Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
ABCA4	24	broad.mit.edu	37	1	94512564	94512564	+	Silent	SNP	C	T	T			TCGA-28-5216-01	TCGA-28-5216-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:94512564C>T	uc001dqh.2	-	19	2933	c.2829G>A	c.(2827-2829)CGG>CGA	p.R943R	ABCA4_uc010otn.1_Silent_p.R869R	NM_000350	NP_000341	P78363	ABCA4_HUMAN	ATP-binding cassette, sub-family A member 4	943	Cytoplasmic.|ABC transporter 1.		R -> W (in STGD1 and FFM).		phototransduction, visible light|visual perception	integral to plasma membrane|membrane fraction	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(4)|skin(4)|central_nervous_system(2)|upper_aerodigestive_tract(1)|breast(1)	12		all_lung(203;0.000757)|Lung NSC(277;0.00335)		all cancers(265;0.00432)|GBM - Glioblastoma multiforme(16;0.00715)|Epithelial(280;0.171)		CCACAGCTGGCCGGCCACAGG	0.522													7	449	---	---	---	---	capture	Silent	SNP	94512564	94512564	ABCA4	1	C	T	T	T	1	0	0	0	0	0	0	0	1	327	26	2	2	34	223
PSMD4	5710	broad.mit.edu	37	1	151237667	151237667	+	Missense_Mutation	SNP	A	G	G			TCGA-28-5216-01	TCGA-28-5216-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:151237667A>G	uc001exl.2	+	5	457	c.395A>G	c.(394-396)AAG>AGG	p.K132R	PSMD4_uc001exn.2_Missense_Mutation_p.K132R	NM_002810	NP_002801	P55036	PSMD4_HUMAN	proteasome 26S non-ATPase subunit 4	132	VWFA.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA repair|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|regulation of transcription, DNA-dependent|S phase of mitotic cell cycle|viral reproduction	proteasome complex	protein binding|zinc ion binding				0	Lung SC(34;0.00471)|Ovarian(49;0.0147)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			AAACGCCTCAAGAAGGAGAAA	0.453													5	89	---	---	---	---	capture	Missense_Mutation	SNP	151237667	151237667	PSMD4	1	A	G	G	G	1	0	0	0	0	1	0	0	0	39	3	3	3	12595	223
XCL1	6375	broad.mit.edu	37	1	168549318	168549318	+	Missense_Mutation	SNP	T	G	G			TCGA-28-5216-01	TCGA-28-5216-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:168549318T>G	uc001gfo.1	+	2	99	c.79T>G	c.(79-81)TCA>GCA	p.S27A		NM_002995	NP_002986	P47992	XCL1_HUMAN	chemokine (C motif) ligand 1	27					CD4-positive, alpha-beta T cell proliferation|CD8-positive, alpha-beta T cell proliferation|cell-cell signaling|cellular response to interleukin-4|cellular response to transforming growth factor beta stimulus|immunoglobulin production in mucosal tissue|lymphocyte chemotaxis|negative regulation of interferon-gamma production|negative regulation of interleukin-2 production|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of T cell cytokine production|negative regulation of T-helper 1 cell activation|negative regulation of transcription, DNA-dependent|neutrophil chemotaxis|positive regulation of activated T cell proliferation|positive regulation of B cell chemotaxis|positive regulation of granzyme A production|positive regulation of granzyme B production|positive regulation of interleukin-10 production|positive regulation of natural killer cell chemotaxis|positive regulation of neutrophil chemotaxis|positive regulation of release of sequestered calcium ion into cytosol|positive regulation of T cell chemotaxis|positive regulation of T cell cytokine production|positive regulation of T cell mediated cytotoxicity|positive regulation of thymocyte migration|positive regulation of transforming growth factor-beta production|regulation of inflammatory response|release of sequestered calcium ion into cytosol|response to virus|T-helper 1 cell cytokine production|T-helper 2 cell cytokine production	extracellular space	chemokine activity|protein homodimerization activity				0	all_hematologic(923;0.208)					GAGTGAAGTCTCAGATAAGAG	0.433													82	118	---	---	---	---	capture	Missense_Mutation	SNP	168549318	168549318	XCL1	1	T	G	G	G	1	0	0	0	0	1	0	0	0	702	54	4	4	17304	223
PRG4	10216	broad.mit.edu	37	1	186276567	186276567	+	Silent	SNP	C	T	T			TCGA-28-5216-01	TCGA-28-5216-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:186276567C>T	uc001gru.3	+	7	1767	c.1716C>T	c.(1714-1716)ACC>ACT	p.T572T	PRG4_uc001grt.3_Silent_p.T531T|PRG4_uc009wyl.2_Silent_p.T479T|PRG4_uc009wym.2_Silent_p.T438T|PRG4_uc010poo.1_Intron	NM_005807	NP_005798	Q92954	PRG4_HUMAN	proteoglycan 4 isoform A	572	59 X 8 AA repeats of K-X-P-X-P-T-T-X.|29.				cell proliferation|immune response	extracellular region	polysaccharide binding|protein binding|scavenger receptor activity			skin(1)	1						CACCCACCACCCCCAAGAAGC	0.642													4	109	---	---	---	---	capture	Silent	SNP	186276567	186276567	PRG4	1	C	T	T	T	1	0	0	0	0	0	0	0	1	275	22	2	2	12377	223
HHIPL2	79802	broad.mit.edu	37	1	222717273	222717273	+	Missense_Mutation	SNP	G	C	C			TCGA-28-5216-01	TCGA-28-5216-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:222717273G>C	uc001hnh.1	-	2	638	c.580C>G	c.(580-582)CTG>GTG	p.L194V		NM_024746	NP_079022	Q6UWX4	HIPL2_HUMAN	HHIP-like 2 precursor	194					carbohydrate metabolic process	extracellular region	oxidoreductase activity, acting on the CH-OH group of donors, quinone or similar compound as acceptor|quinone binding			ovary(1)	1				GBM - Glioblastoma multiforme(131;0.0185)		ACCATGCCCAGGTGGCGGTTG	0.607													8	122	---	---	---	---	capture	Missense_Mutation	SNP	222717273	222717273	HHIPL2	1	G	C	C	C	1	0	0	0	0	1	0	0	0	451	35	4	4	7019	223
PTEN	5728	broad.mit.edu	37	10	89653826	89653826	+	Missense_Mutation	SNP	C	G	G			TCGA-28-5216-01	TCGA-28-5216-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:89653826C>G	uc001kfb.2	+	3	1155	c.124C>G	c.(124-126)CTT>GTT	p.L42V		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog	42	Phosphatase tensin-type.		L -> R (in glioma; retains phosphatase activity towards Ins(1,3,4,5)P4 and PtdIns(3,4,5)P3; retains the ability to bind phospholipid membranes).		activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.L42R(6)|p.?(4)|p.Y27_N212>Y(2)|p.Y27fs*1(2)|p.L42P(1)		endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		TGCAGAAAGACTTGAAGGCGT	0.294		31	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			78	34	---	---	---	---	capture	Missense_Mutation	SNP	89653826	89653826	PTEN	10	C	G	G	G	1	0	0	0	0	1	0	0	0	260	20	4	4	12633	223
