Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
NBPF10	100132406	broad.mit.edu	37	1	145324371	145324371	+	Missense_Mutation	SNP	T	C	C			TCGA-32-1980-01	TCGA-32-1980-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:145324371T>C	uc001end.3	+	30	3826	c.3791T>C	c.(3790-3792)GTA>GCA	p.V1264A	NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF10_uc001emp.3_Intron|NBPF10_uc010oyi.1_Intron|NBPF10_uc010oyk.1_Intron|NBPF10_uc010oyl.1_Intron|NBPF10_uc001enc.2_Intron|NBPF10_uc010oym.1_Intron|NBPF10_uc010oyn.1_Intron|NBPF10_uc010oyo.1_Intron|NBPF10_uc010oyp.1_RNA	NM_001039703	NP_001034792	A6NDV3	A6NDV3_HUMAN	hypothetical protein LOC100132406	1189											0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		CTGCTGGAGGTAGTAGCGCCT	0.498													2	2	---	---	---	---	capture	Missense_Mutation	SNP	145324371	145324371	NBPF10	1	T	C	C	C	1	0	0	0	0	1	0	0	0	741	57	3	3	10100	231
USH2A	7399	broad.mit.edu	37	1	215820917	215820917	+	Missense_Mutation	SNP	T	C	C			TCGA-32-1980-01	TCGA-32-1980-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:215820917T>C	uc001hku.1	-	67	15125	c.14738A>G	c.(14737-14739)AAC>AGC	p.N4913S		NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	4913	Extracellular (Potential).|Fibronectin type-III 34.				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		GCCCACCTCGTTGTGTGCCAC	0.478										HNSCC(13;0.011)			4	57	---	---	---	---	capture	Missense_Mutation	SNP	215820917	215820917	USH2A	1	T	C	C	C	1	0	0	0	0	1	0	0	0	780	60	3	3	16918	231
TAF1A	9015	broad.mit.edu	37	1	222761835	222761835	+	Missense_Mutation	SNP	C	G	G			TCGA-32-1980-01	TCGA-32-1980-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:222761835C>G	uc009xdz.1	-	2	260	c.71G>C	c.(70-72)AGT>ACT	p.S24T	TAF1A_uc001hni.1_5'UTR|TAF1A_uc001hnj.2_Missense_Mutation_p.S24T|TAF1A_uc001hnk.2_5'UTR|TAF1A_uc010pur.1_Missense_Mutation_p.S24T	NM_139352	NP_647603	Q15573	TAF1A_HUMAN	TBP-associated factor 1A isoform 2	24					regulation of transcription, DNA-dependent|termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase I promoter	RNA polymerase I transcription factor complex	DNA binding				0				GBM - Glioblastoma multiforme(131;0.0186)		TCCTGCACCACTGAGCACAGA	0.373													7	94	---	---	---	---	capture	Missense_Mutation	SNP	222761835	222761835	TAF1A	1	C	G	G	G	1	0	0	0	0	1	0	0	0	260	20	4	4	15407	231
LGALS12	85329	broad.mit.edu	37	11	63273794	63273794	+	Translation_Start_Site	SNP	C	T	T			TCGA-32-1980-01	TCGA-32-1980-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:63273794C>T	uc001nxa.2	+	1	271	c.-70C>T	c.(-72--68)AACGC>AATGC		LGALS12_uc001nxb.2_Translation_Start_Site|LGALS12_uc001nxc.2_Translation_Start_Site|LGALS12_uc001nxd.2_5'Flank|LGALS12_uc001nxe.2_5'Flank|LGALS12_uc009yot.2_5'Flank	NM_033101	NP_149092	Q96DT0	LEG12_HUMAN	lectin, galactoside-binding, soluble, 12 isoform						apoptosis|induction of apoptosis by intracellular signals	nucleus	lactose binding			ovary(2)	2						AGCATTAAAACGCTGCAGGTC	0.637													4	20	---	---	---	---	capture	Translation_Start_Site	SNP	63273794	63273794	LGALS12	11	C	T	T	T	1	0	0	0	0	0	0	0	0	235	19	1	1	8659	231
