Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
SPEN	23013	broad.mit.edu	37	1	16260498	16260498	+	Missense_Mutation	SNP	C	G	G			TCGA-32-2494-01	TCGA-32-2494-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:16260498C>G	uc001axk.1	+	11	7967	c.7763C>G	c.(7762-7764)CCT>CGT	p.P2588R	SPEN_uc010obp.1_Missense_Mutation_p.P2547R	NM_015001	NP_055816	Q96T58	MINT_HUMAN	spen homolog, transcriptional regulator	2588	RID.				interspecies interaction between organisms|negative regulation of transcription, DNA-dependent|Notch signaling pathway	nucleus	nucleotide binding|protein binding|RNA binding			ovary(6)|breast(3)|lung(2)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	15		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		AAAACAGCACCTCCAGTGACA	0.522													3	198	---	---	---	---	capture	Missense_Mutation	SNP	16260498	16260498	SPEN	1	C	G	G	G	1	0	0	0	0	1	0	0	0	312	24	4	4	14930	236
CLCNKB	1188	broad.mit.edu	37	1	16377403	16377403	+	Missense_Mutation	SNP	G	A	A			TCGA-32-2494-01	TCGA-32-2494-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:16377403G>A	uc001axw.3	+	12	1167	c.1087G>A	c.(1087-1089)GAC>AAC	p.D363N	FAM131C_uc010obz.1_Intron|CLCNKB_uc001axx.3_Missense_Mutation_p.D363N|CLCNKB_uc001axy.3_Missense_Mutation_p.D194N	NM_000085	NP_000076	P51801	CLCKB_HUMAN	chloride channel Kb isoform 1	363					excretion	chloride channel complex|integral to plasma membrane	voltage-gated chloride channel activity			skin(1)	1		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Colorectal(212;8.04e-08)|COAD - Colon adenocarcinoma(227;5.46e-06)|BRCA - Breast invasive adenocarcinoma(304;9.02e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.00655)|READ - Rectum adenocarcinoma(331;0.0649)		CTCGCTGTTCGACAACCACTC	0.672													14	50	---	---	---	---	capture	Missense_Mutation	SNP	16377403	16377403	CLCNKB	1	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	3435	236
LDLRAD2	401944	broad.mit.edu	37	1	22140914	22140914	+	Missense_Mutation	SNP	C	G	G			TCGA-32-2494-01	TCGA-32-2494-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:22140914C>G	uc001bfg.1	+	2	296	c.109C>G	c.(109-111)CAG>GAG	p.Q37E		NM_001013693	NP_001013715	Q5SZI1	LRAD2_HUMAN	low density lipoprotein receptor class A domain	37	Extracellular (Potential).					integral to membrane	receptor activity				0		Colorectal(325;0.000147)|Renal(390;0.000734)|Lung NSC(340;0.00166)|all_lung(284;0.00172)|Breast(348;0.012)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0427)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0416)|OV - Ovarian serous cystadenocarcinoma(117;5.2e-26)|COAD - Colon adenocarcinoma(152;1.13e-05)|GBM - Glioblastoma multiforme(114;1.36e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000544)|KIRC - Kidney renal clear cell carcinoma(1967;0.00598)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.197)		ACTGTGCGGGCAGACGTGGCA	0.448													3	8	---	---	---	---	capture	Missense_Mutation	SNP	22140914	22140914	LDLRAD2	1	C	G	G	G	1	0	0	0	0	1	0	0	0	325	25	4	4	8626	236
HSPG2	3339	broad.mit.edu	37	1	22165399	22165399	+	Missense_Mutation	SNP	G	A	A			TCGA-32-2494-01	TCGA-32-2494-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:22165399G>A	uc001bfj.2	-	74	10109	c.10069C>T	c.(10069-10071)CCT>TCT	p.P3357S	HSPG2_uc009vqd.2_Missense_Mutation_p.P3358S	NM_005529	NP_005520	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2 precursor	3357	Ig-like C2-type 19.				angiogenesis|cell adhesion|lipid metabolic process|lipoprotein metabolic process	basement membrane|extracellular space|plasma membrane	protein C-terminus binding			ovary(5)|large_intestine(2)|central_nervous_system(1)|skin(1)	9		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Becaplermin(DB00102)|Palifermin(DB00039)	GAGTCCTCAGGGGCTGCACGC	0.682													3	19	---	---	---	---	capture	Missense_Mutation	SNP	22165399	22165399	HSPG2	1	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	7355	236
ELAVL4	1996	broad.mit.edu	37	1	50610767	50610767	+	Missense_Mutation	SNP	G	A	A	rs116391279	by1000genomes	TCGA-32-2494-01	TCGA-32-2494-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:50610767G>A	uc001csb.2	+	2	416	c.148G>A	c.(148-150)GTC>ATC	p.V50I	ELAVL4_uc001cry.3_Missense_Mutation_p.V53I|ELAVL4_uc001crz.3_Missense_Mutation_p.V50I|ELAVL4_uc001csa.3_Missense_Mutation_p.V67I|ELAVL4_uc001csc.3_Missense_Mutation_p.V50I|ELAVL4_uc009vyu.2_Missense_Mutation_p.V55I|ELAVL4_uc010omz.1_Missense_Mutation_p.V55I	NM_021952	NP_068771	P26378	ELAV4_HUMAN	ELAV-like 4 isoform 1	50	RRM 1.				mRNA processing		AU-rich element binding|mRNA 3'-UTR binding|nucleotide binding			ovary(1)|pancreas(1)	2						CAACCTCATCGTCAACTATTT	0.448													29	94	---	---	---	---	capture	Missense_Mutation	SNP	50610767	50610767	ELAVL4	1	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	5007	236
DMRTB1	63948	broad.mit.edu	37	1	53925199	53925199	+	Nonsense_Mutation	SNP	G	T	T			TCGA-32-2494-01	TCGA-32-2494-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:53925199G>T	uc001cvq.1	+	1	128	c.73G>T	c.(73-75)GGA>TGA	p.G25*		NM_033067	NP_149056	Q96MA1	DMRTB_HUMAN	DMRT-like family B with proline-rich C-terminal,	25	DM.				sex differentiation	nucleus	DNA binding|metal ion binding|sequence-specific DNA binding transcription factor activity			ovary(1)|skin(1)	2						GCCCGTCAAGGGACACGCGGG	0.602													12	23	---	---	---	---	capture	Nonsense_Mutation	SNP	53925199	53925199	DMRTB1	1	G	T	T	T	1	0	0	0	0	0	1	0	0	559	43	5	4	4548	236
OR10R2	343406	broad.mit.edu	37	1	158450132	158450132	+	Silent	SNP	T	C	C			TCGA-32-2494-01	TCGA-32-2494-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:158450132T>C	uc010pik.1	+	1	465	c.465T>C	c.(463-465)CTT>CTC	p.L155L	uc001fso.1_RNA	NM_001004472	NP_001004472	Q8NGX6	O10R2_HUMAN	olfactory receptor, family 10, subfamily R,	155	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			pancreas(2)|skin(1)	3	all_hematologic(112;0.0378)					ACCCCACTCTTATGAGCTGGC	0.473													4	256	---	---	---	---	capture	Silent	SNP	158450132	158450132	OR10R2	1	T	C	C	C	1	0	0	0	0	0	0	0	1	782	61	3	3	10821	236
RCSD1	92241	broad.mit.edu	37	1	167667016	167667016	+	Silent	SNP	C	T	T			TCGA-32-2494-01	TCGA-32-2494-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:167667016C>T	uc001gem.2	+	6	1342	c.1155C>T	c.(1153-1155)ACC>ACT	p.T385T	RCSD1_uc010pli.1_Silent_p.T355T	NM_052862	NP_443094	Q6JBY9	CPZIP_HUMAN	RCSD domain containing 1	385										ovary(2)|central_nervous_system(2)|skin(1)	5	all_hematologic(923;0.215)					GCCCCCAGACCGGCCCTGCCC	0.642													3	10	---	---	---	---	capture	Silent	SNP	167667016	167667016	RCSD1	1	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	13080	236
NME7	29922	broad.mit.edu	37	1	169138771	169138771	+	Missense_Mutation	SNP	G	A	A			TCGA-32-2494-01	TCGA-32-2494-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:169138771G>A	uc001gfu.2	-	11	1250	c.1012C>T	c.(1012-1014)CCT>TCT	p.P338S	NME7_uc010plq.1_RNA|NME7_uc001gft.2_Missense_Mutation_p.P302S	NM_013330	NP_037462	Q9Y5B8	NDK7_HUMAN	nucleoside diphosphate kinase 7 isoform a	338					CTP biosynthetic process|GTP biosynthetic process|UTP biosynthetic process	centrosome	ATP binding|metal ion binding|nucleoside diphosphate kinase activity			central_nervous_system(1)	1	all_hematologic(923;0.208)					AGAGTTCCAGGGCGTAAATGC	0.368													3	306	---	---	---	---	capture	Missense_Mutation	SNP	169138771	169138771	NME7	1	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	10403	236
LAMC1	3915	broad.mit.edu	37	1	183111900	183111900	+	Missense_Mutation	SNP	A	G	G			TCGA-32-2494-01	TCGA-32-2494-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:183111900A>G	uc001gpy.3	+	28	5062	c.4805A>G	c.(4804-4806)AAC>AGC	p.N1602S		NM_002293	NP_002284	P11047	LAMC1_HUMAN	laminin, gamma 1 precursor	1602	Potential.|Domain II and I.				axon guidance|cell migration|endoderm development|extracellular matrix disassembly|hemidesmosome assembly|positive regulation of epithelial cell proliferation|protein complex assembly|substrate adhesion-dependent cell spreading	extracellular space|laminin-1 complex|laminin-10 complex|laminin-11 complex	extracellular matrix structural constituent			ovary(3)|large_intestine(1)|kidney(1)	5					Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	GGCTGCTTCAACACCCCGTCC	0.527													21	103	---	---	---	---	capture	Missense_Mutation	SNP	183111900	183111900	LAMC1	1	A	G	G	G	1	0	0	0	0	1	0	0	0	26	2	3	3	8534	236
HMCN1	83872	broad.mit.edu	37	1	186107024	186107024	+	Missense_Mutation	SNP	A	T	T			TCGA-32-2494-01	TCGA-32-2494-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:186107024A>T	uc001grq.1	+	89	14073	c.13844A>T	c.(13843-13845)AAT>ATT	p.N4615I	HMCN1_uc001grs.1_Missense_Mutation_p.N184I	NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN	hemicentin 1 precursor	4615	TSP type-1 2.				response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)|skin(1)	23						ACTTGCAATAATCCATCAGTT	0.493													43	142	---	---	---	---	capture	Missense_Mutation	SNP	186107024	186107024	HMCN1	1	A	T	T	T	1	0	0	0	0	1	0	0	0	52	4	4	4	7145	236
LGALS8	3964	broad.mit.edu	37	1	236711404	236711404	+	Missense_Mutation	SNP	T	A	A			TCGA-32-2494-01	TCGA-32-2494-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:236711404T>A	uc001hxz.1	+	11	1278	c.897T>A	c.(895-897)AGT>AGA	p.S299R	LGALS8_uc001hxw.1_Missense_Mutation_p.S341R|LGALS8_uc001hxy.1_Missense_Mutation_p.S341R|LGALS8_uc009xgg.1_RNA|LGALS8_uc001hya.1_Missense_Mutation_p.S299R|LGALS8_uc001hyb.1_Missense_Mutation_p.S299R|LGALS8_uc001hyc.1_Missense_Mutation_p.S282R	NM_201543	NP_963837	O00214	LEG8_HUMAN	galectin-8 isoform b	299	Galectin 2.					cytoplasm|extracellular space	sugar binding			ovary(1)	1	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;0.0253)|Prostate(94;0.174)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)			AGCTCAGCAGTATTGACACGC	0.408													3	63	---	---	---	---	capture	Missense_Mutation	SNP	236711404	236711404	LGALS8	1	T	A	A	A	1	0	0	0	0	1	0	0	0	738	57	4	4	8667	236
MYO3A	53904	broad.mit.edu	37	10	26312961	26312961	+	Missense_Mutation	SNP	C	T	T			TCGA-32-2494-01	TCGA-32-2494-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:26312961C>T	uc001isn.2	+	9	1102	c.742C>T	c.(742-744)CCA>TCA	p.P248S	MYO3A_uc009xko.1_Missense_Mutation_p.P248S|MYO3A_uc009xkp.1_RNA|MYO3A_uc009xkq.1_Missense_Mutation_p.P248S	NM_017433	NP_059129	Q8NEV4	MYO3A_HUMAN	myosin IIIA	248	Protein kinase.				protein autophosphorylation|response to stimulus|sensory perception of sound|visual perception	cytoplasm|filamentous actin|filopodium|myosin complex	actin binding|actin-dependent ATPase activity|ADP binding|ATP binding|calmodulin binding|plus-end directed microfilament motor activity|protein serine/threonine kinase activity			ovary(6)|stomach(3)|lung(3)|central_nervous_system(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	18						GAATCCACCCCCAAAACTAAG	0.388													38	97	---	---	---	---	capture	Missense_Mutation	SNP	26312961	26312961	MYO3A	10	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	9986	236
