Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
MACF1	23499	broad.mit.edu	37	1	39750772	39750772	+	Silent	SNP	C	T	T			TCGA-32-1982-01	TCGA-32-1982-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:39750772C>T	uc010ois.1	+	13	1369	c.1164C>T	c.(1162-1164)GGC>GGT	p.G388G	MACF1_uc001cda.1_Silent_p.G296G	NM_012090	NP_036222	Q9UPN3	MACF1_HUMAN	microfilament and actin filament cross-linker	388	LRR 3.				cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding			ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			TTGAATTTGGCCGAATTAAAC	0.433													4	152	---	---	---	---	capture	Silent	SNP	39750772	39750772	MACF1	1	C	T	T	T	1	0	0	0	0	0	0	0	1	327	26	2	2	9059	232
ANKRD34A	284615	broad.mit.edu	37	1	145473561	145473561	+	Missense_Mutation	SNP	G	A	A			TCGA-32-1982-01	TCGA-32-1982-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:145473561G>A	uc001enq.1	+	4	1526	c.233G>A	c.(232-234)CGC>CAC	p.R78H	NBPF10_uc001emp.3_Intron	NM_001039888	NP_001034977	Q69YU3	AN34A_HUMAN	ankyrin repeat domain 34	78	ANK 3.										0	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					CGATTAGGGCGCACGGCGCTC	0.706													4	112	---	---	---	---	capture	Missense_Mutation	SNP	145473561	145473561	ANKRD34A	1	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	658	232
MTMR11	10903	broad.mit.edu	37	1	149901667	149901667	+	Missense_Mutation	SNP	T	C	C			TCGA-32-1982-01	TCGA-32-1982-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:149901667T>C	uc001etl.3	-	16	2040	c.1789A>G	c.(1789-1791)ATC>GTC	p.I597V	SF3B4_uc001etj.1_5'Flank|SF3B4_uc001etk.1_5'Flank|SF3B4_uc009wll.1_5'Flank|MTMR11_uc001etm.1_Missense_Mutation_p.I525V	NM_001145862	NP_001139334	A4FU01	MTMRB_HUMAN	myotubularin related protein 11 isoform a	597	Myotubularin phosphatase.						phosphatase activity			central_nervous_system(1)	1	Breast(34;0.0009)|Ovarian(49;0.0377)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.221)|STAD - Stomach adenocarcinoma(528;0.247)			TCAGAGGAGATAGCAGGTCGA	0.597													42	115	---	---	---	---	capture	Missense_Mutation	SNP	149901667	149901667	MTMR11	1	T	C	C	C	1	0	0	0	0	1	0	0	0	637	49	3	3	9850	232
LYST	1130	broad.mit.edu	37	1	235993676	235993676	+	Silent	SNP	G	A	A			TCGA-32-1982-01	TCGA-32-1982-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:235993676G>A	uc001hxj.2	-	3	217	c.42C>T	c.(40-42)ACC>ACT	p.T14T	LYST_uc009xgb.1_RNA|LYST_uc010pxs.1_RNA|LYST_uc001hxl.1_Silent_p.T14T|LYST_uc001hxm.2_RNA|LYST_uc001hxn.1_Silent_p.T14T	NM_000081	NP_000072	Q99698	LYST_HUMAN	lysosomal trafficking regulator	14					defense response to bacterium|defense response to protozoan|defense response to virus|endosome to lysosome transport via multivesicular body sorting pathway|leukocyte chemotaxis|mast cell secretory granule organization|melanosome organization|natural killer cell mediated cytotoxicity|protein transport	cytoplasm|microtubule cytoskeleton	protein binding			ovary(6)|breast(4)|central_nervous_system(2)	12	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			GGTTGACATCGGTCAGAAATT	0.458									Chediak-Higashi_syndrome				25	50	---	---	---	---	capture	Silent	SNP	235993676	235993676	LYST	1	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	9043	232
OR2AK2	391191	broad.mit.edu	37	1	248128698	248128698	+	Missense_Mutation	SNP	G	A	A			TCGA-32-1982-01	TCGA-32-1982-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:248128698G>A	uc010pzd.1	+	1	65	c.65G>A	c.(64-66)AGT>AAT	p.S22N	OR2L13_uc001ids.2_Intron	NM_001004491	NP_001004491	Q8NG84	O2AK2_HUMAN	olfactory receptor, family 2, subfamily AK,	22	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	p.S22R(1)		ovary(1)|breast(1)	2	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0152)			GGAAATCAAAGTTTTGGGACA	0.279													5	172	---	---	---	---	capture	Missense_Mutation	SNP	248128698	248128698	OR2AK2	1	G	A	A	A	1	0	0	0	0	1	0	0	0	468	36	2	2	10890	232
OR2T33	391195	broad.mit.edu	37	1	248436720	248436720	+	Missense_Mutation	SNP	G	A	A			TCGA-32-1982-01	TCGA-32-1982-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:248436720G>A	uc010pzi.1	-	1	397	c.397C>T	c.(397-399)CTC>TTC	p.L133F		NM_001004695	NP_001004695	Q8NG76	O2T33_HUMAN	olfactory receptor, family 2, subfamily T,	133	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			large_intestine(1)|ovary(1)	2	all_cancers(71;0.000124)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			CAGCTCATGAGAGTGGGATAT	0.592													25	149	---	---	---	---	capture	Missense_Mutation	SNP	248436720	248436720	OR2T33	1	G	A	A	A	1	0	0	0	0	1	0	0	0	429	33	2	2	10928	232
ARHGAP21	57584	broad.mit.edu	37	10	24874106	24874106	+	Silent	SNP	G	A	A			TCGA-32-1982-01	TCGA-32-1982-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:24874106G>A	uc001isb.2	-	26	5599	c.5112C>T	c.(5110-5112)TCC>TCT	p.S1704S	ARHGAP21_uc010qdb.1_RNA	NM_020824	NP_065875	Q5T5U3	RHG21_HUMAN	Rho GTPase activating protein 21	1703	Interaction with CTNNA1.				signal transduction	cell junction|cytoplasmic vesicle membrane|cytoskeleton|Golgi membrane	GTPase activator activity|protein binding			ovary(7)|pancreas(1)	8						ATTTTTTCCTGGAAAGAGTAT	0.393													12	146	---	---	---	---	capture	Silent	SNP	24874106	24874106	ARHGAP21	10	G	A	A	A	1	0	0	0	0	0	0	0	1	600	47	2	2	864	232
CUL2	8453	broad.mit.edu	37	10	35299303	35299303	+	Missense_Mutation	SNP	A	T	T			TCGA-32-1982-01	TCGA-32-1982-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:35299303A>T	uc001ixv.2	-	21	2384	c.2174T>A	c.(2173-2175)CTG>CAG	p.L725Q	CUL2_uc009xma.2_Missense_Mutation_p.L594Q|CUL2_uc010qer.1_Missense_Mutation_p.L744Q|CUL2_uc001ixw.2_Missense_Mutation_p.L725Q	NM_003591	NP_003582	Q13617	CUL2_HUMAN	cullin 2	725					cell cycle arrest|G1/S transition of mitotic cell cycle|induction of apoptosis by intracellular signals|interspecies interaction between organisms|negative regulation of cell proliferation|ubiquitin-dependent protein catabolic process	cullin-RING ubiquitin ligase complex	ubiquitin protein ligase binding			ovary(3)	3						TTTGTCTATCAGAACTTCAAT	0.463													34	30	---	---	---	---	capture	Missense_Mutation	SNP	35299303	35299303	CUL2	10	A	T	T	T	1	0	0	0	0	1	0	0	0	91	7	4	4	4015	232
ZNF37A	7587	broad.mit.edu	37	10	38404217	38404217	+	Silent	SNP	G	T	T			TCGA-32-1982-01	TCGA-32-1982-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:38404217G>T	uc001izk.2	+	7	1056	c.237G>T	c.(235-237)CTG>CTT	p.L79L	ZNF37A_uc001izl.2_Silent_p.L79L|ZNF37A_uc001izm.2_Silent_p.L79L	NM_001007094	NP_001007095	P17032	ZN37A_HUMAN	zinc finger protein 37a	79	KRAB.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			breast(1)	1						AGAGTCATCTGGGTGAGTTAG	0.393													14	16	---	---	---	---	capture	Silent	SNP	38404217	38404217	ZNF37A	10	G	T	T	T	1	0	0	0	0	0	0	0	1	600	47	4	4	17752	232
LRRC18	474354	broad.mit.edu	37	10	50121795	50121795	+	Missense_Mutation	SNP	C	T	T	rs138127999		TCGA-32-1982-01	TCGA-32-1982-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:50121795C>T	uc001jhd.2	-	1	486	c.406G>A	c.(406-408)GTG>ATG	p.V136M	WDFY4_uc001jha.3_Intron|LRRC18_uc001jhe.1_Missense_Mutation_p.V136M	NM_001006939	NP_001006940	Q8N456	LRC18_HUMAN	leucine rich repeat containing 18	136	LRR 5.					cytoplasm				ovary(1)|pancreas(1)	2						GTGGTGGGCACGCTGTCCAGG	0.602													11	23	---	---	---	---	capture	Missense_Mutation	SNP	50121795	50121795	LRRC18	10	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	8890	232
CHAT	1103	broad.mit.edu	37	10	50870733	50870733	+	Missense_Mutation	SNP	C	T	T	rs116097791	by1000genomes	TCGA-32-1982-01	TCGA-32-1982-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:50870733C>T	uc001jhz.2	+	14	2035	c.1882C>T	c.(1882-1884)CGG>TGG	p.R628W	CHAT_uc001jhv.1_Missense_Mutation_p.R510W|CHAT_uc001jhx.1_Missense_Mutation_p.R510W|CHAT_uc001jhy.1_Missense_Mutation_p.R510W|CHAT_uc001jia.2_Missense_Mutation_p.R510W|CHAT_uc010qgs.1_Missense_Mutation_p.R510W	NM_020549	NP_065574	P28329	CLAT_HUMAN	choline acetyltransferase isoform 2	628					neurotransmitter biosynthetic process|neurotransmitter secretion	cytosol|nucleus	choline O-acetyltransferase activity			central_nervous_system(3)	3		all_neural(218;0.107)		GBM - Glioblastoma multiforme(2;0.000585)	Choline(DB00122)	GCTGGCACTGCGGGAGCTGGC	0.572													38	56	---	---	---	---	capture	Missense_Mutation	SNP	50870733	50870733	CHAT	10	C	T	T	T	1	0	0	0	0	1	0	0	0	347	27	1	1	3279	232
PTEN	5728	broad.mit.edu	37	10	89692829	89692829	+	Missense_Mutation	SNP	T	C	C			TCGA-32-1982-01	TCGA-32-1982-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:89692829T>C	uc001kfb.2	+	6	1344	c.313T>C	c.(313-315)TGT>CGT	p.C105R		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog	105	Phosphatase tensin-type.		C -> F (in BZS; loss of phosphatase activity towards Ins(1,3,4,5)P4).|C -> Y (in BZS).		activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.C105F(6)|p.R55fs*1(4)|p.C105W(4)|p.C105S(3)|p.?(2)|p.Y27fs*1(2)|p.C105Y(2)|p.Y27_N212>Y(2)|p.C105fs*1(1)|p.C105fs*2(1)|p.C105G(1)|p.C105R(1)|p.F56fs*2(1)|p.P103fs*3(1)		endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		CAAACCCTTTTGTGAAGATCT	0.378		31	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			5	78	---	---	---	---	capture	Missense_Mutation	SNP	89692829	89692829	PTEN	10	T	C	C	C	1	0	0	0	0	1	0	0	0	819	63	3	3	12633	232
OR5T3	390154	broad.mit.edu	37	11	56020589	56020589	+	Missense_Mutation	SNP	C	T	T			TCGA-32-1982-01	TCGA-32-1982-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:56020589C>T	uc010rjd.1	+	1	914	c.914C>T	c.(913-915)TCA>TTA	p.S305L		NM_001004747	NP_001004747	Q8NGG3	OR5T3_HUMAN	olfactory receptor, family 5, subfamily T,	305	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	Esophageal squamous(21;0.00448)					ATCATAGTGTCAATATTTTAC	0.368													29	121	---	---	---	---	capture	Missense_Mutation	SNP	56020589	56020589	OR5T3	11	C	T	T	T	1	0	0	0	0	1	0	0	0	377	29	2	2	11087	232
ANO2	57101	broad.mit.edu	37	12	5724431	5724431	+	Missense_Mutation	SNP	G	A	A			TCGA-32-1982-01	TCGA-32-1982-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:5724431G>A	uc001qnm.2	-	18	1921	c.1849C>T	c.(1849-1851)CGC>TGC	p.R617C		NM_020373	NP_065106	Q9NQ90	ANO2_HUMAN	anoctamin 2	622	Cytoplasmic (Potential).					chloride channel complex|plasma membrane	intracellular calcium activated chloride channel activity			ovary(4)|large_intestine(2)|central_nervous_system(1)	7						AGGATCAGGCGCTCTTCAAAA	0.458													10	24	---	---	---	---	capture	Missense_Mutation	SNP	5724431	5724431	ANO2	12	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	691	232