ARCN1	372	broad.mit.edu	37	11	118461139	118461139	+	Missense_Mutation	SNP	T	A	A			TCGA-32-1980-01	TCGA-32-1980-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:118461139T>A	uc001ptq.2	+	6	1063	c.902T>A	c.(901-903)ATC>AAC	p.I301N	ARCN1_uc009zah.2_Intron|ARCN1_uc010ryg.1_Missense_Mutation_p.I213N|ARCN1_uc009zag.2_Missense_Mutation_p.I342N	NM_001655	NP_001646	P48444	COPD_HUMAN	archain isoform 1	301	MHD.				COPI coating of Golgi vesicle|intracellular protein transport|retrograde vesicle-mediated transport, Golgi to ER	clathrin adaptor complex|COPI vesicle coat|cytosol					0	all_hematologic(175;0.0349)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.0564)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.28e-05)		CATGGCATGATCATGCTTAGG	0.393													6	98	---	---	---	---	capture	Missense_Mutation	SNP	118461139	118461139	ARCN1	11	T	A	A	A	1	0	0	0	0	1	0	0	0	650	50	4	4	835	231
KIF21A	55605	broad.mit.edu	37	12	39716483	39716483	+	Missense_Mutation	SNP	T	C	C	rs147620197		TCGA-32-1980-01	TCGA-32-1980-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:39716483T>C	uc001rly.2	-	27	3804	c.3658A>G	c.(3658-3660)AAG>GAG	p.K1220E	KIF21A_uc001rlv.2_Missense_Mutation_p.K225E|KIF21A_uc001rlw.2_Missense_Mutation_p.K537E|KIF21A_uc001rlx.2_Missense_Mutation_p.K1207E|KIF21A_uc001rlz.2_Missense_Mutation_p.K1184E|KIF21A_uc010skl.1_Missense_Mutation_p.K1200E	NM_017641	NP_060111	Q7Z4S6	KI21A_HUMAN	kinesin family member 21A	1220					microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(4)|pancreas(1)|lung(1)|skin(1)	7		Lung NSC(34;0.179)|all_lung(34;0.213)				CTGCCTATCTTAGAAGGTAAG	0.398													6	73	---	---	---	---	capture	Missense_Mutation	SNP	39716483	39716483	KIF21A	12	T	C	C	C	1	0	0	0	0	1	0	0	0	793	61	3	3	8210	231
F10	2159	broad.mit.edu	37	13	113803697	113803697	+	Missense_Mutation	SNP	C	T	T			TCGA-32-1980-01	TCGA-32-1980-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:113803697C>T	uc001vsx.2	+	8	1390	c.1333C>T	c.(1333-1335)CGT>TGT	p.R445C	F10_uc001vsy.2_3'UTR|F10_uc001vsz.2_3'UTR	NM_000504	NP_000495	P00742	FA10_HUMAN	coagulation factor X preproprotein	445	Peptidase S1.				blood coagulation, extrinsic pathway|blood coagulation, intrinsic pathway|peptidyl-glutamic acid carboxylation|positive regulation of cell migration|positive regulation of protein kinase B signaling cascade|post-translational protein modification|proteolysis	endoplasmic reticulum lumen|extracellular region|Golgi lumen	calcium ion binding|phospholipid binding|protein binding|serine-type endopeptidase activity			pancreas(1)	1	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_cancers(25;0.113)|all_lung(25;0.0364)|all_epithelial(44;0.0373)|Lung NSC(25;0.128)|Breast(118;0.188)	all cancers(43;0.0805)|Epithelial(84;0.231)		Alteplase(DB00009)|Anistreplase(DB00029)|Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Coagulation factor VIIa(DB00036)|Enoxaparin(DB01225)|Heparin(DB01109)|Menadione(DB00170)|Reteplase(DB00015)|Tenecteplase(DB00031)	GGGCTGTGCCCGTAAGGGGAA	0.627													13	98	---	---	---	---	capture	Missense_Mutation	SNP	113803697	113803697	F10	13	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	5290	231
CFL2	1073	broad.mit.edu	37	14	35182132	35182132	+	Missense_Mutation	SNP	G	A	A			TCGA-32-1980-01	TCGA-32-1980-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:35182132G>A	uc001wsg.3	-	4	581	c.440C>T	c.(439-441)TCG>TTG	p.S147L	CFL2_uc010tpn.1_Missense_Mutation_p.S130L|CFL2_uc001wsh.3_Missense_Mutation_p.S147L|CFL2_uc001wsi.3_RNA|CFL2_uc001wsj.3_RNA	NM_021914	NP_068733	Q9Y281	COF2_HUMAN	cofilin 2	147	ADF-H.					cytoplasm|cytoskeleton|nuclear matrix	actin binding			breast(2)	2	Breast(36;0.0361)|Hepatocellular(127;0.158)		LUAD - Lung adenocarcinoma(48;6.07e-06)|Lung(238;2.23e-05)|Epithelial(34;0.0387)|all cancers(34;0.0814)	GBM - Glioblastoma multiforme(112;0.0424)		TCCAAGTGTCGAACGGTCCTT	0.338													6	48	---	---	---	---	capture	Missense_Mutation	SNP	35182132	35182132	CFL2	14	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	3257	231
