Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
CHD5	26038	broad.mit.edu	37	1	6215692	6215692	+	Missense_Mutation	SNP	A	G	G			TCGA-32-2498-01	TCGA-32-2498-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:6215692A>G	uc001amb.1	-	4	573	c.473T>C	c.(472-474)CTG>CCG	p.L158P		NM_015557	NP_056372	Q8TDI0	CHD5_HUMAN	chromodomain helicase DNA binding protein 5	158					chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ATP binding|ATP-dependent helicase activity|DNA binding|zinc ion binding			central_nervous_system(3)|breast(3)|ovary(2)|upper_aerodigestive_tract(1)|lung(1)|skin(1)|pancreas(1)	12	Ovarian(185;0.0634)	all_cancers(23;5.36e-32)|all_epithelial(116;2.32e-17)|all_neural(13;3.68e-06)|all_lung(118;3.94e-06)|all_hematologic(16;2.39e-05)|Lung NSC(185;5.33e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00373)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;3.08e-37)|GBM - Glioblastoma multiforme(13;1.36e-31)|OV - Ovarian serous cystadenocarcinoma(86;7.7e-19)|Colorectal(212;9.97e-08)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(185;6.16e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00109)|BRCA - Breast invasive adenocarcinoma(365;0.0012)|STAD - Stomach adenocarcinoma(132;0.00346)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.193)		GTAGTTGGTCAGCGTGTGGTA	0.632													3	91	---	---	---	---	capture	Missense_Mutation	SNP	6215692	6215692	CHD5	1	A	G	G	G	1	0	0	0	0	1	0	0	0	91	7	3	3	3294	238
ERMAP	114625	broad.mit.edu	37	1	43296184	43296184	+	Missense_Mutation	SNP	G	A	A			TCGA-32-2498-01	TCGA-32-2498-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:43296184G>A	uc001cic.1	+	3	335	c.65G>A	c.(64-66)CGG>CAG	p.R22Q	ERMAP_uc010ojw.1_Missense_Mutation_p.R83Q|ERMAP_uc001cid.1_Intron|ERMAP_uc001cie.1_Missense_Mutation_p.R22Q|ERMAP_uc001cif.1_5'UTR	NM_001017922	NP_001017922	Q96PL5	ERMAP_HUMAN	erythroblast membrane-associated protein	22						integral to membrane|plasma membrane				ovary(1)	1	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				GTCTTCCTCCGGCTGTCTGTG	0.552													23	96	---	---	---	---	capture	Missense_Mutation	SNP	43296184	43296184	ERMAP	1	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	5189	238
CCDC18	343099	broad.mit.edu	37	1	93683307	93683307	+	Missense_Mutation	SNP	A	G	G			TCGA-32-2498-01	TCGA-32-2498-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:93683307A>G	uc001dpq.2	+	14	2365	c.2197A>G	c.(2197-2199)AAG>GAG	p.K733E	CCDC18_uc009wdl.1_Intron	NM_206886	NP_996769	Q5T9S5	CCD18_HUMAN	sarcoma antigen NY-SAR-41	614	Potential.									ovary(2)|breast(2)|pancreas(1)	5		all_lung(203;0.00196)|Lung NSC(277;0.00903)|Melanoma(281;0.099)|all_neural(321;0.185)|Glioma(108;0.203)		all cancers(265;0.00166)|GBM - Glioblastoma multiforme(16;0.00551)|Epithelial(280;0.0967)		AAAGAATGAAAAGATAAGGAG	0.214													2	43	---	---	---	---	capture	Missense_Mutation	SNP	93683307	93683307	CCDC18	1	A	G	G	G	1	0	0	0	0	1	0	0	0	13	1	3	3	2768	238
PSRC1	84722	broad.mit.edu	37	1	109823760	109823760	+	Silent	SNP	G	A	A			TCGA-32-2498-01	TCGA-32-2498-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:109823760G>A	uc001dxg.2	-	5	755	c.633C>T	c.(631-633)GCC>GCT	p.A211A	PSRC1_uc001dxb.2_Silent_p.A41A|PSRC1_uc001dxc.2_Silent_p.A211A|PSRC1_uc001dxd.2_Silent_p.A211A|PSRC1_uc001dxe.2_Silent_p.A211A|PSRC1_uc001dxf.2_Silent_p.A211A|PSRC1_uc001dxh.2_Silent_p.A211A|PSRC1_uc001dxi.2_Silent_p.A211A|PSRC1_uc001dxj.2_Silent_p.A211A	NM_001032290	NP_001027461	Q6PGN9	PSRC1_HUMAN	proline/serine-rich coiled-coil 1 isoform c	211	4 X 4 AA repeats of P-X-X-P.				cell division|microtubule bundle formation|mitotic metaphase plate congression|negative regulation of cell growth|positive regulation of microtubule polymerization|positive regulation of transcription, DNA-dependent|regulation of mitotic spindle organization	cytosol|midbody|spindle pole	microtubule binding				0		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0286)|Lung(183;0.0658)|COAD - Colon adenocarcinoma(174;0.112)|Epithelial(280;0.188)|all cancers(265;0.213)		TCTCCTCACTGGCTGCTGCTC	0.612													3	12	---	---	---	---	capture	Silent	SNP	109823760	109823760	PSRC1	1	G	A	A	A	1	0	0	0	0	0	0	0	1	600	47	2	2	12614	238
FAM63A	55793	broad.mit.edu	37	1	150969818	150969818	+	Missense_Mutation	SNP	G	A	A			TCGA-32-2498-01	TCGA-32-2498-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:150969818G>A	uc001ewf.2	-	11	3039	c.1355C>T	c.(1354-1356)CCA>CTA	p.P452L	FAM63A_uc001ewc.2_Missense_Mutation_p.P310L|FAM63A_uc010pcm.1_Missense_Mutation_p.P357L|FAM63A_uc001ewd.2_Missense_Mutation_p.P310L|FAM63A_uc001ewe.2_Missense_Mutation_p.P286L|FAM63A_uc010pcn.1_Missense_Mutation_p.P500L|FAM63A_uc001ewg.2_Missense_Mutation_p.P452L	NM_018379	NP_001156731	Q8N5J2	FA63A_HUMAN	hypothetical protein LOC55793 isoform 1	452							protein binding			ovary(1)	1	all_lung(15;1.09e-34)|Lung NSC(24;1.1e-30)|Lung SC(34;0.00202)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			CTCCCCGGCTGGGCGTCCAGA	0.572													2	17	---	---	---	---	capture	Missense_Mutation	SNP	150969818	150969818	FAM63A	1	G	A	A	A	1	0	0	0	0	1	0	0	0	611	47	2	2	5544	238
LCE1F	353137	broad.mit.edu	37	1	152748982	152748982	+	Missense_Mutation	SNP	C	A	A	rs1758785		TCGA-32-2498-01	TCGA-32-2498-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152748982C>A	uc010pdv.1	+	1	135	c.135C>A	c.(133-135)AGC>AGA	p.S45R		NM_178354	NP_848131	Q5T754	LCE1F_HUMAN	late cornified envelope 1F	45					keratinization						0	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			CCTGCTGCAGCGTCAGCTCCG	0.413													28	108	---	---	---	---	capture	Missense_Mutation	SNP	152748982	152748982	LCE1F	1	C	A	A	A	1	0	0	0	0	1	0	0	0	350	27	4	4	8584	238
PCNXL2	80003	broad.mit.edu	37	1	233270873	233270873	+	Silent	SNP	C	T	T			TCGA-32-2498-01	TCGA-32-2498-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:233270873C>T	uc001hvl.2	-	21	3958	c.3723G>A	c.(3721-3723)CCG>CCA	p.P1241P	PCNXL2_uc001hvm.1_RNA|PCNXL2_uc009xfu.2_RNA|PCNXL2_uc001hvp.1_RNA|PCNXL2_uc009xfv.1_RNA	NM_014801	NP_055616	A6NKB5	PCX2_HUMAN	pecanex-like 2	1241	Helical; (Potential).					integral to membrane				central_nervous_system(1)|pancreas(1)	2		all_cancers(173;0.0347)|Prostate(94;0.137)				ACTGGTAAACCGGGTTGCAGA	0.398													6	79	---	---	---	---	capture	Silent	SNP	233270873	233270873	PCNXL2	1	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	11495	238
PFKP	5214	broad.mit.edu	37	10	3161018	3161018	+	Missense_Mutation	SNP	G	A	A			TCGA-32-2498-01	TCGA-32-2498-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:3161018G>A	uc001igp.2	+	15	1523	c.1487G>A	c.(1486-1488)CGC>CAC	p.R496H	PFKP_uc001igq.2_Missense_Mutation_p.R488H|PFKP_uc009xhr.2_Missense_Mutation_p.R458H|PFKP_uc009xhs.1_Missense_Mutation_p.R280H|PFKP_uc009xht.2_Missense_Mutation_p.R234H|PFKP_uc009xhu.2_Missense_Mutation_p.R2H	NM_002627	NP_002618	Q01813	K6PP_HUMAN	phosphofructokinase, platelet	496					glycolysis	6-phosphofructokinase complex	6-phosphofructokinase activity|ATP binding|metal ion binding|protein binding			upper_aerodigestive_tract(1)|ovary(1)|lung(1)	3				GBM - Glioblastoma multiforme(1;0.000975)|all cancers(11;0.00351)|Epithelial(11;0.142)		ACACAGATGCGCACGCACAGC	0.582													3	47	---	---	---	---	capture	Missense_Mutation	SNP	3161018	3161018	PFKP	10	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	11669	238
MAPK8	5599	broad.mit.edu	37	10	49612942	49612942	+	Missense_Mutation	SNP	T	A	A			TCGA-32-2498-01	TCGA-32-2498-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:49612942T>A	uc009xnz.2	+	3	394	c.170T>A	c.(169-171)CTA>CAA	p.L57Q	MAPK8_uc001jgl.2_Missense_Mutation_p.L57Q|MAPK8_uc001jgm.2_Missense_Mutation_p.L57Q|MAPK8_uc001jgo.2_Missense_Mutation_p.L57Q|MAPK8_uc009xoa.2_Missense_Mutation_p.L57Q|MAPK8_uc001jgn.2_Missense_Mutation_p.L57Q|MAPK8_uc010qgk.1_Missense_Mutation_p.L57Q|MAPK8_uc001jgp.2_Missense_Mutation_p.L57Q|MAPK8_uc001jgq.2_Missense_Mutation_p.L57Q	NM_139047	NP_620635	P45983	MK08_HUMAN	mitogen-activated protein kinase 8 isoform JNK1	57	Protein kinase.				activation of pro-apoptotic gene products|cellular response to mechanical stimulus|induction of apoptosis by intracellular signals|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of apoptosis|negative regulation of protein binding|nerve growth factor receptor signaling pathway|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|positive regulation of deacetylase activity|regulation of protein localization|regulation of sequence-specific DNA binding transcription factor activity|response to UV|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|histone deacetylase binding|histone deacetylase regulator activity|JUN kinase activity|protein binding			central_nervous_system(3)|lung(2)|stomach(1)|ovary(1)|kidney(1)	8		Ovarian(717;0.0221)|Lung SC(717;0.113)|all_neural(218;0.116)		Epithelial(53;3.46e-65)|Lung(62;0.125)		ATCAAGAAGCTAAGCCGACCA	0.358													5	150	---	---	---	---	capture	Missense_Mutation	SNP	49612942	49612942	MAPK8	10	T	A	A	A	1	0	0	0	0	1	0	0	0	689	53	4	4	9196	238
PCGF5	84333	broad.mit.edu	37	10	93031452	93031452	+	Missense_Mutation	SNP	C	A	A			TCGA-32-2498-01	TCGA-32-2498-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:93031452C>A	uc001khh.2	+	9	968	c.721C>A	c.(721-723)CAG>AAG	p.Q241K	PCGF5_uc010qnk.1_Missense_Mutation_p.Q241K|PCGF5_uc001khi.2_Missense_Mutation_p.Q241K	NM_032373	NP_115749	Q86SE9	PCGF5_HUMAN	polycomb group ring finger 5	241					regulation of transcription, DNA-dependent|transcription, DNA-dependent	centrosome|PcG protein complex	zinc ion binding			lung(1)	1						CCCTTTGTATCAGGTAAGAGG	0.463													4	111	---	---	---	---	capture	Missense_Mutation	SNP	93031452	93031452	PCGF5	10	C	A	A	A	1	0	0	0	0	1	0	0	0	377	29	4	4	11480	238