LRRK2	120892	broad.mit.edu	37	12	40689281	40689281	+	Silent	SNP	G	A	A			TCGA-32-1982-01	TCGA-32-1982-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:40689281G>A	uc001rmg.3	+	23	3052	c.2931G>A	c.(2929-2931)CTG>CTA	p.L977L	LRRK2_uc001rmh.1_Silent_p.L599L|LRRK2_uc009zjw.2_5'UTR	NM_198578	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	977					activation of MAPKK activity|determination of adult lifespan|exploration behavior|intracellular distribution of mitochondria|negative regulation of branching morphogenesis of a nerve|negative regulation of dendritic spine morphogenesis|negative regulation of neuroblast proliferation|negative regulation of neuron maturation|neuromuscular junction development|neuron death|peptidyl-serine phosphorylation|positive regulation of autophagy|positive regulation of dopamine receptor signaling pathway|positive regulation of programmed cell death|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein phosphorylation|positive regulation of protein ubiquitination|protein autophosphorylation|regulation of kidney size|regulation of locomotion|regulation of membrane potential|response to oxidative stress|small GTPase mediated signal transduction|tangential migration from the subventricular zone to the olfactory bulb	external side of mitochondrial outer membrane	ATP binding|GTP binding|GTP-dependent protein kinase activity|GTPase activator activity|MAP kinase kinase activity|protein homodimerization activity|tubulin binding			ovary(12)|stomach(5)|upper_aerodigestive_tract(2)|lung(2)|large_intestine(1)|urinary_tract(1)|pancreas(1)	24	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)				TTTCTTCTCTGGCTTCTGAGA	0.343													22	75	---	---	---	---	capture	Silent	SNP	40689281	40689281	LRRK2	12	G	A	A	A	1	0	0	0	0	0	0	0	1	600	47	2	2	8948	232
LRRIQ1	84125	broad.mit.edu	37	12	85460676	85460676	+	Nonsense_Mutation	SNP	G	T	T			TCGA-32-1982-01	TCGA-32-1982-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:85460676G>T	uc001tac.2	+	10	2806	c.2695G>T	c.(2695-2697)GGA>TGA	p.G899*	LRRIQ1_uc001tab.1_Nonsense_Mutation_p.G899*	NM_001079910	NP_001073379	Q96JM4	LRIQ1_HUMAN	leucine-rich repeats and IQ motif containing 1	899	LRR 4.									ovary(4)|central_nervous_system(1)|skin(1)	6				GBM - Glioblastoma multiforme(134;0.212)		TACTCGAATTGGTAAGAACAA	0.274													8	43	---	---	---	---	capture	Nonsense_Mutation	SNP	85460676	85460676	LRRIQ1	12	G	T	T	T	1	0	0	0	0	0	1	0	0	611	47	5	4	8944	232
MYH6	4624	broad.mit.edu	37	14	23869930	23869930	+	Silent	SNP	G	A	A			TCGA-32-1982-01	TCGA-32-1982-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:23869930G>A	uc001wjv.2	-	13	1465	c.1398C>T	c.(1396-1398)TTC>TTT	p.F466F	MYH6_uc010akp.1_Silent_p.F466F	NM_002471	NP_002462	P13533	MYH6_HUMAN	myosin heavy chain 6	466	Myosin head-like.				adult heart development|atrial cardiac muscle tissue morphogenesis|cardiac muscle fiber development|in utero embryonic development|muscle filament sliding|regulation of ATPase activity|regulation of blood pressure|regulation of heart rate|regulation of the force of heart contraction|sarcomere organization|striated muscle contraction|ventricular cardiac muscle tissue morphogenesis|visceral muscle development	cytosol|focal adhesion|muscle myosin complex|myosin filament|nucleus|sarcomere	actin binding|actin-dependent ATPase activity|ATP binding|calmodulin binding|microfilament motor activity|protein kinase binding|structural constituent of muscle			pancreas(2)|ovary(1)|skin(1)	4	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00764)|READ - Rectum adenocarcinoma(4;0.0289)|Colorectal(4;0.0441)		CGAAGATCTCGAAGCCAGCGA	0.438													13	51	---	---	---	---	capture	Silent	SNP	23869930	23869930	MYH6	14	G	A	A	A	1	0	0	0	0	0	0	0	1	477	37	1	1	9948	232
DICER1	23405	broad.mit.edu	37	14	95569923	95569923	+	Silent	SNP	C	T	T			TCGA-32-1982-01	TCGA-32-1982-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:95569923C>T	uc001ydw.2	-	22	3992	c.3810G>A	c.(3808-3810)GTG>GTA	p.V1270V	DICER1_uc010avh.1_Silent_p.V168V|DICER1_uc001ydv.2_Silent_p.V1260V|DICER1_uc001ydx.2_Silent_p.V1270V|DICER1_uc001ydy.1_Silent_p.V122V	NM_030621	NP_085124	Q9UPY3	DICER_HUMAN	dicer1	1270					negative regulation of Schwann cell proliferation|negative regulation of transcription from RNA polymerase II promoter|nerve development|neuron projection morphogenesis|peripheral nervous system myelin formation|positive regulation of myelination|positive regulation of Schwann cell differentiation|pre-miRNA processing|production of siRNA involved in RNA interference|targeting of mRNA for destruction involved in RNA interference	cytosol|RNA-induced silencing complex	ATP binding|ATP-dependent helicase activity|double-stranded RNA binding|metal ion binding|protein binding|ribonuclease III activity			skin(2)|ovary(1)|pancreas(1)|lung(1)	5		all_cancers(154;0.0621)|all_epithelial(191;0.223)		Epithelial(152;0.211)|COAD - Colon adenocarcinoma(157;0.215)		TGCCCTTGAGCACTTGAATAG	0.468			Mis F|N			pleuropulmonary blastoma			DICER_1_syndrome_|Familial_Multinodular_Goiter_				6	156	---	---	---	---	capture	Silent	SNP	95569923	95569923	DICER1	14	C	T	T	T	1	0	0	0	0	0	0	0	1	314	25	2	2	4479	232
RYR3	6263	broad.mit.edu	37	15	33895352	33895352	+	Missense_Mutation	SNP	G	A	A			TCGA-32-1982-01	TCGA-32-1982-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:33895352G>A	uc001zhi.2	+	18	2021	c.1951G>A	c.(1951-1953)GCG>ACG	p.A651T	RYR3_uc010bar.2_Missense_Mutation_p.A651T	NM_001036	NP_001027	Q15413	RYR3_HUMAN	ryanodine receptor 3	651	Cytoplasmic (By similarity).|B30.2/SPRY 1.				cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(5)|central_nervous_system(4)|lung(1)	10		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		CCTGGGAGTCGCGGAGGGCTC	0.527													57	132	---	---	---	---	capture	Missense_Mutation	SNP	33895352	33895352	RYR3	15	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	13662	232
MFAP1	4236	broad.mit.edu	37	15	44105497	44105497	+	Missense_Mutation	SNP	C	G	G			TCGA-32-1982-01	TCGA-32-1982-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:44105497C>G	uc001zth.1	-	5	860	c.676G>C	c.(676-678)GAG>CAG	p.E226Q		NM_005926	NP_005917	P55081	MFAP1_HUMAN	microfibrillar-associated protein 1	226						microfibril				skin(1)	1		all_cancers(109;7.57e-15)|all_epithelial(112;3.51e-12)|Lung NSC(122;4.72e-08)|all_lung(180;4.9e-07)|Melanoma(134;0.027)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;4.33e-07)		GCTTCCTGCTCCAGCTCCTTC	0.483													91	268	---	---	---	---	capture	Missense_Mutation	SNP	44105497	44105497	MFAP1	15	C	G	G	G	1	0	0	0	0	1	0	0	0	390	30	4	4	9425	232
STUB1	10273	broad.mit.edu	37	16	731823	731823	+	Missense_Mutation	SNP	G	T	T			TCGA-32-1982-01	TCGA-32-1982-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:731823G>T	uc002cit.2	+	4	966	c.555G>T	c.(553-555)GAG>GAT	p.E185D	STUB1_uc002ciu.2_Missense_Mutation_p.E113D|STUB1_uc010bqz.2_RNA|STUB1_uc002civ.2_RNA|JMJD8_uc002ciw.1_3'UTR|JMJD8_uc002cix.1_3'UTR|JMJD8_uc002ciy.1_3'UTR	NM_005861	NP_005852	Q9UNE7	CHIP_HUMAN	STIP1 homology and U-box containing protein 1	185					cellular response to misfolded protein|DNA repair|misfolded or incompletely synthesized protein catabolic process|positive regulation of cellular chaperone-mediated protein complex assembly|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein ubiquitination|proteasomal ubiquitin-dependent protein catabolic process|protein autoubiquitination|protein K63-linked ubiquitination|protein maturation|regulation of glucocorticoid metabolic process|ubiquitin-dependent SMAD protein catabolic process	cytoplasm|nuclear inclusion body|ubiquitin conjugating enzyme complex|ubiquitin ligase complex	Hsp70 protein binding|Hsp90 protein binding|kinase binding|misfolded protein binding|protein binding, bridging|protein homodimerization activity|SMAD binding|TPR domain binding|ubiquitin-ubiquitin ligase activity				0		Hepatocellular(780;0.00335)				GAAACCACGAGGGTGATGAGG	0.637													19	54	---	---	---	---	capture	Missense_Mutation	SNP	731823	731823	STUB1	16	G	T	T	T	1	0	0	0	0	1	0	0	0	451	35	4	4	15225	232
SEC14L5	9717	broad.mit.edu	37	16	5053502	5053502	+	Missense_Mutation	SNP	C	A	A			TCGA-32-1982-01	TCGA-32-1982-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:5053502C>A	uc002cye.2	+	11	1410	c.1230C>A	c.(1228-1230)GAC>GAA	p.D410E		NM_014692	NP_055507	O43304	S14L5_HUMAN	SEC14-like 5	410	CRAL-TRIO.					integral to membrane|intracellular	transporter activity				0						TGGTTGAGGACAATTACCCAG	0.647													22	48	---	---	---	---	capture	Missense_Mutation	SNP	5053502	5053502	SEC14L5	16	C	A	A	A	1	0	0	0	0	1	0	0	0	220	17	4	4	13878	232
IL4R	3566	broad.mit.edu	37	16	27363906	27363906	+	Missense_Mutation	SNP	G	A	A			TCGA-32-1982-01	TCGA-32-1982-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:27363906G>A	uc002don.2	+	7	801	c.559G>A	c.(559-561)GCA>ACA	p.A187T	IL4R_uc002dom.2_Missense_Mutation_p.A187T|IL4R_uc002dop.3_Missense_Mutation_p.A172T|IL4R_uc010bxy.2_Missense_Mutation_p.A187T|IL4R_uc002doo.2_Missense_Mutation_p.A27T	NM_000418	NP_000409	P24394	IL4RA_HUMAN	interleukin 4 receptor alpha chain isoform a	187	Extracellular (Potential).|Fibronectin type-III.				immune response|production of molecular mediator involved in inflammatory response	integral to plasma membrane	identical protein binding|interleukin-4 receptor activity|receptor signaling protein activity			ovary(1)|skin(1)	2						CCTCCGCATCGCAGCCAGCAC	0.592													53	131	---	---	---	---	capture	Missense_Mutation	SNP	27363906	27363906	IL4R	16	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	7621	232
MT1E	4493	broad.mit.edu	37	16	56660826	56660826	+	Silent	SNP	G	A	A			TCGA-32-1982-01	TCGA-32-1982-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:56660826G>A	uc002ejl.2	+	3	308	c.129G>A	c.(127-129)AAG>AAA	p.K43K	MT1A_uc002eji.2_Intron|MT1M_uc010vhe.1_Intron|MT1E_uc002ejm.2_3'UTR	NM_175617	NP_783316	P04732	MT1E_HUMAN	metallothionein 1E	43	Alpha.					cytoplasm	cadmium ion binding|copper ion binding|zinc ion binding				0						GCTGTGCCAAGTGTGCCCAGG	0.597													4	161	---	---	---	---	capture	Silent	SNP	56660826	56660826	MT1E	16	G	A	A	A	1	0	0	0	0	0	0	0	1	464	36	2	2	9809	232
SETD6	79918	broad.mit.edu	37	16	58552049	58552049	+	Missense_Mutation	SNP	T	C	C			TCGA-32-1982-01	TCGA-32-1982-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:58552049T>C	uc002ens.2	+	6	946	c.887T>C	c.(886-888)ATG>ACG	p.M296T	SETD6_uc002enr.2_Missense_Mutation_p.M272T|SETD6_uc010cdm.2_RNA	NM_001160305	NP_001153777	Q8TBK2	SETD6_HUMAN	SET domain containing 6 isoform a	296					negative regulation of NF-kappaB transcription factor activity|peptidyl-lysine monomethylation|regulation of inflammatory response	nucleus	NF-kappaB binding|protein-lysine N-methyltransferase activity			ovary(1)	1						CTGATTCATATGTACGGTTTT	0.448													41	95	---	---	---	---	capture	Missense_Mutation	SNP	58552049	58552049	SETD6	16	T	C	C	C	1	0	0	0	0	1	0	0	0	663	51	3	3	14028	232
