Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
VPS13D	55187	broad.mit.edu	37	1	12371650	12371650	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5220-01	TCGA-28-5220-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:12371650C>T	uc001atv.2	+	28	6931	c.6790C>T	c.(6790-6792)CGG>TGG	p.R2264W	VPS13D_uc001atw.2_Missense_Mutation_p.R2264W|VPS13D_uc001atx.2_Missense_Mutation_p.R1452W|VPS13D_uc001aty.1_Missense_Mutation_p.R2W	NM_015378	NP_056193	Q5THJ4	VP13D_HUMAN	vacuolar protein sorting 13D isoform 1	2264					protein localization					ovary(4)|pancreas(1)	5	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)		GGAATTTATGCGGCCTTATGA	0.438													6	321	---	---	---	---	capture	Missense_Mutation	SNP	12371650	12371650	VPS13D	1	C	T	T	T	1	0	0	0	0	1	0	0	0	347	27	1	1	17074	226
SLC2A1	6513	broad.mit.edu	37	1	43396818	43396818	+	Silent	SNP	G	A	A			TCGA-28-5220-01	TCGA-28-5220-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:43396818G>A	uc001cik.2	-	3	699	c.174C>T	c.(172-174)CCC>CCT	p.P58P		NM_006516	NP_006507	P11166	GTR1_HUMAN	solute carrier family 2 (facilitated glucose	58	Extracellular (Potential).				carbohydrate metabolic process|energy reserve metabolic process|regulation of insulin secretion|water-soluble vitamin metabolic process	integral to membrane|melanosome|membrane fraction|midbody	D-glucose transmembrane transporter activity|dehydroascorbic acid transporter activity			central_nervous_system(2)|pancreas(2)|ovary(1)	5	Ovarian(52;0.00579)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0122)			Etomidate(DB00292)	TGAGCGTGGTGGGCAGGATGC	0.602											OREG0013425	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	65	72	---	---	---	---	capture	Silent	SNP	43396818	43396818	SLC2A1	1	G	A	A	A	1	0	0	0	0	0	0	0	1	600	47	2	2	14430	226
TGFBR3	7049	broad.mit.edu	37	1	92178062	92178062	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5220-01	TCGA-28-5220-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:92178062G>A	uc001doh.2	-	13	2370	c.1904C>T	c.(1903-1905)GCC>GTC	p.A635V	TGFBR3_uc009wde.2_Intron|TGFBR3_uc010osy.1_Missense_Mutation_p.A593V|TGFBR3_uc001doi.2_Missense_Mutation_p.A634V|TGFBR3_uc001doj.2_Missense_Mutation_p.A634V	NM_003243	NP_003234	Q03167	TGBR3_HUMAN	transforming growth factor, beta receptor III	635	ZP.|Extracellular (Potential).		A -> T.		BMP signaling pathway|cardiac epithelial to mesenchymal transition|cardiac muscle cell proliferation|cell growth|cell migration|definitive erythrocyte differentiation|heart trabecula formation|immune response|intracellular protein kinase cascade|liver development|negative regulation of cellular component movement|negative regulation of epithelial cell proliferation|palate development|pathway-restricted SMAD protein phosphorylation|response to follicle-stimulating hormone stimulus|response to luteinizing hormone stimulus|response to prostaglandin E stimulus|transforming growth factor beta receptor signaling pathway|ventricular cardiac muscle tissue morphogenesis	external side of plasma membrane|extracellular space|inhibin-betaglycan-ActRII complex|integral to plasma membrane|intracellular membrane-bounded organelle	coreceptor activity|heparin binding|PDZ domain binding|SMAD binding|transforming growth factor beta binding|transforming growth factor beta receptor activity, type III|type II transforming growth factor beta receptor binding			ovary(3)	3		all_lung(203;0.00719)|Lung NSC(277;0.0268)		all cancers(265;0.0108)|Epithelial(280;0.0825)		CGTTTGGATGGCAAATCCCAG	0.368													4	168	---	---	---	---	capture	Missense_Mutation	SNP	92178062	92178062	TGFBR3	1	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	15708	226
PTCHD3	374308	broad.mit.edu	37	10	27702773	27702773	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5220-01	TCGA-28-5220-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:27702773G>A	uc001itu.2	-	1	525	c.407C>T	c.(406-408)GCG>GTG	p.A136V		NM_001034842	NP_001030014	Q3KNS1	PTHD3_HUMAN	patched domain containing 3	136					spermatid development	integral to membrane	hedgehog receptor activity			ovary(2)|pancreas(1)|skin(1)	4						CCAGGGGTGCGCGCCCACCTG	0.667													30	4	---	---	---	---	capture	Missense_Mutation	SNP	27702773	27702773	PTCHD3	10	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	12629	226
OR51M1	390059	broad.mit.edu	37	11	5410816	5410816	+	Missense_Mutation	SNP	C	A	A			TCGA-28-5220-01	TCGA-28-5220-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:5410816C>A	uc010qzc.1	+	1	188	c.188C>A	c.(187-189)ACC>AAC	p.T63N	HBG2_uc001mak.1_Intron|HBE1_uc001mam.1_Intron|OR51B5_uc001maq.1_Intron	NM_001004756	NP_001004756	B2RNI9	B2RNI9_HUMAN	olfactory receptor, family 51, subfamily M,	63						integral to membrane	olfactory receptor activity				0		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;1.98e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		ATTATTAAGACCAACCCTCGT	0.478													15	239	---	---	---	---	capture	Missense_Mutation	SNP	5410816	5410816	OR51M1	11	C	A	A	A	1	0	0	0	0	1	0	0	0	234	18	4	4	11007	226
