Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
PRAMEF10	343071	broad.mit.edu	37	1	12955489	12955489	+	Missense_Mutation	SNP	G	A	A			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:12955489G>A	uc001auo.2	-	2	263	c.190C>T	c.(190-192)CTC>TTC	p.L64F		NM_001039361	NP_001034450	O60809	PRA10_HUMAN	PRAME family member 10	64											0	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.00224)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		CCCAGAGGGAGGCTGAGGAAG	0.587													5	173	---	---	---	---	capture	Missense_Mutation	SNP	12955489	12955489	PRAMEF10	1	G	A	A	A	1	0	0	0	0	1	0	0	0	455	35	2	2	12327	245
CASP9	842	broad.mit.edu	37	1	15844698	15844698	+	Missense_Mutation	SNP	C	A	A			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:15844698C>A	uc001awn.2	-	2	420	c.325G>T	c.(325-327)GTG>TTG	p.V109L	CASP9_uc001awm.1_Missense_Mutation_p.V109L|CASP9_uc001awo.2_Missense_Mutation_p.V109L|CASP9_uc001awp.2_5'UTR|CASP9_uc009voi.2_Intron|CASP9_uc010obm.1_Missense_Mutation_p.V26L|CASP9_uc001awq.2_Missense_Mutation_p.V26L	NM_001229	NP_001220	P55211	CASP9_HUMAN	caspase 9 isoform alpha preproprotein	109					activation of caspase activity by cytochrome c|induction of apoptosis by intracellular signals|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling	cytosol	cysteine-type endopeptidase activity|enzyme activator activity|protein binding			central_nervous_system(1)|kidney(1)	2		Breast(348;0.000207)|all_lung(284;0.000211)|Colorectal(325;0.000259)|Lung NSC(340;0.000269)|Renal(390;0.000518)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;8.49e-07)|COAD - Colon adenocarcinoma(227;4.36e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00013)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00763)|READ - Rectum adenocarcinoma(331;0.0655)		CTGAGCACCACTGGGGTAAGG	0.517													4	192	---	---	---	---	capture	Missense_Mutation	SNP	15844698	15844698	CASP9	1	C	A	A	A	1	0	0	0	0	1	0	0	0	260	20	4	4	2655	245
MYOM3	127294	broad.mit.edu	37	1	24409117	24409117	+	Silent	SNP	G	A	A			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:24409117G>A	uc001bin.3	-	17	2221	c.2058C>T	c.(2056-2058)GCC>GCT	p.A686A	MYOM3_uc001bim.3_Silent_p.A343A|MYOM3_uc001bio.2_Silent_p.A686A|MYOM3_uc001bip.1_3'UTR	NM_152372	NP_689585	Q5VTT5	MYOM3_HUMAN	myomesin family, member 3	686	Fibronectin type-III 3.									skin(2)|ovary(1)	3		Colorectal(325;3.55e-05)|Renal(390;0.000703)|Lung NSC(340;0.001)|all_lung(284;0.0014)|Ovarian(437;0.00351)|Breast(348;0.0126)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;5.31e-24)|Colorectal(126;7.52e-08)|COAD - Colon adenocarcinoma(152;4.01e-06)|GBM - Glioblastoma multiforme(114;4.36e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00108)|KIRC - Kidney renal clear cell carcinoma(1967;0.00404)|STAD - Stomach adenocarcinoma(196;0.00966)|READ - Rectum adenocarcinoma(331;0.0678)|Lung(427;0.153)		GCTCGGTGGCGGCTGAGCTCT	0.622													37	37	---	---	---	---	capture	Silent	SNP	24409117	24409117	MYOM3	1	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	10003	245
C8B	732	broad.mit.edu	37	1	57425758	57425758	+	Missense_Mutation	SNP	G	A	A			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:57425758G>A	uc001cyp.2	-	2	251	c.184C>T	c.(184-186)CCC>TCC	p.P62S	C8B_uc010oon.1_5'UTR|C8B_uc010ooo.1_Missense_Mutation_p.P10S	NM_000066	NP_000057	P07358	CO8B_HUMAN	complement component 8, beta polypeptide	62					complement activation, alternative pathway|complement activation, classical pathway|cytolysis	membrane attack complex				central_nervous_system(2)|large_intestine(1)|ovary(1)	4						CAATCAATGGGCATCAGGGTA	0.498													4	147	---	---	---	---	capture	Missense_Mutation	SNP	57425758	57425758	C8B	1	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	2394	245
DEPDC1	55635	broad.mit.edu	37	1	68948414	68948414	+	Silent	SNP	T	C	C			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:68948414T>C	uc001dem.3	-	8	1194	c.1077A>G	c.(1075-1077)TCA>TCG	p.S359S	DEPDC1_uc001dej.3_5'Flank|DEPDC1_uc001dek.3_RNA|DEPDC1_uc001del.3_Intron	NM_001114120	NP_001107592	Q5TB30	DEP1A_HUMAN	DEP domain containing 1 isoform a	359					intracellular signal transduction|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	transcriptional repressor complex	GTPase activator activity|protein binding				0				OV - Ovarian serous cystadenocarcinoma(397;7.21e-36)		CAGTAGAATCTGATTCTTCTT	0.343													83	86	---	---	---	---	capture	Silent	SNP	68948414	68948414	DEPDC1	1	T	C	C	C	1	0	0	0	0	0	0	0	1	704	55	3	3	4397	245
MAGI3	260425	broad.mit.edu	37	1	114225544	114225544	+	Silent	SNP	G	A	A			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:114225544G>A	uc001edk.2	+	21	3535	c.3354G>A	c.(3352-3354)TCG>TCA	p.S1118S	MAGI3_uc001edi.3_3'UTR|MAGI3_uc010owm.1_3'UTR|MAGI3_uc001edj.2_3'UTR|MAGI3_uc009wgo.2_RNA	NM_001142782	NP_001136254	Q5TCQ9	MAGI3_HUMAN	membrane-associated guanylate kinase-related  3	1143					apoptosis|interspecies interaction between organisms|intracellular signal transduction	nucleus|tight junction	ATP binding|guanylate kinase activity|protein binding			lung(3)|ovary(2)|central_nervous_system(1)	6	Lung SC(450;0.184)	all_cancers(81;2.34e-09)|all_epithelial(167;7.41e-09)|all_lung(203;7.13e-06)|Lung NSC(69;1.2e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		ATAATCCTTCGTCTTCAAATG	0.318													9	49	---	---	---	---	capture	Silent	SNP	114225544	114225544	MAGI3	1	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	9106	245
AQP10	89872	broad.mit.edu	37	1	154296100	154296100	+	Missense_Mutation	SNP	G	C	C			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:154296100G>C	uc001feu.2	+	5	565	c.525G>C	c.(523-525)TTG>TTC	p.L175F	AQP10_uc001fev.2_Missense_Mutation_p.L175F|ATP8B2_uc001few.2_5'Flank	NM_080429	NP_536354	Q96PS8	AQP10_HUMAN	aquaporin 10	175	Helical; (Potential).				response to toxin|transmembrane transport|water transport	integral to membrane|plasma membrane	transporter activity			central_nervous_system(1)	1	all_lung(78;2.62e-30)|Lung NSC(65;3.94e-28)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)			TGGGGCTCTTGGCCATCCTGG	0.607													9	497	---	---	---	---	capture	Missense_Mutation	SNP	154296100	154296100	AQP10	1	G	C	C	C	1	0	0	0	0	1	0	0	0	607	47	4	4	815	245
MPZL1	9019	broad.mit.edu	37	1	167734984	167734984	+	Missense_Mutation	SNP	T	G	G			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:167734984T>G	uc001geo.2	+	2	458	c.256T>G	c.(256-258)TCG>GCG	p.S86A	MPZL1_uc001gen.3_Missense_Mutation_p.S86A|MPZL1_uc001gep.2_Missense_Mutation_p.S86A|MPZL1_uc001geq.2_Missense_Mutation_p.S86A|MPZL1_uc009wvh.2_RNA	NM_003953	NP_003944	O95297	MPZL1_HUMAN	myelin protein zero-like 1 isoform a	86	Extracellular (Potential).|Ig-like V-type.				cell-cell signaling|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	protein binding|structural molecule activity			ovary(2)	2	all_hematologic(923;0.215)					CACTACTGTGTCGGTAAGAAT	0.483													3	94	---	---	---	---	capture	Missense_Mutation	SNP	167734984	167734984	MPZL1	1	T	G	G	G	1	0	0	0	0	1	0	0	0	754	58	4	4	9661	245
JMJD4	65094	broad.mit.edu	37	1	227922480	227922480	+	Missense_Mutation	SNP	C	A	A			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:227922480C>A	uc001hrb.2	-	2	438	c.438G>T	c.(436-438)CAG>CAT	p.Q146H	SNAP47_uc001hqz.2_Intron|SNAP47_uc001hra.2_Intron|SNAP47_uc001hrd.2_5'Flank|SNAP47_uc001hre.2_5'Flank|SNAP47_uc001hrf.2_5'Flank|JMJD4_uc001hrc.2_Missense_Mutation_p.Q146H	NM_023007	NP_075383	Q9H9V9	JMJD4_HUMAN	jumonji domain containing 4 isoform 1	146											0		Prostate(94;0.0885)				AGTTGTATTCCTGGACCCCAC	0.552													4	142	---	---	---	---	capture	Missense_Mutation	SNP	227922480	227922480	JMJD4	1	C	A	A	A	1	0	0	0	0	1	0	0	0	311	24	4	4	7874	245
ITGA8	8516	broad.mit.edu	37	10	15701007	15701007	+	Silent	SNP	C	T	T			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:15701007C>T	uc001ioc.1	-	10	939	c.939G>A	c.(937-939)ACG>ACA	p.T313T	ITGA8_uc010qcb.1_Silent_p.T298T	NM_003638	NP_003629	P53708	ITA8_HUMAN	integrin, alpha 8 precursor	313	Extracellular (Potential).|FG-GAP 5.				cell differentiation|cell-cell adhesion|cell-matrix adhesion|integrin-mediated signaling pathway|nervous system development	integrin complex	receptor activity			ovary(3)|lung(3)	6						CCTGTTCTCCCGTGAAATTCT	0.303													15	3	---	---	---	---	capture	Silent	SNP	15701007	15701007	ITGA8	10	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	7805	245
PTCHD3	374308	broad.mit.edu	37	10	27702997	27702997	+	Silent	SNP	C	T	T			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:27702997C>T	uc001itu.2	-	1	301	c.183G>A	c.(181-183)GCG>GCA	p.A61A		NM_001034842	NP_001030014	Q3KNS1	PTHD3_HUMAN	patched domain containing 3	61					spermatid development	integral to membrane	hedgehog receptor activity			ovary(2)|pancreas(1)|skin(1)	4						CCTGCTCCGACGCCAGGGGTC	0.687													113	21	---	---	---	---	capture	Silent	SNP	27702997	27702997	PTCHD3	10	C	T	T	T	1	0	0	0	0	0	0	0	1	236	19	1	1	12629	245
PTEN	5728	broad.mit.edu	37	10	89717691	89717691	+	Missense_Mutation	SNP	T	G	G			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:89717691T>G	uc001kfb.2	+	8	1747	c.716T>G	c.(715-717)ATG>AGG	p.M239R		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog	239	C2 tensin-type.				activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.R55fs*1(4)|p.N212fs*1(2)|p.Y27fs*1(2)|p.G165_*404del(1)|p.M239fs*4(1)|p.?(1)|p.G165_K342del(1)|p.R234fs*9(1)|p.K237_Y240>N(1)		endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		GACAAGTTCATGTACTTTGAG	0.413		31	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			150	19	---	---	---	---	capture	Missense_Mutation	SNP	89717691	89717691	PTEN	10	T	G	G	G	1	0	0	0	0	1	0	0	0	663	51	4	4	12633	245
