Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
CPSF3L	54973	broad.mit.edu	37	1	1256376	1256376	+	Silent	SNP	G	A	A			TCGA-28-5214-01	TCGA-28-5214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:1256376G>A	uc001aee.1	-	2	184	c.126C>T	c.(124-126)GAC>GAT	p.D42D	CPSF3L_uc001aef.1_Silent_p.D48D|CPSF3L_uc009vjz.1_Silent_p.D42D|CPSF3L_uc010nyj.1_Silent_p.D13D|CPSF3L_uc001aeg.1_Translation_Start_Site|CPSF3L_uc001aeh.1_Silent_p.D42D|CPSF3L_uc001aei.1_Intron|CPSF3L_uc001aej.1_Missense_Mutation_p.T15I|CPSF3L_uc001aek.1_Intron|CPSF3L_uc001aem.1_Silent_p.D42D|CPSF3L_uc001ael.1_Translation_Start_Site|CPSF3L_uc001aen.1_Silent_p.D42D	NM_017871	NP_060341	Q5TA45	INT11_HUMAN	cleavage and polyadenylation specific factor	42						Golgi apparatus|nucleus	hydrolase activity				0	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;6.71e-35)|OV - Ovarian serous cystadenocarcinoma(86;4.35e-21)|Colorectal(212;0.000166)|COAD - Colon adenocarcinoma(227;0.000196)|Kidney(185;0.00235)|BRCA - Breast invasive adenocarcinoma(365;0.00255)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0349)|Lung(427;0.201)		AGGGACTCACGTCGTCATTGA	0.647													61	118	---	---	---	---	capture	Silent	SNP	1256376	1256376	CPSF3L	1	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	3792	221
NPHP4	261734	broad.mit.edu	37	1	5937354	5937354	+	Silent	SNP	T	C	C			TCGA-28-5214-01	TCGA-28-5214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:5937354T>C	uc001alq.1	-	20	2882	c.2616A>G	c.(2614-2616)AAA>AAG	p.K872K	NPHP4_uc001als.1_RNA|NPHP4_uc009vlt.1_RNA|NPHP4_uc001alt.1_RNA	NM_015102	NP_055917	O75161	NPHP4_HUMAN	nephroretinin	872					actin cytoskeleton organization|cell-cell adhesion|signal transduction|visual behavior	cell-cell junction|centrosome|cilium|microtubule basal body	protein binding|structural molecule activity			pancreas(1)	1	Ovarian(185;0.0634)	all_cancers(23;7.53e-41)|all_epithelial(116;3.96e-23)|all_lung(118;5.12e-09)|all_hematologic(16;5.45e-07)|Lung NSC(185;5.49e-07)|all_neural(13;3.21e-06)|Acute lymphoblastic leukemia(12;3.44e-05)|Breast(487;0.000601)|Renal(390;0.0007)|Colorectal(325;0.00113)|Hepatocellular(190;0.00213)|Glioma(11;0.00223)|Myeloproliferative disorder(586;0.0256)|Ovarian(437;0.04)|Lung SC(97;0.128)|Medulloblastoma(700;0.213)		Epithelial(90;1.69e-36)|GBM - Glioblastoma multiforme(13;5.07e-29)|OV - Ovarian serous cystadenocarcinoma(86;1.05e-19)|Colorectal(212;4.54e-07)|COAD - Colon adenocarcinoma(227;3.14e-05)|Kidney(185;0.00012)|BRCA - Breast invasive adenocarcinoma(365;0.00102)|KIRC - Kidney renal clear cell carcinoma(229;0.00179)|STAD - Stomach adenocarcinoma(132;0.00472)|READ - Rectum adenocarcinoma(331;0.0649)		GCACCACGTGTTTTCCTGCGA	0.632													10	16	---	---	---	---	capture	Silent	SNP	5937354	5937354	NPHP4	1	T	C	C	C	1	0	0	0	0	0	0	0	1	777	60	3	3	10488	221
MACF1	23499	broad.mit.edu	37	1	39833905	39833905	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5214-01	TCGA-28-5214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:39833905C>T	uc010oiu.1	+	14	8308	c.8177C>T	c.(8176-8178)GCG>GTG	p.A2726V	MACF1_uc010ois.1_Missense_Mutation_p.A2224V|MACF1_uc001cda.1_Missense_Mutation_p.A2132V|MACF1_uc001cdc.1_Missense_Mutation_p.A1311V|MACF1_uc001cdb.1_Missense_Mutation_p.A1311V	NM_033044	NP_149033	Q9UPN3	MACF1_HUMAN	microfilament and actin filament cross-linker	4291					cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding			ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			TGTGGCTTTGCGCTGGACTTG	0.453													58	111	---	---	---	---	capture	Missense_Mutation	SNP	39833905	39833905	MACF1	1	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	9059	221
CLCA2	9635	broad.mit.edu	37	1	86916416	86916416	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5214-01	TCGA-28-5214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:86916416G>A	uc001dlr.3	+	12	2317	c.2155G>A	c.(2155-2157)GGT>AGT	p.G719S		NM_006536	NP_006527	Q9UQC9	CLCA2_HUMAN	chloride channel accessory 2 precursor	719	Extracellular (Potential).				cell adhesion	basal plasma membrane|cell junction|extracellular region|integral to plasma membrane	chloride channel activity			ovary(1)|breast(1)|skin(1)	3		Lung NSC(277;0.238)		all cancers(265;0.0233)|Epithelial(280;0.0452)		CACAGCAAACGGTAAGAACCA	0.453													5	255	---	---	---	---	capture	Missense_Mutation	SNP	86916416	86916416	CLCA2	1	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	3423	221
EPHX4	253152	broad.mit.edu	37	1	92528664	92528664	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5214-01	TCGA-28-5214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:92528664G>A	uc001don.2	+	7	1014	c.910G>A	c.(910-912)GGA>AGA	p.G304R		NM_173567	NP_775838	Q8IUS5	EPHX4_HUMAN	abhydrolase domain containing 7	304						integral to membrane	hydrolase activity			central_nervous_system(1)	1						ACTACTGTGGGGAGAGAATGA	0.398													101	214	---	---	---	---	capture	Missense_Mutation	SNP	92528664	92528664	EPHX4	1	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	5137	221
DPYD	1806	broad.mit.edu	37	1	98293688	98293688	+	Missense_Mutation	SNP	G	C	C			TCGA-28-5214-01	TCGA-28-5214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:98293688G>C	uc001drv.2	-	3	352	c.215C>G	c.(214-216)GCT>GGT	p.A72G	DPYD_uc010oub.1_RNA|DPYD_uc001drw.2_Missense_Mutation_p.A72G	NM_000110	NP_000101	Q12882	DPYD_HUMAN	dihydropyrimidine dehydrogenase isoform 1	72	4Fe-4S ferredoxin-type 1.				'de novo' pyrimidine base biosynthetic process|purine base catabolic process|thymidine catabolic process|thymine catabolic process|UMP biosynthetic process|uracil catabolic process	cytosol	4 iron, 4 sulfur cluster binding|dihydroorotate oxidase activity|dihydropyrimidine dehydrogenase (NADP+) activity|electron carrier activity|flavin adenine dinucleotide binding|metal ion binding|NADP binding|protein homodimerization activity			ovary(3)|skin(3)|breast(2)	8		all_epithelial(167;0.000185)|all_lung(203;0.00318)|Lung NSC(277;0.00994)		Colorectal(170;0.0165)|Epithelial(280;0.0526)|all cancers(265;0.104)|READ - Rectum adenocarcinoma(84;0.171)|Lung(183;0.216)	Capecitabine(DB01101)|Enfuvirtide(DB00109)	TTCTCGGAGAGCTCCTCGCTC	0.393													5	126	---	---	---	---	capture	Missense_Mutation	SNP	98293688	98293688	DPYD	1	G	C	C	C	1	0	0	0	0	1	0	0	0	442	34	4	4	4700	221