ENTPD1	953	broad.mit.edu	37	10	97607421	97607421	+	Silent	SNP	C	T	T			TCGA-32-2498-01	TCGA-32-2498-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:97607421C>T	uc001klh.3	+	7	1356	c.1032C>T	c.(1030-1032)GCC>GCT	p.A344A	ENTPD1_uc001kli.3_Silent_p.A351A|uc001klg.1_Intron|ENTPD1_uc010qoj.1_Silent_p.A356A|ENTPD1_uc010qok.1_Silent_p.A236A|ENTPD1_uc010qol.1_Silent_p.A236A|ENTPD1_uc010qom.1_Silent_p.A303A|ENTPD1_uc010qon.1_Silent_p.A206A|ENTPD1_uc009xva.2_Silent_p.A206A|ENTPD1_uc009xuz.2_RNA	NM_001776	NP_001767	P49961	ENTP1_HUMAN	ectonucleoside triphosphate diphosphohydrolase 1	344	Extracellular (Potential).				cell adhesion	integral to plasma membrane	ATP binding			ovary(3)	3		Colorectal(252;0.0821)		Epithelial(162;1.31e-07)|all cancers(201;5.33e-06)		CCCAGTGTGCCTTCAATGGGA	0.383													21	241	---	---	---	---	capture	Silent	SNP	97607421	97607421	ENTPD1	10	C	T	T	T	1	0	0	0	0	0	0	0	1	301	24	2	2	5093	238
OR52E6	390078	broad.mit.edu	37	11	5862576	5862576	+	Missense_Mutation	SNP	C	T	T			TCGA-32-2498-01	TCGA-32-2498-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:5862576C>T	uc010qzq.1	-	1	552	c.552G>A	c.(550-552)ATG>ATA	p.M184I	TRIM5_uc001mbq.1_Intron	NM_001005167	NP_001005167	Q96RD3	O52E6_HUMAN	olfactory receptor, family 52, subfamily E,	184	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;2.55e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GGGCAATGCCCATGTGCTCAC	0.458													4	76	---	---	---	---	capture	Missense_Mutation	SNP	5862576	5862576	OR52E6	11	C	T	T	T	1	0	0	0	0	1	0	0	0	273	21	2	2	11021	238
RIC3	79608	broad.mit.edu	37	11	8190435	8190435	+	Missense_Mutation	SNP	C	A	A			TCGA-32-2498-01	TCGA-32-2498-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:8190435C>A	uc001mgd.2	-	1	156	c.102G>T	c.(100-102)CAG>CAT	p.Q34H	RIC3_uc001mgc.2_Missense_Mutation_p.Q34H|RIC3_uc001mge.2_Missense_Mutation_p.Q34H|RIC3_uc010rbl.1_Translation_Start_Site|RIC3_uc010rbm.1_Missense_Mutation_p.Q34H|RIC3_uc009yfm.2_Missense_Mutation_p.Q34H|RIC3_uc009yfn.2_Translation_Start_Site|RIC3_uc001mgf.3_Missense_Mutation_p.Q34H	NM_024557	NP_078833	Q7Z5B4	RIC3_HUMAN	resistance to inhibitors of cholinesterase 3	34	Lumenal (Potential).					endoplasmic reticulum membrane|Golgi membrane|integral to membrane				large_intestine(1)|ovary(1)|pancreas(1)	3				Epithelial(150;2.89e-07)|BRCA - Breast invasive adenocarcinoma(625;0.204)		GCGGCGGCTCCTGCCGCTTCC	0.652													2	6	---	---	---	---	capture	Missense_Mutation	SNP	8190435	8190435	RIC3	11	C	A	A	A	1	0	0	0	0	1	0	0	0	311	24	4	4	13246	238
SWAP70	23075	broad.mit.edu	37	11	9754172	9754172	+	Missense_Mutation	SNP	C	A	A			TCGA-32-2498-01	TCGA-32-2498-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:9754172C>A	uc001mhw.2	+	7	1094	c.995C>A	c.(994-996)GCT>GAT	p.A332D	SWAP70_uc001mhv.2_Missense_Mutation_p.A332D|SWAP70_uc001mhx.2_Missense_Mutation_p.A274D	NM_015055	NP_055870	Q9UH65	SWP70_HUMAN	SWAP-70 protein	332	Potential.					cytoplasm|lamellipodium|nucleus|plasma membrane	calcium ion binding|DNA binding			ovary(2)|central_nervous_system(1)	3				all cancers(16;1.21e-10)|Epithelial(150;2.81e-09)|BRCA - Breast invasive adenocarcinoma(625;0.00649)		AAGCAGCTGGCTGAACAAGAG	0.567													2	7	---	---	---	---	capture	Missense_Mutation	SNP	9754172	9754172	SWAP70	11	C	A	A	A	1	0	0	0	0	1	0	0	0	364	28	4	4	15313	238
MRGPRX4	117196	broad.mit.edu	37	11	18195044	18195044	+	Missense_Mutation	SNP	A	G	G			TCGA-32-2498-01	TCGA-32-2498-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:18195044A>G	uc001mnv.1	+	1	661	c.241A>G	c.(241-243)ATA>GTA	p.I81V		NM_054032	NP_473373	Q96LA9	MRGX4_HUMAN	MAS-related GPR, member X4	81	Helical; Name=2; (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			skin(1)	1						CTTCCAGATTATACGTTTGCC	0.517													2	44	---	---	---	---	capture	Missense_Mutation	SNP	18195044	18195044	MRGPRX4	11	A	G	G	G	1	0	0	0	0	1	0	0	0	208	16	3	3	9679	238
F2	2147	broad.mit.edu	37	11	46760649	46760649	+	Missense_Mutation	SNP	G	A	A			TCGA-32-2498-01	TCGA-32-2498-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:46760649G>A	uc001ndf.3	+	13	1749	c.1706G>A	c.(1705-1707)GGG>GAG	p.G569E	F2_uc001ndg.3_RNA	NM_000506	NP_000497	P00734	THRB_HUMAN	coagulation factor II preproprotein	569	High affinity receptor-binding region which is also known as the TP508 peptide.|Peptidase S1.				activation of caspase activity|acute-phase response|blood coagulation, intrinsic pathway|cell surface receptor linked signaling pathway|cytosolic calcium ion homeostasis|fibrinolysis|leukocyte migration|negative regulation of astrocyte differentiation|negative regulation of fibrinolysis|negative regulation of platelet activation|negative regulation of proteolysis|peptidyl-glutamic acid carboxylation|platelet activation|positive regulation of collagen biosynthetic process|positive regulation of protein phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of release of sequestered calcium ion into cytosol|post-translational protein modification|proteolysis|STAT protein import into nucleus|tyrosine phosphorylation of STAT protein	cytosol|endoplasmic reticulum lumen|extracellular space|Golgi lumen|plasma membrane|soluble fraction	calcium ion binding|growth factor activity|serine-type endopeptidase activity|thrombospondin receptor activity			ovary(3)	3		all_lung(304;0.000414)|Lung NSC(402;0.0011)		BRCA - Breast invasive adenocarcinoma(625;0.146)	Antihemophilic Factor(DB00025)|Argatroban(DB00278)|Bivalirudin(DB00006)|Coagulation Factor IX(DB00100)|Drotrecogin alfa(DB00055)|Enoxaparin(DB01225)|Heparin(DB01109)|Lepirudin(DB00001)|Menadione(DB00170)|Proflavine(DB01123)|Simvastatin(DB00641)|Suramin(DB04786)|Warfarin(DB00682)|Ximelagatran(DB04898)	GGTGACAGTGGGGGACCCTTT	0.522													3	107	---	---	---	---	capture	Missense_Mutation	SNP	46760649	46760649	F2	11	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	5296	238
NR1H3	10062	broad.mit.edu	37	11	47282203	47282203	+	Missense_Mutation	SNP	G	A	A			TCGA-32-2498-01	TCGA-32-2498-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:47282203G>A	uc009ylm.2	+	4	697	c.476G>A	c.(475-477)CGT>CAT	p.R159H	NR1H3_uc009yll.1_Missense_Mutation_p.R165H|NR1H3_uc010rhk.1_Missense_Mutation_p.R165H|NR1H3_uc001nek.2_Missense_Mutation_p.R114H|NR1H3_uc001nej.2_Missense_Mutation_p.R159H|NR1H3_uc001nel.2_Missense_Mutation_p.R114H|NR1H3_uc001nen.3_Missense_Mutation_p.R159H|NR1H3_uc001nem.2_Missense_Mutation_p.R159H|NR1H3_uc001nep.2_Missense_Mutation_p.R68H	NM_005693	NP_005684	Q13133	NR1H3_HUMAN	nuclear receptor subfamily 1, group H, member 3	159	Nuclear receptor.				apoptotic cell clearance|cellular response to lipopolysaccharide|cholesterol homeostasis|negative regulation of cholesterol storage|negative regulation of inflammatory response|negative regulation of interferon-gamma-mediated signaling pathway|negative regulation of lipid transport|negative regulation of macrophage activation|negative regulation of pancreatic juice secretion|negative regulation of pinocytosis|negative regulation of secretion of lysosomal enzymes|negative regulation of transcription from RNA polymerase II promoter|positive regulation of cellular protein metabolic process|positive regulation of cholesterol efflux|positive regulation of cholesterol homeostasis|positive regulation of fatty acid biosynthetic process|positive regulation of lipoprotein lipase activity|positive regulation of receptor biosynthetic process|positive regulation of toll-like receptor 4 signaling pathway|positive regulation of transcription from RNA polymerase II promoter|positive regulation of triglyceride biosynthetic process|regulation of circadian rhythm|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to progesterone stimulus|triglyceride homeostasis	nuclear chromatin|nucleoplasm	cholesterol binding|steroid hormone receptor activity|sterol response element binding|transcription coactivator activity|zinc ion binding			ovary(2)|lung(1)	3						CGCAAATGCCGTCAGGCTGGC	0.622													8	7	---	---	---	---	capture	Missense_Mutation	SNP	47282203	47282203	NR1H3	11	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	10525	238
TUT1	64852	broad.mit.edu	37	11	62342988	62342988	+	Silent	SNP	G	A	A			TCGA-32-2498-01	TCGA-32-2498-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:62342988G>A	uc001nto.2	-	9	2355	c.2317C>T	c.(2317-2319)CTG>TTG	p.L773L	EEF1G_uc001ntm.1_5'Flank|EEF1G_uc010rlw.1_5'Flank|EEF1G_uc001ntn.1_5'Flank|TUT1_uc001ntp.1_Silent_p.L269L	NM_022830	NP_073741	Q9H6E5	STPAP_HUMAN	terminal uridylyl transferase 1, U6	735					mRNA cleavage|mRNA polyadenylation|snRNA processing	nuclear speck|nucleolus	ATP binding|enzyme binding|mRNA 3'-UTR binding|polynucleotide adenylyltransferase activity|RNA uridylyltransferase activity|zinc ion binding			central_nervous_system(1)|skin(1)	2						CGCTCTGCCAGGGCTGCGTGG	0.692													3	94	---	---	---	---	capture	Silent	SNP	62342988	62342988	TUT1	11	G	A	A	A	1	0	0	0	0	0	0	0	1	451	35	2	2	16662	238
TECTA	7007	broad.mit.edu	37	11	120998727	120998727	+	Missense_Mutation	SNP	G	A	A			TCGA-32-2498-01	TCGA-32-2498-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:120998727G>A	uc010rzo.1	+	8	2041	c.2041G>A	c.(2041-2043)GGG>AGG	p.G681R		NM_005422	NP_005413	O75443	TECTA_HUMAN	tectorin alpha precursor	681					cell-matrix adhesion|sensory perception of sound	anchored to membrane|plasma membrane|proteinaceous extracellular matrix				breast(6)|ovary(2)|skin(2)	10	all_hematologic(175;0.208)	Breast(109;0.000766)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;8.04e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.166)		CGAGGAGGGCGGGGACGTCTA	0.652													3	42	---	---	---	---	capture	Missense_Mutation	SNP	120998727	120998727	TECTA	11	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	15632	238
NFE2	4778	broad.mit.edu	37	12	54686313	54686313	+	Missense_Mutation	SNP	G	A	A			TCGA-32-2498-01	TCGA-32-2498-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:54686313G>A	uc009znk.2	-	2	1477	c.967C>T	c.(967-969)CGC>TGC	p.R323C	NFE2_uc001sfq.2_Missense_Mutation_p.R323C|NFE2_uc001sfr.3_Missense_Mutation_p.R323C|NFE2_uc009znl.2_Missense_Mutation_p.R323C	NM_006163	NP_006154	Q16621	NFE2_HUMAN	nuclear factor, erythroid derived 2 isoform 1	323	Leucine-zipper.				blood circulation|blood coagulation|multicellular organismal development|nucleosome disassembly|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter	actin cytoskeleton|cytoplasm|PML body	protein dimerization activity|protein N-terminus binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|WW domain binding				0						AGCTGTTGGCGCATGACCTCC	0.612													3	57	---	---	---	---	capture	Missense_Mutation	SNP	54686313	54686313	NFE2	12	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	10273	238
