Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
GNB1	2782	broad.mit.edu	37	1	1720568	1720568	+	Missense_Mutation	SNP	C	A	A			TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:1720568C>A	uc001aif.2	-	10	1172	c.840G>T	c.(838-840)AAG>AAT	p.K280N	GNB1_uc009vky.2_Missense_Mutation_p.K180N	NM_002074	NP_002065	P62873	GBB1_HUMAN	guanine nucleotide-binding protein, beta-1	280	WD 6.				cellular response to glucagon stimulus|energy reserve metabolic process|muscarinic acetylcholine receptor signaling pathway|platelet activation|Ras protein signal transduction|synaptic transmission	heterotrimeric G-protein complex	GTPase activity|GTPase binding|signal transducer activity				0	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;5.62e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)		Epithelial(90;1.14e-35)|OV - Ovarian serous cystadenocarcinoma(86;7.31e-23)|GBM - Glioblastoma multiforme(42;3.1e-07)|COAD - Colon adenocarcinoma(227;0.000323)|Colorectal(212;0.000374)|Kidney(185;0.00392)|BRCA - Breast invasive adenocarcinoma(365;0.00573)|STAD - Stomach adenocarcinoma(132;0.0072)|KIRC - Kidney renal clear cell carcinoma(229;0.0482)|Lung(427;0.236)		GGCGCCCGCTCTTGGAGAAGG	0.587											OREG0012998	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	7	110	---	---	---	---	capture	Missense_Mutation	SNP	1720568	1720568	GNB1	1	C	A	A	A	1	0	0	0	0	1	0	0	0	415	32	4	4	6451	237
CHD5	26038	broad.mit.edu	37	1	6206730	6206730	+	Missense_Mutation	SNP	G	C	C			TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:6206730G>C	uc001amb.1	-	10	1685	c.1585C>G	c.(1585-1587)CTA>GTA	p.L529V	CHD5_uc001ama.1_5'Flank|CHD5_uc001amc.1_RNA	NM_015557	NP_056372	Q8TDI0	CHD5_HUMAN	chromodomain helicase DNA binding protein 5	529	Chromo 1.				chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ATP binding|ATP-dependent helicase activity|DNA binding|zinc ion binding			central_nervous_system(3)|breast(3)|ovary(2)|upper_aerodigestive_tract(1)|lung(1)|skin(1)|pancreas(1)	12	Ovarian(185;0.0634)	all_cancers(23;5.36e-32)|all_epithelial(116;2.32e-17)|all_neural(13;3.68e-06)|all_lung(118;3.94e-06)|all_hematologic(16;2.39e-05)|Lung NSC(185;5.33e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00373)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;3.08e-37)|GBM - Glioblastoma multiforme(13;1.36e-31)|OV - Ovarian serous cystadenocarcinoma(86;7.7e-19)|Colorectal(212;9.97e-08)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(185;6.16e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00109)|BRCA - Breast invasive adenocarcinoma(365;0.0012)|STAD - Stomach adenocarcinoma(132;0.00346)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.193)		CTCACCTGTAGCTCCTTCACC	0.647													3	38	---	---	---	---	capture	Missense_Mutation	SNP	6206730	6206730	CHD5	1	G	C	C	C	1	0	0	0	0	1	0	0	0	438	34	4	4	3294	237
CLCNKB	1188	broad.mit.edu	37	1	16377396	16377396	+	Silent	SNP	G	A	A	rs140705060		TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:16377396G>A	uc001axw.3	+	12	1160	c.1080G>A	c.(1078-1080)TCG>TCA	p.S360S	FAM131C_uc010obz.1_Intron|CLCNKB_uc001axx.3_Silent_p.S360S|CLCNKB_uc001axy.3_Silent_p.S191S	NM_000085	NP_000076	P51801	CLCKB_HUMAN	chloride channel Kb isoform 1	360					excretion	chloride channel complex|integral to plasma membrane	voltage-gated chloride channel activity			skin(1)	1		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Colorectal(212;8.04e-08)|COAD - Colon adenocarcinoma(227;5.46e-06)|BRCA - Breast invasive adenocarcinoma(304;9.02e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.00655)|READ - Rectum adenocarcinoma(331;0.0649)		ATCTGGACTCGCTGTTCGACA	0.667													20	41	---	---	---	---	capture	Silent	SNP	16377396	16377396	CLCNKB	1	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	3435	237
PTAFR	5724	broad.mit.edu	37	1	28477001	28477001	+	Missense_Mutation	SNP	C	T	T			TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:28477001C>T	uc001bpl.2	-	2	659	c.532G>A	c.(532-534)GAG>AAG	p.E178K	PTAFR_uc001bpm.3_Missense_Mutation_p.E178K|PTAFR_uc009vte.2_Missense_Mutation_p.E178K	NM_000952	NP_000943	P25105	PTAFR_HUMAN	platelet-activating factor receptor	178	Extracellular (Potential).				chemotaxis|inflammatory response|interferon-gamma-mediated signaling pathway|phosphatidylinositol-mediated signaling	integral to plasma membrane|nucleus	phospholipid binding|platelet activating factor receptor activity				0		Colorectal(325;0.000147)|Renal(390;0.00357)|Lung NSC(340;0.00715)|all_lung(284;0.00732)|Breast(348;0.0174)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0545)|all_neural(195;0.0557)		UCEC - Uterine corpus endometrioid carcinoma (279;0.215)|OV - Ovarian serous cystadenocarcinoma(117;6e-22)|Colorectal(126;3.04e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00279)|BRCA - Breast invasive adenocarcinoma(304;0.00595)|STAD - Stomach adenocarcinoma(196;0.00678)|READ - Rectum adenocarcinoma(331;0.0649)		CTGCCCTTCTCGTAATGCTCA	0.542													28	45	---	---	---	---	capture	Missense_Mutation	SNP	28477001	28477001	PTAFR	1	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	12618	237
SLC44A5	204962	broad.mit.edu	37	1	75708695	75708695	+	Missense_Mutation	SNP	A	G	G	rs148670291		TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:75708695A>G	uc001dgu.2	-	8	491	c.347T>C	c.(346-348)ATC>ACC	p.I116T	SLC44A5_uc001dgt.2_Missense_Mutation_p.I116T|SLC44A5_uc001dgs.2_Missense_Mutation_p.I74T|SLC44A5_uc001dgr.2_Missense_Mutation_p.I74T|SLC44A5_uc010oqz.1_Missense_Mutation_p.I155T|SLC44A5_uc010ora.1_Missense_Mutation_p.I110T|SLC44A5_uc010orb.1_5'UTR	NM_152697	NP_689910	Q8NCS7	CTL5_HUMAN	solute carrier family 44, member 5 isoform A	116	Extracellular (Potential).					integral to membrane|plasma membrane	choline transmembrane transporter activity			ovary(2)|skin(2)	4						GGAGACACAGATCTGTGAACG	0.383													61	110	---	---	---	---	capture	Missense_Mutation	SNP	75708695	75708695	SLC44A5	1	A	G	G	G	1	0	0	0	0	1	0	0	0	156	12	3	3	14531	237
LRRC8C	84230	broad.mit.edu	37	1	90179098	90179098	+	Silent	SNP	T	C	C			TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:90179098T>C	uc001dnl.3	+	3	1211	c.969T>C	c.(967-969)TAT>TAC	p.Y323Y		NM_032270	NP_115646	Q8TDW0	LRC8C_HUMAN	leucine rich repeat containing 8 family, member	323	Helical; (Potential).					endoplasmic reticulum membrane|integral to membrane				ovary(3)|skin(3)|pancreas(1)|central_nervous_system(1)	8		all_lung(203;0.126)		all cancers(265;0.00756)|Epithelial(280;0.0313)		CCTTTTGCTATCTGTGCTTTG	0.408													5	211	---	---	---	---	capture	Silent	SNP	90179098	90179098	LRRC8C	1	T	C	C	C	1	0	0	0	0	0	0	0	1	647	50	3	3	8938	237
ABCA4	24	broad.mit.edu	37	1	94508933	94508933	+	Missense_Mutation	SNP	C	T	T	rs61750062		TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:94508933C>T	uc001dqh.2	-	21	3253	c.3149G>A	c.(3148-3150)GGC>GAC	p.G1050D		NM_000350	NP_000341	P78363	ABCA4_HUMAN	ATP-binding cassette, sub-family A member 4	1050	Cytoplasmic.|ABC transporter 1.				phototransduction, visible light|visual perception	integral to plasma membrane|membrane fraction	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(4)|skin(4)|central_nervous_system(2)|upper_aerodigestive_tract(1)|breast(1)	12		all_lung(203;0.000757)|Lung NSC(277;0.00335)		all cancers(265;0.00432)|GBM - Glioblastoma multiforme(16;0.00715)|Epithelial(280;0.171)		GTGGTGGAGGCCTGTGTCCTC	0.582													48	46	---	---	---	---	capture	Missense_Mutation	SNP	94508933	94508933	ABCA4	1	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	34	237
POU2F1	5451	broad.mit.edu	37	1	167353107	167353107	+	Silent	SNP	G	A	A			TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:167353107G>A	uc001gec.2	+	9	825	c.663G>A	c.(661-663)GCG>GCA	p.A221A	POU2F1_uc010plg.1_RNA|POU2F1_uc001ged.2_Silent_p.A219A|POU2F1_uc001gee.2_Silent_p.A221A|POU2F1_uc010plh.1_Silent_p.A158A|POU2F1_uc001gef.2_Silent_p.A233A|POU2F1_uc001geg.2_Silent_p.A119A	NM_002697	NP_002688	P14859	PO2F1_HUMAN	POU class 2 homeobox 1	221					negative regulation of transcription, DNA-dependent|transcription from RNA polymerase III promoter	nucleoplasm	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(2)|skin(2)|breast(1)	5						TCCTGCAAGCGCAAAATCTTC	0.438													3	129	---	---	---	---	capture	Silent	SNP	167353107	167353107	POU2F1	1	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	12172	237
IVNS1ABP	10625	broad.mit.edu	37	1	185267320	185267320	+	Missense_Mutation	SNP	C	T	T			TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:185267320C>T	uc001grl.2	-	15	2399	c.1776G>A	c.(1774-1776)ATG>ATA	p.M592I	IVNS1ABP_uc001gri.2_Missense_Mutation_p.M252I|IVNS1ABP_uc001grj.2_Missense_Mutation_p.M252I|IVNS1ABP_uc009wyj.2_Missense_Mutation_p.M374I|IVNS1ABP_uc009wyk.2_RNA	NM_006469	NP_006460	Q9Y6Y0	NS1BP_HUMAN	influenza virus NS1A binding protein	592	Kelch 5.				interspecies interaction between organisms|response to virus|RNA splicing|transcription from RNA polymerase III promoter	cytoplasm|cytoskeleton|spliceosomal complex|transcription factor complex				ovary(4)|central_nervous_system(1)	5						TTGGTGAAGTCATATTTCCCA	0.423													11	476	---	---	---	---	capture	Missense_Mutation	SNP	185267320	185267320	IVNS1ABP	1	C	T	T	T	1	0	0	0	0	1	0	0	0	377	29	2	2	7853	237
REN	5972	broad.mit.edu	37	1	204130489	204130489	+	Missense_Mutation	SNP	C	T	T			TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:204130489C>T	uc001haq.2	-	3	348	c.304G>A	c.(304-306)GTC>ATC	p.V102I		NM_000537	NP_000528	P00797	RENI_HUMAN	renin preproprotein	102					angiotensin maturation|regulation of MAPKKK cascade	extracellular space|membrane	aspartic-type endopeptidase activity			skin(3)|central_nervous_system(1)	4	all_cancers(21;0.00965)|Breast(84;0.116)|all_epithelial(62;0.157)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.109)		Aliskiren(DB01258)|Remikiren(DB00212)	GTGTCAAAGACGACTTTGAAG	0.582													12	23	---	---	---	---	capture	Missense_Mutation	SNP	204130489	204130489	REN	1	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	13119	237
OR2T4	127074	broad.mit.edu	37	1	248525116	248525116	+	Silent	SNP	C	A	A			TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:248525116C>A	uc001ieh.1	+	1	234	c.234C>A	c.(232-234)ATC>ATA	p.I78I		NM_001004696	NP_001004696	Q8NH00	OR2T4_HUMAN	olfactory receptor, family 2, subfamily T,	78	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			CTGTCCTGATCCTTCTGATAC	0.473													169	342	---	---	---	---	capture	Silent	SNP	248525116	248525116	OR2T4	1	C	A	A	A	1	0	0	0	0	0	0	0	1	382	30	4	4	10931	237
OR14I1	401994	broad.mit.edu	37	1	248844752	248844752	+	Missense_Mutation	SNP	G	A	A			TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:248844752G>A	uc001ieu.1	-	1	854	c.854C>T	c.(853-855)CCC>CTC	p.P285L		NM_001004734	NP_001004734	A6ND48	O14I1_HUMAN	olfactory receptor, family 14, subfamily I,	285	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						ATATATGATGGGATTGAGGAA	0.403													43	64	---	---	---	---	capture	Missense_Mutation	SNP	248844752	248844752	OR14I1	1	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	10851	237
ANKRD30A	91074	broad.mit.edu	37	10	37486209	37486209	+	Missense_Mutation	SNP	A	G	G			TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:37486209A>G	uc001iza.1	+	28	2546	c.2447A>G	c.(2446-2448)GAG>GGG	p.E816G		NM_052997	NP_443723	Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A	872						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(7)|breast(1)|skin(1)	9						TGCTTTTTAGAGCCTCCCGAG	0.338													3	113	---	---	---	---	capture	Missense_Mutation	SNP	37486209	37486209	ANKRD30A	10	A	G	G	G	1	0	0	0	0	1	0	0	0	143	11	3	3	654	237
ARID5B	84159	broad.mit.edu	37	10	63816874	63816874	+	Splice_Site	SNP	A	C	C			TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:63816874A>C	uc001jlt.1	+	6	873	c.847_splice	c.e6-2	p.V283_splice	ARID5B_uc001jlu.1_Splice_Site_p.V40_splice	NM_032199	NP_115575	Q14865	ARI5B_HUMAN	AT rich interactive domain 5B (MRF1-like)						liver development|negative regulation of transcription, DNA-dependent|positive regulation of sequence-specific DNA binding transcription factor activity|transcription, DNA-dependent		protein binding|transcription regulatory region DNA binding			ovary(2)|upper_aerodigestive_tract(1)|kidney(1)	4	Prostate(12;0.016)|all_hematologic(501;0.215)					TCCCTTTTCCAGGTGAAATGT	0.448													2	29	---	---	---	---	capture	Splice_Site	SNP	63816874	63816874	ARID5B	10	A	C	C	C	1	0	0	0	0	0	0	1	0	91	7	5	4	915	237
