Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
INPP5B	3633	broad.mit.edu	37	1	38345863	38345863	+	Missense_Mutation	SNP	T	C	C			TCGA-32-1991-01	TCGA-32-1991-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:38345863T>C	uc001ccg.1	-	15	1529	c.1435A>G	c.(1435-1437)AAA>GAA	p.K479E	INPP5B_uc009vvk.1_Missense_Mutation_p.K420E|INPP5B_uc001ccf.1_Missense_Mutation_p.K315E|INPP5B_uc010oij.1_RNA	NM_005540	NP_005531	P32019	I5P2_HUMAN	inositol polyphosphate-5-phosphatase, 75kDa	559					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|integral to membrane|microtubule cytoskeleton	GTPase activator activity|inositol-polyphosphate 5-phosphatase activity|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity|protein binding			urinary_tract(1)	1	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)				ACCTGAATTTTCAGCTATACA	0.398													75	119	---	---	---	---	capture	Missense_Mutation	SNP	38345863	38345863	INPP5B	1	T	C	C	C	1	0	0	0	0	1	0	0	0	806	62	3	3	7678	234
CGN	57530	broad.mit.edu	37	1	151491244	151491244	+	Missense_Mutation	SNP	G	T	T			TCGA-32-1991-01	TCGA-32-1991-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:151491244G>T	uc009wmw.2	+	2	393	c.249G>T	c.(247-249)AAG>AAT	p.K83N		NM_020770	NP_065821	Q9P2M7	CING_HUMAN	cingulin	77	Head.					myosin complex|tight junction	actin binding|motor activity			ovary(2)|pancreas(1)	3	Ovarian(49;0.0273)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		LUSC - Lung squamous cell carcinoma(543;0.181)			TCCAAATCAAGGGGGCCAATG	0.592													44	81	---	---	---	---	capture	Missense_Mutation	SNP	151491244	151491244	CGN	1	G	T	T	T	1	0	0	0	0	1	0	0	0	451	35	4	4	3269	234
HRNR	388697	broad.mit.edu	37	1	152187646	152187646	+	Silent	SNP	T	C	C			TCGA-32-1991-01	TCGA-32-1991-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152187646T>C	uc001ezt.1	-	3	6535	c.6459A>G	c.(6457-6459)TCA>TCG	p.S2153S		NM_001009931	NP_001009931	Q86YZ3	HORN_HUMAN	hornerin	2153					keratinization		calcium ion binding|protein binding			skin(2)|ovary(1)	3	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			AAGACGAACCTGAGCTAGATC	0.607													29	685	---	---	---	---	capture	Silent	SNP	152187646	152187646	HRNR	1	T	C	C	C	1	0	0	0	0	0	0	0	1	704	55	3	3	7284	234
ABL2	27	broad.mit.edu	37	1	179077669	179077669	+	Silent	SNP	C	T	T			TCGA-32-1991-01	TCGA-32-1991-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:179077669C>T	uc001gmj.3	-	12	3020	c.2733G>A	c.(2731-2733)CCG>CCA	p.P911P	ABL2_uc010pnf.1_Silent_p.P808P|ABL2_uc010png.1_Silent_p.P787P|ABL2_uc010pnh.1_Silent_p.P890P|ABL2_uc001gmg.3_Silent_p.P793P|ABL2_uc001gmi.3_Silent_p.P896P|ABL2_uc001gmh.3_Silent_p.P875P|ABL2_uc010pne.1_Silent_p.P772P	NM_007314	NP_009298	P42684	ABL2_HUMAN	arg tyrosine kinase isoform b	911	F-actin-binding (By similarity).|Pro-rich.				axon guidance|cell adhesion|peptidyl-tyrosine phosphorylation|positive regulation of oxidoreductase activity|signal transduction	cytoskeleton|cytosol	ATP binding|magnesium ion binding|manganese ion binding|non-membrane spanning protein tyrosine kinase activity|protein binding			lung(8)|breast(3)|ovary(2)|central_nervous_system(1)	14					Adenosine triphosphate(DB00171)|Dasatinib(DB01254)	AAGGCCAGCCCGGCTGCTCTC	0.607			T	ETV6	AML								17	51	---	---	---	---	capture	Silent	SNP	179077669	179077669	ABL2	1	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	93	234
C1orf26	54823	broad.mit.edu	37	1	185144110	185144110	+	Silent	SNP	A	G	G			TCGA-32-1991-01	TCGA-32-1991-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:185144110A>G	uc001grg.3	+	5	945	c.831A>G	c.(829-831)TTA>TTG	p.L277L	C1orf26_uc001grh.3_Silent_p.L277L	NM_001105518	NP_001098988	Q5T5J6	SWT1_HUMAN	hypothetical protein LOC54823	277											0						AGGTTTCATTAAATGTGACTA	0.348													125	176	---	---	---	---	capture	Silent	SNP	185144110	185144110	C1orf26	1	A	G	G	G	1	0	0	0	0	0	0	0	1	167	13	3	3	2017	234
CFH	3075	broad.mit.edu	37	1	196709801	196709801	+	Missense_Mutation	SNP	G	T	T			TCGA-32-1991-01	TCGA-32-1991-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:196709801G>T	uc001gtj.3	+	18	3075	c.2835G>T	c.(2833-2835)ATG>ATT	p.M945I		NM_000186	NP_000177	P08603	CFAH_HUMAN	complement factor H isoform a precursor	945	Sushi 16.				complement activation, alternative pathway	extracellular space				skin(4)|ovary(1)|breast(1)	6						TAGCTCACATGTCAGACAGTT	0.353													125	166	---	---	---	---	capture	Missense_Mutation	SNP	196709801	196709801	CFH	1	G	T	T	T	1	0	0	0	0	1	0	0	0	624	48	4	4	3249	234
PTPRC	5788	broad.mit.edu	37	1	198703534	198703534	+	Silent	SNP	C	A	A			TCGA-32-1991-01	TCGA-32-1991-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:198703534C>A	uc001gur.1	+	22	2431	c.2251C>A	c.(2251-2253)CGA>AGA	p.R751R	PTPRC_uc001gus.1_Silent_p.R703R|PTPRC_uc001gut.1_Silent_p.R590R|PTPRC_uc010ppg.1_Silent_p.R687R	NM_002838	NP_002829	P08575	PTPRC_HUMAN	protein tyrosine phosphatase, receptor type, C	751	Cytoplasmic (Potential).|Tyrosine-protein phosphatase 1.				axon guidance|B cell proliferation|B cell receptor signaling pathway|defense response to virus|immunoglobulin biosynthetic process|negative regulation of cytokine-mediated signaling pathway|negative regulation of protein kinase activity|negative regulation of T cell mediated cytotoxicity|positive regulation of antigen receptor-mediated signaling pathway|positive regulation of B cell proliferation|positive regulation of protein kinase activity|positive regulation of T cell proliferation|regulation of S phase|release of sequestered calcium ion into cytosol|T cell differentiation|T cell receptor signaling pathway	focal adhesion|integral to plasma membrane|membrane raft	protein kinase binding|transmembrane receptor protein tyrosine phosphatase activity			breast(4)|skin(3)|ovary(2)|lung(1)|kidney(1)|pancreas(1)	12						CATGGTCACTCGATGTGAAGA	0.423													7	710	---	---	---	---	capture	Silent	SNP	198703534	198703534	PTPRC	1	C	A	A	A	1	0	0	0	0	0	0	0	1	399	31	4	4	12692	234
PIGR	5284	broad.mit.edu	37	1	207108974	207108974	+	Missense_Mutation	SNP	C	T	T			TCGA-32-1991-01	TCGA-32-1991-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:207108974C>T	uc001hez.2	-	5	1419	c.1235G>A	c.(1234-1236)CGC>CAC	p.R412H	PIGR_uc009xbz.2_Missense_Mutation_p.R412H	NM_002644	NP_002635	P01833	PIGR_HUMAN	polymeric immunoglobulin receptor precursor	412	Ig-like V-type 4.|Extracellular (Potential).					extracellular region|integral to plasma membrane	protein binding			ovary(1)|central_nervous_system(1)|skin(1)	3						CAGGGAGAGGCGGCCCTCGTA	0.637											OREG0014186	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	14	32	---	---	---	---	capture	Missense_Mutation	SNP	207108974	207108974	PIGR	1	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	11800	234
OR2M5	127059	broad.mit.edu	37	1	248308541	248308541	+	Missense_Mutation	SNP	T	C	C			TCGA-32-1991-01	TCGA-32-1991-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:248308541T>C	uc010pze.1	+	1	92	c.92T>C	c.(91-93)GTC>GCC	p.V31A		NM_001004690	NP_001004690	A3KFT3	OR2M5_HUMAN	olfactory receptor, family 2, subfamily M,	31	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|kidney(1)	3	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0388)			TTCTTTCTGGTCCTGGCCATC	0.507													251	364	---	---	---	---	capture	Missense_Mutation	SNP	248308541	248308541	OR2M5	1	T	C	C	C	1	0	0	0	0	1	0	0	0	754	58	3	3	10917	234
DNAJC9	23234	broad.mit.edu	37	10	75006771	75006771	+	Missense_Mutation	SNP	G	C	C			TCGA-32-1991-01	TCGA-32-1991-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:75006771G>C	uc001jtr.2	-	1	255	c.177C>G	c.(175-177)TTC>TTG	p.F59L	DNAJC9_uc010qkg.1_Missense_Mutation_p.F59L|MRPS16_uc010qkh.1_RNA	NM_015190	NP_056005	Q8WXX5	DNJC9_HUMAN	DnaJ homolog, subfamily C, member 9	59	J.				protein folding		heat shock protein binding|unfolded protein binding				0	Prostate(51;0.0119)					TGCATACCTGGAAGCGGCGGG	0.736													2	5	---	---	---	---	capture	Missense_Mutation	SNP	75006771	75006771	DNAJC9	10	G	C	C	C	1	0	0	0	0	1	0	0	0	529	41	4	4	4612	234
PTEN	5728	broad.mit.edu	37	10	89717636	89717636	+	Nonsense_Mutation	SNP	A	T	T			TCGA-32-1991-01	TCGA-32-1991-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:89717636A>T	uc001kfb.2	+	8	1692	c.661A>T	c.(661-663)AAG>TAG	p.K221*		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog	221	C2 tensin-type.				activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.R55fs*1(4)|p.N212fs*1(2)|p.Y27fs*1(2)|p.K221fs*2(1)|p.G165_*404del(1)|p.?(1)|p.G165_K342del(1)|p.K221*(1)|p.Q214fs*22(1)		endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		CTGCCAGCTAAAGGTGAAGAT	0.413		31	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			32	148	---	---	---	---	capture	Nonsense_Mutation	SNP	89717636	89717636	PTEN	10	A	T	T	T	1	0	0	0	0	0	1	0	0	13	1	5	4	12633	234
