698	219
DYSF	8291	broad.mit.edu	37	2	71886153	71886153	+	Missense_Mutation	SNP	C	G	G			TCGA-28-5211-01	TCGA-28-5211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:71886153C>G	uc002sie.2	+	43	5160	c.4784C>G	c.(4783-4785)CCC>CGC	p.P1595R	DYSF_uc010feg.2_Missense_Mutation_p.P1626R|DYSF_uc010feh.2_Missense_Mutation_p.P1602R|DYSF_uc002sig.3_Missense_Mutation_p.P1581R|DYSF_uc010yqx.1_RNA|DYSF_uc010fee.2_Missense_Mutation_p.P1616R|DYSF_uc010fef.2_Missense_Mutation_p.P1633R|DYSF_uc010fei.2_Missense_Mutation_p.P1612R|DYSF_uc010fek.2_Missense_Mutation_p.P1613R|DYSF_uc010fej.2_Missense_Mutation_p.P1603R|DYSF_uc010fel.2_Missense_Mutation_p.P1582R|DYSF_uc010feo.2_Missense_Mutation_p.P1627R|DYSF_uc010fem.2_Missense_Mutation_p.P1617R|DYSF_uc010fen.2_Missense_Mutation_p.P1634R|DYSF_uc002sif.2_Missense_Mutation_p.P1596R|DYSF_uc010yqy.1_Missense_Mutation_p.P476R|DYSF_uc010yqz.1_Missense_Mutation_p.P356R	NM_003494	NP_003485	O75923	DYSF_HUMAN	dysferlin isoform 8	1595	Cytoplasmic (Potential).|C2 5.					cytoplasmic vesicle membrane|integral to membrane|sarcolemma	calcium-dependent phospholipid binding			ovary(3)|breast(2)|pancreas(1)|skin(1)	7						CCCAAGGACCCCAATGGAAAG	0.517													3	53	---	---	---	---	capture	Missense_Mutation	SNP	71886153	71886153	DYSF	2	C	G	G	G	1	0	0	0	0	1	0	0	0	286	22	4	4	4814	219
FAM176A	84141	broad.mit.edu	37	2	75720533	75720533	+	Silent	SNP	G	A	A			TCGA-28-5211-01	TCGA-28-5211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:75720533G>A	uc002sni.2	-	4	766	c.288C>T	c.(286-288)TCC>TCT	p.S96S	FAM176A_uc002snj.1_Silent_p.S83S|FAM176A_uc002snk.1_Silent_p.S96S	NM_001135032	NP_001128504	Q9H8M9	F176A_HUMAN	family with sequence similarity 176, member A	96					apoptosis|autophagy	endoplasmic reticulum membrane|integral to membrane|lysosomal membrane|plasma membrane					0						GTCTCCGCACGGAGAGATCGG	0.647													11	41	---	---	---	---	capture	Silent	SNP	75720533	75720533	FAM176A	2	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	5452	219
NEB	4703	broad.mit.edu	37	2	152363440	152363440	+	Missense_Mutation	SNP	G	T	T			TCGA-28-5211-01	TCGA-28-5211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:152363440G>T	uc010fnx.2	-	135	18627	c.18436C>A	c.(18436-18438)CAG>AAG	p.Q6146K	NEB_uc002txr.2_Missense_Mutation_p.Q2569K|RIF1_uc002txp.2_Intron|NEB_uc010zca.1_5'Flank|NEB_uc010zcb.1_5'UTR|NEB_uc002txt.3_Missense_Mutation_p.Q651K	NM_004543	NP_004534	P20929	NEBU_HUMAN	nebulin isoform 3	6146	Nebulin 168.				muscle filament sliding|muscle organ development|regulation of actin filament length|somatic muscle development	actin cytoskeleton|cytosol|Z disc	actin binding|structural constituent of muscle			ovary(8)|large_intestine(5)|breast(3)|central_nervous_system(2)|skin(1)|pancreas(1)	20				BRCA - Breast invasive adenocarcinoma(221;0.219)		AAATTCTTCTGATTTTCTTTT	0.318													29	82	---	---	---	---	capture	Missense_Mutation	SNP	152363440	152363440	NEB	2	G	T	T	T	1	0	0	0	0	1	0	0	0	585	45	4	4	10209	219