C12orf50	160419	broad.mit.edu	37	12	88391941	88391941	+	Nonsense_Mutation	SNP	C	A	A			TCGA-32-2498-01	TCGA-32-2498-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:88391941C>A	uc001tam.1	-	4	328	c.160G>T	c.(160-162)GAA>TAA	p.E54*	C12orf50_uc001tan.2_Nonsense_Mutation_p.E108*	NM_152589	NP_689802	Q8NA57	CL050_HUMAN	hypothetical protein LOC160419	54										skin(2)|ovary(1)	3						GGAATTCCTTCCTGAATTTCT	0.358													4	86	---	---	---	---	capture	Nonsense_Mutation	SNP	88391941	88391941	C12orf50	12	C	A	A	A	1	0	0	0	0	0	1	0	0	390	30	5	4	1681	238
NTN4	59277	broad.mit.edu	37	12	96131834	96131834	+	Missense_Mutation	SNP	C	T	T			TCGA-32-2498-01	TCGA-32-2498-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:96131834C>T	uc001tei.2	-	3	1123	c.674G>A	c.(673-675)CGC>CAC	p.R225H	NTN4_uc009ztf.2_Missense_Mutation_p.R225H|NTN4_uc009ztg.2_Missense_Mutation_p.R188H	NM_021229	NP_067052	Q9HB63	NET4_HUMAN	netrin 4 precursor	225	Laminin N-terminal.				axon guidance	basement membrane|plasma membrane				upper_aerodigestive_tract(1)|ovary(1)	2						CAGCTGCACGCGAAGGTTGGT	0.443													15	196	---	---	---	---	capture	Missense_Mutation	SNP	96131834	96131834	NTN4	12	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	10609	238
SACS	26278	broad.mit.edu	37	13	23913882	23913882	+	Missense_Mutation	SNP	G	A	A			TCGA-32-2498-01	TCGA-32-2498-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:23913882G>A	uc001uon.2	-	10	4722	c.4133C>T	c.(4132-4134)CCA>CTA	p.P1378L	SACS_uc001uoo.2_Missense_Mutation_p.P1231L|SACS_uc001uop.1_Intron|SACS_uc001uoq.1_Intron	NM_014363	NP_055178	Q9NZJ4	SACS_HUMAN	sacsin	1378					cell death|negative regulation of inclusion body assembly|protein folding	axon|cell body fiber|dendrite|mitochondrion|nucleus	ATP binding|chaperone binding|Hsp70 protein binding|proteasome binding			ovary(7)|skin(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	12		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		TATAGGAACTGGTGTGTTGGG	0.353													3	67	---	---	---	---	capture	Missense_Mutation	SNP	23913882	23913882	SACS	13	G	A	A	A	1	0	0	0	0	1	0	0	0	611	47	2	2	13696	238
NBEA	26960	broad.mit.edu	37	13	35619165	35619165	+	Missense_Mutation	SNP	G	C	C			TCGA-32-2498-01	TCGA-32-2498-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:35619165G>C	uc001uvb.2	+	4	814	c.608G>C	c.(607-609)CGA>CCA	p.R203P		NM_015678	NP_056493	Q8NFP9	NBEA_HUMAN	neurobeachin	203						cytosol|endomembrane system|plasma membrane|trans-Golgi network	protein binding			ovary(9)|large_intestine(2)	11		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)		AGCATGCTTCGAGGAGAAAGT	0.408													2	21	---	---	---	---	capture	Missense_Mutation	SNP	35619165	35619165	NBEA	13	G	C	C	C	1	0	0	0	0	1	0	0	0	481	37	4	4	10094	238
ERO1L	30001	broad.mit.edu	37	14	53162168	53162168	+	Missense_Mutation	SNP	A	G	G			TCGA-32-2498-01	TCGA-32-2498-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:53162168A>G	uc001wzv.2	-	1	258	c.32T>C	c.(31-33)CTC>CCC	p.L11P	ERO1L_uc001wzw.2_RNA|ERO1L_uc010aof.2_RNA	NM_014584	NP_055399	Q96HE7	ERO1A_HUMAN	ERO1-like precursor	11					chaperone mediated protein folding requiring cofactor|electron transport chain|protein thiol-disulfide exchange|response to temperature stimulus|transport	endoplasmic reticulum lumen|endoplasmic reticulum membrane|microsome	disulfide oxidoreductase activity|flavin adenine dinucleotide binding|oxidoreductase activity, acting on a sulfur group of donors, disulfide as acceptor				0	Breast(41;0.226)					GGCGCCCAGGAGGCCAAACAA	0.706													2	5	---	---	---	---	capture	Missense_Mutation	SNP	53162168	53162168	ERO1L	14	A	G	G	G	1	0	0	0	0	1	0	0	0	143	11	3	3	5194	238
C14orf49	161176	broad.mit.edu	37	14	95884310	95884310	+	Silent	SNP	C	A	A			TCGA-32-2498-01	TCGA-32-2498-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:95884310C>A	uc001yei.3	-	17	2796	c.2781G>T	c.(2779-2781)GCG>GCT	p.A927A	C14orf49_uc010avi.2_Silent_p.A922A	NM_152592	NP_689805	Q6ZMZ3	SYNE3_HUMAN	nesprin-3	927	Helical; Anchor for type IV membrane protein; (Potential).|KASH.				cytoskeletal anchoring at nuclear membrane	integral to membrane|nuclear outer membrane|SUN-KASH complex	actin binding			central_nervous_system(1)	1		all_cancers(154;0.0937)		COAD - Colon adenocarcinoma(157;0.245)		gcagtgggagcGCCACACAGC	0.502													3	53	---	---	---	---	capture	Silent	SNP	95884310	95884310	C14orf49	14	C	A	A	A	1	0	0	0	0	0	0	0	1	340	27	4	4	1762	238
MNS1	55329	broad.mit.edu	37	15	56736021	56736021	+	Missense_Mutation	SNP	C	G	G			TCGA-32-2498-01	TCGA-32-2498-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:56736021C>G	uc002adr.2	-	6	883	c.718G>C	c.(718-720)GCA>CCA	p.A240P	MNS1_uc010bfo.2_Missense_Mutation_p.A108P|TEX9_uc002adp.2_Intron|TEX9_uc010ugl.1_Intron	NM_018365	NP_060835	Q8NEH6	MNS1_HUMAN	meiosis-specific nuclear structural 1	240	Potential.|Glu-rich.				meiosis					ovary(1)	1				all cancers(107;0.0196)|GBM - Glioblastoma multiforme(80;0.101)		CTTCGCATTGCATTCATTTTT	0.299													3	118	---	---	---	---	capture	Missense_Mutation	SNP	56736021	56736021	MNS1	15	C	G	G	G	1	0	0	0	0	1	0	0	0	325	25	4	4	9589	238
SNX33	257364	broad.mit.edu	37	15	75941713	75941713	+	Silent	SNP	G	A	A			TCGA-32-2498-01	TCGA-32-2498-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:75941713G>A	uc002bau.2	+	1	366	c.270G>A	c.(268-270)GTG>GTA	p.V90V	IMP3_uc002bat.2_5'Flank|SNX33_uc002bav.2_5'Flank	NM_153271	NP_695003	Q8WV41	SNX33_HUMAN	sorting nexin 33	90					cell communication		phosphatidylinositol binding|protein binding			ovary(1)	1						GCCCCAGTGTGGCCAGCCCAG	0.592													3	39	---	---	---	---	capture	Silent	SNP	75941713	75941713	SNX33	15	G	A	A	A	1	0	0	0	0	0	0	0	1	600	47	2	2	14795	238
RLBP1	6017	broad.mit.edu	37	15	89758334	89758334	+	Missense_Mutation	SNP	A	G	G			TCGA-32-2498-01	TCGA-32-2498-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:89758334A>G	uc002bnl.2	-	6	862	c.482T>C	c.(481-483)TTC>TCC	p.F161S		NM_000326	NP_000317	P12271	RLBP1_HUMAN	retinaldehyde binding protein 1	161	CRAL-TRIO.				response to stimulus|visual perception|vitamin A metabolic process	cytoplasm|soluble fraction	retinol binding|transporter activity			central_nervous_system(1)	1	Lung NSC(78;0.0472)|all_lung(78;0.089)				Vitamin A(DB00162)	CTCAATGTTGAAGAGCATGAC	0.567													3	117	---	---	---	---	capture	Missense_Mutation	SNP	89758334	89758334	RLBP1	15	A	G	G	G	1	0	0	0	0	1	0	0	0	117	9	3	3	13280	238
ZNF423	23090	broad.mit.edu	37	16	49557601	49557601	+	Silent	SNP	C	T	T			TCGA-32-2498-01	TCGA-32-2498-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:49557601C>T	uc002efs.2	-	8	4057	c.3759G>A	c.(3757-3759)GGG>GGA	p.G1253G	ZNF423_uc010vgn.1_Silent_p.G1136G	NM_015069	NP_055884	Q2M1K9	ZN423_HUMAN	zinc finger protein 423	1253					cell differentiation|negative regulation of transcription, DNA-dependent|nervous system development|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(1)|lung(1)|kidney(1)|pancreas(1)	4		all_cancers(37;0.0155)				TGTCCTCCTGCCCGTGCACGG	0.607													3	89	---	---	---	---	capture	Silent	SNP	49557601	49557601	ZNF423	16	C	T	T	T	1	0	0	0	0	0	0	0	1	327	26	2	2	17778	238
DNAH9	1770	broad.mit.edu	37	17	11757514	11757514	+	Missense_Mutation	SNP	C	A	A			TCGA-32-2498-01	TCGA-32-2498-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:11757514C>A	uc002gne.2	+	50	9770	c.9702C>A	c.(9700-9702)CAC>CAA	p.H3234Q	DNAH9_uc010coo.2_Missense_Mutation_p.H2528Q	NM_001372	NP_001363	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9 isoform 2	3234	Stalk (By similarity).				cell projection organization|cellular component movement|microtubule-based movement|spermatogenesis	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			skin(10)|ovary(4)|breast(3)|central_nervous_system(2)|pancreas(1)	20		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		AGAACATTCACGAGAACTGCC	0.542													3	84	---	---	---	---	capture	Missense_Mutation	SNP	11757514	11757514	DNAH9	17	C	A	A	A	1	0	0	0	0	1	0	0	0	246	19	4	4	4564	238
TUBG1	7283	broad.mit.edu	37	17	40766362	40766362	+	Missense_Mutation	SNP	G	C	C			TCGA-32-2498-01	TCGA-32-2498-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:40766362G>C	uc002ian.2	+	9	1326	c.928G>C	c.(928-930)GAC>CAC	p.D310H		NM_001070	NP_001061	P23258	TBG1_HUMAN	tubulin, gamma 1	310					G2/M transition of mitotic cell cycle|meiotic spindle organization|protein polymerization	condensed nuclear chromosome|cytosol|gamma-tubulin complex|polar microtubule	GTP binding|GTPase activity|protein binding|structural constituent of cytoskeleton			ovary(1)	1		Breast(137;0.00116)		BRCA - Breast invasive adenocarcinoma(366;0.129)		CACAGGCCGAGACCGCCAGAC	0.617													2	20	---	---	---	---	capture	Missense_Mutation	SNP	40766362	40766362	TUBG1	17	G	C	C	C	1	0	0	0	0	1	0	0	0	429	33	4	4	16646	238
CNTNAP1	8506	broad.mit.edu	37	17	40845455	40845455	+	Missense_Mutation	SNP	C	G	G			TCGA-32-2498-01	TCGA-32-2498-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:40845455C>G	uc002iay.2	+	18	3109	c.2893C>G	c.(2893-2895)CGG>GGG	p.R965G	CNTNAP1_uc010wgs.1_RNA	NM_003632	NP_003623	P78357	CNTP1_HUMAN	contactin associated protein 1 precursor	965	EGF-like 2.|Extracellular (Potential).				axon guidance|cell adhesion	paranode region of axon	receptor activity|receptor binding|SH3 domain binding|SH3/SH2 adaptor activity			ovary(3)|breast(3)|upper_aerodigestive_tract(1)|lung(1)	8		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.143)		TGCCCACCCTCGGCTCCCCTG	0.612													3	76	---	---	---	---	capture	Missense_Mutation	SNP	40845455	40845455	CNTNAP1	17	C	G	G	G	1	0	0	0	0	1	0	0	0	399	31	4	4	3611	238