SLC22A11	55867	broad.mit.edu	37	11	64337166	64337166	+	Silent	SNP	G	A	A			TCGA-32-1991-01	TCGA-32-1991-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:64337166G>A	uc001oai.2	+	9	1799	c.1425G>A	c.(1423-1425)GGG>GGA	p.G475G	SLC22A11_uc001oaj.2_Intron|SLC22A11_uc009ypq.2_Silent_p.G367G	NM_018484	NP_060954	Q9NSA0	S22AB_HUMAN	solute carrier family 22 member 11	475	Helical; (Potential).				urate metabolic process	apical plasma membrane|external side of plasma membrane|integral to plasma membrane	inorganic anion exchanger activity|protein binding|sodium-independent organic anion transmembrane transporter activity			ovary(1)|central_nervous_system(1)	2					Probenecid(DB01032)	GCCGGCTGGGGGCTATGATGG	0.612													89	173	---	---	---	---	capture	Silent	SNP	64337166	64337166	SLC22A11	11	G	A	A	A	1	0	0	0	0	0	0	0	1	548	43	2	2	14335	234
PHLDB1	23187	broad.mit.edu	37	11	118521224	118521224	+	Silent	SNP	G	A	A			TCGA-32-1991-01	TCGA-32-1991-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:118521224G>A	uc001ptr.1	+	21	4199	c.3846G>A	c.(3844-3846)CGG>CGA	p.R1282R	PHLDB1_uc001pts.2_Silent_p.R1282R|PHLDB1_uc001ptt.2_Silent_p.R1235R|PHLDB1_uc001ptu.1_RNA|PHLDB1_uc001ptv.1_Silent_p.R1097R|PHLDB1_uc001ptw.1_Silent_p.R637R|PHLDB1_uc009zai.1_Silent_p.R318R|PHLDB1_uc001ptx.1_Silent_p.R318R	NM_015157	NP_055972	Q86UU1	PHLB1_HUMAN	pleckstrin homology-like domain, family B,	1282	PH.										0	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0523)|all_hematologic(192;0.0735)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;3.4e-05)		TCTTCGACCGGCTCAAGCGCA	0.572													5	203	---	---	---	---	capture	Silent	SNP	118521224	118521224	PHLDB1	11	G	A	A	A	1	0	0	0	0	0	0	0	1	535	42	2	2	11754	234
VPS26B	112936	broad.mit.edu	37	11	134104939	134104939	+	Silent	SNP	G	T	T			TCGA-32-1991-01	TCGA-32-1991-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:134104939G>T	uc001qhe.2	+	2	828	c.372G>T	c.(370-372)GTG>GTT	p.V124V		NM_052875	NP_443107	Q4G0F5	VP26B_HUMAN	vacuolar protein sorting 26 homolog B	124					protein transport|vacuolar transport	cytosol|retromer complex					0	all_hematologic(175;0.127)	all_cancers(12;1.1e-21)|all_epithelial(12;3.77e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000182)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;2.43e-10)|all cancers(11;2.94e-09)|BRCA - Breast invasive adenocarcinoma(10;9.57e-09)|OV - Ovarian serous cystadenocarcinoma(99;0.00164)|Lung(977;0.216)		GGCAGAATGTGAAGCTACGGT	0.562													56	83	---	---	---	---	capture	Silent	SNP	134104939	134104939	VPS26B	11	G	T	T	T	1	0	0	0	0	0	0	0	1	574	45	4	4	17080	234
NANOG	79923	broad.mit.edu	37	12	7945568	7945568	+	Missense_Mutation	SNP	G	A	A			TCGA-32-1991-01	TCGA-32-1991-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:7945568G>A	uc009zfy.1	+	2	390	c.174G>A	c.(172-174)ATG>ATA	p.M58I		NM_024865	NP_079141	Q9H9S0	NANOG_HUMAN	Nanog homeobox	58					cell proliferation|embryo development|somatic stem cell maintenance	nucleolus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0				Kidney(36;0.0872)		CTTCCTCCATGGATCTGCTTA	0.388													181	282	---	---	---	---	capture	Missense_Mutation	SNP	7945568	7945568	NANOG	12	G	A	A	A	1	0	0	0	0	1	0	0	0	611	47	2	2	10059	234
KLRK1	22914	broad.mit.edu	37	12	10539553	10539553	+	Nonsense_Mutation	SNP	G	A	A			TCGA-32-1991-01	TCGA-32-1991-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:10539553G>A	uc009zhj.2	-	3	261	c.97C>T	c.(97-99)CGA>TGA	p.R33*	uc001qya.1_Intron|KLRK1_uc001qyb.2_RNA|KLRK1_uc001qyc.2_Nonsense_Mutation_p.R33*|KLRK1_uc009zhk.2_Nonsense_Mutation_p.R33*|KLRK1_uc001qyd.2_Nonsense_Mutation_p.R33*	NM_007360	NP_031386	P26718	NKG2D_HUMAN	NKG2-D type II integral membrane protein	33	Cytoplasmic (Potential).				natural killer cell activation|T cell costimulation	integral to plasma membrane	sugar binding				0						TTTTGCCATCGTGTTGAAAAA	0.343													5	111	---	---	---	---	capture	Nonsense_Mutation	SNP	10539553	10539553	KLRK1	12	G	A	A	A	1	0	0	0	0	0	1	0	0	519	40	5	1	8343	234
GRIN2B	2904	broad.mit.edu	37	12	13906747	13906747	+	Missense_Mutation	SNP	C	T	T			TCGA-32-1991-01	TCGA-32-1991-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:13906747C>T	uc001rbt.2	-	3	693	c.514G>A	c.(514-516)GTC>ATC	p.V172I		NM_000834	NP_000825	Q13224	NMDE2_HUMAN	N-methyl-D-aspartate receptor subunit 2B	172	Extracellular (Potential).				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	glycine binding|N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding			central_nervous_system(4)|ovary(3)|skin(3)|lung(2)	12					Felbamate(DB00949)|Haloperidol(DB00502)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)	TAGGTGGTGACGATAGAAAAG	0.463													73	147	---	---	---	---	capture	Missense_Mutation	SNP	13906747	13906747	GRIN2B	12	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	6713	234
ESPL1	9700	broad.mit.edu	37	12	53662559	53662559	+	Missense_Mutation	SNP	C	A	A			TCGA-32-1991-01	TCGA-32-1991-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:53662559C>A	uc001sck.2	+	2	100	c.9C>A	c.(7-9)AGC>AGA	p.S3R	ESPL1_uc001scj.2_5'UTR	NM_012291	NP_036423	Q14674	ESPL1_HUMAN	separase	3					apoptosis|cytokinesis|establishment of mitotic spindle localization|mitotic sister chromatid segregation|negative regulation of sister chromatid cohesion|positive regulation of mitotic metaphase/anaphase transition|proteolysis	centrosome|nucleus	cysteine-type peptidase activity|protein binding			lung(1)|kidney(1)|skin(1)	3						TCATGAGGAGCTTCAAAAGAG	0.527													3	52	---	---	---	---	capture	Missense_Mutation	SNP	53662559	53662559	ESPL1	12	C	A	A	A	1	0	0	0	0	1	0	0	0	363	28	4	4	5208	234
KIAA0564	23078	broad.mit.edu	37	13	42142433	42142433	+	Missense_Mutation	SNP	C	A	A			TCGA-32-1991-01	TCGA-32-1991-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:42142433C>A	uc001uyj.2	-	45	5688	c.5618G>T	c.(5617-5619)AGA>ATA	p.R1873I		NM_015058	NP_055873	A3KMH1	K0564_HUMAN	hypothetical protein LOC23078 isoform a	1873	VWFA.					extracellular region	ATP binding|ATPase activity			ovary(3)|upper_aerodigestive_tract(1)|kidney(1)|skin(1)	6		Lung NSC(96;4.61e-06)|Prostate(109;0.0167)|Lung SC(185;0.0262)|Breast(139;0.0854)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;0.000368)|GBM - Glioblastoma multiforme(144;0.0033)|BRCA - Breast invasive adenocarcinoma(63;0.0969)		TGGTAAAGTTCTCTGAAGCCT	0.502													3	104	---	---	---	---	capture	Missense_Mutation	SNP	42142433	42142433	KIAA0564	13	C	A	A	A	1	0	0	0	0	1	0	0	0	416	32	4	4	8107	234
C14orf49	161176	broad.mit.edu	37	14	95932331	95932331	+	Silent	SNP	G	A	A			TCGA-32-1991-01	TCGA-32-1991-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:95932331G>A	uc001yei.3	-	3	579	c.564C>T	c.(562-564)AGC>AGT	p.S188S	C14orf49_uc010avi.2_Silent_p.S188S|C14orf49_uc001yej.1_Silent_p.S188S	NM_152592	NP_689805	Q6ZMZ3	SYNE3_HUMAN	nesprin-3	188	Cytoplasmic (Potential).				cytoskeletal anchoring at nuclear membrane	integral to membrane|nuclear outer membrane|SUN-KASH complex	actin binding			central_nervous_system(1)	1		all_cancers(154;0.0937)		COAD - Colon adenocarcinoma(157;0.245)		CTTCGTCCACGCTGGGGTCCC	0.607													7	145	---	---	---	---	capture	Silent	SNP	95932331	95932331	C14orf49	14	G	A	A	A	1	0	0	0	0	0	0	0	1	490	38	1	1	1762	234
CHRFAM7A	89832	broad.mit.edu	37	15	30664456	30664456	+	Silent	SNP	C	T	T			TCGA-32-1991-01	TCGA-32-1991-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:30664456C>T	uc001zdt.1	-	7	983	c.417G>A	c.(415-417)AGG>AGA	p.R139R	DKFZP434L187_uc001zds.2_Intron|CHRFAM7A_uc001zdu.1_Silent_p.R48R|CHRFAM7A_uc010azn.2_Silent_p.R48R	NM_139320	NP_647536	Q494W8	CRFM7_HUMAN	CHRNA7-FAM7A fusion isoform 1	139						integral to membrane|postsynaptic membrane	extracellular ligand-gated ion channel activity			skin(1)	1		all_lung(180;3.42e-11)|Breast(32;0.000153)		all cancers(64;1.9e-15)|Epithelial(43;3.59e-12)|GBM - Glioblastoma multiforme(186;9e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00177)|Lung(196;0.153)		AGTAGAGCGTCCTGCGGCGCA	0.572													62	99	---	---	---	---	capture	Silent	SNP	30664456	30664456	CHRFAM7A	15	C	T	T	T	1	0	0	0	0	0	0	0	1	389	30	2	2	3340	234
RYR3	6263	broad.mit.edu	37	15	33952594	33952594	+	Missense_Mutation	SNP	T	A	A			TCGA-32-1991-01	TCGA-32-1991-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:33952594T>A	uc001zhi.2	+	34	4662	c.4592T>A	c.(4591-4593)ATG>AAG	p.M1531K	RYR3_uc010bar.2_Missense_Mutation_p.M1531K	NM_001036	NP_001027	Q15413	RYR3_HUMAN	ryanodine receptor 3	1531	4 X approximate repeats.|Cytoplasmic (By similarity).				cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(5)|central_nervous_system(4)|lung(1)	10		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		CCCCTGCAGATGATGGCGCTC	0.672													9	9	---	---	---	---	capture	Missense_Mutation	SNP	33952594	33952594	RYR3	15	T	A	A	A	1	0	0	0	0	1	0	0	0	663	51	4	4	13662	234