COL6A3	1293	broad.mit.edu	37	2	238275426	238275426	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5211-01	TCGA-28-5211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:238275426C>T	uc002vwl.2	-	11	5689	c.5404G>A	c.(5404-5406)GTC>ATC	p.V1802I	COL6A3_uc002vwo.2_Missense_Mutation_p.V1596I|COL6A3_uc010znj.1_Missense_Mutation_p.V1195I	NM_004369	NP_004360	P12111	CO6A3_HUMAN	alpha 3 type VI collagen isoform 1 precursor	1802	VWFA 9.|Nonhelical region.				axon guidance|cell adhesion|muscle organ development	collagen type VI|extracellular space	serine-type endopeptidase inhibitor activity			ovary(8)|central_nervous_system(6)|skin(2)|upper_aerodigestive_tract(1)|pancreas(1)	18		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		AGCTCCTGGACGTTGCCCACG	0.532													7	51	---	---	---	---	capture	Missense_Mutation	SNP	238275426	238275426	COL6A3	2	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	3666	219
TRAIP	10293	broad.mit.edu	37	3	49869443	49869443	+	Missense_Mutation	SNP	C	A	A			TCGA-28-5211-01	TCGA-28-5211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:49869443C>A	uc003cxs.1	-	11	1049	c.943G>T	c.(943-945)GAT>TAT	p.D315Y	TRAIP_uc010hla.1_Missense_Mutation_p.D216Y	NM_005879	NP_005870	Q9BWF2	TRAIP_HUMAN	TRAF interacting protein	315	Interaction with CYLD.				cell proliferation|induction of apoptosis	perinuclear region of cytoplasm	protein binding|zinc ion binding			lung(4)|upper_aerodigestive_tract(1)|ovary(1)	6				BRCA - Breast invasive adenocarcinoma(193;4.71e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		GCATTGAGATCAATATCATCA	0.542													23	75	---	---	---	---	capture	Missense_Mutation	SNP	49869443	49869443	TRAIP	3	C	A	A	A	1	0	0	0	0	1	0	0	0	377	29	4	4	16331	219
MUC4	4585	broad.mit.edu	37	3	195505836	195505836	+	Missense_Mutation	SNP	G	C	C			TCGA-28-5211-01	TCGA-28-5211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:195505836G>C	uc011bto.1	-	3	12691	c.12231C>G	c.(12229-12231)CAC>CAG	p.H4077Q	MUC4_uc003fva.2_5'Flank|MUC4_uc003fvb.2_5'Flank|MUC4_uc003fvc.2_5'Flank|MUC4_uc003fvd.2_5'Flank|MUC4_uc003fve.2_5'Flank|MUC4_uc010hzr.2_5'Flank|MUC4_uc011btf.1_Intron|MUC4_uc011btg.1_Intron|MUC4_uc011bth.1_Intron|MUC4_uc011bti.1_Intron|MUC4_uc011btj.1_Intron|MUC4_uc011btk.1_Intron|MUC4_uc011btl.1_Intron|MUC4_uc011btm.1_Intron|MUC4_uc011btn.1_Intron|MUC4_uc003fvo.2_Intron|MUC4_uc003fvp.2_Intron|MUC4_uc010hzu.1_Intron	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GAGGGGTGGCGTGACCTGTGG	0.597													2	4	---	---	---	---	capture	Missense_Mutation	SNP	195505836	195505836	MUC4	3	G	C	C	C	1	0	0	0	0	1	0	0	0	516	40	4	4	9888	219
TLR6	10333	broad.mit.edu	37	4	38830190	38830190	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5211-01	TCGA-28-5211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:38830190G>A	uc003gtm.2	-	1	971	c.905C>T	c.(904-906)ACG>ATG	p.T302M	TLR6_uc010ifg.1_Missense_Mutation_p.T302M	NM_006068	NP_006059	Q9Y2C9	TLR6_HUMAN	toll-like receptor 6 precursor	302	Extracellular (Potential).				activation of NF-kappaB-inducing kinase activity|cellular response to diacyl bacterial lipopeptide|defense response to bacterium|detection of diacyl bacterial lipopeptide|inflammatory response|innate immune response|MyD88-dependent toll-like receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interleukin-6 biosynthetic process|positive regulation of JUN kinase activity|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	integral to plasma membrane|phagocytic vesicle membrane	lipopeptide binding|transmembrane receptor activity			ovary(2)	2						TTTCAATGTCGTTTTAGAATA	0.323													10	25	---	---	---	---	capture	Missense_Mutation	SNP	38830190	38830190	TLR6	4	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	15840	219