PTEN	5728	broad.mit.edu	37	10	89717664	89717664	+	Missense_Mutation	SNP	G	A	A			TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:89717664G>A	uc001kfb.2	+	8	1720	c.689G>A	c.(688-690)GGA>GAA	p.G230E		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog	230	C2 tensin-type.				activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.R55fs*1(4)|p.N212fs*1(2)|p.Y27fs*1(2)|p.P231fs*12(1)|p.G230fs*26(1)|p.G165_*404del(1)|p.?(1)|p.G165_K342del(1)|p.G230E(1)|p.G230R(1)		endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		TCCAATTCAGGACCCACACGA	0.428		31	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			82	35	---	---	---	---	capture	Missense_Mutation	SNP	89717664	89717664	PTEN	10	G	A	A	A	1	0	0	0	0	1	0	0	0	533	41	2	2	12633	237
PDCD4	27250	broad.mit.edu	37	10	112655708	112655708	+	Silent	SNP	T	C	C			TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:112655708T>C	uc001kzh.2	+	11	1455	c.1212T>C	c.(1210-1212)GGT>GGC	p.G404G	PDCD4_uc001kzg.2_Silent_p.G393G|PDCD4_uc010qre.1_Silent_p.G390G	NM_014456	NP_055271	Q53EL6	PDCD4_HUMAN	programmed cell death 4 isoform 1	404	MI 2.				apoptosis|cell aging|negative regulation of cell cycle|negative regulation of JUN kinase activity|negative regulation of transcription, DNA-dependent	cytosol|nucleus	protein binding|RNA binding			ovary(1)|breast(1)|skin(1)	3		Breast(234;0.0848)|Lung NSC(174;0.238)		Epithelial(162;0.000526)|all cancers(201;0.00794)|BRCA - Breast invasive adenocarcinoma(275;0.125)		TGTTGTAGGGTTATGAGAGAA	0.353													5	38	---	---	---	---	capture	Silent	SNP	112655708	112655708	PDCD4	10	T	C	C	C	1	0	0	0	0	0	0	0	1	769	60	3	3	11524	237
USP47	55031	broad.mit.edu	37	11	11969542	11969542	+	Missense_Mutation	SNP	C	T	T			TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:11969542C>T	uc001mjs.2	+	21	3905	c.3142C>T	c.(3142-3144)CAT>TAT	p.H1048Y	USP47_uc001mjr.2_Missense_Mutation_p.H980Y|USP47_uc009ygi.2_5'Flank	NM_017944	NP_060414	Q96K76	UBP47_HUMAN	ubiquitin specific protease 47	1068					base-excision repair|cellular response to UV|monoubiquitinated protein deubiquitination|negative regulation of apoptosis|negative regulation of caspase activity|negative regulation of G2/M transition of mitotic cell cycle|negative regulation of transcription, DNA-dependent|positive regulation of cell growth|response to drug|ubiquitin-dependent protein catabolic process	cytoplasm|SCF ubiquitin ligase complex	ubiquitin thiolesterase activity|ubiquitin-specific protease activity|WD40-repeat domain binding			ovary(1)|skin(1)	2				Epithelial(150;0.000339)		TTTCAAACAACATTTAGAGCC	0.398													86	184	---	---	---	---	capture	Missense_Mutation	SNP	11969542	11969542	USP47	11	C	T	T	T	1	0	0	0	0	1	0	0	0	221	17	2	2	16960	237
RTN3	10313	broad.mit.edu	37	11	63487657	63487657	+	Silent	SNP	C	T	T			TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:63487657C>T	uc001nxq.2	+	3	1870	c.1683C>T	c.(1681-1683)GAC>GAT	p.D561D	RTN3_uc001nxo.2_Intron|RTN3_uc001nxm.2_Intron|RTN3_uc001nxn.2_Silent_p.D542D|RTN3_uc001nxp.2_Intron|RTN3_uc009yov.2_Silent_p.D449D|RTN3_uc010rmt.1_Intron|RTN3_uc010rmu.1_Intron	NM_201428	NP_958831	O95197	RTN3_HUMAN	reticulon 3 isoform b	561					apoptosis|endoplasmic reticulum tubular network organization|interspecies interaction between organisms|response to stress|vesicle-mediated transport	endoplasmic reticulum membrane|extracellular space|Golgi membrane|integral to membrane				ovary(1)	1						TGGTCAGTGACTCTGAGCTGC	0.408													5	107	---	---	---	---	capture	Silent	SNP	63487657	63487657	RTN3	11	C	T	T	T	1	0	0	0	0	0	0	0	1	259	20	2	2	13619	237
SLC22A20	440044	broad.mit.edu	37	11	64990066	64990067	+	Missense_Mutation	DNP	AG	GT	GT			TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:64990066_64990067AG>GT	uc010roc.1	+	6	929_930	c.926_927AG>GT	c.(925-927)GAG>GGT	p.E309G	SLC22A20_uc010rob.1_Missense_Mutation_p.G253C	NM_001004326	NP_001004326	A6NK97	S22AK_HUMAN	solute carrier family 22, member 20	309	Cytoplasmic (Potential).				ion transport	integral to membrane	transmembrane transporter activity			central_nervous_system(1)	1						CTGACCAAGGAGGTAAGCGAGC	0.545													5	113	---	---	---	---	capture	Missense_Mutation	DNP	64990066	64990067	SLC22A20	11	AG	GT	GT	GT	1	0	0	0	0	1	0	0	0	132	11	3	3	14344	237
CDC42EP2	10435	broad.mit.edu	37	11	65088799	65088799	+	Nonsense_Mutation	SNP	G	T	T			TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:65088799G>T	uc001odl.2	+	2	880	c.430G>T	c.(430-432)GAG>TAG	p.E144*		NM_006779	NP_006770	O14613	BORG1_HUMAN	Cdc42 effector protein 2	144					actin filament organization|positive regulation of actin filament polymerization|positive regulation of pseudopodium assembly|regulation of cell shape	cytoplasm|cytoskeleton|endomembrane system|plasma membrane	GTP-Rho binding|Rho GTPase activator activity				0						TTCCCCACAGGAGGGAGGGAG	0.667													3	96	---	---	---	---	capture	Nonsense_Mutation	SNP	65088799	65088799	CDC42EP2	11	G	T	T	T	1	0	0	0	0	0	1	0	0	533	41	5	4	3047	237
C1S	716	broad.mit.edu	37	12	7177423	7177423	+	Missense_Mutation	SNP	C	T	T			TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:7177423C>T	uc001qsj.2	+	15	2254	c.1535C>T	c.(1534-1536)CCG>CTG	p.P512L	C1S_uc001qsk.2_Missense_Mutation_p.P512L|C1S_uc001qsl.2_Missense_Mutation_p.P512L|C1S_uc009zfr.2_Missense_Mutation_p.P345L|C1S_uc009zfs.2_RNA	NM_201442	NP_958850	P09871	C1S_HUMAN	complement component 1, s subcomponent	512	Peptidase S1.				complement activation, classical pathway|innate immune response|proteolysis	extracellular region	calcium ion binding|serine-type endopeptidase activity			skin(1)	1					Abciximab(DB00054)|Adalimumab(DB00051)|Basiliximab(DB00074)|Cetuximab(DB00002)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Immune globulin(DB00028)|Muromonab(DB00075)|Rituximab(DB00073)|Trastuzumab(DB00072)	TTTATTCATCCGGGATGGAAG	0.512													19	27	---	---	---	---	capture	Missense_Mutation	SNP	7177423	7177423	C1S	12	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	1956	237
C12orf63	374467	broad.mit.edu	37	12	97087506	97087506	+	Missense_Mutation	SNP	C	T	T			TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:97087506C>T	uc001tet.1	+	12	1624	c.1546C>T	c.(1546-1548)CCT>TCT	p.P516S		NM_198520	NP_940922	Q6ZTY8	CL063_HUMAN	hypothetical protein LOC374467	516										skin(6)|ovary(1)	7						ATAGGTTCTGCCTCTCCTTGC	0.289													36	88	---	---	---	---	capture	Missense_Mutation	SNP	97087506	97087506	C12orf63	12	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	1692	237
SELPLG	6404	broad.mit.edu	37	12	109017719	109017719	+	Missense_Mutation	SNP	T	C	C			TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:109017719T>C	uc001tni.2	-	2	525	c.365A>G	c.(364-366)CAG>CGG	p.Q122R	SELPLG_uc001tnh.2_Missense_Mutation_p.Q122R|SELPLG_uc010sxe.1_Missense_Mutation_p.Q138R	NM_003006	NP_002997	Q14242	SELPL_HUMAN	selectin P ligand	122	1.|Extracellular (Potential).|12 X 10 AA tandem repeats.				blood coagulation|cellular response to interleukin-6	integral to plasma membrane|membrane fraction	bacterial cell surface binding|receptor binding				0						TTGAGTGGTCTGTATCTCCAT	0.602													16	72	---	---	---	---	capture	Missense_Mutation	SNP	109017719	109017719	SELPLG	12	T	C	C	C	1	0	0	0	0	1	0	0	0	715	55	3	3	13913	237
TPCN1	53373	broad.mit.edu	37	12	113729743	113729743	+	Missense_Mutation	SNP	G	A	A			TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:113729743G>A	uc001tuw.2	+	25	2390	c.2093G>A	c.(2092-2094)CGC>CAC	p.R698H	TPCN1_uc001tux.2_Missense_Mutation_p.R770H|TPCN1_uc010syu.1_5'Flank	NM_017901	NP_060371	Q9ULQ1	TPC1_HUMAN	two pore segment channel 1 isoform 2	698	Cytoplasmic (Potential).					endosome membrane|integral to membrane|lysosomal membrane	NAADP-sensitive calcium-release channel activity|voltage-gated ion channel activity			skin(2)|ovary(1)	3						AACTACAGCCGCAAGAACCAG	0.498													4	143	---	---	---	---	capture	Missense_Mutation	SNP	113729743	113729743	TPCN1	12	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	16278	237
KSR2	283455	broad.mit.edu	37	12	118198974	118198974	+	Silent	SNP	C	T	T			TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:118198974C>T	uc001two.2	-	4	796	c.741G>A	c.(739-741)ACG>ACA	p.T247T		NM_173598	NP_775869	Q6VAB6	KSR2_HUMAN	kinase suppressor of ras 2	276	Pro-rich.				intracellular signal transduction	cytoplasm|membrane	ATP binding|metal ion binding|protein serine/threonine kinase activity			lung(10)|central_nervous_system(2)|stomach(1)|large_intestine(1)|breast(1)	15	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					TCATGGGCGGCGTGCCCGGCG	0.706													148	224	---	---	---	---	capture	Silent	SNP	118198974	118198974	KSR2	12	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	8502	237
CLIP1	6249	broad.mit.edu	37	12	122803873	122803873	+	Missense_Mutation	SNP	G	A	A			TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:122803873G>A	uc001ucg.1	-	17	3378	c.3272C>T	c.(3271-3273)GCC>GTC	p.A1091V	CLIP1_uc001uch.1_Missense_Mutation_p.A1080V|CLIP1_uc001uci.1_Missense_Mutation_p.A1045V|CLIP1_uc001ucj.1_Missense_Mutation_p.A666V	NM_002956	NP_002947	P30622	CLIP1_HUMAN	restin isoform a	1091	Potential.				mitotic prometaphase|positive regulation of microtubule polymerization	centrosome|cytosol|endosome|intermediate filament|kinetochore	nucleic acid binding|protein homodimerization activity|zinc ion binding			ovary(2)|breast(1)	3	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.81e-05)|Epithelial(86;6.85e-05)|BRCA - Breast invasive adenocarcinoma(302;0.226)		TATCTGCATGGCATCTTCCGC	0.478													3	82	---	---	---	---	capture	Missense_Mutation	SNP	122803873	122803873	CLIP1	12	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	3497	237
EP400	57634	broad.mit.edu	37	12	132527862	132527862	+	Missense_Mutation	SNP	T	A	A			TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:132527862T>A	uc001ujn.2	+	32	6256	c.6221T>A	c.(6220-6222)ATT>AAT	p.I2074N	EP400_uc001ujl.2_Missense_Mutation_p.I2073N|EP400_uc001ujm.2_Missense_Mutation_p.I1993N	NM_015409	NP_056224	Q96L91	EP400_HUMAN	E1A binding protein p400	2110					histone H2A acetylation|histone H4 acetylation|regulation of transcription, DNA-dependent	NuA4 histone acetyltransferase complex|nuclear speck	ATP binding|DNA binding|helicase activity			central_nervous_system(4)|ovary(3)|breast(3)|skin(2)	12	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		CTCAAGAGTATTGAGTATCTG	0.463													6	102	---	---	---	---	capture	Missense_Mutation	SNP	132527862	132527862	EP400	12	T	A	A	A	1	0	0	0	0	1	0	0	0	676	52	4	4	5104	237
SLC15A1	6564	broad.mit.edu	37	13	99356577	99356577	+	Missense_Mutation	SNP	G	A	A	rs141206459		TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:99356577G>A	uc001vno.2	-	17	1459	c.1382C>T	c.(1381-1383)ACG>ATG	p.T461M		NM_005073	NP_005064	P46059	S15A1_HUMAN	solute carrier family 15 (oligopeptide	461	Extracellular (Potential).				digestion|protein transport	integral to plasma membrane|membrane fraction	peptide:hydrogen symporter activity			ovary(1)	1	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)				Cefadroxil(DB01140)|Ceftibuten(DB01415)|Cyclacillin(DB01000)	CACTAGAAGCGTGTGGCGTTG	0.453													66	119	---	---	---	---	capture	Missense_Mutation	SNP	99356577	99356577	SLC15A1	13	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	14291	237
OR11H12	440153	broad.mit.edu	37	14	19378103	19378103	+	Missense_Mutation	SNP	G	T	T			TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:19378103G>T	uc010tkp.1	+	1	510	c.510G>T	c.(508-510)TGG>TGT	p.W170C		NM_001013354	NP_001013372	B2RN74	O11HC_HUMAN	olfactory receptor, family 11, subfamily H,	170	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		GATTTCTGTGGTTCCTGATCC	0.483													16	454	---	---	---	---	capture	Missense_Mutation	SNP	19378103	19378103	OR11H12	14	G	T	T	T	1	0	0	0	0	1	0	0	0	572	44	4	4	10831	237
OR4Q3	441669	broad.mit.edu	37	14	20216022	20216022	+	Missense_Mutation	SNP	G	T	T			TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:20216022G>T	uc010tkt.1	+	1	436	c.436G>T	c.(436-438)GTT>TTT	p.V146F		NM_172194	NP_751944	Q8NH05	OR4Q3_HUMAN	olfactory receptor, family 4, subfamily Q,	146	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			breast(3)	3	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		CCTTTGGTTGGTTCTTGCCTG	0.488													49	125	---	---	---	---	capture	Missense_Mutation	SNP	20216022	20216022	OR4Q3	14	G	T	T	T	1	0	0	0	0	1	0	0	0	572	44	4	4	10985	237
