Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
UBR4	23352	broad.mit.edu	37	1	19451182	19451182	+	Silent	SNP	A	G	G			TCGA-28-5215-01	TCGA-28-5215-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:19451182A>G	uc001bbi.2	-	65	9445	c.9441T>C	c.(9439-9441)GGT>GGC	p.G3147G	UBR4_uc001bbk.1_Silent_p.G794G	NM_020765	NP_065816	Q5T4S7	UBR4_HUMAN	retinoblastoma-associated factor 600	3147					interspecies interaction between organisms	cytoplasm|cytoskeleton|integral to membrane|nucleus	calmodulin binding|ubiquitin-protein ligase activity|zinc ion binding			kidney(10)|ovary(7)|breast(4)|pancreas(2)|skin(2)	25		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		CAGCAGCATGACCCTGGGAGA	0.413													3	163	---	---	---	---	capture	Silent	SNP	19451182	19451182	UBR4	1	A	G	G	G	1	0	0	0	0	0	0	0	1	119	10	3	3	16786	222
SFN	2810	broad.mit.edu	37	1	27190037	27190037	+	Missense_Mutation	SNP	G	T	T			TCGA-28-5215-01	TCGA-28-5215-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:27190037G>T	uc001bnc.1	+	1	405	c.334G>T	c.(334-336)GGG>TGG	p.G112W	uc010ofi.1_RNA	NM_006142	NP_006133	P31947	1433S_HUMAN	stratifin	112					DNA damage response, signal transduction resulting in induction of apoptosis|negative regulation of caspase activity|release of cytochrome c from mitochondria	cytoplasm|extracellular space|nucleus	protein domain specific binding|protein kinase C inhibitor activity				0		all_cancers(24;1.23e-26)|all_epithelial(13;1.19e-23)|Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;7.26e-05)|Breast(348;0.00017)|Renal(390;0.0007)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.1e-52)|Epithelial(14;2.31e-52)|OV - Ovarian serous cystadenocarcinoma(117;8.22e-30)|Colorectal(126;1.31e-09)|COAD - Colon adenocarcinoma(152;3.45e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000501)|STAD - Stomach adenocarcinoma(196;0.000588)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|READ - Rectum adenocarcinoma(331;0.0419)|GBM - Glioblastoma multiforme(114;0.0767)|Lung(427;0.215)		CAAGGAGGCCGGGGACGCCGA	0.637													4	78	---	---	---	---	capture	Missense_Mutation	SNP	27190037	27190037	SFN	1	G	T	T	T	1	0	0	0	0	1	0	0	0	507	39	4	4	14052	222
BCAR3	8412	broad.mit.edu	37	1	94032964	94032964	+	Missense_Mutation	SNP	A	G	G			TCGA-28-5215-01	TCGA-28-5215-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:94032964A>G	uc001dpz.2	-	11	2446	c.2171T>C	c.(2170-2172)TTT>TCT	p.F724S	BCAR3_uc001dqa.2_Missense_Mutation_p.F724S|BCAR3_uc001dqb.2_Missense_Mutation_p.F724S|BCAR3_uc001dpx.3_Missense_Mutation_p.F400S|BCAR3_uc001dpy.2_Missense_Mutation_p.F633S	NM_003567	NP_003558	O75815	BCAR3_HUMAN	breast cancer antiestrogen resistance 3	724	Ras-GEF.				response to drug|small GTPase mediated signal transduction	intracellular	guanyl-nucleotide exchange factor activity|protein binding			ovary(1)|lung(1)|central_nervous_system(1)	3		all_lung(203;0.00145)|Lung NSC(277;0.00662)		all cancers(265;0.0126)|GBM - Glioblastoma multiforme(16;0.0467)|Epithelial(280;0.166)		GGTTCCTTCAAAAGTCACAGC	0.502													62	87	---	---	---	---	capture	Missense_Mutation	SNP	94032964	94032964	BCAR3	1	A	G	G	G	1	0	0	0	0	1	0	0	0	13	1	3	3	1338	222
IRF6	3664	broad.mit.edu	37	1	209961847	209961847	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5215-01	TCGA-28-5215-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:209961847C>T	uc001hhq.1	-	9	1585	c.1322G>A	c.(1321-1323)CGC>CAC	p.R441H	IRF6_uc010psm.1_Missense_Mutation_p.R346H|IRF6_uc009xct.1_Missense_Mutation_p.R441H	NM_006147	NP_006138	O14896	IRF6_HUMAN	interferon regulatory factor 6	441					cell cycle arrest|interferon-gamma-mediated signaling pathway|mammary gland epithelial cell differentiation|negative regulation of cell proliferation|positive regulation of transcription, DNA-dependent|type I interferon-mediated signaling pathway	cytoplasm|nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(2)	2				OV - Ovarian serous cystadenocarcinoma(81;0.0351)		TTGAAGGATGCGGTACAGCTG	0.557										HNSCC(57;0.16)			15	163	---	---	---	---	capture	Missense_Mutation	SNP	209961847	209961847	IRF6	1	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	7757	222
CDH23	64072	broad.mit.edu	37	10	73375274	73375274	+	Missense_Mutation	SNP	C	G	G			TCGA-28-5215-01	TCGA-28-5215-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:73375274C>G	uc001jrx.3	+	10	1223	c.846C>G	c.(844-846)AGC>AGG	p.S282R	CDH23_uc001jrw.3_Missense_Mutation_p.S282R|CDH23_uc009xql.2_Missense_Mutation_p.S327R	NM_022124	NP_071407	Q9H251	CAD23_HUMAN	cadherin-like 23 isoform 1 precursor	282	Cadherin 3.|Extracellular (Potential).				calcium ion transport|calcium-dependent cell-cell adhesion|cytosolic calcium ion homeostasis|equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	cytosol|integral to membrane|plasma membrane|stereocilium	calcium ion binding|protein binding			central_nervous_system(5)|large_intestine(4)|ovary(2)	11						ATACCAACAGCATCTTTGCCC	0.607													3	57	---	---	---	---	capture	Missense_Mutation	SNP	73375274	73375274	CDH23	10	C	G	G	G	1	0	0	0	0	1	0	0	0	324	25	4	4	3079	222