CTNND1	1500	broad.mit.edu	37	11	57559037	57559037	+	Silent	SNP	G	A	A			TCGA-28-5220-01	TCGA-28-5220-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:57559037G>A	uc001nmc.3	+	3	658	c.87G>A	c.(85-87)GCG>GCA	p.A29A	CTNND1_uc001nlf.1_Silent_p.A29A|CTNND1_uc001nlh.1_Silent_p.A29A|CTNND1_uc001nlu.3_Intron|CTNND1_uc001nlt.3_Intron|CTNND1_uc001nls.3_Intron|CTNND1_uc001nlw.3_Intron|CTNND1_uc001nmf.3_Silent_p.A29A|CTNND1_uc001nmd.3_5'UTR|CTNND1_uc001nlk.3_5'UTR|CTNND1_uc001nme.3_Silent_p.A29A|CTNND1_uc001nll.3_5'UTR|CTNND1_uc001nmg.3_5'UTR|CTNND1_uc001nlj.3_5'UTR|CTNND1_uc001nlr.3_5'UTR|CTNND1_uc001nlp.3_5'UTR|CTNND1_uc001nlx.3_Intron|CTNND1_uc001nlz.3_Intron|CTNND1_uc009ymn.2_Intron|CTNND1_uc001nlm.3_Silent_p.A29A|CTNND1_uc001nly.3_Intron|CTNND1_uc001nmb.3_Intron|CTNND1_uc001nma.3_Intron|CTNND1_uc001nmi.3_Intron|CTNND1_uc001nmh.3_Silent_p.A29A|CTNND1_uc001nlq.3_Intron|CTNND1_uc001nln.3_Silent_p.A29A|CTNND1_uc001nli.3_Silent_p.A29A|CTNND1_uc001nlo.3_Intron|CTNND1_uc001nlv.3_Intron	NM_001085458	NP_001078927	O60716	CTND1_HUMAN	catenin, delta 1 isoform 1ABC	29	Potential.				adherens junction organization|cell junction assembly|negative regulation of canonical Wnt receptor signaling pathway|regulation of transcription, DNA-dependent|transcription, DNA-dependent|Wnt receptor signaling pathway	cytosol|midbody|nucleus	cadherin binding|protein binding|receptor binding			breast(4)|ovary(1)|kidney(1)	6		all_epithelial(135;0.155)				TGACCCGGGCGCTGGAGGAGG	0.637													3	38	---	---	---	---	capture	Silent	SNP	57559037	57559037	CTNND1	11	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	3982	226
ACER3	55331	broad.mit.edu	37	11	76701596	76701596	+	Missense_Mutation	SNP	T	C	C			TCGA-28-5220-01	TCGA-28-5220-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:76701596T>C	uc009yum.1	+	6	520	c.416T>C	c.(415-417)GTA>GCA	p.V139A	ACER3_uc010rsg.1_Missense_Mutation_p.V97A|ACER3_uc009yul.1_RNA|ACER3_uc001oxu.2_RNA|ACER3_uc009yun.1_Missense_Mutation_p.V97A|ACER3_uc009yuo.1_Missense_Mutation_p.V44A|ACER3_uc010rsh.1_Missense_Mutation_p.V102A|ACER3_uc010rsi.1_Missense_Mutation_p.V44A|ACER3_uc010rsj.1_Missense_Mutation_p.V44A	NM_018367	NP_060837	Q9NUN7	ACER3_HUMAN	phytoceramidase, alkaline	139					ceramide metabolic process|phytosphingosine biosynthetic process|positive regulation of cell proliferation|sphingosine biosynthetic process	integral to endoplasmic reticulum membrane|integral to Golgi membrane	phytoceramidase activity				0						TACCTTAAGGTAAAAGAGCCG	0.338													9	463	---	---	---	---	capture	Missense_Mutation	SNP	76701596	76701596	ACER3	11	T	C	C	C	1	0	0	0	0	1	0	0	0	741	57	3	3	140	226
NNMT	4837	broad.mit.edu	37	11	114182998	114182998	+	Silent	SNP	G	A	A			TCGA-28-5220-01	TCGA-28-5220-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:114182998G>A	uc001por.1	+	5	858	c.594G>A	c.(592-594)GCG>GCA	p.A198A	NNMT_uc001pos.1_Silent_p.A198A	NM_006169	NP_006160	P40261	NNMT_HUMAN	nicotinamide N-methyltransferase	198					xenobiotic metabolic process	cytosol	nicotinamide N-methyltransferase activity|pyridine N-methyltransferase activity			ovary(1)	1		all_cancers(61;4.83e-16)|all_epithelial(67;7.28e-09)|all_hematologic(158;0.000135)|Melanoma(852;0.000902)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Prostate(24;0.0906)		BRCA - Breast invasive adenocarcinoma(274;2.79e-06)|Epithelial(105;1.32e-05)|all cancers(92;0.000144)|OV - Ovarian serous cystadenocarcinoma(223;0.128)	Niacin(DB00627)	TCATGGATGCGCTCAAGAGCA	0.612													5	182	---	---	---	---	capture	Silent	SNP	114182998	114182998	NNMT	11	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	10416	226
OR6X1	390260	broad.mit.edu	37	11	123624636	123624636	+	Silent	SNP	G	A	A			TCGA-28-5220-01	TCGA-28-5220-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:123624636G>A	uc010rzy.1	-	1	591	c.591C>T	c.(589-591)GGC>GGT	p.G197G		NM_001005188	NP_001005188	Q8NH79	OR6X1_HUMAN	olfactory receptor, family 6, subfamily X,	197	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3		Breast(109;0.0109)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0279)		TTGCTATGACGCCCAGGAGTT	0.448													24	226	---	---	---	---	capture	Silent	SNP	123624636	123624636	OR6X1	11	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	11116	226
NDUFA12	55967	broad.mit.edu	37	12	95365322	95365322	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5220-01	TCGA-28-5220-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:95365322G>A	uc001tdl.2	-	4	387	c.332C>T	c.(331-333)ACG>ATG	p.T111M		NM_018838	NP_061326	Q9UI09	NDUAC_HUMAN	13kDa differentiation-associated protein	111					respiratory electron transport chain|respiratory gaseous exchange|response to oxidative stress|transport	mitochondrial respiratory chain complex I	electron carrier activity|NADH dehydrogenase (ubiquinone) activity				0					NADH(DB00157)	TTTATGGTTCGTCCAAATGAA	0.423													7	208	---	---	---	---	capture	Missense_Mutation	SNP	95365322	95365322	NDUFA12	12	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	10169	226
RBM19	9904	broad.mit.edu	37	12	114282577	114282577	+	Missense_Mutation	SNP	A	G	G			TCGA-28-5220-01	TCGA-28-5220-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:114282577A>G	uc009zwi.2	-	23	2825	c.2681T>C	c.(2680-2682)CTG>CCG	p.L894P	RBM19_uc001tvn.3_Missense_Mutation_p.L894P|RBM19_uc001tvm.2_Missense_Mutation_p.L894P	NM_001146699	NP_001140171	Q9Y4C8	RBM19_HUMAN	RNA binding motif protein 19	894	RRM 6.				multicellular organismal development|positive regulation of embryonic development	chromosome|cytoplasm|nucleolus|nucleoplasm	nucleotide binding|RNA binding			skin(3)|ovary(1)|liver(1)|central_nervous_system(1)	6	Medulloblastoma(191;0.163)|all_neural(191;0.178)					GCTGTGACACAGGGCGTTGAA	0.637													38	54	---	---	---	---	capture	Missense_Mutation	SNP	114282577	114282577	RBM19	12	A	G	G	G	1	0	0	0	0	1	0	0	0	91	7	3	3	13016	226