SLC18A2	6571	broad.mit.edu	37	10	119014867	119014867	+	Silent	SNP	C	T	T			TCGA-28-5216-01	TCGA-28-5216-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:119014867C>T	uc001ldd.1	+	7	811	c.780C>T	c.(778-780)CTC>CTT	p.L260L	SLC18A2_uc009xyy.1_Silent_p.L57L	NM_003054	NP_003045	Q05940	VMAT2_HUMAN	solute carrier family 18 (vesicular monoamine),	260	Helical; (Potential).				neurotransmitter secretion	clathrin sculpted monoamine transport vesicle membrane|integral to plasma membrane|membrane fraction	monoamine transmembrane transporter activity				0		Colorectal(252;0.19)		all cancers(201;0.029)	Alseroxylon(DB00386)|Reserpine(DB00206)|Tetrabenazine(DB04844)	CCCTGGTACTCTTGGATGGAG	0.627													48	11	---	---	---	---	capture	Silent	SNP	119014867	119014867	SLC18A2	10	C	T	T	T	1	0	0	0	0	0	0	0	1	405	32	2	2	14319	223
OR51E1	143503	broad.mit.edu	37	11	4673967	4673967	+	Missense_Mutation	SNP	G	C	C			TCGA-28-5216-01	TCGA-28-5216-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:4673967G>C	uc001lzi.3	+	2	355	c.211G>C	c.(211-213)GGC>CGC	p.G71R		NM_152430	NP_689643	Q8TCB6	O51E1_HUMAN	olfactory receptor, family 51, subfamily E,	70	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			large_intestine(3)|pancreas(1)	4		Medulloblastoma(188;0.0025)|Breast(177;0.0101)|all_neural(188;0.0227)		Epithelial(150;7.37e-14)|GBM - Glioblastoma multiforme(2;2.85e-05)|BRCA - Breast invasive adenocarcinoma(625;0.00222)|LUSC - Lung squamous cell carcinoma(625;0.19)		CATGCTTTCAGGCATTGACAT	0.453													40	65	---	---	---	---	capture	Missense_Mutation	SNP	4673967	4673967	OR51E1	11	G	C	C	C	1	0	0	0	0	1	0	0	0	455	35	4	4	10998	223
OR4B1	119765	broad.mit.edu	37	11	48238725	48238725	+	Missense_Mutation	SNP	G	A	A	rs150231573	byFrequency	TCGA-28-5216-01	TCGA-28-5216-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:48238725G>A	uc010rhs.1	+	1	364	c.364G>A	c.(364-366)GTG>ATG	p.V122M		NM_001005470	NP_001005470	Q8NGF8	OR4B1_HUMAN	olfactory receptor, family 4, subfamily B,	122	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)|pancreas(1)	4						TGATTGCTACGTGGCCATTTG	0.473													63	85	---	---	---	---	capture	Missense_Mutation	SNP	48238725	48238725	OR4B1	11	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	10948	223
MS4A14	84689	broad.mit.edu	37	11	60164081	60164081	+	Silent	SNP	A	T	T			TCGA-28-5216-01	TCGA-28-5216-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:60164081A>T	uc001npj.2	+	1	595	c.30A>T	c.(28-30)GCA>GCT	p.A10A	MS4A14_uc001npi.2_Intron|MS4A14_uc001npn.2_5'UTR|MS4A14_uc001npk.2_Silent_p.A10A|MS4A14_uc001npl.2_5'UTR|MS4A14_uc001npm.2_5'UTR	NM_032597	NP_115986	Q96JA4	M4A14_HUMAN	membrane-spanning 4-domains, subfamily A, member	10						integral to membrane	receptor activity			breast(1)	1						ACAGAAGGGCAACTCACGTCA	0.458													40	31	---	---	---	---	capture	Silent	SNP	60164081	60164081	MS4A14	11	A	T	T	T	1	0	0	0	0	0	0	0	1	54	5	4	4	9768	223
P2RY2	5029	broad.mit.edu	37	11	72946285	72946285	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5216-01	TCGA-28-5216-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:72946285C>T	uc001otj.2	+	3	1414	c.1081C>T	c.(1081-1083)CGG>TGG	p.R361W	P2RY2_uc001otk.2_Missense_Mutation_p.R361W|P2RY2_uc001otl.2_Missense_Mutation_p.R361W	NM_002564	NP_002555	P41231	P2RY2_HUMAN	purinergic receptor P2Y2	361	Cytoplasmic (Potential).				activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger	integral to plasma membrane	purinergic nucleotide receptor activity, G-protein coupled	p.R361P(1)		ovary(2)|lung(1)|skin(1)	4					Suramin(DB04786)	GGACTCTAGGCGGACAGAGTC	0.582													93	122	---	---	---	---	capture	Missense_Mutation	SNP	72946285	72946285	P2RY2	11	C	T	T	T	1	0	0	0	0	1	0	0	0	347	27	1	1	11256	223
GDPD5	81544	broad.mit.edu	37	11	75160035	75160035	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5216-01	TCGA-28-5216-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:75160035C>T	uc001owo.3	-	10	1238	c.701G>A	c.(700-702)CGC>CAC	p.R234H	GDPD5_uc001owp.3_Missense_Mutation_p.R234H|GDPD5_uc001own.3_5'UTR|GDPD5_uc009yuc.2_Missense_Mutation_p.R96H|GDPD5_uc009yud.2_Missense_Mutation_p.R115H|GDPD5_uc009yue.1_Missense_Mutation_p.R122H	NM_030792	NP_110419	Q8WTR4	GDPD5_HUMAN	glycerophosphodiester phosphodiesterase domain	234	Extracellular (Potential).|GDPD.				glycerol metabolic process|lipid metabolic process|nervous system development	endomembrane system|growth cone|integral to membrane|perinuclear region of cytoplasm	glycerophosphodiester phosphodiesterase activity			ovary(1)	1						GGGGGCCCCGCGGTGGCCAAT	0.607													29	28	---	---	---	---	capture	Missense_Mutation	SNP	75160035	75160035	GDPD5	11	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	6267	223
USP35	57558	broad.mit.edu	37	11	77920718	77920718	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5216-01	TCGA-28-5216-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:77920718G>A	uc009yva.1	+	10	2063	c.1817G>A	c.(1816-1818)TGT>TAT	p.C606Y	USP35_uc001oze.2_Missense_Mutation_p.C362Y|USP35_uc001ozc.2_Missense_Mutation_p.C174Y|USP35_uc010rsp.1_Missense_Mutation_p.C38Y|USP35_uc001ozd.2_Missense_Mutation_p.C217Y|USP35_uc001ozf.2_Missense_Mutation_p.C337Y	NM_020798	NP_065849	Q9P2H5	UBP35_HUMAN	ubiquitin specific protease 35	606					ubiquitin-dependent protein catabolic process		binding|cysteine-type peptidase activity|ubiquitin thiolesterase activity			lung(2)|ovary(1)	3	all_cancers(14;3.77e-18)|all_epithelial(13;6.16e-21)|Breast(9;5.6e-16)|Ovarian(111;0.152)		OV - Ovarian serous cystadenocarcinoma(8;1.04e-25)			CCTGAGCGCTGTCGCCGCCGC	0.657													42	104	---	---	---	---	capture	Missense_Mutation	SNP	77920718	77920718	USP35	11	G	A	A	A	1	0	0	0	0	1	0	0	0	624	48	2	2	16948	223
HEPHL1	341208	broad.mit.edu	37	11	93803618	93803618	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5216-01	TCGA-28-5216-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:93803618G>A	uc001pep.2	+	6	1299	c.1142G>A	c.(1141-1143)CGC>CAC	p.R381H	uc001pen.1_Intron	NM_001098672	NP_001092142	Q6MZM0	HPHL1_HUMAN	hephaestin-like 1 precursor	381	Plastocyanin-like 3.|Extracellular (Potential).				copper ion transport	integral to membrane	copper ion binding|oxidoreductase activity			ovary(3)	3		Acute lymphoblastic leukemia(157;2.34e-05)|all_hematologic(158;0.00824)				CAACAGAGGCGCTACTTTATA	0.443													15	18	---	---	---	---	capture	Missense_Mutation	SNP	93803618	93803618	HEPHL1	11	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	6981	223