DHX32	55760	broad.mit.edu	37	10	127541113	127541113	+	Silent	SNP	T	C	C			TCGA-28-5215-01	TCGA-28-5215-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:127541113T>C	uc001ljf.1	-	5	1682	c.1191A>G	c.(1189-1191)TCA>TCG	p.S397S	BCCIP_uc001ljd.3_Intron|DHX32_uc001lje.1_Silent_p.S21S|DHX32_uc001ljg.1_Silent_p.S397S|DHX32_uc009yam.1_Silent_p.S152S	NM_018180	NP_060650	Q7L7V1	DHX32_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 32	397						mitochondrion|nucleus	ATP binding|helicase activity			breast(2)|ovary(1)|lung(1)	4		all_lung(145;0.00751)|Lung NSC(174;0.0115)|Colorectal(57;0.0846)|all_neural(114;0.0936)				CAGCACTACCTGAAGAAGATG	0.433													3	164	---	---	---	---	capture	Silent	SNP	127541113	127541113	DHX32	10	T	C	C	C	1	0	0	0	0	0	0	0	1	704	55	3	3	4463	222
PNPLA2	57104	broad.mit.edu	37	11	824015	824015	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5215-01	TCGA-28-5215-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:824015G>A	uc001lrt.2	+	8	1139	c.937G>A	c.(937-939)GTG>ATG	p.V313M	PNPLA2_uc009ycl.2_Missense_Mutation_p.R124H|EFCAB4A_uc010qwt.1_5'Flank	NM_020376	NP_065109	Q96AD5	PLPL2_HUMAN	patatin-like phospholipase domain containing 2	313	Lumenal (Potential).				negative regulation of sequestering of triglyceride|positive regulation of triglyceride catabolic process	integral to membrane|lipid particle|plasma membrane	triglyceride lipase activity				0		all_cancers(49;4.75e-06)|all_epithelial(84;0.00204)|Breast(177;0.00234)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;1.63e-25)|Epithelial(43;1.28e-24)|OV - Ovarian serous cystadenocarcinoma(40;7.09e-19)|BRCA - Breast invasive adenocarcinoma(625;4.23e-05)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GGAGGCCTGCGTGGAGCCCAC	0.637													10	18	---	---	---	---	capture	Missense_Mutation	SNP	824015	824015	PNPLA2	11	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	12068	222
OR5D16	390144	broad.mit.edu	37	11	55606777	55606777	+	Missense_Mutation	SNP	T	C	C			TCGA-28-5215-01	TCGA-28-5215-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:55606777T>C	uc010rio.1	+	1	550	c.550T>C	c.(550-552)TCC>CCC	p.S184P		NM_001005496	NP_001005496	Q8NGK9	OR5DG_HUMAN	olfactory receptor, family 5, subfamily D,	184	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(4)|skin(1)	5		all_epithelial(135;0.208)				CTGTGAGTTATCCTCCCTGAT	0.418													73	153	---	---	---	---	capture	Missense_Mutation	SNP	55606777	55606777	OR5D16	11	T	C	C	C	1	0	0	0	0	1	0	0	0	650	50	3	3	11060	222
UVRAG	7405	broad.mit.edu	37	11	75852116	75852116	+	Nonsense_Mutation	SNP	G	T	T			TCGA-28-5215-01	TCGA-28-5215-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:75852116G>T	uc001oxc.2	+	15	2000	c.1759G>T	c.(1759-1761)GAA>TAA	p.E587*	UVRAG_uc010rrw.1_Nonsense_Mutation_p.E486*|UVRAG_uc001oxd.2_Nonsense_Mutation_p.E215*|UVRAG_uc010rrx.1_Nonsense_Mutation_p.E215*|UVRAG_uc010rry.1_Nonsense_Mutation_p.E143*	NM_003369	NP_003360	Q9P2Y5	UVRAG_HUMAN	UV radiation resistance associated	587					DNA repair|positive regulation of autophagy	early endosome|late endosome|lysosome	protein binding			skin(4)|lung(2)	6						AGAACAAGGAGAAGCCCTCTC	0.577													8	89	---	---	---	---	capture	Nonsense_Mutation	SNP	75852116	75852116	UVRAG	11	G	T	T	T	1	0	0	0	0	0	1	0	0	429	33	5	4	16990	222
RACGAP1	29127	broad.mit.edu	37	12	50387942	50387942	+	Silent	SNP	G	C	C			TCGA-28-5215-01	TCGA-28-5215-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:50387942G>C	uc001rvt.2	-	14	1621	c.1311C>G	c.(1309-1311)CGC>CGG	p.R437R	RACGAP1_uc009zlm.1_Silent_p.R437R|RACGAP1_uc001rvs.2_Silent_p.R437R|RACGAP1_uc001rvu.2_Silent_p.R437R	NM_013277	NP_037409	Q9H0H5	RGAP1_HUMAN	Rac GTPase activating protein 1	437	Rho-GAP.				blood coagulation|cytokinesis, actomyosin contractile ring assembly|cytokinesis, initiation of separation|embryo development|microtubule-based movement|neuroblast proliferation|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction|spermatogenesis|sulfate transport	acrosomal vesicle|cytosol|microtubule|midbody|nucleus|spindle	alpha-tubulin binding|beta-tubulin binding|gamma-tubulin binding|GTPase activator activity|metal ion binding			kidney(1)	1						CTCTGTTAAGGCGAAAGGTCA	0.318													110	171	---	---	---	---	capture	Silent	SNP	50387942	50387942	RACGAP1	12	G	C	C	C	1	0	0	0	0	0	0	0	1	535	42	4	4	12872	222
LRP1	4035	broad.mit.edu	37	12	57571370	57571370	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5215-01	TCGA-28-5215-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:57571370G>A	uc001snd.2	+	26	4823	c.4357G>A	c.(4357-4359)GCC>ACC	p.A1453T		NM_002332	NP_002323	Q07954	LRP1_HUMAN	low density lipoprotein-related protein 1	1453	Extracellular (Potential).|LDL-receptor class B 11.				aorta morphogenesis|apoptotic cell clearance|negative regulation of platelet-derived growth factor receptor-beta signaling pathway|negative regulation of smooth muscle cell migration|negative regulation of Wnt receptor signaling pathway|positive regulation of cholesterol efflux|regulation of actin cytoskeleton organization|regulation of phospholipase A2 activity	coated pit|integral to plasma membrane|nucleus	apolipoprotein E binding|calcium ion binding|lipoprotein transporter activity|protein complex binding|receptor activity			ovary(8)|lung(3)|breast(3)|large_intestine(2)|central_nervous_system(2)|skin(2)|pancreas(2)	22				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Alteplase(DB00009)|Anistreplase(DB00029)|Antihemophilic Factor(DB00025)|Becaplermin(DB00102)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	TTGGATTGACGCCAGGTCAGC	0.657													23	40	---	---	---	---	capture	Missense_Mutation	SNP	57571370	57571370	LRP1	12	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	8867	222