RABGGTA	5875	broad.mit.edu	37	14	24739285	24739285	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5220-01	TCGA-28-5220-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:24739285G>A	uc001wof.2	-	4	723	c.301C>T	c.(301-303)CGG>TGG	p.R101W	RABGGTA_uc001woe.2_RNA|RABGGTA_uc001wog.2_Missense_Mutation_p.R101W|RABGGTA_uc001woh.2_RNA|RABGGTA_uc001woi.2_RNA	NM_004581	NP_004572	Q92696	PGTA_HUMAN	Rab geranylgeranyltransferase alpha	101	PFTA 2.				visual perception		Rab geranylgeranyltransferase activity|zinc ion binding				0				GBM - Glioblastoma multiforme(265;0.0184)		GGGTTCACCCGCAGGCAGCTC	0.632													10	7	---	---	---	---	capture	Missense_Mutation	SNP	24739285	24739285	RABGGTA	14	G	A	A	A	1	0	0	0	0	1	0	0	0	493	38	1	1	12862	226
CORO7	79585	broad.mit.edu	37	16	4414382	4414382	+	Silent	SNP	C	T	T			TCGA-28-5220-01	TCGA-28-5220-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:4414382C>T	uc002cwh.3	-	14	1290	c.1170G>A	c.(1168-1170)CGG>CGA	p.R390R	CORO7_uc002cwe.2_RNA|CORO7_uc002cwf.2_Silent_p.R390R|CORO7_uc002cwg.3_Silent_p.R170R|CORO7_uc010uxh.1_Silent_p.R372R|CORO7_uc010uxi.1_Silent_p.R305R|CORO7_uc002cwi.1_Silent_p.R170R|CORO7_uc010uxj.1_RNA|CORO7_uc010btp.1_Silent_p.R170R	NM_024535	NP_078811	P57737	CORO7_HUMAN	coronin 7	390						cytoplasmic membrane-bounded vesicle|cytosol|Golgi membrane|integral to membrane of membrane fraction|soluble fraction					0						TCGGGTGGGGCCGGCAGGCGG	0.701													16	13	---	---	---	---	capture	Silent	SNP	4414382	4414382	CORO7	16	C	T	T	T	1	0	0	0	0	0	0	0	1	327	26	2	2	3724	226
AMAC1	146861	broad.mit.edu	37	17	33520922	33520922	+	Missense_Mutation	SNP	T	A	A			TCGA-28-5220-01	TCGA-28-5220-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:33520922T>A	uc002hjd.2	-	1	491	c.405A>T	c.(403-405)AAA>AAT	p.K135N		NM_152462	NP_689675	Q8N808	AMAC1_HUMAN	acyl-malonyl condensing enzyme 1	135	DUF6 1.					integral to membrane					0				BRCA - Breast invasive adenocarcinoma(366;0.0917)		TGGAAGAACCTTTGCGAACAG	0.607													129	151	---	---	---	---	capture	Missense_Mutation	SNP	33520922	33520922	AMAC1	17	T	A	A	A	1	0	0	0	0	1	0	0	0	725	56	4	4	559	226
KRT20	54474	broad.mit.edu	37	17	39041346	39041346	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5220-01	TCGA-28-5220-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:39041346G>A	uc002hvl.2	-	1	134	c.92C>T	c.(91-93)ACG>ATG	p.T31M		NM_019010	NP_061883	P35900	K1C20_HUMAN	keratin 20	31	Head.				apoptosis|intermediate filament organization	Golgi apparatus|intermediate filament	protein binding|structural constituent of cytoskeleton			large_intestine(1)|kidney(1)|skin(1)	3		Breast(137;0.000301)|Ovarian(249;0.15)				GCTGGGTGTCGTCCCGAGGCG	0.607													52	86	---	---	---	---	capture	Missense_Mutation	SNP	39041346	39041346	KRT20	17	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	8378	226
TBKBP1	9755	broad.mit.edu	37	17	45776024	45776024	+	Missense_Mutation	SNP	C	G	G			TCGA-28-5220-01	TCGA-28-5220-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:45776024C>G	uc002ilu.2	+	4	1366	c.517C>G	c.(517-519)CAA>GAA	p.Q173E		NM_014726	NP_055541	A7MCY6	TBKB1_HUMAN	TBK1 binding protein 1	173					innate immune response						0						GCGGCAACAGCAAGGCCTCCA	0.647											OREG0024498	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	14	7	---	---	---	---	capture	Missense_Mutation	SNP	45776024	45776024	TBKBP1	17	C	G	G	G	1	0	0	0	0	1	0	0	0	325	25	4	4	15525	226
EXOC7	23265	broad.mit.edu	37	17	74084564	74084564	+	Missense_Mutation	SNP	T	G	G			TCGA-28-5220-01	TCGA-28-5220-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:74084564T>G	uc002jqs.2	-	11	1528	c.1433A>C	c.(1432-1434)GAC>GCC	p.D478A	EXOC7_uc010dgv.1_Missense_Mutation_p.D374A|EXOC7_uc002jqq.2_Missense_Mutation_p.D427A|EXOC7_uc010wsw.1_Missense_Mutation_p.D450A|EXOC7_uc010wsx.1_Missense_Mutation_p.D419A|EXOC7_uc002jqr.2_Missense_Mutation_p.D396A|EXOC7_uc010wsv.1_Missense_Mutation_p.D386A	NM_001145297	NP_001138769	Q9UPT5	EXOC7_HUMAN	exocyst complex component 7 isoform 4	478					exocytosis|protein transport	centriolar satellite|cytosol|exocyst|plasma membrane	protein binding				0			LUSC - Lung squamous cell carcinoma(166;0.187)			GTCTGCGAAGTCCTCCAGCGC	0.632													29	31	---	---	---	---	capture	Missense_Mutation	SNP	74084564	74084564	EXOC7	17	T	G	G	G	1	0	0	0	0	1	0	0	0	754	58	4	4	5265	226
ZNF407	55628	broad.mit.edu	37	18	72775660	72775660	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5220-01	TCGA-28-5220-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:72775660G>A	uc002llw.2	+	8	6040	c.5983G>A	c.(5983-5985)GCG>ACG	p.A1995T		NM_017757	NP_060227	Q9C0G0	ZN407_HUMAN	zinc finger protein 407 isoform 1	1995					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2		Esophageal squamous(42;0.131)|Prostate(75;0.173)		BRCA - Breast invasive adenocarcinoma(31;0.184)		ATTGCTCTGTGCGGTCACTGA	0.627													17	32	---	---	---	---	capture	Missense_Mutation	SNP	72775660	72775660	ZNF407	18	G	A	A	A	1	0	0	0	0	1	0	0	0	598	46	2	2	17767	226
FBN3	84467	broad.mit.edu	37	19	8176555	8176555	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5220-01	TCGA-28-5220-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:8176555G>A	uc002mjf.2	-	31	4082	c.4061C>T	c.(4060-4062)GCC>GTC	p.A1354V		NM_032447	NP_115823	Q75N90	FBN3_HUMAN	fibrillin 3 precursor	1354	EGF-like 20; calcium-binding.					proteinaceous extracellular matrix	calcium ion binding|extracellular matrix structural constituent			ovary(6)|skin(3)|pancreas(1)|central_nervous_system(1)	11						GCCATCCCCGGCAAAGCCCTG	0.637													3	59	---	---	---	---	capture	Missense_Mutation	SNP	8176555	8176555	FBN3	19	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	5650	226