GDF10	2662	broad.mit.edu	37	10	48429323	48429323	+	Missense_Mutation	SNP	C	T	T			TCGA-32-2494-01	TCGA-32-2494-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:48429323C>T	uc001jfb.2	-	2	1019	c.563G>A	c.(562-564)CGC>CAC	p.R188H	GDF10_uc009xnp.2_Missense_Mutation_p.R187H|GDF10_uc009xnq.1_Missense_Mutation_p.R188H	NM_004962	NP_004953	P55107	BMP3B_HUMAN	growth differentiation factor 10 precursor	188					growth|skeletal system development|transforming growth factor beta receptor signaling pathway	extracellular space	cytokine activity|growth factor activity			lung(1)|central_nervous_system(1)	2						CATGGCCCCGCGGAGTAGCCC	0.731													11	5	---	---	---	---	capture	Missense_Mutation	SNP	48429323	48429323	GDF10	10	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	6251	236
ZNF195	7748	broad.mit.edu	37	11	3381676	3381676	+	Missense_Mutation	SNP	C	G	G			TCGA-32-2494-01	TCGA-32-2494-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:3381676C>G	uc001lxt.2	-	6	740	c.562G>C	c.(562-564)GAC>CAC	p.D188H	uc001lxr.2_5'Flank|ZNF195_uc001lxv.2_Missense_Mutation_p.D165H|ZNF195_uc001lxs.2_Missense_Mutation_p.D116H|ZNF195_uc010qxr.1_Missense_Mutation_p.D169H|ZNF195_uc009ydz.2_Missense_Mutation_p.D143H|ZNF195_uc001lxu.2_Missense_Mutation_p.D120H	NM_001130520	NP_001123992	O14628	ZN195_HUMAN	zinc finger protein 195 isoform 1	188	Spacer.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Medulloblastoma(188;0.00106)|Breast(177;0.00328)|all_neural(188;0.00681)|Ovarian(85;0.00965)		BRCA - Breast invasive adenocarcinoma(625;0.0361)|LUSC - Lung squamous cell carcinoma(625;0.2)		CTTTCCCAGTCTTTCCTTAAA	0.343													3	157	---	---	---	---	capture	Missense_Mutation	SNP	3381676	3381676	ZNF195	11	C	G	G	G	1	0	0	0	0	1	0	0	0	416	32	4	4	17638	236
CD44	960	broad.mit.edu	37	11	35226085	35226085	+	Nonsense_Mutation	SNP	G	T	T			TCGA-32-2494-01	TCGA-32-2494-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:35226085G>T	uc001mvu.2	+	10	1614	c.1180G>T	c.(1180-1182)GAA>TAA	p.E394*	CD44_uc001mvv.2_Nonsense_Mutation_p.E351*|CD44_uc001mvw.2_Intron|CD44_uc001mvx.2_Intron|CD44_uc001mvy.2_Intron|CD44_uc001mwc.3_Intron|CD44_uc010rer.1_Intron|CD44_uc009ykh.2_Intron|CD44_uc010res.1_Intron|CD44_uc010ret.1_Intron|CD44_uc010reu.1_Intron	NM_000610	NP_000601	P16070	CD44_HUMAN	CD44 antigen isoform 1 precursor	394	Extracellular (Potential).|Stem.				cell-cell adhesion|cell-matrix adhesion|interferon-gamma-mediated signaling pathway|negative regulation of apoptosis|negative regulation of DNA damage response, signal transduction by p53 class mediator|positive regulation of ERK1 and ERK2 cascade|positive regulation of peptidyl-serine phosphorylation|positive regulation of peptidyl-tyrosine phosphorylation	cell surface|Golgi apparatus|integral to plasma membrane	collagen binding|hyaluronic acid binding|receptor activity			pancreas(1)	1	all_cancers(35;0.212)|all_lung(20;0.0874)|all_epithelial(35;0.112)	all_hematologic(20;0.107)	STAD - Stomach adenocarcinoma(6;0.00731)		Hyaluronidase(DB00070)	TAGTACAACGGAAGAAACAGC	0.453													4	158	---	---	---	---	capture	Nonsense_Mutation	SNP	35226085	35226085	CD44	11	G	T	T	T	1	0	0	0	0	0	1	0	0	533	41	5	4	2988	236
PTPRJ	5795	broad.mit.edu	37	11	48134462	48134462	+	Silent	SNP	C	T	T			TCGA-32-2494-01	TCGA-32-2494-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:48134462C>T	uc001ngp.3	+	3	634	c.279C>T	c.(277-279)AAC>AAT	p.N93N	PTPRJ_uc001ngo.3_Silent_p.N93N	NM_002843	NP_002834	Q12913	PTPRJ_HUMAN	protein tyrosine phosphatase, receptor type, J	93	Extracellular (Potential).				contact inhibition|negative regulation of cell growth|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of epidermal growth factor receptor signaling pathway|negative regulation of MAP kinase activity|negative regulation of platelet-derived growth factor receptor signaling pathway|negative regulation of protein kinase B signaling cascade|negative regulation of T cell receptor signaling pathway|negative regulation of vascular permeability|platelet-derived growth factor receptor signaling pathway|positive chemotaxis|positive regulation of focal adhesion assembly|positive regulation of protein kinase B signaling cascade|positive regulation of survival gene product expression	cell surface|cell-cell junction|immunological synapse|integral to plasma membrane|ruffle membrane	beta-catenin binding|delta-catenin binding|gamma-catenin binding|mitogen-activated protein kinase binding|platelet-derived growth factor receptor binding|protein tyrosine phosphatase activity			breast(3)|kidney(3)|ovary(1)|skin(1)	8						CTGGAGCCAACGATAGTTTAA	0.453													4	93	---	---	---	---	capture	Silent	SNP	48134462	48134462	PTPRJ	11	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	12699	236
SLC29A2	3177	broad.mit.edu	37	11	66133408	66133409	+	Missense_Mutation	DNP	CA	AC	AC			TCGA-32-2494-01	TCGA-32-2494-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:66133408_66133409CA>AC	uc001oht.2	-	10	1286_1287	c.1057_1058TG>GT	c.(1057-1059)TGG>GTG	p.W353V	SLC29A2_uc001ohs.2_Missense_Mutation_p.W233V|SLC29A2_uc010rpb.1_RNA|SLC29A2_uc009yrf.2_Missense_Mutation_p.W233V|SLC29A2_uc001ohu.2_Missense_Mutation_p.W353V|SLC29A2_uc001ohv.2_Missense_Mutation_p.V308G|uc001ohw.1_5'Flank	NM_001532	NP_001523	Q14542	S29A2_HUMAN	solute carrier family 29 (nucleoside	353					cell proliferation|nucleobase, nucleoside and nucleotide metabolic process	basolateral plasma membrane|integral to plasma membrane|nuclear membrane|nucleolus	nucleoside transmembrane transporter activity			ovary(1)	1						TGTGCTTACCCACAGGAAGTAA	0.535													16	73	---	---	---	---	capture	Missense_Mutation	DNP	66133408	66133409	SLC29A2	11	CA	AC	AC	AC	1	0	0	0	0	1	0	0	0	273	21	4	4	14427	236
ROBO4	54538	broad.mit.edu	37	11	124764984	124764984	+	Missense_Mutation	SNP	C	T	T			TCGA-32-2494-01	TCGA-32-2494-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:124764984C>T	uc001qbg.2	-	7	1282	c.1142G>A	c.(1141-1143)GGC>GAC	p.G381D	ROBO4_uc010sas.1_Missense_Mutation_p.G236D|ROBO4_uc001qbh.2_Missense_Mutation_p.G271D|ROBO4_uc001qbi.2_5'Flank|ROBO4_uc010sat.1_5'UTR	NM_019055	NP_061928	Q8WZ75	ROBO4_HUMAN	roundabout homolog 4, magic roundabout	381	Fibronectin type-III 2.				angiogenesis|cell differentiation	integral to membrane	receptor activity			ovary(1)|skin(1)	2	all_hematologic(175;0.215)	Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|Breast(109;0.171)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.5e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0301)		TACCTGGTAGCCACGGATGAT	0.542													3	70	---	---	---	---	capture	Missense_Mutation	SNP	124764984	124764984	ROBO4	11	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	13408	236
VEZT	55591	broad.mit.edu	37	12	95660405	95660405	+	Missense_Mutation	SNP	C	T	T			TCGA-32-2494-01	TCGA-32-2494-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:95660405C>T	uc001tdz.2	+	5	812	c.707C>T	c.(706-708)ACA>ATA	p.T236I	VEZT_uc009zsy.1_Missense_Mutation_p.T78I|VEZT_uc001tdr.2_Missense_Mutation_p.T78I|VEZT_uc001tds.2_Missense_Mutation_p.T188I|VEZT_uc001tdt.2_Missense_Mutation_p.T188I|VEZT_uc009zsz.1_Missense_Mutation_p.T236I|VEZT_uc001tdv.2_Missense_Mutation_p.T205I|VEZT_uc001tdw.1_Missense_Mutation_p.T188I|VEZT_uc009zta.1_Missense_Mutation_p.T188I	NM_017599	NP_060069	Q9HBM0	VEZA_HUMAN	vezatin, adherens junctions transmembrane	236						acrosomal vesicle|adherens junction|integral to membrane|nucleus				ovary(1)	1						AGAGGATTTACACTGTGAGTT	0.313													12	36	---	---	---	---	capture	Missense_Mutation	SNP	95660405	95660405	VEZT	12	C	T	T	T	1	0	0	0	0	1	0	0	0	221	17	2	2	17038	236
STAB2	55576	broad.mit.edu	37	12	104147041	104147041	+	Silent	SNP	G	A	A			TCGA-32-2494-01	TCGA-32-2494-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:104147041G>A	uc001tjw.2	+	61	6810	c.6624G>A	c.(6622-6624)CAG>CAA	p.Q2208Q	STAB2_uc009zug.2_RNA	NM_017564	NP_060034	Q8WWQ8	STAB2_HUMAN	stabilin 2 precursor	2208	Extracellular (Potential).|Link.				angiogenesis|cell adhesion|defense response to bacterium|receptor-mediated endocytosis	cytoplasm|external side of plasma membrane|integral to plasma membrane	Gram-negative bacterial cell surface binding|hyaluronic acid binding|low-density lipoprotein receptor activity|protein disulfide oxidoreductase activity|scavenger receptor activity			ovary(9)|skin(5)	14						CACTGGGCCAGTATAAGCTGA	0.567													3	65	---	---	---	---	capture	Silent	SNP	104147041	104147041	STAB2	12	G	A	A	A	1	0	0	0	0	0	0	0	1	464	36	2	2	15128	236
ABCB9	23457	broad.mit.edu	37	12	123434439	123434439	+	Missense_Mutation	SNP	C	T	T			TCGA-32-2494-01	TCGA-32-2494-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:123434439C>T	uc001udm.3	-	4	1053	c.743G>A	c.(742-744)GGC>GAC	p.G248D	ABCB9_uc009zxr.2_Intron|ABCB9_uc001udo.3_Missense_Mutation_p.G248D|ABCB9_uc010taj.1_Missense_Mutation_p.G248D|ABCB9_uc001udp.2_Missense_Mutation_p.G248D|ABCB9_uc001udq.2_Missense_Mutation_p.G30D|ABCB9_uc001udr.2_Missense_Mutation_p.G248D	NM_019625	NP_062571	Q9NP78	ABCB9_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP),	248	ABC transmembrane type-1.				positive regulation of T cell mediated cytotoxicity|protein transport	lysosomal membrane|plasma membrane|TAP complex	ATP binding|MHC class I protein binding|oligopeptide-transporting ATPase activity|peptide antigen binding|protein homodimerization activity|TAP1 binding|TAP2 binding|tapasin binding				0	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;6.84e-05)|Epithelial(86;0.000152)|BRCA - Breast invasive adenocarcinoma(302;0.111)		GGTAAAAATGCCGCCCCGAAT	0.522													4	212	---	---	---	---	capture	Missense_Mutation	SNP	123434439	123434439	ABCB9	12	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	48	236