CLIP1	6249	broad.mit.edu	37	12	122839754	122839754	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5215-01	TCGA-28-5215-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:122839754G>A	uc001ucg.1	-	5	1217	c.1111C>T	c.(1111-1113)CGG>TGG	p.R371W	CLIP1_uc001uch.1_Missense_Mutation_p.R371W|CLIP1_uc001uci.1_Missense_Mutation_p.R371W|CLIP1_uc001ucj.1_Missense_Mutation_p.R72W|CLIP1_uc009zxo.1_5'Flank|CLIP1_uc010tae.1_Intron	NM_002956	NP_002947	P30622	CLIP1_HUMAN	restin isoform a	371	Potential.				mitotic prometaphase|positive regulation of microtubule polymerization	centrosome|cytosol|endosome|intermediate filament|kinetochore	nucleic acid binding|protein homodimerization activity|zinc ion binding			ovary(2)|breast(1)	3	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.81e-05)|Epithelial(86;6.85e-05)|BRCA - Breast invasive adenocarcinoma(302;0.226)		TCCAGATCCCGTTCCGCCAGC	0.632													5	176	---	---	---	---	capture	Missense_Mutation	SNP	122839754	122839754	CLIP1	12	G	A	A	A	1	0	0	0	0	1	0	0	0	519	40	1	1	3497	222
TMEM132D	121256	broad.mit.edu	37	12	129694161	129694161	+	Silent	SNP	G	A	A			TCGA-28-5215-01	TCGA-28-5215-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:129694161G>A	uc009zyl.1	-	5	1675	c.1347C>T	c.(1345-1347)GCC>GCT	p.A449A		NM_133448	NP_597705	Q14C87	T132D_HUMAN	transmembrane protein 132D precursor	449	Extracellular (Potential).					integral to membrane		p.A449V(1)		ovary(10)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	14	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		TCACCGGGACGGCCACCGTCT	0.572													18	82	---	---	---	---	capture	Silent	SNP	129694161	129694161	TMEM132D	12	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	15931	222
OR6S1	341799	broad.mit.edu	37	14	21109809	21109809	+	Silent	SNP	G	A	A			TCGA-28-5215-01	TCGA-28-5215-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:21109809G>A	uc001vxv.1	-	1	42	c.42C>T	c.(40-42)TTC>TTT	p.F14F		NM_001001968	NP_001001968	Q8NH40	OR6S1_HUMAN	olfactory receptor, family 6, subfamily S,	14	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2	all_cancers(95;0.00304)		Epithelial(56;1.23e-06)|all cancers(55;1.01e-05)	GBM - Glioblastoma multiforme(265;0.0135)		CTGCCAGGACGAACTCTGTTG	0.453													162	90	---	---	---	---	capture	Silent	SNP	21109809	21109809	OR6S1	14	G	A	A	A	1	0	0	0	0	0	0	0	1	477	37	1	1	11113	222
VPS18	57617	broad.mit.edu	37	15	41191139	41191139	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5215-01	TCGA-28-5215-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:41191139G>A	uc001zne.2	+	3	607	c.268G>A	c.(268-270)GTG>ATG	p.V90M		NM_020857	NP_065908	Q9P253	VPS18_HUMAN	vacuolar protein sorting 18	90					endosome organization|lysosome organization|protein transport	HOPS complex|late endosome membrane|lysosomal membrane	metal ion binding|protein binding			ovary(2)|large_intestine(1)	3		all_cancers(109;1.35e-17)|all_epithelial(112;3.78e-15)|Lung NSC(122;9.68e-11)|all_lung(180;2.25e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;1.07e-05)|COAD - Colon adenocarcinoma(120;0.15)|BRCA - Breast invasive adenocarcinoma(123;0.164)		GCCCAACCACGTGGAGCTGGG	0.448													15	24	---	---	---	---	capture	Missense_Mutation	SNP	41191139	41191139	VPS18	15	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	17076	222
SLC30A4	7782	broad.mit.edu	37	15	45814527	45814527	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5215-01	TCGA-28-5215-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:45814527C>T	uc001zvj.2	-	2	338	c.26G>A	c.(25-27)CGC>CAC	p.R9H	C15orf21_uc010beg.1_Intron|C15orf21_uc010beh.1_Intron|C15orf21_uc010bei.1_Intron|C15orf21_uc010bej.1_Intron|C15orf21_uc001zvm.1_Intron|C15orf21_uc001zvn.1_Intron	NM_013309	NP_037441	O14863	ZNT4_HUMAN	solute carrier family 30 (zinc transporter),	9	Cytoplasmic (Potential).				regulation of sequestering of zinc ion|response to toxin	endosome membrane|integral to membrane|late endosome	zinc ion transmembrane transporter activity				0		Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;1.58e-16)|GBM - Glioblastoma multiforme(94;2.15e-06)		AGATTTGAGGCGCTTCCACGC	0.652													10	38	---	---	---	---	capture	Missense_Mutation	SNP	45814527	45814527	SLC30A4	15	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	14449	222
SHCBP1	79801	broad.mit.edu	37	16	46615749	46615749	+	Silent	SNP	C	T	T			TCGA-28-5215-01	TCGA-28-5215-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:46615749C>T	uc002eec.3	-	13	1951	c.1911G>A	c.(1909-1911)GGG>GGA	p.G637G		NM_024745	NP_079021	Q8NEM2	SHCBP_HUMAN	SHC SH2-domain binding protein 1	637										ovary(1)|breast(1)	2		all_cancers(37;0.00404)|all_epithelial(9;0.00527)|all_lung(18;0.0413)|Lung NSC(13;0.213)				CTTGCGTGATCCCCAGTTCAC	0.433													115	154	---	---	---	---	capture	Silent	SNP	46615749	46615749	SHCBP1	16	C	T	T	T	1	0	0	0	0	0	0	0	1	379	30	2	2	14167	222