KHNYN	23351	broad.mit.edu	37	14	24901649	24901649	+	Silent	SNP	G	C	C			TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:24901649G>C	uc001wph.3	+	3	1384	c.1182G>C	c.(1180-1182)CGG>CGC	p.R394R	KHNYN_uc010tpc.1_Silent_p.R435R|KHNYN_uc010alw.2_Silent_p.R394R|CBLN3_uc001wpg.3_5'Flank	NM_015299	NP_056114	O15037	KHNYN_HUMAN	hypothetical protein LOC23351	394										ovary(2)|liver(1)	3						GCATGGCACGGGGTCGGGGGC	0.667											OREG0022627	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	69	---	---	---	---	capture	Silent	SNP	24901649	24901649	KHNYN	14	G	C	C	C	1	0	0	0	0	0	0	0	1	548	43	4	4	8072	237
MARK3	4140	broad.mit.edu	37	14	103933475	103933475	+	Missense_Mutation	SNP	A	C	C			TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:103933475A>C	uc001ymz.3	+	11	1723	c.1057A>C	c.(1057-1059)AAA>CAA	p.K353Q	MARK3_uc001ymx.3_Missense_Mutation_p.K353Q|MARK3_uc001ymw.3_Missense_Mutation_p.K353Q|MARK3_uc001yna.3_Missense_Mutation_p.K353Q|MARK3_uc001ymy.3_Missense_Mutation_p.K274Q|MARK3_uc010awp.2_Missense_Mutation_p.K376Q|MARK3_uc010tyb.1_Missense_Mutation_p.K164Q	NM_001128918	NP_001122390	P27448	MARK3_HUMAN	MAP/microtubule affinity-regulating kinase 3	353	UBA.						ATP binding|protein binding|protein serine/threonine kinase activity			central_nervous_system(2)|ovary(1)|stomach(1)	4		Melanoma(154;0.155)	Epithelial(46;0.241)			TAGTAAGATGAAATACGATGA	0.328													114	122	---	---	---	---	capture	Missense_Mutation	SNP	103933475	103933475	MARK3	14	A	C	C	C	1	0	0	0	0	1	0	0	0	117	9	4	4	9227	237
C15orf2	23742	broad.mit.edu	37	15	24924482	24924482	+	Silent	SNP	G	A	A			TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:24924482G>A	uc001ywo.2	+	1	3942	c.3468G>A	c.(3466-3468)CCG>CCA	p.P1156P		NM_018958	NP_061831	Q9NZP6	CO002_HUMAN	hypothetical protein LOC23742	1156					cell differentiation|multicellular organismal development|spermatogenesis					ovary(2)|large_intestine(2)|skin(2)|kidney(1)|central_nervous_system(1)	8		all_cancers(20;2.14e-21)|all_epithelial(15;4.77e-19)|Lung NSC(15;1.43e-14)|all_lung(15;9.57e-14)|Breast(32;0.00086)		all cancers(64;3.19e-24)|Epithelial(43;2.67e-17)|GBM - Glioblastoma multiforme(186;7.36e-07)|BRCA - Breast invasive adenocarcinoma(123;0.000273)|Lung(196;0.229)		TCCAACTTCCGTAAGAGCACC	0.423													42	78	---	---	---	---	capture	Silent	SNP	24924482	24924482	C15orf2	15	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	1770	237
GRIN2A	2903	broad.mit.edu	37	16	10032404	10032404	+	Missense_Mutation	SNP	G	A	A	rs142566406		TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:10032404G>A	uc002czo.3	-	3	967	c.419C>T	c.(418-420)CCG>CTG	p.P140L	GRIN2A_uc010uym.1_Missense_Mutation_p.P140L|GRIN2A_uc010uyn.1_5'UTR|GRIN2A_uc002czr.3_Missense_Mutation_p.P140L	NM_001134407	NP_001127879	Q12879	NMDE1_HUMAN	N-methyl-D-aspartate receptor subunit 2A isoform	140	Extracellular (Potential).				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding			skin(32)|NS(5)|ovary(4)|large_intestine(1)|lung(1)|breast(1)|kidney(1)	45					Felbamate(DB00949)|Glycine(DB00145)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)	GGTAGACGTCGGATCCTGCCA	0.478													27	47	---	---	---	---	capture	Missense_Mutation	SNP	10032404	10032404	GRIN2A	16	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	6712	237
MYH11	4629	broad.mit.edu	37	16	15811149	15811149	+	Missense_Mutation	SNP	C	G	G			TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:15811149C>G	uc002ddy.2	-	38	5459	c.5352G>C	c.(5350-5352)GAG>GAC	p.E1784D	MYH11_uc002ddv.2_Missense_Mutation_p.E1791D|MYH11_uc002ddw.2_Missense_Mutation_p.E1784D|MYH11_uc002ddx.2_Missense_Mutation_p.E1791D|MYH11_uc010bvg.2_Missense_Mutation_p.E1616D|NDE1_uc010uzy.1_Intron|NDE1_uc002dds.2_Intron|MYH11_uc010bvh.2_Missense_Mutation_p.E490D	NM_002474	NP_002465	P35749	MYH11_HUMAN	smooth muscle myosin heavy chain 11 isoform	1784	Potential.				axon guidance|cardiac muscle fiber development|elastic fiber assembly|skeletal muscle myosin thick filament assembly|smooth muscle contraction	cytosol|melanosome|muscle myosin complex|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity|structural constituent of muscle			ovary(6)|skin(3)|lung(2)|breast(2)|upper_aerodigestive_tract(1)|pancreas(1)	15						GCCGGGCACTCTCATTCTTCT	0.647			T	CBFB	AML								60	97	---	---	---	---	capture	Missense_Mutation	SNP	15811149	15811149	MYH11	16	C	G	G	G	1	0	0	0	0	1	0	0	0	415	32	4	4	9941	237
DNAH3	55567	broad.mit.edu	37	16	20952865	20952865	+	Missense_Mutation	SNP	C	T	T			TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:20952865C>T	uc010vbe.1	-	59	11512	c.11512G>A	c.(11512-11514)GAA>AAA	p.E3838K	DNAH3_uc010vbd.1_Missense_Mutation_p.E1273K	NM_017539	NP_060009	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	3838					ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(10)|skin(3)|large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	18				GBM - Glioblastoma multiforme(48;0.207)		TCAACCACTTCCTTAAAATGC	0.453													6	177	---	---	---	---	capture	Missense_Mutation	SNP	20952865	20952865	DNAH3	16	C	T	T	T	1	0	0	0	0	1	0	0	0	390	30	2	2	4560	237
OTOA	146183	broad.mit.edu	37	16	21698929	21698929	+	Missense_Mutation	SNP	C	T	T	rs148114778		TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:21698929C>T	uc002djh.2	+	7	596	c.595C>T	c.(595-597)CGG>TGG	p.R199W	uc002diq.3_Intron|OTOA_uc010vbj.1_Missense_Mutation_p.R120W	NM_144672	NP_653273	Q7RTW8	OTOAN_HUMAN	otoancorin isoform 1	199					sensory perception of sound	anchored to membrane|apical plasma membrane|proteinaceous extracellular matrix				ovary(1)|central_nervous_system(1)|skin(1)	3				GBM - Glioblastoma multiforme(48;0.0414)		CATCACAGAGCGGCTCCCTCG	0.473													31	35	---	---	---	---	capture	Missense_Mutation	SNP	21698929	21698929	OTOA	16	C	T	T	T	1	0	0	0	0	1	0	0	0	347	27	1	1	11206	237
SETD1A	9739	broad.mit.edu	37	16	30975479	30975479	+	Missense_Mutation	SNP	G	A	A			TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:30975479G>A	uc002ead.1	+	6	1390	c.704G>A	c.(703-705)GGC>GAC	p.G235D	SETD1A_uc002eae.1_Missense_Mutation_p.G235D	NM_014712	NP_055527	O15047	SET1A_HUMAN	SET domain containing 1A	235					regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nuclear speck|Set1C/COMPASS complex	histone-lysine N-methyltransferase activity|nucleotide binding|protein binding|RNA binding			ovary(2)|skin(1)	3						ACTGCGGTGGGCACTCCTGGC	0.627													4	130	---	---	---	---	capture	Missense_Mutation	SNP	30975479	30975479	SETD1A	16	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	14023	237
ARHGEF15	22899	broad.mit.edu	37	17	8219094	8219094	+	Silent	SNP	C	T	T			TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:8219094C>T	uc002glc.2	+	8	1564	c.1443C>T	c.(1441-1443)TCC>TCT	p.S481S	ARHGEF15_uc002gld.2_Silent_p.S481S|ARHGEF15_uc010vuw.1_Silent_p.S370S	NM_173728	NP_776089	O94989	ARHGF_HUMAN	Rho guanine exchange factor 15	481	DH.				negative regulation of synapse maturation|regulation of Rho protein signal transduction	dendrite|intracellular	GTPase activator activity|Rho guanyl-nucleotide exchange factor activity			ovary(2)|skin(1)	3						CGCTCCTGTCCCGTGTGCGCT	0.582													3	75	---	---	---	---	capture	Silent	SNP	8219094	8219094	ARHGEF15	17	C	T	T	T	1	0	0	0	0	0	0	0	1	275	22	2	2	891	237
RNF112	7732	broad.mit.edu	37	17	19316608	19316608	+	Missense_Mutation	SNP	G	A	A			TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:19316608G>A	uc010vyw.1	+	5	803	c.604G>A	c.(604-606)GGC>AGC	p.G202S	RNF112_uc010vyu.1_3'UTR|RNF112_uc010vyv.1_Missense_Mutation_p.G202S|RNF112_uc010vyx.1_Missense_Mutation_p.G85S	NM_007148	NP_009079	Q7Z5V9	Q7Z5V9_HUMAN	ring finger protein 112	202							GTP binding|GTPase activity|zinc ion binding			ovary(2)	2						TGGTGAGGGCGGCCGGCCAAG	0.652													20	27	---	---	---	---	capture	Missense_Mutation	SNP	19316608	19316608	RNF112	17	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	13318	237
KRT37	8688	broad.mit.edu	37	17	39580498	39580498	+	Missense_Mutation	SNP	C	T	T			TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:39580498C>T	uc002hwp.1	-	1	325	c.278G>A	c.(277-279)GGG>GAG	p.G93E	uc002hwo.1_RNA	NM_003770	NP_003761	O76014	KRT37_HUMAN	keratin 37	93	Head.					intermediate filament	structural molecule activity			skin(1)	1		Breast(137;0.000496)				GCCGTAGGCCCCACAGATTCC	0.602													40	59	---	---	---	---	capture	Missense_Mutation	SNP	39580498	39580498	KRT37	17	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	8394	237
TRIM65	201292	broad.mit.edu	37	17	73887344	73887344	+	Missense_Mutation	SNP	C	T	T			TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:73887344C>T	uc002jpx.2	-	6	1106	c.1070G>A	c.(1069-1071)CGT>CAT	p.R357H		NM_173547	NP_775818	Q6PJ69	TRI65_HUMAN	tripartite motif-containing 65	357	B30.2/SPRY.					intracellular	zinc ion binding				0			Epithelial(20;7.53e-06)|all cancers(21;9.11e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00092)|LUSC - Lung squamous cell carcinoma(166;0.154)			CCGGGACTGACGACAGTGCTT	0.627													17	42	---	---	---	---	capture	Missense_Mutation	SNP	73887344	73887344	TRIM65	17	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	16422	237
ZNF519	162655	broad.mit.edu	37	18	14105942	14105942	+	Silent	SNP	A	G	G			TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:14105942A>G	uc002kst.1	-	3	750	c.597T>C	c.(595-597)CCT>CCC	p.P199P	ZNF519_uc002ksq.1_Intron|ZNF519_uc002ksr.1_Intron|ZNF519_uc010dlm.1_Intron	NM_145287	NP_660330	Q8TB69	ZN519_HUMAN	zinc finger protein 519	199	C2H2-type 1; degenerate.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						GGATATTTTCAGGGAAAATAA	0.284													3	112	---	---	---	---	capture	Silent	SNP	14105942	14105942	ZNF519	18	A	G	G	G	1	0	0	0	0	0	0	0	1	80	7	3	3	17843	237
ELP2	55250	broad.mit.edu	37	18	33740957	33740957	+	Nonsense_Mutation	SNP	C	G	G			TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:33740957C>G	uc002kzk.1	+	17	1761	c.1751C>G	c.(1750-1752)TCA>TGA	p.S584*	ELP2_uc010xcg.1_Nonsense_Mutation_p.S649*|ELP2_uc002kzl.1_RNA|ELP2_uc002kzm.1_Nonsense_Mutation_p.S558*|ELP2_uc010xch.1_Nonsense_Mutation_p.S579*|ELP2_uc002kzn.1_Nonsense_Mutation_p.S514*|ELP2_uc002kzo.1_Nonsense_Mutation_p.S514*	NM_018255	NP_060725	Q6IA86	ELP2_HUMAN	elongator protein 2	584	WD 10.				regulation of transcription from RNA polymerase II promoter	Golgi apparatus|transcription elongation factor complex				breast(2)|ovary(1)|skin(1)	4						CTGCTTGCCTCAGCTTGTAAG	0.363													50	120	---	---	---	---	capture	Nonsense_Mutation	SNP	33740957	33740957	ELP2	18	C	G	G	G	1	0	0	0	0	0	1	0	0	377	29	5	4	5035	237
RTTN	25914	broad.mit.edu	37	18	67871471	67871471	+	Missense_Mutation	SNP	T	C	C			TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:67871471T>C	uc002lkp.2	-	3	316	c.248A>G	c.(247-249)GAC>GGC	p.D83G	RTTN_uc010xfb.1_5'UTR|RTTN_uc002lkq.1_Missense_Mutation_p.D83G	NM_173630	NP_775901	Q86VV8	RTTN_HUMAN	rotatin	83							binding			ovary(3)|pancreas(2)|skin(1)|breast(1)|central_nervous_system(1)	8		Esophageal squamous(42;0.129)				TGCACCAACGTCAACCAAATG	0.388													4	170	---	---	---	---	capture	Missense_Mutation	SNP	67871471	67871471	RTTN	18	T	C	C	C	1	0	0	0	0	1	0	0	0	754	58	3	3	13629	237
NFATC1	4772	broad.mit.edu	37	18	77246687	77246687	+	Silent	SNP	C	T	T			TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:77246687C>T	uc010xfg.1	+	9	2985	c.2532C>T	c.(2530-2532)CCC>CCT	p.P844P	NFATC1_uc002lnd.2_Intron|NFATC1_uc002lne.2_Intron|NFATC1_uc010xfh.1_Intron|NFATC1_uc010xfj.1_Silent_p.P372P|NFATC1_uc002lnf.2_Silent_p.P831P|NFATC1_uc002lng.2_Intron|NFATC1_uc010xfk.1_Intron	NM_006162	NP_006153	O95644	NFAC1_HUMAN	nuclear factor of activated T-cells, cytosolic	844	Trans-activation domain B (TAD-B).				intracellular signal transduction|positive regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	cytoplasm|nucleus	FK506 binding|protein binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding			large_intestine(1)|ovary(1)	2		Esophageal squamous(42;0.0157)|Melanoma(33;0.144)		OV - Ovarian serous cystadenocarcinoma(15;3.73e-07)|BRCA - Breast invasive adenocarcinoma(31;0.0257)		CGCTCTGCCCCAGCAGCCCCT	0.751													2	20	---	---	---	---	capture	Silent	SNP	77246687	77246687	NFATC1	18	C	T	T	T	1	0	0	0	0	0	0	0	1	262	21	2	2	10268	237