WDR72	256764	broad.mit.edu	37	15	53998128	53998128	+	Silent	SNP	A	G	G			TCGA-32-1991-01	TCGA-32-1991-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:53998128A>G	uc002acj.2	-	10	1140	c.1098T>C	c.(1096-1098)CCT>CCC	p.P366P	WDR72_uc010bfi.1_Silent_p.P366P	NM_182758	NP_877435	Q3MJ13	WDR72_HUMAN	WD repeat domain 72	366										lung(1)|skin(1)	2				all cancers(107;0.0511)		ACTTACCTCTAGGAGAACCAT	0.383													63	110	---	---	---	---	capture	Silent	SNP	53998128	53998128	WDR72	15	A	G	G	G	1	0	0	0	0	0	0	0	1	184	15	3	3	17203	234
PCSK6	5046	broad.mit.edu	37	15	101972225	101972225	+	Silent	SNP	G	A	A	rs117473739	by1000genomes	TCGA-32-1991-01	TCGA-32-1991-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:101972225G>A	uc002bwy.2	-	4	797	c.483C>T	c.(481-483)AAC>AAT	p.N161N	PCSK6_uc010bpd.2_Silent_p.N31N|PCSK6_uc010bpe.2_Silent_p.N161N|PCSK6_uc002bxa.2_Silent_p.N161N|PCSK6_uc002bxb.2_Silent_p.N161N|PCSK6_uc002bxc.1_Silent_p.N161N|PCSK6_uc002bxd.1_Silent_p.N161N|PCSK6_uc002bxe.2_Silent_p.N161N|PCSK6_uc002bxg.1_Silent_p.N161N	NM_002570	NP_002561	P29122	PCSK6_HUMAN	paired basic amino acid cleaving system 4	161	Catalytic.				glycoprotein metabolic process|nerve growth factor processing|nerve growth factor production|nerve growth factor receptor signaling pathway|regulation of BMP signaling pathway|secretion by cell	cell surface|endomembrane system|endoplasmic reticulum|extracellular matrix|extracellular space|Golgi lumen|membrane|soluble fraction	eukaryotic cell surface binding|heparin binding|nerve growth factor binding|serine-type endopeptidase activity			pancreas(2)	2	Lung NSC(78;0.00102)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.000803)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			AAATGGGGTCGTTGAAGTAAA	0.512													15	35	---	---	---	---	capture	Silent	SNP	101972225	101972225	PCSK6	15	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	11507	234
TSC2	7249	broad.mit.edu	37	16	2134267	2134267	+	Missense_Mutation	SNP	C	A	A	rs137854084		TCGA-32-1991-01	TCGA-32-1991-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:2134267C>A	uc002con.2	+	34	4150	c.4044C>A	c.(4042-4044)CAC>CAA	p.H1348Q	TSC2_uc010bsd.2_Missense_Mutation_p.H1325Q|TSC2_uc002coo.2_Missense_Mutation_p.H1281Q|TSC2_uc010uvv.1_Missense_Mutation_p.H1245Q|TSC2_uc010uvw.1_Missense_Mutation_p.H1233Q|TSC2_uc002cop.2_Missense_Mutation_p.H1104Q|TSC2_uc002coq.2_Missense_Mutation_p.H123Q|TSC2_uc002cor.2_Missense_Mutation_p.H49Q	NM_000548	NP_000539	P49815	TSC2_HUMAN	tuberous sclerosis 2 isoform 1	1348					cell cycle arrest|endocytosis|heart development|insulin receptor signaling pathway|insulin-like growth factor receptor signaling pathway|negative regulation of cell size|negative regulation of phosphatidylinositol 3-kinase cascade|negative regulation of protein kinase B signaling cascade|negative regulation of TOR signaling cascade|negative regulation of Wnt receptor signaling pathway|nerve growth factor receptor signaling pathway|neural tube closure|phosphatidylinositol-mediated signaling|positive chemotaxis|protein import into nucleus|protein kinase B signaling cascade|regulation of endocytosis|regulation of insulin receptor signaling pathway|regulation of small GTPase mediated signal transduction	Golgi apparatus|nucleus|perinuclear region of cytoplasm|TSC1-TSC2 complex	GTPase activator activity|protein homodimerization activity			central_nervous_system(4)|lung(3)|ovary(2)|pancreas(1)	10		Hepatocellular(780;0.0202)				AGTCGCTCCACGCGGAGGAGC	0.657			D|Mis|N|F|S			hamartoma|renal cell			Tuberous_Sclerosis				3	30	---	---	---	---	capture	Missense_Mutation	SNP	2134267	2134267	TSC2	16	C	A	A	A	1	0	0	0	0	1	0	0	0	246	19	4	4	16489	234
CHD9	80205	broad.mit.edu	37	16	53190198	53190198	+	Missense_Mutation	SNP	C	A	A			TCGA-32-1991-01	TCGA-32-1991-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:53190198C>A	uc002ehb.2	+	1	361	c.197C>A	c.(196-198)ACT>AAT	p.T66N	CHD9_uc002egy.2_Missense_Mutation_p.T66N|CHD9_uc002egz.1_Missense_Mutation_p.T66N|CHD9_uc002eha.1_Missense_Mutation_p.T66N|CHD9_uc002ehc.2_Missense_Mutation_p.T66N	NM_025134	NP_079410	Q3L8U1	CHD9_HUMAN	chromodomain helicase DNA binding protein 9	66					cellular lipid metabolic process|chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleoplasm	ATP binding|DNA binding|helicase activity|protein binding			lung(2)|central_nervous_system(1)|breast(1)|skin(1)|ovary(1)|kidney(1)	7		all_cancers(37;0.0212)				CAGAAGATGACTGATTTTGAA	0.363													3	104	---	---	---	---	capture	Missense_Mutation	SNP	53190198	53190198	CHD9	16	C	A	A	A	1	0	0	0	0	1	0	0	0	260	20	4	4	3298	234
SLC38A7	55238	broad.mit.edu	37	16	58705012	58705012	+	Missense_Mutation	SNP	C	G	G			TCGA-32-1991-01	TCGA-32-1991-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:58705012C>G	uc002eod.1	-	10	1561	c.1168G>C	c.(1168-1170)GAC>CAC	p.D390H	SLC38A7_uc002eob.1_RNA|SLC38A7_uc002eoc.1_Intron|SLC38A7_uc010vil.1_Missense_Mutation_p.D301H	NM_018231	NP_060701	Q9NVC3	S38A7_HUMAN	solute carrier family 38, member 7	390	Helical; (Potential).				amino acid transport|sodium ion transport	integral to membrane				ovary(1)	1						TTGCCGATGTCAGGGATGAAG	0.667													2	44	---	---	---	---	capture	Missense_Mutation	SNP	58705012	58705012	SLC38A7	16	C	G	G	G	1	0	0	0	0	1	0	0	0	377	29	4	4	14501	234
B3GNT9	84752	broad.mit.edu	37	16	67183810	67183810	+	Silent	SNP	C	A	A			TCGA-32-1991-01	TCGA-32-1991-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:67183810C>A	uc002erf.2	-	2	900	c.579G>T	c.(577-579)CTG>CTT	p.L193L	uc002erg.1_Missense_Mutation_p.S71R	NM_033309	NP_171608	Q6UX72	B3GN9_HUMAN	UDP-GlcNAc:betaGal	193	Lumenal (Potential).				protein glycosylation	Golgi membrane|integral to membrane	galactosyltransferase activity				0						AGGCCCAGAGCAGGATGTCCG	0.642													3	27	---	---	---	---	capture	Silent	SNP	67183810	67183810	B3GNT9	16	C	A	A	A	1	0	0	0	0	0	0	0	1	314	25	4	4	1253	234
B3GNT9	84752	broad.mit.edu	37	16	67184087	67184087	+	Missense_Mutation	SNP	T	G	G			TCGA-32-1991-01	TCGA-32-1991-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:67184087T>G	uc002erf.2	-	2	623	c.302A>C	c.(301-303)AAC>ACC	p.N101T	uc002erg.1_Missense_Mutation_p.L164V	NM_033309	NP_171608	Q6UX72	B3GN9_HUMAN	UDP-GlcNAc:betaGal	101	Lumenal (Potential).				protein glycosylation	Golgi membrane|integral to membrane	galactosyltransferase activity				0						GTGCGGCTGGTTAATGAGCAG	0.672													4	1	---	---	---	---	capture	Missense_Mutation	SNP	67184087	67184087	B3GNT9	16	T	G	G	G	1	0	0	0	0	1	0	0	0	780	60	4	4	1253	234
RICH2	9912	broad.mit.edu	37	17	12887884	12887884	+	Missense_Mutation	SNP	C	A	A			TCGA-32-1991-01	TCGA-32-1991-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:12887884C>A	uc002gnr.3	+	20	2303	c.1976C>A	c.(1975-1977)CCC>CAC	p.P659H	RICH2_uc010vvk.1_Missense_Mutation_p.P659H|RICH2_uc010vvl.1_Missense_Mutation_p.P653H|RICH2_uc002gns.3_Missense_Mutation_p.P453H|RICH2_uc010vvm.1_Missense_Mutation_p.P653H|RICH2_uc010vvn.1_RNA	NM_014859	NP_055674	Q17R89	RHG44_HUMAN	Rho GTPase-activating protein RICH2	659					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity				0						CCCAAGGTCCCCTTTGGCCAG	0.582													35	53	---	---	---	---	capture	Missense_Mutation	SNP	12887884	12887884	RICH2	17	C	A	A	A	1	0	0	0	0	1	0	0	0	286	22	4	4	13249	234
NEUROD2	4761	broad.mit.edu	37	17	37762281	37762281	+	Missense_Mutation	SNP	G	A	A			TCGA-32-1991-01	TCGA-32-1991-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:37762281G>A	uc002hry.2	-	2	772	c.572C>T	c.(571-573)ACT>ATT	p.T191I		NM_006160	NP_006151	Q15784	NDF2_HUMAN	neurogenic differentiation 2	191					cellular response to calcium ion|cellular response to electrical stimulus|cerebellar cortex development|negative regulation of synapse maturation|positive regulation of calcium-mediated signaling|positive regulation of neuron differentiation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of synapse maturation|positive regulation of synaptic plasticity|protein ubiquitination|regulation of transcription from RNA polymerase II promoter	nucleus	E-box binding|protein heterodimerization activity|sequence-specific DNA binding transcription factor activity|transcription corepressor activity				0	Lung NSC(9;1.15e-09)|all_lung(9;6.24e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)		UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Lung(15;0.00549)|LUAD - Lung adenocarcinoma(14;0.0664)			CTTGCACAGAGTCTGCACGTA	0.622													37	37	---	---	---	---	capture	Missense_Mutation	SNP	37762281	37762281	NEUROD2	17	G	A	A	A	1	0	0	0	0	1	0	0	0	468	36	2	2	10256	234