ATP6V0D1	9114	broad.mit.edu	37	16	67477049	67477049	+	Missense_Mutation	SNP	C	T	T			TCGA-32-1982-01	TCGA-32-1982-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:67477049C>T	uc002ete.1	-	4	614	c.514G>A	c.(514-516)GAC>AAC	p.D172N	ATP6V0D1_uc010vjo.1_Missense_Mutation_p.D213N|ATP6V0D1_uc010vjn.1_Missense_Mutation_p.D95N	NM_004691	NP_004682	P61421	VA0D1_HUMAN	ATPase, H+ transporting, lysosomal, V0 subunit	172					ATP hydrolysis coupled proton transport|cellular iron ion homeostasis|insulin receptor signaling pathway|transferrin transport	endosome membrane|proton-transporting V-type ATPase, V0 domain|vacuolar proton-transporting V-type ATPase complex					0		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0439)|Epithelial(162;0.101)		TCGTCAAGGTCCTGCTCTGAA	0.562													55	116	---	---	---	---	capture	Missense_Mutation	SNP	67477049	67477049	ATP6V0D1	16	C	T	T	T	1	0	0	0	0	1	0	0	0	390	30	2	2	1164	232
CDH1	999	broad.mit.edu	37	16	68855965	68855965	+	Silent	SNP	C	T	T			TCGA-32-1982-01	TCGA-32-1982-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:68855965C>T	uc002ewg.1	+	12	1897	c.1773C>T	c.(1771-1773)AAC>AAT	p.N591N	CDH1_uc010vlj.1_RNA|CDH1_uc010cfg.1_Silent_p.N530N	NM_004360	NP_004351	P12830	CADH1_HUMAN	cadherin 1, type 1 preproprotein	591	Extracellular (Potential).|Cadherin 4.				adherens junction organization|cellular component disassembly involved in apoptosis|cellular response to indole-3-methanol|cellular response to lithium ion|homophilic cell adhesion|negative regulation of cell-cell adhesion|positive regulation of transcription factor import into nucleus|positive regulation of transcription, DNA-dependent|regulation of immune response	actin cytoskeleton|aggresome|apical junction complex|catenin complex|cell-cell adherens junction|endosome|focal adhesion|Golgi apparatus|integral to membrane|internal side of plasma membrane|lateral plasma membrane|perinuclear region of cytoplasm	cell adhesion molecule binding|gamma-catenin binding			breast(148)|stomach(71)|biliary_tract(8)|endometrium(3)|soft_tissue(2)|large_intestine(2)|urinary_tract(2)|oesophagus(2)|ovary(2)|thyroid(1)|central_nervous_system(1)|lung(1)	243		all_neural(199;0.0189)|Ovarian(137;0.0563)		Epithelial(162;8.44e-05)|all cancers(182;0.000404)|OV - Ovarian serous cystadenocarcinoma(108;0.000426)|BRCA - Breast invasive adenocarcinoma(181;0.0261)		TGAATGACAACGCCCCCATAC	0.458			Mis|N|F|S		lobular breast|gastric	gastric			Hereditary_Diffuse_Gastric_Cancer				45	131	---	---	---	---	capture	Silent	SNP	68855965	68855965	CDH1	16	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	3066	232
DNAH2	146754	broad.mit.edu	37	17	7663139	7663139	+	Missense_Mutation	SNP	G	A	A	rs112194246		TCGA-32-1982-01	TCGA-32-1982-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7663139G>A	uc002giu.1	+	16	2682	c.2668G>A	c.(2668-2670)GCA>ACA	p.A890T		NM_020877	NP_065928	Q9P225	DYH2_HUMAN	dynein heavy chain domain 3	890	Stem (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(6)|skin(6)|central_nervous_system(1)	13		all_cancers(10;4.66e-07)|Prostate(122;0.081)				GCAGACTTTGGCAGGTGTGGT	0.522													109	248	---	---	---	---	capture	Missense_Mutation	SNP	7663139	7663139	DNAH2	17	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	4559	232
ZNF624	57547	broad.mit.edu	37	17	16526500	16526500	+	Missense_Mutation	SNP	C	T	T			TCGA-32-1982-01	TCGA-32-1982-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:16526500C>T	uc010cpi.1	-	6	1783	c.1700G>A	c.(1699-1701)CGT>CAT	p.R567H		NM_020787	NP_065838	Q9P2J8	ZN624_HUMAN	zinc finger protein 624	567	C2H2-type 11.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			large_intestine(1)|ovary(1)	2				UCEC - Uterine corpus endometrioid carcinoma (92;0.0837)		AGAAGAAGAACGCATGAAGGC	0.368													20	191	---	---	---	---	capture	Missense_Mutation	SNP	16526500	16526500	ZNF624	17	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	17926	232
RAD51C	5889	broad.mit.edu	37	17	56772380	56772380	+	Silent	SNP	A	G	G			TCGA-32-1982-01	TCGA-32-1982-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:56772380A>G	uc002iwu.2	+	2	276	c.234A>G	c.(232-234)ACA>ACG	p.T78T	TEX14_uc002iwr.1_5'Flank|TEX14_uc002iws.1_5'Flank|TEX14_uc010dcz.1_5'Flank|TEX14_uc010dda.1_5'Flank|TEX14_uc010wnz.1_5'Flank|RAD51C_uc002iwt.1_Silent_p.T78T|RAD51C_uc010woa.1_Silent_p.T78T|RAD51C_uc010ddc.2_RNA|RAD51C_uc002iwv.2_RNA|RAD51C_uc002iww.2_RNA|RAD51C_uc010wob.1_RNA	NM_058216	NP_478123	O43502	RA51C_HUMAN	RAD51 homolog C isoform 1	78					blood coagulation|DNA repair	mitochondrion|nucleoplasm|perinuclear region of cytoplasm	ATP binding|DNA binding|DNA-dependent ATPase activity				0	Medulloblastoma(34;0.127)|all_neural(34;0.237)					ATGCTGGTACATCTGAGTCAC	0.398								Homologous_recombination	Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2				38	102	---	---	---	---	capture	Silent	SNP	56772380	56772380	RAD51C	17	A	G	G	G	1	0	0	0	0	0	0	0	1	93	8	3	3	12883	232
CTDP1	9150	broad.mit.edu	37	18	77457977	77457977	+	Missense_Mutation	SNP	A	G	G			TCGA-32-1982-01	TCGA-32-1982-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:77457977A>G	uc002lnh.1	+	4	757	c.610A>G	c.(610-612)ATG>GTG	p.M204V	CTDP1_uc002lni.1_Missense_Mutation_p.M204V|CTDP1_uc010drd.1_Missense_Mutation_p.M204V	NM_004715	NP_004706	Q9Y5B0	CTDP1_HUMAN	CTD (carboxy-terminal domain, RNA polymerase II,	204	FCP1 homology.				positive regulation of viral transcription|protein dephosphorylation|transcription elongation from RNA polymerase II promoter|viral reproduction	nucleoplasm	CTD phosphatase activity|DNA-directed RNA polymerase activity				0		Esophageal squamous(42;0.0157)|Melanoma(33;0.144)		OV - Ovarian serous cystadenocarcinoma(15;5.2e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0277)		CTGTCAGCAGATGTCGAATAA	0.493													19	37	---	---	---	---	capture	Missense_Mutation	SNP	77457977	77457977	CTDP1	18	A	G	G	G	1	0	0	0	0	1	0	0	0	156	12	3	3	3966	232
ATP8B3	148229	broad.mit.edu	37	19	1792112	1792112	+	Missense_Mutation	SNP	C	T	T			TCGA-32-1982-01	TCGA-32-1982-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:1792112C>T	uc002ltw.2	-	19	2312	c.2078G>A	c.(2077-2079)CGG>CAG	p.R693Q	ATP8B3_uc002ltv.2_Missense_Mutation_p.R646Q|ATP8B3_uc002ltx.2_RNA	NM_138813	NP_620168	O60423	AT8B3_HUMAN	ATPase, class I, type 8B, member 3	693	Cytoplasmic (Potential).				ATP biosynthetic process		ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCACAGTGTCCGCAGGGTCTC	0.677													3	10	---	---	---	---	capture	Missense_Mutation	SNP	1792112	1792112	ATP8B3	19	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	1187	232
ADAMTS10	81794	broad.mit.edu	37	19	8668748	8668748	+	Silent	SNP	G	A	A			TCGA-32-1982-01	TCGA-32-1982-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:8668748G>A	uc002mkj.1	-	5	730	c.456C>T	c.(454-456)GAC>GAT	p.D152D	ADAMTS10_uc002mkk.1_Translation_Start_Site	NM_030957	NP_112219	Q9H324	ATS10_HUMAN	ADAM metallopeptidase with thrombospondin type 1	152					proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			pancreas(2)|skin(2)	4						ACTCTTCCTCGTCTGCCACGA	0.572													22	68	---	---	---	---	capture	Silent	SNP	8668748	8668748	ADAMTS10	19	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	256	232
MUC16	94025	broad.mit.edu	37	19	9058871	9058871	+	Silent	SNP	G	T	T			TCGA-32-1982-01	TCGA-32-1982-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:9058871G>T	uc002mkp.2	-	3	28779	c.28575C>A	c.(28573-28575)ACC>ACA	p.T9525T		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	9527	Ser-rich.|Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						TAGCACTGGTGGTTTCCACAT	0.478													59	186	---	---	---	---	capture	Silent	SNP	9058871	9058871	MUC16	19	G	T	T	T	1	0	0	0	0	0	0	0	1	600	47	4	4	9883	232
IL12RB1	3594	broad.mit.edu	37	19	18184347	18184347	+	Missense_Mutation	SNP	G	A	A			TCGA-32-1982-01	TCGA-32-1982-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:18184347G>A	uc002nhw.1	-	8	827	c.763C>T	c.(763-765)CGG>TGG	p.R255W	IL12RB1_uc010xqb.1_Missense_Mutation_p.R255W|IL12RB1_uc002nhx.1_Missense_Mutation_p.R295W|IL12RB1_uc002nhy.2_Missense_Mutation_p.R255W	NM_005535	NP_005526	P42701	I12R1_HUMAN	interleukin 12 receptor, beta 1 isoform 1	255	Extracellular (Potential).|Fibronectin type-III 3.				cellular response to interferon-gamma|interleukin-12-mediated signaling pathway|positive regulation of activated T cell proliferation|positive regulation of defense response to virus by host|positive regulation of interferon-gamma production|positive regulation of memory T cell differentiation|positive regulation of T cell mediated cytotoxicity|positive regulation of T-helper 1 type immune response|positive regulation of T-helper 17 cell lineage commitment|positive regulation of T-helper 17 type immune response	interleukin-12 receptor complex|interleukin-23 receptor complex	cytokine receptor activity			pancreas(1)	1						AGGGTCAGCCGCCTCCTCCCA	0.433													14	55	---	---	---	---	capture	Missense_Mutation	SNP	18184347	18184347	IL12RB1	19	G	A	A	A	1	0	0	0	0	1	0	0	0	493	38	1	1	7549	232
ZNF257	113835	broad.mit.edu	37	19	22271312	22271312	+	Missense_Mutation	SNP	G	A	A			TCGA-32-1982-01	TCGA-32-1982-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:22271312G>A	uc010ecx.2	+	4	929	c.760G>A	c.(760-762)GAG>AAG	p.E254K	ZNF257_uc010ecy.2_Missense_Mutation_p.E222K	NM_033468	NP_258429	Q9Y2Q1	ZN257_HUMAN	zinc finger protein 257	254					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_lung(12;0.0961)|Lung NSC(12;0.103)				TCATACTAGAGAGAAACCCTA	0.388													18	65	---	---	---	---	capture	Missense_Mutation	SNP	22271312	22271312	ZNF257	19	G	A	A	A	1	0	0	0	0	1	0	0	0	429	33	2	2	17680	232
MEIS3	56917	broad.mit.edu	37	19	47920129	47920129	+	Missense_Mutation	SNP	T	C	C			TCGA-32-1982-01	TCGA-32-1982-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:47920129T>C	uc002pgu.2	-	3	724	c.277A>G	c.(277-279)ACA>GCA	p.T93A	MEIS3_uc002pgp.2_5'Flank|MEIS3_uc002pgq.2_Missense_Mutation_p.T174A|MEIS3_uc002pgr.2_5'UTR|MEIS3_uc002pgt.2_Missense_Mutation_p.T93A|MEIS3_uc002pgv.2_Missense_Mutation_p.T93A|MEIS3_uc002pgs.2_Missense_Mutation_p.T93A|MEIS3_uc010eld.2_Missense_Mutation_p.T93A|MEIS3_uc002pgw.2_3'UTR	NM_001009813	NP_001009813	Q99687	MEIS3_HUMAN	Meis1, myeloid ecotropic viral integration site	93						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0		all_cancers(25;1.65e-09)|all_epithelial(76;9.95e-08)|all_lung(116;7.27e-07)|Lung NSC(112;1.6e-06)|Ovarian(192;0.0139)|all_neural(266;0.026)|Breast(70;0.0503)		all cancers(93;0.000198)|OV - Ovarian serous cystadenocarcinoma(262;0.000439)|Epithelial(262;0.0113)|GBM - Glioblastoma multiforme(486;0.0223)		CCAGGGGGTGTCCCCAGCCCA	0.632													5	30	---	---	---	---	capture	Missense_Mutation	SNP	47920129	47920129	MEIS3	19	T	C	C	C	1	0	0	0	0	1	0	0	0	754	58	3	3	9382	232