PQLC1	80148	broad.mit.edu	37	18	77679330	77679330	+	Silent	SNP	C	T	T			TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:77679330C>T	uc002lnl.2	-	5	634	c.462G>A	c.(460-462)ACG>ACA	p.T154T	PQLC1_uc010dre.2_Silent_p.T71T|PQLC1_uc002lnk.2_Silent_p.T136T|PQLC1_uc010xfm.1_Intron	NM_025078	NP_079354	Q8N2U9	PQLC1_HUMAN	PQ loop repeat containing 1 isoform 1	154	Helical; (Potential).					integral to membrane				large_intestine(1)|ovary(1)	2		Esophageal squamous(42;0.0212)|Melanoma(33;0.2)		OV - Ovarian serous cystadenocarcinoma(15;8.2e-07)|BRCA - Breast invasive adenocarcinoma(31;0.0258)		CCGCCACGCCCGTGAAGGCCA	0.627													3	62	---	---	---	---	capture	Silent	SNP	77679330	77679330	PQLC1	18	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	12319	237
FBN3	84467	broad.mit.edu	37	19	8176044	8176044	+	Missense_Mutation	SNP	C	T	T	rs117092804	by1000genomes	TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:8176044C>T	uc002mjf.2	-	32	4129	c.4108G>A	c.(4108-4110)GTG>ATG	p.V1370M		NM_032447	NP_115823	Q75N90	FBN3_HUMAN	fibrillin 3 precursor	1370	EGF-like 21; calcium-binding.					proteinaceous extracellular matrix	calcium ion binding|extracellular matrix structural constituent			ovary(6)|skin(3)|pancreas(1)|central_nervous_system(1)	11						CAGAGGTCCACGTTCTCGGCA	0.657													3	93	---	---	---	---	capture	Missense_Mutation	SNP	8176044	8176044	FBN3	19	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	5650	237
FBN3	84467	broad.mit.edu	37	19	8201272	8201272	+	Missense_Mutation	SNP	C	T	T			TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:8201272C>T	uc002mjf.2	-	10	1366	c.1345G>A	c.(1345-1347)GAT>AAT	p.D449N		NM_032447	NP_115823	Q75N90	FBN3_HUMAN	fibrillin 3 precursor	449	EGF-like 4; calcium-binding.					proteinaceous extracellular matrix	calcium ion binding|extracellular matrix structural constituent			ovary(6)|skin(3)|pancreas(1)|central_nervous_system(1)	11						CGCGGCTCACCAATGCACTCG	0.652													38	104	---	---	---	---	capture	Missense_Mutation	SNP	8201272	8201272	FBN3	19	C	T	T	T	1	0	0	0	0	1	0	0	0	273	21	2	2	5650	237
RDH8	50700	broad.mit.edu	37	19	10131987	10131987	+	Missense_Mutation	SNP	C	T	T			TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:10131987C>T	uc002mmr.2	+	5	842	c.593C>T	c.(592-594)GCG>GTG	p.A198V		NM_015725	NP_056540	Q9NYR8	RDH8_HUMAN	retinol dehydrogenase 8 (all-trans)	198					estrogen biosynthetic process|response to stimulus|visual perception	cytoplasm|integral to plasma membrane	binding|estradiol 17-beta-dehydrogenase activity|NADP-retinol dehydrogenase activity|retinol dehydrogenase activity			ovary(3)|pancreas(1)	4			Epithelial(33;4.24e-05)		Vitamin A(DB00162)	AAGCTTCTGGCGCAGGTTTCT	0.602													54	133	---	---	---	---	capture	Missense_Mutation	SNP	10131987	10131987	RDH8	19	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	13091	237
OR10H5	284433	broad.mit.edu	37	19	15905052	15905052	+	Missense_Mutation	SNP	C	T	T			TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:15905052C>T	uc010xos.1	+	1	194	c.194C>T	c.(193-195)GCC>GTC	p.A65V		NM_001004466	NP_001004466	Q8NGA6	O10H5_HUMAN	olfactory receptor, family 10, subfamily H,	65	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1						TTCCTGTGTGCCCTCTCCATC	0.627													4	177	---	---	---	---	capture	Missense_Mutation	SNP	15905052	15905052	OR10H5	19	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	10813	237
TMEM59L	25789	broad.mit.edu	37	19	18724803	18724803	+	Missense_Mutation	SNP	C	T	T			TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:18724803C>T	uc002njy.3	+	2	380	c.293C>T	c.(292-294)GCC>GTC	p.A98V	TMEM59L_uc010ebu.1_Missense_Mutation_p.A98V	NM_012109	NP_036241	Q9UK28	TM59L_HUMAN	brain-specific membrane-anchored protein	98						Golgi membrane|integral to membrane|membrane fraction				ovary(2)|skin(2)	4						AAGCCCAATGCCACCCAAACT	0.652													4	101	---	---	---	---	capture	Missense_Mutation	SNP	18724803	18724803	TMEM59L	19	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	16069	237
TSHZ3	57616	broad.mit.edu	37	19	31767776	31767776	+	Missense_Mutation	SNP	C	T	T			TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:31767776C>T	uc002nsy.3	-	2	2988	c.2923G>A	c.(2923-2925)GTC>ATC	p.V975I		NM_020856	NP_065907	Q63HK5	TSH3_HUMAN	zinc finger protein 537	975					negative regulation of transcription, DNA-dependent|regulation of respiratory gaseous exchange by neurological system process	growth cone|nucleus	chromatin binding|protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(4)|skin(2)|pancreas(1)|lung(1)	8	Esophageal squamous(110;0.226)					CAAAAGAAGACGGGGTGGCCA	0.512													36	107	---	---	---	---	capture	Missense_Mutation	SNP	31767776	31767776	TSHZ3	19	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	16508	237
RYR1	6261	broad.mit.edu	37	19	38990563	38990563	+	Silent	SNP	G	A	A			TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:38990563G>A	uc002oit.2	+	45	7360	c.7230G>A	c.(7228-7230)CCG>CCA	p.P2410P	RYR1_uc002oiu.2_Silent_p.P2410P|RYR1_uc002oiv.1_5'UTR	NM_000540	NP_000531	P21817	RYR1_HUMAN	skeletal muscle ryanodine receptor isoform 1	2410	Cytoplasmic.|6 X approximate repeats.				muscle contraction|release of sequestered calcium ion into cytosol|response to caffeine|response to hypoxia	cell cortex|cytosol|I band|integral to plasma membrane|junctional sarcoplasmic reticulum membrane|smooth endoplasmic reticulum|terminal cisterna	calcium ion binding|calmodulin binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(7)|pancreas(2)|breast(1)|central_nervous_system(1)|skin(1)	12	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Dantrolene(DB01219)	GTGAGGAACCGCCTGAAGAAA	0.632													5	135	---	---	---	---	capture	Silent	SNP	38990563	38990563	RYR1	19	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	13660	237
FUT1	2523	broad.mit.edu	37	19	49253750	49253750	+	Silent	SNP	G	A	A			TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:49253750G>A	uc002pkk.2	-	4	1764	c.789C>T	c.(787-789)AAC>AAT	p.N263N		NM_000148	NP_000139	P19526	FUT1_HUMAN	fucosyltransferase 1	263	Lumenal (Potential).				L-fucose catabolic process|protein glycosylation	Golgi cisterna membrane|integral to plasma membrane|membrane fraction	galactoside 2-alpha-L-fucosyltransferase activity			ovary(1)	1		all_lung(116;1.7e-06)|all_epithelial(76;3.52e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000135)|all cancers(93;0.000354)|Epithelial(262;0.0191)|GBM - Glioblastoma multiforme(486;0.0222)		ACTCCATGCCGTTGCTGGTGA	0.617													51	153	---	---	---	---	capture	Silent	SNP	49253750	49253750	FUT1	19	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	6043	237
ZNF528	84436	broad.mit.edu	37	19	52918768	52918768	+	Silent	SNP	C	G	G			TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:52918768C>G	uc002pzh.2	+	7	1089	c.663C>G	c.(661-663)GTC>GTG	p.V221V	ZNF528_uc002pzi.2_5'UTR	NM_032423	NP_115799	Q3MIS6	ZN528_HUMAN	zinc finger protein 528	221	C2H2-type 1.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|skin(1)	2				GBM - Glioblastoma multiforme(134;0.00249)|OV - Ovarian serous cystadenocarcinoma(262;0.00817)		GTGGCAAGGTCTTTAGTTGCA	0.413													8	221	---	---	---	---	capture	Silent	SNP	52918768	52918768	ZNF528	19	C	G	G	G	1	0	0	0	0	0	0	0	1	405	32	4	4	17848	237
KIR2DS4	3809	broad.mit.edu	37	19	55349278	55349278	+	Missense_Mutation	SNP	C	A	A			TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:55349278C>A	uc002qhm.1	+	3	364	c.318C>A	c.(316-318)CAC>CAA	p.H106Q	KIR2DS4_uc010yfj.1_Missense_Mutation_p.H99Q|KIR2DS4_uc010yfk.1_RNA|KIR3DL1_uc002qhl.3_Intron|KIR2DS4_uc010esg.1_Missense_Mutation_p.H106Q|KIR2DS4_uc002qhn.1_Missense_Mutation_p.H53Q	NM_012314	NP_036446	P43632	KI2S4_HUMAN	killer cell immunoglobulin-like receptor, two	106	Extracellular (Potential).|Ig-like C2-type 1.					integral to plasma membrane	receptor activity				0				GBM - Glioblastoma multiforme(193;0.0192)		CTGTTCCTCACTCCCCCTATC	0.512													35	820	---	---	---	---	capture	Missense_Mutation	SNP	55349278	55349278	KIR2DS4	19	C	A	A	A	1	0	0	0	0	1	0	0	0	259	20	4	4	8241	237
ZNF814	730051	broad.mit.edu	37	19	58385748	58385748	+	Missense_Mutation	SNP	G	A	A	rs145250945		TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:58385748G>A	uc002qqo.2	-	3	1282	c.1010C>T	c.(1009-1011)GCT>GTT	p.A337V	ZNF814_uc002qqk.2_Intron|ZNF814_uc010yhl.1_Intron	NM_001144989	NP_001138461	B7Z6K7	ZN814_HUMAN	zinc finger protein 814	337	C2H2-type 5.				regulation of transcription, DNA-dependent	intracellular	nucleic acid binding|zinc ion binding				0						ACTGAAGCTAGCATATTTGCT	0.353													6	5	---	---	---	---	capture	Missense_Mutation	SNP	58385748	58385748	ZNF814	19	G	A	A	A	1	0	0	0	0	1	0	0	0	442	34	2	2	18052	237
ZNF274	10782	broad.mit.edu	37	19	58723892	58723892	+	Nonsense_Mutation	SNP	C	T	T			TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:58723892C>T	uc002qrq.1	+	10	1804	c.1345C>T	c.(1345-1347)CGA>TGA	p.R449*	ZNF274_uc002qrr.1_Nonsense_Mutation_p.R417*|ZNF274_uc002qrs.1_Nonsense_Mutation_p.R344*|ZNF274_uc010eum.1_Nonsense_Mutation_p.R208*	NM_133502	NP_598009	Q96GC6	ZN274_HUMAN	zinc finger protein 274 isoform c	449					viral reproduction	centrosome|nucleolus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity|zinc ion binding			ovary(1)	1		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Ovarian(87;0.0443)|Breast(46;0.0889)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0168)|Lung(386;0.215)		TCCTAGAAAACGATTGCGCAA	0.428													42	153	---	---	---	---	capture	Nonsense_Mutation	SNP	58723892	58723892	ZNF274	19	C	T	T	T	1	0	0	0	0	0	1	0	0	243	19	5	1	17689	237
NRXN1	9378	broad.mit.edu	37	2	50280492	50280492	+	Missense_Mutation	SNP	T	G	G			TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:50280492T>G	uc010fbp.2	-	4	1657	c.850A>C	c.(850-852)ACA>CCA	p.T284P	NRXN1_uc002rxb.3_Missense_Mutation_p.T1021P|NRXN1_uc010fbq.2_Missense_Mutation_p.T1389P|NRXN1_uc002rxe.3_Missense_Mutation_p.T1319P	NM_138735	NP_620072	P58400	NRX1B_HUMAN	neurexin 1 isoform beta precursor	284	Extracellular (Potential).				angiogenesis|neuron cell-cell adhesion|neuronal signal transduction	cell surface|endocytic vesicle|integral to membrane|presynaptic membrane	cell adhesion molecule binding|receptor binding			ovary(2)	2		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			ATAATTGATGTGGACATCTCT	0.502													63	108	---	---	---	---	capture	Missense_Mutation	SNP	50280492	50280492	NRXN1	2	T	G	G	G	1	0	0	0	0	1	0	0	0	767	59	4	4	10572	237
LCT	3938	broad.mit.edu	37	2	136594490	136594490	+	Missense_Mutation	SNP	T	A	A			TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:136594490T>A	uc002tuu.1	-	1	261	c.250A>T	c.(250-252)ATC>TTC	p.I84F		NM_002299	NP_002290	P09848	LPH_HUMAN	lactase-phlorizin hydrolase preproprotein	84	Extracellular (Potential).				carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|integral to plasma membrane|membrane fraction	cation binding|glycosylceramidase activity|lactase activity			ovary(7)|central_nervous_system(2)|skin(2)|pancreas(1)|lung(1)	13				BRCA - Breast invasive adenocarcinoma(221;0.169)		TAATGGGTGATCTGACTGGCA	0.507													38	53	---	---	---	---	capture	Missense_Mutation	SNP	136594490	136594490	LCT	2	T	A	A	A	1	0	0	0	0	1	0	0	0	650	50	4	4	8613	237
COBLL1	22837	broad.mit.edu	37	2	165551199	165551199	+	Missense_Mutation	SNP	A	T	T			TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:165551199A>T	uc010zcw.1	-	15	3142	c.3018T>A	c.(3016-3018)AAT>AAA	p.N1006K	COBLL1_uc002ucp.2_Missense_Mutation_p.N939K|COBLL1_uc002ucq.2_Missense_Mutation_p.N901K|COBLL1_uc010zcx.1_Missense_Mutation_p.N947K|COBLL1_uc002ucn.2_Missense_Mutation_p.N367K|COBLL1_uc002uco.2_Missense_Mutation_p.N670K	NM_014900	NP_055715	Q53SF7	COBL1_HUMAN	COBL-like 1	977										ovary(2)|pancreas(1)	3						CTGCCTCTTTATTTGTCAGTT	0.468													8	66	---	---	---	---	capture	Missense_Mutation	SNP	165551199	165551199	COBLL1	2	A	T	T	T	1	0	0	0	0	1	0	0	0	206	16	4	4	3619	237
ZC3H15	55854	broad.mit.edu	37	2	187368763	187368763	+	Missense_Mutation	SNP	G	A	A			TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:187368763G>A	uc002upo.2	+	6	764	c.539G>A	c.(538-540)TGC>TAC	p.C180Y		NM_018471	NP_060941	Q8WU90	ZC3HF_HUMAN	erythropoietin 4 immediate early response	180	C3H1-type 2.					cytoplasm|nucleolus|plasma membrane	nucleic acid binding|zinc ion binding			skin(1)	1			OV - Ovarian serous cystadenocarcinoma(117;0.0148)|Epithelial(96;0.0922)|all cancers(119;0.233)			CTATAGGTGTGCAAGCATTTC	0.438													122	164	---	---	---	---	capture	Missense_Mutation	SNP	187368763	187368763	ZC3H15	2	G	A	A	A	1	0	0	0	0	1	0	0	0	598	46	2	2	17447	237