CCDC155	147872	broad.mit.edu	37	19	49910497	49910497	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5220-01	TCGA-28-5220-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:49910497C>T	uc002pnm.1	+	11	1051	c.877C>T	c.(877-879)CGG>TGG	p.R293W	CCDC155_uc010emx.1_Missense_Mutation_p.R266W	NM_144688	NP_653289	Q8N6L0	CC155_HUMAN	coiled-coil domain containing 155	293	Potential.					integral to membrane	calcium ion binding			ovary(1)|central_nervous_system(1)	2						TTCTTGGCAGCGGCAGCTCTT	0.592													12	23	---	---	---	---	capture	Missense_Mutation	SNP	49910497	49910497	CCDC155	19	C	T	T	T	1	0	0	0	0	1	0	0	0	347	27	1	1	2762	226
TBC1D17	79735	broad.mit.edu	37	19	50387771	50387771	+	Silent	SNP	C	T	T			TCGA-28-5220-01	TCGA-28-5220-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:50387771C>T	uc002pqo.2	+	12	1451	c.1299C>T	c.(1297-1299)AAC>AAT	p.N433N	TBC1D17_uc010ybg.1_Silent_p.N400N|TBC1D17_uc002pqp.2_Silent_p.N84N|TBC1D17_uc002pqq.1_RNA|TBC1D17_uc002pqr.2_Silent_p.N84N|TBC1D17_uc002pqs.2_RNA	NM_024682	NP_078958	Q9HA65	TBC17_HUMAN	TBC1 domain family, member 17	433	Rab-GAP TBC.					intracellular	Rab GTPase activator activity				0		all_lung(116;0.000338)|Lung NSC(112;0.000446)|all_neural(266;0.107)|Ovarian(192;0.231)		GBM - Glioblastoma multiforme(134;0.0116)|OV - Ovarian serous cystadenocarcinoma(262;0.017)		TCATTCAGAACGAGGTGGATG	0.607													99	132	---	---	---	---	capture	Silent	SNP	50387771	50387771	TBC1D17	19	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	15494	226
NT5C1B	93034	broad.mit.edu	37	2	18764143	18764143	+	Missense_Mutation	SNP	T	C	C			TCGA-28-5220-01	TCGA-28-5220-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:18764143T>C	uc002rcz.2	-	7	1296	c.1192A>G	c.(1192-1194)AAT>GAT	p.N398D	NT5C1B_uc002rcy.2_Missense_Mutation_p.N398D|NT5C1B_uc010exr.2_Missense_Mutation_p.N340D|NT5C1B_uc010yju.1_Missense_Mutation_p.N338D|NT5C1B_uc002rda.2_Missense_Mutation_p.N338D|NT5C1B_uc010yjv.1_Missense_Mutation_p.N415D|NT5C1B_uc010yjw.1_Missense_Mutation_p.N381D|NT5C1B_uc010exs.2_Missense_Mutation_p.N400D	NM_001002006	NP_001002006	Q96P26	5NT1B_HUMAN	5' nucleotidase, cytosolic IB isoform 1	398					purine base metabolic process|purine nucleotide catabolic process	cytosol	5'-nucleotidase activity|magnesium ion binding|nucleotide binding			skin(2)|ovary(1)	3	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.177)	Ovarian(717;0.208)				CCGTAGTGATTGACGCTGTTT	0.413													7	150	---	---	---	---	capture	Missense_Mutation	SNP	18764143	18764143	NT5C1B	2	T	C	C	C	1	0	0	0	0	1	0	0	0	819	63	3	3	10593	226
TGFBRAP1	9392	broad.mit.edu	37	2	105897164	105897164	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5220-01	TCGA-28-5220-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:105897164C>T	uc002tcq.2	-	6	1222	c.1138G>A	c.(1138-1140)GTC>ATC	p.V380I	TGFBRAP1_uc010fjc.2_Missense_Mutation_p.V150I|TGFBRAP1_uc002tcr.3_Missense_Mutation_p.V380I	NM_004257	NP_004248	Q8WUH2	TGFA1_HUMAN	transforming growth factor, beta receptor	380					regulation of transcription, DNA-dependent|transforming growth factor beta receptor signaling pathway	cytoplasm|membrane	SMAD binding|small GTPase regulator activity|transforming growth factor beta receptor binding			central_nervous_system(1)|skin(1)	2						AGCTCCCGGACATCAAGCTGG	0.532													29	31	---	---	---	---	capture	Missense_Mutation	SNP	105897164	105897164	TGFBRAP1	2	C	T	T	T	1	0	0	0	0	1	0	0	0	221	17	2	2	15709	226
CNTNAP5	129684	broad.mit.edu	37	2	125367398	125367398	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5220-01	TCGA-28-5220-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:125367398G>A	uc002tno.2	+	12	2138	c.1774G>A	c.(1774-1776)GAG>AAG	p.E592K	CNTNAP5_uc010flu.2_Missense_Mutation_p.E593K	NM_130773	NP_570129	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5 precursor	592	Extracellular (Potential).|Fibrinogen C-terminal.				cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(10)	10				BRCA - Breast invasive adenocarcinoma(221;0.248)		GCAATCCTGCGAGGTGTACAG	0.517													82	111	---	---	---	---	capture	Missense_Mutation	SNP	125367398	125367398	CNTNAP5	2	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	3615	226
PDE11A	50940	broad.mit.edu	37	2	178936459	178936459	+	Missense_Mutation	SNP	C	G	G			TCGA-28-5220-01	TCGA-28-5220-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:178936459C>G	uc002ulq.2	-	1	1024	c.706G>C	c.(706-708)GAC>CAC	p.D236H	PDE11A_uc002ulr.2_Intron|PDE11A_uc002ult.1_Intron	NM_016953	NP_058649	Q9HCR9	PDE11_HUMAN	phosphodiesterase 11A isoform 4	236	GAF 1.				platelet activation|signal transduction	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|metal ion binding			ovary(3)|large_intestine(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.00121)|Epithelial(96;0.00455)|all cancers(119;0.02)			GAGCAGCGGTCAGCATCCACC	0.493									Primary_Pigmented_Nodular_Adrenocortical_Disease_Familial				77	122	---	---	---	---	capture	Missense_Mutation	SNP	178936459	178936459	PDE11A	2	C	G	G	G	1	0	0	0	0	1	0	0	0	377	29	4	4	11534	226
SPHKAP	80309	broad.mit.edu	37	2	228882884	228882884	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5220-01	TCGA-28-5220-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:228882884C>T	uc002vpq.2	-	7	2733	c.2686G>A	c.(2686-2688)GAA>AAA	p.E896K	SPHKAP_uc002vpp.2_Missense_Mutation_p.E896K|SPHKAP_uc010zlx.1_Missense_Mutation_p.E896K	NM_001142644	NP_001136116	Q2M3C7	SPKAP_HUMAN	sphingosine kinase type 1-interacting protein	896						cytoplasm	protein binding			skin(5)|ovary(4)|lung(1)	10		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		ACTTGAACTTCGTTGATGCGA	0.502													376	499	---	---	---	---	capture	Missense_Mutation	SNP	228882884	228882884	SPHKAP	2	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	14940	226