NF1	4763	broad.mit.edu	37	17	29663349	29663349	+	Splice_Site	SNP	A	G	G			TCGA-32-1980-01	TCGA-32-1980-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:29663349A>G	uc002hgg.2	+	41	6340	c.6007_splice	c.e41-2	p.I2003_splice	NF1_uc002hgh.2_Splice_Site_p.I1982_splice|NF1_uc010cso.2_Splice_Site_p.I191_splice|NF1_uc010wbt.1_5'Flank|NF1_uc010wbu.1_5'Flank	NM_001042492	NP_001035957	P21359	NF1_HUMAN	neurofibromin isoform 1						actin cytoskeleton organization|adrenal gland development|artery morphogenesis|camera-type eye morphogenesis|cerebral cortex development|collagen fibril organization|forebrain astrocyte development|forebrain morphogenesis|heart development|liver development|MAPKKK cascade|metanephros development|myelination in peripheral nervous system|negative regulation of cell migration|negative regulation of endothelial cell proliferation|negative regulation of MAP kinase activity|negative regulation of MAPKKK cascade|negative regulation of neuroblast proliferation|negative regulation of oligodendrocyte differentiation|negative regulation of transcription factor import into nucleus|osteoblast differentiation|phosphatidylinositol 3-kinase cascade|pigmentation|positive regulation of adenylate cyclase activity|positive regulation of neuron apoptosis|Ras protein signal transduction|regulation of blood vessel endothelial cell migration|regulation of bone resorption|response to hypoxia|smooth muscle tissue development|spinal cord development|sympathetic nervous system development|visual learning|wound healing	axon|cytoplasm|dendrite|intrinsic to internal side of plasma membrane|nucleus	protein binding|Ras GTPase activator activity			soft_tissue(159)|central_nervous_system(56)|lung(28)|large_intestine(27)|haematopoietic_and_lymphoid_tissue(18)|ovary(18)|autonomic_ganglia(12)|breast(3)|skin(3)|stomach(2)|thyroid(1)|prostate(1)|kidney(1)|pancreas(1)	330		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		TTCTTCAACTAGATTACAGAT	0.323			D|Mis|N|F|S|O		neurofibroma|glioma	neurofibroma|glioma			Neurofibromatosis_type_1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)			3	28	---	---	---	---	capture	Splice_Site	SNP	29663349	29663349	NF1	17	A	G	G	G	1	0	0	0	0	0	0	1	0	195	15	5	3	10263	231
MYOM1	8736	broad.mit.edu	37	18	3188890	3188890	+	Silent	SNP	C	T	T			TCGA-32-1980-01	TCGA-32-1980-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:3188890C>T	uc002klp.2	-	4	961	c.627G>A	c.(625-627)ACG>ACA	p.T209T	MYOM1_uc002klq.2_Silent_p.T209T	NM_003803	NP_003794	P52179	MYOM1_HUMAN	myomesin 1 isoform a	209	5.|6 X 6 AA tandem repeats.					striated muscle myosin thick filament	structural constituent of muscle			ovary(3)|central_nervous_system(1)|pancreas(1)	5						GCCTGGATGCCGTGGACTGCT	0.522													4	87	---	---	---	---	capture	Silent	SNP	3188890	3188890	MYOM1	18	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	10001	231