TP53	7157	broad.mit.edu	37	17	7579312	7579312	+	Silent	SNP	C	T	T	rs55863639		TCGA-28-5215-01	TCGA-28-5215-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7579312C>T	uc002gim.2	-	4	569	c.375G>A	c.(373-375)ACG>ACA	p.T125T	TP53_uc002gig.1_Silent_p.T125T|TP53_uc002gih.2_Silent_p.T125T|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_5'Flank|TP53_uc010cng.1_5'Flank|TP53_uc002gii.1_5'Flank|TP53_uc010cnh.1_Silent_p.T125T|TP53_uc010cni.1_Silent_p.T125T|TP53_uc002gij.2_Silent_p.T125T|TP53_uc010cnj.1_5'Flank|TP53_uc002gin.2_Intron|TP53_uc002gio.2_Intron|TP53_uc010vug.1_Silent_p.T86T|TP53_uc010cnk.1_Silent_p.T140T	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	125	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		T -> A (in a sporadic cancer; somatic mutation).|T -> M (in sporadic cancers; somatic mutation).|T -> R (in sporadic cancers; somatic mutation).|T -> P (in a sporadic cancer; somatic mutation).|T -> K (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.T125T(15)|p.0?(7)|p.T125M(7)|p.T125K(3)|p.T125R(3)|p.?(2)|p.V73fs*9(1)|p.T125P(1)|p.G105_T125del21(1)|p.Y126fs*11(1)|p.T125fs*45(1)|p.T125fs*24(1)|p.T125A(1)|p.P13fs*18(1)|p.T125_Y126insX(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		GGCAACTGACCGTGCAAGTCA	0.537		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			40	36	---	---	---	---	capture	Silent	SNP	7579312	7579312	TP53	17	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	16264	222
MYH2	4620	broad.mit.edu	37	17	10432722	10432722	+	Nonsense_Mutation	SNP	A	T	T			TCGA-28-5215-01	TCGA-28-5215-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:10432722A>T	uc010coi.2	-	25	3322	c.3194T>A	c.(3193-3195)TTG>TAG	p.L1065*	uc002gml.1_Intron|MYH2_uc002gmp.3_Nonsense_Mutation_p.L1065*|MYH2_uc010coj.2_Intron	NM_001100112	NP_001093582	Q9UKX2	MYH2_HUMAN	myosin heavy chain IIa	1065	Potential.				muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(5)|pancreas(4)|skin(3)|lung(1)|kidney(1)	14						GGCCAACTTCAAGTCACCCTC	0.373													93	50	---	---	---	---	capture	Nonsense_Mutation	SNP	10432722	10432722	MYH2	17	A	T	T	T	1	0	0	0	0	0	1	0	0	65	5	5	4	9945	222
NR1D1	9572	broad.mit.edu	37	17	38252312	38252312	+	Silent	SNP	T	C	C			TCGA-28-5215-01	TCGA-28-5215-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:38252312T>C	uc002htz.1	-	5	1259	c.633A>G	c.(631-633)CGA>CGG	p.R211R	NR1D1_uc010cwq.1_RNA|NR1D1_uc010cwr.1_Intron	NM_021724	NP_068370	P20393	NR1D1_HUMAN	nuclear receptor subfamily 1, group D, member 1	211					cellular response to lipopolysaccharide|negative regulation of receptor biosynthetic process|negative regulation of toll-like receptor 4 signaling pathway|negative regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nuclear chromatin|nucleoplasm	sequence-specific DNA binding|steroid hormone receptor activity|transcription corepressor activity|transcription regulatory region DNA binding|zinc ion binding			skin(1)	1	Colorectal(19;0.000442)					GCTGCTTCTCTCGTTTGGGGA	0.562													3	91	---	---	---	---	capture	Silent	SNP	38252312	38252312	NR1D1	17	T	C	C	C	1	0	0	0	0	0	0	0	1	691	54	3	3	10522	222
KRT17	3872	broad.mit.edu	37	17	39780481	39780481	+	Missense_Mutation	SNP	C	T	T	rs28928897		TCGA-28-5215-01	TCGA-28-5215-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:39780481C>T	uc002hxh.2	-	1	402	c.281G>A	c.(280-282)CGC>CAC	p.R94H	JUP_uc010wfs.1_Intron|KRT17_uc010wft.1_Missense_Mutation_p.R94H	NM_000422	NP_000413	Q04695	K1C17_HUMAN	keratin 17	94	Coil 1A.|Rod.		R -> H (in SM).|R -> C (in PC2 and SM).|Missing (in PC2).|R -> P (in PC2).	Missing (in Ref. 5; AAH72018).	epidermis development	cytoplasm|intermediate filament	protein binding|structural constituent of cytoskeleton			ovary(1)|skin(1)	2		Breast(137;0.000307)				GGAGGCCAGGCGGTCATTGAG	0.627									Steatocystoma_Multiplex				100	199	---	---	---	---	capture	Missense_Mutation	SNP	39780481	39780481	KRT17	17	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	8374	222
HELZ	9931	broad.mit.edu	37	17	65157047	65157047	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5215-01	TCGA-28-5215-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:65157047C>T	uc010wqk.1	-	16	2228	c.2041G>A	c.(2041-2043)GCT>ACT	p.A681T	HELZ_uc002jfv.3_RNA|HELZ_uc002jfx.3_Missense_Mutation_p.A681T	NM_014877	NP_055692			helicase with zinc finger domain											ovary(1)|pancreas(1)	2	all_cancers(12;1.24e-11)|Breast(2;1.05e-17)|all_epithelial(3;3.87e-13)					TGTTTGACAGCCTGAGCTAGA	0.493													36	66	---	---	---	---	capture	Missense_Mutation	SNP	65157047	65157047	HELZ	17	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	6975	222
EPB41L3	23136	broad.mit.edu	37	18	5434010	5434010	+	Missense_Mutation	SNP	T	C	C			TCGA-28-5215-01	TCGA-28-5215-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:5434010T>C	uc002kmt.1	-	7	802	c.716A>G	c.(715-717)GAC>GGC	p.D239G	EPB41L3_uc010wzh.1_Missense_Mutation_p.D239G|EPB41L3_uc002kmu.1_Missense_Mutation_p.D239G|EPB41L3_uc010dkq.1_Missense_Mutation_p.D130G|EPB41L3_uc010dks.1_Missense_Mutation_p.D261G|EPB41L3_uc002kmv.1_Missense_Mutation_p.D130G	NM_012307	NP_036439	Q9Y2J2	E41L3_HUMAN	erythrocyte membrane protein band 4.1-like 3	239	FERM.				cortical actin cytoskeleton organization	cell-cell junction|cytoplasm|cytoskeleton|extrinsic to membrane	actin binding|structural molecule activity			ovary(5)	5						TGGGTCATAGTCTCCGAGCTC	0.522													108	224	---	---	---	---	capture	Missense_Mutation	SNP	5434010	5434010	EPB41L3	18	T	C	C	C	1	0	0	0	0	1	0	0	0	754	58	3	3	5109	222