NFKB2	4791	broad.mit.edu	37	10	104156679	104156679	+	Missense_Mutation	SNP	C	T	T			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:104156679C>T	uc001kvb.2	+	6	527	c.262C>T	c.(262-264)CCA>TCA	p.P88S	NFKB2_uc001kva.2_Missense_Mutation_p.P88S|NFKB2_uc010qqk.1_Missense_Mutation_p.P88S|NFKB2_uc001kvd.2_Missense_Mutation_p.P88S|NFKB2_uc009xxc.2_Missense_Mutation_p.P88S	NM_001077494	NP_001070962	Q00653	NFKB2_HUMAN	nuclear factor of kappa light polypeptide gene	88	RHD.				innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of NF-kappaB transcription factor activity|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	Bcl3/NF-kappaB2 complex|cytosol|nucleoplasm	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity			lung(3)	3		Colorectal(252;0.00957)		Epithelial(162;3.4e-08)|all cancers(201;6.41e-07)		CTACGAGGGACCAGCCAAGAT	0.602			T	IGH@	B-NHL								3	45	---	---	---	---	capture	Missense_Mutation	SNP	104156679	104156679	NFKB2	10	C	T	T	T	1	0	0	0	0	1	0	0	0	234	18	2	2	10283	245
LRRC56	115399	broad.mit.edu	37	11	554078	554078	+	Silent	SNP	T	C	C			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:554078T>C	uc010qvz.1	+	14	1936	c.1431T>C	c.(1429-1431)CGT>CGC	p.R477R		NM_198075	NP_932341	Q8IYG6	LRC56_HUMAN	leucine rich repeat containing 56	477										skin(1)	1		all_cancers(49;2.16e-06)|all_epithelial(84;0.000256)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;7.63e-28)|Epithelial(43;7.29e-27)|OV - Ovarian serous cystadenocarcinoma(40;7.15e-21)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0375)|LUSC - Lung squamous cell carcinoma(625;0.0703)		CCAGGGGGCGTCGGCTCCGAG	0.697													35	73	---	---	---	---	capture	Silent	SNP	554078	554078	LRRC56	11	T	C	C	C	1	0	0	0	0	0	0	0	1	743	58	3	3	8927	245
WEE1	7465	broad.mit.edu	37	11	9608358	9608358	+	Missense_Mutation	SNP	G	C	C			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:9608358G>C	uc001mhs.2	+	10	1995	c.1742G>C	c.(1741-1743)CGA>CCA	p.R581P	WEE1_uc001mht.2_Missense_Mutation_p.R367P	NM_003390	NP_003381	P30291	WEE1_HUMAN	WEE1 tyrosine kinase isoform 1	581					blood coagulation|cell cycle checkpoint|cell division|G1/S transition of mitotic cell cycle|G2/M transition of mitotic cell cycle|mitosis|S phase of mitotic cell cycle	nucleoplasm	ATP binding|magnesium ion binding|non-membrane spanning protein tyrosine kinase activity|protein binding|protein serine/threonine kinase activity			central_nervous_system(2)|ovary(1)|breast(1)|skin(1)	5				all cancers(16;4.59e-09)|Epithelial(150;3.15e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0484)		GAACAATTACGAATAGAATTG	0.348													3	86	---	---	---	---	capture	Missense_Mutation	SNP	9608358	9608358	WEE1	11	G	C	C	C	1	0	0	0	0	1	0	0	0	481	37	4	4	17225	245
CHRM4	1132	broad.mit.edu	37	11	46407321	46407321	+	Missense_Mutation	SNP	C	T	T			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:46407321C>T	uc001nct.1	-	1	787	c.787G>A	c.(787-789)GCC>ACC	p.A263T		NM_000741	NP_000732	P08173	ACM4_HUMAN	cholinergic receptor, muscarinic 4	263	Cytoplasmic (By similarity).				cell proliferation	cell junction|integral to plasma membrane|postsynaptic membrane	muscarinic acetylcholine receptor activity				0				GBM - Glioblastoma multiforme(35;0.0254)|Lung(87;0.14)	Atropine(DB00572)|Benzquinamide(DB00767)|Cryptenamine(DB00785)|Homatropine Methylbromide(DB00725)|Methotrimeprazine(DB01403)|Metixene(DB00340)|Olanzapine(DB00334)|Procyclidine(DB00387)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Thiethylperazine(DB00372)|Tropicamide(DB00809)	TCCTCCCGGGCGGCCTCCCCG	0.682													4	7	---	---	---	---	capture	Missense_Mutation	SNP	46407321	46407321	CHRM4	11	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	3344	245
OR8H3	390152	broad.mit.edu	37	11	55890095	55890095	+	Missense_Mutation	SNP	T	A	A			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:55890095T>A	uc001nii.1	+	1	247	c.247T>A	c.(247-249)TTA>ATA	p.L83I		NM_001005201	NP_001005201	Q8N146	OR8H3_HUMAN	olfactory receptor, family 8, subfamily H,	83	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2	Esophageal squamous(21;0.00693)					ACCTAAAACCTTAGCGAACTT	0.438													259	509	---	---	---	---	capture	Missense_Mutation	SNP	55890095	55890095	OR8H3	11	T	A	A	A	1	0	0	0	0	1	0	0	0	725	56	4	4	11143	245
OR5M11	219487	broad.mit.edu	37	11	56310099	56310099	+	Missense_Mutation	SNP	A	T	T			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:56310099A>T	uc010rjl.1	-	1	635	c.635T>A	c.(634-636)ATC>AAC	p.I212N		NM_001005245	NP_001005245	Q96RB7	OR5MB_HUMAN	olfactory receptor, family 5, subfamily M,	212	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						CACCAAGACGATGGTGAGGGA	0.502													29	39	---	---	---	---	capture	Missense_Mutation	SNP	56310099	56310099	OR5M11	11	A	T	T	T	1	0	0	0	0	1	0	0	0	156	12	4	4	11078	245
AHNAK	79026	broad.mit.edu	37	11	62297453	62297453	+	Missense_Mutation	SNP	T	A	A			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:62297453T>A	uc001ntl.2	-	5	4736	c.4436A>T	c.(4435-4437)GAG>GTG	p.E1479V	AHNAK_uc001ntk.1_Intron	NM_001620	NP_001611	Q09666	AHNK_HUMAN	AHNAK nucleoprotein isoform 1	1479					nervous system development	nucleus	protein binding			ovary(10)|pancreas(4)|skin(4)|upper_aerodigestive_tract(1)	19		Melanoma(852;0.155)				AGCTTTTATCTCTCCTTCTAC	0.418													127	208	---	---	---	---	capture	Missense_Mutation	SNP	62297453	62297453	AHNAK	11	T	A	A	A	1	0	0	0	0	1	0	0	0	702	54	4	4	414	245
PLCB3	5331	broad.mit.edu	37	11	64024115	64024115	+	Silent	SNP	C	T	T			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:64024115C>T	uc001nzb.2	+	10	891	c.891C>T	c.(889-891)AGC>AGT	p.S297S	PLCB3_uc009ypg.1_Silent_p.S297S|PLCB3_uc009yph.1_Silent_p.S230S|PLCB3_uc009ypi.2_Silent_p.S297S	NM_000932	NP_000923	Q01970	PLCB3_HUMAN	phospholipase C beta 3	297					intracellular signal transduction|lipid catabolic process|synaptic transmission	cytosol	calcium ion binding|calmodulin binding|phosphatidylinositol phospholipase C activity|signal transducer activity			ovary(1)|pancreas(1)	2						AGGGCTTTAGCCGCTACCTGG	0.632													3	94	---	---	---	---	capture	Silent	SNP	64024115	64024115	PLCB3	11	C	T	T	T	1	0	0	0	0	0	0	0	1	337	26	2	2	11932	245
ATG2A	23130	broad.mit.edu	37	11	64668368	64668368	+	Missense_Mutation	SNP	T	G	G			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:64668368T>G	uc001obx.2	-	30	4431	c.4316A>C	c.(4315-4317)CAC>CCC	p.H1439P	ATG2A_uc001obw.2_Missense_Mutation_p.H204P	NM_015104	NP_055919	Q2TAZ0	ATG2A_HUMAN	autophagy related 2A	1439							protein binding			ovary(1)|central_nervous_system(1)	2						GTGGCCGGGGTGGGGGCCAAA	0.388													2	5	---	---	---	---	capture	Missense_Mutation	SNP	64668368	64668368	ATG2A	11	T	G	G	G	1	0	0	0	0	1	0	0	0	767	59	4	4	1084	245
TMPRSS4	56649	broad.mit.edu	37	11	117975409	117975409	+	Missense_Mutation	SNP	G	A	A	rs140457645	byFrequency	TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:117975409G>A	uc010rxo.1	+	5	605	c.314G>A	c.(313-315)CGC>CAC	p.R105H	TMPRSS4_uc010rxp.1_Missense_Mutation_p.R105H|TMPRSS4_uc010rxq.1_5'UTR|TMPRSS4_uc010rxr.1_Missense_Mutation_p.R80H|TMPRSS4_uc010rxs.1_Missense_Mutation_p.R65H|TMPRSS4_uc009yzu.2_RNA|TMPRSS4_uc010rxt.1_Missense_Mutation_p.R80H	NM_019894	NP_063947	Q9NRS4	TMPS4_HUMAN	transmembrane protease, serine 4 isoform 1	105	Extracellular (Potential).|SRCR.				proteolysis	integral to membrane	scavenger receptor activity|serine-type endopeptidase activity			large_intestine(1)|central_nervous_system(1)	2	all_hematologic(175;0.0487)	Medulloblastoma(222;0.0431)|all_hematologic(192;0.164)|Breast(348;0.183)|all_neural(223;0.238)		BRCA - Breast invasive adenocarcinoma(274;4.16e-05)|Epithelial(105;0.00204)		CTCCCAGTCCGCCTCTCCAAG	0.587													64	39	---	---	---	---	capture	Missense_Mutation	SNP	117975409	117975409	TMPRSS4	11	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	16132	245
C11orf63	79864	broad.mit.edu	37	11	122775064	122775064	+	Missense_Mutation	SNP	A	G	G			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:122775064A>G	uc001pym.2	+	3	1073	c.776A>G	c.(775-777)AAC>AGC	p.N259S	C11orf63_uc001pyl.1_Missense_Mutation_p.N259S	NM_024806	NP_079082	Q6NUN7	CK063_HUMAN	hypothetical protein LOC79864 isoform 1	259										ovary(3)	3		Breast(109;0.00249)|Lung NSC(97;0.0177)|all_lung(97;0.018)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.34e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0311)		GTGGAAAAAAACAAGCTCACT	0.463													146	313	---	---	---	---	capture	Missense_Mutation	SNP	122775064	122775064	C11orf63	11	A	G	G	G	1	0	0	0	0	1	0	0	0	26	2	3	3	1640	245
NR4A1	3164	broad.mit.edu	37	12	52451228	52451228	+	Missense_Mutation	SNP	G	A	A			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:52451228G>A	uc001rzs.2	+	7	1768	c.1454G>A	c.(1453-1455)AGT>AAT	p.S485N	NR4A1_uc010sno.1_Missense_Mutation_p.S498N|NR4A1_uc001rzt.2_Missense_Mutation_p.S485N|NR4A1_uc009zmc.2_Missense_Mutation_p.V99I	NM_002135	NP_002126	P22736	NR4A1_HUMAN	nuclear receptor subfamily 4, group A, member 1	485					nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor		steroid hormone receptor activity|zinc ion binding				0				BRCA - Breast invasive adenocarcinoma(357;0.0967)		TGGATTGACAGTATCCTGGCC	0.612													3	96	---	---	---	---	capture	Missense_Mutation	SNP	52451228	52451228	NR4A1	12	G	A	A	A	1	0	0	0	0	1	0	0	0	468	36	2	2	10539	245
AGAP2	116986	broad.mit.edu	37	12	58124715	58124715	+	Missense_Mutation	SNP	C	A	A			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:58124715C>A	uc001spq.2	-	11	2167	c.2167G>T	c.(2167-2169)GGC>TGC	p.G723C	AGAP2_uc001spp.2_Missense_Mutation_p.G723C|AGAP2_uc001spr.2_Missense_Mutation_p.G387C	NM_001122772	NP_001116244	Q99490	AGAP2_HUMAN	centaurin, gamma 1 isoform PIKE-L	723	PH.				axon guidance|negative regulation of neuron apoptosis|negative regulation of protein catabolic process|protein transport|regulation of ARF GTPase activity|small GTPase mediated signal transduction	mitochondrion|nucleolus	ARF GTPase activator activity|GTP binding|zinc ion binding			central_nervous_system(3)|breast(2)	5						ATCTCCTTGCCGTGGGTACTG	0.582													2	17	---	---	---	---	capture	Missense_Mutation	SNP	58124715	58124715	AGAP2	12	C	A	A	A	1	0	0	0	0	1	0	0	0	299	23	4	4	368	245