TNIP3	79931	broad.mit.edu	37	4	122085228	122085228	+	Missense_Mutation	SNP	G	A	A	rs144762502	byFrequency	TCGA-28-5211-01	TCGA-28-5211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:122085228G>A	uc010ing.2	-	1	249	c.53C>T	c.(52-54)ACG>ATG	p.T18M	TNIP3_uc010inh.2_Missense_Mutation_p.T18M|TNIP3_uc011cgj.1_Missense_Mutation_p.T76M|TNIP3_uc010ini.2_Missense_Mutation_p.T18M	NM_024873	NP_079149	Q96KP6	TNIP3_HUMAN	TNFAIP3 interacting protein 3	18										ovary(1)	1						TTTATGCTCCGTAGAACTTTC	0.398													9	70	---	---	---	---	capture	Missense_Mutation	SNP	122085228	122085228	TNIP3	4	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	16199	219
HCN1	348980	broad.mit.edu	37	5	45695952	45695952	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5211-01	TCGA-28-5211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:45695952C>T	uc003jok.2	-	1	269	c.244G>A	c.(244-246)GAA>AAA	p.E82K		NM_021072	NP_066550	O60741	HCN1_HUMAN	hyperpolarization activated cyclic	82	Cytoplasmic (Potential).					integral to membrane	cAMP binding|sodium channel activity|voltage-gated potassium channel activity			ovary(1)	1						TCGGCGTCTTCGAAGCCCCCC	0.478													6	22	---	---	---	---	capture	Missense_Mutation	SNP	45695952	45695952	HCN1	5	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	6922	219
ZNF366	167465	broad.mit.edu	37	5	71757119	71757120	+	Missense_Mutation	DNP	CG	AT	AT			TCGA-28-5211-01	TCGA-28-5211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:71757119_71757120CG>AT	uc003kce.1	-	2	390_391	c.204_205CG>AT	c.(202-207)CCCGGG>CCATGG	p.G69W		NM_152625	NP_689838	Q8N895	ZN366_HUMAN	zinc finger protein 366	69					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			central_nervous_system(1)|skin(1)	2		Lung NSC(167;0.0247)|Ovarian(174;0.0908)|Prostate(461;0.155)		OV - Ovarian serous cystadenocarcinoma(47;2.51e-53)		TCGAAGACCCCGGGGAACCCAT	0.584													5	73	---	---	---	---	capture	Missense_Mutation	DNP	71757119	71757120	ZNF366	5	CG	AT	AT	AT	1	0	0	0	0	1	0	0	0	299	23	4	4	17750	219
E2F3	1871	broad.mit.edu	37	6	20402625	20402625	+	Silent	SNP	G	C	C			TCGA-28-5211-01	TCGA-28-5211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:20402625G>C	uc003nda.2	+	1	489	c.162G>C	c.(160-162)CCG>CCC	p.P54P	E2F3_uc003ncz.2_Silent_p.P54P	NM_001949	NP_001940	O00716	E2F3_HUMAN	E2F transcription factor 3	54					G1 phase of mitotic cell cycle|G2 phase of mitotic cell cycle|transcription initiation from RNA polymerase II promoter	transcription factor complex	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			lung(1)	1	all_cancers(95;0.154)|all_epithelial(95;0.0585)|Breast(50;0.146)|Ovarian(93;0.148)		OV - Ovarian serous cystadenocarcinoma(7;0.0068)|all cancers(50;0.0148)|Epithelial(50;0.0562)			ccgccgccCCGGGCGCGTACA	0.597													3	68	---	---	---	---	capture	Silent	SNP	20402625	20402625	E2F3	6	G	C	C	C	1	0	0	0	0	0	0	0	1	496	39	4	4	4823	219
BAT2	7916	broad.mit.edu	37	6	31599728	31599728	+	Missense_Mutation	SNP	A	G	G			TCGA-28-5211-01	TCGA-28-5211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:31599728A>G	uc003nvb.3	+	16	3527	c.3278A>G	c.(3277-3279)GAG>GGG	p.E1093G	BAT2_uc011dnv.1_Intron|BAT2_uc003nvc.3_Missense_Mutation_p.E1093G	NM_080686	NP_542417	P48634	PRC2A_HUMAN	HLA-B associated transcript-2	1093	4 X 57 AA type A repeats.					cytoplasm|nucleus	protein binding				0						GAGGGTTCAGAGTATGAGGAA	0.632													13	35	---	---	---	---	capture	Missense_Mutation	SNP	31599728	31599728	BAT2	6	A	G	G	G	1	0	0	0	0	1	0	0	0	143	11	3	3	1308	219