NCOR2	9612	broad.mit.edu	37	12	124857156	124857156	+	Missense_Mutation	SNP	G	A	A			TCGA-32-2494-01	TCGA-32-2494-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:124857156G>A	uc010tba.1	-	20	2336	c.2219C>T	c.(2218-2220)GCC>GTC	p.A740V	NCOR2_uc010tay.1_Missense_Mutation_p.A740V|NCOR2_uc010taz.1_Missense_Mutation_p.A723V|NCOR2_uc010tbb.1_Missense_Mutation_p.A740V|NCOR2_uc010tbc.1_Missense_Mutation_p.A722V|NCOR2_uc001ugj.1_Missense_Mutation_p.A740V	NM_001077261	NP_001070729	Q9Y618	NCOR2_HUMAN	nuclear receptor co-repressor 2 isoform 2	740					cellular lipid metabolic process|negative regulation of transcription from RNA polymerase II promoter|regulation of cellular ketone metabolic process by negative regulation of transcription from an RNA polymerase II promoter|transcription, DNA-dependent	nuclear body|nucleus|transcriptional repressor complex	DNA binding|histone deacetylase binding|Notch binding|protein N-terminus binding|transcription corepressor activity			skin(3)|ovary(1)	4	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)		GTTGACAGTGGCTGTGCAGGG	0.647													3	74	---	---	---	---	capture	Missense_Mutation	SNP	124857156	124857156	NCOR2	12	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	10143	236
PIWIL1	9271	broad.mit.edu	37	12	130830969	130830969	+	Missense_Mutation	SNP	G	A	A			TCGA-32-2494-01	TCGA-32-2494-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:130830969G>A	uc001uik.2	+	5	461	c.371G>A	c.(370-372)CGT>CAT	p.R124H	PIWIL1_uc001uij.1_Missense_Mutation_p.R124H	NM_004764	NP_004755	Q96J94	PIWL1_HUMAN	piwi-like 1	124					gene silencing by RNA|meiosis|multicellular organismal development|regulation of translation|spermatid development	chromatoid body|P granule	mRNA binding|piRNA binding|protein binding			ovary(2)	2	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;3.02e-06)|Epithelial(86;3.85e-05)|all cancers(50;4.65e-05)		CTGACATCCCGTCCCCAGTGG	0.393													29	65	---	---	---	---	capture	Missense_Mutation	SNP	130830969	130830969	PIWIL1	12	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	11860	236
ENOX1	55068	broad.mit.edu	37	13	43788215	43788215	+	Missense_Mutation	SNP	G	A	A	rs146880051		TCGA-32-2494-01	TCGA-32-2494-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:43788215G>A	uc001uza.3	-	17	2143	c.1843C>T	c.(1843-1845)CGC>TGC	p.R615C	ENOX1_uc001uzb.3_Missense_Mutation_p.R615C|ENOX1_uc001uzc.3_Missense_Mutation_p.R615C|ENOX1_uc001uyz.3_Missense_Mutation_p.R224C	NM_001127615	NP_001121087	Q8TC92	ENOX1_HUMAN	ecto-NOX disulfide-thiol exchanger 1	615					electron transport chain|rhythmic process|transport	extracellular space|plasma membrane	nucleic acid binding|nucleotide binding|oxidoreductase activity			pancreas(1)|skin(1)	2		Lung NSC(96;0.000518)|Prostate(109;0.0233)|Hepatocellular(98;0.0268)|Lung SC(185;0.0367)|Breast(139;0.0406)		GBM - Glioblastoma multiforme(144;0.00333)|BRCA - Breast invasive adenocarcinoma(63;0.172)		TTGAACATGCGTGGCAGCCTC	0.433													4	125	---	---	---	---	capture	Missense_Mutation	SNP	43788215	43788215	ENOX1	13	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	5081	236
HEATR5A	25938	broad.mit.edu	37	14	31790820	31790820	+	Missense_Mutation	SNP	C	T	T			TCGA-32-2494-01	TCGA-32-2494-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:31790820C>T	uc001wrf.3	-	19	3052	c.2975G>A	c.(2974-2976)AGT>AAT	p.S992N	HEATR5A_uc010ami.2_Missense_Mutation_p.S890N	NM_015473	NP_056288	Q86XA9	HTR5A_HUMAN	HEAT repeat containing 5A	1279							binding			ovary(1)	1	Hepatocellular(127;0.0877)|Breast(36;0.137)		LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.0797)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.0059)		GAGCTGGTCACTGTGATCTGT	0.408													3	6	---	---	---	---	capture	Missense_Mutation	SNP	31790820	31790820	HEATR5A	14	C	T	T	T	1	0	0	0	0	1	0	0	0	260	20	2	2	6958	236
FOS	2353	broad.mit.edu	37	14	75745716	75745716	+	Missense_Mutation	SNP	G	C	C			TCGA-32-2494-01	TCGA-32-2494-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:75745716G>C	uc001xrn.2	+	1	236	c.31G>C	c.(31-33)GAG>CAG	p.E11Q	FOS_uc010tva.1_Missense_Mutation_p.E11Q|FOS_uc010asi.2_5'Flank|FOS_uc001xro.2_5'Flank	NM_005252	NP_005243	P01100	FOS_HUMAN	v-fos FBJ murine osteosarcoma viral oncogene	11					cellular response to reactive oxygen species|DNA methylation|inflammatory response|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|regulation of sequence-specific DNA binding transcription factor activity|SMAD protein signal transduction|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway|transcription from RNA polymerase II promoter|transforming growth factor beta receptor signaling pathway		protein dimerization activity|R-SMAD binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding			lung(2)|ovary(1)	3		all_lung(585;0.0138)|all_epithelial(191;0.0263)|all_neural(303;0.112)		BRCA - Breast invasive adenocarcinoma(234;0.0117)		CGCAGACTACGAGGCGTCATC	0.662													2	25	---	---	---	---	capture	Missense_Mutation	SNP	75745716	75745716	FOS	14	G	C	C	C	1	0	0	0	0	1	0	0	0	481	37	4	4	5929	236
KCNK13	56659	broad.mit.edu	37	14	90650893	90650893	+	Missense_Mutation	SNP	G	A	A			TCGA-32-2494-01	TCGA-32-2494-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:90650893G>A	uc001xye.1	+	2	1215	c.773G>A	c.(772-774)CGC>CAC	p.R258H		NM_022054	NP_071337	Q9HB14	KCNKD_HUMAN	potassium channel, subfamily K, member 13	258						integral to membrane	potassium channel activity|voltage-gated ion channel activity			skin(1)	1		all_cancers(154;0.186)				GGCCTCTATCGCTTTGCCAAC	0.493													44	120	---	---	---	---	capture	Missense_Mutation	SNP	90650893	90650893	KCNK13	14	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	7983	236
RYR3	6263	broad.mit.edu	37	15	34014993	34014993	+	Missense_Mutation	SNP	C	T	T			TCGA-32-2494-01	TCGA-32-2494-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:34014993C>T	uc001zhi.2	+	44	6767	c.6697C>T	c.(6697-6699)CGG>TGG	p.R2233W	RYR3_uc010bar.2_Missense_Mutation_p.R2233W	NM_001036	NP_001027	Q15413	RYR3_HUMAN	ryanodine receptor 3	2233	4 X approximate repeats.|Cytoplasmic (By similarity).				cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(5)|central_nervous_system(4)|lung(1)	10		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		CCCGGCCCTGCGGGGTGAGGG	0.587													4	197	---	---	---	---	capture	Missense_Mutation	SNP	34014993	34014993	RYR3	15	C	T	T	T	1	0	0	0	0	1	0	0	0	347	27	1	1	13662	236
CILP	8483	broad.mit.edu	37	15	65495753	65495753	+	Silent	SNP	G	A	A			TCGA-32-2494-01	TCGA-32-2494-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:65495753G>A	uc002aon.2	-	7	1156	c.975C>T	c.(973-975)AGC>AGT	p.S325S		NM_003613	NP_003604	O75339	CILP1_HUMAN	cartilage intermediate layer protein	325	Ig-like C2-type.				negative regulation of insulin-like growth factor receptor signaling pathway	extracellular matrix part|extracellular space|proteinaceous extracellular matrix				ovary(4)|pancreas(2)|skin(1)	7						ACAGAGACACGCTCTGCCCAG	0.498													54	128	---	---	---	---	capture	Silent	SNP	65495753	65495753	CILP	15	G	A	A	A	1	0	0	0	0	0	0	0	1	490	38	1	1	3394	236
SCAMP2	10066	broad.mit.edu	37	15	75137888	75137888	+	Missense_Mutation	SNP	T	G	G			TCGA-32-2494-01	TCGA-32-2494-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:75137888T>G	uc002azb.1	-	8	855	c.781A>C	c.(781-783)ATA>CTA	p.I261L	ULK3_uc010ulp.1_5'Flank|ULK3_uc010ulq.1_5'Flank|ULK3_uc010ulr.1_5'Flank|ULK3_uc010bkf.1_5'Flank|ULK3_uc002ayv.2_5'Flank|ULK3_uc010uls.1_5'Flank|ULK3_uc010ult.1_5'Flank|ULK3_uc010ulu.1_5'Flank|SCAMP2_uc002aza.1_Missense_Mutation_p.I111L|SCAMP2_uc010bkg.1_RNA	NM_005697	NP_005688	O15127	SCAM2_HUMAN	secretory carrier membrane protein 2	261	Lumenal (Potential).				post-Golgi vesicle-mediated transport|protein transport	integral to membrane|nucleus|recycling endosome membrane|trans-Golgi network membrane	protein binding			ovary(1)	1						ATGACTGATATGGCCAGGGAA	0.557													74	146	---	---	---	---	capture	Missense_Mutation	SNP	75137888	75137888	SCAMP2	15	T	G	G	G	1	0	0	0	0	1	0	0	0	663	51	4	4	13763	236
ADCY9	115	broad.mit.edu	37	16	4033331	4033331	+	Silent	SNP	C	T	T			TCGA-32-2494-01	TCGA-32-2494-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:4033331C>T	uc002cvx.2	-	7	2960	c.2421G>A	c.(2419-2421)CTG>CTA	p.L807L		NM_001116	NP_001107	O60503	ADCY9_HUMAN	adenylate cyclase 9	807	Helical; (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to plasma membrane	adenylate cyclase activity|ATP binding|metal ion binding			ovary(4)|large_intestine(1)|central_nervous_system(1)	6						CCTCGTACTTCAGGAAGCAGG	0.637											OREG0023573	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	2	10	---	---	---	---	capture	Silent	SNP	4033331	4033331	ADCY9	16	C	T	T	T	1	0	0	0	0	0	0	0	1	366	29	2	2	301	236
RBL2	5934	broad.mit.edu	37	16	53500990	53500990	+	Silent	SNP	G	T	T			TCGA-32-2494-01	TCGA-32-2494-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:53500990G>T	uc002ehi.3	+	14	2002	c.1884G>T	c.(1882-1884)CTG>CTT	p.L628L	RBL2_uc010vgv.1_Silent_p.L554L|RBL2_uc002ehj.2_Silent_p.L338L|RBL2_uc010vgw.1_Silent_p.L412L	NM_005611	NP_005602	Q08999	RBL2_HUMAN	retinoblastoma-like 2 (p130)	628	Spacer.|Pocket; binds E1A.				cell cycle|chromatin modification|regulation of cell cycle|regulation of lipid kinase activity|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus	DNA binding|protein binding			ovary(2)|lung(2)|upper_aerodigestive_tract(1)	5						CTCAGAACCTGGAAAGGGCAG	0.423													73	259	---	---	---	---	capture	Silent	SNP	53500990	53500990	RBL2	16	G	T	T	T	1	0	0	0	0	0	0	0	1	600	47	4	4	13005	236
NOB1	28987	broad.mit.edu	37	16	69782153	69782153	+	Missense_Mutation	SNP	C	A	A			TCGA-32-2494-01	TCGA-32-2494-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:69782153C>A	uc002exs.2	-	7	822	c.806G>T	c.(805-807)CGC>CTC	p.R269L		NM_014062	NP_054781	Q9ULX3	NOB1_HUMAN	nin one binding protein	269						nucleus	metal ion binding|protein binding				0						GCCATGGCAGCGCAAGATGTA	0.473													4	39	---	---	---	---	capture	Missense_Mutation	SNP	69782153	69782153	NOB1	16	C	A	A	A	1	0	0	0	0	1	0	0	0	351	27	4	4	10418	236
CLDN7	1366	broad.mit.edu	37	17	7163801	7163801	+	Silent	SNP	G	A	A			TCGA-32-2494-01	TCGA-32-2494-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7163801G>A	uc002gfm.3	-	4	961	c.528C>T	c.(526-528)ATC>ATT	p.I176I	CLDN7_uc010cmc.2_3'UTR|CLDN7_uc002gfn.3_Silent_p.I176I	NM_001307	NP_001298	O95471	CLD7_HUMAN	claudin 7	176	Helical; (Potential).				calcium-independent cell-cell adhesion	integral to membrane|lateral plasma membrane|tight junction	identical protein binding|structural molecule activity			ovary(1)	1						CACCTCCCAGGATGACTAGGG	0.572													11	25	---	---	---	---	capture	Silent	SNP	7163801	7163801	CLDN7	17	G	A	A	A	1	0	0	0	0	0	0	0	1	525	41	2	2	3455	236