TDG	6996	broad.mit.edu	37	12	104377129	104377129	+	Missense_Mutation	SNP	T	A	A			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:104377129T>A	uc001tkg.2	+	7	977	c.754T>A	c.(754-756)TTT>ATT	p.F252I	TDG_uc009zuk.2_Missense_Mutation_p.F248I|TDG_uc010swi.1_Missense_Mutation_p.F109I|TDG_uc010swj.1_Missense_Mutation_p.F40I	NM_003211	NP_003202	Q13569	TDG_HUMAN	thymine-DNA glycosylase	252					depyrimidination|mismatch repair	nucleoplasm	damaged DNA binding|mismatched DNA binding|protein binding|pyrimidine-specific mismatch base pair DNA N-glycosylase activity			ovary(3)|lung(3)	6				BRCA - Breast invasive adenocarcinoma(302;0.00114)		GAACTTGGAATTTGGGCTTCA	0.299								BER_DNA_glycosylases					4	83	---	---	---	---	capture	Missense_Mutation	SNP	104377129	104377129	TDG	12	T	A	A	A	1	0	0	0	0	1	0	0	0	676	52	4	4	15610	245
BTBD11	121551	broad.mit.edu	37	12	108010913	108010913	+	Silent	SNP	C	T	T			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:108010913C>T	uc001tmk.1	+	8	2570	c.2049C>T	c.(2047-2049)GGC>GGT	p.G683G	BTBD11_uc009zut.1_Silent_p.G683G|BTBD11_uc001tmj.2_Silent_p.G683G|BTBD11_uc001tml.1_Silent_p.G220G	NM_001018072	NP_001018082	A6QL63	BTBDB_HUMAN	BTB (POZ) domain containing 11 isoform a	683						integral to membrane	DNA binding			skin(2)|ovary(1)	3						TGGAGCATGGCGAGGAGAACT	0.612													68	101	---	---	---	---	capture	Silent	SNP	108010913	108010913	BTBD11	12	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	1527	245
KSR2	283455	broad.mit.edu	37	12	117993076	117993076	+	Silent	SNP	T	C	C			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:117993076T>C	uc001two.2	-	9	1384	c.1329A>G	c.(1327-1329)ACA>ACG	p.T443T		NM_173598	NP_775869	Q6VAB6	KSR2_HUMAN	kinase suppressor of ras 2	472					intracellular signal transduction	cytoplasm|membrane	ATP binding|metal ion binding|protein serine/threonine kinase activity			lung(10)|central_nervous_system(2)|stomach(1)|large_intestine(1)|breast(1)	15	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					GAACGGACTCTGTCCGGACTA	0.478													5	51	---	---	---	---	capture	Silent	SNP	117993076	117993076	KSR2	12	T	C	C	C	1	0	0	0	0	0	0	0	1	704	55	3	3	8502	245
DIABLO	56616	broad.mit.edu	37	12	122702873	122702873	+	Silent	SNP	G	T	T			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:122702873G>T	uc010tab.1	-	4	1060	c.255C>A	c.(253-255)ACC>ACA	p.T85T	DIABLO_uc010taa.1_Silent_p.T32T|DIABLO_uc010tac.1_Intron|DIABLO_uc010tad.1_Intron|VPS33A_uc001ucc.2_RNA	NM_019887	NP_063940	Q9NR28	DBLOH_HUMAN	diablo isoform 1 precursor	85				Missing (in Ref. 2; BAB71568).	activation of caspase activity by cytochrome c|induction of apoptosis via death domain receptors	CD40 receptor complex|cytosol|internal side of plasma membrane|mitochondrial intermembrane space	protein binding				0	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000302)|Epithelial(86;0.00051)|BRCA - Breast invasive adenocarcinoma(302;0.223)		GAAAGGTAGAGGTGCTATCTG	0.388													86	167	---	---	---	---	capture	Silent	SNP	122702873	122702873	DIABLO	12	G	T	T	T	1	0	0	0	0	0	0	0	1	444	35	4	4	4475	245
KNTC1	9735	broad.mit.edu	37	12	123014673	123014673	+	Silent	SNP	T	G	G			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:123014673T>G	uc001ucv.2	+	2	226	c.63T>G	c.(61-63)GGT>GGG	p.G21G	KNTC1_uc010taf.1_Silent_p.G21G	NM_014708	NP_055523	P50748	KNTC1_HUMAN	Rough Deal homolog, centromere/kinetochore	21					cell division|mitotic cell cycle checkpoint|mitotic prometaphase|protein complex assembly|regulation of exit from mitosis	condensed chromosome kinetochore|cytosol|kinetochore microtubule|nucleus|spindle pole	protein binding			ovary(5)|kidney(3)|lung(1)|central_nervous_system(1)	10	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.21e-05)|Epithelial(86;0.000178)|BRCA - Breast invasive adenocarcinoma(302;0.217)		TGAGTGTCGGTTCAAGAAAAG	0.403													8	42	---	---	---	---	capture	Silent	SNP	123014673	123014673	KNTC1	12	T	G	G	G	1	0	0	0	0	0	0	0	1	769	60	4	4	8348	245
GPR133	283383	broad.mit.edu	37	12	131593382	131593382	+	Silent	SNP	G	A	A	rs60880996	byFrequency;by1000genomes	TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:131593382G>A	uc001uit.3	+	18	2560	c.2001G>A	c.(1999-2001)TCG>TCA	p.S667S	GPR133_uc010tbm.1_Silent_p.S699S|GPR133_uc009zyo.2_Intron|GPR133_uc001uiv.1_Silent_p.S186S|GPR133_uc009zyp.2_RNA	NM_198827	NP_942122	Q6QNK2	GP133_HUMAN	G protein-coupled receptor 133 precursor	667	Cytoplasmic (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			pancreas(5)|ovary(3)|skin(2)	10	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.68e-06)|all cancers(50;2.71e-06)|Epithelial(86;6.75e-06)		TCTTTGGGTCGGAGGACAGCA	0.348													51	118	---	---	---	---	capture	Silent	SNP	131593382	131593382	GPR133	12	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	6577	245
ERCC5	2073	broad.mit.edu	37	13	103514821	103514821	+	Missense_Mutation	SNP	C	T	T	rs112825485		TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:103514821C>T	uc001vpw.2	+	8	1765	c.1322C>T	c.(1321-1323)CCG>CTG	p.P441L	ERCC5_uc001vpu.1_Missense_Mutation_p.P895L|ERCC5_uc010tjb.1_Missense_Mutation_p.P441L|ERCC5_uc010tjc.1_RNA|ERCC5_uc010tjd.1_Missense_Mutation_p.P273L	NM_000123	NP_000114	P28715	ERCC5_HUMAN	XPG-complementing protein	441					negative regulation of apoptosis|nucleotide-excision repair, DNA damage removal|nucleotide-excision repair, DNA incision, 3'-to lesion|response to UV-C|transcription-coupled nucleotide-excision repair|UV protection	nucleoplasm	bubble DNA binding|double-stranded DNA binding|endodeoxyribonuclease activity|metal ion binding|protein homodimerization activity|protein N-terminus binding|single-stranded DNA binding			ovary(4)|lung(1)|central_nervous_system(1)|skin(1)	7	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.211)					AAAGGAATACCGTTTACTGCA	0.493			Mis|N|F			skin basal cell|skin squamous cell|melanoma		Direct_reversal_of_damage|NER	Xeroderma_Pigmentosum				3	61	---	---	---	---	capture	Missense_Mutation	SNP	103514821	103514821	ERCC5	13	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	5171	245
MYH7	4625	broad.mit.edu	37	14	23898235	23898235	+	Missense_Mutation	SNP	T	G	G			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:23898235T>G	uc001wjx.2	-	14	1442	c.1336A>C	c.(1336-1338)ACC>CCC	p.T446P		NM_000257	NP_000248	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta	446	Myosin head-like.				adult heart development|muscle filament sliding|regulation of heart rate|ventricular cardiac muscle tissue morphogenesis	focal adhesion|muscle myosin complex|myosin filament|nucleus|sarcomere	actin binding|actin-dependent ATPase activity|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(3)|skin(1)	4	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		GTCTCCAGGGTGGCATTGATG	0.567													7	93	---	---	---	---	capture	Missense_Mutation	SNP	23898235	23898235	MYH7	14	T	G	G	G	1	0	0	0	0	1	0	0	0	767	59	4	4	9949	245
FSCB	84075	broad.mit.edu	37	14	44975414	44975414	+	Silent	SNP	A	G	G			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:44975414A>G	uc001wvn.2	-	1	1086	c.777T>C	c.(775-777)CCT>CCC	p.P259P		NM_032135	NP_115511	Q5H9T9	FSCB_HUMAN	fibrous sheath CABYR binding protein	259						cilium				lung(3)|breast(3)|ovary(2)|central_nervous_system(1)	9				GBM - Glioblastoma multiforme(112;0.128)		CTGTTGATGGAGGCTCTATTT	0.458													33	97	---	---	---	---	capture	Silent	SNP	44975414	44975414	FSCB	14	A	G	G	G	1	0	0	0	0	0	0	0	1	132	11	3	3	6009	245
SYT16	83851	broad.mit.edu	37	14	62541877	62541877	+	Missense_Mutation	SNP	G	A	A			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:62541877G>A	uc001xfu.1	+	3	958	c.761G>A	c.(760-762)CGT>CAT	p.R254H	SYT16_uc010tsd.1_Missense_Mutation_p.R254H	NM_031914	NP_114120	Q17RD7	SYT16_HUMAN	synaptotagmin XIV-like	254										central_nervous_system(1)	1				OV - Ovarian serous cystadenocarcinoma(108;0.0438)|BRCA - Breast invasive adenocarcinoma(234;0.118)		AGCCAACGGCGTTATTCTGAG	0.428													17	13	---	---	---	---	capture	Missense_Mutation	SNP	62541877	62541877	SYT16	14	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	15360	245
MAP3K9	4293	broad.mit.edu	37	14	71216774	71216774	+	Missense_Mutation	SNP	C	A	A			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:71216774C>A	uc001xmm.2	-	4	1026	c.1026G>T	c.(1024-1026)TTG>TTT	p.L342F	MAP3K9_uc010ttk.1_Missense_Mutation_p.L79F|MAP3K9_uc001xmk.2_Missense_Mutation_p.L36F|MAP3K9_uc001xml.2_Missense_Mutation_p.L342F	NM_033141	NP_149132	P80192	M3K9_HUMAN	mitogen-activated protein kinase kinase kinase	342	Protein kinase.				activation of JUN kinase activity|protein autophosphorylation		ATP binding|JUN kinase kinase kinase activity|MAP kinase kinase activity|protein homodimerization activity			stomach(2)|lung(1)|central_nervous_system(1)|skin(1)	5				all cancers(60;0.00779)|BRCA - Breast invasive adenocarcinoma(234;0.00884)|OV - Ovarian serous cystadenocarcinoma(108;0.08)		CACCAGTCAGCAACTCCCAAA	0.488													3	77	---	---	---	---	capture	Missense_Mutation	SNP	71216774	71216774	MAP3K9	14	C	A	A	A	1	0	0	0	0	1	0	0	0	324	25	4	4	9171	245
CACNA1H	8912	broad.mit.edu	37	16	1270781	1270781	+	Silent	SNP	C	T	T			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:1270781C>T	uc002cks.2	+	35	7097	c.6849C>T	c.(6847-6849)GAC>GAT	p.D2283D	CACNA1H_uc002ckt.2_Silent_p.D2277D|CACNA1H_uc002cku.2_Silent_p.D978D|CACNA1H_uc010brj.2_Silent_p.D994D|CACNA1H_uc002ckv.2_Silent_p.D972D	NM_021098	NP_066921	O95180	CAC1H_HUMAN	calcium channel, voltage-dependent, T type,	2283	Cytoplasmic (Potential).				aldosterone biosynthetic process|axon guidance|cellular response to hormone stimulus|cellular response to potassium ion|cortisol biosynthetic process|muscle contraction|myoblast fusion|positive regulation of acrosome reaction|regulation of heart contraction	voltage-gated calcium channel complex	low voltage-gated calcium channel activity			breast(2)	2		Hepatocellular(780;0.00369)			Flunarizine(DB04841)|Mibefradil(DB01388)	CTTTCTTGGACGGTAGCCACA	0.652													31	82	---	---	---	---	capture	Silent	SNP	1270781	1270781	CACNA1H	16	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	2521	245