KLK6	5653	broad.mit.edu	37	19	51462468	51462468	+	Silent	SNP	G	A	A	rs148571626		TCGA-32-1982-01	TCGA-32-1982-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:51462468G>A	uc002pui.2	-	7	947	c.687C>T	c.(685-687)AAC>AAT	p.N229N	KLK6_uc010eoj.2_Missense_Mutation_p.T101M|KLK6_uc002puh.2_Silent_p.N238N|KLK6_uc002puj.2_Silent_p.N122N|KLK6_uc010ycn.1_Silent_p.N122N|KLK6_uc002pul.2_Silent_p.N229N|KLK6_uc002pum.2_Silent_p.N122N	NM_001012964	NP_001012982	Q92876	KLK6_HUMAN	kallikrein-related peptidase 6 isoform A	229	Peptidase S1.				amyloid precursor protein metabolic process|central nervous system development|collagen catabolic process|hormone metabolic process|myelination|positive regulation of G-protein coupled receptor protein signaling pathway|protein autoprocessing|proteolysis|regulation of cell differentiation|tissue regeneration	endoplasmic reticulum|extracellular region|microsome|mitochondrion|nucleolus	protein binding|serine-type endopeptidase activity				0		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00372)|GBM - Glioblastoma multiforme(134;0.00871)		ATCTGCAGACGTTGGTGTAGA	0.547													63	220	---	---	---	---	capture	Silent	SNP	51462468	51462468	KLK6	19	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	8328	232
NLRP13	126204	broad.mit.edu	37	19	56423179	56423179	+	Silent	SNP	G	A	A	rs140606375	byFrequency	TCGA-32-1982-01	TCGA-32-1982-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:56423179G>A	uc010ygg.1	-	5	2029	c.2004C>T	c.(2002-2004)GAC>GAT	p.D668D		NM_176810	NP_789780	Q86W25	NAL13_HUMAN	NACHT, leucine rich repeat and PYD containing	668							ATP binding			skin(4)|ovary(3)|pancreas(1)|lung(1)	9		Colorectal(82;3.48e-05)|Ovarian(87;0.0481)|Renal(1328;0.218)		GBM - Glioblastoma multiforme(193;0.0642)		GGAGTTCTTCGTCCTCCAAAA	0.408													61	251	---	---	---	---	capture	Silent	SNP	56423179	56423179	NLRP13	19	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	10382	232
ZNF543	125919	broad.mit.edu	37	19	57840542	57840542	+	Missense_Mutation	SNP	C	T	T			TCGA-32-1982-01	TCGA-32-1982-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:57840542C>T	uc002qoi.1	+	4	2057	c.1712C>T	c.(1711-1713)CCT>CTT	p.P571L		NM_213598	NP_998763	Q08ER8	ZN543_HUMAN	zinc finger protein 543	571					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(1)|pancreas(1)	2		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)		GTGGGAAGACCTTTTATGACT	0.418													5	200	---	---	---	---	capture	Missense_Mutation	SNP	57840542	57840542	ZNF543	19	C	T	T	T	1	0	0	0	0	1	0	0	0	312	24	2	2	17855	232
TPO	7173	broad.mit.edu	37	2	1544411	1544411	+	Silent	SNP	C	T	T			TCGA-32-1982-01	TCGA-32-1982-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:1544411C>T	uc002qww.2	+	16	2755	c.2664C>T	c.(2662-2664)GGC>GGT	p.G888G	TPO_uc010ewj.2_Intron|TPO_uc002qwu.2_Silent_p.G831G|TPO_uc002qwr.2_Silent_p.G888G|TPO_uc002qwx.2_Silent_p.G831G|TPO_uc010yio.1_Silent_p.G715G|TPO_uc010yip.1_Silent_p.G844G|TPO_uc002qwy.1_Silent_p.G184G|TPO_uc002qwz.2_Intron	NM_000547	NP_000538	P07202	PERT_HUMAN	thyroid peroxidase isoform a	888	Cytoplasmic (Potential).				cellular nitrogen compound metabolic process|hormone biosynthetic process|hydrogen peroxide catabolic process	cell surface|cytoplasm|integral to plasma membrane	calcium ion binding|heme binding|iodide peroxidase activity			ovary(7)|pancreas(6)|skin(5)|lung(1)|kidney(1)	20	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.0338)		all cancers(51;0.0356)|OV - Ovarian serous cystadenocarcinoma(76;0.0748)|Epithelial(75;0.12)	Carbimazole(DB00389)|Methimazole(DB00763)|Propylthiouracil(DB00550)	CGGAGACAGGCGGAGGAACTC	0.642													17	65	---	---	---	---	capture	Silent	SNP	1544411	1544411	TPO	2	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	16293	232
ALLC	55821	broad.mit.edu	37	2	3730599	3730599	+	Missense_Mutation	SNP	G	A	A			TCGA-32-1982-01	TCGA-32-1982-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:3730599G>A	uc010ewt.2	+	7	607	c.446G>A	c.(445-447)GGC>GAC	p.G149D		NM_018436	NP_060906	Q8N6M5	ALLC_HUMAN	allantoicase isoform a	168							allantoicase activity			central_nervous_system(1)	1	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.088)	all_cancers(51;0.24)		OV - Ovarian serous cystadenocarcinoma(76;0.088)|all cancers(51;0.151)|Epithelial(75;0.206)		CCTGCTTCCGGCCACAACTAT	0.438										HNSCC(21;0.051)			5	283	---	---	---	---	capture	Missense_Mutation	SNP	3730599	3730599	ALLC	2	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	534	232
APOB	338	broad.mit.edu	37	2	21256280	21256280	+	Nonsense_Mutation	SNP	C	A	A			TCGA-32-1982-01	TCGA-32-1982-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:21256280C>A	uc002red.2	-	9	1143	c.1015G>T	c.(1015-1017)GAG>TAG	p.E339*		NM_000384	NP_000375	P04114	APOB_HUMAN	apolipoprotein B precursor	339	Vitellogenin.				cholesterol homeostasis|cholesterol metabolic process|leukocyte migration|low-density lipoprotein particle clearance|low-density lipoprotein particle remodeling|platelet activation|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis|response to virus	chylomicron remnant|clathrin-coated endocytic vesicle membrane|endoplasmic reticulum lumen|endoplasmic reticulum membrane|endosome lumen|endosome membrane|intermediate-density lipoprotein particle|low-density lipoprotein particle|mature chylomicron|microsome|plasma membrane|very-low-density lipoprotein particle	cholesterol transporter activity|enzyme binding|heparin binding|low-density lipoprotein particle receptor binding|phospholipid binding|protein heterodimerization activity			ovary(11)|skin(9)|central_nervous_system(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)	27	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Atorvastatin(DB01076)	ATATTTTGCTCAGAGATGGTT	0.468													67	174	---	---	---	---	capture	Nonsense_Mutation	SNP	21256280	21256280	APOB	2	C	A	A	A	1	0	0	0	0	0	1	0	0	377	29	5	4	778	232
C2orf71	388939	broad.mit.edu	37	2	29294478	29294478	+	Missense_Mutation	SNP	C	T	T			TCGA-32-1982-01	TCGA-32-1982-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:29294478C>T	uc002rmt.1	-	1	2650	c.2650G>A	c.(2650-2652)GCC>ACC	p.A884T		NM_001029883	NP_001025054	A6NGG8	CB071_HUMAN	hypothetical protein LOC388939	884					response to stimulus|visual perception	photoreceptor outer segment				skin(1)	1						CTCACAGAGGCCCTCAGCTTT	0.657													37	65	---	---	---	---	capture	Missense_Mutation	SNP	29294478	29294478	C2orf71	2	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	2171	232
AMMECR1L	83607	broad.mit.edu	37	2	128631538	128631538	+	Missense_Mutation	SNP	G	A	A			TCGA-32-1982-01	TCGA-32-1982-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:128631538G>A	uc002tpl.2	-	3	522	c.271C>T	c.(271-273)CGG>TGG	p.R91W	AMMECR1L_uc002tpm.2_Missense_Mutation_p.R91W	NM_031445	NP_113633	Q6DCA0	AMERL_HUMAN	AMME chromosomal region gene 1-like	91										central_nervous_system(1)	1	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.07)		CCATTAGGCCGGGGAAGAGGG	0.547													71	139	---	---	---	---	capture	Missense_Mutation	SNP	128631538	128631538	AMMECR1L	2	G	A	A	A	1	0	0	0	0	1	0	0	0	506	39	1	1	579	232
TTN	7273	broad.mit.edu	37	2	179457195	179457195	+	Missense_Mutation	SNP	T	G	G			TCGA-32-1982-01	TCGA-32-1982-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179457195T>G	uc010zfg.1	-	250	52057	c.51833A>C	c.(51832-51834)AAT>ACT	p.N17278T	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.N10973T|TTN_uc010zfi.1_Missense_Mutation_p.N10906T|TTN_uc010zfj.1_Missense_Mutation_p.N10781T	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	18205							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ATGGGCAGCATTACGAATTTC	0.378													126	300	---	---	---	---	capture	Missense_Mutation	SNP	179457195	179457195	TTN	2	T	G	G	G	1	0	0	0	0	1	0	0	0	676	52	4	4	16617	232
TTN	7273	broad.mit.edu	37	2	179476881	179476881	+	Missense_Mutation	SNP	C	T	T			TCGA-32-1982-01	TCGA-32-1982-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179476881C>T	uc010zfg.1	-	216	42777	c.42553G>A	c.(42553-42555)GGA>AGA	p.G14185R	uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.G7880R|TTN_uc010zfi.1_Missense_Mutation_p.G7813R|TTN_uc010zfj.1_Missense_Mutation_p.G7688R	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	15112							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TAGGGTGGTCCAGGAGTGGCT	0.428													15	34	---	---	---	---	capture	Missense_Mutation	SNP	179476881	179476881	TTN	2	C	T	T	T	1	0	0	0	0	1	0	0	0	273	21	2	2	16617	232
DNAH7	56171	broad.mit.edu	37	2	196681639	196681639	+	Silent	SNP	C	T	T			TCGA-32-1982-01	TCGA-32-1982-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:196681639C>T	uc002utj.3	-	51	9575	c.9474G>A	c.(9472-9474)TCG>TCA	p.S3158S		NM_018897	NP_061720	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	3158	AAA 5 (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			skin(10)|ovary(2)	12						TATTGCCTTCCGAAGATGAAA	0.323													19	56	---	---	---	---	capture	Silent	SNP	196681639	196681639	DNAH7	2	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	4562	232
JPH2	57158	broad.mit.edu	37	20	42788505	42788505	+	Missense_Mutation	SNP	G	A	A			TCGA-32-1982-01	TCGA-32-1982-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:42788505G>A	uc002xli.1	-	2	1795	c.922C>T	c.(922-924)CGC>TGC	p.R308C		NM_020433	NP_065166	Q9BR39	JPH2_HUMAN	junctophilin 2 isoform 1	308	MORN 7.|Cytoplasmic (Potential).				calcium ion transport into cytosol|regulation of ryanodine-sensitive calcium-release channel activity	integral to membrane|junctional sarcoplasmic reticulum membrane|plasma membrane					0		Myeloproliferative disorder(115;0.0122)	COAD - Colon adenocarcinoma(18;0.00189)			CCACTGGAGCGTTCGCTCACG	0.672													6	20	---	---	---	---	capture	Missense_Mutation	SNP	42788505	42788505	JPH2	20	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	7884	232
COL6A2	1292	broad.mit.edu	37	21	47545189	47545189	+	Missense_Mutation	SNP	G	A	A			TCGA-32-1982-01	TCGA-32-1982-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:47545189G>A	uc002zia.1	+	24	1862	c.1780G>A	c.(1780-1782)GTC>ATC	p.V594I	COL6A2_uc002zhy.1_Missense_Mutation_p.V594I|COL6A2_uc002zhz.1_Missense_Mutation_p.V594I|COL6A2_uc002zib.1_5'UTR|COL6A2_uc002zic.1_5'Flank	NM_001849	NP_001840	P12110	CO6A2_HUMAN	alpha 2 type VI collagen isoform 2C2 precursor	594	Nonhelical region.				axon guidance|cell-cell adhesion|extracellular matrix organization|protein heterotrimerization	collagen|extracellular space|protein complex	extracellular matrix structural constituent|protein binding, bridging			central_nervous_system(7)|ovary(1)	8	Breast(49;0.245)			Colorectal(79;0.0303)|READ - Rectum adenocarcinoma(84;0.0649)		GGAGTGTGACGTCATGACCTA	0.687													58	132	---	---	---	---	capture	Missense_Mutation	SNP	47545189	47545189	COL6A2	21	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	3665	232