LAMA2	3908	broad.mit.edu	37	6	129802525	129802525	+	Missense_Mutation	SNP	C	G	G			TCGA-28-5211-01	TCGA-28-5211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:129802525C>G	uc003qbn.2	+	54	7795	c.7690C>G	c.(7690-7692)CTT>GTT	p.L2564V	LAMA2_uc003qbo.2_Missense_Mutation_p.L2560V|uc003qbq.2_RNA	NM_000426	NP_000417	P24043	LAMA2_HUMAN	laminin alpha 2 subunit isoform a precursor	2564	Laminin G-like 3.		L -> P (in MDC1A).		cell adhesion|muscle organ development|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	receptor binding|structural molecule activity			ovary(8)|breast(1)|skin(1)	10				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)		CGGCATCATTCTTTTGGGAAG	0.488													32	97	---	---	---	---	capture	Missense_Mutation	SNP	129802525	129802525	LAMA2	6	C	G	G	G	1	0	0	0	0	1	0	0	0	416	32	4	4	8526	219
SYNE1	23345	broad.mit.edu	37	6	152861113	152861113	+	Missense_Mutation	SNP	G	C	C			TCGA-28-5211-01	TCGA-28-5211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:152861113G>C	uc010kiw.2	-	4	713	c.111C>G	c.(109-111)ATC>ATG	p.I37M	SYNE1_uc003qot.3_Missense_Mutation_p.I37M|SYNE1_uc003qou.3_Missense_Mutation_p.I37M|SYNE1_uc010kjb.1_Missense_Mutation_p.I37M|SYNE1_uc003qpa.1_Missense_Mutation_p.I37M	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	37	Actin-binding.|Cytoplasmic (Potential).|CH 1.				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		GATGAGAGTTGATCCATTTTG	0.338										HNSCC(10;0.0054)			30	136	---	---	---	---	capture	Missense_Mutation	SNP	152861113	152861113	SYNE1	6	G	C	C	C	1	0	0	0	0	1	0	0	0	577	45	4	4	15333	219
GRB10	2887	broad.mit.edu	37	7	50674041	50674041	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5211-01	TCGA-28-5211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:50674041G>A	uc003tpi.2	-	11	1296	c.1265C>T	c.(1264-1266)ACG>ATG	p.T422M	GRB10_uc003tph.3_Missense_Mutation_p.T364M|GRB10_uc003tpj.2_Missense_Mutation_p.T376M|GRB10_uc003tpk.2_Missense_Mutation_p.T422M|GRB10_uc010kzb.2_Missense_Mutation_p.T364M|GRB10_uc003tpl.2_Missense_Mutation_p.T416M|GRB10_uc003tpm.2_Missense_Mutation_p.T364M|GRB10_uc003tpn.2_Missense_Mutation_p.T364M	NM_005311	NP_005302	Q13322	GRB10_HUMAN	growth factor receptor-bound protein 10 isoform	422					insulin receptor signaling pathway|insulin receptor signaling pathway|negative regulation of glucose import|negative regulation of glycogen biosynthetic process|negative regulation of insulin receptor signaling pathway|negative regulation of Wnt receptor signaling pathway|positive regulation of phosphorylation|positive regulation of vascular endothelial growth factor receptor signaling pathway	cytosol|plasma membrane	insulin receptor binding|insulin receptor binding|SH3/SH2 adaptor activity			lung(3)|ovary(2)|upper_aerodigestive_tract(1)	6	Glioma(55;0.08)|all_neural(89;0.245)					TACCACTGGCGTCGAGAACGG	0.517									Russell-Silver_syndrome				27	104	---	---	---	---	capture	Missense_Mutation	SNP	50674041	50674041	GRB10	7	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	6689	219