FLG	2312	broad.mit.edu	37	1	152280977	152280977	+	Missense_Mutation	SNP	A	G	G			TCGA-28-5214-01	TCGA-28-5214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152280977A>G	uc001ezu.1	-	3	6421	c.6385T>C	c.(6385-6387)TCA>CCA	p.S2129P		NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	2129	Ser-rich.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TGGGATGCTGAGTGCCTGGAG	0.572									Ichthyosis				10	668	---	---	---	---	capture	Missense_Mutation	SNP	152280977	152280977	FLG	1	A	G	G	G	1	0	0	0	0	1	0	0	0	143	11	3	3	5867	221
FLG	2312	broad.mit.edu	37	1	152282616	152282616	+	Silent	SNP	C	T	T			TCGA-28-5214-01	TCGA-28-5214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152282616C>T	uc001ezu.1	-	3	4782	c.4746G>A	c.(4744-4746)GCG>GCA	p.A1582A		NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	1582	Ser-rich.|Filaggrin 9.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TCTTGGACCCCGCTGATTCTC	0.602									Ichthyosis				9	432	---	---	---	---	capture	Silent	SNP	152282616	152282616	FLG	1	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	5867	221
PKP1	5317	broad.mit.edu	37	1	201289494	201289494	+	Silent	SNP	C	T	T			TCGA-28-5214-01	TCGA-28-5214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:201289494C>T	uc001gwd.2	+	8	1646	c.1395C>T	c.(1393-1395)AGC>AGT	p.S465S	PKP1_uc001gwe.2_Silent_p.S444S|PKP1_uc009wzm.2_Silent_p.S52S	NM_000299	NP_000290	Q13835	PKP1_HUMAN	plakophilin 1 isoform 1b	465					cell adhesion|cellular component disassembly involved in apoptosis|multicellular organismal development	desmosome|intermediate filament|nucleus	intermediate filament binding|signal transducer activity|structural constituent of epidermis			ovary(2)	2						TAGCGGCCAGCCGCTGTGACG	0.612													3	51	---	---	---	---	capture	Silent	SNP	201289494	201289494	PKP1	1	C	T	T	T	1	0	0	0	0	0	0	0	1	337	26	2	2	11887	221
USH2A	7399	broad.mit.edu	37	1	216061963	216061963	+	Silent	SNP	C	T	T			TCGA-28-5214-01	TCGA-28-5214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:216061963C>T	uc001hku.1	-	41	8415	c.8028G>A	c.(8026-8028)CCG>CCA	p.P2676P		NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	2676	Extracellular (Potential).|Fibronectin type-III 13.				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		AATGACTCCTCGGGAGAGTCA	0.468										HNSCC(13;0.011)			75	95	---	---	---	---	capture	Silent	SNP	216061963	216061963	USH2A	1	C	T	T	T	1	0	0	0	0	0	0	0	1	392	31	1	1	16918	221
MAP3K11	4296	broad.mit.edu	37	11	65367001	65367001	+	Silent	SNP	C	A	A	rs138509783		TCGA-28-5214-01	TCGA-28-5214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:65367001C>A	uc001oew.2	-	9	2563	c.2070G>T	c.(2068-2070)CCG>CCT	p.P690P	MAP3K11_uc001oev.2_Silent_p.P106P|MAP3K11_uc010rol.1_Silent_p.P433P|MAP3K11_uc001oex.1_Silent_p.P197P	NM_002419	NP_002410	Q16584	M3K11_HUMAN	mitogen-activated protein kinase kinase kinase	690	Pro-rich.				activation of JUN kinase activity|cell proliferation|G1 phase of mitotic cell cycle|microtubule-based process|positive regulation of JNK cascade|protein autophosphorylation	centrosome|microtubule	ATP binding|JUN kinase kinase kinase activity|mitogen-activated protein kinase kinase kinase binding|protein homodimerization activity			breast(3)|lung(1)|central_nervous_system(1)|skin(1)	6						GGGAAGGGGGCGGCTCGGTCG	0.736													13	75	---	---	---	---	capture	Silent	SNP	65367001	65367001	MAP3K11	11	C	A	A	A	1	0	0	0	0	0	0	0	1	340	27	4	4	9159	221
ANKRD33	341405	broad.mit.edu	37	12	52284680	52284680	+	Missense_Mutation	SNP	G	C	C			TCGA-28-5214-01	TCGA-28-5214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:52284680G>C	uc001rzf.3	+	5	1154	c.575G>C	c.(574-576)AGT>ACT	p.S192T	ANKRD33_uc001rzh.3_3'UTR|ANKRD33_uc001rzd.2_Missense_Mutation_p.S317T|ANKRD33_uc001rze.2_Missense_Mutation_p.S213T|ANKRD33_uc001rzg.3_Missense_Mutation_p.S119T|ANKRD33_uc001rzi.3_Missense_Mutation_p.S192T	NM_001130015	NP_001123487	Q7Z3H0	ANR33_HUMAN	ankyrin repeat domain 33 isoform 1	192											0				BRCA - Breast invasive adenocarcinoma(357;0.0969)		AGCCTGGCCAGTCCCTTCGTC	0.632													3	32	---	---	---	---	capture	Missense_Mutation	SNP	52284680	52284680	ANKRD33	12	G	C	C	C	1	0	0	0	0	1	0	0	0	468	36	4	4	657	221
PAN2	9924	broad.mit.edu	37	12	56717611	56717611	+	Missense_Mutation	SNP	A	T	T			TCGA-28-5214-01	TCGA-28-5214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:56717611A>T	uc001skx.2	-	14	2537	c.2164T>A	c.(2164-2166)TGT>AGT	p.C722S	PAN2_uc001skw.2_5'UTR|PAN2_uc001skz.2_Missense_Mutation_p.C721S|PAN2_uc001sky.2_Missense_Mutation_p.C718S	NM_001127460	NP_001120932	Q504Q3	PAN2_HUMAN	PAN2 polyA specific ribonuclease subunit homolog	722					nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|nuclear-transcribed mRNA poly(A) tail shortening|ubiquitin-dependent protein catabolic process	cytosol|nucleus	nucleic acid binding|poly(A)-specific ribonuclease activity|ubiquitin thiolesterase activity			ovary(2)|skin(2)|large_intestine(1)|breast(1)	6						TACTTTTCACAGGTGTCACAC	0.522													4	154	---	---	---	---	capture	Missense_Mutation	SNP	56717611	56717611	PAN2	12	A	T	T	T	1	0	0	0	0	1	0	0	0	91	7	4	4	11318	221
FGD6	55785	broad.mit.edu	37	12	95603097	95603097	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5214-01	TCGA-28-5214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:95603097C>T	uc001tdp.3	-	2	2187	c.1963G>A	c.(1963-1965)GGA>AGA	p.G655R	FGD6_uc009zsx.2_Intron	NM_018351	NP_060821	Q6ZV73	FGD6_HUMAN	FYVE, RhoGEF and PH domain containing 6	655					actin cytoskeleton organization|filopodium assembly|regulation of Cdc42 GTPase activity|regulation of cell shape	cytoskeleton|Golgi apparatus|lamellipodium|ruffle	metal ion binding|Rho guanyl-nucleotide exchange factor activity|small GTPase binding			ovary(2)|breast(1)	3						GTGGTGTCTCCGAGTTGGCTA	0.443													120	201	---	---	---	---	capture	Missense_Mutation	SNP	95603097	95603097	FGD6	12	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	5783	221