C19orf28	126321	broad.mit.edu	37	19	3547922	3547922	+	Missense_Mutation	SNP	G	C	C			TCGA-28-5215-01	TCGA-28-5215-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:3547922G>C	uc002lxz.2	-	4	931	c.761C>G	c.(760-762)ACC>AGC	p.T254S	C19orf28_uc002lxw.2_Missense_Mutation_p.T254S|C19orf28_uc002lxx.2_Missense_Mutation_p.T254S|C19orf28_uc002lxy.2_Missense_Mutation_p.T245S	NM_174983	NP_778148	Q6NUT3	CS028_HUMAN	hypothetical protein LOC126321 isoform c	254					transmembrane transport	integral to membrane				breast(1)|pancreas(1)	2		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00251)|STAD - Stomach adenocarcinoma(1328;0.18)		CAACAGGGGGGTGTGCTCGCC	0.711													7	12	---	---	---	---	capture	Missense_Mutation	SNP	3547922	3547922	C19orf28	19	G	C	C	C	1	0	0	0	0	1	0	0	0	572	44	4	4	1900	222
ST6GAL2	84620	broad.mit.edu	37	2	107459661	107459661	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5215-01	TCGA-28-5215-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:107459661C>T	uc002tdq.2	-	2	892	c.773G>A	c.(772-774)CGC>CAC	p.R258H	ST6GAL2_uc002tdr.2_Missense_Mutation_p.R258H|ST6GAL2_uc002tds.3_Missense_Mutation_p.R258H	NM_001142351	NP_001135823	Q96JF0	SIAT2_HUMAN	ST6 beta-galactosamide	258	Lumenal (Potential).				growth|multicellular organismal development|oligosaccharide metabolic process|protein glycosylation	Golgi cisterna membrane|integral to Golgi membrane	beta-galactoside alpha-2,6-sialyltransferase activity			pancreas(6)|ovary(4)|skin(1)	11						CACGCGCGCGCGGCTCCGCAG	0.736													4	3	---	---	---	---	capture	Missense_Mutation	SNP	107459661	107459661	ST6GAL2	2	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	15112	222
PSD4	23550	broad.mit.edu	37	2	113950118	113950118	+	Missense_Mutation	SNP	G	A	A	rs140435814	byFrequency	TCGA-28-5215-01	TCGA-28-5215-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:113950118G>A	uc002tjc.2	+	6	1973	c.1790G>A	c.(1789-1791)CGC>CAC	p.R597H	PSD4_uc002tjd.2_Missense_Mutation_p.R218H|PSD4_uc002tje.2_Missense_Mutation_p.R568H|PSD4_uc002tjf.2_Missense_Mutation_p.R218H	NM_012455	NP_036587	Q8NDX1	PSD4_HUMAN	pleckstrin and Sec7 domain containing 4	597	SEC7.				regulation of ARF protein signal transduction	cytoplasm|plasma membrane	ARF guanyl-nucleotide exchange factor activity			ovary(2)	2						CGCCTCTATCGCCTGGAGGGC	0.597													46	79	---	---	---	---	capture	Missense_Mutation	SNP	113950118	113950118	PSD4	2	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	12544	222
INPP5D	3635	broad.mit.edu	37	2	234112804	234112804	+	Missense_Mutation	SNP	C	T	T	rs142742228	by1000genomes	TCGA-28-5215-01	TCGA-28-5215-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:234112804C>T	uc010zmo.1	+	25	3161	c.3008C>T	c.(3007-3009)ACG>ATG	p.T1003M	INPP5D_uc010zmp.1_Missense_Mutation_p.T1002M	NM_001017915	NP_001017915	Q92835	SHIP1_HUMAN	SH2 containing inositol phosphatase isoform a	1003	Pro-rich.				apoptosis|blood coagulation|leukocyte migration|T cell receptor signaling pathway	cytosol	inositol-polyphosphate 5-phosphatase activity|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|SH3 domain binding			ovary(1)|central_nervous_system(1)	2		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0273)|Acute lymphoblastic leukemia(138;0.0328)|Lung NSC(271;0.0843)		Epithelial(121;1.16e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000479)|LUSC - Lung squamous cell carcinoma(224;0.00655)|Lung(119;0.00802)|GBM - Glioblastoma multiforme(43;0.0185)		GCAGGGGACACGCTGCCTCAG	0.517													5	10	---	---	---	---	capture	Missense_Mutation	SNP	234112804	234112804	INPP5D	2	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	7679	222
CABIN1	23523	broad.mit.edu	37	22	24452748	24452748	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5215-01	TCGA-28-5215-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:24452748G>A	uc002zzi.1	+	10	1314	c.1187G>A	c.(1186-1188)CGT>CAT	p.R396H	CABIN1_uc002zzj.1_Missense_Mutation_p.R346H|CABIN1_uc002zzl.1_Missense_Mutation_p.R396H|CABIN1_uc010guk.1_Missense_Mutation_p.R351H|CABIN1_uc002zzk.1_Missense_Mutation_p.R351H	NM_012295	NP_036427	Q9Y6J0	CABIN_HUMAN	calcineurin binding protein 1	396					cell surface receptor linked signaling pathway|chromatin modification	nucleus	protein phosphatase inhibitor activity			ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	5						CGGTCTGCCCGTGTCCGAAAC	0.448													93	186	---	---	---	---	capture	Missense_Mutation	SNP	24452748	24452748	CABIN1	22	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	2504	222
TRIM71	131405	broad.mit.edu	37	3	32933302	32933302	+	Silent	SNP	A	G	G			TCGA-28-5215-01	TCGA-28-5215-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:32933302A>G	uc003cff.2	+	4	2669	c.2606A>G	c.(2605-2607)TAA>TGA	p.*869*		NM_001039111	NP_001034200	Q2Q1W2	LIN41_HUMAN	tripartite motif-containing 71	869					multicellular organismal development	cytoplasm	zinc ion binding			ovary(2)|large_intestine(1)	3						CTCGTCTTCTAATTGCATTTC	0.408													77	169	---	---	---	---	capture	Silent	SNP	32933302	32933302	TRIM71	3	A	G	G	G	1	0	0	0	0	0	0	0	1	167	13	3	3	16427	222