DLC1	10395	broad.mit.edu	37	8	12957581	12957581	+	Silent	SNP	C	T	T	rs138749997	byFrequency	TCGA-28-5211-01	TCGA-28-5211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:12957581C>T	uc003wwm.2	-	9	2709	c.2265G>A	c.(2263-2265)ACG>ACA	p.T755T	DLC1_uc003wwk.1_Silent_p.T318T|DLC1_uc003wwl.1_Silent_p.T352T|DLC1_uc011kxx.1_Silent_p.T244T	NM_182643	NP_872584	Q96QB1	RHG07_HUMAN	deleted in liver cancer 1 isoform 1	755					actin cytoskeleton organization|activation of caspase activity|focal adhesion assembly|forebrain development|heart morphogenesis|hindbrain morphogenesis|induction of apoptosis|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of Rho protein signal transduction|negative regulation of stress fiber assembly|neural tube closure|positive regulation of protein dephosphorylation|regulation of cell shape|small GTPase mediated signal transduction	caveola|cytosol|focal adhesion|nucleus	Rho GTPase activator activity|SH2 domain binding			ovary(3)|pancreas(2)|lung(1)|kidney(1)	7						CAGGGCTGGGCGTGCTGACCG	0.582													12	32	---	---	---	---	capture	Silent	SNP	12957581	12957581	DLC1	8	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	4508	219
SEMA4D	10507	broad.mit.edu	37	9	92003832	92003832	+	Missense_Mutation	SNP	G	T	T			TCGA-28-5211-01	TCGA-28-5211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:92003832G>T	uc004aqo.1	-	12	1477	c.905C>A	c.(904-906)CCG>CAG	p.P302Q	SEMA4D_uc011ltm.1_Missense_Mutation_p.P302Q|SEMA4D_uc011ltn.1_RNA|SEMA4D_uc011lto.1_RNA|SEMA4D_uc004aqp.1_Missense_Mutation_p.P300Q	NM_006378	NP_006369	Q92854	SEM4D_HUMAN	semaphorin 4D isoform 1	302	Sema.|Extracellular (Potential).				anti-apoptosis|axon guidance|cell adhesion|immune response	integral to membrane|plasma membrane	receptor activity|receptor binding			ovary(1)|pancreas(1)	2						CTTCAGGCCCGGGGACCTGAG	0.602													7	108	---	---	---	---	capture	Missense_Mutation	SNP	92003832	92003832	SEMA4D	9	G	T	T	T	1	0	0	0	0	1	0	0	0	507	39	4	4	13927	219
ST6GALNAC4	27090	broad.mit.edu	37	9	130670779	130670779	+	Silent	SNP	C	T	T			TCGA-28-5211-01	TCGA-28-5211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:130670779C>T	uc004bss.2	-	6	1077	c.801G>A	c.(799-801)GAG>GAA	p.E267E	ST6GALNAC4_uc004bst.2_Silent_p.E183E	NM_175039	NP_778204	Q9H4F1	SIA7D_HUMAN	sialyltransferase 7D isoform a	267	Lumenal (Potential).				glycolipid metabolic process|protein glycosylation	integral to Golgi membrane|nucleus|soluble fraction	(alpha-N-acetylneuraminyl-2,3-beta-galactosyl-1,3)-N-acetyl-galactosaminide 6-alpha-sialyltransferase activity				0						GGGGCGCCTGCTCGTGTGCCA	0.627													10	63	---	---	---	---	capture	Silent	SNP	130670779	130670779	ST6GALNAC4	9	C	T	T	T	1	0	0	0	0	0	0	0	1	363	28	2	2	15116	219
PKN3	29941	broad.mit.edu	37	9	131476566	131476566	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5211-01	TCGA-28-5211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:131476566C>T	uc004bvw.2	+	11	1796	c.1403C>T	c.(1402-1404)CCG>CTG	p.P468L	PKN3_uc010myh.2_Missense_Mutation_p.P468L|PKN3_uc011mbk.1_Missense_Mutation_p.P18L	NM_013355	NP_037487	Q6P5Z2	PKN3_HUMAN	protein kinase PKNbeta	468	Pro-rich.				signal transduction	Golgi apparatus|nucleus|perinuclear region of cytoplasm	ATP binding|protein binding|protein kinase C activity			stomach(2)|lung(2)	4						TGCAGCTCCCCGAGCACAATC	0.652													18	39	---	---	---	---	capture	Missense_Mutation	SNP	131476566	131476566	PKN3	9	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	11884	219