ZNF516	9658	broad.mit.edu	37	18	74090999	74090999	+	Missense_Mutation	SNP	G	A	A			TCGA-32-1991-01	TCGA-32-1991-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:74090999G>A	uc010dqx.1	-	3	3306	c.3071C>T	c.(3070-3072)GCG>GTG	p.A1024V	ZNF516_uc002lme.2_RNA|ZNF516_uc002lmd.2_RNA	NM_014643	NP_055458	Q92618	ZN516_HUMAN	zinc finger protein 516	1024					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Prostate(75;0.0869)|Esophageal squamous(42;0.129)		OV - Ovarian serous cystadenocarcinoma(15;7.64e-06)|BRCA - Breast invasive adenocarcinoma(31;0.238)		CTGCAAGGCCGCGTCGCCCCT	0.721													36	24	---	---	---	---	capture	Missense_Mutation	SNP	74090999	74090999	ZNF516	18	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	17839	234
EVI5L	115704	broad.mit.edu	37	19	7928493	7928493	+	Missense_Mutation	SNP	C	A	A			TCGA-32-1991-01	TCGA-32-1991-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:7928493C>A	uc002min.2	+	19	2444	c.2290C>A	c.(2290-2292)CGC>AGC	p.R764S	EVI5L_uc010xjz.1_Missense_Mutation_p.R775S	NM_145245	NP_660288	Q96CN4	EVI5L_HUMAN	ecotropic viral integration site 5-like isoform	764						intracellular	protein binding|Rab GTPase activator activity			ovary(1)	1						GCGCTTCTTCCGCCGTCTGGA	0.687													2	6	---	---	---	---	capture	Missense_Mutation	SNP	7928493	7928493	EVI5L	19	C	A	A	A	1	0	0	0	0	1	0	0	0	299	23	4	4	5245	234
CILP2	148113	broad.mit.edu	37	19	19654993	19654993	+	Missense_Mutation	SNP	G	A	A			TCGA-32-1991-01	TCGA-32-1991-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:19654993G>A	uc002nmv.3	+	8	1724	c.1639G>A	c.(1639-1641)GTG>ATG	p.V547M	CILP2_uc002nmw.3_Missense_Mutation_p.V553M	NM_153221	NP_694953	Q8IUL8	CILP2_HUMAN	cartilage intermediate layer protein 2	547						proteinaceous extracellular matrix	carbohydrate binding|carboxypeptidase activity			ovary(1)	1						AGGTGCCGGCGTGTACCACGA	0.622													101	130	---	---	---	---	capture	Missense_Mutation	SNP	19654993	19654993	CILP2	19	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	3395	234
PSG3	5671	broad.mit.edu	37	19	43233959	43233959	+	Missense_Mutation	SNP	C	T	T			TCGA-32-1991-01	TCGA-32-1991-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:43233959C>T	uc002oue.2	-	4	1091	c.959G>A	c.(958-960)CGC>CAC	p.R320H	PSG3_uc002ouf.2_RNA|PSG1_uc002oug.1_Intron|PSG3_uc010eil.2_Missense_Mutation_p.R342H	NM_021016	NP_066296	Q16557	PSG3_HUMAN	pregnancy specific beta-1-glycoprotein 3	320	Ig-like C2-type 2.				defense response|female pregnancy	extracellular region				ovary(1)|skin(1)	2		Prostate(69;0.00682)				TGGGTAACTGCGGATGCCACC	0.493													104	190	---	---	---	---	capture	Missense_Mutation	SNP	43233959	43233959	PSG3	19	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	12551	234
RUVBL2	10856	broad.mit.edu	37	19	49510608	49510608	+	Nonsense_Mutation	SNP	C	T	T			TCGA-32-1991-01	TCGA-32-1991-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:49510608C>T	uc002plr.1	+	6	458	c.445C>T	c.(445-447)CGA>TGA	p.R149*	RUVBL2_uc002plq.1_Nonsense_Mutation_p.R104*|RUVBL2_uc010yab.1_Nonsense_Mutation_p.R149*|RUVBL2_uc002pls.1_RNA|RUVBL2_uc010emn.1_Nonsense_Mutation_p.R104*|RUVBL2_uc010yac.1_Nonsense_Mutation_p.R104*	NM_006666	NP_006657	Q9Y230	RUVB2_HUMAN	RuvB-like 2	149					cellular response to UV|DNA recombination|DNA repair|histone H2A acetylation|histone H4 acetylation|protein folding|regulation of growth|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|Ino80 complex|membrane|MLL1 complex|NuA4 histone acetyltransferase complex|nuclear matrix	ATP binding|ATP-dependent DNA helicase activity|damaged DNA binding|identical protein binding|unfolded protein binding				0		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		all cancers(93;0.000449)|OV - Ovarian serous cystadenocarcinoma(262;0.000555)|GBM - Glioblastoma multiforme(486;0.00585)|Epithelial(262;0.047)		CCAGATTGATCGACCAGCAAC	0.587													59	82	---	---	---	---	capture	Nonsense_Mutation	SNP	49510608	49510608	RUVBL2	19	C	T	T	T	1	0	0	0	0	0	1	0	0	399	31	5	1	13645	234
LHB	3972	broad.mit.edu	37	19	49519328	49519328	+	Silent	SNP	G	T	T			TCGA-32-1991-01	TCGA-32-1991-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:49519328G>T	uc002plt.2	-	3	432	c.423C>A	c.(421-423)CTC>CTA	p.L141L		NM_000894	NP_000885	P01229	LSHB_HUMAN	luteinizing hormone beta subunit precursor	141					cell-cell signaling|cellular nitrogen compound metabolic process|male gonad development|peptide hormone processing|progesterone biosynthetic process|signal transduction	extracellular region|soluble fraction	hormone activity				0		all_epithelial(76;9.62e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		all cancers(93;0.000371)|OV - Ovarian serous cystadenocarcinoma(262;0.000503)|GBM - Glioblastoma multiforme(486;0.00518)|Epithelial(262;0.0427)	Lutropin alfa(DB00044)|Menotropins(DB00032)	AGGGTCTTTAGAGGAAGAGGA	0.622													4	159	---	---	---	---	capture	Silent	SNP	49519328	49519328	LHB	19	G	T	T	T	1	0	0	0	0	0	0	0	1	418	33	4	4	8681	234
AP2A1	160	broad.mit.edu	37	19	50270423	50270423	+	Silent	SNP	G	A	A			TCGA-32-1991-01	TCGA-32-1991-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:50270423G>A	uc002ppn.2	+	1	244	c.33G>A	c.(31-33)CGG>CGA	p.R11R	AP2A1_uc010enj.1_RNA|AP2A1_uc002ppo.2_Silent_p.R11R	NM_014203	NP_055018	O95782	AP2A1_HUMAN	adaptor-related protein complex 2, alpha 1	11					axon guidance|endocytosis|epidermal growth factor receptor signaling pathway|Golgi to endosome transport|intracellular protein transport|negative regulation of epidermal growth factor receptor signaling pathway|nerve growth factor receptor signaling pathway|regulation of defense response to virus by virus|synaptic transmission|viral reproduction	AP-2 adaptor complex|clathrin coat of trans-Golgi network vesicle|cytosol	protein binding|protein transporter activity			ovary(2)	2		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.0023)|GBM - Glioblastoma multiforme(134;0.0157)		ATGGGATGCGGGGGCTCGCGG	0.706													3	99	---	---	---	---	capture	Silent	SNP	50270423	50270423	AP2A1	19	G	A	A	A	1	0	0	0	0	0	0	0	1	548	43	2	2	732	234
CEACAM18	729767	broad.mit.edu	37	19	51981792	51981792	+	Missense_Mutation	SNP	C	G	G	rs140323408	by1000genomes	TCGA-32-1991-01	TCGA-32-1991-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:51981792C>G	uc002pwv.1	+	2	79	c.79C>G	c.(79-81)CGA>GGA	p.R27G		NM_001080405	NP_001073874	A8MTB9	CEA18_HUMAN	carcinoembryonic antigen-related cell adhesion	27						integral to membrane		p.R27*(1)		skin(1)	1		all_neural(266;0.0529)		GBM - Glioblastoma multiforme(134;0.00148)|OV - Ovarian serous cystadenocarcinoma(262;0.00979)		GGCTGGGAGACGAGACCGGCA	0.647													8	11	---	---	---	---	capture	Missense_Mutation	SNP	51981792	51981792	CEACAM18	19	C	G	G	G	1	0	0	0	0	1	0	0	0	243	19	4	4	3158	234
PRKCG	5582	broad.mit.edu	37	19	54395012	54395012	+	Missense_Mutation	SNP	G	A	A			TCGA-32-1991-01	TCGA-32-1991-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:54395012G>A	uc002qcq.1	+	6	896	c.614G>A	c.(613-615)CGG>CAG	p.R205Q	PRKCG_uc010eqz.1_Missense_Mutation_p.R205Q|PRKCG_uc010yef.1_Missense_Mutation_p.R205Q|PRKCG_uc010yeg.1_Missense_Mutation_p.R205Q|PRKCG_uc010yeh.1_Missense_Mutation_p.R92Q	NM_002739	NP_002730	P05129	KPCG_HUMAN	protein kinase C, gamma	205	C2.				activation of phospholipase C activity|cell death|intracellular signal transduction|negative regulation of protein catabolic process|negative regulation of protein ubiquitination|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of mismatch repair|synaptic transmission	cytosol	ATP binding|protein kinase C activity|zinc ion binding			lung(4)|ovary(2)|pancreas(2)|large_intestine(1)	9	all_cancers(19;0.0462)|all_epithelial(19;0.0258)|all_lung(19;0.185)|Ovarian(34;0.19)|Lung NSC(19;0.218)			GBM - Glioblastoma multiforme(134;0.0521)		CCAGACCCTCGGAACCTGACG	0.532													38	203	---	---	---	---	capture	Missense_Mutation	SNP	54395012	54395012	PRKCG	19	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	12408	234
NLRP2	55655	broad.mit.edu	37	19	55494705	55494705	+	Missense_Mutation	SNP	A	T	T			TCGA-32-1991-01	TCGA-32-1991-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:55494705A>T	uc002qij.2	+	6	1725	c.1639A>T	c.(1639-1641)AAC>TAC	p.N547Y	NLRP2_uc010yfp.1_Missense_Mutation_p.N524Y|NLRP2_uc010esn.2_Missense_Mutation_p.N523Y|NLRP2_uc010eso.2_Missense_Mutation_p.N544Y|NLRP2_uc010esp.2_Missense_Mutation_p.N525Y	NM_017852	NP_060322	Q9NX02	NALP2_HUMAN	NLR family, pyrin domain containing 2	547					apoptosis|positive regulation of caspase activity|positive regulation of interleukin-1 beta secretion	cytoplasm	ATP binding|Pyrin domain binding			ovary(1)|skin(1)	2			BRCA - Breast invasive adenocarcinoma(297;0.163)	GBM - Glioblastoma multiforme(193;0.028)		AAGACTCAGGAACCCCGACCT	0.567													60	113	---	---	---	---	capture	Missense_Mutation	SNP	55494705	55494705	NLRP2	19	A	T	T	T	1	0	0	0	0	1	0	0	0	117	9	4	4	10384	234