TGM2	7052	broad.mit.edu	37	20	36789862	36789862	+	Silent	SNP	G	A	A			TCGA-28-5220-01	TCGA-28-5220-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:36789862G>A	uc002xhr.2	-	2	250	c.150C>T	c.(148-150)TAC>TAT	p.Y50Y	TGM2_uc010zvx.1_Silent_p.Y50Y|TGM2_uc010zvy.1_Intron|TGM2_uc002xhs.1_Silent_p.Y50Y|TGM2_uc002xht.2_Silent_p.Y50Y|TGM2_uc002xhu.3_Silent_p.Y50Y	NM_004613	NP_004604	P21980	TGM2_HUMAN	transglutaminase 2 isoform a	50					apoptotic cell clearance|peptide cross-linking|positive regulation of cell adhesion		acyltransferase activity|metal ion binding|protein binding|protein-glutamine gamma-glutamyltransferase activity			large_intestine(1)|lung(1)|ovary(1)	3		Myeloproliferative disorder(115;0.00878)			L-Glutamine(DB00130)	CACTGGCCTCGTAGTTGCGGC	0.557													48	63	---	---	---	---	capture	Silent	SNP	36789862	36789862	TGM2	20	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	15715	226
PFDN4	5203	broad.mit.edu	37	20	52830966	52830966	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5220-01	TCGA-28-5220-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:52830966C>T	uc002xwx.2	+	2	239	c.101C>T	c.(100-102)ACA>ATA	p.T34I		NM_002623	NP_002614	Q9NQP4	PFD4_HUMAN	prefoldin subunit 4	34					'de novo' posttranslational protein folding	prefoldin complex	chaperone binding|unfolded protein binding				0	Lung NSC(4;1.08e-05)|all_lung(4;2.7e-05)		Colorectal(105;0.124)|STAD - Stomach adenocarcinoma(23;0.206)			AGTAGAATCACAGAGCTGAAG	0.284													20	33	---	---	---	---	capture	Missense_Mutation	SNP	52830966	52830966	PFDN4	20	C	T	T	T	1	0	0	0	0	1	0	0	0	221	17	2	2	11660	226
TRPM2	7226	broad.mit.edu	37	21	45786659	45786659	+	Missense_Mutation	SNP	C	G	G			TCGA-28-5220-01	TCGA-28-5220-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:45786659C>G	uc002zet.1	+	5	659	c.446C>G	c.(445-447)ACG>AGG	p.T149R	TRPM2_uc002zeu.1_Missense_Mutation_p.T149R|TRPM2_uc002zew.1_Missense_Mutation_p.T149R|TRPM2_uc010gpt.1_Missense_Mutation_p.T149R|TRPM2_uc002zex.1_5'Flank	NM_003307	NP_003298	O94759	TRPM2_HUMAN	transient receptor potential cation channel,	149	Cytoplasmic (Potential).					integral to plasma membrane	ADP-ribose diphosphatase activity|calcium channel activity|sodium channel activity			ovary(1)|central_nervous_system(1)|pancreas(1)	3						TCCCAGGACACGCCCTCCAGC	0.617													65	121	---	---	---	---	capture	Missense_Mutation	SNP	45786659	45786659	TRPM2	21	C	G	G	G	1	0	0	0	0	1	0	0	0	247	19	4	4	16469	226
PICK1	9463	broad.mit.edu	37	22	38471061	38471061	+	Silent	SNP	G	A	A			TCGA-28-5220-01	TCGA-28-5220-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:38471061G>A	uc003auq.2	+	13	1560	c.1170G>A	c.(1168-1170)ACG>ACA	p.T390T	PICK1_uc003aur.2_Silent_p.T390T|PICK1_uc003aus.2_Silent_p.T390T|PICK1_uc003aut.2_Silent_p.T390T	NM_012407	NP_036539	Q9NRD5	PICK1_HUMAN	protein interacting with C kinase 1	390					activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|DNA methylation involved in embryo development|DNA methylation involved in gamete generation|monoamine transport|neuronal ion channel clustering|protein phosphorylation|receptor clustering|retrograde vesicle-mediated transport, Golgi to ER|synaptic transmission	cell junction|endocytic vesicle membrane|Golgi apparatus|perinuclear region of cytoplasm|presynaptic membrane	ATPase activity|metal ion binding|protein C-terminus binding|protein kinase C binding|receptor binding				0	Melanoma(58;0.045)					aggaagaCACGGCAGCTGGGG	0.567													24	29	---	---	---	---	capture	Silent	SNP	38471061	38471061	PICK1	22	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	11784	226
RIBC2	26150	broad.mit.edu	37	22	45813805	45813805	+	Missense_Mutation	SNP	C	T	T	rs137932273		TCGA-28-5220-01	TCGA-28-5220-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:45813805C>T	uc011aqs.1	+	4	729	c.520C>T	c.(520-522)CGT>TGT	p.R174C		NM_015653	NP_056468	Q9H4K1	RIBC2_HUMAN	RIB43A domain with coiled-coils 2	106											0		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)		GAAGAACGCCCGTGCTGAACA	0.418													23	31	---	---	---	---	capture	Missense_Mutation	SNP	45813805	45813805	RIBC2	22	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	13245	226
CADPS	8618	broad.mit.edu	37	3	62636671	62636671	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5220-01	TCGA-28-5220-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:62636671C>T	uc003dll.2	-	5	1414	c.1054G>A	c.(1054-1056)GCC>ACC	p.A352T	CADPS_uc003dlm.2_Missense_Mutation_p.A352T|CADPS_uc003dln.2_Missense_Mutation_p.A352T	NM_003716	NP_003707	Q9ULU8	CAPS1_HUMAN	Ca2+-dependent secretion activator isoform 1	352					exocytosis|protein transport	cell junction|cytoplasmic vesicle membrane|cytosol|synapse	lipid binding|metal ion binding			central_nervous_system(2)|ovary(1)	3		Lung SC(41;0.0452)		BRCA - Breast invasive adenocarcinoma(55;5.98e-05)|KIRC - Kidney renal clear cell carcinoma(15;0.0246)|Kidney(15;0.0334)		TCCAAGTTGGCCATGAGCAGG	0.478													7	323	---	---	---	---	capture	Missense_Mutation	SNP	62636671	62636671	CADPS	3	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	2546	226
HEATR7B2	133558	broad.mit.edu	37	5	41070948	41070948	+	Missense_Mutation	SNP	G	T	T			TCGA-28-5220-01	TCGA-28-5220-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:41070948G>T	uc003jmj.3	-	1	497	c.7C>A	c.(7-9)CTT>ATT	p.L3I		NM_173489	NP_775760	Q7Z745	HTRB2_HUMAN	HEAT repeat family member 7B2	3							binding			ovary(6)|central_nervous_system(2)	8						TCTGTACTAAGTGTCATGTCT	0.398													15	43	---	---	---	---	capture	Missense_Mutation	SNP	41070948	41070948	HEATR7B2	5	G	T	T	T	1	0	0	0	0	1	0	0	0	468	36	4	4	6961	226