CCDC150	284992	broad.mit.edu	37	2	197521487	197521487	+	Nonsense_Mutation	SNP	C	T	T			TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:197521487C>T	uc002utp.1	+	3	442	c.307C>T	c.(307-309)CGA>TGA	p.R103*	CCDC150_uc002uto.1_Nonsense_Mutation_p.R103*|CCDC150_uc010zgq.1_RNA|CCDC150_uc010zgr.1_Intron|CCDC150_uc010zgs.1_Intron	NM_001080539	NP_001074008	Q8NCX0	CC150_HUMAN	coiled-coil domain containing 150	103											0						TCTGGTAAATCGAATGTGCCG	0.398													40	87	---	---	---	---	capture	Nonsense_Mutation	SNP	197521487	197521487	CCDC150	2	C	T	T	T	1	0	0	0	0	0	1	0	0	399	31	5	1	2759	237
WFDC11	259239	broad.mit.edu	37	20	44278019	44278020	+	Missense_Mutation	DNP	TT	AA	AA			TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:44278019_44278020TT>AA	uc002xpa.2	-	4	314_315	c.119_120AA>TT	c.(118-120)GAA>GTT	p.E40V		NM_147197	NP_671730	Q8NEX6	WFD11_HUMAN	WAP four-disulfide core domain 11 precursor	40						extracellular region					0		Myeloproliferative disorder(115;0.0122)				CCCAGCATTCTTCAAGTAACAA	0.391													7	325	---	---	---	---	capture	Missense_Mutation	DNP	44278019	44278020	WFDC11	20	TT	AA	AA	AA	1	0	0	0	0	1	0	0	0	725	56	4	4	17230	237
KRTAP6-2	337967	broad.mit.edu	37	21	31971188	31971188	+	Silent	SNP	G	A	A			TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:31971188G>A	uc011adc.1	-	1	6	c.6C>T	c.(4-6)TGC>TGT	p.C2C	KRTAP22-1_uc011add.1_5'Flank	NM_181604	NP_853635	Q3LI66	KRA62_HUMAN	keratin associated protein 6-2	2						intermediate filament					0						AGTAGCTGCCGCACATCGTGA	0.483													46	72	---	---	---	---	capture	Silent	SNP	31971188	31971188	KRTAP6-2	21	G	A	A	A	1	0	0	0	0	0	0	0	1	490	38	1	1	8490	237
DSCR6	53820	broad.mit.edu	37	21	38380461	38380461	+	Missense_Mutation	SNP	G	A	A			TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:38380461G>A	uc002yvv.2	+	2	319	c.109G>A	c.(109-111)GCG>ACG	p.A37T	DSCR6_uc011aec.1_5'UTR|DSCR6_uc010gnd.2_5'UTR	NM_018962	NP_061835	P57055	DSCR6_HUMAN	Down syndrome critical region protein 6	37						nucleus				breast(1)	1		Myeloproliferative disorder(46;0.0632)				TTCCAGCCCCGCGCCGTGGCG	0.582													39	53	---	---	---	---	capture	Missense_Mutation	SNP	38380461	38380461	DSCR6	21	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	4728	237
MCM3AP	8888	broad.mit.edu	37	21	47662773	47662773	+	Missense_Mutation	SNP	A	C	C			TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:47662773A>C	uc002zir.1	-	25	5405	c.5369T>G	c.(5368-5370)TTG>TGG	p.L1790W	MCM3APAS_uc002zim.2_Intron|MCM3APAS_uc002zin.2_Intron|MCM3AP_uc002zio.1_Missense_Mutation_p.L285W|MCM3AP_uc002zip.1_Missense_Mutation_p.L531W|MCM3AP_uc002ziq.1_Missense_Mutation_p.L717W|MCM3APAS_uc002zis.1_Intron	NM_003906	NP_003897	O60318	MCM3A_HUMAN	minichromosome maintenance complex component 3	1790					DNA replication|protein import into nucleus	cytosol|nucleus	DNA binding|nucleotide binding			large_intestine(2)|lung(1)|ovary(1)|skin(1)	5	Breast(49;0.112)					TTCCCACGACAAAGGAACATC	0.403													10	128	---	---	---	---	capture	Missense_Mutation	SNP	47662773	47662773	MCM3AP	21	A	C	C	C	1	0	0	0	0	1	0	0	0	65	5	4	4	9301	237
HSCB	150274	broad.mit.edu	37	22	29147228	29147228	+	Splice_Site	SNP	G	A	A			TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:29147228G>A	uc003aea.2	+	5	610	c.569_splice	c.e5-1	p.A190_splice		NM_172002	NP_741999	Q8IWL3	HSC20_HUMAN	J-type co-chaperone HSC20 precursor						iron-sulfur cluster assembly|protein folding	mitochondrion	chaperone binding|heat shock protein binding|metal ion binding			kidney(1)	1						TTCTTTTTCAGCTAAACAGAA	0.299													2	21	---	---	---	---	capture	Splice_Site	SNP	29147228	29147228	HSCB	22	G	A	A	A	1	0	0	0	0	0	0	1	0	442	34	5	2	7299	237
NEK10	152110	broad.mit.edu	37	3	27233608	27233608	+	Missense_Mutation	SNP	T	G	G			TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:27233608T>G	uc010hfk.2	-	5	582	c.353A>C	c.(352-354)GAA>GCA	p.E118A	NEK10_uc003cds.1_Missense_Mutation_p.E203A|NEK10_uc010hfj.2_Missense_Mutation_p.E118A			Q6ZWH5	NEK10_HUMAN	RecName: Full=Serine/threonine-protein kinase Nek10;          EC=2.7.11.1; AltName: Full=NimA-related protein kinase 10;	806							ATP binding|metal ion binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(5)|stomach(2)|central_nervous_system(2)|lung(2)|skin(1)|pancreas(1)	13						TCGTTCCCGTTCTAGCTTCTT	0.423													66	118	---	---	---	---	capture	Missense_Mutation	SNP	27233608	27233608	NEK10	3	T	G	G	G	1	0	0	0	0	1	0	0	0	794	62	4	4	10229	237
SLC22A14	9389	broad.mit.edu	37	3	38355344	38355344	+	Silent	SNP	C	G	G			TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:38355344C>G	uc010hhc.1	+	8	1332	c.1290C>G	c.(1288-1290)CTC>CTG	p.L430L	SLC22A14_uc003cib.2_Silent_p.L430L|SLC22A14_uc011ayo.1_RNA	NM_004803	NP_004794	Q9Y267	S22AE_HUMAN	organic cation transporter like 4	430	Helical; (Potential).					integral to plasma membrane	organic cation transmembrane transporter activity				0				KIRC - Kidney renal clear cell carcinoma(284;0.0554)|Kidney(284;0.0696)		GCATCTTTCTCCTCCAGCAGA	0.577													11	172	---	---	---	---	capture	Silent	SNP	38355344	38355344	SLC22A14	3	C	G	G	G	1	0	0	0	0	0	0	0	1	379	30	4	4	14338	237
CDCP1	64866	broad.mit.edu	37	3	45153846	45153846	+	Silent	SNP	A	G	G			TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:45153846A>G	uc003com.2	-	3	519	c.384T>C	c.(382-384)GAT>GAC	p.D128D	CDCP1_uc003con.2_Silent_p.D128D	NM_022842	NP_073753	Q9H5V8	CDCP1_HUMAN	CUB domain-containing protein 1 isoform 1	128	Extracellular (Potential).					extracellular region|integral to membrane|plasma membrane				ovary(1)|central_nervous_system(1)|skin(1)	3				BRCA - Breast invasive adenocarcinoma(193;0.00928)|KIRC - Kidney renal clear cell carcinoma(197;0.0519)|Kidney(197;0.0651)		GAGCTTTGACATCCCAGATGA	0.527													181	247	---	---	---	---	capture	Silent	SNP	45153846	45153846	CDCP1	3	A	G	G	G	1	0	0	0	0	0	0	0	1	102	8	3	3	3064	237
MYH15	22989	broad.mit.edu	37	3	108179152	108179152	+	Missense_Mutation	SNP	G	C	C			TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:108179152G>C	uc003dxa.1	-	18	2044	c.1987C>G	c.(1987-1989)CAT>GAT	p.H663D		NM_014981	NP_055796	Q9Y2K3	MYH15_HUMAN	myosin, heavy polypeptide 15	663	Myosin head-like.					myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity			ovary(5)|central_nervous_system(2)	7						ATTACTTTATGCAGAGATGCA	0.299													2	25	---	---	---	---	capture	Missense_Mutation	SNP	108179152	108179152	MYH15	3	G	C	C	C	1	0	0	0	0	1	0	0	0	598	46	4	4	9944	237
DIRC2	84925	broad.mit.edu	37	3	122514299	122514299	+	Missense_Mutation	SNP	G	A	A			TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:122514299G>A	uc003efw.3	+	1	399	c.260G>A	c.(259-261)AGC>AAC	p.S87N	DIRC2_uc010hrl.2_RNA|DIRC2_uc010hrm.2_5'UTR|HSPBAP1_uc003efu.1_5'Flank|HSPBAP1_uc003efv.1_5'Flank	NM_032839	NP_116228	Q96SL1	DIRC2_HUMAN	disrupted in renal carcinoma 2	87					transport	integral to membrane					0				GBM - Glioblastoma multiforme(114;0.0614)		GGCTTCTCCAGCTGGGACATC	0.662													15	12	---	---	---	---	capture	Missense_Mutation	SNP	122514299	122514299	DIRC2	3	G	A	A	A	1	0	0	0	0	1	0	0	0	442	34	2	2	4492	237
SELT	51714	broad.mit.edu	37	3	150321196	150321196	+	Missense_Mutation	SNP	G	A	A			TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:150321196G>A	uc011bnx.1	+	1	131	c.47G>A	c.(46-48)CGG>CAG	p.R16Q	SERP1_uc003exz.2_5'Flank|uc003eye.1_5'Flank	NM_016275	NP_057359	P62341	SELT_HUMAN	selenoprotein T precursor	16				RSE -> WSD (in Ref. 4; AAH09611).	cell redox homeostasis|selenocysteine incorporation		selenium binding				0			LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)			GCGATGGTCCGGAGCGAGGCC	0.597													3	32	---	---	---	---	capture	Missense_Mutation	SNP	150321196	150321196	SELT	3	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	13915	237
PIK3CA	5290	broad.mit.edu	37	3	178916614	178916614	+	Missense_Mutation	SNP	A	G	G			TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:178916614A>G	uc003fjk.2	+	2	158	c.1A>G	c.(1-3)ATG>GTG	p.M1V		NM_006218	NP_006209	P42336	PK3CA_HUMAN	phosphoinositide-3-kinase, catalytic, alpha	1					epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell costimulation|T cell receptor signaling pathway		1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity			breast(1564)|large_intestine(776)|endometrium(246)|urinary_tract(195)|ovary(141)|skin(112)|stomach(98)|thyroid(77)|central_nervous_system(69)|lung(65)|upper_aerodigestive_tract(58)|haematopoietic_and_lymphoid_tissue(27)|cervix(25)|biliary_tract(22)|liver(20)|oesophagus(17)|pancreas(11)|penis(8)|pituitary(8)|autonomic_ganglia(4)|prostate(3)|kidney(2)|meninges(1)|eye(1)|NS(1)|soft_tissue(1)|bone(1)	3553	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)			AATCAGAACAATGCCTCCACG	0.378		57	Mis		colorectal|gastric|gliobastoma|breast					HNSCC(19;0.045)|TSP Lung(28;0.18)			25	45	---	---	---	---	capture	Missense_Mutation	SNP	178916614	178916614	PIK3CA	3	A	G	G	G	1	0	0	0	0	1	0	0	0	52	4	3	3	11816	237
MFSD7	84179	broad.mit.edu	37	4	680439	680439	+	Missense_Mutation	SNP	T	C	C			TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:680439T>C	uc003gay.2	-	2	233	c.176A>G	c.(175-177)GAG>GGG	p.E59G	MFSD7_uc003gaw.2_5'Flank|MFSD7_uc003gax.2_Missense_Mutation_p.E59G|MFSD7_uc003gaz.2_Intron|MFSD7_uc003gba.2_Missense_Mutation_p.E59G|MFSD7_uc003gbb.1_5'UTR	NM_032219	NP_115595	Q6UXD7	MFSD7_HUMAN	major facilitator superfamily domain containing	59					transmembrane transport	integral to membrane					0						GACCAAGTCCTCAGCAATGAC	0.622													39	65	---	---	---	---	capture	Missense_Mutation	SNP	680439	680439	MFSD7	4	T	C	C	C	1	0	0	0	0	1	0	0	0	702	54	3	3	9449	237
DRD5	1816	broad.mit.edu	37	4	9784960	9784960	+	Missense_Mutation	SNP	G	A	A			TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:9784960G>A	uc003gmb.3	+	1	1703	c.1307G>A	c.(1306-1308)CGC>CAC	p.R436H		NM_000798	NP_000789	P21918	DRD5_HUMAN	dopamine receptor D5	436	Cytoplasmic (Potential).				activation of adenylate cyclase activity by dopamine receptor signaling pathway|activation of phospholipase C activity by dopamine receptor signaling pathway|cellular calcium ion homeostasis|negative regulation of NAD(P)H oxidase activity|reactive oxygen species metabolic process|synaptic transmission, dopaminergic	integral to plasma membrane				skin(1)	1					Apomorphine(DB00714)|Carphenazine(DB01038)|Fenoldopam(DB00800)|Zuclopenthixol(DB01624)	CCTTTCGATCGCATGTTCCAG	0.552													63	72	---	---	---	---	capture	Missense_Mutation	SNP	9784960	9784960	DRD5	4	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	4715	237
UGT2A1	10941	broad.mit.edu	37	4	70513056	70513056	+	Missense_Mutation	SNP	T	C	C			TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:70513056T>C	uc003hem.3	-	1	370	c.307A>G	c.(307-309)ACC>GCC	p.T103A	UGT2A1_uc011caq.1_Missense_Mutation_p.T103A|UGT2A1_uc010ihu.2_Missense_Mutation_p.T103A|UGT2A1_uc010iht.2_Missense_Mutation_p.T103A	NM_006798	NP_006789	Q9Y4X1	UD2A1_HUMAN	UDP glucuronosyltransferase 2 family,	103	Extracellular (Potential).				detection of chemical stimulus|sensory perception of smell	integral to membrane	glucuronosyltransferase activity|glucuronosyltransferase activity			ovary(1)	1						CTCCAAATGGTTGAAGGAGAT	0.408													46	64	---	---	---	---	capture	Missense_Mutation	SNP	70513056	70513056	UGT2A1	4	T	C	C	C	1	0	0	0	0	1	0	0	0	780	60	3	3	16835	237
EGF	1950	broad.mit.edu	37	4	110883096	110883096	+	Missense_Mutation	SNP	T	A	A			TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:110883096T>A	uc003hzy.3	+	8	1719	c.1267T>A	c.(1267-1269)TGT>AGT	p.C423S	EGF_uc011cfu.1_Missense_Mutation_p.C381S|EGF_uc011cfv.1_Missense_Mutation_p.C423S	NM_001963	NP_001954	P01133	EGF_HUMAN	epidermal growth factor precursor	423	EGF-like 3.|Extracellular (Potential).				angiogenesis|DNA replication|epidermal growth factor receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway|negative regulation of secretion|platelet activation|platelet degranulation|positive regulation of catenin import into nucleus|positive regulation of epidermal growth factor receptor activity|positive regulation of MAP kinase activity|positive regulation of mitosis|regulation of calcium ion import|regulation of protein localization at cell surface	integral to membrane|plasma membrane|platelet alpha granule lumen	calcium ion binding|epidermal growth factor receptor binding|growth factor activity|transmembrane receptor protein tyrosine kinase activator activity			ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	4		Hepatocellular(203;0.0893)		OV - Ovarian serous cystadenocarcinoma(123;9.87e-06)	Sulindac(DB00605)	CTTATGTTTCTGTCCTGAAGG	0.393													6	295	---	---	---	---	capture	Missense_Mutation	SNP	110883096	110883096	EGF	4	T	A	A	A	1	0	0	0	0	1	0	0	0	715	55	4	4	4917	237