SOX5	6660	broad.mit.edu	37	12	24048786	24048786	+	Missense_Mutation	SNP	A	G	G			TCGA-28-5216-01	TCGA-28-5216-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:24048786A>G	uc001rfw.2	-	2	313	c.211T>C	c.(211-213)TCT>CCT	p.S71P	SOX5_uc001rfx.2_Missense_Mutation_p.S58P|SOX5_uc001rfy.2_Missense_Mutation_p.S58P|SOX5_uc010siv.1_Missense_Mutation_p.S58P|SOX5_uc010siw.1_RNA|SOX5_uc001rfz.1_Intron|SOX5_uc001rga.2_Intron	NM_006940	NP_008871	P35711	SOX5_HUMAN	SRY (sex determining region Y)-box 5 isoform a	71					transcription from RNA polymerase II promoter	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(5)|lung(1)	6						GTCAGCAGAGAAACTGGCTGA	0.483													242	226	---	---	---	---	capture	Missense_Mutation	SNP	24048786	24048786	SOX5	12	A	G	G	G	1	0	0	0	0	1	0	0	0	117	9	3	3	14846	223
OR8S1	341568	broad.mit.edu	37	12	48919470	48919470	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5216-01	TCGA-28-5216-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:48919470C>T	uc010slu.1	+	1	56	c.56C>T	c.(55-57)GCC>GTC	p.A19V		NM_001005203	NP_001005203	Q8NH09	OR8S1_HUMAN	olfactory receptor, family 8, subfamily S,	19	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1						GGGCTGTCTGCCGACCCCAAC	0.512													5	275	---	---	---	---	capture	Missense_Mutation	SNP	48919470	48919470	OR8S1	12	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	11150	223
ADCY6	112	broad.mit.edu	37	12	49177053	49177053	+	Silent	SNP	G	T	T			TCGA-28-5216-01	TCGA-28-5216-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:49177053G>T	uc001rsh.3	-	1	825	c.165C>A	c.(163-165)CCC>CCA	p.P55P	ADCY6_uc001rsj.3_Silent_p.P55P|ADCY6_uc001rsi.3_Silent_p.P55P	NM_015270	NP_056085	O43306	ADCY6_HUMAN	adenylate cyclase 6 isoform a	55	Cytoplasmic (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane	ATP binding|metal ion binding				0						CCGCAGGGGTGGGGCTGGGTG	0.726													13	16	---	---	---	---	capture	Silent	SNP	49177053	49177053	ADCY6	12	G	T	T	T	1	0	0	0	0	0	0	0	1	600	47	4	4	298	223
ADCY6	112	broad.mit.edu	37	12	49177063	49177063	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5216-01	TCGA-28-5216-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:49177063G>A	uc001rsh.3	-	1	815	c.155C>T	c.(154-156)CCA>CTA	p.P52L	ADCY6_uc001rsj.3_Missense_Mutation_p.P52L|ADCY6_uc001rsi.3_Missense_Mutation_p.P52L	NM_015270	NP_056085	O43306	ADCY6_HUMAN	adenylate cyclase 6 isoform a	52	Cytoplasmic (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane	ATP binding|metal ion binding				0						GGGGCTGGGTGGCTCTGCATC	0.716													11	16	---	---	---	---	capture	Missense_Mutation	SNP	49177063	49177063	ADCY6	12	G	A	A	A	1	0	0	0	0	1	0	0	0	611	47	2	2	298	223
CEP290	80184	broad.mit.edu	37	12	88505570	88505570	+	Silent	SNP	A	G	G			TCGA-28-5216-01	TCGA-28-5216-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:88505570A>G	uc001tar.2	-	21	2462	c.2118T>C	c.(2116-2118)GAT>GAC	p.D706D	CEP290_uc001tat.2_Silent_p.D499D|CEP290_uc009zsl.1_RNA	NM_025114	NP_079390	O15078	CE290_HUMAN	centrosomal protein 290kDa	706	Potential.				cilium assembly|eye photoreceptor cell development|G2/M transition of mitotic cell cycle|hindbrain development|otic vesicle formation|positive regulation of transcription, DNA-dependent|pronephros development|protein transport	cell surface|centrosome|cytosol|nucleus|photoreceptor connecting cilium	protein binding			ovary(5)|breast(1)|pancreas(1)	7						CGGTAAGCTGATCAACTTGGG	0.368													9	66	---	---	---	---	capture	Silent	SNP	88505570	88505570	CEP290	12	A	G	G	G	1	0	0	0	0	0	0	0	1	154	12	3	3	3221	223
ARL1	400	broad.mit.edu	37	12	101796696	101796696	+	Silent	SNP	C	T	T			TCGA-28-5216-01	TCGA-28-5216-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:101796696C>T	uc001tib.2	-	3	320	c.171G>A	c.(169-171)ACG>ACA	p.T57T	ARL1_uc010svn.1_Silent_p.T11T|ARL1_uc010svo.1_RNA|ARL1_uc001tic.2_Silent_p.T57T	NM_001177	NP_001168	P40616	ARL1_HUMAN	ADP-ribosylation factor-like 1	57					small GTPase mediated signal transduction	Golgi membrane	enzyme activator activity|GTP binding|GTPase activity|metal ion binding|protein binding			central_nervous_system(1)	1		Lung NSC(355;2.1e-05)|Breast(359;0.00015)|Myeloproliferative disorder(1001;0.163)		GBM - Glioblastoma multiforme(134;1.67e-09)|BRCA - Breast invasive adenocarcinoma(302;0.0125)		GGTTTTTGTACGTCACCGTCT	0.358													36	75	---	---	---	---	capture	Silent	SNP	101796696	101796696	ARL1	12	C	T	T	T	1	0	0	0	0	0	0	0	1	236	19	1	1	918	223
SACS	26278	broad.mit.edu	37	13	23911703	23911703	+	Silent	SNP	C	T	T			TCGA-28-5216-01	TCGA-28-5216-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:23911703C>T	uc001uon.2	-	10	6901	c.6312G>A	c.(6310-6312)GGG>GGA	p.G2104G	SACS_uc001uoo.2_Silent_p.G1957G|SACS_uc001uop.1_Intron|SACS_uc001uoq.1_Intron	NM_014363	NP_055178	Q9NZJ4	SACS_HUMAN	sacsin	2104					cell death|negative regulation of inclusion body assembly|protein folding	axon|cell body fiber|dendrite|mitochondrion|nucleus	ATP binding|chaperone binding|Hsp70 protein binding|proteasome binding			ovary(7)|skin(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	12		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		CCAAAGGATGCCCCTCCAAGG	0.403													4	105	---	---	---	---	capture	Silent	SNP	23911703	23911703	SACS	13	C	T	T	T	1	0	0	0	0	0	0	0	1	327	26	2	2	13696	223
HEATR5A	25938	broad.mit.edu	37	14	31816973	31816973	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5216-01	TCGA-28-5216-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:31816973C>T	uc001wrf.3	-	13	2047	c.1970G>A	c.(1969-1971)AGC>AAC	p.S657N	HEATR5A_uc010ami.2_Missense_Mutation_p.S555N|HEATR5A_uc001wrg.1_Missense_Mutation_p.S539N|HEATR5A_uc010tpk.1_Missense_Mutation_p.S950N	NM_015473	NP_056288	Q86XA9	HTR5A_HUMAN	HEAT repeat containing 5A	944							binding			ovary(1)	1	Hepatocellular(127;0.0877)|Breast(36;0.137)		LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.0797)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.0059)		AGGAGAAGTGCTGTCCTGCGC	0.383													13	8	---	---	---	---	capture	Missense_Mutation	SNP	31816973	31816973	HEATR5A	14	C	T	T	T	1	0	0	0	0	1	0	0	0	364	28	2	2	6958	223
GPR132	29933	broad.mit.edu	37	14	105518249	105518249	+	Silent	SNP	G	A	A			TCGA-28-5216-01	TCGA-28-5216-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:105518249G>A	uc001yqd.2	-	4	1124	c.225C>T	c.(223-225)AAC>AAT	p.N75N	GPR132_uc001yqc.2_Translation_Start_Site|GPR132_uc001yqe.2_Silent_p.N66N	NM_013345	NP_037477	Q9UNW8	GP132_HUMAN	G protein-coupled receptor 132	75	Cytoplasmic (Potential).				response to stress	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(2)|central_nervous_system(1)	3		all_cancers(154;0.0953)|Melanoma(154;0.155)|all_epithelial(191;0.219)	OV - Ovarian serous cystadenocarcinoma(23;0.00778)|all cancers(16;0.00936)|Epithelial(46;0.0227)	Epithelial(152;0.02)|all cancers(159;0.0419)|OV - Ovarian serous cystadenocarcinoma(161;0.0521)		CGGCCAGCACGTTGCCCTGCA	0.647													68	10	---	---	---	---	capture	Silent	SNP	105518249	105518249	GPR132	14	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	6576	223