ENC1	8507	broad.mit.edu	37	5	73931652	73931652	+	Missense_Mutation	SNP	T	C	C			TCGA-28-5220-01	TCGA-28-5220-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:73931652T>C	uc003kdc.3	-	2	1790	c.659A>G	c.(658-660)TAT>TGT	p.Y220C	ENC1_uc011css.1_Missense_Mutation_p.Y147C	NM_003633	NP_003624	O14682	ENC1_HUMAN	ectodermal-neural cortex (with BTB-like domain)	220					nervous system development	cytoplasm|cytoskeleton|nuclear matrix	actin binding			ovary(1)|pancreas(1)|skin(1)	3		all_lung(232;0.0154)|Lung NSC(167;0.0331)|Ovarian(174;0.0798)		OV - Ovarian serous cystadenocarcinoma(47;1.45e-59)		CTTCAGGTCATAGCTGATCCA	0.512													100	133	---	---	---	---	capture	Missense_Mutation	SNP	73931652	73931652	ENC1	5	T	C	C	C	1	0	0	0	0	1	0	0	0	637	49	3	3	5068	226
PDGFRB	5159	broad.mit.edu	37	5	149503887	149503887	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5220-01	TCGA-28-5220-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:149503887G>A	uc003lro.2	-	14	2418	c.1949C>T	c.(1948-1950)TCG>TTG	p.S650L	PDGFRB_uc010jhd.2_Missense_Mutation_p.S489L	NM_002609	NP_002600	P09619	PGFRB_HUMAN	platelet-derived growth factor receptor beta	650	Cytoplasmic (Potential).|Protein kinase.				aorta morphogenesis|cardiac myofibril assembly|hemopoiesis|metanephric glomerular capillary formation|metanephric glomerular mesangial cell proliferation involved in metanephros development|peptidyl-tyrosine phosphorylation|positive regulation of calcium ion import|positive regulation of chemotaxis|positive regulation of DNA biosynthetic process|positive regulation of ERK1 and ERK2 cascade|positive regulation of MAP kinase activity|positive regulation of metanephric mesenchymal cell migration by platelet-derived growth factor receptor-beta signaling pathway|positive regulation of mitosis|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of reactive oxygen species metabolic process|positive regulation of smooth muscle cell migration|positive regulation of smooth muscle cell proliferation|protein autophosphorylation|regulation of actin cytoskeleton organization|retina vasculature development in camera-type eye|smooth muscle cell chemotaxis	apical plasma membrane|cytoplasm|integral to plasma membrane|nucleus	ATP binding|platelet activating factor receptor activity|platelet-derived growth factor beta-receptor activity|platelet-derived growth factor binding|platelet-derived growth factor receptor binding|vascular endothelial growth factor receptor activity			central_nervous_system(4)|lung(4)|breast(3)|stomach(2)|prostate(2)|large_intestine(1)|ovary(1)	17		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		Becaplermin(DB00102)|Dasatinib(DB01254)|Imatinib(DB00619)|Sorafenib(DB00398)|Sunitinib(DB01268)	CTTCAGCTCCGACATAAGGGC	0.637			T	ETV6|TRIP11|HIP1|RAB5EP|H4|NIN|HCMOGT-1|PDE4DIP	MPD|AML|CMML|CML								42	64	---	---	---	---	capture	Missense_Mutation	SNP	149503887	149503887	PDGFRB	5	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	11565	226
SDK1	221935	broad.mit.edu	37	7	4011129	4011129	+	Missense_Mutation	SNP	C	A	A			TCGA-28-5220-01	TCGA-28-5220-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:4011129C>A	uc003smx.2	+	12	1885	c.1746C>A	c.(1744-1746)GAC>GAA	p.D582E		NM_152744	NP_689957	Q7Z5N4	SDK1_HUMAN	sidekick 1 precursor	582	Ig-like C2-type 6.				cell adhesion	integral to membrane				large_intestine(3)|ovary(2)|skin(1)	6		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		CTCCTGAGGACCACGTGGTGA	0.542													29	75	---	---	---	---	capture	Missense_Mutation	SNP	4011129	4011129	SDK1	7	C	A	A	A	1	0	0	0	0	1	0	0	0	233	18	4	4	13861	226
AQP1	358	broad.mit.edu	37	7	30961834	30961834	+	Missense_Mutation	SNP	C	T	T			TCGA-28-5220-01	TCGA-28-5220-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:30961834C>T	uc003tbv.1	+	2	595	c.538C>T	c.(538-540)CAC>TAC	p.H180Y	AQP1_uc011kac.1_Missense_Mutation_p.H240Y|AQP1_uc010kwf.1_Missense_Mutation_p.H97Y|AQP1_uc010kwg.1_Missense_Mutation_p.H61Y|AQP1_uc010kwh.1_Missense_Mutation_p.H129Y	NM_198098	NP_932766	P29972	AQP1_HUMAN	aquaporin 1	180	Helical; Name=Helix 5.	Substrate discrimination.			ammonium transport|cell volume homeostasis|cellular hyperosmotic response|cellular response to cAMP|cellular response to copper ion|cellular response to dexamethasone stimulus|cellular response to hydrogen peroxide|cellular response to hypoxia|cellular response to mechanical stimulus|cellular response to mercury ion|cellular response to nitric oxide|cellular response to retinoic acid|cellular response to salt stress|cellular response to UV|cerebrospinal fluid secretion|cGMP biosynthetic process|establishment or maintenance of actin cytoskeleton polarity|lateral ventricle development|maintenance of symbiont-containing vacuole via substance secreted by host|negative regulation of apoptosis|odontogenesis|pancreatic juice secretion|positive regulation of angiogenesis|positive regulation of fibroblast proliferation|positive regulation of saliva secretion|renal water transport|response to drug|transepithelial water transport	apical plasma membrane|basal plasma membrane|brush border membrane|cytoplasm|integral to plasma membrane|nuclear membrane|sarcolemma|symbiont-containing vacuole	ammonia transmembrane transporter activity|carbon dioxide transmembrane transporter activity|glycerol transmembrane transporter activity|intracellular cGMP activated cation channel activity|nitric oxide transmembrane transporter activity|potassium channel activity|potassium ion transmembrane transporter activity|protein binding|water channel activity				0		Melanoma(862;0.16)			Acetazolamide(DB00819)	AGCCCTTGGACACCTCCTGGC	0.692													28	45	---	---	---	---	capture	Missense_Mutation	SNP	30961834	30961834	AQP1	7	C	T	T	T	1	0	0	0	0	1	0	0	0	221	17	2	2	814	226