ADAMTS12	81792	broad.mit.edu	37	5	33751608	33751608	+	Missense_Mutation	SNP	C	T	T			TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:33751608C>T	uc003jia.1	-	3	698	c.535G>A	c.(535-537)GTG>ATG	p.V179M	ADAMTS12_uc010iuq.1_Missense_Mutation_p.V179M|ADAMTS12_uc003jib.1_Missense_Mutation_p.V179M	NM_030955	NP_112217	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1	179					proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)	9						TGCTTCTTCACGGGTTCAATG	0.423										HNSCC(64;0.19)			142	123	---	---	---	---	capture	Missense_Mutation	SNP	33751608	33751608	ADAMTS12	5	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	257	237
ACSL6	23305	broad.mit.edu	37	5	131296260	131296260	+	Nonsense_Mutation	SNP	G	A	A			TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:131296260G>A	uc010jdo.1	-	19	1920	c.1837C>T	c.(1837-1839)CAG>TAG	p.Q613*	ACSL6_uc003kvv.1_RNA|ACSL6_uc003kvx.1_Nonsense_Mutation_p.Q638*|ACSL6_uc003kvy.1_Nonsense_Mutation_p.Q638*|ACSL6_uc003kwb.2_Nonsense_Mutation_p.Q603*|ACSL6_uc003kvz.1_Nonsense_Mutation_p.Q538*|ACSL6_uc003kwa.1_Nonsense_Mutation_p.Q624*|ACSL6_uc003kvw.1_Nonsense_Mutation_p.Q259*|ACSL6_uc010jdn.1_Nonsense_Mutation_p.Q628*	NM_015256	NP_056071	Q9UKU0	ACSL6_HUMAN	acyl-CoA synthetase long-chain family member 6	613	Cytoplasmic (Potential).				fatty acid metabolic process|long-chain fatty-acyl-CoA biosynthetic process|triglyceride biosynthetic process	endoplasmic reticulum membrane|integral to membrane|microsome|mitochondrial outer membrane|peroxisomal membrane|plasma membrane	ATP binding|long-chain fatty acid-CoA ligase activity			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3		all_cancers(142;0.107)|Breast(839;0.198)|Lung NSC(810;0.216)|all_lung(232;0.248)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			CCTCTCTTCTGGGCCCAGGAG	0.458													83	46	---	---	---	---	capture	Nonsense_Mutation	SNP	131296260	131296260	ACSL6	5	G	A	A	A	1	0	0	0	0	0	1	0	0	611	47	5	2	181	237
FABP6	2172	broad.mit.edu	37	5	159656578	159656578	+	Missense_Mutation	SNP	G	A	A			TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:159656578G>A	uc003lya.1	+	1	142	c.14G>A	c.(13-15)GGC>GAC	p.G5D	FABP6_uc003lxx.1_Missense_Mutation_p.G54D|FABP6_uc003lxz.1_Missense_Mutation_p.G54D	NM_001445	NP_001436	P51161	FABP6_HUMAN	gastrotropin isoform 2	5					bile acid and bile salt transport|bile acid metabolic process|negative regulation of cell proliferation	cytosol	transporter activity				0	Renal(175;0.00196)	Medulloblastoma(196;0.0354)|all_neural(177;0.116)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			GCTTTCACCGGCAAGTTCGAG	0.537													8	449	---	---	---	---	capture	Missense_Mutation	SNP	159656578	159656578	FABP6	5	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	5315	237
PGBD1	84547	broad.mit.edu	37	6	28269185	28269186	+	Missense_Mutation	DNP	GT	TA	TA			TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:28269185_28269186GT>TA	uc003nky.2	+	7	1924_1925	c.1554_1555GT>TA	c.(1552-1557)AAGTTT>AATATT	p.518_519KF>NI	PGBD1_uc003nkz.2_Missense_Mutation_p.518_519KF>NI	NM_032507	NP_115896	Q96JS3	PGBD1_HUMAN	piggyBac transposable element derived 1	518_519					viral reproduction	membrane|nucleus	scavenger receptor activity|sequence-specific DNA binding transcription factor activity			ovary(4)	4						AAAAAGATAAGTTTACAAAGTT	0.356													5	215	---	---	---	---	capture	Missense_Mutation	DNP	28269185	28269186	PGBD1	6	GT	TA	TA	TA	1	0	0	0	0	1	0	0	0	464	36	4	4	11683	237
TRIM10	10107	broad.mit.edu	37	6	30126240	30126240	+	Missense_Mutation	SNP	C	T	T			TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:30126240C>T	uc003npo.3	-	3	768	c.692G>A	c.(691-693)CGG>CAG	p.R231Q	TRIM10_uc003npn.2_Missense_Mutation_p.R231Q	NM_006778	NP_006769	Q9UDY6	TRI10_HUMAN	tripartite motif-containing 10 isoform 1	231						cytoplasm	zinc ion binding				0						AGCACTAAACCGGCAGATCTC	0.542													440	112	---	---	---	---	capture	Missense_Mutation	SNP	30126240	30126240	TRIM10	6	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	16369	237
C6orf27	80737	broad.mit.edu	37	6	31742303	31742303	+	Silent	SNP	C	A	A			TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:31742303C>A	uc011dog.1	-	5	949	c.711G>T	c.(709-711)CCG>CCT	p.P237P	C6orf27_uc003nxd.2_5'UTR|C6orf27_uc011doh.1_RNA	NM_025258	NP_079534	Q9Y334	G7C_HUMAN	G7c protein precursor	237						extracellular region				ovary(3)	3						CTGGAGGTTTCGGGGGATGAG	0.542													4	60	---	---	---	---	capture	Silent	SNP	31742303	31742303	C6orf27	6	C	A	A	A	1	0	0	0	0	0	0	0	1	392	31	4	4	2339	237
TAP2	6891	broad.mit.edu	37	6	32797852	32797852	+	Silent	SNP	C	T	T			TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:32797852C>T	uc003occ.2	-	9	1681	c.1650G>A	c.(1648-1650)GGG>GGA	p.G550G	TAP2_uc011dqf.1_Silent_p.G550G|TAP2_uc003ocb.1_Silent_p.G550G|TAP2_uc003ocd.2_Silent_p.G550G	NM_018833	NP_061313	Q03519	TAP2_HUMAN	transporter 2, ATP-binding cassette, sub-family	550	ABC transporter.|Cytoplasmic (Potential).				antigen processing and presentation of endogenous peptide antigen via MHC class I via ER pathway, TAP-dependent|antigen processing and presentation of endogenous peptide antigen via MHC class Ib via ER pathway, TAP-dependent|antigen processing and presentation of exogenous protein antigen via MHC class Ib, TAP-dependent|cytosol to ER transport|intracellular transport of viral proteins in host cell|peptide antigen transport|positive regulation of antigen processing and presentation of peptide antigen via MHC class I|positive regulation of T cell mediated cytotoxicity	nucleus|plasma membrane|TAP complex	ATP binding|MHC class I protein binding|oligopeptide-transporting ATPase activity|peptide antigen binding|peptide antigen-transporting ATPase activity|TAP1 binding|TAP2 binding|tapasin binding				0						CAGGCTCCTGCCCAACTGAAA	0.587													45	113	---	---	---	---	capture	Silent	SNP	32797852	32797852	TAP2	6	C	T	T	T	1	0	0	0	0	0	0	0	1	327	26	2	2	15439	237
CRISP3	10321	broad.mit.edu	37	6	49700907	49700907	+	Splice_Site	SNP	C	T	T			TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:49700907C>T	uc003ozs.2	-	6	536	c.521_splice	c.e6+1	p.A174_splice		NM_006061	NP_006052	P54108	CRIS3_HUMAN	cysteine-rich secretory protein 3 precursor						innate immune response	proteinaceous extracellular matrix|specific granule				skin(2)	2	Lung NSC(77;0.0161)		KIRC - Kidney renal clear cell carcinoma(2;0.106)|Kidney(12;0.156)			TATATACTTACGCAGGACAAT	0.299													94	28	---	---	---	---	capture	Splice_Site	SNP	49700907	49700907	CRISP3	6	C	T	T	T	1	0	0	0	0	0	0	1	0	247	19	5	1	3846	237
NT5E	4907	broad.mit.edu	37	6	86203692	86203692	+	Silent	SNP	T	C	C			TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:86203692T>C	uc003pko.3	+	9	2251	c.1695T>C	c.(1693-1695)CTT>CTC	p.L565L	NT5E_uc010kbr.2_Silent_p.L515L	NM_002526	NP_002517	P21589	5NTD_HUMAN	5' nucleotidase, ecto precursor	565					DNA metabolic process|purine base metabolic process|pyrimidine base metabolic process|pyrimidine nucleoside catabolic process	anchored to membrane|cytoplasm|membrane fraction|plasma membrane	5'-nucleotidase activity|nucleotide binding			ovary(3)|central_nervous_system(1)	4		all_cancers(76;0.000215)|Acute lymphoblastic leukemia(125;3.66e-08)|all_hematologic(105;8.61e-05)|all_epithelial(107;0.0427)		BRCA - Breast invasive adenocarcinoma(108;0.0417)	Pentoxifylline(DB00806)	TTCTTTCACTTTGGGCAGTGA	0.358													3	86	---	---	---	---	capture	Silent	SNP	86203692	86203692	NT5E	6	T	C	C	C	1	0	0	0	0	0	0	0	1	821	64	3	3	10600	237
MAP3K5	4217	broad.mit.edu	37	6	137041637	137041637	+	Missense_Mutation	SNP	T	C	C			TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:137041637T>C	uc003qhc.2	-	2	900	c.539A>G	c.(538-540)AAC>AGC	p.N180S	MAP3K5_uc011edk.1_Missense_Mutation_p.N25S|MAP3K5_uc010kgw.1_Missense_Mutation_p.N180S	NM_005923	NP_005914	Q99683	M3K5_HUMAN	mitogen-activated protein kinase kinase kinase	180					activation of JUN kinase activity|activation of MAPKK activity|cellular response to hydrogen peroxide|induction of apoptosis by extracellular signals|interspecies interaction between organisms		ATP binding|caspase activator activity|magnesium ion binding|MAP kinase kinase kinase activity|protein homodimerization activity|protein phosphatase binding			ovary(2)|skin(2)|lung(1)	5	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00137)|OV - Ovarian serous cystadenocarcinoma(155;0.00569)		GAGGATGATGTTGTTGGCCAT	0.473													10	114	---	---	---	---	capture	Missense_Mutation	SNP	137041637	137041637	MAP3K5	6	T	C	C	C	1	0	0	0	0	1	0	0	0	780	60	3	3	9167	237
GLI3	2737	broad.mit.edu	37	7	42005081	42005081	+	Missense_Mutation	SNP	A	G	G			TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:42005081A>G	uc011kbh.1	-	15	3681	c.3590T>C	c.(3589-3591)ATG>ACG	p.M1197T	GLI3_uc011kbg.1_Missense_Mutation_p.M1138T	NM_000168	NP_000159	P10071	GLI3_HUMAN	GLI-Kruppel family member GLI3	1197					negative regulation of alpha-beta T cell differentiation|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of smoothened signaling pathway|negative regulation of transcription from RNA polymerase II promoter|negative thymic T cell selection|positive regulation of alpha-beta T cell differentiation|positive regulation of transcription from RNA polymerase II promoter|thymocyte apoptosis	cilium|cytosol|nucleolus	beta-catenin binding|histone acetyltransferase binding|histone deacetylase binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(11)|ovary(3)|large_intestine(2)|central_nervous_system(1)|kidney(1)|pancreas(1)	19						GTGGACGACCATGCCGTTGCA	0.662									Greig_Cephalopolysyndactyly|Pallister-Hall_syndrome				15	168	---	---	---	---	capture	Missense_Mutation	SNP	42005081	42005081	GLI3	7	A	G	G	G	1	0	0	0	0	1	0	0	0	104	8	3	3	6375	237
LMTK2	22853	broad.mit.edu	37	7	97822800	97822800	+	Missense_Mutation	SNP	C	T	T			TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:97822800C>T	uc003upd.1	+	11	3316	c.3023C>T	c.(3022-3024)GCG>GTG	p.A1008V		NM_014916	NP_055731	Q8IWU2	LMTK2_HUMAN	lemur tyrosine kinase 2 precursor	1008					early endosome to late endosome transport|endocytic recycling|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|protein autophosphorylation|receptor recycling|transferrin transport	early endosome|Golgi apparatus|integral to membrane|perinuclear region of cytoplasm|recycling endosome	ATP binding|myosin VI binding|protein phosphatase inhibitor activity|protein serine/threonine kinase activity|protein tyrosine kinase activity			lung(9)|stomach(3)|pancreas(2)|large_intestine(1)|breast(1)	16	all_cancers(62;3.23e-09)|all_epithelial(64;7.65e-10)|Lung NSC(181;0.00902)|all_lung(186;0.0104)|Esophageal squamous(72;0.0125)					GTCCACGAAGCGCTACTGGAC	0.587													88	228	---	---	---	---	capture	Missense_Mutation	SNP	97822800	97822800	LMTK2	7	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	8779	237
LAMB1	3912	broad.mit.edu	37	7	107566693	107566693	+	Missense_Mutation	SNP	C	A	A	rs143093758		TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:107566693C>A	uc003vew.2	-	32	5334	c.4999G>T	c.(4999-5001)GGG>TGG	p.G1667W	LAMB1_uc003vev.2_Missense_Mutation_p.G1691W|LAMB1_uc003veu.2_Missense_Mutation_p.G150W	NM_002291	NP_002282	P07942	LAMB1_HUMAN	laminin, beta 1 precursor	1667	Potential.|Domain I.				axon guidance|odontogenesis|positive regulation of cell migration|positive regulation of epithelial cell proliferation|substrate adhesion-dependent cell spreading	extracellular space|laminin-1 complex|laminin-10 complex|laminin-2 complex|laminin-8 complex|perinuclear region of cytoplasm	extracellular matrix structural constituent			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	8					Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	TCTGCCTCCCCGGAGTTTTGG	0.428													5	247	---	---	---	---	capture	Missense_Mutation	SNP	107566693	107566693	LAMB1	7	C	A	A	A	1	0	0	0	0	1	0	0	0	299	23	4	4	8530	237
LAMB4	22798	broad.mit.edu	37	7	107703420	107703420	+	Silent	SNP	G	A	A	rs144037364	byFrequency	TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:107703420G>A	uc010ljo.1	-	23	3165	c.3081C>T	c.(3079-3081)TCC>TCT	p.S1027S	LAMB4_uc003vey.2_Silent_p.S1027S|LAMB4_uc010ljp.1_5'UTR	NM_007356	NP_031382	A4D0S4	LAMB4_HUMAN	laminin, beta 4 precursor	1027	Laminin EGF-like 11.				cell adhesion	basement membrane				ovary(4)|breast(2)|large_intestine(1)|skin(1)	8						GACTCACGCCGGAAGCATGGC	0.517													3	54	---	---	---	---	capture	Silent	SNP	107703420	107703420	LAMB4	7	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	8533	237