ZNF263	10127	broad.mit.edu	37	16	3339529	3339529	+	Silent	SNP	G	A	A			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:3339529G>A	uc002cuq.2	+	6	1355	c.1023G>A	c.(1021-1023)TCG>TCA	p.S341S	ZNF263_uc010uww.1_5'UTR|ZNF263_uc002cur.2_5'UTR	NM_005741	NP_005732	O14978	ZN263_HUMAN	zinc finger protein 263	341					viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(3)|ovary(1)	4						ATGACCGGTCGCAAGGGGATT	0.632													27	86	---	---	---	---	capture	Silent	SNP	3339529	3339529	ZNF263	16	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	17683	245
IQCK	124152	broad.mit.edu	37	16	19729740	19729740	+	Missense_Mutation	SNP	G	C	C			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:19729740G>C	uc002dgr.2	+	2	811	c.112G>C	c.(112-114)GAG>CAG	p.E38Q	IQCK_uc002dgs.2_RNA|IQCK_uc010vat.1_Missense_Mutation_p.E38Q|IQCK_uc010bwc.2_RNA|IQCK_uc010vau.1_5'UTR|C16orf88_uc002dgq.2_5'Flank	NM_153208	NP_694940	Q8N0W5	IQCK_HUMAN	IQ motif containing K	38										skin(1)	1						CGCGTCCCGCGAGCTGCCTGT	0.652													2	5	---	---	---	---	capture	Missense_Mutation	SNP	19729740	19729740	IQCK	16	G	C	C	C	1	0	0	0	0	1	0	0	0	481	37	4	4	7736	245
MVP	9961	broad.mit.edu	37	16	29855978	29855978	+	Missense_Mutation	SNP	G	A	A	rs148167046		TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:29855978G>A	uc002dui.2	+	11	1883	c.1799G>A	c.(1798-1800)CGC>CAC	p.R600H	uc002dtf.2_Intron|BOLA2_uc010bzb.1_Intron|MVP_uc002duj.2_Missense_Mutation_p.R600H|MVP_uc010vea.1_Missense_Mutation_p.R194H	NM_005115	NP_005106	Q14764	MVP_HUMAN	major vault protein	600					mRNA transport|protein transport|response to drug|transmembrane transport	cytoplasm|nuclear pore|ribonucleoprotein complex	protein binding			skin(2)|ovary(1)|central_nervous_system(1)	4						CGCATCATTCGCACTGCTGTC	0.617													38	182	---	---	---	---	capture	Missense_Mutation	SNP	29855978	29855978	MVP	16	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	9906	245
PRSS36	146547	broad.mit.edu	37	16	31151818	31151818	+	Missense_Mutation	SNP	T	C	C			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:31151818T>C	uc002ebd.2	-	13	2221	c.2162A>G	c.(2161-2163)GAC>GGC	p.D721G	PRSS36_uc010vff.1_Missense_Mutation_p.D496G|PRSS36_uc010vfg.1_Missense_Mutation_p.D716G|PRSS36_uc010vfh.1_Intron	NM_173502	NP_775773	Q5K4E3	POLS2_HUMAN	protease, serine, 36 precursor	721	Peptidase S1 3.				proteolysis	cytoplasm|proteinaceous extracellular matrix	serine-type endopeptidase activity			ovary(1)	1						CTCACCTCGGTCCTGGGGTTC	0.667													49	33	---	---	---	---	capture	Missense_Mutation	SNP	31151818	31151818	PRSS36	16	T	C	C	C	1	0	0	0	0	1	0	0	0	754	58	3	3	12520	245
RPGRIP1L	23322	broad.mit.edu	37	16	53686572	53686572	+	Missense_Mutation	SNP	T	C	C			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:53686572T>C	uc002ehp.2	-	15	2091	c.2027A>G	c.(2026-2028)AAT>AGT	p.N676S	RPGRIP1L_uc002eho.3_Missense_Mutation_p.N676S|RPGRIP1L_uc010vgy.1_Missense_Mutation_p.N676S|RPGRIP1L_uc010cbx.2_Missense_Mutation_p.N676S|RPGRIP1L_uc010vgz.1_Missense_Mutation_p.N676S	NM_015272	NP_056087	Q68CZ1	FTM_HUMAN	RPGRIP1-like isoform a	676	C2 1.				negative regulation of G-protein coupled receptor protein signaling pathway	cell-cell junction|centrosome|cilium axoneme|microtubule basal body	thromboxane A2 receptor binding			ovary(1)	1		all_cancers(37;0.0973)				GGTGATAGTATTCTTCTGAAT	0.378													42	93	---	---	---	---	capture	Missense_Mutation	SNP	53686572	53686572	RPGRIP1L	16	T	C	C	C	1	0	0	0	0	1	0	0	0	676	52	3	3	13442	245
NUDT21	11051	broad.mit.edu	37	16	56473612	56473612	+	Missense_Mutation	SNP	T	C	C			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:56473612T>C	uc002eja.2	-	4	575	c.428A>G	c.(427-429)GAT>GGT	p.D143G	NUDT21_uc002eiz.2_Missense_Mutation_p.D68G	NM_007006	NP_008937	O43809	CPSF5_HUMAN	cleavage and polyadenylation specific factor 5	143	Nudix hydrolase.|Necessary for interactions with PAPOLA and PABPN1.|Necessary for RNA-binding.				mRNA polyadenylation|nuclear mRNA splicing, via spliceosome|protein tetramerization|termination of RNA polymerase II transcription	centrosome|mRNA cleavage factor complex|paraspeckles	AU-rich element binding|histone deacetylase binding|hydrolase activity|mRNA binding|protein homodimerization activity				0						ACCAATGCAATCGTCAATGAC	0.408													319	144	---	---	---	---	capture	Missense_Mutation	SNP	56473612	56473612	NUDT21	16	T	C	C	C	1	0	0	0	0	1	0	0	0	650	50	3	3	10645	245
TMEM208	29100	broad.mit.edu	37	16	67261781	67261781	+	Missense_Mutation	SNP	G	C	C			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:67261781G>C	uc002esi.2	+	2	155	c.49G>C	c.(49-51)GAA>CAA	p.E17Q	LRRC29_uc002ese.2_5'Flank|LRRC29_uc002esf.2_5'Flank|LRRC29_uc002esg.2_5'Flank|LRRC29_uc010vjg.1_5'Flank|TMEM208_uc002esj.2_RNA	NM_014187	NP_054906	Q9BTX3	TM208_HUMAN	HSPC171 protein	17						integral to membrane					0		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00067)|Epithelial(162;0.00442)|all cancers(182;0.0417)		GCAGATATTTGAAGAGAACAG	0.532													17	11	---	---	---	---	capture	Missense_Mutation	SNP	67261781	67261781	TMEM208	16	G	C	C	C	1	0	0	0	0	1	0	0	0	585	45	4	4	16016	245
EDC4	23644	broad.mit.edu	37	16	67914753	67914753	+	Silent	SNP	A	G	G			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:67914753A>G	uc002eur.2	+	18	2557	c.2391A>G	c.(2389-2391)GGA>GGG	p.G797G	EDC4_uc010cer.2_Silent_p.G416G|EDC4_uc002eus.2_Silent_p.G527G|EDC4_uc002eut.1_5'Flank	NM_014329	NP_055144	Q6P2E9	EDC4_HUMAN	autoantigen RCD8	797					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay	cytoplasmic mRNA processing body|cytosol|nucleus	protein binding			ovary(2)|central_nervous_system(2)	4		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0042)|Epithelial(162;0.0185)|all cancers(182;0.121)		GGCTTGATGGAGGCCCTGGGG	0.672													3	179	---	---	---	---	capture	Silent	SNP	67914753	67914753	EDC4	16	A	G	G	G	1	0	0	0	0	0	0	0	1	132	11	3	3	4863	245
PLCG2	5336	broad.mit.edu	37	16	81942161	81942161	+	Silent	SNP	C	T	T	rs11548654		TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:81942161C>T	uc002fgt.2	+	17	1850	c.1698C>T	c.(1696-1698)AGC>AGT	p.S566S	PLCG2_uc010chg.1_Silent_p.S566S	NM_002661	NP_002652	P16885	PLCG2_HUMAN	phospholipase C, gamma 2	566	SH2 1.				intracellular signal transduction|phospholipid catabolic process|platelet activation	plasma membrane	phosphatidylinositol phospholipase C activity|protein binding|signal transducer activity			large_intestine(4)|lung(2)|ovary(1)|skin(1)	8						TTCGGGAGAGCGAGACCTTCC	0.592													6	35	---	---	---	---	capture	Silent	SNP	81942161	81942161	PLCG2	16	C	T	T	T	1	0	0	0	0	0	0	0	1	350	27	1	1	11939	245
DERL2	51009	broad.mit.edu	37	17	5383436	5383436	+	Missense_Mutation	SNP	G	T	T			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:5383436G>T	uc002gcc.1	-	6	568	c.552C>A	c.(550-552)TTC>TTA	p.F184L		NM_016041	NP_057125	Q9GZP9	DERL2_HUMAN	Der1-like domain family, member 2	184	Helical; Name=4; (Potential).				endoplasmic reticulum unfolded protein response|ER-associated protein catabolic process|positive regulation of cell growth|positive regulation of cell proliferation|retrograde protein transport, ER to cytosol	integral to endoplasmic reticulum membrane	protein binding				0						CATCTTCCAAGAAAAAATATA	0.358													87	170	---	---	---	---	capture	Missense_Mutation	SNP	5383436	5383436	DERL2	17	G	T	T	T	1	0	0	0	0	1	0	0	0	425	33	4	4	4405	245
TP53	7157	broad.mit.edu	37	17	7577544	7577544	+	Missense_Mutation	SNP	A	C	C			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7577544A>C	uc002gim.2	-	7	931	c.737T>G	c.(736-738)ATG>AGG	p.M246R	TP53_uc002gig.1_Missense_Mutation_p.M246R|TP53_uc002gih.2_Missense_Mutation_p.M246R|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.M114R|TP53_uc010cng.1_Missense_Mutation_p.M114R|TP53_uc002gii.1_Missense_Mutation_p.M114R|TP53_uc010cnh.1_Missense_Mutation_p.M246R|TP53_uc010cni.1_Missense_Mutation_p.M246R|TP53_uc002gij.2_Missense_Mutation_p.M246R|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Missense_Mutation_p.M153R|TP53_uc002gio.2_Missense_Mutation_p.M114R	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	246	|Interaction with HIPK1 (By similarity).|Interacts with the 53BP2 SH3 domain.|Interaction with AXIN1 (By similarity).		M -> R (in sporadic cancers; somatic mutation).|M -> K (in sporadic cancers; somatic mutation).|M -> T (in sporadic cancers; somatic mutation).|M -> L (in sporadic cancers; somatic mutation).|M -> I (in sporadic cancers; somatic mutation).|M -> V (in LFS; germline mutation and in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.M246V(28)|p.M246I(24)|p.M246R(10)|p.M246K(8)|p.0?(7)|p.M246T(6)|p.M246L(2)|p.M246fs*1(2)|p.M246_P250delMNRRP(2)|p.G244fs*17(1)|p.C242fs*98(1)|p.C242_M246>L(1)|p.C238_M246delCNSSCMGGM(1)|p.G245fs*14(1)|p.G245fs*16(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		CCTCCGGTTCATGCCGCCCAT	0.572		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			55	12	---	---	---	---	capture	Missense_Mutation	SNP	7577544	7577544	TP53	17	A	C	C	C	1	0	0	0	0	1	0	0	0	104	8	4	4	16264	245
DNAH2	146754	broad.mit.edu	37	17	7640511	7640511	+	Missense_Mutation	SNP	C	T	T			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7640511C>T	uc002giu.1	+	7	1119	c.1105C>T	c.(1105-1107)CGC>TGC	p.R369C	DNAH2_uc002git.2_Missense_Mutation_p.R369C|DNAH2_uc010vuk.1_Missense_Mutation_p.R369C	NM_020877	NP_065928	Q9P225	DYH2_HUMAN	dynein heavy chain domain 3	369	Stem (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(6)|skin(6)|central_nervous_system(1)	13		all_cancers(10;4.66e-07)|Prostate(122;0.081)				CAGTCTCATCCGCATCATCTG	0.517													41	58	---	---	---	---	capture	Missense_Mutation	SNP	7640511	7640511	DNAH2	17	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	4559	245