KCNK3	3777	broad.mit.edu	37	2	26950700	26950700	+	Missense_Mutation	SNP	G	A	A			TCGA-32-1991-01	TCGA-32-1991-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:26950700G>A	uc002rhn.2	+	2	612	c.449G>A	c.(448-450)CGG>CAG	p.R150Q		NM_002246	NP_002237	O14649	KCNK3_HUMAN	potassium channel, subfamily K, member 3	150	Cytoplasmic (Potential).				synaptic transmission	integral to plasma membrane				ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CTGGGCATGCGGCGCGCCGAC	0.652													50	99	---	---	---	---	capture	Missense_Mutation	SNP	26950700	26950700	KCNK3	2	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	7989	234
THADA	63892	broad.mit.edu	37	2	43458375	43458375	+	Silent	SNP	G	A	A			TCGA-32-1991-01	TCGA-32-1991-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:43458375G>A	uc002rsw.3	-	38	5926	c.5574C>T	c.(5572-5574)TCC>TCT	p.S1858S	THADA_uc010far.2_Silent_p.S1053S|THADA_uc002rsx.3_Silent_p.S1858S|THADA_uc002rsy.3_RNA	NM_001083953	NP_001077422	Q6YHU6	THADA_HUMAN	thyroid adenoma associated	1858							binding			ovary(2)|skin(1)	3		Acute lymphoblastic leukemia(82;0.00361)|all_hematologic(82;0.00837)				GACGCCAGCCGGACTTTGAGA	0.517													3	113	---	---	---	---	capture	Silent	SNP	43458375	43458375	THADA	2	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	15725	234
CNTNAP5	129684	broad.mit.edu	37	2	125555882	125555882	+	Missense_Mutation	SNP	C	A	A			TCGA-32-1991-01	TCGA-32-1991-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:125555882C>A	uc002tno.2	+	19	3563	c.3199C>A	c.(3199-3201)CTG>ATG	p.L1067M	CNTNAP5_uc010flu.2_Missense_Mutation_p.L1068M	NM_130773	NP_570129	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5 precursor	1067	Extracellular (Potential).|Laminin G-like 4.				cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(10)	10				BRCA - Breast invasive adenocarcinoma(221;0.248)		CGTGGTTGTTCTGCTCTGCAA	0.498													8	93	---	---	---	---	capture	Missense_Mutation	SNP	125555882	125555882	CNTNAP5	2	C	A	A	A	1	0	0	0	0	1	0	0	0	415	32	4	4	3615	234
UBR3	130507	broad.mit.edu	37	2	170850840	170850840	+	Silent	SNP	G	A	A			TCGA-32-1991-01	TCGA-32-1991-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:170850840G>A	uc010zdi.1	+	26	3792	c.3792G>A	c.(3790-3792)GGG>GGA	p.G1264G	UBR3_uc002ufr.3_RNA|UBR3_uc010fqa.2_Silent_p.G85G|UBR3_uc002uft.3_Silent_p.G117G	NM_172070	NP_742067	Q6ZT12	UBR3_HUMAN	E3 ubiquitin-protein ligase UBR3	1264					sensory perception of smell|suckling behavior|ubiquitin-dependent protein catabolic process	integral to membrane	ubiquitin-protein ligase activity|zinc ion binding				0						TAGTTTTGGGGCAGTGCCGTG	0.418													70	120	---	---	---	---	capture	Silent	SNP	170850840	170850840	UBR3	2	G	A	A	A	1	0	0	0	0	0	0	0	1	535	42	2	2	16785	234
FAM126B	285172	broad.mit.edu	37	2	201853144	201853144	+	Missense_Mutation	SNP	C	G	G			TCGA-32-1991-01	TCGA-32-1991-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:201853144C>G	uc002uws.3	-	11	1020	c.832G>C	c.(832-834)GTT>CTT	p.V278L	FAM126B_uc002uwu.2_Missense_Mutation_p.V196L|FAM126B_uc002uwv.2_Missense_Mutation_p.V278L	NM_173822	NP_776183	Q8IXS8	F126B_HUMAN	hypothetical protein LOC285172	278						intracellular				ovary(1)	1						GCATTGGCAACCTACAATGAT	0.338													3	194	---	---	---	---	capture	Missense_Mutation	SNP	201853144	201853144	FAM126B	2	C	G	G	G	1	0	0	0	0	1	0	0	0	234	18	4	4	5384	234
PLEKHM3	389072	broad.mit.edu	37	2	208841553	208841553	+	Silent	SNP	A	G	G			TCGA-32-1991-01	TCGA-32-1991-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:208841553A>G	uc002vcl.2	-	3	1858	c.1368T>C	c.(1366-1368)AAT>AAC	p.N456N	PLEKHM3_uc002vcm.2_Silent_p.N456N	NM_001080475	NP_001073944	Q6ZWE6	PKHM3_HUMAN	pleckstrin homology domain containing, family M,	456	PH 2.				intracellular signal transduction		metal ion binding			ovary(1)	1						TCCTCGCCACATTGGCAGCTA	0.522													45	61	---	---	---	---	capture	Silent	SNP	208841553	208841553	PLEKHM3	2	A	G	G	G	1	0	0	0	0	0	0	0	1	102	8	3	3	11985	234
CEBPB	1051	broad.mit.edu	37	20	48807614	48807614	+	Missense_Mutation	SNP	C	T	T			TCGA-32-1991-01	TCGA-32-1991-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:48807614C>T	uc002xvi.1	+	1	239	c.44C>T	c.(43-45)CCG>CTG	p.P15L	CEBPB_uc002xvh.2_RNA	NM_005194	NP_005185	P17676	CEBPB_HUMAN	CCAAT/enhancer binding protein beta	15	Required for Lys-174 sumoylation.				acute-phase response|immune response		sequence-specific enhancer binding RNA polymerase II transcription factor activity				0			BRCA - Breast invasive adenocarcinoma(9;5.72e-08)|STAD - Stomach adenocarcinoma(23;0.19)			CTCCCCCTGCCGCCGCCGCCG	0.647													2	15	---	---	---	---	capture	Missense_Mutation	SNP	48807614	48807614	CEBPB	20	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	3168	234
HIRA	7290	broad.mit.edu	37	22	19365576	19365576	+	Missense_Mutation	SNP	C	T	T			TCGA-32-1991-01	TCGA-32-1991-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:19365576C>T	uc002zpf.1	-	14	1649	c.1429G>A	c.(1429-1431)GCA>ACA	p.A477T	HIRA_uc011agx.1_Missense_Mutation_p.A343T|HIRA_uc010grn.1_Missense_Mutation_p.A477T|HIRA_uc010gro.1_Missense_Mutation_p.A433T|HIRA_uc010grp.2_RNA	NM_003325	NP_003316	P54198	HIRA_HUMAN	HIR histone cell cycle regulation defective	477	Interaction with CCNA1.|Interaction with ASF1A.				chromatin modification|regulation of transcription from RNA polymerase II promoter	PML body	chromatin binding|protein binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity			ovary(1)	1	Colorectal(54;0.0993)					TTAAAGAATGCCGTGGAGAAG	0.468													6	351	---	---	---	---	capture	Missense_Mutation	SNP	19365576	19365576	HIRA	22	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	7045	234
TRIOBP	11078	broad.mit.edu	37	22	38119801	38119801	+	Missense_Mutation	SNP	A	G	G	rs71317064		TCGA-32-1991-01	TCGA-32-1991-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:38119801A>G	uc003atr.2	+	7	1509	c.1238A>G	c.(1237-1239)AAA>AGA	p.K413R	TRIOBP_uc003atu.2_Missense_Mutation_p.K241R|TRIOBP_uc003atq.1_Missense_Mutation_p.K413R|TRIOBP_uc003ats.1_Missense_Mutation_p.K241R	NM_001039141	NP_001034230	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein isoform 6	413					actin modification|barbed-end actin filament capping	actin cytoskeleton|cytoplasm|nucleus	actin binding|GTP-Rho binding|myosin II binding|protein binding|ubiquitin protein ligase binding			central_nervous_system(1)	1	Melanoma(58;0.0574)					GACAATCCCAAAGCCTCCAGA	0.582													4	168	---	---	---	---	capture	Missense_Mutation	SNP	38119801	38119801	TRIOBP	22	A	G	G	G	1	0	0	0	0	1	0	0	0	13	1	3	3	16436	234
C3orf32	51066	broad.mit.edu	37	3	8661576	8661576	+	Missense_Mutation	SNP	C	A	A			TCGA-32-1991-01	TCGA-32-1991-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:8661576C>A	uc003bqu.2	-	12	1286	c.1040G>T	c.(1039-1041)TGC>TTC	p.C347F	C3orf32_uc003bqz.2_Missense_Mutation_p.C347F|C3orf32_uc003bqs.1_RNA|C3orf32_uc003bqt.2_Missense_Mutation_p.C296F|C3orf32_uc011atg.1_Missense_Mutation_p.C369F|C3orf32_uc003bqv.2_Missense_Mutation_p.C296F|C3orf32_uc003bqw.2_RNA|C3orf32_uc003bqx.2_RNA|C3orf32_uc003bqy.2_Missense_Mutation_p.C347F	NM_015931	NP_057015	Q9Y2M2	CC032_HUMAN	hypothetical protein LOC51066	347										skin(1)	1						ACAGCCACAGCAATACCGCTC	0.507													3	97	---	---	---	---	capture	Missense_Mutation	SNP	8661576	8661576	C3orf32	3	C	A	A	A	1	0	0	0	0	1	0	0	0	325	25	4	4	2202	234
CCBP2	1238	broad.mit.edu	37	3	42905968	42905968	+	Translation_Start_Site	SNP	C	T	T			TCGA-32-1991-01	TCGA-32-1991-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:42905968C>T	uc003cme.2	+	3	153	c.-26C>T	c.(-28--24)GACGT>GATGT		CCBP2_uc003cmd.1_Translation_Start_Site|CCBP2_uc003cmf.2_Translation_Start_Site|CCBP2_uc003cmg.2_Intron|CYP8B1_uc010hif.2_Intron	NM_001296	NP_001287	O00590	CCBP2_HUMAN	chemokine binding protein 2						chemotaxis|immune response|multicellular organismal development	integral to plasma membrane	C-X-C chemokine receptor activity			lung(4)|skin(1)	5				KIRC - Kidney renal clear cell carcinoma(284;0.241)		CACTACAGGACGTCGGGACTG	0.527													42	18	---	---	---	---	capture	Translation_Start_Site	SNP	42905968	42905968	CCBP2	3	C	T	T	T	1	0	0	0	0	0	0	0	0	235	19	1	1	2708	234
PCNP	57092	broad.mit.edu	37	3	101304326	101304326	+	Missense_Mutation	SNP	G	A	A			TCGA-32-1991-01	TCGA-32-1991-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:101304326G>A	uc003dva.2	+	3	343	c.325G>A	c.(325-327)GTA>ATA	p.V109I	PCNP_uc003dvb.2_RNA|PCNP_uc003dvc.2_RNA|PCNP_uc003dvd.2_Missense_Mutation_p.V109I	NM_020357	NP_065090	Q8WW12	PCNP_HUMAN	PEST proteolytic signal containing nuclear	109					cell cycle|proteasomal ubiquitin-dependent protein catabolic process|protein ubiquitination	nucleus	protein binding				0						AACTCTTTCAGTAGCAGCAGC	0.299													3	204	---	---	---	---	capture	Missense_Mutation	SNP	101304326	101304326	PCNP	3	G	A	A	A	1	0	0	0	0	1	0	0	0	468	36	2	2	11492	234