MET	4233	broad.mit.edu	37	7	116340174	116340174	+	Missense_Mutation	SNP	T	C	C			TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:116340174T>C	uc003vij.2	+	2	1223	c.1036T>C	c.(1036-1038)TTC>CTC	p.F346L	MET_uc010lkh.2_Missense_Mutation_p.F346L|MET_uc011knc.1_Missense_Mutation_p.F346L|MET_uc011knd.1_Missense_Mutation_p.F346L|MET_uc011kne.1_Missense_Mutation_p.F346L|MET_uc011knf.1_Missense_Mutation_p.F346L|MET_uc011kng.1_Missense_Mutation_p.F346L|MET_uc011knh.1_Missense_Mutation_p.F346L|MET_uc011kni.1_Missense_Mutation_p.F346L|MET_uc003vii.1_Missense_Mutation_p.F365L|MET_uc010lkg.2_Missense_Mutation_p.F346L|MET_uc011kmz.1_Missense_Mutation_p.F346L|MET_uc011kna.1_Missense_Mutation_p.F346L|MET_uc011knb.1_Missense_Mutation_p.F346L	NM_000245	NP_000236	P08581	MET_HUMAN	met proto-oncogene isoform b precursor	346	Extracellular (Potential).|Sema.				axon guidance|cell proliferation	basal plasma membrane|integral to plasma membrane	ATP binding|hepatocyte growth factor receptor activity|protein binding			upper_aerodigestive_tract(63)|lung(41)|kidney(18)|NS(10)|ovary(5)|thyroid(4)|central_nervous_system(4)|stomach(3)|liver(3)|pleura(2)|large_intestine(2)|breast(2)|testis(1)|skin(1)	159	all_cancers(3;1.25e-07)|all_epithelial(6;4.07e-08)|Lung NSC(10;0.00108)|all_lung(10;0.00125)	Ovarian(593;0.133)	GBM - Glioblastoma multiforme(2;2.31e-07)|all cancers(2;0.000419)|STAD - Stomach adenocarcinoma(10;0.000512)			TTTCGGGGTGTTCGCACAAAG	0.468			Mis		papillary renal|head-neck squamous cell 	papillary renal			Hereditary_Papillary_Renal_Carcinoma_(type_1)				22	58	---	---	---	---	capture	Missense_Mutation	SNP	116340174	116340174	MET	7	T	C	C	C	1	0	0	0	0	1	0	0	0	780	60	3	3	9397	237
MET	4233	broad.mit.edu	37	7	116340270	116340270	+	Missense_Mutation	SNP	G	A	A			TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:116340270G>A	uc003vij.2	+	2	1319	c.1132G>A	c.(1132-1134)GTC>ATC	p.V378I	MET_uc010lkh.2_Missense_Mutation_p.V378I|MET_uc011knc.1_Missense_Mutation_p.V378I|MET_uc011knd.1_Missense_Mutation_p.V378I|MET_uc011kne.1_Missense_Mutation_p.V378I|MET_uc011knf.1_Missense_Mutation_p.V378I|MET_uc011kng.1_Missense_Mutation_p.V378I|MET_uc011knh.1_Missense_Mutation_p.V378I|MET_uc011kni.1_Missense_Mutation_p.V378I|MET_uc003vii.1_Missense_Mutation_p.V397I|MET_uc010lkg.2_Missense_Mutation_p.V378I|MET_uc011kmz.1_Missense_Mutation_p.V378I|MET_uc011kna.1_Missense_Mutation_p.V378I|MET_uc011knb.1_Missense_Mutation_p.V378I	NM_000245	NP_000236	P08581	MET_HUMAN	met proto-oncogene isoform b precursor	378	Extracellular (Potential).|Sema.				axon guidance|cell proliferation	basal plasma membrane|integral to plasma membrane	ATP binding|hepatocyte growth factor receptor activity|protein binding			upper_aerodigestive_tract(63)|lung(41)|kidney(18)|NS(10)|ovary(5)|thyroid(4)|central_nervous_system(4)|stomach(3)|liver(3)|pleura(2)|large_intestine(2)|breast(2)|testis(1)|skin(1)	159	all_cancers(3;1.25e-07)|all_epithelial(6;4.07e-08)|Lung NSC(10;0.00108)|all_lung(10;0.00125)	Ovarian(593;0.133)	GBM - Glioblastoma multiforme(2;2.31e-07)|all cancers(2;0.000419)|STAD - Stomach adenocarcinoma(10;0.000512)			CAACAAGATCGTCAACAAAAA	0.433			Mis		papillary renal|head-neck squamous cell 	papillary renal			Hereditary_Papillary_Renal_Carcinoma_(type_1)				86	193	---	---	---	---	capture	Missense_Mutation	SNP	116340270	116340270	MET	7	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	9397	237
KCNH2	3757	broad.mit.edu	37	7	150645539	150645539	+	Silent	SNP	C	T	T			TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:150645539C>T	uc003wic.2	-	11	2698	c.2685G>A	c.(2683-2685)ACG>ACA	p.T895T	KCNH2_uc003wib.2_Silent_p.T555T|KCNH2_uc011kux.1_Silent_p.T799T	NM_000238	NP_000229	Q12809	KCNH2_HUMAN	voltage-gated potassium channel, subfamily H,	895	Cytoplasmic (Potential).			T->A: Abolishes phosphorylation; when associated with A-283; A-890 and A-1137.	blood circulation|muscle contraction|regulation of heart contraction|regulation of transcription, DNA-dependent	voltage-gated potassium channel complex	delayed rectifier potassium channel activity|two-component sensor activity			skin(3)|ovary(1)	4	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	Amiodarone(DB01118)|Amsacrine(DB00276)|Astemizole(DB00637)|Carvedilol(DB01136)|Cisapride(DB00604)|Dofetilide(DB00204)|Halofantrine(DB01218)|Ibutilide(DB00308)|Pimozide(DB01100)|Propafenone(DB01182)|Quinidine(DB00908)|Sertindole(DB06144)|Sotalol(DB00489)|Terfenadine(DB00342)|Verapamil(DB00661)	cacccTTGTCCGTGCGCCTGC	0.368													5	62	---	---	---	---	capture	Silent	SNP	150645539	150645539	KCNH2	7	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	7954	237
NEFM	4741	broad.mit.edu	37	8	24775127	24775127	+	Missense_Mutation	SNP	A	G	G			TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:24775127A>G	uc003xed.3	+	3	1792	c.1759A>G	c.(1759-1761)AAA>GAA	p.K587E	NEFM_uc011lac.1_Missense_Mutation_p.K587E|NEFM_uc010lue.2_Missense_Mutation_p.K211E	NM_005382	NP_005373	P07197	NFM_HUMAN	neurofilament, medium polypeptide 150kDa isoform	587	Tail.					neurofilament	protein binding|structural constituent of cytoskeleton			breast(1)	1		Prostate(55;0.157)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0197)|Epithelial(17;2.44e-10)|Colorectal(74;0.0108)|COAD - Colon adenocarcinoma(73;0.0375)		agaggaaaagaaagtggagga	0.249													8	6	---	---	---	---	capture	Missense_Mutation	SNP	24775127	24775127	NEFM	8	A	G	G	G	1	0	0	0	0	1	0	0	0	117	9	3	3	10223	237
UBR5	51366	broad.mit.edu	37	8	103297923	103297923	+	Missense_Mutation	SNP	C	G	G			TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:103297923C>G	uc003ykr.1	-	39	5335	c.5302G>C	c.(5302-5304)GCT>CCT	p.A1768P	UBR5_uc003yks.1_Missense_Mutation_p.A1768P	NM_015902	NP_056986	O95071	UBR5_HUMAN	ubiquitin protein ligase E3 component n-recognin	1768	Poly-Ala.				cell proliferation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of catenin import into nucleus|positive regulation of protein import into nucleus, translocation|progesterone receptor signaling pathway|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|response to DNA damage stimulus	nucleus|soluble fraction	protein binding|RNA binding|ubiquitin-ubiquitin ligase activity|zinc ion binding			lung(16)|ovary(4)|large_intestine(3)|breast(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|kidney(1)	28	all_cancers(14;8e-07)|all_epithelial(15;2.18e-08)|Lung NSC(17;2.55e-05)|all_lung(17;8.85e-05)		OV - Ovarian serous cystadenocarcinoma(57;0.000442)			GCTTCCAAAGCAGCTGCTGCA	0.468													36	55	---	---	---	---	capture	Missense_Mutation	SNP	103297923	103297923	UBR5	8	C	G	G	G	1	0	0	0	0	1	0	0	0	325	25	4	4	16787	237
CSMD3	114788	broad.mit.edu	37	8	113420584	113420584	+	Silent	SNP	T	C	C			TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:113420584T>C	uc003ynu.2	-	34	5727	c.5568A>G	c.(5566-5568)GGA>GGG	p.G1856G	CSMD3_uc003yns.2_Intron|CSMD3_uc003ynt.2_Silent_p.G1816G|CSMD3_uc011lhx.1_Silent_p.G1752G	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	1856	Extracellular (Potential).|CUB 10.					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						CTGTTATTGGTCCAACTGAAG	0.343										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			3	173	---	---	---	---	capture	Silent	SNP	113420584	113420584	CSMD3	8	T	C	C	C	1	0	0	0	0	0	0	0	1	743	58	3	3	3911	237
BICD2	23299	broad.mit.edu	37	9	95480999	95480999	+	Missense_Mutation	SNP	G	T	T			TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:95480999G>T	uc004aso.1	-	5	1985	c.1928C>A	c.(1927-1929)GCA>GAA	p.A643E	BICD2_uc004asp.1_Missense_Mutation_p.A643E	NM_015250	NP_056065	Q8TD16	BICD2_HUMAN	bicaudal D homolog 2 isoform 2	643					microtubule anchoring at microtubule organizing center|minus-end-directed organelle transport along microtubule	cytoplasmic vesicle|cytoskeleton|Golgi apparatus|plasma membrane	Rab GTPase binding			skin(1)	1						GTCCACGGCTGCCTGCAGGTG	0.622													15	415	---	---	---	---	capture	Missense_Mutation	SNP	95480999	95480999	BICD2	9	G	T	T	T	1	0	0	0	0	1	0	0	0	598	46	4	4	1417	237
ARSH	347527	broad.mit.edu	37	X	2933417	2933417	+	Silent	SNP	A	G	G			TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:2933417A>G	uc011mhj.1	+	4	747	c.747A>G	c.(745-747)GCA>GCG	p.A249A		NM_001011719	NP_001011719	Q5FYA8	ARSH_HUMAN	arylsulfatase family, member H	249						integral to membrane	arylsulfatase activity|metal ion binding			lung(1)	1		all_cancers(21;9e-05)|all_epithelial(21;6.22e-06)|all_lung(23;0.000597)|Lung NSC(23;0.00901)|Lung SC(21;0.186)				TGAAGGAGGCACTTGCTTTCA	0.398													4	132	---	---	---	---	capture	Silent	SNP	2933417	2933417	ARSH	23	A	G	G	G	1	0	0	0	0	0	0	0	1	67	6	3	3	986	237
FRMPD4	9758	broad.mit.edu	37	X	12736450	12736450	+	Missense_Mutation	SNP	G	A	A			TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:12736450G>A	uc004cuz.1	+	16	4011	c.3505G>A	c.(3505-3507)GCT>ACT	p.A1169T	FRMPD4_uc011mij.1_Missense_Mutation_p.A1161T	NM_014728	NP_055543	Q14CM0	FRPD4_HUMAN	FERM and PDZ domain containing 4	1169					positive regulation of synapse structural plasticity	cytoskeleton|dendritic spine	phosphatidylinositol-4,5-bisphosphate binding|protein binding			central_nervous_system(5)|ovary(3)|skin(2)|large_intestine(1)|lung(1)|pancreas(1)	13						CCCAGAGGACGCTGACTCGTC	0.542													228	254	---	---	---	---	capture	Missense_Mutation	SNP	12736450	12736450	FRMPD4	23	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	6002	237
CXorf59	286464	broad.mit.edu	37	X	36091481	36091481	+	Missense_Mutation	SNP	G	T	T			TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:36091481G>T	uc004ddk.1	+	4	602	c.416G>T	c.(415-417)AGG>ATG	p.R139M		NM_173695	NP_775966	Q8N9S7	CX059_HUMAN	hypothetical protein LOC286464	139						integral to membrane				central_nervous_system(1)	1						ACTATAAGAAGGTGAGAGTCC	0.343													114	111	---	---	---	---	capture	Missense_Mutation	SNP	36091481	36091481	CXorf59	23	G	T	T	T	1	0	0	0	0	1	0	0	0	455	35	4	4	4075	237
BCOR	54880	broad.mit.edu	37	X	39911637	39911637	+	Missense_Mutation	SNP	G	T	T			TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:39911637G>T	uc004den.3	-	15	5285	c.4993C>A	c.(4993-4995)CTG>ATG	p.L1665M	BCOR_uc004dep.3_Missense_Mutation_p.L1631M|BCOR_uc004deo.3_Missense_Mutation_p.L1613M|BCOR_uc010nhb.2_3'UTR|BCOR_uc004dem.3_Missense_Mutation_p.L1631M	NM_001123385	NP_001116857	Q6W2J9	BCOR_HUMAN	BCL-6 interacting corepressor isoform c	1665					heart development|histone H2A monoubiquitination|negative regulation of bone mineralization|negative regulation of histone H3-K36 methylation|negative regulation of histone H3-K4 methylation|negative regulation of tooth mineralization|negative regulation of transcription from RNA polymerase II promoter|odontogenesis|palate development|specification of axis polarity|transcription, DNA-dependent	nucleus	heat shock protein binding|histone deacetylase binding|transcription corepressor activity|transcription factor binding|transcription regulatory region DNA binding			ovary(2)|kidney(1)|central_nervous_system(1)	4						TCCGAAAGCAGTAGCCAGTTT	0.393													5	121	---	---	---	---	capture	Missense_Mutation	SNP	39911637	39911637	BCOR	23	G	T	T	T	1	0	0	0	0	1	0	0	0	464	36	4	4	1375	237
HUWE1	10075	broad.mit.edu	37	X	53571567	53571567	+	Silent	SNP	G	A	A			TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:53571567G>A	uc004dsp.2	-	72	11607	c.11205C>T	c.(11203-11205)GAC>GAT	p.D3735D	HUWE1_uc004dsn.2_Silent_p.D2543D|HUWE1_uc004dsq.1_Silent_p.D50D	NM_031407	NP_113584	Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1	3735					base-excision repair|cell differentiation|histone ubiquitination|protein monoubiquitination|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	DNA binding|protein binding|ubiquitin-protein ligase activity			ovary(8)|large_intestine(4)|breast(4)|kidney(1)	17						GGCGCGTGTCGTCCCGGAGCT	0.552													57	42	---	---	---	---	capture	Silent	SNP	53571567	53571567	HUWE1	23	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	7386	237