ALOX15B	247	broad.mit.edu	37	17	7943287	7943287	+	Silent	SNP	G	A	A			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7943287G>A	uc002gju.2	+	3	551	c.435G>A	c.(433-435)CGG>CGA	p.R145R	ALOX15B_uc002gjv.2_Silent_p.R145R|ALOX15B_uc002gjw.2_Silent_p.R145R|ALOX15B_uc010vun.1_Silent_p.R145R|ALOX15B_uc010cnp.2_5'UTR	NM_001141	NP_001132	O15296	LX15B_HUMAN	arachidonate 15-lipoxygenase, second type	145	Lipoxygenase.				induction of apoptosis|leukotriene biosynthetic process|negative regulation of cell cycle|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of growth|prostate gland development|regulation of epithelial cell differentiation	cytoplasm	arachidonate 15-lipoxygenase activity|iron ion binding|lipoxygenase activity			ovary(1)	1						TTCAGGCCCGGCAGGAGATGT	0.607													83	125	---	---	---	---	capture	Silent	SNP	7943287	7943287	ALOX15B	17	G	A	A	A	1	0	0	0	0	0	0	0	1	535	42	2	2	539	245
GLP2R	9340	broad.mit.edu	37	17	9737155	9737155	+	Missense_Mutation	SNP	G	A	A	rs147858947	byFrequency	TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:9737155G>A	uc002gmd.1	+	2	221	c.221G>A	c.(220-222)CGG>CAG	p.R74Q	GLP2R_uc010cog.1_RNA	NM_004246	NP_004237	O95838	GLP2R_HUMAN	glucagon-like peptide 2 receptor precursor	74	Extracellular (Potential).				G-protein signaling, coupled to cAMP nucleotide second messenger|positive regulation of cell proliferation	integral to membrane|plasma membrane				lung(2)|ovary(1)	3					Glucagon recombinant(DB00040)	GAAACGACTCGGAAGTGGGCT	0.413													41	50	---	---	---	---	capture	Missense_Mutation	SNP	9737155	9737155	GLP2R	17	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	6389	245
MYH13	8735	broad.mit.edu	37	17	10243484	10243484	+	Missense_Mutation	SNP	T	C	C			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:10243484T>C	uc002gmk.1	-	18	2129	c.2039A>G	c.(2038-2040)AAT>AGT	p.N680S		NM_003802	NP_003793	Q9UKX3	MYH13_HUMAN	myosin, heavy polypeptide 13, skeletal muscle	680	Myosin head-like.|Actin-binding (By similarity).				muscle contraction	muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(4)|skin(2)	6						CTTGGTCTCATTGGGAATCAG	0.423													2	36	---	---	---	---	capture	Missense_Mutation	SNP	10243484	10243484	MYH13	17	T	C	C	C	1	0	0	0	0	1	0	0	0	676	52	3	3	9942	245
CETN1	1068	broad.mit.edu	37	18	580606	580606	+	Silent	SNP	G	A	A			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:580606G>A	uc002kko.1	+	1	240	c.198G>A	c.(196-198)AAG>AAA	p.K66K		NM_004066	NP_004057	Q12798	CETN1_HUMAN	centrin 1	66	EF-hand 2.				cell division|mitosis	spindle pole	ATP binding|ATP-dependent helicase activity|calcium ion binding|nucleic acid binding			upper_aerodigestive_tract(1)|ovary(1)	2						AACCCAGGAAGGAAGAGATGA	0.557													3	65	---	---	---	---	capture	Silent	SNP	580606	580606	CETN1	18	G	A	A	A	1	0	0	0	0	0	0	0	1	451	35	2	2	3242	245
MYOM1	8736	broad.mit.edu	37	18	3126851	3126851	+	Missense_Mutation	SNP	G	A	A			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:3126851G>A	uc002klp.2	-	19	3173	c.2839C>T	c.(2839-2841)CGT>TGT	p.R947C	MYOM1_uc002klq.2_Missense_Mutation_p.R851C	NM_003803	NP_003794	P52179	MYOM1_HUMAN	myomesin 1 isoform a	947	Fibronectin type-III 4.					striated muscle myosin thick filament	structural constituent of muscle			ovary(3)|central_nervous_system(1)|pancreas(1)	5						ATTGAGTCACGAAAACTTTCA	0.423													8	22	---	---	---	---	capture	Missense_Mutation	SNP	3126851	3126851	MYOM1	18	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	10001	245
DSC2	1824	broad.mit.edu	37	18	28659892	28659892	+	Missense_Mutation	SNP	T	A	A			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:28659892T>A	uc002kwl.3	-	11	2038	c.1584A>T	c.(1582-1584)AAA>AAT	p.K528N	DSC2_uc002kwk.3_Missense_Mutation_p.K528N	NM_024422	NP_077740	Q02487	DSC2_HUMAN	desmocollin 2 isoform Dsc2a preproprotein	528	Extracellular (Potential).|Cadherin 4.				homophilic cell adhesion	desmosome|integral to membrane	calcium ion binding			ovary(2)|skin(1)	3			OV - Ovarian serous cystadenocarcinoma(10;0.0241)			TTCTGAAAACTTTGATTGATC	0.343													146	236	---	---	---	---	capture	Missense_Mutation	SNP	28659892	28659892	DSC2	18	T	A	A	A	1	0	0	0	0	1	0	0	0	725	56	4	4	4721	245
TNFSF9	8744	broad.mit.edu	37	19	6531065	6531065	+	Silent	SNP	C	T	T			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:6531065C>T	uc002mfh.2	+	1	56	c.18C>T	c.(16-18)GAC>GAT	p.D6D		NM_003811	NP_003802	P41273	TNFL9_HUMAN	tumor necrosis factor (ligand) superfamily,	6	Cytoplasmic (Potential).				apoptosis|cell proliferation|cell-cell signaling|immune response|signal transduction	extracellular space|integral to membrane	cytokine activity|tumor necrosis factor receptor binding			central_nervous_system(1)	1						ACGCCTCTGACGCTTCACTGG	0.632													85	34	---	---	---	---	capture	Silent	SNP	6531065	6531065	TNFSF9	19	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	16195	245
FBN3	84467	broad.mit.edu	37	19	8200953	8200953	+	Missense_Mutation	SNP	C	G	G			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:8200953C>G	uc002mjf.2	-	12	1504	c.1483G>C	c.(1483-1485)GTC>CTC	p.V495L		NM_032447	NP_115823	Q75N90	FBN3_HUMAN	fibrillin 3 precursor	495	EGF-like 5; calcium-binding.					proteinaceous extracellular matrix	calcium ion binding|extracellular matrix structural constituent			ovary(6)|skin(3)|pancreas(1)|central_nervous_system(1)	11						CCACCACTGACAATGCACTCG	0.612													2	42	---	---	---	---	capture	Missense_Mutation	SNP	8200953	8200953	FBN3	19	C	G	G	G	1	0	0	0	0	1	0	0	0	221	17	4	4	5650	245
WDR83	84292	broad.mit.edu	37	19	12779320	12779320	+	Splice_Site	SNP	A	G	G			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:12779320A>G	uc002mue.3	+	2	180	c.-155_splice	c.e2-2		MAN2B1_uc002mub.2_5'Flank|MAN2B1_uc010dyv.1_5'Flank|WDR83_uc002muc.2_Splice_Site|C19orf56_uc002mud.2_Intron|WDR83_uc010dyw.2_5'Flank	NM_001099737	NP_001093207	Q9BRX9	WDR83_HUMAN	mitogen-activated protein kinase organizer 1						nuclear mRNA splicing, via spliceosome	catalytic step 2 spliceosome|cytoplasm				lung(1)|breast(1)	2						CTTGTTCTGTAGGGCAAGTCT	0.557													2	48	---	---	---	---	capture	Splice_Site	SNP	12779320	12779320	WDR83	19	A	G	G	G	1	0	0	0	0	0	0	1	0	195	15	5	3	17213	245
MYO9B	4650	broad.mit.edu	37	19	17308666	17308666	+	Missense_Mutation	SNP	A	G	G			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:17308666A>G	uc010eak.2	+	23	4264	c.4112A>G	c.(4111-4113)CAG>CGG	p.Q1371R	MYO9B_uc002nfi.2_Missense_Mutation_p.Q1371R|MYO9B_uc002nfj.1_Missense_Mutation_p.Q1371R|MYO9B_uc002nfl.1_5'Flank	NM_004145	NP_004136	Q13459	MYO9B_HUMAN	myosin IXB isoform 1	1371	Tail.				actin filament-based movement	cell cortex|cytosol|filamentous actin|myosin complex|perinuclear region of cytoplasm	actin binding|ADP binding|ATP binding|ATPase activity|calmodulin binding|metal ion binding|microfilament motor activity|Rho GTPase activator activity			breast(1)	1						GCCAAGGCTCAGGTAACAAca	0.308													3	134	---	---	---	---	capture	Missense_Mutation	SNP	17308666	17308666	MYO9B	19	A	G	G	G	1	0	0	0	0	1	0	0	0	91	7	3	3	9995	245
ZFP30	22835	broad.mit.edu	37	19	38127033	38127033	+	Missense_Mutation	SNP	G	A	A			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:38127033G>A	uc002ogv.1	-	6	925	c.409C>T	c.(409-411)CCT>TCT	p.P137S	ZFP30_uc002ogw.1_Missense_Mutation_p.P137S|ZFP30_uc002ogx.1_Missense_Mutation_p.P137S|ZFP30_uc010xtt.1_Missense_Mutation_p.P136S	NM_014898	NP_055713	Q9Y2G7	ZFP30_HUMAN	zinc finger protein 30 homolog	137					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			CTGTAAGTAGGCATTTTTTCA	0.408													5	223	---	---	---	---	capture	Missense_Mutation	SNP	38127033	38127033	ZFP30	19	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	17524	245
CEACAM4	1089	broad.mit.edu	37	19	42133314	42133314	+	Silent	SNP	G	A	A			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:42133314G>A	uc002orh.1	-	1	129	c.18C>T	c.(16-18)GCC>GCT	p.A6A	CEACAM4_uc010xwd.1_Silent_p.A6A	NM_001817	NP_001808	O75871	CEAM4_HUMAN	carcinoembryonic antigen-related cell adhesion	6						integral to plasma membrane|membrane fraction					0						CACGGGGAGCGGCTGAGGGGG	0.652													22	19	---	---	---	---	capture	Silent	SNP	42133314	42133314	CEACAM4	19	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	3163	245
CLPTM1	1209	broad.mit.edu	37	19	45476426	45476426	+	Missense_Mutation	SNP	C	T	T			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:45476426C>T	uc002pai.2	+	3	283	c.268C>T	c.(268-270)CGC>TGC	p.R90C	CLPTM1_uc010ejv.1_Translation_Start_Site|CLPTM1_uc010xxf.1_Translation_Start_Site|CLPTM1_uc010xxg.1_Missense_Mutation_p.R76C	NM_001294	NP_001285	O96005	CLPT1_HUMAN	cleft lip and palate associated transmembrane	90	Extracellular (Potential).				cell differentiation|multicellular organismal development|regulation of T cell differentiation in thymus	external side of plasma membrane|integral to plasma membrane				ovary(1)	1		all_neural(266;0.224)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00354)|Epithelial(262;0.187)		AGGAGCTCCACGCGTCGCCAG	0.627													3	57	---	---	---	---	capture	Missense_Mutation	SNP	45476426	45476426	CLPTM1	19	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	3519	245
LILRA5	353514	broad.mit.edu	37	19	54823150	54823150	+	Silent	SNP	C	T	T			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:54823150C>T	uc002qfe.2	-	4	513	c.393G>A	c.(391-393)CTG>CTA	p.L131L	LILRA5_uc002qff.2_Silent_p.L119L|LILRA5_uc010yev.1_Silent_p.L131L|LILRA5_uc010yew.1_Silent_p.L119L|LILRA5_uc002qfh.1_Silent_p.L119L|LILRA5_uc002qfg.1_Silent_p.L131L	NM_021250	NP_067073	A6NI73	LIRA5_HUMAN	leukocyte immunoglobulin-like receptor subfamily	131	Extracellular (Potential).|Ig-like C2-type 1.				innate immune response	extracellular region|integral to membrane	receptor activity			upper_aerodigestive_tract(1)	1	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		CCACCAGCTCCAGGGGGTCGC	0.622													3	184	---	---	---	---	capture	Silent	SNP	54823150	54823150	LILRA5	19	C	T	T	T	1	0	0	0	0	0	0	0	1	262	21	2	2	8708	245