ABI3	51225	broad.mit.edu	37	17	47299979	47299979	+	Missense_Mutation	SNP	A	G	G			TCGA-32-2498-01	TCGA-32-2498-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:47299979A>G	uc002iop.1	+	8	1501	c.1003A>G	c.(1003-1005)ATC>GTC	p.I335V	ABI3_uc002ioq.1_Missense_Mutation_p.I329V	NM_016428	NP_057512	Q9P2A4	ABI3_HUMAN	NESH protein isoform 1	335	SH3.				cellular component movement|regulation of cell migration	cytoplasm|lamellipodium	protein binding				0			Epithelial(5;6.37e-06)|all cancers(6;6.36e-05)			GGGCACTGTCATCTGTGTCAC	0.572										HNSCC(55;0.14)			6	33	---	---	---	---	capture	Missense_Mutation	SNP	47299979	47299979	ABI3	17	A	G	G	G	1	0	0	0	0	1	0	0	0	104	8	3	3	90	238
SLC16A3	9123	broad.mit.edu	37	17	80195743	80195743	+	Missense_Mutation	SNP	C	T	T			TCGA-32-2498-01	TCGA-32-2498-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:80195743C>T	uc002kea.2	+	4	1236	c.1097C>T	c.(1096-1098)GCC>GTC	p.A366V	SLC16A3_uc002kee.2_Missense_Mutation_p.A366V|SLC16A3_uc002keb.2_Missense_Mutation_p.A366V|SLC16A3_uc002kec.2_Missense_Mutation_p.A366V|SLC16A3_uc002ked.2_Missense_Mutation_p.A366V	NM_001042422	NP_001035887	O15427	MOT4_HUMAN	solute carrier family 16, member 3	366	Helical; (Potential).				blood coagulation|leukocyte migration|organic anion transport|pyruvate metabolic process	actin cytoskeleton|integral to plasma membrane|membrane fraction|nuclear membrane	secondary active monocarboxylate transmembrane transporter activity|symporter activity			upper_aerodigestive_tract(1)|lung(1)	2	Breast(20;0.00285)|all_neural(118;0.0804)|Lung NSC(278;0.128)|all_lung(278;0.145)|Ovarian(332;0.227)		OV - Ovarian serous cystadenocarcinoma(97;0.00463)|BRCA - Breast invasive adenocarcinoma(99;0.0149)		Pyruvic acid(DB00119)	GAGGCGGTGGCCGTGCTCGTC	0.697													3	36	---	---	---	---	capture	Missense_Mutation	SNP	80195743	80195743	SLC16A3	17	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	14302	238
DSC3	1825	broad.mit.edu	37	18	28576781	28576781	+	Missense_Mutation	SNP	A	T	T			TCGA-32-2498-01	TCGA-32-2498-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:28576781A>T	uc002kwj.3	-	15	2624	c.2469T>A	c.(2467-2469)AGT>AGA	p.S823R	DSC3_uc002kwi.3_Missense_Mutation_p.S823R	NM_001941	NP_001932	Q14574	DSC3_HUMAN	desmocollin 3 isoform Dsc3a preproprotein	823	Cytoplasmic (Potential).				homophilic cell adhesion|protein stabilization	desmosome|integral to membrane|membrane fraction	calcium ion binding|gamma-catenin binding			ovary(2)|skin(2)	4			OV - Ovarian serous cystadenocarcinoma(10;0.125)			GTTGAGTAAAACTGTGCCACT	0.473													31	75	---	---	---	---	capture	Missense_Mutation	SNP	28576781	28576781	DSC3	18	A	T	T	T	1	0	0	0	0	1	0	0	0	24	2	4	4	4722	238
ATP4A	495	broad.mit.edu	37	19	36051513	36051513	+	Missense_Mutation	SNP	G	A	A			TCGA-32-2498-01	TCGA-32-2498-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:36051513G>A	uc002oal.1	-	6	568	c.539C>T	c.(538-540)GCC>GTC	p.A180V	ATP4A_uc010eee.1_5'Flank	NM_000704	NP_000695	P20648	ATP4A_HUMAN	hydrogen/potassium-exchanging ATPase 4A	180	Cytoplasmic (Potential).				ATP biosynthetic process|ATP hydrolysis coupled proton transport	integral to plasma membrane	ATP binding|hydrogen:potassium-exchanging ATPase activity|magnesium ion binding			ovary(1)	1	all_lung(56;1.05e-07)|Lung NSC(56;1.63e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)		Esomeprazole(DB00736)|Lansoprazole(DB00448)|Omeprazole(DB00338)|Pantoprazole(DB00213)|Rabeprazole(DB01129)|Trifluoperazine(DB00831)	GATGACAGTGGCTTGCTGCGG	0.622													3	40	---	---	---	---	capture	Missense_Mutation	SNP	36051513	36051513	ATP4A	19	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	1136	238
SLC8A2	6543	broad.mit.edu	37	19	47969508	47969508	+	Silent	SNP	C	T	T			TCGA-32-2498-01	TCGA-32-2498-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:47969508C>T	uc002pgx.2	-	2	431	c.153G>A	c.(151-153)CCG>CCA	p.P51P	SLC8A2_uc010xyq.1_Intron|SLC8A2_uc010xyr.1_Intron|SLC8A2_uc010ele.2_Silent_p.P51P	NM_015063	NP_055878	Q9UPR5	NAC2_HUMAN	solute carrier family 8 member 2 precursor	51	Extracellular (Potential).				cell communication|platelet activation	integral to membrane|plasma membrane	calcium:sodium antiporter activity|calmodulin binding			skin(3)|ovary(1)	4		all_cancers(25;3.05e-07)|all_lung(116;4.19e-06)|Lung NSC(112;7.16e-06)|all_epithelial(76;7.65e-06)|all_neural(266;0.0652)|Ovarian(192;0.086)|Breast(70;0.173)		OV - Ovarian serous cystadenocarcinoma(262;0.000501)|all cancers(93;0.00058)|Epithelial(262;0.0181)|GBM - Glioblastoma multiforme(486;0.0457)		GCAGCACCCCCGGCTGGCAGC	0.701													2	6	---	---	---	---	capture	Silent	SNP	47969508	47969508	SLC8A2	19	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	14599	238
LRRC4B	94030	broad.mit.edu	37	19	51021882	51021882	+	Missense_Mutation	SNP	G	A	A			TCGA-32-2498-01	TCGA-32-2498-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:51021882G>A	uc002pss.2	-	3	1225	c.1088C>T	c.(1087-1089)GCG>GTG	p.A363V		NM_001080457	NP_001073926	Q9NT99	LRC4B_HUMAN	leucine rich repeat containing 4B precursor	363	LRRCT.|Extracellular (Potential).					cell junction|integral to membrane|presynaptic membrane				central_nervous_system(1)|skin(1)	2		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00284)|GBM - Glioblastoma multiforme(134;0.0188)		GATGACGGGCGCATAGCAGGT	0.667													3	40	---	---	---	---	capture	Missense_Mutation	SNP	51021882	51021882	LRRC4B	19	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	8922	238
SIGLEC14	100049587	broad.mit.edu	37	19	52149127	52149127	+	Missense_Mutation	SNP	C	T	T			TCGA-32-2498-01	TCGA-32-2498-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:52149127C>T	uc002pxf.3	-	3	728	c.608G>A	c.(607-609)AGG>AAG	p.R203K		NM_001098612	NP_001092082	Q08ET2	SIG14_HUMAN	sialic acid binding Ig-like lectin 14 precursor	203	Ig-like C2-type 1.|Extracellular (Potential).				cell adhesion	integral to membrane|plasma membrane	protein binding|sugar binding			ovary(1)	1		all_neural(266;0.0299)		GBM - Glioblastoma multiforme(134;0.000965)|OV - Ovarian serous cystadenocarcinoma(262;0.0195)		GTCCTCGGGCCTGGGGGTGAG	0.632													7	40	---	---	---	---	capture	Missense_Mutation	SNP	52149127	52149127	SIGLEC14	19	C	T	T	T	1	0	0	0	0	1	0	0	0	312	24	2	2	14202	238
TNNI3	7137	broad.mit.edu	37	19	55665416	55665416	+	Silent	SNP	C	T	T			TCGA-32-2498-01	TCGA-32-2498-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:55665416C>T	uc002qjg.3	-	7	531	c.531G>A	c.(529-531)AAG>AAA	p.K177K	TNNI3_uc010yft.1_Silent_p.K169K	NM_000363	NP_000354	P19429	TNNI3_HUMAN	troponin I, cardiac	177			Missing (in CMH7).		cardiac muscle contraction|cellular calcium ion homeostasis|muscle filament sliding|negative regulation of ATPase activity|regulation of systemic arterial blood pressure by ischemic conditions|vasculogenesis|ventricular cardiac muscle tissue morphogenesis	cytosol|troponin complex	actin binding|calcium channel inhibitor activity|calcium-dependent protein binding|protein domain specific binding|protein kinase binding|troponin C binding|troponin T binding			lung(1)|pancreas(1)	2			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0452)		TGTCCTCCTTCTTCACCTGCT	0.627													44	132	---	---	---	---	capture	Silent	SNP	55665416	55665416	TNNI3	19	C	T	T	T	1	0	0	0	0	0	0	0	1	415	32	2	2	16211	238
ZNF470	388566	broad.mit.edu	37	19	57081704	57081704	+	Missense_Mutation	SNP	G	T	T			TCGA-32-2498-01	TCGA-32-2498-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:57081704G>T	uc002qnl.3	+	3	700	c.24G>T	c.(22-24)GAG>GAT	p.E8D	uc002qnk.1_5'Flank|ZNF470_uc010etn.2_RNA	NM_001001668	NP_001001668	Q6ECI4	ZN470_HUMAN	zinc finger protein 470	8					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|pancreas(1)	2		Colorectal(82;5.46e-05)|Ovarian(87;0.0822)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0294)		AAGAGGTAGAGGTGGCAGGAA	0.418													6	91	---	---	---	---	capture	Missense_Mutation	SNP	57081704	57081704	ZNF470	19	G	T	T	T	1	0	0	0	0	1	0	0	0	451	35	4	4	17808	238
EMILIN1	11117	broad.mit.edu	37	2	27306136	27306136	+	Missense_Mutation	SNP	G	C	C			TCGA-32-2498-01	TCGA-32-2498-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:27306136G>C	uc002rii.3	+	4	2125	c.1697G>C	c.(1696-1698)CGG>CCG	p.R566P	EMILIN1_uc002rik.3_5'Flank	NM_007046	NP_008977	Q9Y6C2	EMIL1_HUMAN	elastin microfibril interfacer 1 precursor	566					cell adhesion	collagen				pancreas(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ACTGCGGCCCGGCTAGGCCAA	0.632													5	61	---	---	---	---	capture	Missense_Mutation	SNP	27306136	27306136	EMILIN1	2	G	C	C	C	1	0	0	0	0	1	0	0	0	507	39	4	4	5048	238
EPC2	26122	broad.mit.edu	37	2	149541164	149541164	+	Splice_Site	SNP	A	G	G			TCGA-32-2498-01	TCGA-32-2498-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:149541164A>G	uc010zbt.1	+	12	1885	c.1858_splice	c.e12-2	p.G620_splice		NM_015630	NP_056445	Q52LR7	EPC2_HUMAN	enhancer of polycomb homolog 2						chromatin modification|DNA repair|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus				ovary(1)|breast(1)|pancreas(1)	3				BRCA - Breast invasive adenocarcinoma(221;0.0516)		TTCATTTTATAGGGCTCAAGC	0.438													2	20	---	---	---	---	capture	Splice_Site	SNP	149541164	149541164	EPC2	2	A	G	G	G	1	0	0	0	0	0	0	1	0	195	15	5	3	5116	238
NEB	4703	broad.mit.edu	37	2	152472597	152472597	+	Missense_Mutation	SNP	C	G	G			TCGA-32-2498-01	TCGA-32-2498-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:152472597C>G	uc010fnx.2	-	72	10670	c.10479G>C	c.(10477-10479)GAG>GAC	p.E3493D		NM_004543	NP_004534	P20929	NEBU_HUMAN	nebulin isoform 3	3493	Nebulin 95.				muscle filament sliding|muscle organ development|regulation of actin filament length|somatic muscle development	actin cytoskeleton|cytosol|Z disc	actin binding|structural constituent of muscle			ovary(8)|large_intestine(5)|breast(3)|central_nervous_system(2)|skin(1)|pancreas(1)	20				BRCA - Breast invasive adenocarcinoma(221;0.219)		CCTTCTTGGACTCTTCCAAAG	0.378													2	34	---	---	---	---	capture	Missense_Mutation	SNP	152472597	152472597	NEB	2	C	G	G	G	1	0	0	0	0	1	0	0	0	259	20	4	4	10209	238