C15orf55	256646	broad.mit.edu	37	15	34640826	34640826	+	Missense_Mutation	SNP	C	T	T	rs138533937		TCGA-28-5216-01	TCGA-28-5216-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:34640826C>T	uc001zif.2	+	2	828	c.673C>T	c.(673-675)CGG>TGG	p.R225W	C15orf55_uc010ucc.1_Missense_Mutation_p.R253W|C15orf55_uc010ucd.1_Missense_Mutation_p.R243W	NM_175741	NP_786883	Q86Y26	NUT_HUMAN	nuclear protein in testis	225						cytoplasm|nucleus			BRD4_ENST00000263377/C15orf55(24)|BRD3/C15orf55(3)	midline_organs(25)|ovary(2)|lung(2)|skin(1)	30		all_lung(180;2.78e-08)		all cancers(64;4.53e-18)|GBM - Glioblastoma multiforme(113;8.29e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0249)		AGCCTTGGCCCGGAGGCACCT	0.483			T	BRD3|BRD4	lethal midline carcinoma								17	162	---	---	---	---	capture	Missense_Mutation	SNP	34640826	34640826	C15orf55	15	C	T	T	T	1	0	0	0	0	1	0	0	0	295	23	1	1	1789	223
TRPM7	54822	broad.mit.edu	37	15	50935595	50935595	+	Silent	SNP	A	G	G			TCGA-28-5216-01	TCGA-28-5216-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:50935595A>G	uc001zyt.3	-	5	741	c.477T>C	c.(475-477)GGT>GGC	p.G159G	TRPM7_uc010bew.1_Silent_p.G159G	NM_017672	NP_060142	Q96QT4	TRPM7_HUMAN	transient receptor potential cation channel,	159	Cytoplasmic (Potential).				cell death	integral to membrane	ATP binding|calcium channel activity|metal ion binding|protein serine/threonine kinase activity			ovary(4)|stomach(3)|breast(1)|central_nervous_system(1)|skin(1)	10				all cancers(107;0.000819)|GBM - Glioblastoma multiforme(94;0.0045)		CTTTAATAAGACCTTTTCCAA	0.383													5	263	---	---	---	---	capture	Silent	SNP	50935595	50935595	TRPM7	15	A	G	G	G	1	0	0	0	0	0	0	0	1	119	10	3	3	16474	223
KIF7	374654	broad.mit.edu	37	15	90189143	90189143	+	Missense_Mutation	SNP	G	A	A	rs150543610		TCGA-28-5216-01	TCGA-28-5216-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:90189143G>A	uc002bof.2	-	8	1980	c.1903C>T	c.(1903-1905)CGG>TGG	p.R635W	KIF7_uc010upw.1_Missense_Mutation_p.R122W	NM_198525	NP_940927	Q2M1P5	KIF7_HUMAN	kinesin family member 7	635					microtubule-based movement|negative regulation of smoothened signaling pathway|positive regulation of smoothened signaling pathway	cilium	ATP binding|microtubule motor activity|protein binding			ovary(2)|lung(1)	3	Lung NSC(78;0.0237)|all_lung(78;0.0478)		BRCA - Breast invasive adenocarcinoma(143;0.128)			TGTAAGGTCCGCCTGGGCGGc	0.577													8	74	---	---	---	---	capture	Missense_Mutation	SNP	90189143	90189143	KIF7	15	G	A	A	A	1	0	0	0	0	1	0	0	0	493	38	1	1	8231	223
UMOD	7369	broad.mit.edu	37	16	20357616	20357616	+	Missense_Mutation	SNP	A	T	T			TCGA-28-5216-01	TCGA-28-5216-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:20357616A>T	uc002dgz.2	-	5	1143	c.1014T>A	c.(1012-1014)AAT>AAA	p.N338K	UMOD_uc002dha.2_Missense_Mutation_p.N338K|UMOD_uc002dhb.2_Missense_Mutation_p.N371K	NM_003361	NP_003352	P07911	UROM_HUMAN	uromodulin precursor	338	ZP.				cellular defense response|negative regulation of cell proliferation	anchored to membrane|apical plasma membrane|basolateral plasma membrane|cilium membrane|extrinsic to membrane|primary cilium|spindle pole	calcium ion binding			ovary(1)|skin(1)	2						CCTTCATGTCATTGGCCCCAC	0.557													31	89	---	---	---	---	capture	Missense_Mutation	SNP	20357616	20357616	UMOD	16	A	T	T	T	1	0	0	0	0	1	0	0	0	102	8	4	4	16861	223
TP53	7157	broad.mit.edu	37	17	7577535	7577535	+	Missense_Mutation	SNP	C	A	A			TCGA-28-5216-01	TCGA-28-5216-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7577535C>A	uc002gim.2	-	7	940	c.746G>T	c.(745-747)AGG>ATG	p.R249M	TP53_uc002gig.1_Missense_Mutation_p.R249M|TP53_uc002gih.2_Missense_Mutation_p.R249M|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.R117M|TP53_uc010cng.1_Missense_Mutation_p.R117M|TP53_uc002gii.1_Missense_Mutation_p.R117M|TP53_uc010cnh.1_Missense_Mutation_p.R249M|TP53_uc010cni.1_Missense_Mutation_p.R249M|TP53_uc002gij.2_Missense_Mutation_p.R249M|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Missense_Mutation_p.R156M|TP53_uc002gio.2_Missense_Mutation_p.R117M	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	249	|Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		R -> W (in sporadic cancers; somatic mutation).|RP -> SA (in a sporadic cancer; somatic mutation).|RP -> SS (in sporadic cancers; somatic mutation).|R -> T (in sporadic cancers; somatic mutation).|R -> N (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|R -> I (in a sporadic cancer; somatic mutation).|R -> M (in sporadic cancers; somatic mutation).|R -> G (in sporadic cancers; somatic mutation).|R -> K (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.R249S(303)|p.R249M(25)|p.R249G(24)|p.R249W(23)|p.R249T(16)|p.R249K(14)|p.0?(7)|p.R249R(6)|p.R249fs*96(6)|p.M246_P250delMNRRP(2)|p.R249fs*14(2)|p.R248_P250delRRP(1)|p.R249_P250delRP(1)|p.R249_P250insR(1)|p.R249_P250>SS(1)|p.N247_R249delNRR(1)|p.N247_P250delNRRP(1)|p.R249fs*19(1)|p.R249_T256delRPILTIIT(1)|p.R249fs*15(1)|p.R249_I251delRPI(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		GAGGATGGGCCTCCGGTTCAT	0.567		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			45	14	---	---	---	---	capture	Missense_Mutation	SNP	7577535	7577535	TP53	17	C	A	A	A	1	0	0	0	0	1	0	0	0	312	24	4	4	16264	223
CHD3	1107	broad.mit.edu	37	17	7811263	7811263	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5216-01	TCGA-28-5216-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7811263G>A	uc002gje.2	+	34	5228	c.5078G>A	c.(5077-5079)CGG>CAG	p.R1693Q	CHD3_uc002gjd.2_Missense_Mutation_p.R1752Q|CHD3_uc002gjf.2_Missense_Mutation_p.R1659Q|CHD3_uc002gjh.2_Missense_Mutation_p.R270Q|CHD3_uc002gjj.2_5'Flank	NM_001005273	NP_001005273	Q12873	CHD3_HUMAN	chromodomain helicase DNA binding protein 3	1693	Required for interaction with PCNT.				chromatin modification|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	microtubule organizing center|NuRD complex	ATP binding|ATP-dependent DNA helicase activity|DNA binding|protein binding|zinc ion binding			breast(1)	1		Prostate(122;0.202)				GATGAGCCACGGTCCAATGGG	0.567													63	111	---	---	---	---	capture	Missense_Mutation	SNP	7811263	7811263	CHD3	17	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	3292	223