CDRT15	146822	broad.mit.edu	37	17	14139674	14139674	+	Silent	SNP	G	A	A	rs141627800		TCGA-32-2494-01	TCGA-32-2494-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:14139674G>A	uc010vvu.1	-	2	336	c.336C>T	c.(334-336)GCC>GCT	p.A112A	CDRT15_uc010coq.2_RNA	NM_001007530	NP_001007531	Q96T59	CDRTF_HUMAN	CMT1A duplicated region transcript 15	112											0				UCEC - Uterine corpus endometrioid carcinoma (92;0.0822)		TCTCTGGAGGGGCCTCTTCCC	0.607													9	57	---	---	---	---	capture	Silent	SNP	14139674	14139674	CDRT15	17	G	A	A	A	1	0	0	0	0	0	0	0	1	548	43	2	2	3144	236
NF1	4763	broad.mit.edu	37	17	29508438	29508438	+	Splice_Site	SNP	A	G	G			TCGA-32-2494-01	TCGA-32-2494-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:29508438A>G	uc002hgg.2	+	6	920	c.587_splice	c.e6-2	p.E196_splice	NF1_uc002hge.1_Splice_Site_p.E196_splice|NF1_uc002hgf.1_Splice_Site_p.E196_splice|NF1_uc002hgh.2_Splice_Site_p.E196_splice|NF1_uc010csn.1_Splice_Site_p.E56_splice	NM_001042492	NP_001035957	P21359	NF1_HUMAN	neurofibromin isoform 1						actin cytoskeleton organization|adrenal gland development|artery morphogenesis|camera-type eye morphogenesis|cerebral cortex development|collagen fibril organization|forebrain astrocyte development|forebrain morphogenesis|heart development|liver development|MAPKKK cascade|metanephros development|myelination in peripheral nervous system|negative regulation of cell migration|negative regulation of endothelial cell proliferation|negative regulation of MAP kinase activity|negative regulation of MAPKKK cascade|negative regulation of neuroblast proliferation|negative regulation of oligodendrocyte differentiation|negative regulation of transcription factor import into nucleus|osteoblast differentiation|phosphatidylinositol 3-kinase cascade|pigmentation|positive regulation of adenylate cyclase activity|positive regulation of neuron apoptosis|Ras protein signal transduction|regulation of blood vessel endothelial cell migration|regulation of bone resorption|response to hypoxia|smooth muscle tissue development|spinal cord development|sympathetic nervous system development|visual learning|wound healing	axon|cytoplasm|dendrite|intrinsic to internal side of plasma membrane|nucleus	protein binding|Ras GTPase activator activity			soft_tissue(159)|central_nervous_system(56)|lung(28)|large_intestine(27)|haematopoietic_and_lymphoid_tissue(18)|ovary(18)|autonomic_ganglia(12)|breast(3)|skin(3)|stomach(2)|thyroid(1)|prostate(1)|kidney(1)|pancreas(1)	330		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		TGTTTTTTCCAGAAACAGCAT	0.299			D|Mis|N|F|S|O		neurofibroma|glioma	neurofibroma|glioma			Neurofibromatosis_type_1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)			3	58	---	---	---	---	capture	Splice_Site	SNP	29508438	29508438	NF1	17	A	G	G	G	1	0	0	0	0	0	0	1	0	91	7	5	3	10263	236
TADA2A	6871	broad.mit.edu	37	17	35834667	35834667	+	Missense_Mutation	SNP	G	A	A			TCGA-32-2494-01	TCGA-32-2494-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:35834667G>A	uc002hnt.2	+	15	1236	c.1079G>A	c.(1078-1080)CGG>CAG	p.R360Q	TADA2A_uc002hnv.2_Missense_Mutation_p.R360Q|TADA2A_uc002hnw.2_Missense_Mutation_p.R259Q|TADA2A_uc010cvb.2_Missense_Mutation_p.R156Q	NM_001488	NP_001479	O75478	TAD2A_HUMAN	transcriptional adaptor 2A isoform a	360	SWIRM.				histone H3 acetylation|transcription from RNA polymerase II promoter	chromosome|PCAF complex	DNA binding|sequence-specific DNA binding transcription factor activity|transcription cofactor activity|zinc ion binding			breast(3)|skin(1)	4						ATAGGTAGACGGAGTGCACCA	0.453													5	23	---	---	---	---	capture	Missense_Mutation	SNP	35834667	35834667	TADA2A	17	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	15398	236
KRT12	3859	broad.mit.edu	37	17	39021192	39021192	+	Missense_Mutation	SNP	G	A	A			TCGA-32-2494-01	TCGA-32-2494-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:39021192G>A	uc002hvk.2	-	3	697	c.673C>T	c.(673-675)CGC>TGC	p.R225C		NM_000223	NP_000214	Q99456	K1C12_HUMAN	keratin 12	225	Rod.|Coil 1B.				visual perception	intermediate filament	structural molecule activity			ovary(1)	1		Breast(137;0.000301)				ACGCCCTGGCGCAGGGCCAGT	0.552													27	71	---	---	---	---	capture	Missense_Mutation	SNP	39021192	39021192	KRT12	17	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	8369	236
TANC2	26115	broad.mit.edu	37	17	61466072	61466072	+	Missense_Mutation	SNP	C	G	G			TCGA-32-2494-01	TCGA-32-2494-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:61466072C>G	uc002jal.3	+	14	2569	c.2546C>G	c.(2545-2547)TCC>TGC	p.S849C	TANC2_uc010wpe.1_Missense_Mutation_p.S759C|TANC2_uc002jan.1_5'UTR|TANC2_uc002jao.3_5'Flank|TANC2_uc002jam.1_Missense_Mutation_p.S216C	NM_025185	NP_079461	Q9HCD6	TANC2_HUMAN	tetratricopeptide repeat, ankyrin repeat and	849	ANK 1.						binding			ovary(2)	2						GAAGGTCTTTCCATGGCACTG	0.323													2	24	---	---	---	---	capture	Missense_Mutation	SNP	61466072	61466072	TANC2	17	C	G	G	G	1	0	0	0	0	1	0	0	0	390	30	4	4	15433	236
SERPINB10	5273	broad.mit.edu	37	18	61585321	61585321	+	Silent	SNP	G	A	A			TCGA-32-2494-01	TCGA-32-2494-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:61585321G>A	uc010xev.1	+	4	447	c.357G>A	c.(355-357)ACG>ACA	p.T119T	SERPINB10_uc010xew.1_Silent_p.T119T	NM_005024	NP_005015	P48595	SPB10_HUMAN	serine (or cysteine) proteinase inhibitor, clade	119						cytoplasm|nucleus	serine-type endopeptidase inhibitor activity	p.T119T(1)		lung(1)|kidney(1)|skin(1)	3		Esophageal squamous(42;0.131)				GAGAGAAAACGTATGCATTTC	0.348													30	80	---	---	---	---	capture	Silent	SNP	61585321	61585321	SERPINB10	18	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	13990	236
GZMM	3004	broad.mit.edu	37	19	547333	547333	+	Missense_Mutation	SNP	C	T	T	rs148691419	byFrequency	TCGA-32-2494-01	TCGA-32-2494-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:547333C>T	uc002low.1	+	2	154	c.109C>T	c.(109-111)CGC>TGC	p.R37C		NM_005317	NP_005308	P51124	GRAM_HUMAN	granzyme M precursor	37	Peptidase S1.				apoptosis|cytolysis|innate immune response|proteolysis	extracellular region	serine-type endopeptidase activity				0		all_cancers(10;1.94e-35)|all_epithelial(18;5.94e-23)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CCCCCACTCGCGCCCGTACAT	0.662													57	140	---	---	---	---	capture	Missense_Mutation	SNP	547333	547333	GZMM	19	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	6848	236
FSD1	79187	broad.mit.edu	37	19	4323057	4323057	+	Missense_Mutation	SNP	G	A	A			TCGA-32-2494-01	TCGA-32-2494-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:4323057G>A	uc002lzy.2	+	11	1267	c.1114G>A	c.(1114-1116)GGC>AGC	p.G372S	FSD1_uc002lzz.2_Missense_Mutation_p.G372S|FSD1_uc002maa.2_Missense_Mutation_p.G185S	NM_024333	NP_077309	Q9BTV5	FSD1_HUMAN	fibronectin type III and SPRY domain containing	372	B30.2/SPRY.				cell division|mitosis	cleavage furrow|microtubule|microtubule organizing center|nucleus				skin(1)	1				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.034)|STAD - Stomach adenocarcinoma(1328;0.18)		GTTCGGCGTGGGCGTGGCCTA	0.687													11	25	---	---	---	---	capture	Missense_Mutation	SNP	4323057	4323057	FSD1	19	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	6013	236
ZNF799	90576	broad.mit.edu	37	19	12501446	12501446	+	Missense_Mutation	SNP	T	C	C			TCGA-32-2494-01	TCGA-32-2494-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:12501446T>C	uc010dyt.2	-	4	1916	c.1766A>G	c.(1765-1767)GAA>GGA	p.E589G	ZNF799_uc002mts.3_Intron	NM_001080821	NP_001074290	Q96GE5	ZN799_HUMAN	zinc finger protein 799	589	C2H2-type 17.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(3)|ovary(2)|skin(1)	6						TTCCTTACATTCATACGGGTT	0.413													4	179	---	---	---	---	capture	Missense_Mutation	SNP	12501446	12501446	ZNF799	19	T	C	C	C	1	0	0	0	0	1	0	0	0	806	62	3	3	18042	236
KPTN	11133	broad.mit.edu	37	19	47979804	47979804	+	Silent	SNP	G	A	A			TCGA-32-2494-01	TCGA-32-2494-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:47979804G>A	uc002pgy.2	-	11	1271	c.1167C>T	c.(1165-1167)GGC>GGT	p.G389G	KPTN_uc010xys.1_RNA	NM_007059	NP_008990	Q9Y664	KPTN_HUMAN	kaptin (actin binding protein)	389					actin filament organization|cellular component movement|sensory perception of sound	actin cytoskeleton|growth cone|microtubule organizing center|nucleus|perinuclear region of cytoplasm|stereocilium	actin binding			ovary(1)	1		all_cancers(25;1.55e-10)|all_epithelial(76;3.4e-08)|all_lung(116;1.73e-07)|Lung NSC(112;3.95e-07)|Ovarian(192;0.0139)|all_neural(266;0.026)|Breast(70;0.0503)		OV - Ovarian serous cystadenocarcinoma(262;0.000428)|all cancers(93;0.000631)|Epithelial(262;0.0153)|GBM - Glioblastoma multiforme(486;0.0694)		GGATGTGCACGCCCTTCAGGG	0.627													3	44	---	---	---	---	capture	Silent	SNP	47979804	47979804	KPTN	19	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	8357	236
TNNT1	7138	broad.mit.edu	37	19	55645562	55645562	+	Missense_Mutation	SNP	C	G	G			TCGA-32-2494-01	TCGA-32-2494-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:55645562C>G	uc002qjb.3	-	12	711	c.622G>C	c.(622-624)GCC>CCC	p.A208P	TNNT1_uc002qiz.3_Intron|TNNT1_uc002qja.3_Intron|TNNT1_uc002qjc.3_Intron|TNNT1_uc002qje.3_Intron|TNNT1_uc002qjd.3_Intron	NM_003283	NP_003274	P13805	TNNT1_HUMAN	troponin T1, skeletal, slow isoform a	208					muscle filament sliding|negative regulation of muscle contraction	cytosol|troponin complex	tropomyosin binding			ovary(1)	1			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.047)		GGCAGCCAGGCAGACCGGGCC	0.448													2	14	---	---	---	---	capture	Missense_Mutation	SNP	55645562	55645562	TNNT1	19	C	G	G	G	1	0	0	0	0	1	0	0	0	325	25	4	4	16213	236
LHCGR	3973	broad.mit.edu	37	2	48915481	48915481	+	Silent	SNP	C	A	A			TCGA-32-2494-01	TCGA-32-2494-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:48915481C>A	uc002rwu.3	-	11	1525	c.1455G>T	c.(1453-1455)CTG>CTT	p.L485L	GTF2A1L_uc002rwt.2_Intron	NM_000233	NP_000224	P22888	LSHR_HUMAN	luteinizing hormone/choriogonadotropin receptor	485	Helical; Name=4; (Potential).				male genitalia development|male gonad development	endosome|integral to plasma membrane	luteinizing hormone receptor activity			ovary(3)|lung(2)|breast(2)|skin(1)	8		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.176)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		Cetrorelix(DB00050)|Choriogonadotropin alfa(DB00097)|Goserelin(DB00014)|Lutropin alfa(DB00044)|Menotropins(DB00032)	CAAGCATAATCAGAATGGCAT	0.453									Familial_Male-Limited_Precocious_Puberty				42	78	---	---	---	---	capture	Silent	SNP	48915481	48915481	LHCGR	2	C	A	A	A	1	0	0	0	0	0	0	0	1	366	29	4	4	8682	236