CABIN1	23523	broad.mit.edu	37	22	24561503	24561503	+	Missense_Mutation	SNP	A	G	G			TCGA-32-1982-01	TCGA-32-1982-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:24561503A>G	uc002zzi.1	+	31	5043	c.4916A>G	c.(4915-4917)TAT>TGT	p.Y1639C	CABIN1_uc002zzj.1_Missense_Mutation_p.Y1560C|CABIN1_uc002zzl.1_Missense_Mutation_p.Y1639C|CABIN1_uc002zzm.1_Missense_Mutation_p.Y64C	NM_012295	NP_036427	Q9Y6J0	CABIN_HUMAN	calcineurin binding protein 1	1639					cell surface receptor linked signaling pathway|chromatin modification	nucleus	protein phosphatase inhibitor activity			ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	5						CGCAGGAAGTATCTGCGAGAT	0.612													6	20	---	---	---	---	capture	Missense_Mutation	SNP	24561503	24561503	CABIN1	22	A	G	G	G	1	0	0	0	0	1	0	0	0	208	16	3	3	2504	232
CHDH	55349	broad.mit.edu	37	3	53856599	53856599	+	Silent	SNP	G	A	A			TCGA-32-1982-01	TCGA-32-1982-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:53856599G>A	uc003dgz.2	-	4	1214	c.774C>T	c.(772-774)GCC>GCT	p.A258A		NM_018397	NP_060867	Q8NE62	CHDH_HUMAN	choline dehydrogenase precursor	258					alcohol metabolic process		choline dehydrogenase activity|flavin adenine dinucleotide binding			ovary(1)|central_nervous_system(1)	2		Hepatocellular(537;0.152)		BRCA - Breast invasive adenocarcinoma(193;0.000158)|KIRC - Kidney renal clear cell carcinoma(284;0.00588)|Kidney(284;0.00673)|OV - Ovarian serous cystadenocarcinoma(275;0.118)	Choline(DB00122)	CAAGCGTCTCGGCCTCGGCCT	0.632													13	56	---	---	---	---	capture	Silent	SNP	53856599	53856599	CHDH	3	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	3299	232
SULT1B1	27284	broad.mit.edu	37	4	70615520	70615520	+	Missense_Mutation	SNP	C	G	G			TCGA-32-1982-01	TCGA-32-1982-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:70615520C>G	uc003hen.2	-	4	592	c.294G>C	c.(292-294)GAG>GAC	p.E98D		NM_014465	NP_055280	O43704	ST1B1_HUMAN	sulfotransferase family, cytosolic, 1B, member	98					3'-phosphoadenosine 5'-phosphosulfate metabolic process|cellular biogenic amine metabolic process|flavonoid metabolic process|steroid metabolic process|sulfation|thyroid hormone metabolic process|xenobiotic metabolic process	cytosol					0						ATGGATTCTTCTCCAATTGTT	0.383													29	89	---	---	---	---	capture	Missense_Mutation	SNP	70615520	70615520	SULT1B1	4	C	G	G	G	1	0	0	0	0	1	0	0	0	415	32	4	4	15264	232
PRKG2	5593	broad.mit.edu	37	4	82074799	82074799	+	Missense_Mutation	SNP	T	C	C			TCGA-32-1982-01	TCGA-32-1982-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:82074799T>C	uc003hmh.2	-	6	1003	c.989A>G	c.(988-990)AAG>AGG	p.K330R	PRKG2_uc011ccf.1_5'UTR|PRKG2_uc011ccg.1_5'UTR|PRKG2_uc011cch.1_Missense_Mutation_p.K330R	NM_006259	NP_006250	Q13237	KGP2_HUMAN	protein kinase, cGMP-dependent, type II	330	cGMP 2.				platelet activation|signal transduction	cytosol	ATP binding|cGMP binding|cGMP-dependent protein kinase activity			breast(3)|central_nervous_system(2)|ovary(1)|large_intestine(1)	7						AATAGTTACCTTTCCTTTTGC	0.333													37	73	---	---	---	---	capture	Missense_Mutation	SNP	82074799	82074799	PRKG2	4	T	C	C	C	1	0	0	0	0	1	0	0	0	728	56	3	3	12419	232
MMRN1	22915	broad.mit.edu	37	4	90874400	90874400	+	Missense_Mutation	SNP	A	G	G			TCGA-32-1982-01	TCGA-32-1982-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:90874400A>G	uc003hst.2	+	8	3589	c.3518A>G	c.(3517-3519)GAG>GGG	p.E1173G	MMRN1_uc010iku.2_Missense_Mutation_p.E476G|MMRN1_uc011cds.1_Missense_Mutation_p.E915G	NM_007351	NP_031377	Q13201	MMRN1_HUMAN	multimerin 1	1173	C1q.				cell adhesion|platelet activation|platelet degranulation	extracellular region|platelet alpha granule lumen				ovary(4)	4		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;6.96e-05)		CTTGCATTTGAGTCTGAAAAT	0.368													3	154	---	---	---	---	capture	Missense_Mutation	SNP	90874400	90874400	MMRN1	4	A	G	G	G	1	0	0	0	0	1	0	0	0	143	11	3	3	9582	232
ZFP42	132625	broad.mit.edu	37	4	188924074	188924074	+	Missense_Mutation	SNP	C	T	T			TCGA-32-1982-01	TCGA-32-1982-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:188924074C>T	uc003izg.1	+	3	358	c.113C>T	c.(112-114)GCG>GTG	p.A38V	ZFP42_uc003izh.1_Missense_Mutation_p.A38V|ZFP42_uc003izi.1_Missense_Mutation_p.A38V	NM_174900	NP_777560	Q96MM3	ZFP42_HUMAN	zinc finger protein 42	38					female gonad development|male gonad development|meiosis	cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|skin(1)	2		all_cancers(14;6.2e-52)|all_epithelial(14;7.36e-37)|all_lung(41;2.29e-15)|Lung NSC(41;6.7e-15)|Breast(6;1.53e-05)|Melanoma(20;3.01e-05)|Hepatocellular(41;0.00335)|all_hematologic(60;0.014)|Renal(120;0.0183)|Prostate(90;0.0421)|Colorectal(36;0.227)		OV - Ovarian serous cystadenocarcinoma(60;1.54e-11)|BRCA - Breast invasive adenocarcinoma(30;4.21e-06)|GBM - Glioblastoma multiforme(59;8.93e-05)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.157)		GACCTGCAGGCGGAAATAGAA	0.572													30	90	---	---	---	---	capture	Missense_Mutation	SNP	188924074	188924074	ZFP42	4	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	17530	232
ZFP42	132625	broad.mit.edu	37	4	188924640	188924640	+	Missense_Mutation	SNP	G	A	A			TCGA-32-1982-01	TCGA-32-1982-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:188924640G>A	uc003izg.1	+	3	924	c.679G>A	c.(679-681)GTT>ATT	p.V227I	ZFP42_uc003izh.1_Missense_Mutation_p.V227I|ZFP42_uc003izi.1_Missense_Mutation_p.V227I	NM_174900	NP_777560	Q96MM3	ZFP42_HUMAN	zinc finger protein 42	227	C2H2-type 2.				female gonad development|male gonad development|meiosis	cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|skin(1)	2		all_cancers(14;6.2e-52)|all_epithelial(14;7.36e-37)|all_lung(41;2.29e-15)|Lung NSC(41;6.7e-15)|Breast(6;1.53e-05)|Melanoma(20;3.01e-05)|Hepatocellular(41;0.00335)|all_hematologic(60;0.014)|Renal(120;0.0183)|Prostate(90;0.0421)|Colorectal(36;0.227)		OV - Ovarian serous cystadenocarcinoma(60;1.54e-11)|BRCA - Breast invasive adenocarcinoma(30;4.21e-06)|GBM - Glioblastoma multiforme(59;8.93e-05)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.157)		GAAAGCGTTCGTTGAGAGCTC	0.502													34	108	---	---	---	---	capture	Missense_Mutation	SNP	188924640	188924640	ZFP42	4	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	17530	232
ANKRA2	57763	broad.mit.edu	37	5	72857050	72857050	+	Missense_Mutation	SNP	G	A	A			TCGA-32-1982-01	TCGA-32-1982-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:72857050G>A	uc003kcu.1	-	3	999	c.353C>T	c.(352-354)TCT>TTT	p.S118F	ANKRA2_uc003kcv.2_Missense_Mutation_p.S118F	NM_023039	NP_075526	Q9H9E1	ANRA2_HUMAN	ankyrin repeat, family A (RFXANK-like), 2	118						cytoskeleton|cytosol|membrane	low-density lipoprotein particle binding				0		Lung NSC(167;0.0378)|Ovarian(174;0.0908)		OV - Ovarian serous cystadenocarcinoma(47;3.71e-54)		CTTTGTTGTAGAGGGGGTGTA	0.388													37	117	---	---	---	---	capture	Missense_Mutation	SNP	72857050	72857050	ANKRA2	5	G	A	A	A	1	0	0	0	0	1	0	0	0	429	33	2	2	633	232
PCDHA1	56147	broad.mit.edu	37	5	140167547	140167547	+	Missense_Mutation	SNP	G	A	A			TCGA-32-1982-01	TCGA-32-1982-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140167547G>A	uc003lhb.2	+	1	1672	c.1672G>A	c.(1672-1674)GAG>AAG	p.E558K	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lgz.2_Missense_Mutation_p.E558K	NM_018900	NP_061723	Q9Y5I3	PCDA1_HUMAN	protocadherin alpha 1 isoform 1 precursor	558	Cadherin 5.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	extracellular region|integral to plasma membrane	calcium ion binding|protein binding			skin(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGTGCTGGACGAGAACGACAA	0.672													35	126	---	---	---	---	capture	Missense_Mutation	SNP	140167547	140167547	PCDHA1	5	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	11422	232
PCDHA8	56140	broad.mit.edu	37	5	140221381	140221381	+	Missense_Mutation	SNP	G	A	A			TCGA-32-1982-01	TCGA-32-1982-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140221381G>A	uc003lhs.2	+	1	475	c.475G>A	c.(475-477)GAT>AAT	p.D159N	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhr.1_Missense_Mutation_p.D159N	NM_018911	NP_061734	Q9Y5H6	PCDA8_HUMAN	protocadherin alpha 8 isoform 1 precursor	159	Cadherin 2.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding			upper_aerodigestive_tract(1)|ovary(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGGCGCGTCCGATGCAGATGT	0.458													50	121	---	---	---	---	capture	Missense_Mutation	SNP	140221381	140221381	PCDHA8	5	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	11433	232
PCDHGB4	8641	broad.mit.edu	37	5	140769126	140769126	+	Missense_Mutation	SNP	C	T	T			TCGA-32-1982-01	TCGA-32-1982-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140769126C>T	uc003lkc.1	+	1	1675	c.1675C>T	c.(1675-1677)CGG>TGG	p.R559W	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc011dav.1_Missense_Mutation_p.R559W	NM_003736	NP_003727	Q9UN71	PCDGG_HUMAN	protocadherin gamma subfamily B, 4 isoform 1	559	Cadherin 5.|Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CAATGCGCCACGGGTGCTGTA	0.662													12	31	---	---	---	---	capture	Missense_Mutation	SNP	140769126	140769126	PCDHGB4	5	C	T	T	T	1	0	0	0	0	1	0	0	0	243	19	1	1	11468	232
SLC36A3	285641	broad.mit.edu	37	5	150672978	150672978	+	Silent	SNP	G	A	A			TCGA-32-1982-01	TCGA-32-1982-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:150672978G>A	uc003ltw.2	-	4	770	c.351C>T	c.(349-351)TAC>TAT	p.Y117Y	GM2A_uc011dcs.1_Intron|SLC36A3_uc003ltv.2_Silent_p.Y61Y|SLC36A3_uc003ltx.2_Silent_p.Y117Y	NM_181774	NP_861439	Q495N2	S36A3_HUMAN	solute carrier family 36, member 3 isoform 2	117	Cytoplasmic (Potential).					integral to membrane				ovary(2)|skin(1)	3		Medulloblastoma(196;0.109)|all_hematologic(541;0.243)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TTTCAAGGCCGTACATCGTGG	0.428													21	47	---	---	---	---	capture	Silent	SNP	150672978	150672978	SLC36A3	5	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	14487	232
ZNF193	7746	broad.mit.edu	37	6	28200919	28200919	+	Missense_Mutation	SNP	G	A	A			TCGA-32-1982-01	TCGA-32-1982-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:28200919G>A	uc003nkq.1	+	4	1263	c.1148G>A	c.(1147-1149)CGC>CAC	p.R383H	ZNF193_uc003nkr.1_Missense_Mutation_p.R383H|ZNF193_uc010jqz.1_Missense_Mutation_p.R434H	NM_006299	NP_006290	O15535	ZN193_HUMAN	zinc finger protein 193	383	C2H2-type 5.				viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0						AACCTCATTCGCCATCAGAAG	0.502													37	76	---	---	---	---	capture	Missense_Mutation	SNP	28200919	28200919	ZNF193	6	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	17637	232