MIPEP	4285	broad.mit.edu	37	13	24330744	24330744	+	Missense_Mutation	SNP	G	A	A	rs148780512	byFrequency;by1000genomes	TCGA-28-5214-01	TCGA-28-5214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:24330744G>A	uc001uox.3	-	18	2084	c.1984C>T	c.(1984-1986)CGC>TGC	p.R662C		NM_005932	NP_005923	Q99797	MIPEP_HUMAN	mitochondrial intermediate peptidase precursor	662					protein processing involved in protein targeting to mitochondrion|proteolysis	mitochondrial matrix	metal ion binding|metalloendopeptidase activity			central_nervous_system(1)	1		all_cancers(29;1.83e-22)|all_epithelial(30;8.75e-19)|all_lung(29;9.17e-18)|Lung SC(185;0.0225)|Breast(139;0.14)		all cancers(112;0.00389)|Epithelial(112;0.0266)|OV - Ovarian serous cystadenocarcinoma(117;0.0717)|Lung(94;0.207)|GBM - Glioblastoma multiforme(144;0.232)		CTGCGATAGCGCTCCCCGGCA	0.517													12	156	---	---	---	---	capture	Missense_Mutation	SNP	24330744	24330744	MIPEP	13	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	9504	221
FMN1	342184	broad.mit.edu	37	15	33359642	33359642	+	Silent	SNP	A	G	G			TCGA-28-5214-01	TCGA-28-5214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:33359642A>G	uc001zhf.3	-	1	444	c.444T>C	c.(442-444)TCT>TCC	p.S148S	FMN1_uc001zhg.2_Silent_p.S148S	NM_001103184	NP_001096654	Q68DA7	FMN1_HUMAN	formin 1	Error:Variant_position_missing_in_Q68DA7_after_alignment					actin cytoskeleton organization	actin cytoskeleton|adherens junction|cytoplasm|nucleus	actin binding			ovary(1)	1		all_lung(180;1.14e-07)		all cancers(64;3.05e-15)|Epithelial(43;1.67e-10)|GBM - Glioblastoma multiforme(186;4.95e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0262)		CATCAGAGTCAGAATCACTGG	0.522													44	109	---	---	---	---	capture	Silent	SNP	33359642	33359642	FMN1	15	A	G	G	G	1	0	0	0	0	0	0	0	1	80	7	3	3	5893	221
SPATA5L1	79029	broad.mit.edu	37	15	45709546	45709546	+	Silent	SNP	A	G	G			TCGA-28-5214-01	TCGA-28-5214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:45709546A>G	uc001zve.2	+	6	2026	c.1917A>G	c.(1915-1917)TTA>TTG	p.L639L	SPATA5L1_uc001zvf.2_RNA	NM_024063	NP_076968	Q9BVQ7	SPA5L_HUMAN	spermatogenesis associated 5-like 1	639						cytoplasm	ATP binding|nucleoside-triphosphatase activity			ovary(3)|skin(1)	4		Lung NSC(122;8.3e-05)|all_lung(180;0.000547)|Melanoma(134;0.0417)		all cancers(107;7.31e-17)|GBM - Glioblastoma multiforme(94;6.28e-07)		CTGCTTTGTTACGACCTGGAA	0.393													3	190	---	---	---	---	capture	Silent	SNP	45709546	45709546	SPATA5L1	15	A	G	G	G	1	0	0	0	0	0	0	0	1	180	14	3	3	14904	221
VPS13C	54832	broad.mit.edu	37	15	62182532	62182532	+	Missense_Mutation	SNP	C	T	T	rs150364963		TCGA-28-5214-01	TCGA-28-5214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:62182532C>T	uc002agz.2	-	67	9247	c.9173G>A	c.(9172-9174)CGC>CAC	p.R3058H	VPS13C_uc002aha.2_Missense_Mutation_p.R3015H|VPS13C_uc002ahb.1_Missense_Mutation_p.R3058H|VPS13C_uc002ahc.1_Missense_Mutation_p.R3015H	NM_020821	NP_065872	Q709C8	VP13C_HUMAN	vacuolar protein sorting 13C protein isoform 2A	3058					protein localization					ovary(2)	2						AACTCTCTGGCGCCCATCCAG	0.443													32	89	---	---	---	---	capture	Missense_Mutation	SNP	62182532	62182532	VPS13C	15	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	17073	221
NR2F2	7026	broad.mit.edu	37	15	96877739	96877739	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5214-01	TCGA-28-5214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:96877739C>T	uc010uri.1	+	2	2101	c.877C>T	c.(877-879)CGG>TGG	p.R293W	NR2F2_uc002btp.2_Missense_Mutation_p.R160W|NR2F2_uc010urj.1_Missense_Mutation_p.R140W|NR2F2_uc010urk.1_Missense_Mutation_p.R140W	NM_021005	NP_066285	P24468	COT2_HUMAN	nuclear receptor subfamily 2, group F, member 2	293	Interaction with ZFPM2 (By similarity).|Ligand-binding (By similarity).				lipid metabolic process|negative regulation of cyclin-dependent protein kinase activity|negative regulation of endothelial cell migration|negative regulation of endothelial cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|regulation of transcription involved in lymphatic endothelial cell fate commitment	nucleus	ligand-regulated transcription factor activity|protein homodimerization activity|retinoic acid binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|transcription corepressor activity|zinc ion binding			ovary(2)|breast(1)	3	Lung NSC(78;0.0186)|Melanoma(26;0.0195)|all_lung(78;0.0297)		OV - Ovarian serous cystadenocarcinoma(32;0.0856)			GGACCACATACGGATCTTCCA	0.627													26	46	---	---	---	---	capture	Missense_Mutation	SNP	96877739	96877739	NR2F2	15	C	T	T	T	1	0	0	0	0	1	0	0	0	243	19	1	1	10535	221
FOXN1	8456	broad.mit.edu	37	17	26864328	26864328	+	Silent	SNP	A	C	C			TCGA-28-5214-01	TCGA-28-5214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:26864328A>C	uc010crm.2	+	9	2019	c.1821A>C	c.(1819-1821)GCA>GCC	p.A607A	FOXN1_uc002hbj.2_Silent_p.A607A	NM_003593	NP_003584	O15353	FOXN1_HUMAN	forkhead box N1	607					defense response|embryo development|epithelial cell proliferation|keratinocyte differentiation|organ morphogenesis|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|regulation of transcription from RNA polymerase II promoter|thymus development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			skin(1)	1	Lung NSC(42;0.00431)					GCTCCGGGGCACTGGGTGACC	0.687													24	46	---	---	---	---	capture	Silent	SNP	26864328	26864328	FOXN1	17	A	C	C	C	1	0	0	0	0	0	0	0	1	67	6	4	4	5963	221
GJC1	10052	broad.mit.edu	37	17	42882434	42882434	+	Missense_Mutation	SNP	A	G	G			TCGA-28-5214-01	TCGA-28-5214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:42882434A>G	uc002ihj.2	-	2	1263	c.752T>C	c.(751-753)CTT>CCT	p.L251P	GJC1_uc002ihk.2_Missense_Mutation_p.L251P|GJC1_uc002ihl.2_Missense_Mutation_p.L251P|GJC1_uc010czx.2_Missense_Mutation_p.L251P|GJC1_uc010czy.1_Missense_Mutation_p.L112P	NM_005497	NP_005488	P36383	CXG1_HUMAN	connexin 45	251	Cytoplasmic (Potential).				cellular membrane organization|gap junction assembly|muscle contraction|synaptic transmission|transport	connexon complex|integral to membrane					0		Prostate(33;0.0959)				CCCTAAATGAAGCATCTCCCA	0.413													100	317	---	---	---	---	capture	Missense_Mutation	SNP	42882434	42882434	GJC1	17	A	G	G	G	1	0	0	0	0	1	0	0	0	39	3	3	3	6351	221