SI	6476	broad.mit.edu	37	3	164733001	164733001	+	Silent	SNP	A	G	G			TCGA-28-5215-01	TCGA-28-5215-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:164733001A>G	uc003fei.2	-	33	3971	c.3909T>C	c.(3907-3909)AAT>AAC	p.N1303N		NM_001041	NP_001032	P14410	SUIS_HUMAN	sucrase-isomaltase	1303	Sucrase.|Lumenal.				carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|brush border|Golgi apparatus|integral to membrane	carbohydrate binding|oligo-1,6-glucosidase activity|sucrose alpha-glucosidase activity			ovary(7)|upper_aerodigestive_tract(4)|skin(2)|pancreas(1)	14		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)	TCTTTGTTTCATTTCCTGAAA	0.348										HNSCC(35;0.089)			53	66	---	---	---	---	capture	Silent	SNP	164733001	164733001	SI	3	A	G	G	G	1	0	0	0	0	0	0	0	1	102	8	3	3	14190	222
NDST4	64579	broad.mit.edu	37	4	115998231	115998231	+	Translation_Start_Site	SNP	G	A	A			TCGA-28-5215-01	TCGA-28-5215-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:115998231G>A	uc003ibu.2	-	2	641	c.-38C>T	c.(-40--36)AACGA>AATGA		NDST4_uc010imw.2_Intron	NM_022569	NP_072091	Q9H3R1	NDST4_HUMAN	heparan sulfate N-deacetylase/N-sulfotransferase							Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine N-sulfotransferase activity|hydrolase activity			skin(3)|ovary(1)	4		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000562)		TCCCAATTTCGTTTCCTAAAG	0.338													13	32	---	---	---	---	capture	Translation_Start_Site	SNP	115998231	115998231	NDST4	4	G	A	A	A	1	0	0	0	0	0	0	0	0	508	40	1	1	10165	222
TRIML2	205860	broad.mit.edu	37	4	189012730	189012730	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5215-01	TCGA-28-5215-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:189012730C>T	uc003izl.2	-	7	997	c.961G>A	c.(961-963)GGG>AGG	p.G321R	TRIML2_uc003izj.1_Missense_Mutation_p.G149S|TRIML2_uc003izk.1_Missense_Mutation_p.G129S|TRIML2_uc011cle.1_Missense_Mutation_p.G396S	NM_173553	NP_775824	Q8N7C3	TRIMM_HUMAN	tripartite motif family-like 2	321	B30.2/SPRY.						ligase activity			central_nervous_system(2)	2		all_cancers(14;3.11e-44)|all_epithelial(14;7.86e-31)|all_lung(41;4.3e-13)|Lung NSC(41;9.69e-13)|Melanoma(20;7.86e-05)|Breast(6;0.000148)|all_hematologic(60;0.0202)|Hepatocellular(41;0.0218)|Renal(120;0.0376)|Prostate(90;0.0513)		OV - Ovarian serous cystadenocarcinoma(60;1.79e-11)|BRCA - Breast invasive adenocarcinoma(30;4.52e-06)|GBM - Glioblastoma multiforme(59;1.62e-05)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.0091)|READ - Rectum adenocarcinoma(43;0.163)		AGGAAAACGCCAACTGTGTCC	0.517													114	254	---	---	---	---	capture	Missense_Mutation	SNP	189012730	189012730	TRIML2	4	C	T	T	T	1	0	0	0	0	1	0	0	0	273	21	2	2	16434	222
ADAMTS6	11174	broad.mit.edu	37	5	64520167	64520167	+	Missense_Mutation	SNP	G	A	A	rs143194045		TCGA-28-5215-01	TCGA-28-5215-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:64520167G>A	uc003jtp.2	-	18	3066	c.2252C>T	c.(2251-2253)GCC>GTC	p.A751V	ADAMTS6_uc003jto.2_RNA|ADAMTS6_uc003jtq.2_RNA|ADAMTS6_uc003jtr.1_Missense_Mutation_p.A372V	NM_197941	NP_922932	Q9UKP5	ATS6_HUMAN	ADAM metallopeptidase with thrombospondin type 1	751	Spacer.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding				0		Lung NSC(167;2.44e-06)|Prostate(74;0.014)|Ovarian(174;0.0549)|Breast(144;0.111)|Colorectal(97;0.235)		Lung(70;0.00942)		CTTTGACATGGCAACTTCTCT	0.408													5	199	---	---	---	---	capture	Missense_Mutation	SNP	64520167	64520167	ADAMTS6	5	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	270	222
PCDHA2	56146	broad.mit.edu	37	5	140176553	140176553	+	Silent	SNP	G	A	A			TCGA-28-5215-01	TCGA-28-5215-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140176553G>A	uc003lhd.2	+	1	2110	c.2004G>A	c.(2002-2004)TCG>TCA	p.S668S	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhc.1_Silent_p.S668S|PCDHA2_uc011czy.1_Silent_p.S668S	NM_018905	NP_061728	Q9Y5H9	PCDA2_HUMAN	protocadherin alpha 2 isoform 1 precursor	668	Cadherin 6.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding			ovary(4)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGTTAGTGTCGTTGGTGGAAA	0.652													6	105	---	---	---	---	capture	Silent	SNP	140176553	140176553	PCDHA2	5	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	11427	222
TRIM26	7726	broad.mit.edu	37	6	30164404	30164404	+	Silent	SNP	C	T	T	rs137972961		TCGA-28-5215-01	TCGA-28-5215-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:30164404C>T	uc003npr.2	-	5	863	c.654G>A	c.(652-654)ACG>ACA	p.T218T	TRIM26_uc003nps.2_Silent_p.T218T|TRIM26_uc010jry.2_5'UTR|TRIM26_uc003npt.2_Silent_p.T218T	NM_003449	NP_003440	Q12899	TRI26_HUMAN	tripartite motif-containing 26	218	Potential.						DNA binding|zinc ion binding			ovary(2)|lung(1)	3						CCCTGCCCTCCGTGAGCTCCT	0.642													6	95	---	---	---	---	capture	Silent	SNP	30164404	30164404	TRIM26	6	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	16383	222
SIM1	6492	broad.mit.edu	37	6	100911318	100911318	+	Silent	SNP	C	T	T			TCGA-28-5215-01	TCGA-28-5215-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:100911318C>T	uc003pqj.3	-	1	234	c.27G>A	c.(25-27)GCG>GCA	p.A9A	SIM1_uc010kcu.2_Silent_p.A9A	NM_005068	NP_005059	P81133	SIM1_HUMAN	single-minded homolog 1	9	Basic motif.				cell differentiation|nervous system development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|signal transducer activity			ovary(4)	4		all_cancers(76;9.88e-06)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0248)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0774)		TCCTAGTCCGCGCAGCATTTT	0.423													151	261	---	---	---	---	capture	Silent	SNP	100911318	100911318	SIM1	6	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	14216	222