MUC16	94025	broad.mit.edu	37	19	9075072	9075072	+	Missense_Mutation	SNP	G	A	A			TCGA-32-1980-01	TCGA-32-1980-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:9075072G>A	uc002mkp.2	-	3	12578	c.12374C>T	c.(12373-12375)ACG>ATG	p.T4125M		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	4127	Thr-rich.|Extracellular (Potential).|Ser-rich.				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						TCTCTGAGTCGTAGCCAGTGG	0.502													4	67	---	---	---	---	capture	Missense_Mutation	SNP	9075072	9075072	MUC16	19	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	9883	231
NDUFA13	51079	broad.mit.edu	37	19	19645858	19645858	+	Missense_Mutation	SNP	G	A	A			TCGA-32-1980-01	TCGA-32-1980-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:19645858G>A	uc010xqy.1	+	5	839	c.580G>A	c.(580-582)GCT>ACT	p.A194T	NDUFA13_uc010xqx.1_3'UTR|YJEFN3_uc002nmt.1_Missense_Mutation_p.A112T|YJEFN3_uc010ecf.1_Missense_Mutation_p.A62T|YJEFN3_uc002nmu.1_RNA	NM_015965	NP_057049	Q9P0J0	NDUAD_HUMAN	NADH dehydrogenase (ubiquinone) 1 alpha	Error:Variant_position_missing_in_Q9P0J0_after_alignment					apoptotic nuclear change|induction of apoptosis by extracellular signals|negative regulation of cell growth|negative regulation of transcription, DNA-dependent|negative regulation of translation|protein import into nucleus|reactive oxygen species metabolic process|respiratory electron transport chain	integral to membrane|mitochondrial respiratory chain complex I|nucleoplasm	ATP binding|NADH dehydrogenase (ubiquinone) activity|protein binding				0					NADH(DB00157)	CCCGTTGCCCGCTCTCTCCCG	0.498													6	183	---	---	---	---	capture	Missense_Mutation	SNP	19645858	19645858	NDUFA13	19	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	10170	231
NLRP4	147945	broad.mit.edu	37	19	56379119	56379119	+	Missense_Mutation	SNP	C	T	T			TCGA-32-1980-01	TCGA-32-1980-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:56379119C>T	uc002qmd.3	+	6	2653	c.2231C>T	c.(2230-2232)GCT>GTT	p.A744V	NLRP4_uc002qmf.2_Missense_Mutation_p.A669V|NLRP4_uc010etf.2_Intron	NM_134444	NP_604393	Q96MN2	NALP4_HUMAN	NLR family, pyrin domain containing 4	744	LRR 3.						ATP binding			ovary(5)|skin(4)|lung(3)|upper_aerodigestive_tract(1)|kidney(1)|pancreas(1)	15		Colorectal(82;0.0002)|Ovarian(87;0.221)		GBM - Glioblastoma multiforme(193;0.0606)		GAAGTCCTTGCTGGCCTTCTA	0.483													12	125	---	---	---	---	capture	Missense_Mutation	SNP	56379119	56379119	NLRP4	19	C	T	T	T	1	0	0	0	0	1	0	0	0	364	28	2	2	10386	231
TTN	7273	broad.mit.edu	37	2	179640164	179640164	+	Missense_Mutation	SNP	C	G	G			TCGA-32-1980-01	TCGA-32-1980-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179640164C>G	uc010zfg.1	-	28	6651	c.6427G>C	c.(6427-6429)GCT>CCT	p.A2143P	TTN_uc010zfh.1_Missense_Mutation_p.A2097P|TTN_uc010zfi.1_Missense_Mutation_p.A2097P|TTN_uc010zfj.1_Missense_Mutation_p.A2097P|TTN_uc002unb.2_Missense_Mutation_p.A2143P|uc002unc.1_5'Flank	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	2143							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GAGTCCTCAGCAGTCACATCT	0.443													3	22	---	---	---	---	capture	Missense_Mutation	SNP	179640164	179640164	TTN	2	C	G	G	G	1	0	0	0	0	1	0	0	0	325	25	4	4	16617	231
PCNT	5116	broad.mit.edu	37	21	47845820	47845820	+	Missense_Mutation	SNP	G	A	A			TCGA-32-1980-01	TCGA-32-1980-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:47845820G>A	uc002zji.3	+	33	7362	c.7255G>A	c.(7255-7257)GAG>AAG	p.E2419K	PCNT_uc002zjj.2_Missense_Mutation_p.E2301K	NM_006031	NP_006022	O95613	PCNT_HUMAN	pericentrin	2419					cilium assembly|G2/M transition of mitotic cell cycle	cytosol|microtubule	calmodulin binding			ovary(4)|breast(2)|pancreas(2)	8	Breast(49;0.112)					CCCAAGCGGCGAGCCACACCC	0.577													5	117	---	---	---	---	capture	Missense_Mutation	SNP	47845820	47845820	PCNT	21	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	11493	231