MC4R	4160	broad.mit.edu	37	18	58039563	58039563	+	Missense_Mutation	SNP	C	T	T	rs142837166		TCGA-28-5214-01	TCGA-28-5214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:58039563C>T	uc002lie.1	-	1	439	c.20G>A	c.(19-21)CGT>CAT	p.R7H		NM_005912	NP_005903	P32245	MC4R_HUMAN	melanocortin 4 receptor	7	Extracellular (Potential).				feeding behavior|G-protein signaling, coupled to cAMP nucleotide second messenger|positive regulation of bone resorption|positive regulation of cAMP biosynthetic process	integral to membrane|plasma membrane	melanocyte-stimulating hormone receptor activity|neuropeptide binding|ubiquitin protein ligase binding			lung(1)	1		Colorectal(73;0.0946)				GTGCATCCCACGGTGGGTGGA	0.537													38	70	---	---	---	---	capture	Missense_Mutation	SNP	58039563	58039563	MC4R	18	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	9279	221
HDGFRP2	84717	broad.mit.edu	37	19	4475292	4475292	+	Silent	SNP	C	T	T			TCGA-28-5214-01	TCGA-28-5214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:4475292C>T	uc002mao.2	+	2	186	c.93C>T	c.(91-93)GGC>GGT	p.G31G	HDGFRP2_uc002map.2_Silent_p.G31G|HDGFRP2_uc010dtz.1_5'Flank	NM_001001520	NP_001001520	Q7Z4V5	HDGR2_HUMAN	hepatoma-derived growth factor-related protein 2	31	PWWP.				transcription, DNA-dependent	nucleus	DNA binding|protein binding				0						TCGCGGATGGCGCCGTGAAGC	0.562													14	106	---	---	---	---	capture	Silent	SNP	4475292	4475292	HDGFRP2	19	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	6947	221
ZNF564	163050	broad.mit.edu	37	19	12638084	12638084	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5214-01	TCGA-28-5214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:12638084G>A	uc002mty.2	-	4	1048	c.838C>T	c.(838-840)CCC>TCC	p.P280S	ZNF709_uc002mtx.3_Intron	NM_144976	NP_659413	Q8TBZ8	ZN564_HUMAN	zinc finger protein 564	280					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						CATTCATGGGGTTTCTCTCCA	0.403													35	193	---	---	---	---	capture	Missense_Mutation	SNP	12638084	12638084	ZNF564	19	G	A	A	A	1	0	0	0	0	1	0	0	0	572	44	2	2	17874	221
CCDC123	84902	broad.mit.edu	37	19	33406291	33406291	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5214-01	TCGA-28-5214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:33406291C>T	uc002nty.2	-	14	1606	c.1517G>A	c.(1516-1518)GGC>GAC	p.G506D	CCDC123_uc002ntx.2_Missense_Mutation_p.G259D|CCDC123_uc010edg.2_RNA|CCDC123_uc002ntz.1_Missense_Mutation_p.G505D	NM_032816	NP_116205	Q96ST8	CEP89_HUMAN	coiled-coil domain containing 123	506	Potential.					centrosome|spindle pole					0	Esophageal squamous(110;0.137)					TGCGATTTTGCCATCCGAGTG	0.358													5	336	---	---	---	---	capture	Missense_Mutation	SNP	33406291	33406291	CCDC123	19	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	2733	221
PSG9	5678	broad.mit.edu	37	19	43762524	43762524	+	Missense_Mutation	SNP	G	C	C			TCGA-28-5214-01	TCGA-28-5214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:43762524G>C	uc002owd.3	-	5	1172	c.1073C>G	c.(1072-1074)TCT>TGT	p.S358C	PSG9_uc002owe.3_Missense_Mutation_p.S265C|PSG9_uc010xwm.1_Missense_Mutation_p.S265C|PSG9_uc002owf.3_Missense_Mutation_p.S172C|PSG9_uc002owg.2_Missense_Mutation_p.S265C|PSG9_uc002owh.2_Missense_Mutation_p.S172C	NM_002784	NP_002775	Q00887	PSG9_HUMAN	pregnancy specific beta-1-glycoprotein 9	358	Ig-like C2-type 3.				female pregnancy	extracellular region				ovary(1)|skin(1)	2		Prostate(69;0.00682)				CGGTGGGTTAGATTCCGTGAA	0.448													34	675	---	---	---	---	capture	Missense_Mutation	SNP	43762524	43762524	PSG9	19	G	C	C	C	1	0	0	0	0	1	0	0	0	429	33	4	4	12557	221
SYNGR4	23546	broad.mit.edu	37	19	48878966	48878966	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5214-01	TCGA-28-5214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:48878966C>T	uc002piz.2	+	4	673	c.428C>T	c.(427-429)GCC>GTC	p.A143V		NM_012451	NP_036583	O95473	SNG4_HUMAN	synaptogyrin 4	143	MARVEL.					integral to membrane					0		all_epithelial(76;5.08e-07)|all_lung(116;5.76e-06)|Lung NSC(112;1.18e-05)|Prostate(7;0.0143)|all_neural(266;0.0189)|Ovarian(192;0.0261)|Breast(70;0.203)		OV - Ovarian serous cystadenocarcinoma(262;0.000138)|all cancers(93;0.00017)|Epithelial(262;0.0138)|GBM - Glioblastoma multiforme(486;0.0146)		AGCAGCAGTGCCCAGGCAGCC	0.612													52	195	---	---	---	---	capture	Missense_Mutation	SNP	48878966	48878966	SYNGR4	19	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	15339	221
LILRA1	11024	broad.mit.edu	37	19	55106242	55106242	+	Silent	SNP	T	C	C			TCGA-28-5214-01	TCGA-28-5214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:55106242T>C	uc002qgh.1	+	4	365	c.183T>C	c.(181-183)TAT>TAC	p.Y61Y	LILRA2_uc010yfg.1_Intron|LILRA1_uc010yfh.1_Silent_p.Y61Y	NM_006863	NP_006854	O75019	LIRA1_HUMAN	leukocyte immunoglobulin-like receptor,	61	Ig-like C2-type 1.|Extracellular (Potential).				cell surface receptor linked signaling pathway|defense response|regulation of immune response	integral to membrane|plasma membrane	antigen binding|transmembrane receptor activity			skin(2)|ovary(1)	3				GBM - Glioblastoma multiforme(193;0.0348)		ACCGTCTGTATAGAGAAAAGA	0.577													80	213	---	---	---	---	capture	Silent	SNP	55106242	55106242	LILRA1	19	T	C	C	C	1	0	0	0	0	0	0	0	1	634	49	3	3	8704	221
POLR1A	25885	broad.mit.edu	37	2	86272753	86272753	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5214-01	TCGA-28-5214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:86272753C>T	uc002sqs.2	-	20	3252	c.2873G>A	c.(2872-2874)GGC>GAC	p.G958D	POLR1A_uc010ytb.1_Missense_Mutation_p.G324D|POLR1A_uc002sqt.1_5'Flank	NM_015425	NP_056240	O95602	RPA1_HUMAN	DNA-directed RNA polymerase I A	958					termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription initiation from RNA polymerase I promoter	DNA-directed RNA polymerase I complex|nucleoplasm	DNA binding|DNA-directed RNA polymerase activity|protein binding|zinc ion binding			ovary(2)|skin(1)	3						AGGTTTGATGCCGGTGAGGAA	0.512													5	189	---	---	---	---	capture	Missense_Mutation	SNP	86272753	86272753	POLR1A	2	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	12112	221
PCDP1	200373	broad.mit.edu	37	2	120385285	120385285	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5214-01	TCGA-28-5214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:120385285C>T	uc002tmb.2	+	17	1807	c.715C>T	c.(715-717)CGG>TGG	p.R239W	PCDP1_uc010yyq.1_Missense_Mutation_p.R369W	NM_001029996	NP_001025167	Q4G0U5	PCDP1_HUMAN	primary ciliary dyskinesia protein 1	525						cilium	calmodulin binding				0	Colorectal(110;0.196)					TTATACCAGCCGGTTCTCTGT	0.537													118	185	---	---	---	---	capture	Missense_Mutation	SNP	120385285	120385285	PCDP1	2	C	T	T	T	1	0	0	0	0	1	0	0	0	295	23	1	1	11475	221