ALG1L2	644974	broad.mit.edu	37	3	129811972	129811972	+	Missense_Mutation	SNP	G	C	C			TCGA-32-1991-01	TCGA-32-1991-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:129811972G>C	uc011bld.1	+	4	468	c.282G>C	c.(280-282)CAG>CAC	p.Q94H	ALG1L2_uc010hth.2_RNA	NM_001136152	NP_001129624	C9J202	AG1L2_HUMAN	asparagine-linked glycosylation 1-like 2	94					biosynthetic process		transferase activity, transferring glycosyl groups				0						TTGACGGACAGAACCTTCCTT	0.383													5	164	---	---	---	---	capture	Missense_Mutation	SNP	129811972	129811972	ALG1L2	3	G	C	C	C	1	0	0	0	0	1	0	0	0	425	33	4	4	518	234
DNAJC19	131118	broad.mit.edu	37	3	180702463	180702463	+	Missense_Mutation	SNP	C	T	T			TCGA-32-1991-01	TCGA-32-1991-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:180702463C>T	uc003fkt.2	-	6	456	c.316G>A	c.(316-318)GCT>ACT	p.A106T	DNAJC19_uc003fku.2_RNA	NM_145261	NP_660304	Q96DA6	TIM14_HUMAN	DnaJ homolog, subfamily C, member 19	106	J.|Mitochondrial matrix (Potential).				genitalia development|protein folding|protein targeting to mitochondrion|transmembrane transport|visual perception	integral to membrane|mitochondrial inner membrane	heat shock protein binding				0	all_cancers(143;3.12e-14)|Ovarian(172;0.0212)		Epithelial(37;3.05e-36)|OV - Ovarian serous cystadenocarcinoma(80;1.55e-22)			AAATCTTTAGCTTCATTGATT	0.284													2	21	---	---	---	---	capture	Missense_Mutation	SNP	180702463	180702463	DNAJC19	3	C	T	T	T	1	0	0	0	0	1	0	0	0	364	28	2	2	4594	234
DRD5	1816	broad.mit.edu	37	4	9784083	9784083	+	Missense_Mutation	SNP	A	T	T			TCGA-32-1991-01	TCGA-32-1991-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:9784083A>T	uc003gmb.3	+	1	826	c.430A>T	c.(430-432)AGG>TGG	p.R144W		NM_000798	NP_000789	P21918	DRD5_HUMAN	dopamine receptor D5	144	Cytoplasmic (Potential).				activation of adenylate cyclase activity by dopamine receptor signaling pathway|activation of phospholipase C activity by dopamine receptor signaling pathway|cellular calcium ion homeostasis|negative regulation of NAD(P)H oxidase activity|reactive oxygen species metabolic process|synaptic transmission, dopaminergic	integral to plasma membrane				skin(1)	1					Apomorphine(DB00714)|Carphenazine(DB01038)|Fenoldopam(DB00800)|Zuclopenthixol(DB01624)	GGCCATCTCCAGGCCCTTCCG	0.597													29	42	---	---	---	---	capture	Missense_Mutation	SNP	9784083	9784083	DRD5	4	A	T	T	T	1	0	0	0	0	1	0	0	0	88	7	4	4	4715	234
SEPSECS	51091	broad.mit.edu	37	4	25127315	25127315	+	Splice_Site	SNP	C	T	T			TCGA-32-1991-01	TCGA-32-1991-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:25127315C>T	uc003grg.2	-	10	1424	c.1211_splice	c.e10+1	p.R404_splice	SEPSECS_uc003gri.2_Splice_Site_p.R403_splice|SEPSECS_uc003grh.2_Splice_Site_p.R325_splice	NM_153825	NP_722547	Q9HD40	SPCS_HUMAN	Sep (O-phosphoserine) tRNA:Sec (selenocysteine)						selenocysteine incorporation	cytoplasm|nucleus	pyridoxal phosphate binding|transferase activity, transferring selenium-containing groups|tRNA binding				0		Breast(46;0.173)			Pyridoxal Phosphate(DB00114)	AACATACTTACCTGGCTCCAG	0.388													18	29	---	---	---	---	capture	Splice_Site	SNP	25127315	25127315	SEPSECS	4	C	T	T	T	1	0	0	0	0	0	0	1	0	234	18	5	2	13951	234
CCKAR	886	broad.mit.edu	37	4	26491828	26491828	+	Missense_Mutation	SNP	C	A	A			TCGA-32-1991-01	TCGA-32-1991-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:26491828C>A	uc003gse.1	-	1	215	c.62G>T	c.(61-63)GGG>GTG	p.G21V		NM_000730	NP_000721	P32238	CCKAR_HUMAN	cholecystokinin A receptor	21	Extracellular (Potential).				activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|elevation of cytosolic calcium ion concentration|response to nutrient	integral to plasma membrane	cholecystokinin receptor activity			lung(3)|pancreas(1)	4		Breast(46;0.0503)			Ceruletide(DB00403)	ATTTTCGAGCCCGAGTTCACA	0.493													4	139	---	---	---	---	capture	Missense_Mutation	SNP	26491828	26491828	CCKAR	4	C	A	A	A	1	0	0	0	0	1	0	0	0	286	22	4	4	2853	234
RBM47	54502	broad.mit.edu	37	4	40440439	40440439	+	Missense_Mutation	SNP	T	C	C			TCGA-32-1991-01	TCGA-32-1991-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:40440439T>C	uc003gvc.2	-	4	1182	c.472A>G	c.(472-474)ATC>GTC	p.I158V	RBM47_uc003gvd.2_Missense_Mutation_p.I158V|RBM47_uc003gve.2_RNA|RBM47_uc011bys.1_Missense_Mutation_p.I120V|RBM47_uc003gvg.1_Missense_Mutation_p.I158V	NM_001098634	NP_001092104	A0AV96	RBM47_HUMAN	RNA binding motif protein 47 isoform a	158	RRM 2.					nucleus	nucleotide binding|RNA binding			breast(3)	3						ATCTTGGGGATCCCGCCGATG	0.637													6	60	---	---	---	---	capture	Missense_Mutation	SNP	40440439	40440439	RBM47	4	T	C	C	C	1	0	0	0	0	1	0	0	0	650	50	3	3	13036	234
SRD5A1	6715	broad.mit.edu	37	5	6662995	6662995	+	Missense_Mutation	SNP	C	T	T			TCGA-32-1991-01	TCGA-32-1991-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:6662995C>T	uc003jdw.2	+	4	819	c.629C>T	c.(628-630)GCC>GTC	p.A210V	SRD5A1_uc011cml.1_RNA|SRD5A1_uc011cmm.1_Missense_Mutation_p.A163V	NM_001047	NP_001038	P18405	S5A1_HUMAN	steroid-5-alpha-reductase 1	210	Helical; (Potential).				androgen biosynthetic process|cell differentiation|sex determination|sex differentiation	endoplasmic reticulum membrane|integral to membrane|microsome	3-oxo-5-alpha-steroid 4-dehydrogenase activity|electron carrier activity				0					Dutasteride(DB01126)|Finasteride(DB01216)	TGTGGCTATGCCCTGGCCAGC	0.423													7	223	---	---	---	---	capture	Missense_Mutation	SNP	6662995	6662995	SRD5A1	5	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	15030	234
ZNF622	90441	broad.mit.edu	37	5	16453250	16453250	+	Missense_Mutation	SNP	T	A	A			TCGA-32-1991-01	TCGA-32-1991-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:16453250T>A	uc003jfq.2	-	5	1298	c.1178A>T	c.(1177-1179)CAT>CTT	p.H393L		NM_033414	NP_219482	Q969S3	ZN622_HUMAN	zinc finger protein 622	393						cytoplasm|nucleus	nucleic acid binding|zinc ion binding			ovary(1)	1						CAAGGAGCGATGACCCACTCT	0.463													137	217	---	---	---	---	capture	Missense_Mutation	SNP	16453250	16453250	ZNF622	5	T	A	A	A	1	0	0	0	0	1	0	0	0	663	51	4	4	17924	234
NPR3	4883	broad.mit.edu	37	5	32739137	32739137	+	Splice_Site	SNP	G	A	A			TCGA-32-1991-01	TCGA-32-1991-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:32739137G>A	uc003jhv.2	+	3	1277	c.1059_splice	c.e3+1	p.Y353_splice	NPR3_uc010iuo.2_Splice_Site_p.Y137_splice|NPR3_uc011cnz.1_Splice_Site_p.Y137_splice|NPR3_uc003jhu.2_Splice_Site_p.Y353_splice	NM_000908	NP_000899	P17342	ANPRC_HUMAN	natriuretic peptide receptor C/guanylate cyclase						osteoclast proliferation|positive regulation of urine volume|regulation of blood pressure|regulation of osteoblast proliferation|skeletal system development	integral to membrane	hormone binding|natriuretic peptide receptor activity			ovary(1)|central_nervous_system(1)	2					Nesiritide(DB04899)	GGAGGATTACGTAAGTGCCTG	0.408													61	107	---	---	---	---	capture	Splice_Site	SNP	32739137	32739137	NPR3	5	G	A	A	A	1	0	0	0	0	0	0	1	0	520	40	5	1	10503	234
SH3RF2	153769	broad.mit.edu	37	5	145393623	145393623	+	Missense_Mutation	SNP	A	T	T			TCGA-32-1991-01	TCGA-32-1991-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:145393623A>T	uc003lnt.2	+	5	1296	c.1058A>T	c.(1057-1059)CAG>CTG	p.Q353L	SH3RF2_uc011dbl.1_Missense_Mutation_p.Q353L	NM_152550	NP_689763	Q8TEC5	SH3R2_HUMAN	SH3 domain containing ring finger 2	353							ligase activity|protein phosphatase 1 binding|zinc ion binding			ovary(1)|skin(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TGTGTGGGACAGGTAGGGAAG	0.512													4	195	---	---	---	---	capture	Missense_Mutation	SNP	145393623	145393623	SH3RF2	5	A	T	T	T	1	0	0	0	0	1	0	0	0	91	7	4	4	14152	234
DCTN4	51164	broad.mit.edu	37	5	150133220	150133220	+	Splice_Site	SNP	C	A	A			TCGA-32-1991-01	TCGA-32-1991-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:150133220C>A	uc003lsv.2	-	3	309	c.207_splice	c.e3-1	p.R69_splice	DCTN4_uc003lsu.2_Splice_Site_p.R12_splice|DCTN4_uc010jhi.2_Splice_Site_p.R69_splice|DCTN4_uc010jhj.2_Splice_Site|DCTN4_uc011dck.1_Splice_Site_p.R12_splice	NM_016221	NP_057305	Q9UJW0	DCTN4_HUMAN	dynactin 4 (p62) isoform b							centrosome|nucleus	protein N-terminus binding			central_nervous_system(1)	1		Medulloblastoma(196;0.167)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			ATTGGCACATCTGTGACATGA	0.438													32	36	---	---	---	---	capture	Splice_Site	SNP	150133220	150133220	DCTN4	5	C	A	A	A	1	0	0	0	0	0	0	1	0	416	32	5	4	4268	234
PBX2	5089	broad.mit.edu	37	6	32156280	32156280	+	Silent	SNP	G	T	T			TCGA-32-1991-01	TCGA-32-1991-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:32156280G>T	uc003oav.1	-	3	568	c.297C>A	c.(295-297)GGC>GGA	p.G99G	PBX2_uc003oaw.2_Silent_p.G99G	NM_002586	NP_002577	P40425	PBX2_HUMAN	pre-B-cell leukemia homeobox 2	99							transcription factor binding			ovary(1)	1						GAATGCTGAGGCCTAGCATGC	0.612													5	71	---	---	---	---	capture	Silent	SNP	32156280	32156280	PBX2	6	G	T	T	T	1	0	0	0	0	0	0	0	1	535	42	4	4	11396	234