NLRP13	126204	broad.mit.edu	37	19	56422072	56422072	+	Silent	SNP	G	A	A			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:56422072G>A	uc010ygg.1	-	6	2164	c.2139C>T	c.(2137-2139)CAC>CAT	p.H713H		NM_176810	NP_789780	Q86W25	NAL13_HUMAN	NACHT, leucine rich repeat and PYD containing	713							ATP binding			skin(4)|ovary(3)|pancreas(1)|lung(1)	9		Colorectal(82;3.48e-05)|Ovarian(87;0.0481)|Renal(1328;0.218)		GBM - Glioblastoma multiforme(193;0.0642)		TGTTCCATGCGTGCATCCTGG	0.463													27	169	---	---	---	---	capture	Silent	SNP	56422072	56422072	NLRP13	19	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	10382	245
CAD	790	broad.mit.edu	37	2	27449783	27449783	+	Missense_Mutation	SNP	A	G	G			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:27449783A>G	uc002rji.2	+	15	2402	c.2240A>G	c.(2239-2241)AAG>AGG	p.K747R	CAD_uc010eyw.2_Missense_Mutation_p.K684R	NM_004341	NP_004332	P27708	PYR1_HUMAN	carbamoylphosphate synthetase 2/aspartate	747	CPSase (Carbamoyl-phosphate synthase).|CPSase A.				'de novo' pyrimidine base biosynthetic process|drug metabolic process|glutamine metabolic process|peptidyl-threonine phosphorylation|protein autophosphorylation|pyrimidine nucleoside biosynthetic process|pyrimidine nucleotide biosynthetic process	cytosol|neuronal cell body|nuclear matrix|terminal button	aspartate binding|aspartate carbamoyltransferase activity|ATP binding|carbamoyl-phosphate synthase (glutamine-hydrolyzing) activity|dihydroorotase activity|enzyme binding|identical protein binding|metal ion binding|protein kinase activity			ovary(4)|large_intestine(2)|kidney(2)|lung(1)|pancreas(1)	10	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				L-Aspartic Acid(DB00128)|L-Glutamine(DB00130)	GACCTTAGCAAGTTCCTGCGA	0.562													104	182	---	---	---	---	capture	Missense_Mutation	SNP	27449783	27449783	CAD	2	A	G	G	G	1	0	0	0	0	1	0	0	0	39	3	3	3	2541	245
DPP10	57628	broad.mit.edu	37	2	116548668	116548668	+	Missense_Mutation	SNP	T	A	A			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:116548668T>A	uc002tla.1	+	18	2000	c.1543T>A	c.(1543-1545)TTG>ATG	p.L515M	DPP10_uc002tlb.1_Missense_Mutation_p.L465M|DPP10_uc002tlc.1_Missense_Mutation_p.L511M|DPP10_uc002tle.2_Missense_Mutation_p.L519M|DPP10_uc002tlf.1_Missense_Mutation_p.L508M	NM_020868	NP_065919	Q8N608	DPP10_HUMAN	dipeptidyl peptidase 10 isoform long	515	Extracellular (Potential).				proteolysis	integral to membrane|membrane fraction	serine-type peptidase activity			ovary(5)|large_intestine(2)|skin(2)|breast(1)	10						ATATTTTATATTGGAAAGCAA	0.303													23	52	---	---	---	---	capture	Missense_Mutation	SNP	116548668	116548668	DPP10	2	T	A	A	A	1	0	0	0	0	1	0	0	0	673	52	4	4	4682	245
YSK4	80122	broad.mit.edu	37	2	135744775	135744775	+	Missense_Mutation	SNP	G	A	A			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:135744775G>A	uc002tue.1	-	7	1698	c.1667C>T	c.(1666-1668)ACT>ATT	p.T556I	YSK4_uc002tuf.1_Intron|YSK4_uc010fnc.1_Intron|YSK4_uc010fnd.1_Missense_Mutation_p.T443I|YSK4_uc010zbg.1_Intron|YSK4_uc002tuh.3_Missense_Mutation_p.T284I|YSK4_uc002tui.3_Missense_Mutation_p.T573I	NM_025052	NP_079328	Q56UN5	YSK4_HUMAN	Yeast Sps1/Ste20-related kinase 4 isoform 1	556							ATP binding|protein serine/threonine kinase activity			stomach(2)|urinary_tract(1)|ovary(1)|breast(1)	5				BRCA - Breast invasive adenocarcinoma(221;0.112)		GGGACCTTCAGTAGAAATCAC	0.428													138	144	---	---	---	---	capture	Missense_Mutation	SNP	135744775	135744775	YSK4	2	G	A	A	A	1	0	0	0	0	1	0	0	0	468	36	2	2	17376	245
FAP	2191	broad.mit.edu	37	2	163055364	163055365	+	Missense_Mutation	DNP	GC	AA	AA			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:163055364_163055365GC>AA	uc002ucd.2	-	16	1512_1513	c.1304_1305GC>TT	c.(1303-1305)AGC>ATT	p.S435I	FAP_uc010fpc.2_5'UTR|FAP_uc010zct.1_Missense_Mutation_p.S410I|FAP_uc010fpd.2_5'UTR	NM_004460	NP_004451	Q12884	SEPR_HUMAN	fibroblast activation protein, alpha subunit	435	Extracellular (Potential).				endothelial cell migration|negative regulation of extracellular matrix disassembly|proteolysis	cell junction|integral to membrane|invadopodium membrane|lamellipodium membrane	dipeptidyl-peptidase activity|metalloendopeptidase activity|protein homodimerization activity|serine-type endopeptidase activity			ovary(3)	3						CACACTTCTTGCTTGGAGGATA	0.371													12	71	---	---	---	---	capture	Missense_Mutation	DNP	163055364	163055365	FAP	2	GC	AA	AA	AA	1	0	0	0	0	1	0	0	0	594	46	2	2	5619	245
TTN	7273	broad.mit.edu	37	2	179421857	179421857	+	Missense_Mutation	SNP	C	T	T			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179421857C>T	uc010zfg.1	-	279	80544	c.80320G>A	c.(80320-80322)GTT>ATT	p.V26774I	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.V20469I|TTN_uc010zfi.1_Missense_Mutation_p.V20402I|TTN_uc010zfj.1_Missense_Mutation_p.V20277I	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	27701							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GTGATACGAACATTTCTTGGG	0.403													29	29	---	---	---	---	capture	Missense_Mutation	SNP	179421857	179421857	TTN	2	C	T	T	T	1	0	0	0	0	1	0	0	0	221	17	2	2	16617	245
TTN	7273	broad.mit.edu	37	2	179483569	179483569	+	Missense_Mutation	SNP	T	A	A			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179483569T>A	uc010zfg.1	-	200	39228	c.39004A>T	c.(39004-39006)ATC>TTC	p.I13002F	TTN_uc010zfh.1_Missense_Mutation_p.I6697F|TTN_uc010zfi.1_Missense_Mutation_p.I6630F|TTN_uc010zfj.1_Missense_Mutation_p.I6505F	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	13929							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GCTGTCTTGATTTTTGGTGCA	0.408													12	15	---	---	---	---	capture	Missense_Mutation	SNP	179483569	179483569	TTN	2	T	A	A	A	1	0	0	0	0	1	0	0	0	676	52	4	4	16617	245
TTN	7273	broad.mit.edu	37	2	179485012	179485012	+	Silent	SNP	G	A	A			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179485012G>A	uc010zfg.1	-	197	38756	c.38532C>T	c.(38530-38532)TGC>TGT	p.C12844C	TTN_uc010zfh.1_Silent_p.C6539C|TTN_uc010zfi.1_Silent_p.C6472C|TTN_uc010zfj.1_Silent_p.C6347C	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	13771							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGGAGAGCTGGCAGGAGAAGA	0.418													4	190	---	---	---	---	capture	Silent	SNP	179485012	179485012	TTN	2	G	A	A	A	1	0	0	0	0	0	0	0	1	542	42	2	2	16617	245
CPXM1	56265	broad.mit.edu	37	20	2776322	2776322	+	Missense_Mutation	SNP	C	T	T			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:2776322C>T	uc002wgu.2	-	11	1707	c.1643G>A	c.(1642-1644)CGC>CAC	p.R548H	CPXM1_uc010gas.2_Intron	NM_019609	NP_062555	Q96SM3	CPXM1_HUMAN	carboxypeptidase X, member 1 precursor	548					cell adhesion|proteolysis		metallocarboxypeptidase activity|zinc ion binding			ovary(2)|skin(2)	4						GCAGGGTCGGCGGCTGGTGTC	0.622													21	58	---	---	---	---	capture	Missense_Mutation	SNP	2776322	2776322	CPXM1	20	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	3802	245
ProSAPiP1	9762	broad.mit.edu	37	20	3146165	3146165	+	Missense_Mutation	SNP	C	T	T			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:3146165C>T	uc002wia.1	-	2	2699	c.1301G>A	c.(1300-1302)CGG>CAG	p.R434Q	ProSAPiP1_uc002wib.1_Missense_Mutation_p.R388Q	NM_014731	NP_055546	O60299	PRIP1_HUMAN	ProSAPiP1 protein	434	Potential.					cell junction|cytoplasm|postsynaptic density|postsynaptic membrane				pancreas(1)	1						TTCCTCTATCCGGGGCAGGAA	0.662													32	82	---	---	---	---	capture	Missense_Mutation	SNP	3146165	3146165	ProSAPiP1	20	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	12765	245
CRLS1	54675	broad.mit.edu	37	20	5996124	5996124	+	Missense_Mutation	SNP	G	T	T			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:5996124G>T	uc002wmn.3	+	3	716	c.562G>T	c.(562-564)GAT>TAT	p.D188Y	CRLS1_uc010gbq.2_RNA|CRLS1_uc010gbr.2_Missense_Mutation_p.D89Y|CRLS1_uc010gbs.1_Missense_Mutation_p.D77Y	NM_019095	NP_061968	Q9UJA2	CRLS1_HUMAN	cardiolipin synthase 1 isoform 1	188					phospholipid biosynthetic process	integral to membrane|mitochondrial inner membrane	phosphotransferase activity, for other substituted phosphate groups				0						GACCTATGCAGATCTTATTCC	0.383													21	103	---	---	---	---	capture	Missense_Mutation	SNP	5996124	5996124	CRLS1	20	G	T	T	T	1	0	0	0	0	1	0	0	0	429	33	4	4	3854	245
SALL4	57167	broad.mit.edu	37	20	50401201	50401201	+	Missense_Mutation	SNP	G	A	A			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:50401201G>A	uc002xwh.3	-	4	2866	c.2765C>T	c.(2764-2766)GCG>GTG	p.A922V	SALL4_uc010gii.2_Missense_Mutation_p.A485V|SALL4_uc002xwi.3_Missense_Mutation_p.A145V	NM_020436	NP_065169	Q9UJQ4	SALL4_HUMAN	sal-like 4	922					transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2						GTTATTGTTCGCCCCGTGTGT	0.468													51	125	---	---	---	---	capture	Missense_Mutation	SNP	50401201	50401201	SALL4	20	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	13705	245
LZTR1	8216	broad.mit.edu	37	22	21345975	21345975	+	Missense_Mutation	SNP	C	A	A			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:21345975C>A	uc002zto.2	+	9	953	c.850C>A	c.(850-852)CGC>AGC	p.R284S	LZTR1_uc002ztn.2_Missense_Mutation_p.R243S|LZTR1_uc011ahy.1_Missense_Mutation_p.R265S|LZTR1_uc010gsr.1_Missense_Mutation_p.R155S	NM_006767	NP_006758	Q8N653	LZTR1_HUMAN	leucine-zipper-like transcription regulator 1	284	Kelch 4.				anatomical structure morphogenesis		sequence-specific DNA binding transcription factor activity			ovary(2)|lung(2)	4	all_cancers(11;1.83e-25)|all_epithelial(7;9.19e-23)|Lung NSC(8;3.06e-15)|all_lung(8;5.05e-14)|Melanoma(16;0.000465)|Ovarian(15;0.0028)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000204)|Lung(15;0.00494)|Epithelial(17;0.195)			CCCGCAGCGGCGCTACGGGCA	0.632													8	4	---	---	---	---	capture	Missense_Mutation	SNP	21345975	21345975	LZTR1	22	C	A	A	A	1	0	0	0	0	1	0	0	0	351	27	4	4	9052	245