FNDC1	84624	broad.mit.edu	37	6	159655381	159655381	+	Silent	SNP	G	A	A			TCGA-28-5215-01	TCGA-28-5215-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:159655381G>A	uc010kjv.2	+	11	4037	c.3837G>A	c.(3835-3837)CCG>CCA	p.P1279P	FNDC1_uc010kjw.1_Silent_p.P1164P	NM_032532	NP_115921	Q4ZHG4	FNDC1_HUMAN	fibronectin type III domain containing 1	1279						extracellular region				large_intestine(4)|ovary(3)|central_nervous_system(1)	8		Breast(66;0.000781)|Ovarian(120;0.0308)|Prostate(117;0.195)		OV - Ovarian serous cystadenocarcinoma(65;2.6e-16)|BRCA - Breast invasive adenocarcinoma(81;1.06e-05)		ACCCCTGGCCGCAGTACACCA	0.701													10	11	---	---	---	---	capture	Silent	SNP	159655381	159655381	FNDC1	6	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	5912	222
CHN2	1124	broad.mit.edu	37	7	29438049	29438049	+	Silent	SNP	C	T	T			TCGA-28-5215-01	TCGA-28-5215-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:29438049C>T	uc003szz.2	+	5	674	c.237C>T	c.(235-237)GCC>GCT	p.A79A	CHN2_uc011jzs.1_Silent_p.A154A|CHN2_uc010kva.2_Intron|CHN2_uc010kvb.2_Intron|CHN2_uc010kvc.2_Silent_p.A44A|CHN2_uc011jzt.1_Silent_p.A92A|CHN2_uc010kvd.2_Intron|CHN2_uc011jzu.1_Silent_p.A64A	NM_004067	NP_004058	P52757	CHIO_HUMAN	beta chimerin isoform 2	79	SH2.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|membrane	GTPase activator activity|metal ion binding|SH3/SH2 adaptor activity			ovary(2)	2						TGGAGGGTGCCTACATCCTTA	0.522													113	221	---	---	---	---	capture	Silent	SNP	29438049	29438049	CHN2	7	C	T	T	T	1	0	0	0	0	0	0	0	1	301	24	2	2	3328	222
ASB4	51666	broad.mit.edu	37	7	95115358	95115358	+	Silent	SNP	A	G	G			TCGA-28-5215-01	TCGA-28-5215-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:95115358A>G	uc011kij.1	+	1	75	c.75A>G	c.(73-75)CTA>CTG	p.L25L	ASB4_uc003unx.2_Silent_p.L25L	NM_016116	NP_057200	Q9Y574	ASB4_HUMAN	ankyrin repeat and SOCS box-containing protein 4	25					intracellular signal transduction					central_nervous_system(1)	1	all_cancers(62;2.27e-10)|all_epithelial(64;2.28e-09)|Lung NSC(181;0.218)|all_lung(186;0.246)		STAD - Stomach adenocarcinoma(171;0.0151)			TTGAGGCGCTAAAGTCCAATG	0.438													59	90	---	---	---	---	capture	Silent	SNP	95115358	95115358	ASB4	7	A	G	G	G	1	0	0	0	0	0	0	0	1	158	13	3	3	1016	222
ANK1	286	broad.mit.edu	37	8	41566469	41566469	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5215-01	TCGA-28-5215-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:41566469C>T	uc003xok.2	-	17	1909	c.1825G>A	c.(1825-1827)GCT>ACT	p.A609T	NKX6-3_uc010lxa.1_Intron|ANK1_uc003xoh.2_5'Flank|ANK1_uc003xoi.2_Missense_Mutation_p.A609T|ANK1_uc003xoj.2_Missense_Mutation_p.A609T|ANK1_uc003xol.2_Missense_Mutation_p.A609T|ANK1_uc003xom.2_Missense_Mutation_p.A642T	NM_020476	NP_065209	P16157	ANK1_HUMAN	ankyrin 1 isoform 1	609	ANK 18.|89 kDa domain.				axon guidance|cytoskeleton organization|exocytosis|maintenance of epithelial cell apical/basal polarity|signal transduction	basolateral plasma membrane|cytosol|sarcomere|sarcoplasmic reticulum|spectrin-associated cytoskeleton	cytoskeletal adaptor activity|enzyme binding|protein binding|spectrin binding|structural constituent of cytoskeleton	p.A609T(1)		ovary(3)|central_nervous_system(3)|lung(2)|breast(1)	9	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)			TGCTTGGCAGCGATGTGCAAA	0.582													35	85	---	---	---	---	capture	Missense_Mutation	SNP	41566469	41566469	ANK1	8	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	617	222
ATP6V0D2	245972	broad.mit.edu	37	8	87162356	87162356	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5215-01	TCGA-28-5215-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:87162356C>T	uc003ydp.1	+	6	724	c.655C>T	c.(655-657)CGT>TGT	p.R219C		NM_152565	NP_689778	Q8N8Y2	VA0D2_HUMAN	ATPase, H+ transporting, lysosomal 38kDa, V0	219					ATP hydrolysis coupled proton transport|cellular iron ion homeostasis|insulin receptor signaling pathway|transferrin transport	apical plasma membrane|endosome membrane|proton-transporting V-type ATPase, V0 domain|vacuolar proton-transporting V-type ATPase complex	hydrogen ion transmembrane transporter activity|protein binding				0						GGCCGACAGACGTGCTTTTAT	0.408													67	242	---	---	---	---	capture	Missense_Mutation	SNP	87162356	87162356	ATP6V0D2	8	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	1165	222
ADAMTSL1	92949	broad.mit.edu	37	9	18777555	18777555	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5215-01	TCGA-28-5215-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:18777555C>T	uc003zne.3	+	19	3455	c.3328C>T	c.(3328-3330)CGC>TGC	p.R1110C		NM_001040272	NP_001035362	Q8N6G6	ATL1_HUMAN	ADAMTS-like 1 isoform 4 precursor	1110						proteinaceous extracellular matrix	metallopeptidase activity|zinc ion binding			ovary(3)|upper_aerodigestive_tract(1)|lung(1)	5				GBM - Glioblastoma multiforme(50;1.29e-17)		GGAGATCTTCCGCAGCCACCT	0.647													9	22	---	---	---	---	capture	Missense_Mutation	SNP	18777555	18777555	ADAMTSL1	9	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	274	222