CKAP2L	150468	broad.mit.edu	37	2	113514209	113514209	+	Missense_Mutation	SNP	C	T	T			TCGA-32-2494-01	TCGA-32-2494-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:113514209C>T	uc002tie.2	-	4	818	c.739G>A	c.(739-741)GGA>AGA	p.G247R	CKAP2L_uc002tif.2_Intron|CKAP2L_uc010yxp.1_Missense_Mutation_p.G82R|CKAP2L_uc010yxq.1_Missense_Mutation_p.G82R	NM_152515	NP_689728	Q8IYA6	CKP2L_HUMAN	cytoskeleton associated protein 2-like	247						centrosome					0						TGTGTTTCTCCAACAAATTGT	0.403													51	150	---	---	---	---	capture	Missense_Mutation	SNP	113514209	113514209	CKAP2L	2	C	T	T	T	1	0	0	0	0	1	0	0	0	273	21	2	2	3408	236
TRAK2	66008	broad.mit.edu	37	2	202250994	202250994	+	Missense_Mutation	SNP	G	T	T			TCGA-32-2494-01	TCGA-32-2494-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:202250994G>T	uc002uyb.3	-	14	2356	c.1910C>A	c.(1909-1911)CCA>CAA	p.P637Q		NM_015049	NP_055864	O60296	TRAK2_HUMAN	trafficking protein, kinesin binding 2	637				Missing (in Ref. 2).		early endosome|plasma membrane	GABA receptor binding				0						CCCTGTTACTGGCTTGGATGT	0.418													3	123	---	---	---	---	capture	Missense_Mutation	SNP	202250994	202250994	TRAK2	2	G	T	T	T	1	0	0	0	0	1	0	0	0	611	47	4	4	16333	236
KRTAP19-5	337972	broad.mit.edu	37	21	31874370	31874370	+	Silent	SNP	G	A	A			TCGA-32-2494-01	TCGA-32-2494-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:31874370G>A	uc011ada.1	-	1	39	c.39C>T	c.(37-39)TAC>TAT	p.Y13Y		NM_181611	NP_853642	Q3LI72	KR195_HUMAN	keratin associated protein 19-5	13						intermediate filament	protein binding				0						CTCCGTAGCCGTAGCCCAGGC	0.572													24	53	---	---	---	---	capture	Silent	SNP	31874370	31874370	KRTAP19-5	21	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	8452	236
KRTAP6-1	337966	broad.mit.edu	37	21	31986219	31986219	+	Missense_Mutation	SNP	C	T	T	rs146113466		TCGA-32-2494-01	TCGA-32-2494-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:31986219C>T	uc002yop.2	-	1	5	c.5G>A	c.(4-6)TGT>TAT	p.C2Y	KRTAP20-1_uc011ade.1_5'Flank	NM_181602	NP_853633	Q3LI64	KRA61_HUMAN	keratin associated protein 6-1	2						cytosol|intermediate filament					0						GTAGCTGCCACACATGGTGTT	0.547													9	123	---	---	---	---	capture	Missense_Mutation	SNP	31986219	31986219	KRTAP6-1	21	C	T	T	T	1	0	0	0	0	1	0	0	0	221	17	2	2	8489	236
SBF1	6305	broad.mit.edu	37	22	50886843	50886843	+	Missense_Mutation	SNP	C	T	T			TCGA-32-2494-01	TCGA-32-2494-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:50886843C>T	uc003blh.2	-	38	5377	c.5182G>A	c.(5182-5184)GCA>ACA	p.A1728T	SBF1_uc003ble.2_Missense_Mutation_p.A192T|SBF1_uc003blf.2_Missense_Mutation_p.A204T|SBF1_uc011arx.1_Missense_Mutation_p.A1366T	NM_002972	NP_002963	O95248	MTMR5_HUMAN	SET binding factor 1	1702					protein dephosphorylation	integral to membrane|nucleus	protein tyrosine/serine/threonine phosphatase activity				0		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.206)|LUAD - Lung adenocarcinoma(64;0.247)		TGGTGGGGTGCGGTGGACACA	0.657													14	48	---	---	---	---	capture	Missense_Mutation	SNP	50886843	50886843	SBF1	22	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	13750	236
CNTN6	27255	broad.mit.edu	37	3	1339583	1339583	+	Silent	SNP	G	T	T			TCGA-32-2494-01	TCGA-32-2494-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:1339583G>T	uc003boz.2	+	7	936	c.669G>T	c.(667-669)GGG>GGT	p.G223G	CNTN6_uc010hbo.2_Silent_p.G218G|CNTN6_uc011asj.1_Silent_p.G151G|CNTN6_uc003bpa.2_Silent_p.G223G	NM_014461	NP_055276	Q9UQ52	CNTN6_HUMAN	contactin 6 precursor	223					axon guidance|cell adhesion|central nervous system development|Notch signaling pathway	anchored to membrane|plasma membrane				skin(3)|lung(2)|breast(2)|pancreas(1)	8		all_cancers(2;0.000164)|all_epithelial(2;0.107)		Epithelial(13;0.000233)|all cancers(10;0.0013)|OV - Ovarian serous cystadenocarcinoma(96;0.0139)		GTGTGATGGGGGAATATGAAC	0.353													45	145	---	---	---	---	capture	Silent	SNP	1339583	1339583	CNTN6	3	G	T	T	T	1	0	0	0	0	0	0	0	1	548	43	4	4	3610	236
ITPR1	3708	broad.mit.edu	37	3	4856788	4856788	+	Missense_Mutation	SNP	G	A	A			TCGA-32-2494-01	TCGA-32-2494-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:4856788G>A	uc003bqa.2	+	56	7957	c.7609G>A	c.(7609-7611)GTC>ATC	p.V2537I	ITPR1_uc010hca.1_Missense_Mutation_p.V2522I|ITPR1_uc011asu.1_Missense_Mutation_p.V548I|ITPR1_uc003bqc.2_Missense_Mutation_p.V1507I|ITPR1_uc010hcc.1_Missense_Mutation_p.V305I|ITPR1_uc011asv.1_Missense_Mutation_p.V261I	NM_001099952	NP_001093422	Q14643	ITPR1_HUMAN	inositol 1,4,5-triphosphate receptor, type 1	2585	Helical; (Potential).				activation of phospholipase C activity|cell death|energy reserve metabolic process|nerve growth factor receptor signaling pathway|platelet activation|regulation of insulin secretion|response to hypoxia	endoplasmic reticulum membrane|integral to membrane|platelet dense granule membrane|platelet dense tubular network membrane	calcium ion transmembrane transporter activity|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity|intracellular ligand-gated calcium channel activity|phosphatidylinositol binding|protein binding			lung(7)|breast(5)|ovary(4)|large_intestine(1)|liver(1)|skin(1)|kidney(1)|pancreas(1)	21				Epithelial(13;0.0199)|OV - Ovarian serous cystadenocarcinoma(96;0.0361)|all cancers(10;0.0982)		CTTCTTCATGGTCATCATCAT	0.448													4	224	---	---	---	---	capture	Missense_Mutation	SNP	4856788	4856788	ITPR1	3	G	A	A	A	1	0	0	0	0	1	0	0	0	572	44	2	2	7843	236
ATP2B2	491	broad.mit.edu	37	3	10452358	10452358	+	Missense_Mutation	SNP	G	A	A			TCGA-32-2494-01	TCGA-32-2494-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:10452358G>A	uc003bvt.2	-	3	780	c.341C>T	c.(340-342)GCC>GTC	p.A114V	ATP2B2_uc003bvv.2_Missense_Mutation_p.A114V|ATP2B2_uc003bvw.2_Missense_Mutation_p.A114V|ATP2B2_uc010hdp.2_Missense_Mutation_p.A114V|ATP2B2_uc010hdo.2_5'UTR	NM_001001331	NP_001001331	Q01814	AT2B2_HUMAN	plasma membrane calcium ATPase 2 isoform 1	114	Helical; (Potential).				ATP biosynthetic process|cytosolic calcium ion homeostasis|platelet activation	cytosol|integral to membrane|plasma membrane	ATP binding|ATP binding|calcium ion binding|calcium-transporting ATPase activity|calcium-transporting ATPase activity|calmodulin binding|calmodulin binding|metal ion binding|PDZ domain binding|protein C-terminus binding			ovary(3)|skin(2)|central_nervous_system(1)	6						GATGATGGCGGCAATCTCCAG	0.592													6	397	---	---	---	---	capture	Missense_Mutation	SNP	10452358	10452358	ATP2B2	3	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	1131	236
C3orf20	84077	broad.mit.edu	37	3	14799018	14799018	+	Missense_Mutation	SNP	A	C	C			TCGA-32-2494-01	TCGA-32-2494-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:14799018A>C	uc003byy.2	+	13	2485	c.2081A>C	c.(2080-2082)GAC>GCC	p.D694A	C3orf20_uc003byz.2_Missense_Mutation_p.D572A|C3orf20_uc003bza.2_Missense_Mutation_p.D572A|C3orf20_uc003bzb.1_Missense_Mutation_p.D195A|C3orf20_uc011avj.1_Missense_Mutation_p.D21A	NM_032137	NP_115513	Q8ND61	CC020_HUMAN	hypothetical protein LOC84077	694						cytoplasm|integral to membrane				ovary(3)|skin(1)	4						CTGGTCTCTGACGTGGAGCTG	0.632													33	100	---	---	---	---	capture	Missense_Mutation	SNP	14799018	14799018	C3orf20	3	A	C	C	C	1	0	0	0	0	1	0	0	0	130	10	4	4	2193	236
MYRIP	25924	broad.mit.edu	37	3	40231528	40231528	+	Silent	SNP	G	A	A			TCGA-32-2494-01	TCGA-32-2494-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:40231528G>A	uc003cka.2	+	10	1374	c.1239G>A	c.(1237-1239)AGG>AGA	p.R413R	MYRIP_uc010hhu.2_RNA|MYRIP_uc010hhv.2_Silent_p.R413R|MYRIP_uc010hhw.2_Silent_p.R324R|MYRIP_uc011ayz.1_Silent_p.R226R|uc003ckb.2_Intron	NM_015460	NP_056275	Q8NFW9	MYRIP_HUMAN	myosin VIIA and Rab interacting protein	413	Myosin-binding.				intracellular protein transport		actin binding|zinc ion binding			ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	5				KIRC - Kidney renal clear cell carcinoma(284;0.174)|Kidney(284;0.206)		TGTGTCCCAGGTCCCGGGCCC	0.637													46	105	---	---	---	---	capture	Silent	SNP	40231528	40231528	MYRIP	3	G	A	A	A	1	0	0	0	0	0	0	0	1	568	44	2	2	10010	236
PIK3CB	5291	broad.mit.edu	37	3	138374244	138374244	+	Missense_Mutation	SNP	T	G	G			TCGA-32-2494-01	TCGA-32-2494-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:138374244T>G	uc011bmq.1	-	22	3200	c.3200A>C	c.(3199-3201)GAC>GCC	p.D1067A	PIK3CB_uc011bmn.1_Missense_Mutation_p.D579A|PIK3CB_uc011bmo.1_Missense_Mutation_p.D518A|PIK3CB_uc011bmp.1_Missense_Mutation_p.D654A|PIK3CB_uc003est.1_RNA	NM_006219	NP_006210	P42338	PK3CB_HUMAN	catalytic phosphatidylinositol 3-kinase beta	1067	PI3K/PI4K.				activation of MAPK activity|chemotaxis|fibroblast growth factor receptor signaling pathway|G-protein coupled receptor protein signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell receptor signaling pathway	phosphatidylinositol 3-kinase complex	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity			breast(2)|ovary(1)|lung(1)|skin(1)	5						AGATCTGTAGTCTTTCCGAAC	0.408													60	143	---	---	---	---	capture	Missense_Mutation	SNP	138374244	138374244	PIK3CB	3	T	G	G	G	1	0	0	0	0	1	0	0	0	754	58	4	4	11817	236
PIK3CB	5291	broad.mit.edu	37	3	138374281	138374281	+	Missense_Mutation	SNP	T	C	C			TCGA-32-2494-01	TCGA-32-2494-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:138374281T>C	uc011bmq.1	-	22	3163	c.3163A>G	c.(3163-3165)ACT>GCT	p.T1055A	PIK3CB_uc011bmn.1_Missense_Mutation_p.T567A|PIK3CB_uc011bmo.1_Missense_Mutation_p.T506A|PIK3CB_uc011bmp.1_Missense_Mutation_p.T642A|PIK3CB_uc003est.1_RNA	NM_006219	NP_006210	P42338	PK3CB_HUMAN	catalytic phosphatidylinositol 3-kinase beta	1055	PI3K/PI4K.				activation of MAPK activity|chemotaxis|fibroblast growth factor receptor signaling pathway|G-protein coupled receptor protein signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell receptor signaling pathway	phosphatidylinositol 3-kinase complex	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity			breast(2)|ovary(1)|lung(1)|skin(1)	5						TTCACTTTAGTAGTCCAGCTT	0.413													49	145	---	---	---	---	capture	Missense_Mutation	SNP	138374281	138374281	PIK3CB	3	T	C	C	C	1	0	0	0	0	1	0	0	0	741	57	3	3	11817	236
KCNAB1	7881	broad.mit.edu	37	3	155838668	155838668	+	Missense_Mutation	SNP	C	T	T			TCGA-32-2494-01	TCGA-32-2494-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:155838668C>T	uc003far.2	+	1	332	c.268C>T	c.(268-270)CCG>TCG	p.P90S	KCNAB1_uc011bon.1_Missense_Mutation_p.P90S	NM_172160	NP_751892	Q14722	KCAB1_HUMAN	potassium voltage-gated channel, shaker-related	90						cytoplasm|integral to membrane	oxidoreductase activity|potassium channel regulator activity|voltage-gated potassium channel activity			ovary(3)|skin(1)	4			LUSC - Lung squamous cell carcinoma(72;0.0461)|Lung(72;0.0465)			CACAGGCATGCCGCACAGGTA	0.592													3	76	---	---	---	---	capture	Missense_Mutation	SNP	155838668	155838668	KCNAB1	3	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	7931	236