FGD5	152273	broad.mit.edu	37	3	14861995	14861995	+	Missense_Mutation	SNP	G	A	A			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:14861995G>A	uc003bzc.2	+	1	1527	c.1417G>A	c.(1417-1419)GCG>ACG	p.A473T	FGD5_uc011avk.1_Missense_Mutation_p.A473T	NM_152536	NP_689749	Q6ZNL6	FGD5_HUMAN	FYVE, RhoGEF and PH domain containing 5	473					actin cytoskeleton organization|filopodium assembly|regulation of Cdc42 GTPase activity|regulation of cell shape	cytoskeleton|Golgi apparatus|lamellipodium|ruffle	metal ion binding|Rho guanyl-nucleotide exchange factor activity|small GTPase binding			ovary(3)|kidney(1)|pancreas(1)	5						CCTGGTTCCCGCGGACAGGAA	0.642													22	64	---	---	---	---	capture	Missense_Mutation	SNP	14861995	14861995	FGD5	3	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	5782	245
ZBED2	79413	broad.mit.edu	37	3	111312849	111312849	+	Missense_Mutation	SNP	C	T	T			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:111312849C>T	uc003dxy.2	-	2	1085	c.200G>A	c.(199-201)CGT>CAT	p.R67H	CD96_uc003dxv.2_Intron|CD96_uc003dxw.2_Intron|CD96_uc003dxx.2_Intron|CD96_uc010hpy.1_Intron	NM_024508	NP_078784	Q9BTP6	ZBED2_HUMAN	zinc finger, BED domain containing 2	67	BED-type.						DNA binding|metal ion binding			skin(1)	1						GTGCCCAGCACGAGCAGGAGC	0.612													28	89	---	---	---	---	capture	Missense_Mutation	SNP	111312849	111312849	ZBED2	3	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	17399	245
MFI2	4241	broad.mit.edu	37	3	196735736	196735736	+	Silent	SNP	G	C	C			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:196735736G>C	uc003fxk.3	-	12	1739	c.1626C>G	c.(1624-1626)CGC>CGG	p.R542R		NM_005929	NP_005920	P08582	TRFM_HUMAN	melanoma-associated antigen p97 isoform 1	542	Transferrin-like 2.				cellular iron ion homeostasis|iron ion transport	anchored to membrane|extracellular region|integral to plasma membrane	ferric iron binding|protein binding				0	all_cancers(143;3.95e-09)|Ovarian(172;0.0634)|Breast(254;0.0838)		Epithelial(36;4.55e-24)|all cancers(36;2.87e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.76e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00536)		CACACTTGTTGCGGCCCTGCT	0.642													4	152	---	---	---	---	capture	Silent	SNP	196735736	196735736	MFI2	3	G	C	C	C	1	0	0	0	0	0	0	0	1	587	46	4	4	9434	245
ARAP2	116984	broad.mit.edu	37	4	36231022	36231022	+	Missense_Mutation	SNP	C	G	G			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:36231022C>G	uc003gsq.1	-	2	425	c.87G>C	c.(85-87)GAG>GAC	p.E29D	ARAP2_uc003gsr.1_Missense_Mutation_p.E29D	NM_015230	NP_056045	Q8WZ64	ARAP2_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH	29	SAM.				regulation of ARF GTPase activity|small GTPase mediated signal transduction	cytosol	ARF GTPase activator activity|phosphatidylinositol-3,4,5-trisphosphate binding|zinc ion binding			ovary(1)|pancreas(1)|skin(1)	3						TAAAACCAGACTCATGGAAAT	0.393													57	195	---	---	---	---	capture	Missense_Mutation	SNP	36231022	36231022	ARAP2	4	C	G	G	G	1	0	0	0	0	1	0	0	0	259	20	4	4	832	245
RBM47	54502	broad.mit.edu	37	4	40440160	40440160	+	Missense_Mutation	SNP	G	A	A			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:40440160G>A	uc003gvc.2	-	4	1461	c.751C>T	c.(751-753)CGC>TGC	p.R251C	RBM47_uc003gvd.2_Missense_Mutation_p.R251C|RBM47_uc003gve.2_RNA|RBM47_uc011bys.1_Missense_Mutation_p.R213C|RBM47_uc003gvg.1_Missense_Mutation_p.R251C	NM_001098634	NP_001092104	A0AV96	RBM47_HUMAN	RNA binding motif protein 47 isoform a	251	RRM 3.					nucleus	nucleotide binding|RNA binding			breast(3)	3						ATGAGGTTGCGCACGTAGAGG	0.617													54	147	---	---	---	---	capture	Missense_Mutation	SNP	40440160	40440160	RBM47	4	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	13036	245
UBA6	55236	broad.mit.edu	37	4	68543331	68543331	+	Missense_Mutation	SNP	G	T	T			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:68543331G>T	uc003hdg.3	-	6	515	c.463C>A	c.(463-465)CAG>AAG	p.Q155K	UBA6_uc003hdi.2_Missense_Mutation_p.Q155K|UBA6_uc003hdj.2_Missense_Mutation_p.Q155K	NM_018227	NP_060697	A0AVT1	UBA6_HUMAN	ubiquitin-activating enzyme E1-like 2	155					protein ubiquitination|ubiquitin-dependent protein catabolic process	cytoplasm	ATP binding|FAT10 activating enzyme activity|ligase activity|protein binding				0						GTACTAACCTGGTATTTATCT	0.308													58	121	---	---	---	---	capture	Missense_Mutation	SNP	68543331	68543331	UBA6	4	G	T	T	T	1	0	0	0	0	1	0	0	0	611	47	4	4	16714	245
PTPN13	5783	broad.mit.edu	37	4	87671855	87671855	+	Silent	SNP	A	G	G			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:87671855A>G	uc003hpz.2	+	18	3363	c.2883A>G	c.(2881-2883)GAA>GAG	p.E961E	PTPN13_uc003hpy.2_Silent_p.E961E|PTPN13_uc003hqa.2_Silent_p.E961E|PTPN13_uc003hqb.2_Intron	NM_080683	NP_542414	Q12923	PTN13_HUMAN	protein tyrosine phosphatase, non-receptor type	961						cytoplasm|cytoskeleton|plasma membrane	protein binding|protein binding|protein tyrosine phosphatase activity			ovary(4)|breast(1)|kidney(1)	6		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.00082)		CATGGGAGGAAAAGCCTAGAG	0.438													20	46	---	---	---	---	capture	Silent	SNP	87671855	87671855	PTPN13	4	A	G	G	G	1	0	0	0	0	0	0	0	1	11	1	3	3	12677	245
CCNA2	890	broad.mit.edu	37	4	122744710	122744710	+	Missense_Mutation	SNP	G	A	A			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:122744710G>A	uc003iec.3	-	1	379	c.74C>T	c.(73-75)GCG>GTG	p.A25V		NM_001237	NP_001228	P20248	CCNA2_HUMAN	cyclin A	25					cell division|mitosis|mitotic cell cycle G2/M transition DNA damage checkpoint|Ras protein signal transduction|regulation of cyclin-dependent protein kinase activity	cytoplasm|nucleoplasm	protein kinase binding			ovary(1)	1						CTCTTGGAGCGCCGTCTGCTG	0.692													3	26	---	---	---	---	capture	Missense_Mutation	SNP	122744710	122744710	CCNA2	4	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	2881	245
SMARCA5	8467	broad.mit.edu	37	4	144461639	144461639	+	Missense_Mutation	SNP	A	T	T			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:144461639A>T	uc003ijg.2	+	14	2356	c.1894A>T	c.(1894-1896)ATT>TTT	p.I632F		NM_003601	NP_003592	O60264	SMCA5_HUMAN	SWI/SNF-related matrix-associated	632	Helicase C-terminal.				CenH3-containing nucleosome assembly at centromere|nucleosome positioning|regulation of transcription from RNA polymerase II promoter|transcription initiation, DNA-dependent	condensed chromosome|nucleolus|nucleoplasm|NURF complex|RSF complex	ATP binding|ATPase activity|DNA binding|helicase activity|nucleosome binding|protein binding			skin(1)	1	all_hematologic(180;0.158)					TTCAATAGTCATTCAACAAGG	0.363													73	105	---	---	---	---	capture	Missense_Mutation	SNP	144461639	144461639	SMARCA5	4	A	T	T	T	1	0	0	0	0	1	0	0	0	104	8	4	4	14663	245
C4orf45	152940	broad.mit.edu	37	4	159881481	159881481	+	Missense_Mutation	SNP	G	T	T			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:159881481G>T	uc003iqf.1	-	3	398	c.313C>A	c.(313-315)CAA>AAA	p.Q105K	C4orf45_uc010iqt.1_Intron	NM_152543	NP_689756	Q96LM5	CD045_HUMAN	hypothetical protein LOC152940	105											0						AGAGAAGCTTGACTTAGTTCT	0.308													5	30	---	---	---	---	capture	Missense_Mutation	SNP	159881481	159881481	C4orf45	4	G	T	T	T	1	0	0	0	0	1	0	0	0	585	45	4	4	2251	245
PLEKHG4B	153478	broad.mit.edu	37	5	140833	140833	+	Splice_Site	SNP	T	G	G			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140833T>G	uc003jak.2	+	1	459	c.409_splice	c.e1+2	p.D137_splice		NM_052909	NP_443141	Q96PX9	PKH4B_HUMAN	pleckstrin homology domain containing, family G						regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity			skin(2)	2			all cancers(22;0.0253)|Lung(60;0.113)	Kidney(1;0.119)		AAGAGGAAGGTAAATGCTCCC	0.552													10	31	---	---	---	---	capture	Splice_Site	SNP	140833	140833	PLEKHG4B	5	T	G	G	G	1	0	0	0	0	0	0	1	0	741	57	5	4	11975	245
CTNND2	1501	broad.mit.edu	37	5	11199757	11199757	+	Missense_Mutation	SNP	C	T	T			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:11199757C>T	uc003jfa.1	-	11	1923	c.1778G>A	c.(1777-1779)GGC>GAC	p.G593D	CTNND2_uc010itt.2_Missense_Mutation_p.G502D|CTNND2_uc011cmy.1_Missense_Mutation_p.G256D|CTNND2_uc011cmz.1_Missense_Mutation_p.G160D|CTNND2_uc010itu.1_RNA|CTNND2_uc011cmx.1_Missense_Mutation_p.G160D	NM_001332	NP_001323	Q9UQB3	CTND2_HUMAN	catenin (cadherin-associated protein), delta 2	593	ARM 3.				multicellular organismal development|neuron cell-cell adhesion|regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	adherens junction|cytoplasm|nucleus	protein binding			large_intestine(2)|ovary(2)|skin(2)|pancreas(1)|lung(1)	8						GAGCTGGATGCCTCCTTGTCT	0.473													58	100	---	---	---	---	capture	Missense_Mutation	SNP	11199757	11199757	CTNND2	5	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	3983	245
PTGER4	5734	broad.mit.edu	37	5	40681332	40681332	+	Silent	SNP	G	A	A			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:40681332G>A	uc003jlz.2	+	2	829	c.237G>A	c.(235-237)ACG>ACA	p.T79T		NM_000958	NP_000949	P35408	PE2R4_HUMAN	prostaglandin E receptor 4, subtype EP4	79	Helical; Name=2; (Potential).				G-protein signaling, coupled to cAMP nucleotide second messenger|immune response	integral to membrane|plasma membrane	prostaglandin E receptor activity			lung(2)	2						CCATCGCCACGTACATGAAGG	0.607											OREG0016588	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	70	139	---	---	---	---	capture	Silent	SNP	40681332	40681332	PTGER4	5	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	12640	245