OPHN1	4983	broad.mit.edu	37	X	67331781	67331781	+	Missense_Mutation	SNP	G	A	A			TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:67331781G>A	uc004dww.3	-	18	1735	c.1441C>T	c.(1441-1443)CGC>TGC	p.R481C	OPHN1_uc011mpg.1_Missense_Mutation_p.R481C	NM_002547	NP_002538	O60890	OPHN1_HUMAN	oligophrenin 1	481	Rho-GAP.				axon guidance|endocytosis|filopodium assembly|small GTPase mediated signal transduction|substrate-dependent cell migration, cell extension	axon|cell junction|cytosol|dendritic spine|synapse	cytoskeletal adaptor activity|Rho GTPase activator activity|SH3 domain binding			ovary(2)	2						GCTCCTAGGCGGTAATCCAGG	0.403													105	93	---	---	---	---	capture	Missense_Mutation	SNP	67331781	67331781	OPHN1	23	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	10779	237
CAPN6	827	broad.mit.edu	37	X	110494471	110494471	+	Missense_Mutation	SNP	G	C	C			TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:110494471G>C	uc004epc.1	-	7	1105	c.937C>G	c.(937-939)CTG>GTG	p.L313V	CAPN6_uc011msu.1_Missense_Mutation_p.L58V	NM_014289	NP_055104	Q9Y6Q1	CAN6_HUMAN	calpain 6	313	Calpain catalytic.				microtubule bundle formation|proteolysis|regulation of cytoskeleton organization	perinuclear region of cytoplasm|spindle microtubule	calcium-dependent cysteine-type endopeptidase activity|microtubule binding			ovary(2)|upper_aerodigestive_tract(1)|large_intestine(1)|lung(1)|skin(1)	6						ACAAGCCCCAGGTTCTTGCGA	0.393													38	31	---	---	---	---	capture	Missense_Mutation	SNP	110494471	110494471	CAPN6	23	G	C	C	C	1	0	0	0	0	1	0	0	0	451	35	4	4	2606	237
GRIA3	2892	broad.mit.edu	37	X	122538688	122538688	+	Missense_Mutation	SNP	G	A	A			TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:122538688G>A	uc004etq.3	+	11	1716	c.1423G>A	c.(1423-1425)GTT>ATT	p.V475I	GRIA3_uc004etr.3_Missense_Mutation_p.V475I|GRIA3_uc004ets.3_RNA|GRIA3_uc011muf.1_Missense_Mutation_p.V459I	NM_007325	NP_015564	P42263	GRIA3_HUMAN	glutamate receptor, ionotrophic, AMPA 3 isoform	475	Extracellular (Potential).				glutamate signaling pathway|synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|cell junction|endocytic vesicle membrane|postsynaptic membrane	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|extracellular-glutamate-gated ion channel activity			ovary(3)|central_nervous_system(1)|pancreas(1)	5					L-Glutamic Acid(DB00142)	ATTGTCCATCGTTGGTGACGG	0.418													245	201	---	---	---	---	capture	Missense_Mutation	SNP	122538688	122538688	GRIA3	23	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	6702	237
GPR112	139378	broad.mit.edu	37	X	135496349	135496349	+	Missense_Mutation	SNP	G	C	C			TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:135496349G>C	uc004ezu.1	+	25	9359	c.9068G>C	c.(9067-9069)GGA>GCA	p.G3023A	GPR112_uc010nsb.1_Missense_Mutation_p.G2818A	NM_153834	NP_722576	Q8IZF6	GP112_HUMAN	G-protein coupled receptor 112	3023	Cytoplasmic (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(5)|large_intestine(2)|skin(2)|lung(1)|breast(1)|pancreas(1)	12	Acute lymphoblastic leukemia(192;0.000127)					ATAAAGGTTGGATATAAACAG	0.318													5	431	---	---	---	---	capture	Missense_Mutation	SNP	135496349	135496349	GPR112	23	G	C	C	C	1	0	0	0	0	1	0	0	0	533	41	4	4	6563	237
PLXNA3	55558	broad.mit.edu	37	X	153694760	153694760	+	Silent	SNP	G	A	A			TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:153694760G>A	uc004flm.2	+	16	3014	c.2841G>A	c.(2839-2841)GCG>GCA	p.A947A		NM_017514	NP_059984	P51805	PLXA3_HUMAN	plexin A3 precursor	947	IPT/TIG 2.|Extracellular (Potential).				axon guidance	integral to membrane|intracellular|plasma membrane	transmembrane receptor activity			upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	3	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					GTGGCCCGGCGTCCGGGGGCA	0.662													164	128	---	---	---	---	capture	Silent	SNP	153694760	153694760	PLXNA3	23	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	12024	237
HSD11B1	3290	broad.mit.edu	37	1	209880164	209880164	+	Frame_Shift_Del	DEL	G	-	-			TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:209880164delG	uc001hhj.2	+	4	437	c.330delG	c.(328-330)ATGfs	p.M110fs	HSD11B1_uc001hhk.2_Frame_Shift_Del_p.M110fs	NM_181755	NP_861420	P28845	DHI1_HUMAN	11-beta-hydroxysteroid dehydrogenase 1	110	Lumenal (Potential).				glucocorticoid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	11-beta-hydroxysteroid dehydrogenase (NADP+) activity|11-beta-hydroxysteroid dehydrogenase|binding			breast(1)	1				OV - Ovarian serous cystadenocarcinoma(81;1.04e-55)|Epithelial(68;1.57e-52)|all cancers(67;1.83e-46)|Colorectal(1306;0.115)	NADH(DB00157)	GAAAGCTCATGGGTGAGGCTG	0.517													11	257	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	209880164	209880164	HSD11B1	1	G	-	-	-	1	0	1	0	1	0	0	0	0	611	47	5	5	7300	237
PABPN1	8106	broad.mit.edu	37	14	23777257	23777258	+	Frame_Shift_Ins	INS	-	C	C			TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:23777257_23777258insC	uc001wjh.3	+	3	469_470	c.281_282insC	c.(280-282)GGCfs	p.G94fs	BCL2L2_uc001wjg.3_Frame_Shift_Ins_p.G94fs|BCL2L2_uc001wji.3_Frame_Shift_Ins_p.G94fs	NM_004643	NP_004634	Q86U42	PABP2_HUMAN	poly(A) binding protein, nuclear 1	Error:Variant_position_missing_in_Q86U42_after_alignment					modification by virus of host mRNA processing|mRNA 3'-end processing|muscle contraction|nuclear mRNA splicing, via spliceosome|poly(A)+ mRNA export from nucleus|termination of RNA polymerase II transcription|viral infectious cycle	cytoplasm|nucleoplasm|ribonucleoprotein complex	nucleotide binding|protein binding|RNA binding			ovary(2)	2	all_cancers(95;6.69e-06)			GBM - Glioblastoma multiforme(265;0.00643)		CCCAACTGGGGCCGCCTTGTAG	0.574													7	297	---	---	---	---	capture_indel	Frame_Shift_Ins	INS	23777257	23777258	PABPN1	14	-	C	C	C	1	0	1	1	0	0	0	0	0	546	42	5	5	11272	237
SMCHD1	23347	broad.mit.edu	37	18	2770043	2770044	+	Frame_Shift_Del	DEL	CA	-	-			TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:2770043_2770044delCA	uc002klm.3	+	39	5092_5093	c.4903_4904delCA	c.(4903-4905)CAGfs	p.Q1635fs	SMCHD1_uc002klk.3_RNA|SMCHD1_uc002kll.3_RNA	NM_015295	NP_056110	A6NHR9	SMHD1_HUMAN	structural maintenance of chromosomes flexible	1635					chromosome organization		ATP binding				0						CCAATTATCTCAGTCTATTGTT	0.277													25	44	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	2770043	2770044	SMCHD1	18	CA	-	-	-	1	0	1	0	1	0	0	0	0	377	29	5	5	14680	237
RTTN	25914	broad.mit.edu	37	18	67684705	67684705	+	Frame_Shift_Del	DEL	G	-	-			TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:67684705delG	uc002lkp.2	-	46	6427	c.6359delC	c.(6358-6360)CCTfs	p.P2120fs	RTTN_uc002lko.2_RNA|RTTN_uc010xfb.1_Frame_Shift_Del_p.P1208fs|RTTN_uc002lkn.2_Frame_Shift_Del_p.P110fs|RTTN_uc010dqp.2_Frame_Shift_Del_p.P372fs	NM_173630	NP_775901	Q86VV8	RTTN_HUMAN	rotatin	2120							binding			ovary(3)|pancreas(2)|skin(1)|breast(1)|central_nervous_system(1)	8		Esophageal squamous(42;0.129)				GATAAGAAGAGGCAATAAAGG	0.388													15	218	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	67684705	67684705	RTTN	18	G	-	-	-	1	0	1	0	1	0	0	0	0	455	35	5	5	13629	237
PVRL2	5819	broad.mit.edu	37	19	45389216	45389216	+	Frame_Shift_Del	DEL	A	-	-			TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:45389216delA	uc002ozw.1	+	7	1609	c.1219delA	c.(1219-1221)AAGfs	p.K407fs		NM_001042724	NP_001036189	Q92692	PVRL2_HUMAN	poliovirus receptor related 2 isoform delta	407	Cytoplasmic (Potential).				adherens junction organization|adhesion to symbiont|cell junction assembly|homophilic cell adhesion|positive regulation of immunoglobulin mediated immune response|positive regulation of mast cell activation|positive regulation of natural killer cell mediated cytotoxicity directed against tumor cell target|susceptibility to natural killer cell mediated cytotoxicity|susceptibility to T cell mediated cytotoxicity|viral envelope fusion with host membrane|virion attachment, binding of host cell surface coreceptor	cell surface|integral to membrane|zonula adherens	cell adhesion molecule binding|coreceptor activity|protein homodimerization activity				0	Lung NSC(12;0.00195)|all_lung(12;0.00522)	Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0143)		TCCCTCCTACAAGCCACCAAC	0.483													16	288	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	45389216	45389216	PVRL2	19	A	-	-	-	1	0	1	0	1	0	0	0	0	65	5	5	5	12735	237
GOLGB1	2804	broad.mit.edu	37	3	121413693	121413693	+	Frame_Shift_Del	DEL	G	-	-			TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:121413693delG	uc003eei.3	-	13	5788	c.5662delC	c.(5662-5664)CAGfs	p.Q1888fs	GOLGB1_uc010hrc.2_Frame_Shift_Del_p.Q1893fs|GOLGB1_uc003eej.3_Frame_Shift_Del_p.Q1854fs|GOLGB1_uc011bjm.1_Frame_Shift_Del_p.Q1774fs|GOLGB1_uc010hrd.1_Frame_Shift_Del_p.Q1852fs	NM_004487	NP_004478	Q14789	GOGB1_HUMAN	golgi autoantigen, golgin subfamily b,	1888	Cytoplasmic (Potential).|Potential.				Golgi organization	ER-Golgi intermediate compartment|Golgi membrane|Golgi stack|integral to membrane	protein binding			ovary(6)|breast(2)|skin(2)	10				GBM - Glioblastoma multiforme(114;0.0989)		ACTTCCTCCTGAAGCATTTTT	0.368													28	562	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	121413693	121413693	GOLGB1	3	G	-	-	-	1	0	1	0	1	0	0	0	0	585	45	5	5	6499	237
PDZD2	23037	broad.mit.edu	37	5	32074373	32074381	+	In_Frame_Del	DEL	CCTATGCAG	-	-			TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:32074373_32074381delCCTATGCAG	uc003jhl.2	+	18	3549_3557	c.3161_3169delCCTATGCAG	c.(3160-3171)TCCTATGCAGCC>TCC	p.YAA1055del	PDZD2_uc003jhm.2_In_Frame_Del_p.YAA1055del|PDZD2_uc011cnx.1_In_Frame_Del_p.YAA881del	NM_178140	NP_835260	O15018	PDZD2_HUMAN	PDZ domain containing 2	1055_1057					cell adhesion	cell-cell junction|endoplasmic reticulum|extracellular region|nucleus				central_nervous_system(4)|ovary(2)|skin(2)|large_intestine(1)	9						GATGCTGCGTCCTATGCAGCCAACCTCAC	0.569													13	413	---	---	---	---	capture_indel	In_Frame_Del	DEL	32074373	32074381	PDZD2	5	CCTATGCAG	-	-	-	1	0	1	0	1	0	0	0	0	390	30	5	5	11604	237
CSF1R	1436	broad.mit.edu	37	5	149456956	149456956	+	Frame_Shift_Del	DEL	G	-	-			TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:149456956delG	uc003lrl.2	-	5	967	c.772delC	c.(772-774)CAAfs	p.Q258fs	CSF1R_uc011dcd.1_Frame_Shift_Del_p.Q110fs|CSF1R_uc010jhc.2_RNA|CSF1R_uc003lrm.2_Frame_Shift_Del_p.Q258fs|CSF1R_uc011dce.1_Frame_Shift_Del_p.Q258fs|CSF1R_uc011dcf.1_Frame_Shift_Del_p.Q258fs	NM_005211	NP_005202	P07333	CSF1R_HUMAN	colony stimulating factor 1 receptor precursor	258	Extracellular (Potential).|Ig-like C2-type 3.				cell proliferation|multicellular organismal development|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane|receptor complex	ATP binding|cytokine binding|macrophage colony-stimulating factor receptor activity|protein homodimerization activity			haematopoietic_and_lymphoid_tissue(38)|lung(6)|central_nervous_system(3)|liver(3)|breast(2)|endometrium(1)|ovary(1)	54			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)		Imatinib(DB00619)|Sunitinib(DB01268)	AGGACTTTTTGGTAACGGTTA	0.443													9	603	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	149456956	149456956	CSF1R	5	G	-	-	-	1	0	1	0	1	0	0	0	0	611	47	5	5	3897	237
TAF1	6872	broad.mit.edu	37	X	70598242	70598246	+	Frame_Shift_Del	DEL	ACTAT	-	-			TCGA-32-2495-01	TCGA-32-2495-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:70598242_70598246delACTAT	uc004dzu.3	+	7	1139_1143	c.1088_1092delACTAT	c.(1087-1092)GACTATfs	p.D363fs	BCYRN1_uc011mpt.1_Intron|TAF1_uc004dzt.3_Frame_Shift_Del_p.D384fs	NM_138923	NP_620278	P21675	TAF1_HUMAN	TBP-associated factor 1 isoform 2	363_364	Protein kinase 1.				G1 phase of mitotic cell cycle|interspecies interaction between organisms|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription initiation from RNA polymerase II promoter|protein autophosphorylation|regulation of transcription involved in G2/M-phase of mitotic cell cycle|RNA polymerase II transcriptional preinitiation complex assembly|transcription elongation from RNA polymerase II promoter|viral reproduction	MLL1 complex|transcription factor TFIID complex	ATP binding|histone acetyl-lysine binding|histone acetyltransferase activity|p53 binding|protein binding|protein serine/threonine kinase activity|sequence-specific DNA binding|TBP-class protein binding|transcription coactivator activity			ovary(7)|breast(4)|large_intestine(2)|central_nervous_system(2)|lung(1)|skin(1)	17	Renal(35;0.156)	all_lung(315;0.000321)				AGTGGGTTTGACTATGGCTTCAAAC	0.454													14	491	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	70598242	70598246	TAF1	23	ACTAT	-	-	-	1	0	1	0	1	0	0	0	0	130	10	5	5	15401	237