MYH2	4620	broad.mit.edu	37	17	10428377	10428377	+	Silent	SNP	A	G	G			TCGA-28-5216-01	TCGA-28-5216-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:10428377A>G	uc010coi.2	-	34	4796	c.4668T>C	c.(4666-4668)TCT>TCC	p.S1556S	uc002gml.1_Intron|MYH2_uc002gmp.3_Silent_p.S1556S|MYH2_uc010coj.2_Intron	NM_001100112	NP_001093582	Q9UKX2	MYH2_HUMAN	myosin heavy chain IIa	1556	Potential.				muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(5)|pancreas(4)|skin(3)|lung(1)|kidney(1)	14						CATGTTCAAGAGATGCCTTAA	0.388													186	34	---	---	---	---	capture	Silent	SNP	10428377	10428377	MYH2	17	A	G	G	G	1	0	0	0	0	0	0	0	1	132	11	3	3	9945	223
ABCA8	10351	broad.mit.edu	37	17	66924136	66924136	+	Silent	SNP	A	T	T			TCGA-28-5216-01	TCGA-28-5216-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:66924136A>T	uc002jhp.2	-	9	1373	c.1194T>A	c.(1192-1194)ATT>ATA	p.I398I	ABCA8_uc002jhq.2_Silent_p.I398I|ABCA8_uc010wqq.1_Silent_p.I398I|ABCA8_uc010wqr.1_Silent_p.I337I|ABCA8_uc002jhr.2_Silent_p.I398I	NM_007168	NP_009099	O94911	ABCA8_HUMAN	ATP-binding cassette, sub-family A member 8	398	Helical; (Potential).					integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(2)|skin(1)	3	Breast(10;4.56e-13)					TTGTTGCTACAATGAGATTTG	0.328													77	17	---	---	---	---	capture	Silent	SNP	66924136	66924136	ABCA8	17	A	T	T	T	1	0	0	0	0	0	0	0	1	60	5	4	4	38	223
DSG3	1830	broad.mit.edu	37	18	29052349	29052349	+	Missense_Mutation	SNP	A	G	G			TCGA-28-5216-01	TCGA-28-5216-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:29052349A>G	uc002kws.2	+	13	2109	c.2000A>G	c.(1999-2001)CAT>CGT	p.H667R	DSG3_uc002kwt.2_5'Flank	NM_001944	NP_001935	P32926	DSG3_HUMAN	desmoglein 3 preproprotein	667	Cytoplasmic (Potential).				cellular component disassembly involved in apoptosis|homophilic cell adhesion	cytosol|desmosome|integral to membrane	calcium ion binding			skin(4)|ovary(3)|lung(1)|central_nervous_system(1)	9			OV - Ovarian serous cystadenocarcinoma(10;0.00504)			GGAACAATTCATCAGTGGGGA	0.448													24	102	---	---	---	---	capture	Missense_Mutation	SNP	29052349	29052349	DSG3	18	A	G	G	G	1	0	0	0	0	1	0	0	0	104	8	3	3	4733	223
ZFR2	23217	broad.mit.edu	37	19	3823274	3823274	+	Silent	SNP	C	A	A			TCGA-28-5216-01	TCGA-28-5216-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:3823274C>A	uc002lyw.2	-	8	1353	c.1341G>T	c.(1339-1341)GCG>GCT	p.A447A	ZFR2_uc010xhx.1_RNA	NM_015174	NP_055989	Q9UPR6	ZFR2_HUMAN	zinc finger RNA binding protein 2 isoform 1	447						intracellular	nucleic acid binding|zinc ion binding			central_nervous_system(1)|pancreas(1)	2				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00514)|STAD - Stomach adenocarcinoma(1328;0.19)		CCACCGGCTGCGCATCAGAGC	0.622													29	278	---	---	---	---	capture	Silent	SNP	3823274	3823274	ZFR2	19	C	A	A	A	1	0	0	0	0	0	0	0	1	340	27	4	4	17540	223
RFX1	5989	broad.mit.edu	37	19	14079442	14079442	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5216-01	TCGA-28-5216-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:14079442C>T	uc002mxv.2	-	12	1939	c.1667G>A	c.(1666-1668)GGG>GAG	p.G556E		NM_002918	NP_002909	P22670	RFX1_HUMAN	regulatory factor X1	556					immune response	nucleus	DNA binding|protein binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity			lung(1)|pancreas(1)	2			OV - Ovarian serous cystadenocarcinoma(19;6.67e-23)			CGGCTGCTGCCCCACCGCCAC	0.662													28	52	---	---	---	---	capture	Missense_Mutation	SNP	14079442	14079442	RFX1	19	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	13157	223
CPAMD8	27151	broad.mit.edu	37	19	17013524	17013524	+	Silent	SNP	G	A	A			TCGA-28-5216-01	TCGA-28-5216-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:17013524G>A	uc002nfb.2	-	35	4793	c.4761C>T	c.(4759-4761)GAC>GAT	p.D1587D	CPAMD8_uc002nfd.1_Silent_p.D52D	NM_015692	NP_056507	Q8IZJ3	CPMD8_HUMAN	C3 and PZP-like, alpha-2-macroglobulin domain	1540	Poly-Asp.					extracellular space|plasma membrane	serine-type endopeptidase inhibitor activity			ovary(4)|breast(4)|large_intestine(3)|pancreas(1)|skin(1)	13						GGTCATCATCGTCAGCTGGGG	0.662													28	49	---	---	---	---	capture	Silent	SNP	17013524	17013524	CPAMD8	19	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	3760	223
CEACAM20	125931	broad.mit.edu	37	19	45021085	45021085	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5216-01	TCGA-28-5216-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:45021085C>T	uc010ejn.1	-	6	1247	c.1231G>A	c.(1231-1233)GAC>AAC	p.D411N	CEACAM20_uc010ejo.1_Missense_Mutation_p.D411N|CEACAM20_uc010ejp.1_Intron|CEACAM20_uc010ejq.1_Intron	NM_001102597	NP_001096067	Q6UY09	CEA20_HUMAN	carcinoembryonic antigen-related cell adhesion	411	Ig-like C2-type 4.|Extracellular (Potential).					integral to membrane				large_intestine(2)	2		Prostate(69;0.0352)				TAGATCCCGTCGTGTTCCCAG	0.592													10	8	---	---	---	---	capture	Missense_Mutation	SNP	45021085	45021085	CEACAM20	19	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	3160	223
VN1R2	317701	broad.mit.edu	37	19	53761868	53761868	+	Silent	SNP	C	T	T			TCGA-28-5216-01	TCGA-28-5216-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:53761868C>T	uc002qbi.2	+	1	324	c.240C>T	c.(238-240)CAC>CAT	p.H80H		NM_173856	NP_776255	Q8NFZ6	VN1R2_HUMAN	vomeronasal 1 receptor 2	80	Cytoplasmic (Potential).				response to pheromone	integral to membrane|plasma membrane	pheromone receptor activity				0				GBM - Glioblastoma multiforme(134;0.00301)		tctctgcacacggagagaaac	0.104													18	16	---	---	---	---	capture	Silent	SNP	53761868	53761868	VN1R2	19	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	17061	223
GPN1	11321	broad.mit.edu	37	2	27861753	27861753	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5216-01	TCGA-28-5216-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:27861753C>T	uc010ymc.1	+	9	635	c.614C>T	c.(613-615)ACT>ATT	p.T205I	GPN1_uc010ezf.2_Missense_Mutation_p.T179I|GPN1_uc010yma.1_Missense_Mutation_p.T112I|GPN1_uc010ymb.1_Missense_Mutation_p.T96I|GPN1_uc010ymd.1_Missense_Mutation_p.T86I|GPN1_uc010yme.1_Missense_Mutation_p.T205I|GPN1_uc010ezg.1_Missense_Mutation_p.T86I	NM_007266	NP_009197	Q9HCN4	GPN1_HUMAN	GPN-loop GTPase 1 isoform a	191						cytoplasm	GTP binding|nucleoside-triphosphatase activity|protein binding				0						CTGGTACAGACTGACATCATT	0.393													11	117	---	---	---	---	capture	Missense_Mutation	SNP	27861753	27861753	GPN1	2	C	T	T	T	1	0	0	0	0	1	0	0	0	260	20	2	2	6551	223