ARHGAP6	395	broad.mit.edu	37	X	11682473	11682473	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5211-01	TCGA-28-5211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:11682473G>A	uc004cup.1	-	1	1349	c.476C>T	c.(475-477)TCC>TTC	p.S159F	ARHGAP6_uc004cuo.1_RNA|ARHGAP6_uc004cur.1_Missense_Mutation_p.S159F	NM_013427	NP_038286	O43182	RHG06_HUMAN	Rho GTPase activating protein 6 isoform 1	159					actin filament polymerization|activation of phospholipase C activity|negative regulation of focal adhesion assembly|negative regulation of stress fiber assembly|Rho protein signal transduction	actin filament|cytosol	phospholipase activator activity|phospholipase binding|Rho GTPase activator activity|SH3 domain binding|SH3/SH2 adaptor activity			urinary_tract(1)|lung(1)	2						GCCTCCCCCGGATGAACAGAG	0.657													11	12	---	---	---	---	capture	Missense_Mutation	SNP	11682473	11682473	ARHGAP6	23	G	A	A	A	1	0	0	0	0	1	0	0	0	533	41	2	2	880	219
MAGEC2	51438	broad.mit.edu	37	X	141291609	141291609	+	Missense_Mutation	SNP	G	T	T			TCGA-28-5211-01	TCGA-28-5211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:141291609G>T	uc004fbu.1	-	3	513	c.165C>A	c.(163-165)TTC>TTA	p.F55L		NM_016249	NP_057333	Q9UBF1	MAGC2_HUMAN	melanoma antigen family C, 2	55	Ser-rich.					cytoplasm|nucleus				breast(2)	2	Acute lymphoblastic leukemia(192;6.56e-05)					AGGATGTGGAGAAAGAAGAGG	0.483										HNSCC(46;0.14)			25	32	---	---	---	---	capture	Missense_Mutation	SNP	141291609	141291609	MAGEC2	23	G	T	T	T	1	0	0	0	0	1	0	0	0	425	33	4	4	9095	219
COG2	22796	broad.mit.edu	37	1	230798959	230798959	+	Frame_Shift_Del	DEL	A	-	-	rs141422644	byFrequency	TCGA-28-5211-01	TCGA-28-5211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:230798959delA	uc001htw.2	+	4	524	c.373delA	c.(373-375)AAAfs	p.K125fs	COG2_uc001htx.2_Frame_Shift_Del_p.K125fs|COG2_uc010pwc.1_5'UTR	NM_007357	NP_031383	Q14746	COG2_HUMAN	component of oligomeric golgi complex 2 isoform	125					Golgi organization|intra-Golgi vesicle-mediated transport|intracellular protein transport|oligosaccharide biosynthetic process|protein glycosylation	Golgi membrane|Golgi stack|Golgi transport complex	protein binding|protein transporter activity				0	Breast(184;0.0871)|Ovarian(103;0.183)	Prostate(94;0.178)				GGACATTAGGAAAAAAAAGGT	0.348													7	158	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	230798959	230798959	COG2	1	A	-	-	-	1	0	1	0	1	0	0	0	0	117	9	5	5	3623	219
CDON	50937	broad.mit.edu	37	11	125853903	125853903	+	Frame_Shift_Del	DEL	C	-	-	rs139149075		TCGA-28-5211-01	TCGA-28-5211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:125853903delC	uc009zbw.2	-	16	2987	c.2859delG	c.(2857-2859)GGGfs	p.G953fs	CDON_uc001qdb.3_Frame_Shift_Del_p.G330fs|CDON_uc001qdc.3_Frame_Shift_Del_p.G953fs	NM_016952	NP_058648	Q4KMG0	CDON_HUMAN	surface glycoprotein, Ig superfamily member	953	Extracellular (Potential).				cell adhesion|muscle cell differentiation|positive regulation of muscle cell differentiation	integral to membrane|plasma membrane	protein binding			ovary(3)|skin(2)|breast(1)	6	all_hematologic(175;0.177)	Breast(109;0.00157)|Lung NSC(97;0.0127)|all_lung(97;0.0133)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.51e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0604)		TGGTTGCAGGCCCCACATTTC	0.463													13	47	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	125853903	125853903	CDON	11	C	-	-	-	1	0	1	0	1	0	0	0	0	327	26	5	5	3139	219