ZNF142	7701	broad.mit.edu	37	2	219503257	219503257	+	Silent	SNP	G	A	A			TCGA-28-5214-01	TCGA-28-5214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:219503257G>A	uc002vin.2	-	10	5305	c.4869C>T	c.(4867-4869)TGC>TGT	p.C1623C	ZNF142_uc002vil.2_Silent_p.C1584C|ZNF142_uc010fvt.2_Silent_p.C1460C|ZNF142_uc002vim.2_Silent_p.C1460C	NM_001105537	NP_001099007	P52746	ZN142_HUMAN	zinc finger protein 142	1623	C2H2-type 31.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(2)|ovary(1)|skin(1)	4		Renal(207;0.0474)		Epithelial(149;5.21e-07)|all cancers(144;0.000106)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)		TGCAGAGGCGGCAAAAGAAGG	0.607													4	111	---	---	---	---	capture	Silent	SNP	219503257	219503257	ZNF142	2	G	A	A	A	1	0	0	0	0	0	0	0	1	542	42	2	2	17611	221
ISM1	140862	broad.mit.edu	37	20	13279761	13279761	+	Silent	SNP	C	T	T			TCGA-28-5214-01	TCGA-28-5214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:13279761C>T	uc010gce.1	+	6	1056	c.1050C>T	c.(1048-1050)GAC>GAT	p.D350D	TASP1_uc010zri.1_Intron	NM_080826	NP_543016	B1AKI9	ISM1_HUMAN	isthmin 1 homolog precursor	350	AMOP.					extracellular region					0						GCTGGAAGGACGCCAGCGGGC	0.647													4	37	---	---	---	---	capture	Silent	SNP	13279761	13279761	ISM1	20	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	7783	221
ZBTB46	140685	broad.mit.edu	37	20	62421878	62421878	+	Missense_Mutation	SNP	A	C	C			TCGA-28-5214-01	TCGA-28-5214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:62421878A>C	uc002ygv.1	-	2	434	c.233T>G	c.(232-234)GTC>GGC	p.V78G	ZBTB46_uc002ygu.2_RNA	NM_025224	NP_079500	Q86UZ6	ZBT46_HUMAN	zinc finger and BTB domain containing 46	78	BTB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding|zinc ion binding			large_intestine(1)|ovary(1)	2	all_cancers(38;2.09e-12)|all_epithelial(29;3.8e-14)|Lung NSC(23;7.61e-10)|all_lung(23;2.64e-09)					CTGGGCCGTGACGATGTCCAG	0.612													4	111	---	---	---	---	capture	Missense_Mutation	SNP	62421878	62421878	ZBTB46	20	A	C	C	C	1	0	0	0	0	1	0	0	0	130	10	4	4	17427	221
SCN11A	11280	broad.mit.edu	37	3	38892224	38892224	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5214-01	TCGA-28-5214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:38892224C>T	uc011ays.1	-	25	4274	c.4075G>A	c.(4075-4077)GTG>ATG	p.V1359M	SCN11A_uc003cis.1_Missense_Mutation_p.V24M	NM_014139	NP_054858	Q9UI33	SCNBA_HUMAN	sodium channel, voltage-gated, type XI, alpha	1359					response to drug	voltage-gated sodium channel complex	voltage-gated sodium channel activity			skin(6)|ovary(1)|haematopoietic_and_lymphoid_tissue(1)|pancreas(1)	9				Kidney(284;0.00202)|KIRC - Kidney renal clear cell carcinoma(284;0.00226)	Cocaine(DB00907)	ATGTCGAACACGAGACCTTGA	0.308													46	101	---	---	---	---	capture	Missense_Mutation	SNP	38892224	38892224	SCN11A	3	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	13806	221
GPR128	84873	broad.mit.edu	37	3	100349573	100349573	+	Missense_Mutation	SNP	A	G	G			TCGA-28-5214-01	TCGA-28-5214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:100349573A>G	uc003duc.2	+	3	522	c.254A>G	c.(253-255)TAT>TGT	p.Y85C		NM_032787	NP_116176	Q96K78	GP128_HUMAN	G protein-coupled receptor 128 precursor	85	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(3)|skin(1)	4						AATAGTACCTATATGGGTTTT	0.318													47	59	---	---	---	---	capture	Missense_Mutation	SNP	100349573	100349573	GPR128	3	A	G	G	G	1	0	0	0	0	1	0	0	0	208	16	3	3	6575	221
EPHB1	2047	broad.mit.edu	37	3	134898744	134898744	+	Missense_Mutation	SNP	A	G	G			TCGA-28-5214-01	TCGA-28-5214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:134898744A>G	uc003eqt.2	+	10	2022	c.1802A>G	c.(1801-1803)GAG>GGG	p.E601G	EPHB1_uc003equ.2_Missense_Mutation_p.E162G	NM_004441	NP_004432	P54762	EPHB1_HUMAN	ephrin receptor EphB1 precursor	601	Cytoplasmic (Potential).					integral to plasma membrane	ATP binding|ephrin receptor activity|protein binding			lung(11)|ovary(6)|stomach(4)|breast(3)|central_nervous_system(2)|skin(2)|large_intestine(1)|pancreas(1)	30						TTCACTTACGAGGATCCCAAC	0.483													4	312	---	---	---	---	capture	Missense_Mutation	SNP	134898744	134898744	EPHB1	3	A	G	G	G	1	0	0	0	0	1	0	0	0	143	11	3	3	5129	221
CORIN	10699	broad.mit.edu	37	4	47679958	47679958	+	Missense_Mutation	SNP	C	T	T	rs149563697	byFrequency	TCGA-28-5214-01	TCGA-28-5214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:47679958C>T	uc003gxm.2	-	9	1339	c.1246G>A	c.(1246-1248)GTC>ATC	p.V416I	CORIN_uc011bzf.1_Missense_Mutation_p.V277I|CORIN_uc011bzg.1_Missense_Mutation_p.V349I|CORIN_uc011bzh.1_Missense_Mutation_p.V379I|CORIN_uc011bzi.1_Missense_Mutation_p.V379I	NM_006587	NP_006578	Q9Y5Q5	CORIN_HUMAN	corin	416	Extracellular (Potential).				peptide hormone processing|regulation of systemic arterial blood pressure by atrial natriuretic peptide	integral to membrane|plasma membrane	scavenger receptor activity|serine-type endopeptidase activity|serine-type exopeptidase activity			ovary(1)|central_nervous_system(1)	2						CACTTACTGACGCTGCAGTTC	0.493													38	68	---	---	---	---	capture	Missense_Mutation	SNP	47679958	47679958	CORIN	4	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	3717	221
UGT2B15	7366	broad.mit.edu	37	4	69536075	69536075	+	Missense_Mutation	SNP	C	A	A			TCGA-28-5214-01	TCGA-28-5214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:69536075C>A	uc011cal.1	-	1	300	c.262G>T	c.(262-264)GAT>TAT	p.D88Y		NM_001076	NP_001067	P54855	UDB15_HUMAN	UDP glycosyltransferase 2B15 precursor	88					steroid metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity				0						AGAAGAGAATCTTCCAAATAA	0.294													108	171	---	---	---	---	capture	Missense_Mutation	SNP	69536075	69536075	UGT2B15	4	C	A	A	A	1	0	0	0	0	1	0	0	0	416	32	4	4	16840	221
UGT2B10	7365	broad.mit.edu	37	4	69870669	69870669	+	Missense_Mutation	SNP	C	A	A			TCGA-28-5214-01	TCGA-28-5214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:69870669C>A	uc011cao.1	-	9	1517	c.1381G>T	c.(1381-1383)GCT>TCT	p.A461S	UGT2B10_uc011can.1_Missense_Mutation_p.A377S			P36537	UDB10_HUMAN	RecName: Full=UDP-glucuronosyltransferase 2B28;          Short=UDPGT 2B28;          EC=2.4.1.17; Flags: Precursor;	498	Helical; (Potential).				lipid metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity			skin(3)|ovary(2)	5						GCCACACAGGCCAGCAGGAAC	0.448													11	227	---	---	---	---	capture	Missense_Mutation	SNP	69870669	69870669	UGT2B10	4	C	A	A	A	1	0	0	0	0	1	0	0	0	338	26	4	4	16838	221