DCAF8L2	347442	broad.mit.edu	37	X	27765562	27765562	+	Nonsense_Mutation	SNP	C	T	T			TCGA-28-5215-01	TCGA-28-5215-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:27765562C>T	uc011mjy.1	+	1	637	c.550C>T	c.(550-552)CGA>TGA	p.R184*		NM_001136533	NP_001130005			DDB1 and CUL4 associated factor 8-like 2											central_nervous_system(1)|pancreas(1)	2						TGCCCTGCCCCGACCTCGCTG	0.612													3	2	---	---	---	---	capture	Nonsense_Mutation	SNP	27765562	27765562	DCAF8L2	23	C	T	T	T	1	0	0	0	0	0	1	0	0	295	23	5	1	4237	222
ZNF630	57232	broad.mit.edu	37	X	47918931	47918931	+	Missense_Mutation	SNP	G	C	C			TCGA-28-5215-01	TCGA-28-5215-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:47918931G>C	uc004div.3	-	5	1152	c.900C>G	c.(898-900)TTC>TTG	p.F300L	ZNF630_uc010nhz.1_Intron|ZNF630_uc004diw.2_Missense_Mutation_p.F176L	NM_001037735	NP_001032824	Q2M218	ZN630_HUMAN	zinc finger protein 630	300	C2H2-type 2.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|lung(1)	2						ATTTCTCACTGAAGGCTTTCC	0.413													70	160	---	---	---	---	capture	Missense_Mutation	SNP	47918931	47918931	ZNF630	23	G	C	C	C	1	0	0	0	0	1	0	0	0	581	45	4	4	17932	222
DCX	1641	broad.mit.edu	37	X	110644549	110644549	+	Missense_Mutation	SNP	T	G	G			TCGA-28-5215-01	TCGA-28-5215-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:110644549T>G	uc004epd.2	-	3	789	c.617A>C	c.(616-618)TAT>TCT	p.Y206S	DCX_uc011msv.1_Missense_Mutation_p.Y206S|DCX_uc004epe.2_Missense_Mutation_p.Y125S|DCX_uc004epf.2_Missense_Mutation_p.Y125S|DCX_uc004epg.2_Missense_Mutation_p.Y125S	NM_000555	NP_000546	O43602	DCX_HUMAN	doublecortin isoform a	206	Doublecortin 1.		Y -> H (in LISX1 and SBHX).|Y -> D (in SBHX).		axon guidance|central nervous system development|intracellular signal transduction	cytosol|microtubule associated complex	microtubule binding			central_nervous_system(2)|lung(1)|skin(1)	4						GGAACAGACATAGCTTTCCCC	0.378													82	154	---	---	---	---	capture	Missense_Mutation	SNP	110644549	110644549	DCX	23	T	G	G	G	1	0	0	0	0	1	0	0	0	637	49	4	4	4277	222
AIFM1	9131	broad.mit.edu	37	X	129264005	129264005	+	Missense_Mutation	SNP	G	T	T			TCGA-28-5215-01	TCGA-28-5215-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:129264005G>T	uc004evg.2	-	15	1888	c.1710C>A	c.(1708-1710)GAC>GAA	p.D570E	AIFM1_uc011mur.1_Missense_Mutation_p.D218E|AIFM1_uc011mus.1_3'UTR|AIFM1_uc004evh.2_Missense_Mutation_p.D566E|AIFM1_uc004evi.2_Missense_Mutation_p.D283E|AIFM1_uc004evk.2_RNA	NM_004208	NP_004199	O95831	AIFM1_HUMAN	programmed cell death 8 isoform 1	570					activation of caspase activity|apoptosis in response to endoplasmic reticulum stress|cell redox homeostasis|DNA damage response, signal transduction resulting in induction of apoptosis|DNA fragmentation involved in apoptotic nuclear change	cytosol|mitochondrial inner membrane|mitochondrial intermembrane space|nucleus|perinuclear region of cytoplasm	DNA binding|electron carrier activity|flavin adenine dinucleotide binding|oxidoreductase activity|protein binding			ovary(4)|central_nervous_system(1)	5						CGACCACTTTGTCCCTGAGGT	0.517													10	686	---	---	---	---	capture	Missense_Mutation	SNP	129264005	129264005	AIFM1	23	G	T	T	T	1	0	0	0	0	1	0	0	0	620	48	4	4	426	222
ATP6AP1	537	broad.mit.edu	37	X	153663708	153663708	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5215-01	TCGA-28-5215-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:153663708G>A	uc004flf.1	+	9	1121	c.1060G>A	c.(1060-1062)GCC>ACC	p.A354T	ATP6AP1_uc004flg.1_RNA|ATP6AP1_uc004flh.1_Missense_Mutation_p.A314T|GDI1_uc011mzo.1_5'Flank|GDI1_uc004fli.3_5'Flank	NM_001183	NP_001174	Q15904	VAS1_HUMAN	ATPase, H+ transporting, lysosomal accessory	354					ATP hydrolysis coupled proton transport	integral to membrane|proton-transporting V-type ATPase, V1 domain|vacuolar membrane	ATP binding|hydrogen ion transporting ATP synthase activity, rotational mechanism|proton-transporting ATPase activity, rotational mechanism			ovary(3)|breast(1)	4	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					TGGCTCCGTCGCCTACTTCAA	0.597													33	78	---	---	---	---	capture	Missense_Mutation	SNP	153663708	153663708	ATP6AP1	23	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	1156	222
PODXL	5420	broad.mit.edu	37	7	131195806	131195807	+	Frame_Shift_Ins	INS	-	G	G			TCGA-28-5215-01	TCGA-28-5215-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:131195806_131195807insG	uc003vqw.3	-	2	744_745	c.486_487insC	c.(484-489)AGCAGCfs	p.S162fs	PODXL_uc003vqx.3_Frame_Shift_Ins_p.S162fs	NM_001018111	NP_001018121	O00592	PODXL_HUMAN	podocalyxin-like isoform 1 precursor	162_163	Thr-rich.|Extracellular (Potential).				cell adhesion|epithelial tube formation|negative regulation of cell-cell adhesion|positive regulation of cell migration|positive regulation of cell-cell adhesion mediated by integrin|regulation of microvillus assembly	actin cytoskeleton|apical plasma membrane|centrosome|filopodium|integral to plasma membrane|lamellipodium|membrane raft|microvillus membrane|nucleolus|ruffle				breast(2)|pancreas(1)	3	Melanoma(18;0.162)					ACACTGTGGCTGCTTTTCCCCC	0.535													9	701	---	---	---	---	capture_indel	Frame_Shift_Ins	INS	131195806	131195807	PODXL	7	-	G	G	G	1	0	1	1	0	0	0	0	0	715	55	5	5	12083	222