EEF1A1	1915	broad.mit.edu	37	6	74228304	74228304	+	Missense_Mutation	SNP	C	T	T			TCGA-32-1982-01	TCGA-32-1982-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:74228304C>T	uc003phi.2	-	5	839	c.802G>A	c.(802-804)GAG>AAG	p.E268K	EEF1A1_uc003phd.2_5'UTR|EEF1A1_uc003phe.2_Missense_Mutation_p.E258K|EEF1A1_uc003phf.2_Missense_Mutation_p.E268K|EEF1A1_uc003phg.2_Missense_Mutation_p.E268K|EEF1A1_uc003phh.2_Missense_Mutation_p.E114K|EEF1A1_uc003phj.2_Missense_Mutation_p.E268K|EEF1A1_uc003phk.2_Missense_Mutation_p.E268K|EEF1A1_uc003phl.2_Intron|EEF1A1_uc003phm.1_Intron	NM_001402	NP_001393	P68104	EF1A1_HUMAN	eukaryotic translation elongation factor 1 alpha	268						cytosol|eukaryotic translation elongation factor 1 complex	GTP binding|GTPase activity|protein binding|translation elongation factor activity				0						ACACCAGTCTCCACTCGGCCA	0.418											OREG0003895	type=REGULATORY REGION|Gene=D16891|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	30	84	---	---	---	---	capture	Missense_Mutation	SNP	74228304	74228304	EEF1A1	6	C	T	T	T	1	0	0	0	0	1	0	0	0	390	30	2	2	4878	232
HBS1L	10767	broad.mit.edu	37	6	135318720	135318720	+	Missense_Mutation	SNP	G	C	C			TCGA-32-1982-01	TCGA-32-1982-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:135318720G>C	uc003qez.2	-	6	821	c.614C>G	c.(613-615)TCT>TGT	p.S205C	HBS1L_uc003qey.2_Missense_Mutation_p.S41C|HBS1L_uc011ecy.1_Intron|HBS1L_uc011ecz.1_Missense_Mutation_p.S41C|HBS1L_uc011eda.1_Missense_Mutation_p.S163C	NM_006620	NP_006611	Q9Y450	HBS1L_HUMAN	Hsp70 subfamily B suppressor 1-like protein	205					signal transduction		GTP binding|GTPase activity|translation elongation factor activity			skin(2)	2	Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.0046)|GBM - Glioblastoma multiforme(68;0.00702)		AACATCGGAAGAAGCAATGGC	0.443													53	149	---	---	---	---	capture	Missense_Mutation	SNP	135318720	135318720	HBS1L	6	G	C	C	C	1	0	0	0	0	1	0	0	0	429	33	4	4	6914	232
BCLAF1	9774	broad.mit.edu	37	6	136582520	136582520	+	Silent	SNP	T	C	C			TCGA-32-1982-01	TCGA-32-1982-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:136582520T>C	uc003qgx.1	-	12	2893	c.2640A>G	c.(2638-2640)AAA>AAG	p.K880K	BCLAF1_uc011edb.1_Silent_p.K159K|BCLAF1_uc003qgw.1_Silent_p.K707K|BCLAF1_uc003qgy.1_Silent_p.K829K|BCLAF1_uc011edc.1_RNA|BCLAF1_uc011edd.1_RNA|BCLAF1_uc011ede.1_Silent_p.K878K	NM_014739	NP_055554	Q9NYF8	BCLF1_HUMAN	BCL2-associated transcription factor 1 isoform	880					induction of apoptosis|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus	DNA binding|protein binding			ovary(1)	1	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00226)|OV - Ovarian serous cystadenocarcinoma(155;0.00331)		TGCTACCTGATTTTTTGAAGT	0.428													71	457	---	---	---	---	capture	Silent	SNP	136582520	136582520	BCLAF1	6	T	C	C	C	1	0	0	0	0	0	0	0	1	673	52	3	3	1372	232
IFNGR1	3459	broad.mit.edu	37	6	137519737	137519737	+	Missense_Mutation	SNP	C	G	G			TCGA-32-1982-01	TCGA-32-1982-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:137519737C>G	uc003qho.2	-	7	1004	c.901G>C	c.(901-903)GAA>CAA	p.E301Q	IFNGR1_uc011edm.1_Missense_Mutation_p.E273Q	NM_000416	NP_000407	P15260	INGR1_HUMAN	interferon gamma receptor 1 precursor	301	Cytoplasmic (Potential).				regulation of interferon-gamma-mediated signaling pathway|response to virus	integral to plasma membrane	interferon-gamma receptor activity			upper_aerodigestive_tract(1)	1	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000829)|OV - Ovarian serous cystadenocarcinoma(155;0.00389)	Interferon gamma-1b(DB00033)	TATTTTGATTCAGGTTTTGTC	0.393													3	108	---	---	---	---	capture	Missense_Mutation	SNP	137519737	137519737	IFNGR1	6	C	G	G	G	1	0	0	0	0	1	0	0	0	377	29	4	4	7474	232
SYNE1	23345	broad.mit.edu	37	6	152831380	152831380	+	Nonsense_Mutation	SNP	G	A	A			TCGA-32-1982-01	TCGA-32-1982-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:152831380G>A	uc010kiw.2	-	8	1131	c.529C>T	c.(529-531)CAA>TAA	p.Q177*	SYNE1_uc003qot.3_Nonsense_Mutation_p.Q184*|SYNE1_uc003qou.3_Nonsense_Mutation_p.Q177*|SYNE1_uc010kjb.1_Nonsense_Mutation_p.Q177*|SYNE1_uc003qpa.1_Nonsense_Mutation_p.Q177*	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	177	Actin-binding.|Cytoplasmic (Potential).				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		GCATTTCCTTGGATCTTGGTG	0.453										HNSCC(10;0.0054)			52	198	---	---	---	---	capture	Nonsense_Mutation	SNP	152831380	152831380	SYNE1	6	G	A	A	A	1	0	0	0	0	0	1	0	0	611	47	5	2	15333	232
MAP3K4	4216	broad.mit.edu	37	6	161527602	161527602	+	Missense_Mutation	SNP	G	A	A			TCGA-32-1982-01	TCGA-32-1982-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:161527602G>A	uc003qtn.2	+	20	4055	c.3913G>A	c.(3913-3915)GAA>AAA	p.E1305K	MAP3K4_uc010kkc.1_Missense_Mutation_p.E1301K|MAP3K4_uc003qto.2_Missense_Mutation_p.E1255K|MAP3K4_uc011efz.1_RNA|MAP3K4_uc011ega.1_Missense_Mutation_p.E758K|MAP3K4_uc003qtp.2_Missense_Mutation_p.E241K|MAP3K4_uc003qtq.2_5'UTR	NM_005922	NP_005913	Q9Y6R4	M3K4_HUMAN	mitogen-activated protein kinase kinase kinase 4	1305					activation of MAPKK activity|JNK cascade|positive regulation of JUN kinase activity	perinuclear region of cytoplasm	ATP binding|MAP kinase kinase kinase activity|metal ion binding|protein binding			ovary(3)|lung(3)|skin(2)|stomach(1)	9		Breast(66;0.000776)|Ovarian(120;0.0367)|Prostate(117;0.0771)		OV - Ovarian serous cystadenocarcinoma(65;1.85e-18)|BRCA - Breast invasive adenocarcinoma(81;3.04e-05)		CCGATTGTTTGAAGAAAAGAG	0.408													26	65	---	---	---	---	capture	Missense_Mutation	SNP	161527602	161527602	MAP3K4	6	G	A	A	A	1	0	0	0	0	1	0	0	0	585	45	2	2	9166	232
MAP3K4	4216	broad.mit.edu	37	6	161527656	161527656	+	Missense_Mutation	SNP	G	A	A			TCGA-32-1982-01	TCGA-32-1982-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:161527656G>A	uc003qtn.2	+	20	4109	c.3967G>A	c.(3967-3969)GAT>AAT	p.D1323N	MAP3K4_uc010kkc.1_Missense_Mutation_p.D1319N|MAP3K4_uc003qto.2_Missense_Mutation_p.D1273N|MAP3K4_uc011efz.1_RNA|MAP3K4_uc011ega.1_Missense_Mutation_p.D776N|MAP3K4_uc003qtp.2_Missense_Mutation_p.D259N|MAP3K4_uc003qtq.2_Missense_Mutation_p.D12N	NM_005922	NP_005913	Q9Y6R4	M3K4_HUMAN	mitogen-activated protein kinase kinase kinase 4	1323					activation of MAPKK activity|JNK cascade|positive regulation of JUN kinase activity	perinuclear region of cytoplasm	ATP binding|MAP kinase kinase kinase activity|metal ion binding|protein binding			ovary(3)|lung(3)|skin(2)|stomach(1)	9		Breast(66;0.000776)|Ovarian(120;0.0367)|Prostate(117;0.0771)		OV - Ovarian serous cystadenocarcinoma(65;1.85e-18)|BRCA - Breast invasive adenocarcinoma(81;3.04e-05)		TCAAGTTTGTGATACGCCTAA	0.398													30	75	---	---	---	---	capture	Missense_Mutation	SNP	161527656	161527656	MAP3K4	6	G	A	A	A	1	0	0	0	0	1	0	0	0	585	45	2	2	9166	232
ELMO1	9844	broad.mit.edu	37	7	37354483	37354483	+	Missense_Mutation	SNP	C	T	T			TCGA-32-1982-01	TCGA-32-1982-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:37354483C>T	uc003tfk.1	-	4	470	c.163G>A	c.(163-165)GAT>AAT	p.D55N	ELMO1_uc010kxg.1_Missense_Mutation_p.D55N	NM_014800	NP_055615	Q92556	ELMO1_HUMAN	engulfment and cell motility 1 isoform 1	55					actin cytoskeleton organization|apoptosis|cellular component movement|phagocytosis, engulfment|Rac protein signal transduction|regulation of defense response to virus by virus|viral reproduction	cytoskeleton|cytosol|plasma membrane	SH3 domain binding			ovary(3)|skin(2)|upper_aerodigestive_tract(1)	6						TTTGAACTATCGGCATGCTGG	0.323													12	80	---	---	---	---	capture	Missense_Mutation	SNP	37354483	37354483	ELMO1	7	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	5020	232
EGFR	1956	broad.mit.edu	37	7	55233043	55233043	+	Missense_Mutation	SNP	G	T	T	rs139236063		TCGA-32-1982-01	TCGA-32-1982-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:55233043G>T	uc003tqk.2	+	15	2039	c.1793G>T	c.(1792-1794)GGA>GTA	p.G598V	EGFR_uc003tqi.2_Missense_Mutation_p.G598V|EGFR_uc003tqj.2_Missense_Mutation_p.G598V|EGFR_uc010kzg.1_Missense_Mutation_p.G553V|EGFR_uc011kco.1_Missense_Mutation_p.G545V|EGFR_uc011kcp.1_Intron|EGFR_uc011kcq.1_RNA|EGFR_uc003tqn.2_RNA	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	598	Approximate.|Extracellular (Potential).				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	p.G598V(16)		lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	TGCCCGGCAGGAGTCATGGGA	0.567		8	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			784	151	---	---	---	---	capture	Missense_Mutation	SNP	55233043	55233043	EGFR	7	G	T	T	T	1	0	0	0	0	1	0	0	0	533	41	4	4	4922	232
TYW1B	441250	broad.mit.edu	37	7	72093896	72093896	+	Silent	SNP	C	T	T			TCGA-32-1982-01	TCGA-32-1982-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:72093896C>T	uc011kej.1	-	15	1752	c.1593G>A	c.(1591-1593)GGG>GGA	p.G531G	TYW1B_uc011keh.1_Silent_p.G369G|TYW1B_uc011kei.1_Silent_p.G157G	NM_001145440	NP_001138912	Q6NUM6	TYW1B_HUMAN	tRNA-yW synthesizing protein 1 homolog B isoform	531					tRNA processing		4 iron, 4 sulfur cluster binding|FMN binding|iron ion binding|oxidoreductase activity				0						AGTCAGGATTCCCCAGGGACA	0.537													3	18	---	---	---	---	capture	Silent	SNP	72093896	72093896	TYW1B	7	C	T	T	T	1	0	0	0	0	0	0	0	1	379	30	2	2	16701	232
RABL5	64792	broad.mit.edu	37	7	100959711	100959711	+	Missense_Mutation	SNP	C	A	A			TCGA-32-1982-01	TCGA-32-1982-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:100959711C>A	uc003uyl.2	-	4	422	c.319G>T	c.(319-321)GTC>TTC	p.V107F	RABL5_uc011kkk.1_Missense_Mutation_p.V30F|RABL5_uc011kkl.1_Missense_Mutation_p.V30F|RABL5_uc003uym.2_Missense_Mutation_p.V77F|RABL5_uc010lhw.2_RNA|RABL5_uc011kkm.1_Missense_Mutation_p.V107F	NM_022777	NP_073614	Q9H7X7	RABL5_HUMAN	RAB, member RAS oncogene family-like 5 isoform	107							GTP binding				0	Lung NSC(181;0.215)					GGCTGTTGGACAAAGCAGGAA	0.502													41	148	---	---	---	---	capture	Missense_Mutation	SNP	100959711	100959711	RABL5	7	C	A	A	A	1	0	0	0	0	1	0	0	0	221	17	4	4	12868	232
SLC26A5	375611	broad.mit.edu	37	7	103050961	103050961	+	Silent	SNP	G	A	A			TCGA-32-1982-01	TCGA-32-1982-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:103050961G>A	uc003vbz.2	-	7	842	c.606C>T	c.(604-606)GCC>GCT	p.A202A	SLC26A5_uc003vbt.1_Silent_p.A202A|SLC26A5_uc003vbu.1_Silent_p.A202A|SLC26A5_uc003vbv.1_Silent_p.A202A|SLC26A5_uc003vbw.2_RNA|SLC26A5_uc003vbx.2_Silent_p.A202A|SLC26A5_uc003vby.2_RNA|SLC26A5_uc010liy.2_RNA	NM_198999	NP_945350	P58743	S26A5_HUMAN	prestin isoform a	202	Helical; Name=4; (Potential).				regulation of cell shape|sensory perception of sound	integral to membrane	secondary active sulfate transmembrane transporter activity			ovary(1)	1						TGAGATATATGGCCACAAATC	0.408													3	85	---	---	---	---	capture	Silent	SNP	103050961	103050961	SLC26A5	7	G	A	A	A	1	0	0	0	0	0	0	0	1	600	47	2	2	14412	232