PKD1L1	168507	broad.mit.edu	37	7	47840381	47840381	+	Missense_Mutation	SNP	G	A	A	rs141837186		TCGA-28-5220-01	TCGA-28-5220-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:47840381G>A	uc003tny.1	-	54	8059	c.8059C>T	c.(8059-8061)CCC>TCC	p.P2687S	C7orf69_uc003tnz.3_Intron|C7orf69_uc003toa.1_Intron	NM_138295	NP_612152	Q8TDX9	PK1L1_HUMAN	polycystin-1L1	2687	Extracellular (Potential).				cell-cell adhesion	integral to membrane				ovary(8)|upper_aerodigestive_tract(2)|breast(1)	11						AGCAGCCCGGGGAAGGCGTCT	0.577													111	266	---	---	---	---	capture	Missense_Mutation	SNP	47840381	47840381	PKD1L1	7	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	11867	226
AKAP9	10142	broad.mit.edu	37	7	91624020	91624020	+	Missense_Mutation	SNP	A	G	G			TCGA-28-5220-01	TCGA-28-5220-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:91624020A>G	uc003ulg.2	+	6	887	c.662A>G	c.(661-663)AAG>AGG	p.K221R	AKAP9_uc003uld.3_Missense_Mutation_p.K221R|AKAP9_uc003ule.2_Missense_Mutation_p.K233R|AKAP9_uc003ulf.2_Missense_Mutation_p.K221R	NM_005751	NP_005742	Q99996	AKAP9_HUMAN	A-kinase anchor protein 9 isoform 2	233	Potential.|Gln-rich.				G2/M transition of mitotic cell cycle|signal transduction|synaptic transmission|transport	centrosome|cytosol|Golgi apparatus	receptor binding			breast(7)|ovary(6)|lung(5)|skin(3)|large_intestine(2)|prostate(2)|central_nervous_system(1)	26	all_cancers(62;2.46e-09)|all_epithelial(64;4.42e-08)|Breast(17;0.00206)|all_lung(186;0.185)|all_hematologic(106;0.215)|Lung NSC(181;0.249)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			AGAAGAGAAAAGGATGAGACA	0.318			T	BRAF	papillary thyroid								3	166	---	---	---	---	capture	Missense_Mutation	SNP	91624020	91624020	AKAP9	7	A	G	G	G	1	0	0	0	0	1	0	0	0	39	3	3	3	459	226
RELN	5649	broad.mit.edu	37	7	103191670	103191670	+	Missense_Mutation	SNP	G	A	A			TCGA-28-5220-01	TCGA-28-5220-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:103191670G>A	uc003vca.2	-	41	6306	c.6146C>T	c.(6145-6147)GCG>GTG	p.A2049V	RELN_uc010liz.2_Missense_Mutation_p.A2049V	NM_005045	NP_005036	P78509	RELN_HUMAN	reelin isoform a	2049	BNR 9.				axon guidance|cell adhesion|cerebral cortex tangential migration|glial cell differentiation|neuron migration|peptidyl-tyrosine phosphorylation|positive regulation of protein kinase activity|positive regulation of small GTPase mediated signal transduction|response to pain|spinal cord patterning	cytoplasm|dendrite|extracellular space|proteinaceous extracellular matrix	metal ion binding|protein serine/threonine/tyrosine kinase activity|serine-type peptidase activity			ovary(8)|upper_aerodigestive_tract(5)|large_intestine(2)|central_nervous_system(2)|skin(1)|pancreas(1)	19				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		GTGCCAGGTCGCCCCGAAGTC	0.547													22	39	---	---	---	---	capture	Missense_Mutation	SNP	103191670	103191670	RELN	7	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	13115	226
RNF32	140545	broad.mit.edu	37	7	156451221	156451221	+	Missense_Mutation	SNP	C	G	G			TCGA-28-5220-01	TCGA-28-5220-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:156451221C>G	uc003wmo.2	+	7	823	c.641C>G	c.(640-642)CCT>CGT	p.P214R	RNF32_uc010lql.1_RNA|RNF32_uc010lqm.2_Missense_Mutation_p.P214R|RNF32_uc003wmq.2_Missense_Mutation_p.P214R|RNF32_uc003wmr.2_Missense_Mutation_p.P214R|RNF32_uc003wms.2_Missense_Mutation_p.P214R|RNF32_uc003wmu.2_RNA|RNF32_uc003wmt.2_Missense_Mutation_p.P214R	NM_030936	NP_112198	Q9H0A6	RNF32_HUMAN	ring finger protein 32	214	IQ.					aggresome|endosome	protein binding|zinc ion binding				0	Ovarian(565;0.218)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.00291)	UCEC - Uterine corpus endometrioid carcinoma (81;0.169)		AAAACAGTACCTCCCACAGAT	0.383													67	168	---	---	---	---	capture	Missense_Mutation	SNP	156451221	156451221	RNF32	7	C	G	G	G	1	0	0	0	0	1	0	0	0	312	24	4	4	13380	226
LYN	4067	broad.mit.edu	37	8	56863056	56863056	+	Missense_Mutation	SNP	A	G	G			TCGA-28-5220-01	TCGA-28-5220-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:56863056A>G	uc003xsk.3	+	5	605	c.323A>G	c.(322-324)AAA>AGA	p.K108R	LYN_uc003xsl.3_Missense_Mutation_p.K87R	NM_002350	NP_002341	P07948	LYN_HUMAN	Yamaguchi sarcoma viral (v-yes-1) oncogene	108	SH3.				erythrocyte differentiation|interspecies interaction between organisms|leukocyte migration|platelet activation|positive regulation of cellular component movement|positive regulation of stress-activated protein kinase signaling cascade|positive regulation of tyrosine phosphorylation of STAT protein|response to DNA damage stimulus|T cell costimulation	cytosol|Golgi apparatus|membrane raft|nucleus|perinuclear region of cytoplasm	ATP binding|ion channel binding|non-membrane spanning protein tyrosine kinase activity|receptor signaling protein tyrosine kinase activity			ovary(1)|breast(1)|central_nervous_system(1)	3		all_lung(136;0.0555)|Lung NSC(129;0.0726)|all_epithelial(80;0.0772)	Epithelial(17;0.000834)|all cancers(17;0.00598)			CTTTTAACAAAAAAAGAAGGC	0.348													216	248	---	---	---	---	capture	Missense_Mutation	SNP	56863056	56863056	LYN	8	A	G	G	G	1	0	0	0	0	1	0	0	0	13	1	3	3	9022	226
COL14A1	7373	broad.mit.edu	37	8	121219270	121219270	+	Silent	SNP	C	T	T			TCGA-28-5220-01	TCGA-28-5220-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:121219270C>T	uc003yox.2	+	10	1393	c.1128C>T	c.(1126-1128)GCC>GCT	p.A376A	COL14A1_uc003yoy.2_Silent_p.A54A|COL14A1_uc010mde.1_Silent_p.A54A	NM_021110	NP_066933	Q05707	COEA1_HUMAN	collagen, type XIV, alpha 1 precursor	376	Fibronectin type-III 2.				cell-cell adhesion|collagen fibril organization	collagen type XIV|extracellular space	collagen binding|extracellular matrix structural constituent|protein binding, bridging			ovary(4)|kidney(4)|skin(2)|pancreas(1)|central_nervous_system(1)	12	Lung NSC(37;6.52e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		OV - Ovarian serous cystadenocarcinoma(1;6.47e-38)|STAD - Stomach adenocarcinoma(47;0.00503)			GGACTCATGCCCCAGGAAATG	0.428													48	62	---	---	---	---	capture	Silent	SNP	121219270	121219270	COL14A1	8	C	T	T	T	1	0	0	0	0	0	0	0	1	275	22	2	2	3636	226