VPS8	23355	broad.mit.edu	37	3	184543975	184543975	+	Missense_Mutation	SNP	C	G	G			TCGA-32-2494-01	TCGA-32-2494-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:184543975C>G	uc003fpb.1	+	3	349	c.178C>G	c.(178-180)CCT>GCT	p.P60A	VPS8_uc010hyd.1_Missense_Mutation_p.P60A|VPS8_uc003fpc.1_Missense_Mutation_p.P60A	NM_015303	NP_056118	Q8N3P4	VPS8_HUMAN	vacuolar protein sorting 8 homolog isoform b	60							zinc ion binding			ovary(1)	1	all_cancers(143;2.51e-11)|Ovarian(172;0.0339)|Breast(254;0.247)		Epithelial(37;1.02e-33)|OV - Ovarian serous cystadenocarcinoma(80;4.81e-22)			GTTTGATATTCCTCAAGTTGA	0.318													20	38	---	---	---	---	capture	Missense_Mutation	SNP	184543975	184543975	VPS8	3	C	G	G	G	1	0	0	0	0	1	0	0	0	390	30	4	4	17100	236
ACAP2	23527	broad.mit.edu	37	3	195012473	195012473	+	Silent	SNP	C	T	T			TCGA-32-2494-01	TCGA-32-2494-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:195012473C>T	uc003fun.3	-	20	2266	c.2025G>A	c.(2023-2025)CGG>CGA	p.R675R		NM_012287	NP_036419	Q15057	ACAP2_HUMAN	centaurin, beta 2	675	ANK 2.				regulation of ARF GTPase activity		ARF GTPase activator activity|zinc ion binding			large_intestine(1)|ovary(1)	2						GCAATGGTCCCCGCCCTTGGA	0.413													30	91	---	---	---	---	capture	Silent	SNP	195012473	195012473	ACAP2	3	C	T	T	T	1	0	0	0	0	0	0	0	1	275	22	2	2	119	236
AFF1	4299	broad.mit.edu	37	4	88048823	88048823	+	Missense_Mutation	SNP	G	A	A			TCGA-32-2494-01	TCGA-32-2494-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:88048823G>A	uc003hqj.3	+	15	3318	c.2911G>A	c.(2911-2913)GCA>ACA	p.A971T	AFF1_uc011ccz.1_Missense_Mutation_p.A978T|AFF1_uc003hqk.3_Missense_Mutation_p.A971T|AFF1_uc011cda.1_Missense_Mutation_p.A609T	NM_005935	NP_005926	P51825	AFF1_HUMAN	myeloid/lymphoid or mixed-lineage leukemia	971						nucleus	sequence-specific DNA binding transcription factor activity			breast(1)	1		Acute lymphoblastic leukemia(40;0.0935)|all_hematologic(202;0.111)|Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000233)		CATGAGGGAGGCAAAAAAGAT	0.378													4	146	---	---	---	---	capture	Missense_Mutation	SNP	88048823	88048823	AFF1	4	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	356	236
NR3C2	4306	broad.mit.edu	37	4	149181209	149181209	+	Missense_Mutation	SNP	A	C	C			TCGA-32-2494-01	TCGA-32-2494-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:149181209A>C	uc003ilj.3	-	3	2152	c.1818T>G	c.(1816-1818)TGT>TGG	p.C606W	NR3C2_uc003ilk.3_Missense_Mutation_p.C606W|NR3C2_uc010iph.2_RNA	NM_000901	NP_000892	P08235	MCR_HUMAN	nuclear receptor subfamily 3, group C, member 2	606	NR C4-type.|Nuclear receptor.				regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	endoplasmic reticulum membrane|nucleoplasm	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid binding|steroid hormone receptor activity|zinc ion binding			large_intestine(1)	1	all_hematologic(180;0.151)			GBM - Glioblastoma multiforme(119;0.0614)	Desoxycorticosterone Pivalate(DB01134)|Eplerenone(DB00700)|Fludrocortisone(DB00687)|Spironolactone(DB00421)	CCTCATCCCCACACACCAAAC	0.413													42	122	---	---	---	---	capture	Missense_Mutation	SNP	149181209	149181209	NR3C2	4	A	C	C	C	1	0	0	0	0	1	0	0	0	76	6	4	4	10538	236
POC5	134359	broad.mit.edu	37	5	74998543	74998543	+	Missense_Mutation	SNP	T	C	C			TCGA-32-2494-01	TCGA-32-2494-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:74998543T>C	uc003keh.3	-	5	597	c.400A>G	c.(400-402)ACA>GCA	p.T134A	POC5_uc010izu.2_Missense_Mutation_p.T17A|POC5_uc003keg.3_Missense_Mutation_p.T109A	NM_001099271	NP_001092741	Q8NA72	POC5_HUMAN	proteome of centriole 5 isoform 1	134					cell cycle	centriole				lung(1)	1						CTAGAATTTGTTGCTGGTGAG	0.403													2	19	---	---	---	---	capture	Missense_Mutation	SNP	74998543	74998543	POC5	5	T	C	C	C	1	0	0	0	0	1	0	0	0	780	60	3	3	12080	236
HIVEP1	3096	broad.mit.edu	37	6	12121493	12121493	+	Missense_Mutation	SNP	G	A	A			TCGA-32-2494-01	TCGA-32-2494-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:12121493G>A	uc003nac.2	+	4	1644	c.1465G>A	c.(1465-1467)GTA>ATA	p.V489I	HIVEP1_uc011diq.1_RNA	NM_002114	NP_002105	P15822	ZEP1_HUMAN	human immunodeficiency virus type I enhancer	489					transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|protein binding|zinc ion binding			ovary(3)|large_intestine(1)|central_nervous_system(1)|skin(1)	6	Breast(50;0.0639)|Ovarian(93;0.0816)	all_hematologic(90;0.117)				TCATTCAGACGTAGAAGACAG	0.527													35	76	---	---	---	---	capture	Missense_Mutation	SNP	12121493	12121493	HIVEP1	6	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	7111	236
SNX14	57231	broad.mit.edu	37	6	86258062	86258062	+	Missense_Mutation	SNP	G	C	C			TCGA-32-2494-01	TCGA-32-2494-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:86258062G>C	uc003pkr.2	-	9	1017	c.824C>G	c.(823-825)TCT>TGT	p.S275C	SNX14_uc003pkp.2_Missense_Mutation_p.S138C|SNX14_uc003pkq.2_5'UTR|SNX14_uc011dzg.1_Missense_Mutation_p.S223C|SNX14_uc003pks.2_Missense_Mutation_p.S231C|SNX14_uc003pkt.2_Missense_Mutation_p.S275C	NM_153816	NP_722523	Q9Y5W7	SNX14_HUMAN	sorting nexin 14 isoform a	275	PXA.				cell communication|protein transport	integral to membrane	phosphatidylinositol binding|signal transducer activity				0		all_cancers(76;4.83e-07)|Acute lymphoblastic leukemia(125;3.3e-08)|Prostate(29;2.55e-07)|all_hematologic(105;3.66e-05)|all_epithelial(107;0.000695)|Lung NSC(302;0.197)|all_lung(197;0.24)		BRCA - Breast invasive adenocarcinoma(108;0.0423)		CACAGAGCCAGACAGAATCTC	0.219													24	55	---	---	---	---	capture	Missense_Mutation	SNP	86258062	86258062	SNX14	6	G	C	C	C	1	0	0	0	0	1	0	0	0	429	33	4	4	14777	236
SIM1	6492	broad.mit.edu	37	6	100901720	100901720	+	Missense_Mutation	SNP	C	T	T			TCGA-32-2494-01	TCGA-32-2494-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:100901720C>T	uc003pqj.3	-	2	383	c.176G>A	c.(175-177)GGG>GAG	p.G59E	SIM1_uc010kcu.2_Missense_Mutation_p.G59E	NM_005068	NP_005059	P81133	SIM1_HUMAN	single-minded homolog 1	59					cell differentiation|nervous system development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|signal transducer activity			ovary(4)	4		all_cancers(76;9.88e-06)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0248)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0774)		CTCGCCGAGCCCTGTGGAGAC	0.627													12	39	---	---	---	---	capture	Missense_Mutation	SNP	100901720	100901720	SIM1	6	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	14216	236
BVES	11149	broad.mit.edu	37	6	105549004	105549004	+	Missense_Mutation	SNP	G	A	A	rs138992583		TCGA-32-2494-01	TCGA-32-2494-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:105549004G>A	uc003pqw.2	-	8	1200	c.1043C>T	c.(1042-1044)CCG>CTG	p.P348L	BVES_uc003pqx.2_Missense_Mutation_p.P348L|BVES_uc003pqy.2_Missense_Mutation_p.P348L	NM_147147	NP_671488	Q8NE79	POPD1_HUMAN	blood vessel epicardial substance isoform 5	348	Cytoplasmic (Potential).				epithelial cell-cell adhesion|muscle organ development|positive regulation of locomotion|positive regulation of receptor recycling|regulation of Cdc42 GTPase activity|regulation of cell shape|regulation of Rac GTPase activity|substrate adhesion-dependent cell spreading|vesicle-mediated transport	integral to membrane|lateral plasma membrane|tight junction	structural molecule activity				0		all_cancers(87;2.83e-05)|Acute lymphoblastic leukemia(125;1.95e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0101)|Colorectal(196;0.204)|Lung NSC(302;0.238)				TGGAGATGCCGGTTCAAAAAC	0.453													3	140	---	---	---	---	capture	Missense_Mutation	SNP	105549004	105549004	BVES	6	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	1563	236
TIAM2	26230	broad.mit.edu	37	6	155498003	155498003	+	Missense_Mutation	SNP	C	A	A			TCGA-32-2494-01	TCGA-32-2494-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:155498003C>A	uc003qqb.2	+	12	3688	c.2415C>A	c.(2413-2415)GAC>GAA	p.D805E	TIAM2_uc003qqe.2_Missense_Mutation_p.D805E|TIAM2_uc010kjj.2_Missense_Mutation_p.D338E|TIAM2_uc003qqf.2_Missense_Mutation_p.D181E|TIAM2_uc011efl.1_Missense_Mutation_p.D141E|TIAM2_uc003qqg.2_Missense_Mutation_p.D117E	NM_012454	NP_036586	Q8IVF5	TIAM2_HUMAN	T-cell lymphoma invasion and metastasis 2	805					apoptosis|cellular lipid metabolic process|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|filopodium|growth cone|lamellipodium	receptor signaling protein activity|Rho guanyl-nucleotide exchange factor activity			ovary(3)|breast(1)	4		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;8.1e-13)|BRCA - Breast invasive adenocarcinoma(81;0.0053)		TTCCCCGAGACAATGCATGGG	0.408													7	224	---	---	---	---	capture	Missense_Mutation	SNP	155498003	155498003	TIAM2	6	C	A	A	A	1	0	0	0	0	1	0	0	0	220	17	4	4	15776	236
FNDC1	84624	broad.mit.edu	37	6	159672498	159672498	+	Missense_Mutation	SNP	G	A	A			TCGA-32-2494-01	TCGA-32-2494-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:159672498G>A	uc010kjv.2	+	17	5199	c.4999G>A	c.(4999-5001)GTG>ATG	p.V1667M		NM_032532	NP_115921	Q4ZHG4	FNDC1_HUMAN	fibronectin type III domain containing 1	1667	Fibronectin type-III 5.					extracellular region				large_intestine(4)|ovary(3)|central_nervous_system(1)	8		Breast(66;0.000781)|Ovarian(120;0.0308)|Prostate(117;0.195)		OV - Ovarian serous cystadenocarcinoma(65;2.6e-16)|BRCA - Breast invasive adenocarcinoma(81;1.06e-05)		CGTGGTGGCCGTGGAAGGTTG	0.537													16	37	---	---	---	---	capture	Missense_Mutation	SNP	159672498	159672498	FNDC1	6	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	5912	236
MAD1L1	8379	broad.mit.edu	37	7	2255875	2255875	+	Silent	SNP	C	T	T			TCGA-32-2494-01	TCGA-32-2494-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:2255875C>T	uc003slh.1	-	8	992	c.726G>A	c.(724-726)GTG>GTA	p.V242V	MAD1L1_uc003sle.1_5'Flank|MAD1L1_uc003slf.1_Silent_p.V242V|MAD1L1_uc003slg.1_Silent_p.V242V|MAD1L1_uc010ksh.1_Silent_p.V242V|MAD1L1_uc003sli.1_Silent_p.V150V|MAD1L1_uc010ksi.1_Silent_p.V195V|MAD1L1_uc010ksj.2_Silent_p.V242V	NM_001013836	NP_001013858	Q9Y6D9	MD1L1_HUMAN	MAD1-like 1 protein	242	Potential.				cell division|mitotic anaphase|mitotic cell cycle spindle assembly checkpoint|mitotic metaphase|mitotic prometaphase|mitotic telophase	actin cytoskeleton|centrosome|condensed chromosome kinetochore|cytosol|mitochondrion|nucleus|spindle	protein binding			lung(1)|central_nervous_system(1)	2		Ovarian(82;0.0272)		UCEC - Uterine corpus endometrioid carcinoma (27;0.134)|OV - Ovarian serous cystadenocarcinoma(56;3.63e-14)		TCATGTTCTTCACAATCGCTG	0.493													20	59	---	---	---	---	capture	Silent	SNP	2255875	2255875	MAD1L1	7	C	T	T	T	1	0	0	0	0	0	0	0	1	366	29	2	2	9062	236