ERBB4	2066	broad.mit.edu	37	2	212251866	212251866	+	Missense_Mutation	SNP	C	A	A	rs149665378		TCGA-32-2498-01	TCGA-32-2498-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:212251866C>A	uc002veg.1	-	27	3291	c.3193G>T	c.(3193-3195)GTA>TTA	p.V1065L	ERBB4_uc002veh.1_Missense_Mutation_p.V1049L|ERBB4_uc010zji.1_Missense_Mutation_p.V1055L|ERBB4_uc010zjj.1_Missense_Mutation_p.V1039L	NM_005235	NP_005226	Q15303	ERBB4_HUMAN	v-erb-a erythroblastic leukemia viral oncogene	1065	Cytoplasmic (Potential).				cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent|transmembrane receptor protein tyrosine kinase signaling pathway	basolateral plasma membrane|cytoplasm|integral to membrane|nucleus	ATP binding|protein binding|receptor signaling protein tyrosine kinase activity|transmembrane receptor protein tyrosine kinase activity			lung(21)|skin(5)|stomach(2)|breast(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	33		Renal(323;0.06)|Lung NSC(271;0.197)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;5.86e-06)|all cancers(144;2.95e-05)|Lung(261;0.00244)|LUSC - Lung squamous cell carcinoma(224;0.00266)		TCTCGGTATACAAACTGGTTC	0.433										TSP Lung(8;0.080)			4	238	---	---	---	---	capture	Missense_Mutation	SNP	212251866	212251866	ERBB4	2	C	A	A	A	1	0	0	0	0	1	0	0	0	221	17	4	4	5164	238
DNAJB3	414061	broad.mit.edu	37	2	234652528	234652528	+	Missense_Mutation	SNP	C	T	T			TCGA-32-2498-01	TCGA-32-2498-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:234652528C>T	uc002vuz.2	-	1	134	c.35G>A	c.(34-36)CGG>CAG	p.R12Q	UGT1A8_uc010zmv.1_Intron|UGT1A8_uc002vup.2_Intron|UGT1A10_uc002vuq.3_Intron|UGT1A10_uc002vur.2_Intron|UGT1A9_uc010zmw.1_Intron|UGT1A9_uc002vus.2_Intron|UGT1A7_uc010zmx.1_Intron|UGT1A7_uc002vut.2_Intron|UGT1A6_uc002vuu.2_Intron|UGT1A6_uc010zmy.1_Intron|UGT1A6_uc002vuv.3_Intron|UGT1A5_uc010zmz.1_Intron|UGT1A5_uc002vuw.2_Intron|UGT1A4_uc010zna.1_Intron|UGT1A4_uc002vux.2_Intron|UGT1A3_uc010znb.1_Intron|UGT1A3_uc002vuy.2_Intron	NM_001001394	NP_001001394	Q8WWF6	DNJB3_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 3	12	J.				protein folding		heat shock protein binding|unfolded protein binding				0						TGAGGCCTGCCGGGGCACGTC	0.642													4	70	---	---	---	---	capture	Missense_Mutation	SNP	234652528	234652528	DNAJB3	2	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	4577	238
C20orf94	128710	broad.mit.edu	37	20	10582459	10582459	+	Missense_Mutation	SNP	G	C	C			TCGA-32-2498-01	TCGA-32-2498-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:10582459G>C	uc010zre.1	+	6	577	c.397G>C	c.(397-399)GAA>CAA	p.E133Q		NM_001009608	NP_001009608	Q5VYV7	CT094_HUMAN	hypothetical protein LOC128710	133							protein binding				0						AAGTCAGAATGAAGATTTGGT	0.328													3	101	---	---	---	---	capture	Missense_Mutation	SNP	10582459	10582459	C20orf94	20	G	C	C	C	1	0	0	0	0	1	0	0	0	585	45	4	4	2102	238
SPTLC3	55304	broad.mit.edu	37	20	12989978	12989978	+	Missense_Mutation	SNP	C	A	A			TCGA-32-2498-01	TCGA-32-2498-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:12989978C>A	uc002wod.1	+	1	352	c.63C>A	c.(61-63)AGC>AGA	p.S21R	SPTLC3_uc002wob.1_RNA|SPTLC3_uc002woc.2_Missense_Mutation_p.S21R	NM_018327	NP_060797	Q9NUV7	SPTC3_HUMAN	serine palmitoyltransferase, long chain base	21					sphingoid biosynthetic process	integral to membrane|serine C-palmitoyltransferase complex	pyridoxal phosphate binding|serine C-palmitoyltransferase activity|transferase activity, transferring nitrogenous groups				0					Pyridoxal Phosphate(DB00114)	AGAAACAGAGCAATGGCTCAC	0.488													3	69	---	---	---	---	capture	Missense_Mutation	SNP	12989978	12989978	SPTLC3	20	C	A	A	A	1	0	0	0	0	1	0	0	0	324	25	4	4	15017	238
CHEK2	11200	broad.mit.edu	37	22	29091840	29091841	+	Missense_Mutation	DNP	TG	CA	CA	rs142470496;rs146546850	byFrequency;byFrequency	TCGA-32-2498-01	TCGA-32-2498-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:29091840_29091841TG>CA	uc003adu.1	-	11	1188_1189	c.1116_1117CA>TG	c.(1114-1119)TCCAAG>TCTGAG	p.K373E	CHEK2_uc003ads.1_Missense_Mutation_p.K152E|CHEK2_uc010gvh.1_Missense_Mutation_p.K282E|CHEK2_uc010gvi.1_Intron|CHEK2_uc010gvj.1_Intron|CHEK2_uc003adr.1_RNA|CHEK2_uc010gvk.1_RNA|CHEK2_uc003adt.1_Missense_Mutation_p.K416E|CHEK2_uc003adv.1_Missense_Mutation_p.K344E|CHEK2_uc003adw.1_Missense_Mutation_p.K373E|CHEK2_uc003adx.1_Missense_Mutation_p.K152E|CHEK2_uc003ady.1_Missense_Mutation_p.K373E|CHEK2_uc003adz.1_Missense_Mutation_p.K177E	NM_007194	NP_009125	O96017	CHK2_HUMAN	protein kinase CHK2 isoform a	373	Protein kinase.				cell cycle|DNA damage checkpoint|DNA damage response, signal transduction resulting in induction of apoptosis|replicative senescence	PML body	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity	p.K373E(2)|p.S372S(1)		central_nervous_system(17)|stomach(1)|ovary(1)|lung(1)	20						CCCAAAATCTTGGAGTGCCCAA	0.416			F			breast 		Direct_reversal_of_damage|Other_conserved_DNA_damage_response_genes	Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|CHEK2-associated_cancer				6	77	---	---	---	---	capture	Missense_Mutation	DNP	29091840	29091841	CHEK2	22	TG	CA	CA	CA	1	0	0	0	0	1	0	0	0	819	63	3	3	3301	238
ATG7	10533	broad.mit.edu	37	3	11400061	11400061	+	Missense_Mutation	SNP	C	T	T			TCGA-32-2498-01	TCGA-32-2498-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:11400061C>T	uc003bwc.2	+	13	1571	c.1454C>T	c.(1453-1455)GCC>GTC	p.A485V	ATG7_uc003bwd.2_Missense_Mutation_p.A485V|ATG7_uc011aum.1_Missense_Mutation_p.A446V	NM_006395	NP_006386	O95352	ATG7_HUMAN	APG7 autophagy 7-like isoform a	485					autophagy|cellular membrane fusion|positive regulation of protein modification process|protein lipidation|protein transport	cytoplasm	APG12 activating enzyme activity|protein homodimerization activity|ubiquitin activating enzyme activity			central_nervous_system(1)	1						TGGCTTCCTGCCGTCATTGCT	0.522													3	24	---	---	---	---	capture	Missense_Mutation	SNP	11400061	11400061	ATG7	3	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	1092	238
BAP1	8314	broad.mit.edu	37	3	52440327	52440327	+	Missense_Mutation	SNP	T	C	C			TCGA-32-2498-01	TCGA-32-2498-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:52440327T>C	uc003ddx.2	-	9	840	c.725A>G	c.(724-726)GAG>GGG	p.E242G	BAP1_uc003ddw.2_5'Flank|BAP1_uc010hmg.2_5'Flank|BAP1_uc010hmh.2_5'Flank	NM_004656	NP_004647	Q92560	BAP1_HUMAN	BRCA1 associated protein-1	242					monoubiquitinated histone H2A deubiquitination|negative regulation of cell proliferation|protein K48-linked deubiquitination|regulation of cell cycle|regulation of cell growth|ubiquitin-dependent protein catabolic process	cytoplasm|nucleolus|PR-DUB complex	chromatin binding|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			pleura(32)|eye(28)|lung(2)|ovary(2)|breast(1)	65				BRCA - Breast invasive adenocarcinoma(193;1.72e-05)|Kidney(197;0.0018)|KIRC - Kidney renal clear cell carcinoma(197;0.00203)|OV - Ovarian serous cystadenocarcinoma(275;0.0277)		CAGCCTGGCCTCATACTTGAT	0.617			N|Mis|F|S|O		uveal melanoma|breast|NSCLC								3	59	---	---	---	---	capture	Missense_Mutation	SNP	52440327	52440327	BAP1	3	T	C	C	C	1	0	0	0	0	1	0	0	0	702	54	3	3	1300	238
ADCY5	111	broad.mit.edu	37	3	123038651	123038651	+	Missense_Mutation	SNP	C	T	T			TCGA-32-2498-01	TCGA-32-2498-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:123038651C>T	uc003egh.1	-	10	2126	c.2126G>A	c.(2125-2127)AGT>AAT	p.S709N	ADCY5_uc003egg.1_Missense_Mutation_p.S342N|ADCY5_uc003egi.1_Missense_Mutation_p.S268N	NM_183357	NP_899200	O95622	ADCY5_HUMAN	adenylate cyclase 5	709	Cytoplasmic (Potential).				activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane|plasma membrane	adenylate cyclase activity|ATP binding|metal ion binding			ovary(4)	4				GBM - Glioblastoma multiforme(114;0.0342)		AGGGTTCGCACTCTCCTGGGC	0.622													2	23	---	---	---	---	capture	Missense_Mutation	SNP	123038651	123038651	ADCY5	3	C	T	T	T	1	0	0	0	0	1	0	0	0	260	20	2	2	297	238
NPHP3	27031	broad.mit.edu	37	3	132432110	132432110	+	Missense_Mutation	SNP	C	G	G			TCGA-32-2498-01	TCGA-32-2498-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:132432110C>G	uc003epe.1	-	6	1055	c.978G>C	c.(976-978)AAG>AAC	p.K326N	NPHP3_uc003epf.1_Missense_Mutation_p.K81N	NM_153240	NP_694972	Q7Z494	NPHP3_HUMAN	nephrocystin 3	326					maintenance of organ identity|negative regulation of canonical Wnt receptor signaling pathway|photoreceptor cell maintenance|regulation of Wnt receptor signaling pathway, planar cell polarity pathway|Wnt receptor signaling pathway	cilium	protein binding			ovary(1)	1						CGCACATTCTCTTAAGTTTAG	0.274													2	27	---	---	---	---	capture	Missense_Mutation	SNP	132432110	132432110	NPHP3	3	C	G	G	G	1	0	0	0	0	1	0	0	0	415	32	4	4	10487	238
DNAJB11	51726	broad.mit.edu	37	3	186302253	186302253	+	Missense_Mutation	SNP	G	C	C			TCGA-32-2498-01	TCGA-32-2498-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:186302253G>C	uc003fqi.2	+	9	1107	c.887G>C	c.(886-888)GGA>GCA	p.G296A		NM_016306	NP_057390	Q9UBS4	DJB11_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 11	296					protein folding	endoplasmic reticulum lumen	heat shock protein binding			ovary(1)|lung(1)	2	all_cancers(143;2.84e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;1.44e-20)	GBM - Glioblastoma multiforme(93;0.0476)		ACCAGGCCAGGAGCGAAGCTA	0.443													3	81	---	---	---	---	capture	Missense_Mutation	SNP	186302253	186302253	DNAJB11	3	G	C	C	C	1	0	0	0	0	1	0	0	0	533	41	4	4	4572	238
LSG1	55341	broad.mit.edu	37	3	194369500	194369500	+	Missense_Mutation	SNP	C	A	A			TCGA-32-2498-01	TCGA-32-2498-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:194369500C>A	uc003fui.2	-	11	1768	c.1453G>T	c.(1453-1455)GCT>TCT	p.A485S		NM_018385	NP_060855	Q9H089	LSG1_HUMAN	large subunit GTPase 1	485					nuclear export|protein transport	Cajal body|endoplasmic reticulum	GTP binding|hydrolase activity				0	all_cancers(143;1.68e-08)|Ovarian(172;0.0634)		OV - Ovarian serous cystadenocarcinoma(49;4.34e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;7.55e-06)		CCATAGGTAGCTTCTAAAACA	0.463													4	90	---	---	---	---	capture	Missense_Mutation	SNP	194369500	194369500	LSG1	3	C	A	A	A	1	0	0	0	0	1	0	0	0	364	28	4	4	8964	238