BCL6	604	broad.mit.edu	37	3	187447774	187447774	+	Missense_Mutation	SNP	C	T	T			TCGA-32-1980-01	TCGA-32-1980-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:187447774C>T	uc003frp.3	-	5	876	c.419G>A	c.(418-420)CGT>CAT	p.R140H	BCL6_uc011bsf.1_Missense_Mutation_p.R140H|BCL6_uc010hza.2_Missense_Mutation_p.R38H|BCL6_uc003frq.1_Missense_Mutation_p.R140H	NM_001130845	NP_001124317	P41182	BCL6_HUMAN	B-cell lymphoma 6 protein isoform 1	140					negative regulation of B cell apoptosis|negative regulation of cell growth|negative regulation of S phase of mitotic cell cycle|negative regulation of transcription from RNA polymerase II promoter|positive regulation of apoptosis|protein import into nucleus, translocation|regulation of germinal center formation|response to DNA damage stimulus	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)|lung(2)|central_nervous_system(1)	5	all_cancers(143;9.45e-12)|Ovarian(172;0.0418)		OV - Ovarian serous cystadenocarcinoma(80;1.76e-18)	GBM - Glioblastoma multiforme(93;0.0141)		GAACTCTTCACGAGGAGGCTT	0.522			T|Mis	IG loci|ZNFN1A1|LCP1|PIM1|TFRC|MHC2TA|NACA|HSPCB|HSPCA|HIST1H4I|IL21R| POU2AF1|ARHH|EIF4A2|SFRS3	NHL|CLL								5	85	---	---	---	---	capture	Missense_Mutation	SNP	187447774	187447774	BCL6	3	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	1365	231
REST	5978	broad.mit.edu	37	4	57777086	57777086	+	Silent	SNP	A	G	G			TCGA-32-1980-01	TCGA-32-1980-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:57777086A>G	uc003hch.2	+	2	629	c.282A>G	c.(280-282)GAA>GAG	p.E94E	REST_uc003hci.2_Silent_p.E94E|REST_uc003hcj.1_Silent_p.E94E|REST_uc010ihf.2_5'UTR	NM_005612	NP_005603	Q13127	REST_HUMAN	RE1-silencing transcription factor	94	Interaction with SIN3A.				cardiac muscle cell myoblast differentiation|cellular response to drug|cellular response to electrical stimulus|cellular response to glucocorticoid stimulus|histone H4 deacetylation|negative regulation by host of viral transcription|negative regulation of aldosterone biosynthetic process|negative regulation of calcium ion-dependent exocytosis|negative regulation of cell proliferation|negative regulation of cortisol biosynthetic process|negative regulation of dense core granule biogenesis|negative regulation of insulin secretion|negative regulation of mesenchymal stem cell differentiation|negative regulation of neurogenesis|negative regulation of neuron differentiation|positive regulation of apoptosis|positive regulation of caspase activity|positive regulation of transcription, DNA-dependent	cytoplasm|transcriptional repressor complex	calcium channel activity|chromatin binding|core promoter proximal region sequence-specific DNA binding|core promoter sequence-specific DNA binding|outward rectifier potassium channel activity|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription|zinc ion binding			skin(5)|upper_aerodigestive_tract(1)|ovary(1)|lung(1)|central_nervous_system(1)	9	Glioma(25;0.08)|all_neural(26;0.181)					AAGGACTTGAAGAGTCTGCTG	0.458													4	65	---	---	---	---	capture	Silent	SNP	57777086	57777086	REST	4	A	G	G	G	1	0	0	0	0	0	0	0	1	37	3	3	3	13129	231