WDFY3	23001	broad.mit.edu	37	4	85611704	85611704	+	Missense_Mutation	SNP	C	G	G			TCGA-28-5214-01	TCGA-28-5214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:85611704C>G	uc003hpd.2	-	61	9726	c.9318G>C	c.(9316-9318)GAG>GAC	p.E3106D		NM_014991	NP_055806	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3 isoform	3106	WD 1.					cytoplasmic part|extrinsic to membrane|nuclear envelope	1-phosphatidylinositol binding|metal ion binding|protein binding			ovary(2)|central_nervous_system(1)	3		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		AGGTGCCCATCTCCCACACAC	0.517													9	143	---	---	---	---	capture	Missense_Mutation	SNP	85611704	85611704	WDFY3	4	C	G	G	G	1	0	0	0	0	1	0	0	0	415	32	4	4	17151	221
FSTL5	56884	broad.mit.edu	37	4	162577555	162577555	+	Silent	SNP	T	C	C			TCGA-28-5214-01	TCGA-28-5214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:162577555T>C	uc003iqh.2	-	7	1255	c.819A>G	c.(817-819)CAA>CAG	p.Q273Q	FSTL5_uc003iqi.2_Silent_p.Q272Q|FSTL5_uc010iqv.2_Silent_p.Q272Q	NM_020116	NP_064501	Q8N475	FSTL5_HUMAN	follistatin-like 5 isoform a	273	Ig-like 1.					extracellular region	calcium ion binding			ovary(2)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|skin(1)	8	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.179)		TCAGGGTTCCTTGAATGGCAC	0.388													35	96	---	---	---	---	capture	Silent	SNP	162577555	162577555	FSTL5	4	T	C	C	C	1	0	0	0	0	0	0	0	1	725	56	3	3	6022	221
CDH9	1007	broad.mit.edu	37	5	26988213	26988213	+	Missense_Mutation	SNP	C	G	G			TCGA-28-5214-01	TCGA-28-5214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:26988213C>G	uc003jgs.1	-	2	397	c.228G>C	c.(226-228)AAG>AAC	p.K76N	CDH9_uc010iug.2_Missense_Mutation_p.K76N	NM_016279	NP_057363	Q9ULB4	CADH9_HUMAN	cadherin 9, type 2 preproprotein	76	Extracellular (Potential).|Cadherin 1.				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(5)|skin(2)|upper_aerodigestive_tract(1)|haematopoietic_and_lymphoid_tissue(1)	9						AAATTCTTACCTTGCCTACAT	0.348													14	37	---	---	---	---	capture	Missense_Mutation	SNP	26988213	26988213	CDH9	5	C	G	G	G	1	0	0	0	0	1	0	0	0	311	24	4	4	3088	221
C5orf48	389320	broad.mit.edu	37	5	125971812	125971812	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5214-01	TCGA-28-5214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:125971812G>A	uc003kub.1	+	3	297	c.284G>A	c.(283-285)CGT>CAT	p.R95H		NM_207408	NP_997291	Q6ZNM6	CE048_HUMAN	hypothetical protein LOC389320	95										ovary(1)	1						GGGGAAGATCGTAAAGTTGTC	0.443													25	314	---	---	---	---	capture	Missense_Mutation	SNP	125971812	125971812	C5orf48	5	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	2283	221
PCDHGA9	56107	broad.mit.edu	37	5	140783915	140783915	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5214-01	TCGA-28-5214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140783915G>A	uc003lkh.1	+	1	1396	c.1396G>A	c.(1396-1398)GCC>ACC	p.A466T	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc003lkf.1_Intron|PCDHGA9_uc011dax.1_Missense_Mutation_p.A466T	NM_018921	NP_061744	Q9Y5G4	PCDG9_HUMAN	protocadherin gamma subfamily A, 9 isoform 1	466	Extracellular (Potential).|Cadherin 5.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGAAAACAACGCCAGAGGTAC	0.468													33	71	---	---	---	---	capture	Missense_Mutation	SNP	140783915	140783915	PCDHGA9	5	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	11464	221
GRIA1	2890	broad.mit.edu	37	5	153149798	153149798	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5214-01	TCGA-28-5214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:153149798G>A	uc003lva.3	+	13	2458	c.2093G>A	c.(2092-2094)CGG>CAG	p.R698Q	GRIA1_uc003luy.3_Missense_Mutation_p.R698Q|GRIA1_uc003luz.3_Missense_Mutation_p.R603Q|GRIA1_uc011dcv.1_RNA|GRIA1_uc011dcw.1_Missense_Mutation_p.R618Q|GRIA1_uc011dcx.1_Missense_Mutation_p.R629Q|GRIA1_uc011dcy.1_Missense_Mutation_p.R708Q|GRIA1_uc011dcz.1_Missense_Mutation_p.R708Q	NM_001114183	NP_001107655	P42261	GRIA1_HUMAN	glutamate receptor, ionotropic, AMPA 1 isoform	698	Extracellular (Potential).				synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|cell junction|dendritic spine|endocytic vesicle membrane|endoplasmic reticulum membrane|neuronal cell body|postsynaptic density|postsynaptic membrane	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity|PDZ domain binding			ovary(4)|skin(2)	6		Medulloblastoma(196;0.0391)|all_neural(177;0.16)|all_hematologic(541;0.21)	Kidney(363;0.000173)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		Desflurane(DB01189)|Enflurane(DB00228)|Halothane(DB01159)|Isoflurane(DB00753)|L-Glutamic Acid(DB00142)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)	GTTTTTGTGCGGACCACAGAG	0.468													4	175	---	---	---	---	capture	Missense_Mutation	SNP	153149798	153149798	GRIA1	5	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	6700	221
RNF130	55819	broad.mit.edu	37	5	179393829	179393829	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5214-01	TCGA-28-5214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:179393829C>T	uc003mll.1	-	7	1534	c.1127G>A	c.(1126-1128)GGA>GAA	p.G376E	RNF130_uc003mlm.1_Missense_Mutation_p.G376E	NM_018434	NP_060904	Q86XS8	GOLI_HUMAN	ring finger protein 130 precursor	376	Cytoplasmic (Potential).				apoptosis	cytoplasm|integral to membrane|nucleus	ubiquitin-protein ligase activity|zinc ion binding			lung(2)|ovary(1)	3	all_cancers(89;5.49e-05)|all_epithelial(37;1.94e-05)|Renal(175;0.000159)|Lung NSC(126;0.00118)|all_lung(126;0.00212)	all_cancers(40;0.0294)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GTTGATTTCTCCTGTTCTCGG	0.587													26	51	---	---	---	---	capture	Missense_Mutation	SNP	179393829	179393829	RNF130	5	C	T	T	T	1	0	0	0	0	1	0	0	0	390	30	2	2	13330	221
HIVEP1	3096	broad.mit.edu	37	6	12123451	12123451	+	Silent	SNP	C	T	T			TCGA-28-5214-01	TCGA-28-5214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:12123451C>T	uc003nac.2	+	4	3602	c.3423C>T	c.(3421-3423)TCC>TCT	p.S1141S	HIVEP1_uc011diq.1_RNA	NM_002114	NP_002105	P15822	ZEP1_HUMAN	human immunodeficiency virus type I enhancer	1141					transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|protein binding|zinc ion binding			ovary(3)|large_intestine(1)|central_nervous_system(1)|skin(1)	6	Breast(50;0.0639)|Ovarian(93;0.0816)	all_hematologic(90;0.117)				ACACCAACTCCCTGAGCAGGC	0.507													52	93	---	---	---	---	capture	Silent	SNP	12123451	12123451	HIVEP1	6	C	T	T	T	1	0	0	0	0	0	0	0	1	275	22	2	2	7111	221