HOXA13	3209	broad.mit.edu	37	7	27238936	27238936	+	Missense_Mutation	SNP	A	G	G			TCGA-32-2494-01	TCGA-32-2494-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:27238936A>G	uc003szb.1	-	1	790	c.761T>C	c.(760-762)GTG>GCG	p.V254A	uc003szc.1_5'Flank	NM_000522	NP_000513	P31271	HXA13_HUMAN	homeobox A13	254					skeletal system development	nucleus	sequence-specific DNA binding			breast(1)	1						GCCCGGCACCACTGGCATATC	0.672			T	NUP98	AML								11	49	---	---	---	---	capture	Missense_Mutation	SNP	27238936	27238936	HOXA13	7	A	G	G	G	1	0	0	0	0	1	0	0	0	78	6	3	3	7216	236
ZNF479	90827	broad.mit.edu	37	7	57187809	57187809	+	Missense_Mutation	SNP	T	G	G			TCGA-32-2494-01	TCGA-32-2494-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:57187809T>G	uc010kzo.2	-	5	1584	c.1313A>C	c.(1312-1314)AAA>ACA	p.K438T		NM_033273	NP_150376	Q96JC4	ZN479_HUMAN	zinc finger protein 479	438	C2H2-type 10.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(3)|skin(1)	4			GBM - Glioblastoma multiforme(1;9.18e-12)			TTCTTCACATTTGTAGGGTCT	0.453													3	167	---	---	---	---	capture	Missense_Mutation	SNP	57187809	57187809	ZNF479	7	T	G	G	G	1	0	0	0	0	1	0	0	0	832	64	4	4	17812	236
ASZ1	136991	broad.mit.edu	37	7	117067510	117067510	+	Missense_Mutation	SNP	G	A	A			TCGA-32-2494-01	TCGA-32-2494-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:117067510G>A	uc003vjb.2	-	1	68	c.5C>T	c.(4-6)GCG>GTG	p.A2V	ASZ1_uc011kno.1_Missense_Mutation_p.A2V|ASZ1_uc011knp.1_5'UTR	NM_130768	NP_570124	Q8WWH4	ASZ1_HUMAN	ankyrin repeat, SAM and basic leucine zipper	2					cell differentiation|DNA methylation involved in gamete generation|gene silencing by RNA|male meiosis|multicellular organismal development|piRNA metabolic process|spermatogenesis	pi-body	signal transducer activity			central_nervous_system(2)|ovary(1)	3	Lung NSC(10;0.00156)|all_lung(10;0.00175)		STAD - Stomach adenocarcinoma(10;0.000512)			CGCGCTCGCCGCCATGCCAGC	0.692											OREG0003439	type=REGULATORY REGION|Gene=ASZ1|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	18	30	---	---	---	---	capture	Missense_Mutation	SNP	117067510	117067510	ASZ1	7	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	1060	236
TRPV6	55503	broad.mit.edu	37	7	142575507	142575507	+	Silent	SNP	C	T	T	rs145875993		TCGA-32-2494-01	TCGA-32-2494-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:142575507C>T	uc003wbx.1	-	3	462	c.246G>A	c.(244-246)GCG>GCA	p.A82A	TRPV6_uc003wbw.1_5'Flank|TRPV6_uc010lou.1_5'UTR	NM_018646	NP_061116	Q9H1D0	TRPV6_HUMAN	transient receptor potential cation channel,	82	Cytoplasmic (Potential).|ANK 2.				regulation of calcium ion-dependent exocytosis	integral to plasma membrane	calcium channel activity|calmodulin binding			ovary(2)	2	Melanoma(164;0.059)					CTATGTGTAGCGCTGTTTCCC	0.562													75	256	---	---	---	---	capture	Silent	SNP	142575507	142575507	TRPV6	7	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	16483	236
ARHGEF5	7984	broad.mit.edu	37	7	144060770	144060770	+	Silent	SNP	T	C	C	rs141931104	by1000genomes	TCGA-32-2494-01	TCGA-32-2494-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:144060770T>C	uc003wel.2	+	2	1126	c.1008T>C	c.(1006-1008)AAT>AAC	p.N336N	ARHGEF5_uc003wek.2_Silent_p.N336N	NM_005435	NP_005426	Q12774	ARHG5_HUMAN	rho guanine nucleotide exchange factor 5	336					intracellular signal transduction|regulation of Rho protein signal transduction	intracellular	GTP binding|protein binding|Rho guanyl-nucleotide exchange factor activity			skin(2)	2	Melanoma(164;0.14)					CAGAAGAGAATAGGGCGGACT	0.512													3	207	---	---	---	---	capture	Silent	SNP	144060770	144060770	ARHGEF5	7	T	C	C	C	1	0	0	0	0	0	0	0	1	634	49	3	3	902	236
DPYSL2	1808	broad.mit.edu	37	8	26492400	26492400	+	Silent	SNP	C	A	A			TCGA-32-2494-01	TCGA-32-2494-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:26492400C>A	uc003xfb.1	+	8	1145	c.795C>A	c.(793-795)GCC>GCA	p.A265A	DPYSL2_uc003xfa.2_Silent_p.A370A|DPYSL2_uc011lag.1_Silent_p.A265A|DPYSL2_uc010luk.1_RNA|DPYSL2_uc011lah.1_Silent_p.A229A	NM_001386	NP_001377	Q16555	DPYL2_HUMAN	dihydropyrimidinase-like 2	265					axon guidance|pyrimidine base catabolic process|signal transduction	cytosol	dihydropyrimidinase activity|protein binding			large_intestine(1)	1		all_cancers(63;0.121)|Ovarian(32;2.68e-05)|all_epithelial(46;0.116)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0228)|Epithelial(17;3.33e-10)|Colorectal(74;0.183)		AGGTCATCGCCCAGGCACGGA	0.607													3	67	---	---	---	---	capture	Silent	SNP	26492400	26492400	DPYSL2	8	C	A	A	A	1	0	0	0	0	0	0	0	1	275	22	4	4	4702	236
LYN	4067	broad.mit.edu	37	8	56854426	56854426	+	Missense_Mutation	SNP	G	A	A			TCGA-32-2494-01	TCGA-32-2494-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:56854426G>A	uc003xsk.3	+	2	290	c.8G>A	c.(7-9)TGT>TAT	p.C3Y	LYN_uc003xsl.3_Missense_Mutation_p.C3Y	NM_002350	NP_002341	P07948	LYN_HUMAN	Yamaguchi sarcoma viral (v-yes-1) oncogene	3				C->A: Loss of localization to the cell membrane; when associated with A-2.	erythrocyte differentiation|interspecies interaction between organisms|leukocyte migration|platelet activation|positive regulation of cellular component movement|positive regulation of stress-activated protein kinase signaling cascade|positive regulation of tyrosine phosphorylation of STAT protein|response to DNA damage stimulus|T cell costimulation	cytosol|Golgi apparatus|membrane raft|nucleus|perinuclear region of cytoplasm	ATP binding|ion channel binding|non-membrane spanning protein tyrosine kinase activity|receptor signaling protein tyrosine kinase activity			ovary(1)|breast(1)|central_nervous_system(1)	3		all_lung(136;0.0555)|Lung NSC(129;0.0726)|all_epithelial(80;0.0772)	Epithelial(17;0.000834)|all cancers(17;0.00598)			AATATGGGATGTATAAAATCA	0.343													31	73	---	---	---	---	capture	Missense_Mutation	SNP	56854426	56854426	LYN	8	G	A	A	A	1	0	0	0	0	1	0	0	0	624	48	2	2	9022	236
DMRT2	10655	broad.mit.edu	37	9	1056405	1056405	+	Missense_Mutation	SNP	G	A	A			TCGA-32-2494-01	TCGA-32-2494-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:1056405G>A	uc003zha.2	+	4	1018	c.818G>A	c.(817-819)CGC>CAC	p.R273H	DMRT2_uc003zgx.3_Missense_Mutation_p.R40H|DMRT2_uc010mgz.2_Missense_Mutation_p.R40H|DMRT2_uc003zgy.3_Missense_Mutation_p.R117H|DMRT2_uc003zhb.3_3'UTR|DMRT2_uc011llt.1_3'UTR|DMRT2_uc011llu.1_3'UTR|DMRT2_uc011llv.1_Missense_Mutation_p.R273H	NM_181872	NP_870987	Q9Y5R5	DMRT2_HUMAN	doublesex and mab-3 related transcription factor	273					male gonad development|sex determination	nucleus	DNA binding|metal ion binding|sequence-specific DNA binding transcription factor activity				0		all_lung(10;1.49e-09)|Lung NSC(10;1.86e-09)		Lung(218;0.0195)|GBM - Glioblastoma multiforme(50;0.0388)		CTGCCCAACCGCATGGTGCCT	0.473													4	164	---	---	---	---	capture	Missense_Mutation	SNP	1056405	1056405	DMRT2	9	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	4544	236
KIAA1045	23349	broad.mit.edu	37	9	34971375	34971375	+	Missense_Mutation	SNP	G	T	T			TCGA-32-2494-01	TCGA-32-2494-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:34971375G>T	uc003zvq.2	+	2	258	c.80G>T	c.(79-81)GGG>GTG	p.G27V	KIAA1045_uc003zvr.2_Missense_Mutation_p.G27V	NM_015297	NP_056112	Q9UPV7	K1045_HUMAN	hypothetical protein LOC23349	27							calcium ion binding			skin(1)	1			LUSC - Lung squamous cell carcinoma(32;0.00575)			TTCAAGGATGGGCTGCGGGAC	0.607													3	120	---	---	---	---	capture	Missense_Mutation	SNP	34971375	34971375	KIAA1045	9	G	T	T	T	1	0	0	0	0	1	0	0	0	559	43	4	4	8129	236
OR13C3	138803	broad.mit.edu	37	9	107298263	107298263	+	Missense_Mutation	SNP	C	A	A			TCGA-32-2494-01	TCGA-32-2494-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:107298263C>A	uc004bcb.1	-	1	832	c.832G>T	c.(832-834)GTG>TTG	p.V278L		NM_001001961	NP_001001961	Q8NGS6	O13C3_HUMAN	olfactory receptor, family 13, subfamily C,	278	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			pancreas(1)	1						AATATGATCACCACAGTCAGG	0.418													43	224	---	---	---	---	capture	Missense_Mutation	SNP	107298263	107298263	OR13C3	9	C	A	A	A	1	0	0	0	0	1	0	0	0	234	18	4	4	10839	236
CCNB3	85417	broad.mit.edu	37	X	50053319	50053319	+	Missense_Mutation	SNP	G	T	T			TCGA-32-2494-01	TCGA-32-2494-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:50053319G>T	uc004dox.3	+	6	2448	c.2150G>T	c.(2149-2151)AGC>ATC	p.S717I	CCNB3_uc004doy.2_Missense_Mutation_p.S717I|CCNB3_uc004doz.2_Intron|CCNB3_uc010njq.2_Intron	NM_033031	NP_149020	Q8WWL7	CCNB3_HUMAN	cyclin B3 isoform 3	717					cell division|meiosis|regulation of cyclin-dependent protein kinase activity|regulation of G2/M transition of mitotic cell cycle	nucleus	protein kinase binding			ovary(4)|lung(3)|large_intestine(1)|pancreas(1)	9	Ovarian(276;0.236)					CAGGAGAAAAGCACCATGGAA	0.453													28	79	---	---	---	---	capture	Missense_Mutation	SNP	50053319	50053319	CCNB3	23	G	T	T	T	1	0	0	0	0	1	0	0	0	442	34	4	4	2885	236
ZC3H12B	340554	broad.mit.edu	37	X	64721739	64721739	+	Silent	SNP	G	A	A			TCGA-32-2494-01	TCGA-32-2494-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:64721739G>A	uc010nko.2	+	5	1137	c.1128G>A	c.(1126-1128)TCG>TCA	p.S376S		NM_001010888	NP_001010888	Q5HYM0	ZC12B_HUMAN	zinc finger CCCH-type containing 12B	376							endonuclease activity|nucleic acid binding|zinc ion binding			lung(1)|kidney(1)|pancreas(1)	3						CCCAGCGTTCGGTGGCTGATG	0.527													5	13	---	---	---	---	capture	Silent	SNP	64721739	64721739	ZC3H12B	23	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	17442	236
AWAT2	158835	broad.mit.edu	37	X	69263788	69263788	+	Silent	SNP	A	G	G			TCGA-32-2494-01	TCGA-32-2494-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:69263788A>G	uc004dxt.1	-	3	261	c.255T>C	c.(253-255)TAT>TAC	p.Y85Y		NM_001002254	NP_001002254	Q6E213	AWAT2_HUMAN	wax synthase 2	85						endoplasmic reticulum membrane|integral to membrane	long-chain-alcohol O-fatty-acyltransferase activity				0						TGAGAGGGAAATAATCGCTGT	0.557													6	17	---	---	---	---	capture	Silent	SNP	69263788	69263788	AWAT2	23	A	G	G	G	1	0	0	0	0	0	0	0	1	50	4	3	3	1225	236