MUC4	4585	broad.mit.edu	37	3	195505782	195505782	+	Silent	SNP	G	A	A			TCGA-32-2498-01	TCGA-32-2498-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:195505782G>A	uc011bto.1	-	3	12745	c.12285C>T	c.(12283-12285)ACC>ACT	p.T4095T	MUC4_uc003fva.2_5'Flank|MUC4_uc003fvb.2_5'Flank|MUC4_uc003fvc.2_5'Flank|MUC4_uc003fvd.2_5'Flank|MUC4_uc003fve.2_5'Flank|MUC4_uc010hzr.2_5'Flank|MUC4_uc011btf.1_Intron|MUC4_uc011btg.1_Intron|MUC4_uc011bth.1_Intron|MUC4_uc011bti.1_Intron|MUC4_uc011btj.1_Intron|MUC4_uc011btk.1_Intron|MUC4_uc011btl.1_Intron|MUC4_uc011btm.1_Intron|MUC4_uc011btn.1_Intron|MUC4_uc003fvo.2_Intron|MUC4_uc003fvp.2_Intron|MUC4_uc010hzu.1_Intron	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a	980	Ser-rich.				cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		CAGGAAGAGGGGTGGCGTGAC	0.597													2	12	---	---	---	---	capture	Silent	SNP	195505782	195505782	MUC4	3	G	A	A	A	1	0	0	0	0	0	0	0	1	548	43	2	2	9888	238
GAK	2580	broad.mit.edu	37	4	875807	875807	+	Missense_Mutation	SNP	C	G	G			TCGA-32-2498-01	TCGA-32-2498-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:875807C>G	uc003gbm.3	-	15	1748	c.1549G>C	c.(1549-1551)GTG>CTG	p.V517L	GAK_uc003gbn.3_Missense_Mutation_p.V438L|GAK_uc010ibk.1_Missense_Mutation_p.V411L|GAK_uc003gbl.3_Missense_Mutation_p.V381L	NM_005255	NP_005246	O14976	GAK_HUMAN	cyclin G associated kinase	517	Phosphatase tensin-type.				cell cycle	focal adhesion|Golgi apparatus|perinuclear region of cytoplasm	ATP binding|heat shock protein binding|protein serine/threonine kinase activity			lung(2)|central_nervous_system(1)|skin(1)	4				Colorectal(103;0.219)		CAGACGGCCACAGCAGACGCG	0.657													2	11	---	---	---	---	capture	Missense_Mutation	SNP	875807	875807	GAK	4	C	G	G	G	1	0	0	0	0	1	0	0	0	221	17	4	4	6135	238
WHSC1	7468	broad.mit.edu	37	4	1902364	1902364	+	Translation_Start_Site	SNP	C	T	T			TCGA-32-2498-01	TCGA-32-2498-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:1902364C>T	uc003gdz.3	+	2	159	c.-17C>T	c.(-19--15)AACGG>AATGG		WHSC1_uc003geb.3_Translation_Start_Site|WHSC1_uc003gec.3_Translation_Start_Site|WHSC1_uc003ged.3_Translation_Start_Site|WHSC1_uc003gee.3_RNA|WHSC1_uc003gef.3_RNA|WHSC1_uc003gdx.2_Translation_Start_Site|WHSC1_uc003gdy.1_Translation_Start_Site|WHSC1_uc010icd.1_Translation_Start_Site|WHSC1_uc003gea.1_Translation_Start_Site|WHSC1_uc010ice.1_Translation_Start_Site|WHSC1_uc003geg.1_Translation_Start_Site|WHSC1_uc003geh.1_Translation_Start_Site	NM_001042424	NP_001035889	O96028	NSD2_HUMAN	Wolf-Hirschhorn syndrome candidate 1 protein						anatomical structure morphogenesis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|cytoplasm|nuclear membrane|nucleolus	DNA binding|histone-lysine N-methyltransferase activity|zinc ion binding			ovary(3)|lung(3)|skin(2)|pancreas(1)	9		all_epithelial(65;1.34e-05)	OV - Ovarian serous cystadenocarcinoma(23;0.00606)	STAD - Stomach adenocarcinoma(129;0.232)		GTTCTAAGAACGGAAGCATCT	0.393			T	IGH@	MM								5	180	---	---	---	---	capture	Translation_Start_Site	SNP	1902364	1902364	WHSC1	4	C	T	T	T	1	0	0	0	0	0	0	0	0	235	19	1	1	17243	238
N4BP2	55728	broad.mit.edu	37	4	40122526	40122526	+	Missense_Mutation	SNP	G	A	A			TCGA-32-2498-01	TCGA-32-2498-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:40122526G>A	uc003guy.3	+	9	3133	c.2795G>A	c.(2794-2796)GGC>GAC	p.G932D	N4BP2_uc010ifq.2_Missense_Mutation_p.G852D|N4BP2_uc010ifr.2_Missense_Mutation_p.G852D	NM_018177	NP_060647	Q86UW6	N4BP2_HUMAN	Nedd4 binding protein 2	932						cytoplasm	ATP binding|ATP-dependent polydeoxyribonucleotide 5'-hydroxyl-kinase activity|endonuclease activity|protein binding			lung(3)|breast(2)|kidney(2)|ovary(1)	8						GCCTGTTGGGGCACAAGCTCT	0.413													3	78	---	---	---	---	capture	Missense_Mutation	SNP	40122526	40122526	N4BP2	4	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	10020	238
BEND4	389206	broad.mit.edu	37	4	42119671	42119671	+	Missense_Mutation	SNP	G	A	A			TCGA-32-2498-01	TCGA-32-2498-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:42119671G>A	uc003gwn.2	-	6	2049	c.1469C>T	c.(1468-1470)GCT>GTT	p.A490V	BEND4_uc003gwm.2_3'UTR	NM_207406	NP_997289	Q6ZU67	BEND4_HUMAN	BEN domain containing 4 isoform a	490	BEN.										0						GTGACCGACAGCGTCGCTGAA	0.527													2	13	---	---	---	---	capture	Missense_Mutation	SNP	42119671	42119671	BEND4	4	G	A	A	A	1	0	0	0	0	1	0	0	0	442	34	2	2	1389	238
LPHN3	23284	broad.mit.edu	37	4	62599060	62599060	+	Missense_Mutation	SNP	A	G	G			TCGA-32-2498-01	TCGA-32-2498-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:62599060A>G	uc010ihh.2	+	5	1156	c.983A>G	c.(982-984)GAG>GGG	p.E328G	LPHN3_uc003hcq.3_Missense_Mutation_p.E328G|LPHN3_uc010ihg.1_Missense_Mutation_p.E396G|LPHN3_uc003hcs.1_Missense_Mutation_p.E157G	NM_015236	NP_056051	Q9HAR2	LPHN3_HUMAN	latrophilin 3 precursor	328	Extracellular (Potential).|Olfactomedin-like.				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity|sugar binding			lung(15)|ovary(1)|central_nervous_system(1)|pancreas(1)	18						TCTGTATATGAGGATGATGAC	0.388													2	28	---	---	---	---	capture	Missense_Mutation	SNP	62599060	62599060	LPHN3	4	A	G	G	G	1	0	0	0	0	1	0	0	0	143	11	3	3	8833	238
ANKRD17	26057	broad.mit.edu	37	4	74005420	74005420	+	Silent	SNP	T	C	C			TCGA-32-2498-01	TCGA-32-2498-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:74005420T>C	uc003hgp.2	-	15	3030	c.2913A>G	c.(2911-2913)CCA>CCG	p.P971P	ANKRD17_uc003hgo.2_Silent_p.P858P|ANKRD17_uc003hgq.2_Intron|ANKRD17_uc003hgr.2_Silent_p.P971P|ANKRD17_uc011cbd.1_Silent_p.P536P	NM_032217	NP_115593	O75179	ANR17_HUMAN	ankyrin repeat domain protein 17 isoform a	971	Gln-rich.				interspecies interaction between organisms	cytoplasm|nucleus	RNA binding			ovary(5)|skin(3)|upper_aerodigestive_tract(1)|lung(1)	10	Breast(15;0.000295)		Epithelial(6;8.86e-07)|OV - Ovarian serous cystadenocarcinoma(6;6.22e-06)|all cancers(17;1.51e-05)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			CGATGGACCCTGGAGGCAAGG	0.567													2	37	---	---	---	---	capture	Silent	SNP	74005420	74005420	ANKRD17	4	T	C	C	C	1	0	0	0	0	0	0	0	1	704	55	3	3	643	238
MED7	9443	broad.mit.edu	37	5	156566376	156566376	+	Missense_Mutation	SNP	C	A	A			TCGA-32-2498-01	TCGA-32-2498-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:156566376C>A	uc010jik.2	-	2	459	c.67G>T	c.(67-69)GAT>TAT	p.D23Y	MED7_uc003lwm.3_Missense_Mutation_p.D23Y	NM_001100816	NP_001094286	O43513	MED7_HUMAN	mediator complex subunit 7	23					regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex|transcription factor complex	protein binding|transcription coactivator activity				0	Renal(175;0.00212)	Medulloblastoma(196;0.0354)|all_neural(177;0.0999)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			ATATTTTCATCCGTATATTCC	0.423													3	82	---	---	---	---	capture	Missense_Mutation	SNP	156566376	156566376	MED7	5	C	A	A	A	1	0	0	0	0	1	0	0	0	390	30	4	4	9365	238
ODZ2	57451	broad.mit.edu	37	5	167645612	167645612	+	Missense_Mutation	SNP	G	C	C			TCGA-32-2498-01	TCGA-32-2498-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:167645612G>C	uc010jjd.2	+	23	4689	c.4689G>C	c.(4687-4689)AAG>AAC	p.K1563N	ODZ2_uc003lzr.3_Missense_Mutation_p.K1333N|ODZ2_uc003lzt.3_Missense_Mutation_p.K936N|ODZ2_uc010jje.2_Missense_Mutation_p.K827N	NM_001122679	NP_001116151			odz, odd Oz/ten-m homolog 2											ovary(6)|central_nervous_system(4)	10	Renal(175;0.00124)|Lung NSC(126;0.136)|all_lung(126;0.242)	Medulloblastoma(196;0.0241)|all_neural(177;0.026)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0444)|OV - Ovarian serous cystadenocarcinoma(192;0.0694)|Epithelial(171;0.124)		CGGTCAGCAAGAACAAGCCTG	0.478													65	65	---	---	---	---	capture	Missense_Mutation	SNP	167645612	167645612	ODZ2	5	G	C	C	C	1	0	0	0	0	1	0	0	0	425	33	4	4	10740	238
FAM65B	9750	broad.mit.edu	37	6	24843298	24843298	+	Missense_Mutation	SNP	A	G	G			TCGA-32-2498-01	TCGA-32-2498-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:24843298A>G	uc003neo.1	-	14	1888	c.1712T>C	c.(1711-1713)CTC>CCC	p.L571P	FAM65B_uc011djs.1_Missense_Mutation_p.L550P|FAM65B_uc011dju.1_Missense_Mutation_p.L555P|FAM65B_uc003nep.2_Missense_Mutation_p.L521P|FAM65B_uc011djt.1_Missense_Mutation_p.L521P	NM_014722	NP_055537	Q9Y4F9	FA65B_HUMAN	hypothetical protein LOC9750 isoform 1	571					cell differentiation|muscle organ development	cytoskeleton|filopodium|mitochondrion	binding			ovary(1)	1						TGCAGATGTGAGCCTCTTGAC	0.527													4	180	---	---	---	---	capture	Missense_Mutation	SNP	24843298	24843298	FAM65B	6	A	G	G	G	1	0	0	0	0	1	0	0	0	143	11	3	3	5548	238
HFE	3077	broad.mit.edu	37	6	26093160	26093160	+	Silent	SNP	C	A	A			TCGA-32-2498-01	TCGA-32-2498-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:26093160C>A	uc003nfx.1	+	4	1024	c.864C>A	c.(862-864)GGC>GGA	p.G288G	HFE_uc003nfy.1_Silent_p.G265G|HFE_uc010jqe.1_Silent_p.G285G|HFE_uc003nfz.1_Silent_p.G200G|HFE_uc003ngd.1_Silent_p.G186G|HFE_uc003nga.1_Silent_p.G274G|HFE_uc003ngb.1_Silent_p.G182G|HFE_uc003ngc.1_Silent_p.G196G|HFE_uc003nge.1_Silent_p.G108G|HFE_uc003ngf.1_Intron	NM_000410	NP_000401	Q30201	HFE_HUMAN	hemochromatosis protein isoform 1 precursor	288	Alpha-3.|Ig-like C1-type.|Extracellular (Potential).				antigen processing and presentation of peptide antigen via MHC class I|cellular iron ion homeostasis|immune response|iron ion transport|protein complex assembly|receptor-mediated endocytosis	apical part of cell|basal part of cell|cytoplasmic vesicle|early endosome|integral to plasma membrane|MHC class I protein complex|perinuclear region of cytoplasm|recycling endosome	protein binding				0						AGCACCCAGGCCTGGATCAGC	0.552									Hemochromatosis				4	70	---	---	---	---	capture	Silent	SNP	26093160	26093160	HFE	6	C	A	A	A	1	0	0	0	0	0	0	0	1	327	26	4	4	7006	238