PGK2	5232	broad.mit.edu	37	6	49754388	49754388	+	Silent	SNP	G	A	A	rs147140024	byFrequency	TCGA-28-5214-01	TCGA-28-5214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:49754388G>A	uc003ozu.2	-	1	620	c.513C>T	c.(511-513)CGC>CGT	p.R171R		NM_138733	NP_620061	P07205	PGK2_HUMAN	phosphoglycerate kinase 2	171		Substrate (By similarity).			glycolysis	cytosol	ATP binding|phosphoglycerate kinase activity			ovary(1)	1	Lung NSC(77;0.0402)					AACTATGAGCGCGGTGTGCAG	0.458													54	120	---	---	---	---	capture	Silent	SNP	49754388	49754388	PGK2	6	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	11694	221
INHBA	3624	broad.mit.edu	37	7	41729925	41729925	+	Missense_Mutation	SNP	T	A	A			TCGA-28-5214-01	TCGA-28-5214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:41729925T>A	uc003thq.2	-	2	839	c.604A>T	c.(604-606)AGT>TGT	p.S202C	INHBA_uc003thr.2_Missense_Mutation_p.S202C	NM_002192	NP_002183	P08476	INHBA_HUMAN	inhibin beta A precursor	202					cell cycle arrest|cell surface receptor linked signaling pathway|defense response|erythrocyte differentiation|eyelid development in camera-type eye|G1/S transition of mitotic cell cycle|growth|hair follicle development|hemoglobin biosynthetic process|hemopoietic progenitor cell differentiation|induction of apoptosis|male gonad development|negative regulation of B cell differentiation|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of follicle-stimulating hormone secretion|negative regulation of interferon-gamma biosynthetic process|negative regulation of macrophage differentiation|negative regulation of phosphorylation|nervous system development|odontogenesis|ovarian follicle development|palate development|positive regulation of erythrocyte differentiation|positive regulation of follicle-stimulating hormone secretion|positive regulation of ovulation|positive regulation of transcription from RNA polymerase II promoter|progesterone secretion|regulation of activin receptor signaling pathway	activin A complex|inhibin A complex	cytokine activity|follistatin binding|growth factor activity|hormone activity|identical protein binding|signal transducer activity			lung(5)|ovary(1)	6						AACAGTTCACTCCTCTCCCCC	0.582										TSP Lung(11;0.080)			34	120	---	---	---	---	capture	Missense_Mutation	SNP	41729925	41729925	INHBA	7	T	A	A	A	1	0	0	0	0	1	0	0	0	702	54	4	4	7664	221
TMEM120A	83862	broad.mit.edu	37	7	75617603	75617603	+	Missense_Mutation	SNP	A	C	C			TCGA-28-5214-01	TCGA-28-5214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:75617603A>C	uc003ued.2	-	7	634	c.530T>G	c.(529-531)ATC>AGC	p.I177S	TMEM120A_uc003uee.2_Missense_Mutation_p.I81S|TMEM120A_uc003ueb.1_5'Flank|TMEM120A_uc003uec.2_Missense_Mutation_p.I81S	NM_031925	NP_114131	Q9BXJ8	T120A_HUMAN	transmembrane protein 120A	177	Helical; (Potential).					integral to membrane					0						GCTCTCCCGGATGGTCAGGGT	0.652													21	115	---	---	---	---	capture	Missense_Mutation	SNP	75617603	75617603	TMEM120A	7	A	C	C	C	1	0	0	0	0	1	0	0	0	156	12	4	4	15918	221
SMURF1	57154	broad.mit.edu	37	7	98636012	98636012	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5214-01	TCGA-28-5214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:98636012G>A	uc003upu.1	-	15	2085	c.1765C>T	c.(1765-1767)CGG>TGG	p.R589W	SMURF1_uc003upv.1_Missense_Mutation_p.R563W|SMURF1_uc003upt.2_Missense_Mutation_p.R563W	NM_020429	NP_065162	Q9HCE7	SMUF1_HUMAN	Smad ubiquitination regulatory factor 1 isoform	589	HECT.				BMP signaling pathway|cell differentiation|ectoderm development|negative regulation of BMP signaling pathway|negative regulation of transforming growth factor beta receptor signaling pathway|positive regulation of protein ubiquitination|proteasomal ubiquitin-dependent protein catabolic process|protein export from nucleus|protein localization at cell surface|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|receptor catabolic process|transforming growth factor beta receptor signaling pathway|ubiquitin-dependent SMAD protein catabolic process	cytosol|plasma membrane	activin binding|I-SMAD binding|R-SMAD binding|ubiquitin-protein ligase activity			skin(2)|ovary(1)|lung(1)	4	all_cancers(62;1.05e-08)|all_epithelial(64;4.34e-09)|Lung NSC(181;0.00902)|all_lung(186;0.0145)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)|Lung(104;0.224)			TGGCATTACCGGACGTATTCT	0.577													32	100	---	---	---	---	capture	Missense_Mutation	SNP	98636012	98636012	SMURF1	7	G	A	A	A	1	0	0	0	0	1	0	0	0	506	39	1	1	14711	221
PIK3CG	5294	broad.mit.edu	37	7	106509059	106509059	+	Silent	SNP	C	T	T			TCGA-28-5214-01	TCGA-28-5214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:106509059C>T	uc003vdv.3	+	2	1138	c.1053C>T	c.(1051-1053)ACC>ACT	p.T351T	PIK3CG_uc003vdu.2_Silent_p.T351T|PIK3CG_uc003vdw.2_Silent_p.T351T	NM_002649	NP_002640	P48736	PK3CG_HUMAN	phosphoinositide-3-kinase, catalytic, gamma	351					G-protein coupled receptor protein signaling pathway|phosphatidylinositol-mediated signaling|platelet activation	phosphatidylinositol 3-kinase complex	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity|protein binding			lung(16)|central_nervous_system(8)|breast(5)|pancreas(3)|stomach(2)|ovary(2)|upper_aerodigestive_tract(1)|skin(1)	38						GTGTGTTCACCGTGTCCCTGT	0.572													66	241	---	---	---	---	capture	Silent	SNP	106509059	106509059	PIK3CG	7	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	11819	221
PRSS1	5644	broad.mit.edu	37	7	142460295	142460295	+	Silent	SNP	C	T	T	rs146076691		TCGA-28-5214-01	TCGA-28-5214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:142460295C>T	uc003wak.2	+	4	485	c.468C>T	c.(466-468)GAC>GAT	p.D156D	uc011krr.1_Intron|uc003vzp.2_Intron|uc011ksh.1_Intron|uc011ksi.1_Intron|uc003vzw.1_Intron|uc010loj.1_Intron|uc003wad.2_Intron|uc003wag.1_Intron|TRY6_uc011ksn.1_Intron|PRSS1_uc003wam.2_Silent_p.D96D	NM_002769	NP_002760	P07477	TRY1_HUMAN	protease, serine, 1 preproprotein	156	Peptidase S1.				digestion|proteolysis	extracellular space	metal ion binding|protein binding|serine-type endopeptidase activity			large_intestine(1)|central_nervous_system(1)	2	Melanoma(164;0.047)	all_cancers(3;2.14e-49)|Acute lymphoblastic leukemia(3;7.3e-185)|all_hematologic(3;1.1e-165)	all cancers(2;0.000126)|Colorectal(2;0.000157)|Epithelial(2;0.000191)|COAD - Colon adenocarcinoma(2;0.00189)			ACTACCCAGACGAGCTGCAGT	0.507									Hereditary_Pancreatitis				102	761	---	---	---	---	capture	Silent	SNP	142460295	142460295	PRSS1	7	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	12509	221