ZFAND3	60685	broad.mit.edu	37	6	38084429	38084429	+	Missense_Mutation	SNP	G	C	C			TCGA-32-1991-01	TCGA-32-1991-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:38084429G>C	uc003onx.2	+	5	858	c.443G>C	c.(442-444)CGA>CCA	p.R148P		NM_021943	NP_068762	Q9H8U3	ZFAN3_HUMAN	zinc finger, AN1-type domain 3	148							DNA binding|zinc ion binding			ovary(1)	1						GAAACCAGTCGATCTAAACAG	0.507													67	100	---	---	---	---	capture	Missense_Mutation	SNP	38084429	38084429	ZFAND3	6	G	C	C	C	1	0	0	0	0	1	0	0	0	481	37	4	4	17509	234
CAPN11	11131	broad.mit.edu	37	6	44147870	44147870	+	Missense_Mutation	SNP	G	A	A			TCGA-32-1991-01	TCGA-32-1991-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:44147870G>A	uc003owt.1	+	14	1648	c.1610G>A	c.(1609-1611)CGG>CAG	p.R537Q	CAPN11_uc011dvn.1_Missense_Mutation_p.R191Q	NM_007058	NP_008989	Q9UMQ6	CAN11_HUMAN	calpain 11	537	Domain III.				proteolysis	acrosomal vesicle	calcium ion binding|calcium-dependent cysteine-type endopeptidase activity			ovary(1)|breast(1)	2	all_cancers(18;3.19e-06)|Lung NSC(15;0.00108)|all_lung(25;0.00278)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			TTCCTGCTTCGGGTCTTCACC	0.577													3	75	---	---	---	---	capture	Missense_Mutation	SNP	44147870	44147870	CAPN11	6	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	2600	234
BCLAF1	9774	broad.mit.edu	37	6	136599814	136599814	+	Nonsense_Mutation	SNP	G	A	A			TCGA-32-1991-01	TCGA-32-1991-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:136599814G>A	uc003qgx.1	-	4	458	c.205C>T	c.(205-207)CGA>TGA	p.R69*	BCLAF1_uc003qgw.1_Nonsense_Mutation_p.R69*|BCLAF1_uc003qgy.1_Nonsense_Mutation_p.R67*|BCLAF1_uc011edc.1_RNA|BCLAF1_uc011edd.1_RNA|BCLAF1_uc011ede.1_Nonsense_Mutation_p.R67*	NM_014739	NP_055554	Q9NYF8	BCLF1_HUMAN	BCL2-associated transcription factor 1 isoform	69					induction of apoptosis|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus	DNA binding|protein binding			ovary(1)	1	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00226)|OV - Ovarian serous cystadenocarcinoma(155;0.00331)		CCATAAGGTCGTCTCATTCCT	0.433													22	185	---	---	---	---	capture	Nonsense_Mutation	SNP	136599814	136599814	BCLAF1	6	G	A	A	A	1	0	0	0	0	0	1	0	0	519	40	5	1	1372	234
EGFR	1956	broad.mit.edu	37	7	55221821	55221821	+	Missense_Mutation	SNP	G	A	A			TCGA-32-1991-01	TCGA-32-1991-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:55221821G>A	uc003tqk.2	+	7	1111	c.865G>A	c.(865-867)GCC>ACC	p.A289T	EGFR_uc003tqh.2_Missense_Mutation_p.A289T|EGFR_uc003tqi.2_Missense_Mutation_p.A289T|EGFR_uc003tqj.2_Missense_Mutation_p.A289T|EGFR_uc010kzg.1_Missense_Mutation_p.A244T|EGFR_uc011kco.1_Missense_Mutation_p.A236T|EGFR_uc011kcp.1_5'Flank|EGFR_uc011kcq.1_5'Flank	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	289	Approximate.|Extracellular (Potential).				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	p.A289V(20)|p.V30_R297>G(5)|p.A289T(3)|p.A289D(3)		lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	CAGCTTTGGTGCCACCTGCGT	0.592		8	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			24	930	---	---	---	---	capture	Missense_Mutation	SNP	55221821	55221821	EGFR	7	G	A	A	A	1	0	0	0	0	1	0	0	0	598	46	2	2	4922	234
RNF133	168433	broad.mit.edu	37	7	122338474	122338474	+	Missense_Mutation	SNP	T	G	G			TCGA-32-1991-01	TCGA-32-1991-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:122338474T>G	uc003vkj.1	-	1	735	c.499A>C	c.(499-501)ATT>CTT	p.I167L	CADPS2_uc010lkp.2_Intron|CADPS2_uc010lkq.2_Intron	NM_139175	NP_631914	Q8WVZ7	RN133_HUMAN	ring finger protein 133	167	PA.					endoplasmic reticulum membrane|integral to membrane	ligase activity|zinc ion binding			skin(1)	1						CCCTTCTTAATTAAATGGAAA	0.423													156	365	---	---	---	---	capture	Missense_Mutation	SNP	122338474	122338474	RNF133	7	T	G	G	G	1	0	0	0	0	1	0	0	0	676	52	4	4	13331	234
SMARCD3	6604	broad.mit.edu	37	7	150945617	150945617	+	Missense_Mutation	SNP	C	T	T			TCGA-32-1991-01	TCGA-32-1991-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:150945617C>T	uc003wjs.2	-	1	133	c.32G>A	c.(31-33)CGC>CAC	p.R11H	SMARCD3_uc003wjt.2_Intron|SMARCD3_uc003wju.2_Intron|SMARCD3_uc011kvh.1_Missense_Mutation_p.R11H|SMARCD3_uc010lqa.1_Missense_Mutation_p.R11H	NM_001003801	NP_001003801	Q6STE5	SMRD3_HUMAN	SWI/SNF related, matrix associated, actin	11					cellular lipid metabolic process|chromatin modification|nervous system development|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nBAF complex|npBAF complex|nucleoplasm|SWI/SNF complex	nuclear hormone receptor binding|protein binding|transcription coactivator activity|transcription factor binding			ovary(1)|lung(1)	2			OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		CGTGGCTTTGCGCGCCCCTCC	0.498													5	264	---	---	---	---	capture	Missense_Mutation	SNP	150945617	150945617	SMARCD3	7	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	14671	234
DEFA4	1669	broad.mit.edu	37	8	6794410	6794410	+	Silent	SNP	G	A	A	rs61749084	byFrequency	TCGA-32-1991-01	TCGA-32-1991-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:6794410G>A	uc003wqu.1	-	2	63	c.12C>T	c.(10-12)ATC>ATT	p.I4I		NM_001925	NP_001916	P12838	DEF4_HUMAN	defensin, alpha 4 preproprotein	4					defense response to bacterium|defense response to fungus|killing of cells of other organism	extracellular space				large_intestine(1)	1				COAD - Colon adenocarcinoma(149;0.0572)|READ - Rectum adenocarcinoma(644;0.121)		CGAGGAGGGCGATAATCCTCA	0.622													16	33	---	---	---	---	capture	Silent	SNP	6794410	6794410	DEFA4	8	G	A	A	A	1	0	0	0	0	0	0	0	1	473	37	1	1	4349	234
NKX3-1	4824	broad.mit.edu	37	8	23538761	23538761	+	Silent	SNP	C	T	T			TCGA-32-1991-01	TCGA-32-1991-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:23538761C>T	uc011kzx.1	-	2	726	c.678G>A	c.(676-678)GTG>GTA	p.V226V	NKX3-1_uc003xdv.1_Intron	NM_006167	NP_006158	Q99801	NKX31_HUMAN	NK3 homeobox 1	226					negative regulation of estrogen receptor binding|negative regulation of transcription, DNA-dependent|positive regulation of cell division|positive regulation of mitotic cell cycle|positive regulation of transcription from RNA polymerase II promoter	nucleus	estrogen receptor activity|estrogen receptor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region sequence-specific DNA binding				0		Prostate(55;0.114)		Colorectal(74;0.0146)|COAD - Colon adenocarcinoma(73;0.061)|BRCA - Breast invasive adenocarcinoma(99;0.0708)		TCCAGCTGCCCACGCAGTACA	0.542													57	91	---	---	---	---	capture	Silent	SNP	23538761	23538761	NKX3-1	8	C	T	T	T	1	0	0	0	0	0	0	0	1	262	21	2	2	10362	234
PREX2	80243	broad.mit.edu	37	8	68989642	68989642	+	Missense_Mutation	SNP	G	A	A			TCGA-32-1991-01	TCGA-32-1991-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:68989642G>A	uc003xxv.1	+	15	1607	c.1580G>A	c.(1579-1581)CGC>CAC	p.R527H	PREX2_uc003xxu.1_Missense_Mutation_p.R527H|PREX2_uc011lez.1_Missense_Mutation_p.R462H	NM_024870	NP_079146	Q70Z35	PREX2_HUMAN	DEP domain containing 2 isoform a	527	DEP 2.				G-protein coupled receptor protein signaling pathway|intracellular signal transduction	intracellular	protein binding|Rac GTPase activator activity|Rac guanyl-nucleotide exchange factor activity			skin(6)|large_intestine(4)|pancreas(3)|lung(2)|ovary(1)|kidney(1)	17						GGAGATTGCCGCACCAGAGAA	0.438													5	229	---	---	---	---	capture	Missense_Mutation	SNP	68989642	68989642	PREX2	8	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	12373	234
WDYHV1	55093	broad.mit.edu	37	8	124442261	124442261	+	Silent	SNP	A	G	G			TCGA-32-1991-01	TCGA-32-1991-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:124442261A>G	uc003yqn.1	+	3	347	c.222A>G	c.(220-222)GGA>GGG	p.G74G	WDYHV1_uc011lij.1_Silent_p.G14G|WDYHV1_uc003yqo.1_RNA	NM_018024	NP_060494	Q96HA8	NTAQ1_HUMAN	WDYHV motif containing 1	74					protein modification process	cytosol|nucleus	protein binding|protein N-terminal glutamine amidohydrolase activity			ovary(1)|skin(1)	2						CTGGAGATGGACCTGTGATCT	0.378													4	110	---	---	---	---	capture	Silent	SNP	124442261	124442261	WDYHV1	8	A	G	G	G	1	0	0	0	0	0	0	0	1	119	10	3	3	17224	234
LRRC24	441381	broad.mit.edu	37	8	145748578	145748578	+	Missense_Mutation	SNP	C	G	G			TCGA-32-1991-01	TCGA-32-1991-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:145748578C>G	uc003zdm.2	-	5	955	c.823G>C	c.(823-825)GAG>CAG	p.E275Q	LRRC24_uc003zdn.2_Missense_Mutation_p.E272Q|LRRC14_uc003zdk.1_3'UTR|LRRC14_uc003zdl.1_3'UTR|LRRC14_uc003zdo.2_RNA	NM_001024678	NP_001019849	Q50LG9	LRC24_HUMAN	leucine rich repeat containing 24 precursor	275	Ig-like C2-type.					integral to membrane					0	all_cancers(97;5.56e-11)|all_epithelial(106;3.54e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.48e-41)|Epithelial(56;1.85e-40)|all cancers(56;3.59e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0483)|Colorectal(110;0.055)			CGCAGGTCCTCACCCAGGTTG	0.682													2	18	---	---	---	---	capture	Missense_Mutation	SNP	145748578	145748578	LRRC24	8	C	G	G	G	1	0	0	0	0	1	0	0	0	377	29	4	4	8895	234