TTN	7273	broad.mit.edu	37	2	179496000	179496000	+	Missense_Mutation	SNP	A	C	C			TCGA-28-5216-01	TCGA-28-5216-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179496000A>C	uc010zfg.1	-	186	36295	c.36071T>G	c.(36070-36072)CTT>CGT	p.L12024R	TTN_uc010zfh.1_Missense_Mutation_p.L5719R|TTN_uc010zfi.1_Missense_Mutation_p.L5652R|TTN_uc010zfj.1_Missense_Mutation_p.L5527R	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	12951							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ATAATCTTGAAGTTTTCCTGT	0.348													12	37	---	---	---	---	capture	Missense_Mutation	SNP	179496000	179496000	TTN	2	A	C	C	C	1	0	0	0	0	1	0	0	0	39	3	4	4	16617	223
DNAH7	56171	broad.mit.edu	37	2	196753131	196753131	+	Missense_Mutation	SNP	C	G	G			TCGA-28-5216-01	TCGA-28-5216-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:196753131C>G	uc002utj.3	-	33	5358	c.5257G>C	c.(5257-5259)GAG>CAG	p.E1753Q		NM_018897	NP_061720	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	1753	AAA 2 (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			skin(10)|ovary(2)	12						ATGTGAGGCTCCATGTAAATC	0.393													4	77	---	---	---	---	capture	Missense_Mutation	SNP	196753131	196753131	DNAH7	2	C	G	G	G	1	0	0	0	0	1	0	0	0	390	30	4	4	4562	223
ZDBF2	57683	broad.mit.edu	37	2	207171009	207171009	+	Missense_Mutation	SNP	A	G	G			TCGA-28-5216-01	TCGA-28-5216-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:207171009A>G	uc002vbp.2	+	5	2007	c.1757A>G	c.(1756-1758)GAT>GGT	p.D586G		NM_020923	NP_065974	Q9HCK1	ZDBF2_HUMAN	zinc finger, DBF-type containing 2	586							nucleic acid binding|zinc ion binding			ovary(3)	3						TTTGATTGTGATGTTTCTCTT	0.428													24	62	---	---	---	---	capture	Missense_Mutation	SNP	207171009	207171009	ZDBF2	2	A	G	G	G	1	0	0	0	0	1	0	0	0	156	12	3	3	17479	223
MMP9	4318	broad.mit.edu	37	20	44639814	44639814	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5216-01	TCGA-28-5216-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:44639814G>A	uc002xqz.2	+	5	701	c.682G>A	c.(682-684)GCG>ACG	p.A228T		NM_004994	NP_004985	P14780	MMP9_HUMAN	matrix metalloproteinase 9 preproprotein	228	Fibronectin type-II 1.				collagen catabolic process|macrophage differentiation|positive regulation of keratinocyte migration|proteolysis	extracellular space|proteinaceous extracellular matrix	collagen binding|metalloendopeptidase activity|zinc ion binding	p.A228A(1)		ovary(1)|pancreas(1)	2		Myeloproliferative disorder(115;0.0122)			Glucosamine(DB01296)|Marimastat(DB00786)|Minocycline(DB01017)|Simvastatin(DB00641)	CGCAGATGGCGCGGCCTGCCA	0.637													174	96	---	---	---	---	capture	Missense_Mutation	SNP	44639814	44639814	MMP9	20	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	9581	223
SALL4	57167	broad.mit.edu	37	20	50408434	50408434	+	Silent	SNP	C	A	A	rs143754390		TCGA-28-5216-01	TCGA-28-5216-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:50408434C>A	uc002xwh.3	-	2	689	c.588G>T	c.(586-588)CGG>CGT	p.R196R	SALL4_uc010gii.2_Silent_p.R196R|SALL4_uc002xwi.3_Intron	NM_020436	NP_065169	Q9UJQ4	SALL4_HUMAN	sal-like 4	196					transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2						CATCCGCGCTCCGCTGATTCA	0.602													84	201	---	---	---	---	capture	Silent	SNP	50408434	50408434	SALL4	20	C	A	A	A	1	0	0	0	0	0	0	0	1	379	30	4	4	13705	223
ZNF860	344787	broad.mit.edu	37	3	32031844	32031844	+	Missense_Mutation	SNP	T	G	G			TCGA-28-5216-01	TCGA-28-5216-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:32031844T>G	uc011axg.1	+	2	1822	c.1273T>G	c.(1273-1275)TCT>GCT	p.S425A		NM_001137674	NP_001131146	A6NHJ4	ZN860_HUMAN	zinc finger protein 860	425					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						TGAAGAGAGATCTTACAAGTG	0.348													35	84	---	---	---	---	capture	Missense_Mutation	SNP	32031844	32031844	ZNF860	3	T	G	G	G	1	0	0	0	0	1	0	0	0	650	50	4	4	18070	223
SETD2	29072	broad.mit.edu	37	3	47127761	47127761	+	Missense_Mutation	SNP	T	C	C			TCGA-28-5216-01	TCGA-28-5216-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:47127761T>C	uc003cqs.2	-	11	5374	c.5321A>G	c.(5320-5322)CAT>CGT	p.H1774R	SETD2_uc003cqv.2_Missense_Mutation_p.H1841R|SETD2_uc003cqt.1_5'Flank	NM_014159	NP_054878	Q9BYW2	SETD2_HUMAN	SET domain containing 2	1774					regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleus	DNA binding|histone-lysine N-methyltransferase activity|oxidoreductase activity|transition metal ion binding			kidney(24)|ovary(5)|skin(1)|central_nervous_system(1)|breast(1)	32		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		AGACAGCCCATGACGTTCCAG	0.498			N|F|S|Mis		clear cell renal carcinoma								39	101	---	---	---	---	capture	Missense_Mutation	SNP	47127761	47127761	SETD2	3	T	C	C	C	1	0	0	0	0	1	0	0	0	663	51	3	3	14024	223
MST1	4485	broad.mit.edu	37	3	49723304	49723304	+	Silent	SNP	C	T	T			TCGA-28-5216-01	TCGA-28-5216-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:49723304C>T	uc003cxg.2	-	10	1311	c.1239G>A	c.(1237-1239)CCG>CCA	p.P413P	MST1_uc011bcs.1_Missense_Mutation_p.R452H	NM_020998	NP_066278	P26927	HGFL_HUMAN	macrophage stimulating 1 (hepatocyte growth	399	Kringle 4.				proteolysis	extracellular region	serine-type endopeptidase activity			lung(1)	1				BRCA - Breast invasive adenocarcinoma(193;4.47e-05)|Kidney(197;0.00216)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		GCGGCTTGTGCGGCGTCTCAG	0.682													6	323	---	---	---	---	capture	Silent	SNP	49723304	49723304	MST1	3	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	9800	223
SLMAP	7871	broad.mit.edu	37	3	57898233	57898233	+	Missense_Mutation	SNP	G	T	T			TCGA-28-5216-01	TCGA-28-5216-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:57898233G>T	uc003dje.1	+	18	1979	c.1774G>T	c.(1774-1776)GCA>TCA	p.A592S	SLMAP_uc003djd.1_Missense_Mutation_p.A575S|SLMAP_uc003djf.1_Missense_Mutation_p.A554S|SLMAP_uc003djg.1_Missense_Mutation_p.A186S|SLMAP_uc011bez.1_Missense_Mutation_p.A60S|SLMAP_uc011bfa.1_Missense_Mutation_p.A126S|SLMAP_uc003djh.2_Missense_Mutation_p.A85S|SLMAP_uc003dji.1_Missense_Mutation_p.A126S|SLMAP_uc011bfb.1_Missense_Mutation_p.A126S|SLMAP_uc011bfc.1_Missense_Mutation_p.A85S	NM_007159	NP_009090	Q14BN4	SLMAP_HUMAN	sarcolemma associated protein	592	Cytoplasmic (Potential).|Potential.				muscle contraction|protein folding	integral to plasma membrane|microtubule organizing center|prefoldin complex|sarcolemma|smooth endoplasmic reticulum	unfolded protein binding				0				BRCA - Breast invasive adenocarcinoma(55;0.000271)|KIRC - Kidney renal clear cell carcinoma(284;0.0602)|Kidney(284;0.0754)|OV - Ovarian serous cystadenocarcinoma(275;0.182)		TCAAGCAGCAGCAAAGGTTGC	0.483													104	72	---	---	---	---	capture	Missense_Mutation	SNP	57898233	57898233	SLMAP	3	G	T	T	T	1	0	0	0	0	1	0	0	0	442	34	4	4	14641	223