TRAPPC9	83696	broad.mit.edu	37	8	141310662	141310662	+	Silent	SNP	T	C	C			TCGA-28-5214-01	TCGA-28-5214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:141310662T>C	uc003yvj.2	-	11	1808	c.1674A>G	c.(1672-1674)AAA>AAG	p.K558K	TRAPPC9_uc003yvh.2_Silent_p.K656K|TRAPPC9_uc003yvi.1_Silent_p.K549K	NM_001160372	NP_001153844	Q96Q05	TPPC9_HUMAN	trafficking protein particle complex 9 isoform	558					cell differentiation	endoplasmic reticulum|Golgi apparatus				skin(2)	2						CCAGCAAGCTTTTCATTTTGT	0.443													4	268	---	---	---	---	capture	Silent	SNP	141310662	141310662	TRAPPC9	8	T	C	C	C	1	0	0	0	0	0	0	0	1	829	64	3	3	16348	221
LINGO2	158038	broad.mit.edu	37	9	27949565	27949565	+	Nonsense_Mutation	SNP	G	A	A			TCGA-28-5214-01	TCGA-28-5214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:27949565G>A	uc003zqu.1	-	2	1299	c.1105C>T	c.(1105-1107)CGA>TGA	p.R369*	LINGO2_uc010mjf.1_Nonsense_Mutation_p.R369*|LINGO2_uc003zqv.1_Nonsense_Mutation_p.R369*	NM_152570	NP_689783	Q7L985	LIGO2_HUMAN	leucine rich repeat and Ig domain containing 2	369	LRRCT.|Extracellular (Potential).					integral to membrane				upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	3	Melanoma(11;0.242)	all_neural(11;2.78e-09)		UCEC - Uterine corpus endometrioid carcinoma (5;0.0818)|GBM - Glioblastoma multiforme(2;1.31e-34)|all cancers(2;2.37e-25)|Lung(2;7.48e-08)|LUSC - Lung squamous cell carcinoma(38;5.09e-07)|KIRC - Kidney renal clear cell carcinoma(2;0.0465)|Kidney(2;0.0604)		GTGGGCTGTCGCTGCAAGATC	0.547													36	59	---	---	---	---	capture	Nonsense_Mutation	SNP	27949565	27949565	LINGO2	9	G	A	A	A	1	0	0	0	0	0	1	0	0	493	38	5	1	8735	221
KLF9	687	broad.mit.edu	37	9	73002796	73002796	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5214-01	TCGA-28-5214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:73002796G>A	uc004aht.2	-	2	1925	c.631C>T	c.(631-633)CGC>TGC	p.R211C		NM_001206	NP_001197	Q13886	KLF9_HUMAN	Kruppel-like factor 9	211	C2H2-type 3.				regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0						CTCATGAAGCGCTTCTCACAC	0.592													5	153	---	---	---	---	capture	Missense_Mutation	SNP	73002796	73002796	KLF9	9	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	8273	221
EPB41L4B	54566	broad.mit.edu	37	9	112015778	112015778	+	Missense_Mutation	SNP	T	C	C			TCGA-28-5214-01	TCGA-28-5214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:112015778T>C	uc004bdz.1	-	12	1517	c.1222A>G	c.(1222-1224)ACC>GCC	p.T408A	EPB41L4B_uc004bea.2_Missense_Mutation_p.T408A	NM_019114	NP_061987	Q9H329	E41LB_HUMAN	erythrocyte membrane protein band 4.1 like 4B	408						cytoplasm|cytoskeleton|extrinsic to membrane	cytoskeletal protein binding|structural constituent of cytoskeleton			ovary(1)|central_nervous_system(1)|skin(1)	3						CTCTCAAAGGTGCTGGTTCTT	0.403													91	192	---	---	---	---	capture	Missense_Mutation	SNP	112015778	112015778	EPB41L4B	9	T	C	C	C	1	0	0	0	0	1	0	0	0	767	59	3	3	5111	221
CDX4	1046	broad.mit.edu	37	X	72667327	72667327	+	Nonsense_Mutation	SNP	C	T	T			TCGA-28-5214-01	TCGA-28-5214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:72667327C>T	uc011mqk.1	+	1	238	c.238C>T	c.(238-240)CGA>TGA	p.R80*		NM_005193	NP_005184	O14627	CDX4_HUMAN	caudal type homeobox 4	80						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0	Renal(35;0.156)					CAGTCCCCCGCGAGAAGACTG	0.607													35	20	---	---	---	---	capture	Nonsense_Mutation	SNP	72667327	72667327	CDX4	23	C	T	T	T	1	0	0	0	0	0	1	0	0	347	27	5	1	3153	221
ATRX	546	broad.mit.edu	37	X	76918965	76918965	+	Silent	SNP	C	T	T			TCGA-28-5214-01	TCGA-28-5214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:76918965C>T	uc004ecp.3	-	12	4258	c.4026G>A	c.(4024-4026)CGG>CGA	p.R1342R	ATRX_uc004ecq.3_Silent_p.R1304R|ATRX_uc004eco.3_Silent_p.R1127R|ATRX_uc004ecr.2_Silent_p.R1274R	NM_000489	NP_000480	P46100	ATRX_HUMAN	transcriptional regulator ATRX isoform 1	1342					DNA methylation|DNA recombination|DNA repair|regulation of transcription, DNA-dependent	nuclear heterochromatin	ATP binding|chromo shadow domain binding|DNA binding|DNA helicase activity|zinc ion binding			haematopoietic_and_lymphoid_tissue(14)|pancreas(12)|lung(1)|breast(1)|skin(1)|kidney(1)	30					Phosphatidylserine(DB00144)	TCAATTTGTGCCGCAAAAGCC	0.363			Mis|F|N		Pancreatic neuroendocrine tumors		ATR-X (alpha thalassemia/mental retardation) syndrome						4	83	---	---	---	---	capture	Silent	SNP	76918965	76918965	ATRX	23	C	T	T	T	1	0	0	0	0	0	0	0	1	327	26	2	2	1199	221
MAGEA8	4107	broad.mit.edu	37	X	149013838	149013838	+	Silent	SNP	G	A	A			TCGA-28-5214-01	TCGA-28-5214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:149013838G>A	uc004fdw.1	+	3	1007	c.792G>A	c.(790-792)GCG>GCA	p.A264A		NM_005364	NP_005355	P43361	MAGA8_HUMAN	melanoma antigen family A, 8	264	MAGE.										0	Acute lymphoblastic leukemia(192;6.56e-05)					ACCGCCAGGCGCCCGGCAGTG	0.582													128	57	---	---	---	---	capture	Silent	SNP	149013838	149013838	MAGEA8	23	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	9085	221
IK	3550	broad.mit.edu	37	5	140033536	140033536	+	Frame_Shift_Del	DEL	G	-	-			TCGA-28-5214-01	TCGA-28-5214-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140033536delG	uc003lgq.2	+	6	528	c.418delG	c.(418-420)GCAfs	p.A140fs	IK_uc011czk.1_Frame_Shift_Del_p.A140fs	NM_006083	NP_006074	Q13123	RED_HUMAN	RED protein	140					cell-cell signaling|immune response	extracellular space|nucleus|soluble fraction				large_intestine(1)	1		all_hematologic(541;4.8e-07)|all_lung(500;0.000434)|Lung NSC(810;0.00161)|Breast(839;0.128)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CAAATCAGCTGCAGAGAAGAG	0.328													19	38	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	140033536	140033536	IK	5	G	-	-	-	1	0	1	0	1	0	0	0	0	598	46	5	5	7532	221