ABCF1	23	broad.mit.edu	37	6	30545667	30545667	+	Missense_Mutation	SNP	C	G	G			TCGA-32-2498-01	TCGA-32-2498-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:30545667C>G	uc003nql.2	+	3	288	c.193C>G	c.(193-195)CAG>GAG	p.Q65E	ABCF1_uc003nqk.2_Missense_Mutation_p.Q65E|ABCF1_uc003nqm.2_Missense_Mutation_p.Q65E|ABCF1_uc010jsb.2_Missense_Mutation_p.Q65E	NM_001025091	NP_001020262	Q8NE71	ABCF1_HUMAN	ATP-binding cassette, sub-family F, member 1	65					inflammatory response|translational initiation	nuclear envelope|nuclear envelope|nucleoplasm|nucleoplasm|polysomal ribosome	ATP binding|ATP binding|ATPase activity|protein binding|ribosome binding|translation activator activity|translation factor activity, nucleic acid binding			ovary(2)	2						GAAGGagcagcagcagcagca	0.433													3	54	---	---	---	---	capture	Missense_Mutation	SNP	30545667	30545667	ABCF1	6	C	G	G	G	1	0	0	0	0	1	0	0	0	325	25	4	4	65	238
FOXP4	116113	broad.mit.edu	37	6	41545729	41545729	+	Silent	SNP	C	G	G	rs141432353		TCGA-32-2498-01	TCGA-32-2498-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:41545729C>G	uc003oql.2	+	3	668	c.210C>G	c.(208-210)CTC>CTG	p.L70L	FOXP4_uc003oqm.2_Silent_p.L70L|FOXP4_uc003oqn.2_Silent_p.L70L	NM_001012426	NP_001012426	Q8IVH2	FOXP4_HUMAN	forkhead box P4 isoform 1	70	Gln-rich.				embryonic foregut morphogenesis|heart development|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|tissue development	cytoplasm|transcription factor complex	chromatin binding|DNA bending activity|double-stranded DNA binding|promoter binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding|zinc ion binding			breast(1)	1	Ovarian(28;0.0327)|Colorectal(47;0.196)					TGCAGGCTCTCCAAGTGGCCC	0.602													2	13	---	---	---	---	capture	Silent	SNP	41545729	41545729	FOXP4	6	C	G	G	G	1	0	0	0	0	0	0	0	1	379	30	4	4	5973	238
PERP	64065	broad.mit.edu	37	6	138417591	138417591	+	Silent	SNP	G	A	A			TCGA-32-2498-01	TCGA-32-2498-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:138417591G>A	uc003qht.2	-	2	438	c.255C>T	c.(253-255)TTC>TTT	p.F85F		NM_022121	NP_071404	Q96FX8	PERP_HUMAN	PERP, TP53 apoptosis effector	85	Helical; (Potential).				apoptosis|cell adhesion	desmosome|Golgi apparatus|integral to membrane|nucleus					0	Breast(32;0.0799)|Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000878)|OV - Ovarian serous cystadenocarcinoma(155;0.000997)		CCAGGATGATGAAGCCACAGA	0.478													3	11	---	---	---	---	capture	Silent	SNP	138417591	138417591	PERP	6	G	A	A	A	1	0	0	0	0	0	0	0	1	581	45	2	2	11635	238
FBXO30	84085	broad.mit.edu	37	6	146126547	146126547	+	Missense_Mutation	SNP	G	A	A			TCGA-32-2498-01	TCGA-32-2498-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:146126547G>A	uc003qla.2	-	2	1194	c.995C>T	c.(994-996)GCG>GTG	p.A332V	uc003qky.1_Intron	NM_032145	NP_115521	Q8TB52	FBX30_HUMAN	F-box only protein 30	332							ubiquitin-protein ligase activity|zinc ion binding			ovary(2)|large_intestine(1)	3		Ovarian(120;0.0776)		OV - Ovarian serous cystadenocarcinoma(155;1.95e-07)|GBM - Glioblastoma multiforme(68;0.0149)		TGCTGCCACCGCAAGTGAGCT	0.428													3	119	---	---	---	---	capture	Missense_Mutation	SNP	146126547	146126547	FBXO30	6	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	5686	238
MAFK	7975	broad.mit.edu	37	7	1579852	1579852	+	Silent	SNP	G	A	A			TCGA-32-2498-01	TCGA-32-2498-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:1579852G>A	uc003skr.2	+	3	523	c.312G>A	c.(310-312)CTG>CTA	p.L104L	MAFK_uc003sks.1_RNA	NM_002360	NP_002351	O60675	MAFK_HUMAN	v-maf musculoaponeurotic fibrosarcoma oncogene	104	Leucine-zipper.				blood coagulation	nucleoplasm	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0178)|OV - Ovarian serous cystadenocarcinoma(56;5.75e-15)		GGCTGGAGCTGGACGCCCTGC	0.692													2	15	---	---	---	---	capture	Silent	SNP	1579852	1579852	MAFK	7	G	A	A	A	1	0	0	0	0	0	0	0	1	600	47	2	2	9075	238
MAFK	7975	broad.mit.edu	37	7	1579867	1579867	+	Silent	SNP	C	G	G			TCGA-32-2498-01	TCGA-32-2498-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:1579867C>G	uc003skr.2	+	3	538	c.327C>G	c.(325-327)TCC>TCG	p.S109S	MAFK_uc003sks.1_RNA	NM_002360	NP_002351	O60675	MAFK_HUMAN	v-maf musculoaponeurotic fibrosarcoma oncogene	109	Leucine-zipper.				blood coagulation	nucleoplasm	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0178)|OV - Ovarian serous cystadenocarcinoma(56;5.75e-15)		CCCTGCGCTCCAAGTACGAGG	0.682													2	22	---	---	---	---	capture	Silent	SNP	1579867	1579867	MAFK	7	C	G	G	G	1	0	0	0	0	0	0	0	1	262	21	4	4	9075	238
DOCK4	9732	broad.mit.edu	37	7	111585795	111585795	+	Missense_Mutation	SNP	C	G	G			TCGA-32-2498-01	TCGA-32-2498-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:111585795C>G	uc003vfx.2	-	9	1029	c.760G>C	c.(760-762)GAA>CAA	p.E254Q	DOCK4_uc003vfy.2_Missense_Mutation_p.E254Q|DOCK4_uc003vga.1_5'UTR|DOCK4_uc010ljt.1_Missense_Mutation_p.E254Q	NM_014705	NP_055520	Q8N1I0	DOCK4_HUMAN	dedicator of cytokinesis 4	254					cell chemotaxis	cytosol|endomembrane system|membrane|stereocilium	GTP binding|guanyl-nucleotide exchange factor activity|PDZ domain binding|Rac GTPase activator activity|Rac GTPase binding|receptor tyrosine kinase binding|SH3 domain binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)	4		Acute lymphoblastic leukemia(1;0.0441)				CAATGTCGTTCCGGTTTATCA	0.353													2	27	---	---	---	---	capture	Missense_Mutation	SNP	111585795	111585795	DOCK4	7	C	G	G	G	1	0	0	0	0	1	0	0	0	390	30	4	4	4645	238
TAS2R4	50832	broad.mit.edu	37	7	141478700	141478700	+	Missense_Mutation	SNP	C	G	G			TCGA-32-2498-01	TCGA-32-2498-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:141478700C>G	uc003vwq.1	+	1	412	c.412C>G	c.(412-414)CTG>GTG	p.L138V		NM_016944	NP_058640	Q9NYW5	TA2R4_HUMAN	taste receptor T2R4	138	Helical; Name=4; (Potential).				sensory perception of taste	cilium membrane	taste receptor activity				0	Melanoma(164;0.0171)			BRCA - Breast invasive adenocarcinoma(188;0.196)		GGCCTGTGTGCTGATTTCTGC	0.458													60	374	---	---	---	---	capture	Missense_Mutation	SNP	141478700	141478700	TAS2R4	7	C	G	G	G	1	0	0	0	0	1	0	0	0	363	28	4	4	15465	238
PSD3	23362	broad.mit.edu	37	8	18729893	18729893	+	Missense_Mutation	SNP	C	A	A			TCGA-32-2498-01	TCGA-32-2498-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:18729893C>A	uc003wza.2	-	3	584	c.481G>T	c.(481-483)GTT>TTT	p.V161F		NM_015310	NP_056125	Q9NYI0	PSD3_HUMAN	ADP-ribosylation factor guanine nucleotide	161					regulation of ARF protein signal transduction	cell junction|cytoplasm|postsynaptic density|postsynaptic membrane	ARF guanyl-nucleotide exchange factor activity			ovary(3)	3				Colorectal(111;0.0281)|READ - Rectum adenocarcinoma(644;0.183)		AAACTAGAAACAGCATCTTGG	0.438													3	96	---	---	---	---	capture	Missense_Mutation	SNP	18729893	18729893	PSD3	8	C	A	A	A	1	0	0	0	0	1	0	0	0	221	17	4	4	12543	238
ANK1	286	broad.mit.edu	37	8	41530255	41530255	+	Silent	SNP	C	G	G	rs138394311	byFrequency	TCGA-32-2498-01	TCGA-32-2498-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:41530255C>G	uc003xok.2	-	38	4797	c.4713G>C	c.(4711-4713)GCG>GCC	p.A1571A	NKX6-3_uc010lxa.1_Intron|ANK1_uc003xoh.2_Intron|ANK1_uc003xoi.2_Silent_p.A1571A|ANK1_uc003xoj.2_Silent_p.A1571A|ANK1_uc003xol.2_Intron|ANK1_uc003xom.2_Silent_p.A1612A	NM_020476	NP_065209	P16157	ANK1_HUMAN	ankyrin 1 isoform 1	1571	55 kDa regulatory domain.				axon guidance|cytoskeleton organization|exocytosis|maintenance of epithelial cell apical/basal polarity|signal transduction	basolateral plasma membrane|cytosol|sarcomere|sarcoplasmic reticulum|spectrin-associated cytoskeleton	cytoskeletal adaptor activity|enzyme binding|protein binding|spectrin binding|structural constituent of cytoskeleton			ovary(3)|central_nervous_system(3)|lung(2)|breast(1)	9	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)			GCGTGAGGCCCGCAGACCACA	0.602													2	34	---	---	---	---	capture	Silent	SNP	41530255	41530255	ANK1	8	C	G	G	G	1	0	0	0	0	0	0	0	1	288	23	4	4	617	238
HAUS6	54801	broad.mit.edu	37	9	19089520	19089520	+	Missense_Mutation	SNP	T	G	G			TCGA-32-2498-01	TCGA-32-2498-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:19089520T>G	uc003znk.2	-	5	727	c.474A>C	c.(472-474)AAA>AAC	p.K158N	HAUS6_uc003znl.1_Missense_Mutation_p.K22N	NM_017645	NP_060115	Q7Z4H7	HAUS6_HUMAN	HAUS augmin-like complex, subunit 6	158					cell division|centrosome organization|mitosis|spindle assembly	centrosome|HAUS complex|microtubule|nucleus|spindle				ovary(2)	2						AGTCCTGTGGTTTTATGTTAA	0.289													3	45	---	---	---	---	capture	Missense_Mutation	SNP	19089520	19089520	HAUS6	9	T	G	G	G	1	0	0	0	0	1	0	0	0	777	60	4	4	6897	238
TUBB2C	10383	broad.mit.edu	37	9	140137057	140137057	+	Silent	SNP	C	T	T			TCGA-32-2498-01	TCGA-32-2498-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:140137057C>T	uc004cmh.1	+	4	489	c.387C>T	c.(385-387)TGC>TGT	p.C129C	TUBB2C_uc004cmg.1_5'UTR	NM_006088	NP_006079	P68371	TBB2C_HUMAN	tubulin, beta, 2	129					'de novo' posttranslational protein folding|cellular component movement|G2/M transition of mitotic cell cycle|microtubule-based movement|natural killer cell mediated cytotoxicity|protein polymerization	cytosol|microtubule	GTP binding|GTPase activity|MHC class I protein binding|structural molecule activity|unfolded protein binding			ovary(1)	1	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0698)	OV - Ovarian serous cystadenocarcinoma(145;6.37e-05)|Epithelial(140;0.00057)		GCTGTGACTGCCTGCAGGGTT	0.617													9	107	---	---	---	---	capture	Silent	SNP	140137057	140137057	TUBB2C	9	C	T	T	T	1	0	0	0	0	0	0	0	1	337	26	2	2	16638	238