FOXB2	442425	broad.mit.edu	37	9	79635212	79635212	+	Silent	SNP	C	T	T			TCGA-28-5220-01	TCGA-28-5220-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:79635212C>T	uc004ako.1	+	1	642	c.642C>T	c.(640-642)CCC>CCT	p.P214P		NM_001013735	NP_001013757	Q5VYV0	FOXB2_HUMAN	forkhead box B2	214					brain development|embryo development|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding				0						CGTCTCACCCCGGCAAGATGC	0.517													2	0	---	---	---	---	capture	Silent	SNP	79635212	79635212	FOXB2	9	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	5937	226
OR13C4	138804	broad.mit.edu	37	9	107289309	107289309	+	Missense_Mutation	SNP	A	G	G			TCGA-28-5220-01	TCGA-28-5220-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:107289309A>G	uc011lvn.1	-	1	182	c.182T>C	c.(181-183)TTC>TCC	p.F61S		NM_001001919	NP_001001919	Q8NGS5	O13C4_HUMAN	olfactory receptor, family 13, subfamily C,	61	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1						GCCCAGGAAGAAGTACATGGG	0.418													3	112	---	---	---	---	capture	Missense_Mutation	SNP	107289309	107289309	OR13C4	9	A	G	G	G	1	0	0	0	0	1	0	0	0	117	9	3	3	10840	226
SMC1A	8243	broad.mit.edu	37	X	53432322	53432322	+	Missense_Mutation	SNP	G	T	T			TCGA-28-5220-01	TCGA-28-5220-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:53432322G>T	uc004dsg.2	-	12	1982	c.1913C>A	c.(1912-1914)ACA>AAA	p.T638K	SMC1A_uc011moe.1_Missense_Mutation_p.T616K|SMC1A_uc011mof.1_Missense_Mutation_p.T404K	NM_006306	NP_006297	Q14683	SMC1A_HUMAN	structural maintenance of chromosomes 1A	638	Flexible hinge.				cell cycle checkpoint|cell division|DNA repair|meiosis|mitotic metaphase/anaphase transition|mitotic prometaphase|mitotic sister chromatid cohesion|mitotic spindle organization|negative regulation of DNA endoreduplication|nuclear mRNA splicing, via spliceosome|response to radiation|signal transduction in response to DNA damage	cohesin core heterodimer|condensed chromosome kinetochore|condensed nuclear chromosome|cytoplasm|meiotic cohesin complex|nucleoplasm	ATP binding|chromatin binding|microtubule motor activity|protein heterodimerization activity			ovary(5)|central_nervous_system(1)	6						CAGTGCCACTGTCTACACACA	0.562													46	4	---	---	---	---	capture	Missense_Mutation	SNP	53432322	53432322	SMC1A	23	G	T	T	T	1	0	0	0	0	1	0	0	0	624	48	4	4	14673	226
SATL1	340562	broad.mit.edu	37	X	84347411	84347411	+	Missense_Mutation	SNP	C	G	G			TCGA-28-5220-01	TCGA-28-5220-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:84347411C>G	uc011mqx.1	-	6	2074	c.2074G>C	c.(2074-2076)GCA>CCA	p.A692P	SATL1_uc004een.2_3'UTR	NM_001163541	NP_001157013	Q86VE3	SATL1_HUMAN	spermidine/spermine N1-acetyl transferase-like 1	505	N-acetyltransferase.						N-acetyltransferase activity			breast(2)	2						TCTTCCCATGCCATGTCCAGG	0.458													2	11	---	---	---	---	capture	Missense_Mutation	SNP	84347411	84347411	SATL1	23	C	G	G	G	1	0	0	0	0	1	0	0	0	326	26	4	4	13747	226
ZNF101	94039	broad.mit.edu	37	19	19790246	19790247	+	Frame_Shift_Ins	INS	-	C	C			TCGA-28-5220-01	TCGA-28-5220-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:19790246_19790247insC	uc002nni.1	+	4	558_559	c.448_449insC	c.(448-450)TCCfs	p.S150fs	ZNF101_uc010ecg.1_Frame_Shift_Ins_p.S30fs|ZNF101_uc002nnj.1_Frame_Shift_Ins_p.S30fs	NM_033204	NP_149981	Q8IZC7	ZN101_HUMAN	zinc finger protein 101	150					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2						TGGGAAAGCCTCCATTTCCCCC	0.510													92	214	---	---	---	---	capture_indel	Frame_Shift_Ins	INS	19790246	19790247	ZNF101	19	-	C	C	C	1	0	1	1	0	0	0	0	0	702	54	5	5	17594	226
GALNT5	11227	broad.mit.edu	37	2	158114680	158114681	+	Frame_Shift_Ins	INS	-	C	C			TCGA-28-5220-01	TCGA-28-5220-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:158114680_158114681insC	uc002tzg.2	+	1	341_342	c.86_87insC	c.(85-87)GACfs	p.D29fs	GALNT5_uc010zci.1_RNA	NM_014568	NP_055383	Q7Z7M9	GALT5_HUMAN	N-acetylgalactosaminyltransferase 5	29	Helical; Signal-anchor for type II membrane protein; (Potential).				glycosaminoglycan biosynthetic process	Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			breast(3)|skin(1)	4						CTCCTCTTTGACATGGCAGCTC	0.495													113	213	---	---	---	---	capture_indel	Frame_Shift_Ins	INS	158114680	158114681	GALNT5	2	-	C	C	C	1	0	1	1	0	0	0	0	0	130	10	5	5	6156	226
TRAM1	23471	broad.mit.edu	37	8	71510232	71510256	+	Splice_Site	DEL	TCGCCTGTTAATTTTCTAAAAATAA	-	-			TCGA-28-5220-01	TCGA-28-5220-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:71510232_71510256delTCGCCTGTTAATTTTCTAAAAATAA	uc003xyo.1	-	4	480	c.310_splice	c.e4-1	p.K104_splice	TRAM1_uc011lfc.1_Splice_Site_p.K73_splice	NM_014294	NP_055109	Q15629	TRAM1_HUMAN	translocation associated membrane protein 1						cotranslational protein targeting to membrane|transmembrane transport	endoplasmic reticulum membrane|integral to membrane	protein binding|receptor activity			ovary(1)	1			Epithelial(68;0.00679)|all cancers(69;0.0324)|OV - Ovarian serous cystadenocarcinoma(28;0.0509)			AGAAGTGCATTCGCCTGTTAATTTTCTAAAAATAAAAACAGCCAT	0.302													7	33	---	---	---	---	capture_indel	Splice_Site	DEL	71510232	71510256	TRAM1	8	TCGCCTGTTAATTTTCTAAAAATAA	-	-	-	1	0	1	0	1	0	0	1	0	795	62	5	5	16334	226