NONO	4841	broad.mit.edu	37	X	70514099	70514099	+	Missense_Mutation	SNP	T	C	C			TCGA-32-2494-01	TCGA-32-2494-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:70514099T>C	uc004dzo.2	+	6	1081	c.371T>C	c.(370-372)ATT>ACT	p.I124T	BCYRN1_uc011mpt.1_Intron|NONO_uc004dzn.2_Missense_Mutation_p.I124T|NONO_uc004dzp.2_Missense_Mutation_p.I124T|NONO_uc011mpv.1_Missense_Mutation_p.I35T|NONO_uc004dzq.2_5'UTR	NM_001145408	NP_001138880	Q15233	NONO_HUMAN	non-POU domain containing, octamer-binding	124	DBHS.|RRM 1.				DNA recombination|DNA repair|mRNA processing|regulation of transcription, DNA-dependent|RNA splicing|transcription, DNA-dependent	nuclear matrix|paraspeckles	DNA binding|identical protein binding|nucleotide binding|RNA binding		NONO/TFE3(2)	ovary(2)|kidney(2)	4	Renal(35;0.156)					CTAGCGGAGATTGCCAAAGTG	0.488			T	TFE3	papillary renal cancer								3	111	---	---	---	---	capture	Missense_Mutation	SNP	70514099	70514099	NONO	23	T	C	C	C	1	0	0	0	0	1	0	0	0	676	52	3	3	10441	236
TAF1	6872	broad.mit.edu	37	X	70586172	70586172	+	Missense_Mutation	SNP	C	T	T			TCGA-32-2494-01	TCGA-32-2494-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:70586172C>T	uc004dzu.3	+	1	59	c.8C>T	c.(7-9)CCC>CTC	p.P3L	BCYRN1_uc011mpt.1_Intron|TAF1_uc004dzt.3_Missense_Mutation_p.P3L	NM_138923	NP_620278	P21675	TAF1_HUMAN	TBP-associated factor 1 isoform 2	3	Protein kinase 1.				G1 phase of mitotic cell cycle|interspecies interaction between organisms|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription initiation from RNA polymerase II promoter|protein autophosphorylation|regulation of transcription involved in G2/M-phase of mitotic cell cycle|RNA polymerase II transcriptional preinitiation complex assembly|transcription elongation from RNA polymerase II promoter|viral reproduction	MLL1 complex|transcription factor TFIID complex	ATP binding|histone acetyl-lysine binding|histone acetyltransferase activity|p53 binding|protein binding|protein serine/threonine kinase activity|sequence-specific DNA binding|TBP-class protein binding|transcription coactivator activity			ovary(7)|breast(4)|large_intestine(2)|central_nervous_system(2)|lung(1)|skin(1)	17	Renal(35;0.156)	all_lung(315;0.000321)				TCTATGGGACCCGGCTGCGAT	0.537													25	86	---	---	---	---	capture	Missense_Mutation	SNP	70586172	70586172	TAF1	23	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	15401	236
ACTRT1	139741	broad.mit.edu	37	X	127185764	127185764	+	Missense_Mutation	SNP	G	A	A			TCGA-32-2494-01	TCGA-32-2494-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:127185764G>A	uc004eum.2	-	1	619	c.422C>T	c.(421-423)GCG>GTG	p.A141V		NM_138289	NP_612146	Q8TDG2	ACTT1_HUMAN	actin-related protein T1	141						cytoplasm|cytoskeleton				ovary(2)|central_nervous_system(2)|skin(1)	5						CGCTGCCACCGCATGATTAGA	0.522													6	540	---	---	---	---	capture	Missense_Mutation	SNP	127185764	127185764	ACTRT1	23	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	218	236
SLC25A14	9016	broad.mit.edu	37	X	129492634	129492634	+	Silent	SNP	A	G	G			TCGA-32-2494-01	TCGA-32-2494-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:129492634A>G	uc004evn.1	+	7	732	c.519A>G	c.(517-519)GGA>GGG	p.G173G	SLC25A14_uc011mut.1_Missense_Mutation_p.K110E|SLC25A14_uc011muu.1_Silent_p.G173G|SLC25A14_uc010nrg.2_Silent_p.G170G|SLC25A14_uc004evo.1_5'UTR|SLC25A14_uc004evp.1_Silent_p.G173G|SLC25A14_uc004evq.1_Silent_p.G170G|SLC25A14_uc004evr.1_Silent_p.G170G	NM_003951	NP_003942	O95258	UCP5_HUMAN	solute carrier family 25, member 14 isoform	173	Solcar 2.				aerobic respiration|mitochondrial transport	integral to plasma membrane|mitochondrial inner membrane	binding			ovary(1)	1						AGGCTCAAGGAAGCTTGTTCC	0.353													69	151	---	---	---	---	capture	Silent	SNP	129492634	129492634	SLC25A14	23	A	G	G	G	1	0	0	0	0	0	0	0	1	106	9	3	3	14368	236
GPR112	139378	broad.mit.edu	37	X	135433699	135433699	+	Missense_Mutation	SNP	C	T	T			TCGA-32-2494-01	TCGA-32-2494-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:135433699C>T	uc004ezu.1	+	7	7112	c.6821C>T	c.(6820-6822)TCG>TTG	p.S2274L	GPR112_uc010nsb.1_Missense_Mutation_p.S2069L|GPR112_uc010nsc.1_Intron	NM_153834	NP_722576	Q8IZF6	GP112_HUMAN	G-protein coupled receptor 112	2274	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(5)|large_intestine(2)|skin(2)|lung(1)|breast(1)|pancreas(1)	12	Acute lymphoblastic leukemia(192;0.000127)					ACGGAAAATTCGGTAAAATAA	0.254													21	53	---	---	---	---	capture	Missense_Mutation	SNP	135433699	135433699	GPR112	23	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	6563	236
ATP11C	286410	broad.mit.edu	37	X	138879436	138879436	+	Missense_Mutation	SNP	C	A	A			TCGA-32-2494-01	TCGA-32-2494-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:138879436C>A	uc004faz.2	-	11	1015	c.916G>T	c.(916-918)GCT>TCT	p.A306S	ATP11C_uc004fay.2_RNA|ATP11C_uc004fba.2_Missense_Mutation_p.A306S	NM_173694	NP_775965	Q8NB49	AT11C_HUMAN	ATPase, class VI, type 11C isoform a	306	Helical; (Potential).				ATP biosynthetic process	integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(5)|large_intestine(3)	8	Acute lymphoblastic leukemia(192;0.000127)					CATACTGCAGCTTTGGTCAGT	0.343													62	156	---	---	---	---	capture	Missense_Mutation	SNP	138879436	138879436	ATP11C	23	C	A	A	A	1	0	0	0	0	1	0	0	0	364	28	4	4	1112	236
TKTL1	8277	broad.mit.edu	37	X	153543586	153543586	+	Missense_Mutation	SNP	G	A	A			TCGA-32-2494-01	TCGA-32-2494-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:153543586G>A	uc004fkg.2	+	7	1114	c.928G>A	c.(928-930)GTT>ATT	p.V310I	TKTL1_uc011mzl.1_Missense_Mutation_p.V304I|TKTL1_uc011mzm.1_Missense_Mutation_p.V106I|TKTL1_uc004fkh.2_Missense_Mutation_p.V254I	NM_012253	NP_036385	P51854	TKTL1_HUMAN	transketolase-like 1 isoform a	310					glucose catabolic process|thiamine metabolic process	cytoplasm|nucleus	metal ion binding|transketolase activity			ovary(3)|skin(1)	4	all_cancers(53;5.05e-16)|all_epithelial(53;1.82e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					CAACAGAGTCGTTGTGCTGGA	0.483													53	157	---	---	---	---	capture	Missense_Mutation	SNP	153543586	153543586	TKTL1	23	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	15820	236
ARHGAP29	9411	broad.mit.edu	37	1	94650593	94650594	+	Frame_Shift_Ins	INS	-	T	T			TCGA-32-2494-01	TCGA-32-2494-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:94650593_94650594insT	uc001dqj.3	-	18	2312_2313	c.1943_1944insA	c.(1942-1944)AAGfs	p.K648fs	ARHGAP29_uc009wdq.1_RNA|ARHGAP29_uc001dqk.2_Frame_Shift_Ins_p.K214fs	NM_004815	NP_004806	Q52LW3	RHG29_HUMAN	PTPL1-associated RhoGAP 1	648	Phorbol-ester/DAG-type.				Rho protein signal transduction	cytosol	metal ion binding|Rho GTPase activator activity			breast(4)|skin(3)|lung(2)|upper_aerodigestive_tract(1)|ovary(1)	11		all_lung(203;0.000732)|Lung NSC(277;0.00328)		all cancers(265;0.0187)|Epithelial(280;0.159)		TTTCCAAACACTTTCGATGACA	0.361													31	73	---	---	---	---	capture_indel	Frame_Shift_Ins	INS	94650593	94650594	ARHGAP29	1	-	T	T	T	1	0	1	1	0	0	0	0	0	259	20	5	5	871	236
CD2	914	broad.mit.edu	37	1	117311354	117311354	+	Frame_Shift_Del	DEL	A	-	-			TCGA-32-2494-01	TCGA-32-2494-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:117311354delA	uc001egu.3	+	5	1034	c.1005delA	c.(1003-1005)CCAfs	p.P335fs		NM_001767	NP_001758	P06729	CD2_HUMAN	CD2 molecule precursor	335	Cytoplasmic (Potential).|Pro-rich.				blood coagulation|cell surface receptor linked signaling pathway|cell-cell adhesion|induction of apoptosis|leukocyte migration|membrane raft polarization|natural killer cell activation|positive regulation of myeloid dendritic cell activation|regulation of T cell differentiation|T cell activation	integral to plasma membrane	receptor activity			breast(1)	1	Lung SC(450;0.225)	all_cancers(81;3.15e-06)|Acute lymphoblastic leukemia(138;1.7e-08)|all_epithelial(167;8.38e-07)|all_lung(203;3.37e-06)|Lung NSC(69;2.31e-05)		Epithelial(280;6.71e-26)|OV - Ovarian serous cystadenocarcinoma(397;4.74e-24)|all cancers(265;1.93e-22)|Lung(183;0.0543)|Kidney(133;0.0813)|Colorectal(144;0.174)|KIRC - Kidney renal clear cell carcinoma(1967;0.176)|LUSC - Lung squamous cell carcinoma(189;0.189)|BRCA - Breast invasive adenocarcinoma(282;0.201)	Alefacept(DB00092)	GAGTTCAGCCAAAACCTCCCC	0.517													7	296	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	117311354	117311354	CD2	1	A	-	-	-	1	0	1	0	1	0	0	0	0	54	5	5	5	2950	236
GPATCH4	54865	broad.mit.edu	37	1	156565503	156565504	+	Frame_Shift_Ins	INS	-	T	T			TCGA-32-2494-01	TCGA-32-2494-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:156565503_156565504insT	uc001fpm.2	-	8	668_669	c.629_630insA	c.(628-630)AAGfs	p.K210fs	APOA1BP_uc010php.1_Intron|GPATCH4_uc001fpl.2_Frame_Shift_Ins_p.K205fs	NM_015590	NP_056405	Q5T3I0	GPTC4_HUMAN	G patch domain containing 4 isoform 1	205	Potential.					intracellular	nucleic acid binding			ovary(1)	1	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					TTTTCTTTTTCTTTTTTTTGGG	0.535													7	238	---	---	---	---	capture_indel	Frame_Shift_Ins	INS	156565503	156565504	GPATCH4	1	-	T	T	T	1	0	1	1	0	0	0	0	0	415	32	5	5	6527	236
C11orf82	220042	broad.mit.edu	37	11	82639902	82639905	+	Frame_Shift_Del	DEL	CAAA	-	-			TCGA-32-2494-01	TCGA-32-2494-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:82639902_82639905delCAAA	uc001ozt.2	+	4	441_444	c.197_200delCAAA	c.(196-201)TCAAACfs	p.S66fs	C11orf82_uc010rsr.1_5'UTR|C11orf82_uc010rss.1_Intron|C11orf82_uc009yvd.2_Frame_Shift_Del_p.S66fs	NM_145018	NP_659455	Q8IXT1	NOXIN_HUMAN	nitric oxide-inducible gene protein	66_67					apoptosis|cell cycle arrest	cytoplasm|nucleus				ovary(2)	2						GTTGCAGAATCAAACAAATTGTTT	0.343													45	117	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	82639902	82639905	C11orf82	11	CAAA	-	-	-	1	0	1	0	1	0	0	0	0	377	29	5	5	1651	236
AFP	174	broad.mit.edu	37	4	74316398	74316398	+	Frame_Shift_Del	DEL	A	-	-			TCGA-32-2494-01	TCGA-32-2494-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:74316398delA	uc003hgz.1	+	11	1403	c.1356delA	c.(1354-1356)AGAfs	p.R452fs	AFP_uc003hha.1_Frame_Shift_Del_p.R452fs|AFP_uc011cbg.1_Frame_Shift_Del_p.R226fs	NM_001134	NP_001125	P02771	FETA_HUMAN	alpha-fetoprotein precursor	452	Albumin 3.				transport		metal ion binding			ovary(1)	1	Breast(15;0.00102)		Epithelial(6;2.42e-05)|all cancers(17;0.000268)|OV - Ovarian serous cystadenocarcinoma(6;0.000324)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			CCATCACCAGAAAAATGGCAG	0.517									Alpha-Fetoprotein_Hereditary_Persistence_of				32	92	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	74316398	74316398	AFP	4	A	-	-	-	1	0	1	0	1	0	0	0	0	115	9	5	5	363	236