BCOR	54880	broad.mit.edu	37	X	39930364	39930364	+	Missense_Mutation	SNP	C	A	A			TCGA-32-2498-01	TCGA-32-2498-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:39930364C>A	uc004den.3	-	6	3392	c.3100G>T	c.(3100-3102)GGC>TGC	p.G1034C	BCOR_uc004dep.3_Missense_Mutation_p.G1034C|BCOR_uc004deo.3_Missense_Mutation_p.G1016C|BCOR_uc004dem.3_Missense_Mutation_p.G1034C	NM_001123385	NP_001116857	Q6W2J9	BCOR_HUMAN	BCL-6 interacting corepressor isoform c	1034					heart development|histone H2A monoubiquitination|negative regulation of bone mineralization|negative regulation of histone H3-K36 methylation|negative regulation of histone H3-K4 methylation|negative regulation of tooth mineralization|negative regulation of transcription from RNA polymerase II promoter|odontogenesis|palate development|specification of axis polarity|transcription, DNA-dependent	nucleus	heat shock protein binding|histone deacetylase binding|transcription corepressor activity|transcription factor binding|transcription regulatory region DNA binding			ovary(2)|kidney(1)|central_nervous_system(1)	4						GCTGGGTGGCCACCTTCTCTT	0.453													5	54	---	---	---	---	capture	Missense_Mutation	SNP	39930364	39930364	BCOR	23	C	A	A	A	1	0	0	0	0	1	0	0	0	273	21	4	4	1375	238
OTUD5	55593	broad.mit.edu	37	X	48781329	48781329	+	Missense_Mutation	SNP	G	C	C			TCGA-32-2498-01	TCGA-32-2498-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:48781329G>C	uc004dlu.2	-	7	1340	c.1279C>G	c.(1279-1281)CCC>GCC	p.P427A	OTUD5_uc004dlt.3_Missense_Mutation_p.P422A|OTUD5_uc004dlv.2_Missense_Mutation_p.P422A|OTUD5_uc011mmp.1_Missense_Mutation_p.P205A	NM_017602	NP_060072	Q96G74	OTUD5_HUMAN	OTU domain containing 5 isoform a	427					negative regulation of type I interferon production		cysteine-type peptidase activity			pancreas(1)	1						GCTTTCCGGGGCTGCAGCGGG	0.632													2	8	---	---	---	---	capture	Missense_Mutation	SNP	48781329	48781329	OTUD5	23	G	C	C	C	1	0	0	0	0	1	0	0	0	546	42	4	4	11219	238
IL13RA1	3597	broad.mit.edu	37	X	117910474	117910474	+	Silent	SNP	G	T	T			TCGA-32-2498-01	TCGA-32-2498-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:117910474G>T	uc004eqs.2	+	10	1234	c.1191G>T	c.(1189-1191)CTG>CTT	p.L397L	IL13RA1_uc004eqt.1_Silent_p.L397L	NM_001560	NP_001551	P78552	I13R1_HUMAN	interleukin 13 receptor, alpha 1 precursor	397	Cytoplasmic (Potential).					interleukin-13 receptor complex	cytokine receptor activity				0						ATGATACTCTGGTAAGAACAG	0.274													4	43	---	---	---	---	capture	Silent	SNP	117910474	117910474	IL13RA1	23	G	T	T	T	1	0	0	0	0	0	0	0	1	600	47	4	4	7552	238
ZNF449	203523	broad.mit.edu	37	X	134494411	134494411	+	Missense_Mutation	SNP	C	A	A			TCGA-32-2498-01	TCGA-32-2498-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:134494411C>A	uc004eys.2	+	5	1132	c.967C>A	c.(967-969)CAC>AAC	p.H323N	ZNF449_uc004eyt.2_Missense_Mutation_p.H203N|ZNF449_uc004eyu.2_Missense_Mutation_p.H129N	NM_152695	NP_689908	Q6P9G9	ZN449_HUMAN	zinc finger protein 449	323	C2H2-type 1.				viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)	2	Acute lymphoblastic leukemia(192;6.56e-05)					AGAGAAACCTCACCGATGTCC	0.478													3	66	---	---	---	---	capture	Missense_Mutation	SNP	134494411	134494411	ZNF449	23	C	A	A	A	1	0	0	0	0	1	0	0	0	377	29	4	4	17799	238
GPR101	83550	broad.mit.edu	37	X	136113427	136113427	+	Missense_Mutation	SNP	G	A	A			TCGA-32-2498-01	TCGA-32-2498-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:136113427G>A	uc011mwh.1	-	1	407	c.407C>T	c.(406-408)CCT>CTT	p.P136L		NM_054021	NP_473362	Q96P66	GP101_HUMAN	G protein-coupled receptor 101	136	Cytoplasmic (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(3)|lung(1)|skin(1)	5	Acute lymphoblastic leukemia(192;0.000127)					GTAGGAGAGAGGGTGGATGAT	0.597													3	24	---	---	---	---	capture	Missense_Mutation	SNP	136113427	136113427	GPR101	23	G	A	A	A	1	0	0	0	0	1	0	0	0	455	35	2	2	6556	238
RENBP	5973	broad.mit.edu	37	X	153208532	153208532	+	Splice_Site	SNP	C	T	T			TCGA-32-2498-01	TCGA-32-2498-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:153208532C>T	uc004fjo.1	-	6	633	c.463_splice	c.e6-1	p.T155_splice	RENBP_uc011mzh.1_Splice_Site_p.T155_splice	NM_002910	NP_002901	P51606	RENBP_HUMAN	renin binding protein						mannose metabolic process|regulation of blood pressure		endopeptidase inhibitor activity|mannose-6-phosphate isomerase activity|N-acylglucosamine 2-epimerase activity			ovary(1)|pancreas(1)	2	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)				N-Acetyl-D-glucosamine(DB00141)	CCGCTTCCGTCTGGGGGTGCA	0.687													2	14	---	---	---	---	capture	Splice_Site	SNP	153208532	153208532	RENBP	23	C	T	T	T	1	0	0	0	0	0	0	1	0	416	32	5	2	13120	238
SLC44A3	126969	broad.mit.edu	37	1	95357932	95357932	+	Frame_Shift_Del	DEL	T	-	-			TCGA-32-2498-01	TCGA-32-2498-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:95357932delT	uc001dqv.3	+	14	1823	c.1716delT	c.(1714-1716)GCTfs	p.A572fs	SLC44A3_uc001dqx.3_Frame_Shift_Del_p.A571fs|SLC44A3_uc010otq.1_Frame_Shift_Del_p.A504fs|SLC44A3_uc010otr.1_Frame_Shift_Del_p.A536fs|SLC44A3_uc001dqw.3_Frame_Shift_Del_p.A524fs|SLC44A3_uc010ots.1_Frame_Shift_Del_p.A492fs|SLC44A3_uc009wds.2_Frame_Shift_Del_p.A475fs|SLC44A3_uc010ott.1_Frame_Shift_Del_p.A491fs	NM_001114106	NP_001107578	Q8N4M1	CTL3_HUMAN	solute carrier family 44, member 3 isoform 1	572	Helical; (Potential).					integral to membrane|plasma membrane	choline transmembrane transporter activity			kidney(1)	1		all_lung(203;0.000712)|Lung NSC(277;0.00316)		all cancers(265;0.039)|Epithelial(280;0.124)	Choline(DB00122)	TATTGGTAGCTTTTTTTGCCT	0.423													7	435	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	95357932	95357932	SLC44A3	1	T	-	-	-	1	0	1	0	1	0	0	0	0	717	56	5	5	14529	238
KIAA0907	22889	broad.mit.edu	37	1	155886422	155886423	+	Frame_Shift_Del	DEL	CT	-	-			TCGA-32-2498-01	TCGA-32-2498-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:155886422_155886423delCT	uc001fmi.1	-	12	1570_1571	c.1546_1547delAG	c.(1546-1548)AGGfs	p.R516fs	KIAA0907_uc001fmj.1_Frame_Shift_Del_p.R516fs|KIAA0907_uc009wrk.1_Frame_Shift_Del_p.R373fs|KIAA0907_uc009wrl.1_RNA	NM_014949	NP_055764	Q7Z7F0	K0907_HUMAN	hypothetical protein LOC22889	516											0	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)		OV - Ovarian serous cystadenocarcinoma(3;8.82e-06)			TTACCTGTCCCTCTCTCTCTCT	0.396													9	573	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	155886422	155886423	KIAA0907	1	CT	-	-	-	1	0	1	0	1	0	0	0	0	312	24	5	5	8121	238
INA	9118	broad.mit.edu	37	10	105048271	105048273	+	In_Frame_Del	DEL	GAG	-	-			TCGA-32-2498-01	TCGA-32-2498-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:105048271_105048273delGAG	uc001kws.2	+	3	1394_1396	c.1345_1347delGAG	c.(1345-1347)GAGdel	p.E454del		NM_032727	NP_116116	Q16352	AINX_HUMAN	internexin neuronal intermediate filament	454	Tail.|Poly-Glu.				cell differentiation|nervous system development	neurofilament	structural constituent of cytoskeleton			ovary(1)|breast(1)	2				Epithelial(162;3.45e-09)|all cancers(201;9.17e-08)|BRCA - Breast invasive adenocarcinoma(275;0.198)		ACTTAAGAAAGAGGAGGAGGAGG	0.458													7	228	---	---	---	---	capture_indel	In_Frame_Del	DEL	105048271	105048273	INA	10	GAG	-	-	-	1	0	1	0	1	0	0	0	0	429	33	5	5	7653	238
TSC2	7249	broad.mit.edu	37	16	2120552	2120552	+	Frame_Shift_Del	DEL	G	-	-			TCGA-32-2498-01	TCGA-32-2498-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:2120552delG	uc002con.2	+	17	1918	c.1812delG	c.(1810-1812)CTGfs	p.L604fs	TSC2_uc010bsd.2_Frame_Shift_Del_p.L604fs|TSC2_uc002coo.2_Frame_Shift_Del_p.L604fs|TSC2_uc010uvv.1_Frame_Shift_Del_p.L567fs|TSC2_uc010uvw.1_Frame_Shift_Del_p.L555fs|TSC2_uc002cop.2_Frame_Shift_Del_p.L404fs	NM_000548	NP_000539	P49815	TSC2_HUMAN	tuberous sclerosis 2 isoform 1	604					cell cycle arrest|endocytosis|heart development|insulin receptor signaling pathway|insulin-like growth factor receptor signaling pathway|negative regulation of cell size|negative regulation of phosphatidylinositol 3-kinase cascade|negative regulation of protein kinase B signaling cascade|negative regulation of TOR signaling cascade|negative regulation of Wnt receptor signaling pathway|nerve growth factor receptor signaling pathway|neural tube closure|phosphatidylinositol-mediated signaling|positive chemotaxis|protein import into nucleus|protein kinase B signaling cascade|regulation of endocytosis|regulation of insulin receptor signaling pathway|regulation of small GTPase mediated signal transduction	Golgi apparatus|nucleus|perinuclear region of cytoplasm|TSC1-TSC2 complex	GTPase activator activity|protein homodimerization activity			central_nervous_system(4)|lung(3)|ovary(2)|pancreas(1)	10		Hepatocellular(780;0.0202)				GCTACACCCTGCCAATCGCGA	0.622			D|Mis|N|F|S			hamartoma|renal cell			Tuberous_Sclerosis				56	19	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	2120552	2120552	TSC2	16	G	-	-	-	1	0	1	0	1	0	0	0	0	587	46	5	5	16489	238
FGFR3	2261	broad.mit.edu	37	4	1806181	1806181	+	Frame_Shift_Del	DEL	C	-	-			TCGA-32-2498-01	TCGA-32-2498-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:1806181delC	uc003gdr.3	+	9	1456	c.1200delC	c.(1198-1200)AGCfs	p.S400fs	FGFR3_uc003gdu.2_Frame_Shift_Del_p.S402fs|FGFR3_uc003gds.3_Intron|FGFR3_uc003gdq.3_Frame_Shift_Del_p.S400fs	NM_000142	NP_000133	P22607	FGFR3_HUMAN	fibroblast growth factor receptor 3 isoform 1	400	Cytoplasmic (Potential).				bone maturation|cell growth|insulin receptor signaling pathway|JAK-STAT cascade|MAPKKK cascade|negative regulation of developmental growth|positive regulation of cell proliferation	integral to plasma membrane	ATP binding|fibroblast growth factor binding|fibroblast growth factor receptor activity|identical protein binding			urinary_tract(2177)|skin(314)|upper_aerodigestive_tract(57)|haematopoietic_and_lymphoid_tissue(24)|prostate(9)|cervix(6)|central_nervous_system(4)|large_intestine(3)|lung(3)|testis(2)|pancreas(1)	2600		Breast(71;0.212)|all_epithelial(65;0.241)	all cancers(2;0.000145)|OV - Ovarian serous cystadenocarcinoma(23;0.0019)|Epithelial(3;0.00221)|GBM - Glioblastoma multiforme(2;0.234)		Palifermin(DB00039)	GCCTGCGCAGCCCCCCCAAGA	0.627		1	Mis|T	IGH@|ETV6	bladder|MM|T-cell lymphoma		Hypochondroplasia|Thanatophoric dysplasia		Muenke_syndrome|Saethre-Chotzen_syndrome				7	439	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	1806181	1806181	FGFR3	4	C	-	-	-	1	0	1	0	1	0	0	0	0	337	26	5	5	5813	238