NUP205	23165	broad.mit.edu	37	7	135304420	135304420	+	Missense_Mutation	SNP	G	T	T			TCGA-32-1982-01	TCGA-32-1982-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:135304420G>T	uc003vsw.2	+	29	4244	c.4213G>T	c.(4213-4215)GAC>TAC	p.D1405Y	NUP205_uc003vsx.2_5'Flank	NM_015135	NP_055950	Q92621	NU205_HUMAN	nucleoporin 205kDa	1405					carbohydrate metabolic process|glucose transport|mRNA transport|protein import into nucleus, docking|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear pore	protein binding			ovary(3)|breast(1)|central_nervous_system(1)|skin(1)	6						GAAACTGTTAGACTTCATTTT	0.303													32	154	---	---	---	---	capture	Missense_Mutation	SNP	135304420	135304420	NUP205	7	G	T	T	T	1	0	0	0	0	1	0	0	0	429	33	4	4	10666	232
KEL	3792	broad.mit.edu	37	7	142650951	142650951	+	Silent	SNP	G	A	A			TCGA-32-1982-01	TCGA-32-1982-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:142650951G>A	uc003wcb.2	-	9	1227	c.1017C>T	c.(1015-1017)GAC>GAT	p.D339D		NM_000420	NP_000411	P23276	KELL_HUMAN	Kell blood group, metallo-endopeptidase	339	Extracellular (Potential).				proteolysis|vasoconstriction	integral to membrane|plasma membrane	metal ion binding|metalloendopeptidase activity|protein binding			ovary(3)|central_nervous_system(1)	4	Melanoma(164;0.059)					AATATTCCACGTCATGGACCA	0.537													123	431	---	---	---	---	capture	Silent	SNP	142650951	142650951	KEL	7	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	8064	232
ARHGEF35	445328	broad.mit.edu	37	7	143884178	143884178	+	Silent	SNP	G	A	A	rs140097295		TCGA-32-1982-01	TCGA-32-1982-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:143884178G>A	uc003wdz.1	-	2	1417	c.1299C>T	c.(1297-1299)CCC>CCT	p.P433P		NM_001003702	NP_001003702	A5YM69	ARG35_HUMAN	Rho guanine nucleotide exchange factor (GEF)	433											0						TCTGAGTCCCGGGAATCTGAG	0.567													14	59	---	---	---	---	capture	Silent	SNP	143884178	143884178	ARHGEF35	7	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	898	232
ADAM28	10863	broad.mit.edu	37	8	24181418	24181418	+	Silent	SNP	G	A	A			TCGA-32-1982-01	TCGA-32-1982-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:24181418G>A	uc003xdy.2	+	9	875	c.792G>A	c.(790-792)AAG>AAA	p.K264K	ADAM28_uc003xdx.2_Silent_p.K264K|ADAM28_uc011kzz.1_Silent_p.K31K|ADAM28_uc011laa.1_RNA|ADAM28_uc010lua.2_5'Flank	NM_014265	NP_055080	Q9UKQ2	ADA28_HUMAN	ADAM metallopeptidase domain 28 isoform 1	264	Peptidase M12B.|Extracellular (Potential).				proteolysis|spermatogenesis	extracellular region|integral to membrane|plasma membrane	metalloendopeptidase activity|zinc ion binding			skin(3)|lung(1)|central_nervous_system(1)	5		Prostate(55;0.0959)		Colorectal(74;0.0129)|COAD - Colon adenocarcinoma(73;0.0434)|BRCA - Breast invasive adenocarcinoma(99;0.175)		ATAAGATAAAGATAACCCCAA	0.383													36	79	---	---	---	---	capture	Silent	SNP	24181418	24181418	ADAM28	8	G	A	A	A	1	0	0	0	0	0	0	0	1	425	33	2	2	246	232
JPH1	56704	broad.mit.edu	37	8	75171695	75171695	+	Missense_Mutation	SNP	C	T	T			TCGA-32-1982-01	TCGA-32-1982-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:75171695C>T	uc003yae.2	-	3	1223	c.1183G>A	c.(1183-1185)GCG>ACG	p.A395T	JPH1_uc003yaf.2_Missense_Mutation_p.A395T|JPH1_uc003yag.1_Missense_Mutation_p.A259T	NM_020647	NP_065698	Q9HDC5	JPH1_HUMAN	junctophilin 1	395	Ala-rich.|Cytoplasmic (Potential).				calcium ion transport into cytosol|regulation of ryanodine-sensitive calcium-release channel activity	integral to membrane|junctional membrane complex|junctional sarcoplasmic reticulum membrane|plasma membrane				ovary(1)	1	Breast(64;0.00576)		BRCA - Breast invasive adenocarcinoma(89;0.0499)|Epithelial(68;0.0728)|all cancers(69;0.176)			GCGGCCAGCGCGGCCTGGTCG	0.597													17	35	---	---	---	---	capture	Missense_Mutation	SNP	75171695	75171695	JPH1	8	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	7883	232
ENPP2	5168	broad.mit.edu	37	8	120629796	120629796	+	Missense_Mutation	SNP	G	A	A			TCGA-32-1982-01	TCGA-32-1982-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:120629796G>A	uc003yot.1	-	6	573	c.487C>T	c.(487-489)CGC>TGC	p.R163C	ENPP2_uc003yos.1_Missense_Mutation_p.R163C|ENPP2_uc010mdd.1_Missense_Mutation_p.R163C	NM_001040092	NP_001035181	Q13822	ENPP2_HUMAN	autotaxin isoform 2 preproprotein	163					cellular component movement|chemotaxis|G-protein coupled receptor protein signaling pathway|immune response|phosphate metabolic process|phosphatidylcholine catabolic process|regulation of cell migration	extracellular space|integral to plasma membrane	alkylglycerophosphoethanolamine phosphodiesterase activity|calcium ion binding|lysophospholipase activity|nucleic acid binding|nucleotide diphosphatase activity|phosphodiesterase I activity|polysaccharide binding|scavenger receptor activity|transcription factor binding|zinc ion binding			ovary(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)|large_intestine(1)|kidney(1)	7	Lung NSC(37;5.03e-06)|Ovarian(258;0.0249)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00185)			AATGGAGGGCGAACAAACCTT	0.368													9	26	---	---	---	---	capture	Missense_Mutation	SNP	120629796	120629796	ENPP2	8	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	5085	232
TSNARE1	203062	broad.mit.edu	37	8	143310871	143310871	+	Missense_Mutation	SNP	T	C	C			TCGA-32-1982-01	TCGA-32-1982-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:143310871T>C	uc003ywk.2	-	13	1634	c.1516A>G	c.(1516-1518)ATC>GTC	p.I506V	TSNARE1_uc011lju.1_Missense_Mutation_p.I505V|TSNARE1_uc003ywj.2_Missense_Mutation_p.I507V	NM_145003	NP_659440	Q96NA8	TSNA1_HUMAN	t-SNARE domain containing 1	506	Poly-Ile.|Helical; (Potential).				vesicle-mediated transport	integral to membrane					0	all_cancers(97;7.39e-11)|all_epithelial(106;8.98e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000332)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)					GTGGCGATGATGATGATGATG	0.423													21	41	---	---	---	---	capture	Missense_Mutation	SNP	143310871	143310871	TSNARE1	8	T	C	C	C	1	0	0	0	0	1	0	0	0	663	51	3	3	16513	232
EPB41L4B	54566	broad.mit.edu	37	9	112017853	112017853	+	Silent	SNP	C	T	T			TCGA-32-1982-01	TCGA-32-1982-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:112017853C>T	uc004bdz.1	-	11	1402	c.1107G>A	c.(1105-1107)ACG>ACA	p.T369T	EPB41L4B_uc004bea.2_Silent_p.T369T	NM_019114	NP_061987	Q9H329	E41LB_HUMAN	erythrocyte membrane protein band 4.1 like 4B	369	FERM.					cytoplasm|cytoskeleton|extrinsic to membrane	cytoskeletal protein binding|structural constituent of cytoskeleton			ovary(1)|central_nervous_system(1)|skin(1)	3						TGTTTCCTGGCGTCCGCAGTC	0.522													36	120	---	---	---	---	capture	Silent	SNP	112017853	112017853	EPB41L4B	9	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	5111	232
CXorf59	286464	broad.mit.edu	37	X	36103536	36103536	+	Silent	SNP	C	T	T			TCGA-32-1982-01	TCGA-32-1982-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:36103536C>T	uc004ddk.1	+	5	708	c.522C>T	c.(520-522)CTC>CTT	p.L174L		NM_173695	NP_775966	Q8N9S7	CX059_HUMAN	hypothetical protein LOC286464	174						integral to membrane				central_nervous_system(1)	1						ATGTGCTGCTCCATTTGAGTG	0.353													33	80	---	---	---	---	capture	Silent	SNP	36103536	36103536	CXorf59	23	C	T	T	T	1	0	0	0	0	0	0	0	1	379	30	2	2	4075	232
HDAC6	10013	broad.mit.edu	37	X	48661362	48661362	+	Missense_Mutation	SNP	G	A	A			TCGA-32-1982-01	TCGA-32-1982-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:48661362G>A	uc011mmi.1	+	3	273	c.178G>A	c.(178-180)GGC>AGC	p.G60S	HDAC6_uc004dkr.1_Missense_Mutation_p.G60S|HDAC6_uc004dks.1_Missense_Mutation_p.G60S|HDAC6_uc010nig.1_5'UTR|HDAC6_uc004dkt.1_Missense_Mutation_p.G60S|HDAC6_uc004dku.3_Missense_Mutation_p.G60S|HDAC6_uc011mmj.1_Missense_Mutation_p.G5S|HDAC6_uc011mmk.1_Missense_Mutation_p.G41S	NM_006044	NP_006035	Q9UBN7	HDAC6_HUMAN	histone deacetylase 6	60					aggresome assembly|cellular response to hydrogen peroxide|Hsp90 deacetylation|lysosome localization|macroautophagy|misfolded or incompletely synthesized protein catabolic process|negative regulation of proteolysis|negative regulation of transcription, DNA-dependent|peptidyl-lysine deacetylation|polyubiquitinated misfolded protein transport|positive regulation of apoptosis|positive regulation of cellular chaperone-mediated protein complex assembly|positive regulation of epithelial cell migration|positive regulation of receptor biosynthetic process|positive regulation of signal transduction|regulation of androgen receptor signaling pathway|regulation of receptor activity|response to growth factor stimulus|response to toxin|transcription, DNA-dependent|tubulin deacetylation	aggresome|caveola|cell leading edge|cytosol|histone deacetylase complex|microtubule associated complex|perinuclear region of cytoplasm	actin binding|alpha-tubulin binding|beta-catenin binding|dynein complex binding|histone deacetylase activity (H3-K16 specific)|histone deacetylase binding|Hsp90 protein binding|microtubule binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|polyubiquitin binding|tau protein binding|tubulin deacetylase activity|zinc ion binding			ovary(3)|upper_aerodigestive_tract(1)	4					Vorinostat(DB02546)	GAAGAAGCTCGGCCAAGCAAT	0.488													8	26	---	---	---	---	capture	Missense_Mutation	SNP	48661362	48661362	HDAC6	23	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	6938	232
SMC1A	8243	broad.mit.edu	37	X	53439144	53439144	+	Missense_Mutation	SNP	G	T	T			TCGA-32-1982-01	TCGA-32-1982-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:53439144G>T	uc004dsg.2	-	6	983	c.914C>A	c.(913-915)ACC>AAC	p.T305N	SMC1A_uc011moe.1_Missense_Mutation_p.T283N|SMC1A_uc011mof.1_Intron	NM_006306	NP_006297	Q14683	SMC1A_HUMAN	structural maintenance of chromosomes 1A	305	Potential.				cell cycle checkpoint|cell division|DNA repair|meiosis|mitotic metaphase/anaphase transition|mitotic prometaphase|mitotic sister chromatid cohesion|mitotic spindle organization|negative regulation of DNA endoreduplication|nuclear mRNA splicing, via spliceosome|response to radiation|signal transduction in response to DNA damage	cohesin core heterodimer|condensed chromosome kinetochore|condensed nuclear chromosome|cytoplasm|meiotic cohesin complex|nucleoplasm	ATP binding|chromatin binding|microtubule motor activity|protein heterodimerization activity			ovary(5)|central_nervous_system(1)	6						TTTGTGGGAGGTGTTCTCCTT	0.498													22	59	---	---	---	---	capture	Missense_Mutation	SNP	53439144	53439144	SMC1A	23	G	T	T	T	1	0	0	0	0	1	0	0	0	572	44	4	4	14673	232