SPARCL1	8404	broad.mit.edu	37	4	88415064	88415064	+	Silent	SNP	T	C	C			TCGA-32-1980-01	TCGA-32-1980-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:88415064T>C	uc010ikm.2	-	5	1460	c.888A>G	c.(886-888)CAA>CAG	p.Q296Q	SPARCL1_uc011cdc.1_Silent_p.Q171Q|SPARCL1_uc003hqs.3_Silent_p.Q296Q|SPARCL1_uc011cdd.1_Silent_p.Q171Q|SPARCL1_uc003hqt.2_Silent_p.Q296Q	NM_001128310	NP_001121782	Q14515	SPRL1_HUMAN	SPARC-like 1 precursor	296					signal transduction	extracellular space|proteinaceous extracellular matrix	calcium ion binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(123;0.00118)		TTTTACCCTCTTGACTCTGCC	0.418													6	199	---	---	---	---	capture	Silent	SNP	88415064	88415064	SPARCL1	4	T	C	C	C	1	0	0	0	0	0	0	0	1	725	56	3	3	14888	231
FAT4	79633	broad.mit.edu	37	4	126337603	126337603	+	Missense_Mutation	SNP	G	A	A			TCGA-32-1980-01	TCGA-32-1980-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:126337603G>A	uc003ifj.3	+	6	6844	c.6844G>A	c.(6844-6846)GTG>ATG	p.V2282M	FAT4_uc011cgp.1_Missense_Mutation_p.V580M	NM_024582	NP_078858	Q6V0I7	FAT4_HUMAN	FAT tumor suppressor homolog 4 precursor	2282	Extracellular (Potential).|Cadherin 22.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(9)|skin(5)|upper_aerodigestive_tract(2)|pancreas(2)	18						TGTTCTACAGGTGGTGGCAAG	0.368													10	98	---	---	---	---	capture	Missense_Mutation	SNP	126337603	126337603	FAT4	4	G	A	A	A	1	0	0	0	0	1	0	0	0	572	44	2	2	5638	231
NHLRC1	378884	broad.mit.edu	37	6	18122155	18122155	+	Missense_Mutation	SNP	C	T	T			TCGA-32-1980-01	TCGA-32-1980-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:18122155C>T	uc003ncl.1	-	1	697	c.683G>A	c.(682-684)GGG>GAG	p.G228E		NM_198586	NP_940988	Q6VVB1	NHLC1_HUMAN	NHL repeat containing 1	228	NHL 3.				proteasomal ubiquitin-dependent protein catabolic process|protein polyubiquitination	endoplasmic reticulum|nucleus	protein binding|ubiquitin-protein ligase activity|zinc ion binding				0	Ovarian(93;0.016)|Breast(50;0.0245)	all_hematologic(90;0.165)	all cancers(50;0.0451)|Epithelial(50;0.0493)			TACCACAATCCCATTCTGAGG	0.532													5	35	---	---	---	---	capture	Missense_Mutation	SNP	18122155	18122155	NHLRC1	6	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	10312	231
OR9A4	130075	broad.mit.edu	37	7	141619469	141619469	+	Missense_Mutation	SNP	C	T	T			TCGA-32-1980-01	TCGA-32-1980-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:141619469C>T	uc003vwu.1	+	1	794	c.794C>T	c.(793-795)ACG>ATG	p.T265M		NM_001001656	NP_001001656	Q8NGU2	OR9A4_HUMAN	olfactory receptor, family 9, subfamily A,	265	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1	Melanoma(164;0.0171)					CCCAAGCAAACGCAGGCAGCT	0.478													5	35	---	---	---	---	capture	Missense_Mutation	SNP	141619469	141619469	OR9A4	7	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	11153	231
ZNF782	158431	broad.mit.edu	37	9	99581330	99581330	+	Silent	SNP	G	C	C			TCGA-32-1980-01	TCGA-32-1980-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:99581330G>C	uc004awp.1	-	6	1256	c.975C>G	c.(973-975)CTC>CTG	p.L325L	ZNF782_uc011lup.1_Silent_p.L193L	NM_001001662	NP_001001662	Q6ZMW2	ZN782_HUMAN	zinc finger protein 782	325	C2H2-type 2; degenerate.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Acute lymphoblastic leukemia(62;0.0527)				GATGCACTGGGAGGGTTGAAT	0.398													10	80	---	---	---	---	capture	Silent	SNP	99581330	99581330	ZNF782	9	G	C	C	C	1	0	0	0	0	0	0	0	1	522	41	4	4	18031	231