ARPM1	84517	broad.mit.edu	37	3	169487253	169487253	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5216-01	TCGA-28-5216-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:169487253G>A	uc003ffs.1	-	1	431	c.56C>T	c.(55-57)GCG>GTG	p.A19V		NM_032487	NP_115876	Q9BYD9	ARPM1_HUMAN	actin related protein M1	19						cytoplasm|cytoskeleton					0	all_cancers(22;9.55e-22)|all_epithelial(15;2.04e-26)|all_lung(20;5.05e-16)|Lung NSC(18;2.19e-15)|Ovarian(172;0.000223)|Breast(254;0.197)		Epithelial(2;4.03e-64)|all cancers(2;5.01e-59)|Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.00676)			AGCCACGCCCGCCTTGATCAT	0.672													5	87	---	---	---	---	capture	Missense_Mutation	SNP	169487253	169487253	ARPM1	3	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	969	223
KIAA1109	84162	broad.mit.edu	37	4	123238013	123238013	+	Missense_Mutation	SNP	C	G	G			TCGA-28-5216-01	TCGA-28-5216-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:123238013C>G	uc003ieh.2	+	60	10711	c.10666C>G	c.(10666-10668)CTG>GTG	p.L3556V	KIAA1109_uc003iel.1_Missense_Mutation_p.L1491V	NM_015312	NP_056127	Q2LD37	K1109_HUMAN	fragile site-associated protein	3556					regulation of cell growth|regulation of epithelial cell differentiation	integral to membrane|nucleus				ovary(8)|skin(2)|pancreas(1)|central_nervous_system(1)	12						AATAGATGATCTGAAGTATGT	0.254													35	45	---	---	---	---	capture	Missense_Mutation	SNP	123238013	123238013	KIAA1109	4	C	G	G	G	1	0	0	0	0	1	0	0	0	415	32	4	4	8130	223
KIAA1712	80817	broad.mit.edu	37	4	175229838	175229838	+	Splice_Site	SNP	A	G	G			TCGA-28-5216-01	TCGA-28-5216-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:175229838A>G	uc003itr.2	+	7	922	c.508_splice	c.e7-2	p.K170_splice	KIAA1712_uc010iro.2_Splice_Site_p.K170_splice|KIAA1712_uc003its.2_Splice_Site	NM_001040157	NP_001035247	Q9C0F1	CEP44_HUMAN	HBV PreS1-transactivated protein 3 isoform a							centrosome|midbody|spindle pole					0		Prostate(90;0.00276)|Melanoma(52;0.0179)|Renal(120;0.0376)|Breast(14;0.0991)|all_hematologic(60;0.124)|all_neural(102;0.196)		all cancers(43;4.06e-18)|Epithelial(43;1.18e-15)|OV - Ovarian serous cystadenocarcinoma(60;4.65e-09)|GBM - Glioblastoma multiforme(59;0.00098)|STAD - Stomach adenocarcinoma(60;0.0029)|LUSC - Lung squamous cell carcinoma(193;0.0949)		TTCTCTATGCAGAAGAAAGCT	0.249													59	81	---	---	---	---	capture	Splice_Site	SNP	175229838	175229838	KIAA1712	4	A	G	G	G	1	0	0	0	0	0	0	1	0	91	7	5	3	8175	223
ZNF608	57507	broad.mit.edu	37	5	124080387	124080387	+	Missense_Mutation	SNP	T	G	G			TCGA-28-5216-01	TCGA-28-5216-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:124080387T>G	uc003ktq.1	-	1	419	c.296A>C	c.(295-297)AAA>ACA	p.K99T	ZNF608_uc003ktr.1_RNA|ZNF608_uc003kts.1_Missense_Mutation_p.K99T|ZNF608_uc003ktt.1_Missense_Mutation_p.K99T	NM_020747	NP_065798	Q9ULD9	ZN608_HUMAN	zinc finger protein 608	99						intracellular	zinc ion binding			skin(3)|ovary(2)|lung(1)	6		all_cancers(142;0.186)|Prostate(80;0.081)	KIRC - Kidney renal clear cell carcinoma(527;0.159)|Kidney(363;0.221)	OV - Ovarian serous cystadenocarcinoma(64;0.00126)|Epithelial(69;0.00238)|all cancers(49;0.00783)		GCTGGTCTCTTTGTGTGAATT	0.507													66	67	---	---	---	---	capture	Missense_Mutation	SNP	124080387	124080387	ZNF608	5	T	G	G	G	1	0	0	0	0	1	0	0	0	832	64	4	4	17912	223
PCDHA1	56147	broad.mit.edu	37	5	140166327	140166327	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5216-01	TCGA-28-5216-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140166327G>A	uc003lhb.2	+	1	452	c.452G>A	c.(451-453)CGT>CAT	p.R151H	PCDHA1_uc003lha.2_Missense_Mutation_p.R151H|PCDHA1_uc003lgz.2_Missense_Mutation_p.R151H	NM_018900	NP_061723	Q9Y5I3	PCDA1_HUMAN	protocadherin alpha 1 isoform 1 precursor	151	Extracellular (Potential).				homophilic cell adhesion|nervous system development	extracellular region|integral to plasma membrane	calcium ion binding|protein binding			skin(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTGAATTCGCGTTTTCCGATA	0.448													119	146	---	---	---	---	capture	Missense_Mutation	SNP	140166327	140166327	PCDHA1	5	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	11422	223
MYLIP	29116	broad.mit.edu	37	6	16141881	16141881	+	Missense_Mutation	SNP	G	C	C			TCGA-28-5216-01	TCGA-28-5216-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:16141881G>C	uc003nbq.2	+	3	541	c.304G>C	c.(304-306)GAG>CAG	p.E102Q	MYLIP_uc003nbr.2_5'UTR	NM_013262	NP_037394	Q8WY64	MYLIP_HUMAN	myosin regulatory light chain interacting	102	FERM.				cellular component movement|nervous system development	cytoplasm|cytoskeleton|extrinsic to membrane	cytoskeletal protein binding|ubiquitin-protein ligase activity|zinc ion binding			pancreas(1)	1	Breast(50;0.0799)|Ovarian(93;0.103)	all_hematologic(90;0.0895)	Epithelial(50;0.241)			GCACATCAAGGAGGCCCTCTT	0.512													69	90	---	---	---	---	capture	Missense_Mutation	SNP	16141881	16141881	MYLIP	6	G	C	C	C	1	0	0	0	0	1	0	0	0	533	41	4	4	9965	223
C7orf65	401335	broad.mit.edu	37	7	47698593	47698593	+	Missense_Mutation	SNP	C	A	A			TCGA-28-5216-01	TCGA-28-5216-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:47698593C>A	uc010kyp.1	+	3	258	c.223C>A	c.(223-225)CTA>ATA	p.L75I		NM_001123065	NP_001116537	Q6ZTY9	CG065_HUMAN	hypothetical protein LOC401335	75											0						CAGGGAGCTGCTATTTCTGTT	0.502													41	51	---	---	---	---	capture	Missense_Mutation	SNP	47698593	47698593	C7orf65	7	C	A	A	A	1	0	0	0	0	1	0	0	0	363	28	4	4	2388	223
MUC17	140453	broad.mit.edu	37	7	100701312	100701312	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5216-01	TCGA-28-5216-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:100701312C>T	uc003uxp.1	+	13	13522	c.13469C>T	c.(13468-13470)ACG>ATG	p.T4490M	MUC17_uc010lho.1_RNA	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN	mucin 17 precursor	4490	Cytoplasmic (Potential).					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity			ovary(14)|skin(8)|breast(3)|lung(2)	27	Lung NSC(181;0.136)|all_lung(186;0.182)					CAGGTAATGACGACATCATTT	0.493													49	98	---	---	---	---	capture	Missense_Mutation	SNP	100701312	100701312	MUC17	7	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	9884	223