KIAA1045	23349	broad.mit.edu	37	9	34971449	34971449	+	Missense_Mutation	SNP	G	A	A			TCGA-32-1991-01	TCGA-32-1991-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:34971449G>A	uc003zvq.2	+	2	332	c.154G>A	c.(154-156)GTC>ATC	p.V52I	KIAA1045_uc003zvr.2_Missense_Mutation_p.V52I	NM_015297	NP_056112	Q9UPV7	K1045_HUMAN	hypothetical protein LOC23349	52							calcium ion binding			skin(1)	1			LUSC - Lung squamous cell carcinoma(32;0.00575)			AGAGGGCTCCGTCCAGGAGGT	0.647													3	76	---	---	---	---	capture	Missense_Mutation	SNP	34971449	34971449	KIAA1045	9	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	8129	234
C9orf64	84267	broad.mit.edu	37	9	86554575	86554575	+	Missense_Mutation	SNP	G	A	A			TCGA-32-1991-01	TCGA-32-1991-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:86554575G>A	uc004anb.2	-	4	1125	c.877C>T	c.(877-879)CTT>TTT	p.L293F	C9orf64_uc004anc.2_Missense_Mutation_p.L152F	NM_032307	NP_115683	Q5T6V5	CI064_HUMAN	hypothetical protein LOC84267	293											0						AGCTCCAGAAGACAATCCCGG	0.458													110	136	---	---	---	---	capture	Missense_Mutation	SNP	86554575	86554575	C9orf64	9	G	A	A	A	1	0	0	0	0	1	0	0	0	429	33	2	2	2465	234
GADD45G	10912	broad.mit.edu	37	9	92220750	92220750	+	Silent	SNP	C	T	T			TCGA-32-1991-01	TCGA-32-1991-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:92220750C>T	uc004aqq.2	+	3	434	c.324C>T	c.(322-324)GGC>GGT	p.G108G	GADD45G_uc004aqr.2_Silent_p.G90G	NM_006705	NP_006696	O95257	GA45G_HUMAN	growth arrest and DNA-damage-inducible, gamma	108					activation of MAPKKK activity|apoptosis|cell differentiation|DNA repair|multicellular organismal development		protein binding				0						TGGGCGCCGGCGAGGAGGCGG	0.662													3	42	---	---	---	---	capture	Silent	SNP	92220750	92220750	GADD45G	9	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	6125	234
C9orf102	375748	broad.mit.edu	37	9	98728904	98728904	+	Nonsense_Mutation	SNP	G	T	T			TCGA-32-1991-01	TCGA-32-1991-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:98728904G>T	uc004avt.3	+	14	2429	c.2041G>T	c.(2041-2043)GGA>TGA	p.G681*	C9orf102_uc011lum.1_Nonsense_Mutation_p.G383*|C9orf102_uc010mry.1_Nonsense_Mutation_p.G383*|C9orf102_uc010mrz.2_Nonsense_Mutation_p.G492*|C9orf102_uc004avu.2_Translation_Start_Site	NM_001010895	NP_001010895	Q5T890	RAD26_HUMAN	RAD26L hypothetical protein	681					DNA repair	nucleus	ATP binding|ATP-dependent helicase activity|DNA binding				0		Acute lymphoblastic leukemia(62;0.0559)				AGCAGTTCAAGGATCTAAAGA	0.408													84	145	---	---	---	---	capture	Nonsense_Mutation	SNP	98728904	98728904	C9orf102	9	G	T	T	T	1	0	0	0	0	0	1	0	0	455	35	5	4	2422	234
DDX3X	1654	broad.mit.edu	37	X	41204796	41204796	+	Missense_Mutation	SNP	C	A	A			TCGA-32-1991-01	TCGA-32-1991-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:41204796C>A	uc004dfe.2	+	12	2165	c.1310C>A	c.(1309-1311)GCA>GAA	p.A437E	DDX3X_uc004dff.2_Missense_Mutation_p.A437E|DDX3X_uc011mkq.1_Missense_Mutation_p.A421E|DDX3X_uc011mkr.1_Intron|DDX3X_uc011mks.1_Intron|DDX3X_uc004dfg.2_RNA|DDX3X_uc011mkt.1_RNA	NM_001356	NP_001347	O00571	DDX3X_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 3	437	Helicase C-terminal.|Necessary for interaction with XPO1.				interspecies interaction between organisms	cytoplasm|nuclear speck	ATP binding|ATP-dependent RNA helicase activity|DNA binding|protein binding|RNA binding			ovary(2)|breast(2)|central_nervous_system(1)|skin(1)	6						CTCCTAAATGCAACAGGTAAC	0.249										HNSCC(61;0.18)			4	125	---	---	---	---	capture	Missense_Mutation	SNP	41204796	41204796	DDX3X	23	C	A	A	A	1	0	0	0	0	1	0	0	0	325	25	4	4	4316	234
AKAP4	8852	broad.mit.edu	37	X	49957173	49957173	+	Missense_Mutation	SNP	C	T	T			TCGA-32-1991-01	TCGA-32-1991-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:49957173C>T	uc004dow.1	-	5	2315	c.2191G>A	c.(2191-2193)GCA>ACA	p.A731T	AKAP4_uc004dov.1_Missense_Mutation_p.A348T|AKAP4_uc010njp.1_Missense_Mutation_p.A553T|AKAP4_uc004dou.1_Missense_Mutation_p.A722T	NM_003886	NP_003877	Q5JQC9	AKAP4_HUMAN	A-kinase anchor protein 4 isoform 1	731					cell projection organization|single fertilization|sperm motility	cAMP-dependent protein kinase complex|cilium|cytoskeleton|microtubule-based flagellum	protein kinase A binding			kidney(3)|central_nervous_system(2)|ovary(1)|lung(1)|skin(1)	8	Ovarian(276;0.236)					GGCTTATTTGCCGAGGCTGCT	0.448													3	66	---	---	---	---	capture	Missense_Mutation	SNP	49957173	49957173	AKAP4	23	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	453	234
RGAG1	57529	broad.mit.edu	37	X	109694254	109694254	+	Missense_Mutation	SNP	G	A	A			TCGA-32-1991-01	TCGA-32-1991-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:109694254G>A	uc004eor.1	+	3	655	c.409G>A	c.(409-411)GTA>ATA	p.V137I	RGAG1_uc011msr.1_Missense_Mutation_p.V137I	NM_020769	NP_065820	Q8NET4	RGAG1_HUMAN	retrotransposon gag domain containing 1	137										lung(2)|upper_aerodigestive_tract(1)|ovary(1)	4						AGAGTATGGGGTAATGTCCCC	0.502													148	33	---	---	---	---	capture	Missense_Mutation	SNP	109694254	109694254	RGAG1	23	G	A	A	A	1	0	0	0	0	1	0	0	0	572	44	2	2	13169	234
MAGEA11	4110	broad.mit.edu	37	X	148794878	148794878	+	Missense_Mutation	SNP	A	C	C			TCGA-32-1991-01	TCGA-32-1991-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:148794878A>C	uc004fdq.2	+	2	161	c.59A>C	c.(58-60)AAG>ACG	p.K20T	HSFX2_uc004fdl.2_Intron|HSFX1_uc004fdm.2_Intron|MAGEA11_uc004fdr.2_Intron	NM_005366	NP_005357	P43364	MAGAB_HUMAN	melanoma antigen family A, 11 isoform a	20						cytoplasm|nucleus	protein binding			ovary(2)	2	Acute lymphoblastic leukemia(192;6.56e-05)|Colorectal(9;0.0662)					ATCAAGAGGAAGAAGAAGAGG	0.572													84	27	---	---	---	---	capture	Missense_Mutation	SNP	148794878	148794878	MAGEA11	23	A	C	C	C	1	0	0	0	0	1	0	0	0	39	3	4	4	9079	234
SOX13	9580	broad.mit.edu	37	1	204086257	204086259	+	In_Frame_Del	DEL	AGC	-	-			TCGA-32-1991-01	TCGA-32-1991-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:204086257_204086259delAGC	uc001ham.2	+	6	1194_1196	c.599_601delAGC	c.(598-603)AAGCAG>AAG	p.Q204del	SOX13_uc001hal.2_In_Frame_Del_p.Q204del|SOX13_uc010pqp.1_In_Frame_Del_p.Q204del|SOX13_uc010pqq.1_In_Frame_Del_p.Q71del	NM_005686	NP_005677	Q9UN79	SOX13_HUMAN	SRY-box 13	204	Gln-rich.				anatomical structure morphogenesis	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			breast(1)|central_nervous_system(1)	2	all_cancers(21;0.0754)|Breast(84;0.116)|all_epithelial(62;0.189)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.109)			CAGATTGCAAAGCAGCAGCAGCA	0.581													10	2003	---	---	---	---	capture_indel	In_Frame_Del	DEL	204086257	204086259	SOX13	1	AGC	-	-	-	1	0	1	0	1	0	0	0	0	39	3	5	5	14836	234
PIK3R1	5295	broad.mit.edu	37	5	67591096	67591098	+	In_Frame_Del	DEL	GAA	-	-			TCGA-32-1991-01	TCGA-32-1991-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:67591096_67591098delGAA	uc003jva.2	+	13	2249_2251	c.1689_1691delGAA	c.(1687-1692)ATGAAC>ATC	p.563_564MN>I	PIK3R1_uc003jvb.2_In_Frame_Del_p.563_564MN>I|PIK3R1_uc003jvc.2_In_Frame_Del_p.263_264MN>I|PIK3R1_uc003jvd.2_In_Frame_Del_p.293_294MN>I|PIK3R1_uc003jve.2_In_Frame_Del_p.242_243MN>I|PIK3R1_uc011crb.1_In_Frame_Del_p.233_234MN>I	NM_181523	NP_852664	P27986	P85A_HUMAN	phosphoinositide-3-kinase, regulatory subunit 1	563_564					epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|growth hormone receptor signaling pathway|insulin receptor signaling pathway|insulin-like growth factor receptor signaling pathway|interspecies interaction between organisms|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol 3-kinase cascade|phosphatidylinositol phosphorylation|phosphatidylinositol-mediated signaling|platelet activation|positive regulation of establishment of protein localization in plasma membrane|positive regulation of glucose import|T cell costimulation|T cell receptor signaling pathway	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex	1-phosphatidylinositol binding|ErbB-3 class receptor binding|insulin binding|insulin receptor binding|insulin receptor substrate binding|insulin-like growth factor receptor binding|phosphatidylinositol 3-kinase regulator activity|protein phosphatase binding	p.N564D(3)|p.D560_S565del(1)|p.R562_M563ins13(1)|p.?(1)		endometrium(34)|central_nervous_system(27)|large_intestine(20)|breast(7)|ovary(5)|haematopoietic_and_lymphoid_tissue(3)|lung(2)|urinary_tract(1)|skin(1)|pancreas(1)	101		Lung NSC(167;1.99e-05)|Prostate(74;0.00308)|Ovarian(174;0.00473)|Colorectal(97;0.0176)		OV - Ovarian serous cystadenocarcinoma(47;3.76e-51)|Lung(70;0.0211)	Isoproterenol(DB01064)	ACAAACGTATGAACAGCATTAAA	0.374			Mis|F|O		gliobastoma|ovarian|colorectal					TCGA GBM(4;<1E-08)			117	205	---	---	---	---	capture_indel	In_Frame_Del	DEL	67591096	67591098	PIK3R1	5	GAA	-	-	-	1	0	1	0	1	0	0	0	0	585	45	5	5	11821	234