TAF1	6872	broad.mit.edu	37	X	70627913	70627913	+	Silent	SNP	C	T	T			TCGA-32-1982-01	TCGA-32-1982-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:70627913C>T	uc004dzu.3	+	28	4344	c.4293C>T	c.(4291-4293)CGC>CGT	p.R1431R	BCYRN1_uc011mpt.1_Intron|TAF1_uc004dzt.3_Silent_p.R1452R|TAF1_uc004dzv.3_Silent_p.R605R|TAF1_uc010nld.1_RNA|TAF1_uc010nle.1_RNA|TAF1_uc010nlf.1_5'UTR|TAF1_uc004dzx.2_RNA|TAF1_uc004dzy.2_RNA	NM_138923	NP_620278	P21675	TAF1_HUMAN	TBP-associated factor 1 isoform 2	1431	Bromo 1.|Interaction with ASF1A and ASF1B.|Protein kinase 2.				G1 phase of mitotic cell cycle|interspecies interaction between organisms|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription initiation from RNA polymerase II promoter|protein autophosphorylation|regulation of transcription involved in G2/M-phase of mitotic cell cycle|RNA polymerase II transcriptional preinitiation complex assembly|transcription elongation from RNA polymerase II promoter|viral reproduction	MLL1 complex|transcription factor TFIID complex	ATP binding|histone acetyl-lysine binding|histone acetyltransferase activity|p53 binding|protein binding|protein serine/threonine kinase activity|sequence-specific DNA binding|TBP-class protein binding|transcription coactivator activity			ovary(7)|breast(4)|large_intestine(2)|central_nervous_system(2)|lung(1)|skin(1)	17	Renal(35;0.156)	all_lung(315;0.000321)				AAACACTCCGCGAAAACGTGC	0.443													44	128	---	---	---	---	capture	Silent	SNP	70627913	70627913	TAF1	23	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	15401	232
PGK1	5230	broad.mit.edu	37	X	77378404	77378404	+	Silent	SNP	T	A	A			TCGA-32-1982-01	TCGA-32-1982-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:77378404T>A	uc004ecz.3	+	7	886	c.714T>A	c.(712-714)GGT>GGA	p.G238G	PGK1_uc010nlz.2_RNA|PGK1_uc011mqq.1_Silent_p.G210G	NM_000291	NP_000282	P00558	PGK1_HUMAN	phosphoglycerate kinase 1	238					gluconeogenesis|glycolysis	cytosol	ATP binding|phosphoglycerate kinase activity			upper_aerodigestive_tract(1)|ovary(1)	2						TTATTGGTGGTGGAATGGCTT	0.398													4	148	---	---	---	---	capture	Silent	SNP	77378404	77378404	PGK1	23	T	A	A	A	1	0	0	0	0	0	0	0	1	756	59	4	4	11693	232
RPA4	29935	broad.mit.edu	37	X	96139791	96139791	+	Missense_Mutation	SNP	C	T	T			TCGA-32-1982-01	TCGA-32-1982-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:96139791C>T	uc004efv.3	+	1	780	c.482C>T	c.(481-483)ACG>ATG	p.T161M	DIAPH2_uc004eft.3_Intron|DIAPH2_uc004efu.3_Intron|DIAPH2_uc004efs.2_Intron	NM_013347	NP_037479	Q13156	RFA4_HUMAN	replication protein A4, 34kDa	161					DNA damage checkpoint|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|nucleotide-excision repair	DNA replication factor A complex|nucleoplasm	single-stranded DNA binding				0						ATTCTGGAAACGGTCAATGCA	0.458								Other_identified_genes_with_known_or_suspected_DNA_repair_function					49	126	---	---	---	---	capture	Missense_Mutation	SNP	96139791	96139791	RPA4	23	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	13431	232
PCDH19	57526	broad.mit.edu	37	X	99662858	99662858	+	Silent	SNP	G	A	A			TCGA-32-1982-01	TCGA-32-1982-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:99662858G>A	uc010nmz.2	-	1	2414	c.738C>T	c.(736-738)AGC>AGT	p.S246S	PCDH19_uc004efw.3_Silent_p.S246S|PCDH19_uc004efx.3_Silent_p.S246S	NM_020766	NP_001098713	Q8TAB3	PCD19_HUMAN	protocadherin 19 isoform b	246	Cadherin 3.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)|breast(2)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	7						TTTCTGGCACGCTCACCGCGT	0.617													71	147	---	---	---	---	capture	Silent	SNP	99662858	99662858	PCDH19	23	G	A	A	A	1	0	0	0	0	0	0	0	1	490	38	1	1	11417	232
MID2	11043	broad.mit.edu	37	X	107084402	107084402	+	Silent	SNP	G	A	A			TCGA-32-1982-01	TCGA-32-1982-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:107084402G>A	uc004enl.2	+	2	1080	c.507G>A	c.(505-507)ACG>ACA	p.T169T	MID2_uc004enk.2_Silent_p.T169T	NM_012216	NP_036348	Q9UJV3	TRIM1_HUMAN	midline 2 isoform 1	169	B box-type 1; degenerate.					centrosome|microtubule	ligase activity|zinc ion binding			ovary(1)	1						TGCGGGCCACGCACCCCAACA	0.552													31	67	---	---	---	---	capture	Silent	SNP	107084402	107084402	MID2	23	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	9490	232
MAGEA6	4105	broad.mit.edu	37	X	151869622	151869622	+	Missense_Mutation	SNP	G	T	T			TCGA-32-1982-01	TCGA-32-1982-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:151869622G>T	uc004ffq.1	+	3	506	c.312G>T	c.(310-312)GAG>GAT	p.E104D	MAGEA6_uc004ffr.1_Missense_Mutation_p.E104D|MAGEA2_uc010nto.2_Intron	NM_005363	NP_005354	P43360	MAGA6_HUMAN	melanoma antigen family A, 6	104							protein binding				0	Acute lymphoblastic leukemia(192;6.56e-05)					TGGAGTCTGAGTTCCAAGCAG	0.547													56	174	---	---	---	---	capture	Missense_Mutation	SNP	151869622	151869622	MAGEA6	23	G	T	T	T	1	0	0	0	0	1	0	0	0	464	36	4	4	9084	232
DKC1	1736	broad.mit.edu	37	X	154004585	154004585	+	Missense_Mutation	SNP	G	A	A			TCGA-32-1982-01	TCGA-32-1982-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:154004585G>A	uc004fmm.2	+	14	1672	c.1462G>A	c.(1462-1464)GAG>AAG	p.E488K	DKC1_uc010nvf.2_Missense_Mutation_p.E483K	NM_001363	NP_001354	O60832	DKC1_HUMAN	dyskerin isoform 1	488	Nuclear and nucleolar localization.				cell proliferation|pseudouridine synthesis|rRNA processing|telomere maintenance via telomerase	Cajal body|nucleolus|telomerase holoenzyme complex	protein binding|pseudouridine synthase activity|RNA binding|telomerase activity				0	all_cancers(53;8.15e-17)|all_epithelial(53;1.1e-10)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					GAGCGGGGCCGAGCCTGGAGA	0.468									Congenital_Dyskeratosis				16	22	---	---	---	---	capture	Missense_Mutation	SNP	154004585	154004585	DKC1	23	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	4500	232
CHD8	57680	broad.mit.edu	37	14	21860669	21860673	+	Frame_Shift_Del	DEL	TTTGA	-	-			TCGA-32-1982-01	TCGA-32-1982-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:21860669_21860673delTTTGA	uc001was.1	-	34	6021_6025	c.5927_5931delTCAAA	c.(5926-5931)ATCAAAfs	p.I1976fs	CHD8_uc001war.1_Frame_Shift_Del_p.I1872fs|SNORD9_uc001wat.1_5'Flank	NM_020920	NP_065971	Q9HCK8	CHD8_HUMAN	chromodomain helicase DNA binding protein 8	2255_2256					ATP-dependent chromatin remodeling|canonical Wnt receptor signaling pathway|negative regulation of transcription, DNA-dependent|negative regulation of Wnt receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase III promoter|transcription, DNA-dependent	MLL1 complex	ATP binding|beta-catenin binding|DNA binding|DNA helicase activity|DNA-dependent ATPase activity|methylated histone residue binding|p53 binding			ovary(6)|upper_aerodigestive_tract(1)|large_intestine(1)|breast(1)|skin(1)	10	all_cancers(95;0.00121)		Epithelial(56;2.55e-06)|all cancers(55;1.73e-05)	GBM - Glioblastoma multiforme(265;0.00424)		AGCTTACATCTTTGATTTGAACTGT	0.468													66	244	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	21860669	21860673	CHD8	14	TTTGA	-	-	-	1	0	1	0	1	0	0	0	0	725	56	5	5	3297	232
SMG1	23049	broad.mit.edu	37	16	18875017	18875018	+	Frame_Shift_Del	DEL	GT	-	-			TCGA-32-1982-01	TCGA-32-1982-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:18875017_18875018delGT	uc002dfm.2	-	25	4012_4013	c.3649_3650delAC	c.(3649-3651)ACCfs	p.T1217fs	SMG1_uc010bwb.2_Frame_Shift_Del_p.T1077fs	NM_015092	NP_055907	Q96Q15	SMG1_HUMAN	PI-3-kinase-related kinase SMG-1	1217	FAT.|Interaction with SMG8 and SMG9.				DNA repair|mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|peptidyl-serine phosphorylation|phosphatidylinositol phosphorylation|protein autophosphorylation	cytoplasm|nucleus	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			breast(5)|stomach(4)|lung(4)|kidney(2)|ovary(1)	16						AGTGCTACTGGTACTCTTTTTC	0.366													62	162	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	18875017	18875018	SMG1	16	GT	-	-	-	1	0	1	0	1	0	0	0	0	572	44	5	5	14687	232
ACE	1636	broad.mit.edu	37	17	61554654	61554654	+	Frame_Shift_Del	DEL	G	-	-			TCGA-32-1982-01	TCGA-32-1982-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:61554654delG	uc002jau.1	+	1	221	c.199delG	c.(199-201)GCCfs	p.A67fs	ACE_uc010wph.1_Frame_Shift_Del_p.A67fs|ACE_uc010wpi.1_Frame_Shift_Del_p.A67fs|ACE_uc010ddu.1_5'UTR	NM_000789	NP_000780	P12821	ACE_HUMAN	angiotensin I converting enzyme 1 isoform 1	67	Extracellular (Potential).|Peptidase M2 1.				arachidonic acid secretion|hormone catabolic process|kidney development|peptide catabolic process|regulation of smooth muscle cell migration	endosome|external side of plasma membrane|extracellular space|integral to membrane|membrane fraction|plasma membrane	actin binding|bradykinin receptor binding|carboxypeptidase activity|chloride ion binding|drug binding|metallopeptidase activity|peptidyl-dipeptidase activity|zinc ion binding			ovary(2)|upper_aerodigestive_tract(1)|pancreas(1)	4					Benazepril(DB00542)|Captopril(DB01197)|Deserpidine(DB01089)|Enalapril(DB00584)|Fosinopril(DB00492)|Lisinopril(DB00722)|Moexipril(DB00691)|Perindopril(DB00790)|Quinapril(DB00881)|Ramipril(DB00178)|Rescinnamine(DB01180)|Spirapril(DB01348)|Trandolapril(DB00519)	GAGCGTGGCCGCCAGCTGGGC	0.507													2	4	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	61554654	61554654	ACE	17	G	-	-	-	1	0	1	0	1	0	0	0	0	494	38	5	5	136	232
DNAJB7	150353	broad.mit.edu	37	22	41257115	41257115	+	Frame_Shift_Del	DEL	T	-	-			TCGA-32-1982-01	TCGA-32-1982-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:41257115delT	uc003azj.2	-	1	1016	c.884delA	c.(883-885)AAGfs	p.K295fs	XPNPEP3_uc011aox.1_Intron|XPNPEP3_uc003azh.2_Intron|XPNPEP3_uc003azi.2_Intron|XPNPEP3_uc011aoy.1_5'Flank|XPNPEP3_uc003azg.1_Intron|XPNPEP3_uc003azf.1_Intron|XPNPEP3_uc010gyh.1_5'Flank	NM_145174	NP_660157	Q7Z6W7	DNJB7_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 7	295	Poly-Lys.				protein folding		heat shock protein binding|unfolded protein binding			ovary(1)	1						TTTACGCTTCTTTTTTTTCCT	0.378													9	210	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	41257115	41257115	DNAJB7	22	T	-	-	-	1	0	1	0	1	0	0	0	0	728	56	5	5	4581	232
GPRC6A	222545	broad.mit.edu	37	6	117150029	117150031	+	In_Frame_Del	DEL	ACA	-	-			TCGA-32-1982-01	TCGA-32-1982-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:117150029_117150031delACA	uc003pxj.1	-	1	168_170	c.146_148delTGT	c.(145-150)TTGTCC>TCC	p.L49del	GPRC6A_uc003pxk.1_In_Frame_Del_p.L49del|GPRC6A_uc003pxl.1_In_Frame_Del_p.L49del	NM_148963	NP_683766	Q5T6X5	GPC6A_HUMAN	G protein-coupled receptor, family C, group 6,	49	Extracellular (Potential).				response to amino acid stimulus		G-protein coupled receptor activity			ovary(4)|skin(2)	6		all_cancers(87;0.0314)|all_epithelial(87;0.0216)|Colorectal(196;0.234)		GBM - Glioblastoma multiforme(226;0.0265)|all cancers(137;0.0554)|OV - Ovarian serous cystadenocarcinoma(136;0.07)		TCTTCTGAGGACAACATTTTTTC	0.443													32	90	---	---	---	---	capture_indel	In_Frame_Del	DEL	117150029	117150031	GPRC6A	6	ACA	-	-	-	1	0	1	0	1	0	0	0	0	130	10	5	5	6661	232