SLC26A3	1811	broad.mit.edu	37	7	107416977	107416977	+	Missense_Mutation	SNP	C	G	G			TCGA-28-5216-01	TCGA-28-5216-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:107416977C>G	uc003ver.2	-	15	1808	c.1597G>C	c.(1597-1599)GAA>CAA	p.E533Q	SLC26A3_uc003ves.2_Missense_Mutation_p.E498Q	NM_000111	NP_000102	P40879	S26A3_HUMAN	solute carrier family 26, member 3	533	STAS.				excretion	integral to membrane|membrane fraction	inorganic anion exchanger activity|secondary active sulfate transmembrane transporter activity|sequence-specific DNA binding transcription factor activity|transcription cofactor activity			ovary(3)|skin(1)	4						TTCACTCCTTCTGGCTCATAC	0.378													3	137	---	---	---	---	capture	Missense_Mutation	SNP	107416977	107416977	SLC26A3	7	C	G	G	G	1	0	0	0	0	1	0	0	0	416	32	4	4	14410	223
OR6B1	135946	broad.mit.edu	37	7	143701298	143701298	+	Missense_Mutation	SNP	A	T	T			TCGA-28-5216-01	TCGA-28-5216-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:143701298A>T	uc003wdt.1	+	1	209	c.209A>T	c.(208-210)GAG>GTG	p.E70V		NM_001005281	NP_001005281	O95007	OR6B1_HUMAN	olfactory receptor, family 6, subfamily B,	70	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1	Melanoma(164;0.0783)					TCCTTCTTGGAGACCTGGTAC	0.458													100	113	---	---	---	---	capture	Missense_Mutation	SNP	143701298	143701298	OR6B1	7	A	T	T	T	1	0	0	0	0	1	0	0	0	143	11	4	4	11091	223
RUNX1T1	862	broad.mit.edu	37	8	93027036	93027036	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5216-01	TCGA-28-5216-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:93027036G>A	uc003yfd.2	-	3	323	c.239C>T	c.(238-240)ACG>ATG	p.T80M	RUNX1T1_uc003yfc.1_Missense_Mutation_p.T53M|RUNX1T1_uc003yfe.1_Missense_Mutation_p.T43M|RUNX1T1_uc010mao.2_Missense_Mutation_p.T53M|RUNX1T1_uc011lgi.1_Missense_Mutation_p.T91M|RUNX1T1_uc003yfh.1_Missense_Mutation_p.T43M|RUNX1T1_uc003yfb.1_Missense_Mutation_p.T43M|RUNX1T1_uc003yff.1_Missense_Mutation_p.T43M|RUNX1T1_uc003yfg.1_Missense_Mutation_p.T43M	NM_175634	NP_783552	Q06455	MTG8_HUMAN	acute myelogenous leukemia 1 translocation 1	80					generation of precursor metabolites and energy	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(9)|large_intestine(3)|breast(2)|central_nervous_system(1)|pancreas(1)	16			BRCA - Breast invasive adenocarcinoma(11;0.0141)			AGAATGGCTCGTGCCATTAGT	0.473													49	34	---	---	---	---	capture	Missense_Mutation	SNP	93027036	93027036	RUNX1T1	8	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	13639	223
KCNK9	51305	broad.mit.edu	37	8	140630517	140630517	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5216-01	TCGA-28-5216-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:140630517C>T	uc003yvf.1	-	2	1173	c.1109G>A	c.(1108-1110)CGC>CAC	p.R370H	KCNK9_uc003yvg.1_Missense_Mutation_p.R370H|KCNK9_uc003yve.1_RNA	NM_016601	NP_057685	Q9NPC2	KCNK9_HUMAN	potassium channel, subfamily K, member 9	370	Cytoplasmic (Potential).					integral to membrane|membrane fraction	potassium channel activity|voltage-gated ion channel activity			ovary(2)|lung(1)	3	all_cancers(97;3.94e-14)|all_epithelial(106;4.81e-13)|Lung NSC(106;8.18e-05)|all_lung(105;0.00015)|Ovarian(258;0.00235)|Acute lymphoblastic leukemia(118;0.155)	Ovarian(118;0.134)	BRCA - Breast invasive adenocarcinoma(115;0.0855)			GGACTTCCGGCGTTTCATCAG	0.453													95	106	---	---	---	---	capture	Missense_Mutation	SNP	140630517	140630517	KCNK9	8	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	7994	223
PLEC	5339	broad.mit.edu	37	8	144992145	144992145	+	Silent	SNP	C	T	T			TCGA-28-5216-01	TCGA-28-5216-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:144992145C>T	uc003zaf.1	-	32	12425	c.12255G>A	c.(12253-12255)TCG>TCA	p.S4085S	PLEC_uc003zab.1_Silent_p.S3948S|PLEC_uc003zac.1_Silent_p.S3952S|PLEC_uc003zad.2_Silent_p.S3948S|PLEC_uc003zae.1_Silent_p.S3916S|PLEC_uc003zag.1_Silent_p.S3926S|PLEC_uc003zah.2_Silent_p.S3934S|PLEC_uc003zaj.2_Silent_p.S3975S	NM_201380	NP_958782	Q15149	PLEC_HUMAN	plectin isoform 1	4085	Plectin 22.|Globular 2.				cellular component disassembly involved in apoptosis|hemidesmosome assembly	cytosol|focal adhesion|hemidesmosome|intermediate filament cytoskeleton|sarcolemma	actin binding|structural constituent of muscle|structural constituent of muscle			large_intestine(2)|ovary(2)|pancreas(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	9						CCTGGTACACCGAGAGCCGTT	0.612													15	32	---	---	---	---	capture	Silent	SNP	144992145	144992145	PLEC	8	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	11955	223
NOL6	65083	broad.mit.edu	37	9	33464075	33464075	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5216-01	TCGA-28-5216-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:33464075C>T	uc003zsz.2	-	22	2965	c.2864G>A	c.(2863-2865)CGC>CAC	p.R955H	SUGT1P1_uc010mjq.1_Intron|NOL6_uc003zsy.2_Missense_Mutation_p.R9H|NOL6_uc003zta.2_Intron|NOL6_uc010mjv.2_Missense_Mutation_p.R952H|NOL6_uc011lob.1_Missense_Mutation_p.R903H|NOL6_uc003ztb.1_Missense_Mutation_p.R955H	NM_022917	NP_075068	Q9H6R4	NOL6_HUMAN	nucleolar protein family 6 alpha isoform	955					rRNA processing	condensed nuclear chromosome|nucleolus	RNA binding			ovary(2)	2			LUSC - Lung squamous cell carcinoma(29;0.00788)	GBM - Glioblastoma multiforme(74;0.152)		AGAGTTTTTGCGGTCTTGGGG	0.567													6	282	---	---	---	---	capture	Missense_Mutation	SNP	33464075	33464075	NOL6	9	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	10432	223
CXorf65	158830	broad.mit.edu	37	X	70325861	70325861	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5216-01	TCGA-28-5216-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:70325861C>T	uc011mpo.1	-	3	253	c.239G>A	c.(238-240)CGT>CAT	p.R80H	CXorf65_uc011mpp.1_Missense_Mutation_p.R32H	NM_001025265	NP_001020436	A6NEN9	CX065_HUMAN	hypothetical protein LOC158830	80										central_nervous_system(1)	1						TGGTGGCCCACGTTCCACCTT	0.433													108	16	---	---	---	---	capture	Missense_Mutation	SNP	70325861	70325861	CXorf65	23	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	4077	223
FUT4	2526	broad.mit.edu	37	11	94278241	94278244	+	Frame_Shift_Del	DEL	CAAC	-	-			TCGA-28-5216-01	TCGA-28-5216-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:94278241_94278244delCAAC	uc001pez.2	+	1	1225_1228	c.942_945delCAAC	c.(940-945)TTCAACfs	p.F314fs	PIWIL4_uc010rue.1_Intron|PIWIL4_uc009ywk.1_5'Flank	NM_002033	NP_002024	P22083	FUT4_HUMAN	fucosyltransferase 4	314_315	Lumenal (Potential).				L-fucose catabolic process|protein glycosylation	Golgi cisterna membrane|integral to membrane|membrane fraction	alpha(1,3)-fucosyltransferase activity			skin(1)	1		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				GTAACCTCTTCAACTGGACGCTCT	0.681													20	66	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	94278241	94278244	FUT4	11	CAAC	-	-	-	1	0	1	0	1	0	0	0	0	376	29	5	5	6048	223