THBS4	7060	broad.mit.edu	37	5	79373950	79373950	+	Missense_Mutation	SNP	A	G	G			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:79373950A>G	uc003kgh.2	+	18	2488	c.2165A>G	c.(2164-2166)AAC>AGC	p.N722S	uc003kgi.3_Intron	NM_003248	NP_003239	P35443	TSP4_HUMAN	thrombospondin 4 precursor	722	TSP type-3 8.				endothelial cell-cell adhesion|myoblast migration|negative regulation of angiogenesis|positive regulation of endothelial cell proliferation|positive regulation of neutrophil chemotaxis|positive regulation of peptidyl-tyrosine phosphorylation	basement membrane|extracellular space	calcium ion binding|heparin binding|integrin binding|structural molecule activity				0		Lung NSC(167;0.00328)|all_lung(232;0.00355)|Ovarian(174;0.0261)		OV - Ovarian serous cystadenocarcinoma(54;6.3e-45)|Epithelial(54;1.77e-39)|all cancers(79;3.2e-34)		TGCCCAGAGAACGCAGAGGTC	0.592													2	32	---	---	---	---	capture	Missense_Mutation	SNP	79373950	79373950	THBS4	5	A	G	G	G	1	0	0	0	0	1	0	0	0	26	2	3	3	15741	245
GPR98	84059	broad.mit.edu	37	5	90021005	90021005	+	Missense_Mutation	SNP	C	A	A			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:90021005C>A	uc003kju.2	+	47	10105	c.10009C>A	c.(10009-10011)CTT>ATT	p.L3337I	GPR98_uc003kjt.2_Missense_Mutation_p.L1043I|GPR98_uc003kjv.2_Missense_Mutation_p.L937I	NM_032119	NP_115495	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98 precursor	3337	Extracellular (Potential).|EAR 2.				cell communication|cell-cell adhesion|maintenance of organ identity|neuropeptide signaling pathway|photoreceptor cell maintenance	cell surface|cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(11)|central_nervous_system(3)|pancreas(2)	16		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		AAAGCCTTCTCTTAACAGTGT	0.264													3	22	---	---	---	---	capture	Missense_Mutation	SNP	90021005	90021005	GPR98	5	C	A	A	A	1	0	0	0	0	1	0	0	0	416	32	4	4	6654	245
PCDHB1	29930	broad.mit.edu	37	5	140432384	140432384	+	Silent	SNP	C	T	T			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140432384C>T	uc003lik.1	+	1	1406	c.1329C>T	c.(1327-1329)TCC>TCT	p.S443S		NM_013340	NP_037472	Q9Y5F3	PCDB1_HUMAN	protocadherin beta 1 precursor	443	Cadherin 4.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TGCTAATATCCGACGTTAATG	0.448													120	120	---	---	---	---	capture	Silent	SNP	140432384	140432384	PCDHB1	5	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	11437	245
FAM71B	153745	broad.mit.edu	37	5	156589852	156589852	+	Missense_Mutation	SNP	T	C	C			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:156589852T>C	uc003lwn.2	-	2	1524	c.1424A>G	c.(1423-1425)AAC>AGC	p.N475S		NM_130899	NP_570969	Q8TC56	FA71B_HUMAN	family with sequence similarity 71, member B	475						nucleus				ovary(4)|pancreas(1)|skin(1)	6	Renal(175;0.00212)	Medulloblastoma(196;0.0523)|all_neural(177;0.21)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			ATCTCTCGTGTTTTTATGGCC	0.527													82	279	---	---	---	---	capture	Missense_Mutation	SNP	156589852	156589852	FAM71B	5	T	C	C	C	1	0	0	0	0	1	0	0	0	780	60	3	3	5556	245
GABRA6	2559	broad.mit.edu	37	5	161128598	161128598	+	Missense_Mutation	SNP	C	T	T			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:161128598C>T	uc003lyu.2	+	9	1519	c.1181C>T	c.(1180-1182)GCG>GTG	p.A394V	GABRA6_uc003lyv.2_Missense_Mutation_p.A165V	NM_000811	NP_000802	Q16445	GBRA6_HUMAN	gamma-aminobutyric acid A receptor, alpha 6	394	Cytoplasmic (Probable).				gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity			ovary(7)|skin(3)|large_intestine(1)|central_nervous_system(1)	12	Renal(175;0.00259)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		Alprazolam(DB00404)|Ethchlorvynol(DB00189)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Lorazepam(DB00186)|Meprobamate(DB00371)|Midazolam(DB00683)	CTCACGAGAGCGCCCATCTTA	0.473										TCGA Ovarian(5;0.080)			96	99	---	---	---	---	capture	Missense_Mutation	SNP	161128598	161128598	GABRA6	5	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	6107	245
MDC1	9656	broad.mit.edu	37	6	30675376	30675376	+	Nonsense_Mutation	SNP	C	A	A			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:30675376C>A	uc003nrg.3	-	8	3420	c.2980G>T	c.(2980-2982)GGA>TGA	p.G994*	MDC1_uc003nrf.3_Intron|MDC1_uc011dmp.1_Intron	NM_014641	NP_055456	Q14676	MDC1_HUMAN	mediator of DNA-damage checkpoint 1	994				Missing (in Ref. 2; CAH18685).	cell cycle|double-strand break repair via homologous recombination|intra-S DNA damage checkpoint	focal adhesion|nucleoplasm	FHA domain binding|protein C-terminus binding			breast(2)|ovary(1)|kidney(1)	4						ACTGGGGATCCCCTTCCACCT	0.637								Other_conserved_DNA_damage_response_genes					4	178	---	---	---	---	capture	Nonsense_Mutation	SNP	30675376	30675376	MDC1	6	C	A	A	A	1	0	0	0	0	0	1	0	0	286	22	5	4	9316	245
DST	667	broad.mit.edu	37	6	56476386	56476386	+	Silent	SNP	A	G	G			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:56476386A>G	uc003pdf.2	-	37	4996	c.4968T>C	c.(4966-4968)AGT>AGC	p.S1656S	DST_uc003pcz.3_Silent_p.S1478S|DST_uc011dxj.1_Silent_p.S1507S|DST_uc011dxk.1_Silent_p.S1518S|DST_uc003pcy.3_Silent_p.S1152S|DST_uc003pdb.2_Silent_p.S1152S	NM_001144769	NP_001138241	Q03001	DYST_HUMAN	dystonin isoform 2	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					cell adhesion|cell cycle arrest|cell motility|hemidesmosome assembly|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization|maintenance of cell polarity|microtubule cytoskeleton organization|response to wounding	actin cytoskeleton|axon|axon part|basement membrane|cell cortex|cell leading edge|cytoplasmic membrane-bounded vesicle|endoplasmic reticulum membrane|hemidesmosome|hemidesmosome|integral to membrane|intermediate filament|intermediate filament cytoskeleton|microtubule cytoskeleton|microtubule plus end|nuclear envelope|sarcomere|Z disc	actin binding|calcium ion binding|integrin binding|microtubule plus-end binding|protein binding|protein C-terminus binding|protein homodimerization activity			ovary(7)|central_nervous_system(6)|upper_aerodigestive_tract(1)	14	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			ATATTTCCTCACTGGAAATCT	0.333													2	50	---	---	---	---	capture	Silent	SNP	56476386	56476386	DST	6	A	G	G	G	1	0	0	0	0	0	0	0	1	76	6	3	3	4738	245
PTP4A1	7803	broad.mit.edu	37	6	64289185	64289185	+	Missense_Mutation	SNP	C	A	A			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:64289185C>A	uc003pek.2	+	7	1339	c.353C>A	c.(352-354)GCA>GAA	p.A118E	PTP4A1_uc003pel.2_Missense_Mutation_p.A118E	NM_003463	NP_003454	Q93096	TP4A1_HUMAN	protein tyrosine phosphatase type IVA, member 1	118	Tyrosine-protein phosphatase.|Interaction with ATF5 (By similarity).				cell cycle|multicellular organismal development	early endosome|endoplasmic reticulum|internal side of plasma membrane|spindle	protein binding|protein tyrosine phosphatase activity				0	all_cancers(3;0.071)|all_epithelial(2;0.0146)|Lung NSC(77;0.175)		Epithelial(2;0.0365)|LUSC - Lung squamous cell carcinoma(74;0.0644)|all cancers(2;0.112)|Lung(124;0.13)			GTTGCCCTAGCATTAATTGAA	0.328													4	152	---	---	---	---	capture	Missense_Mutation	SNP	64289185	64289185	PTP4A1	6	C	A	A	A	1	0	0	0	0	1	0	0	0	325	25	4	4	12665	245
C6orf182	285753	broad.mit.edu	37	6	109480497	109480497	+	Missense_Mutation	SNP	T	C	C			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:109480497T>C	uc010kdk.2	+	11	1425	c.848T>C	c.(847-849)ATC>ACC	p.I283T	C6orf182_uc003psx.3_Missense_Mutation_p.I283T|C6orf182_uc010kdl.2_Missense_Mutation_p.I283T|C6orf182_uc003psy.3_Missense_Mutation_p.I283T	NM_001083535	NP_001077004	Q8IYX8	CE57L_HUMAN	hypothetical protein LOC285753	283						microtubule|microtubule organizing center					0		all_cancers(87;4.45e-07)|Acute lymphoblastic leukemia(125;2.15e-10)|all_hematologic(75;3.25e-08)|all_epithelial(87;0.000254)|Colorectal(196;0.0293)|all_lung(197;0.11)		BRCA - Breast invasive adenocarcinoma(108;0.00123)|Epithelial(106;0.0022)|all cancers(137;0.00405)|OV - Ovarian serous cystadenocarcinoma(136;0.0233)		GACCCACATATCCTTCAGAAA	0.433													48	106	---	---	---	---	capture	Missense_Mutation	SNP	109480497	109480497	C6orf182	6	T	C	C	C	1	0	0	0	0	1	0	0	0	650	50	3	3	2323	245
C6orf170	221322	broad.mit.edu	37	6	121433663	121433663	+	Missense_Mutation	SNP	C	G	G			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:121433663C>G	uc003pyo.1	-	29	3380	c.3312G>C	c.(3310-3312)AGG>AGC	p.R1104S		NM_152730	NP_689943	Q96NH3	BROMI_HUMAN	hypothetical protein LOC221322	1104					multicellular organismal development	cilium|cytoplasm	Rab GTPase activator activity			central_nervous_system(2)|ovary(1)	3				GBM - Glioblastoma multiforme(226;0.00521)		AAATATGTAGCCTTGGCAACC	0.338													4	106	---	---	---	---	capture	Missense_Mutation	SNP	121433663	121433663	C6orf170	6	C	G	G	G	1	0	0	0	0	1	0	0	0	337	26	4	4	2321	245
GRM1	2911	broad.mit.edu	37	6	146708084	146708084	+	Missense_Mutation	SNP	A	T	T			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:146708084A>T	uc010khw.1	+	7	2131	c.1661A>T	c.(1660-1662)GAA>GTA	p.E554V	GRM1_uc010khv.1_Missense_Mutation_p.E554V|GRM1_uc003qll.2_Missense_Mutation_p.E554V|GRM1_uc011edz.1_Missense_Mutation_p.E554V|GRM1_uc011eea.1_Missense_Mutation_p.E554V	NM_000838	NP_000829	Q13255	GRM1_HUMAN	glutamate receptor, metabotropic 1 isoform alpha	554	Extracellular (Potential).				synaptic transmission	integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity			lung(8)|ovary(4)|central_nervous_system(3)|large_intestine(2)|breast(2)	19		Ovarian(120;0.0387)		OV - Ovarian serous cystadenocarcinoma(155;5.35e-08)|GBM - Glioblastoma multiforme(68;0.00762)	Acamprosate(DB00659)|L-Glutamic Acid(DB00142)	AAAGAGAATGAATATGTGCAA	0.438													33	144	---	---	---	---	capture	Missense_Mutation	SNP	146708084	146708084	GRM1	6	A	T	T	T	1	0	0	0	0	1	0	0	0	117	9	4	4	6729	245
PLEKHG1	57480	broad.mit.edu	37	6	151117039	151117039	+	Splice_Site	SNP	G	T	T			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:151117039G>T	uc003qny.1	+	6	941	c.629_splice	c.e6+1	p.R210_splice	PLEKHG1_uc011eel.1_Splice_Site_p.R250_splice|PLEKHG1_uc011eem.1_Splice_Site_p.R269_splice|PLEKHG1_uc003qnz.2_Splice_Site_p.R210_splice	NM_001029884	NP_001025055	Q9ULL1	PKHG1_HUMAN	pleckstrin homology domain containing, family G						regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity			ovary(2)	2			BRCA - Breast invasive adenocarcinoma(37;0.0923)	OV - Ovarian serous cystadenocarcinoma(155;6.69e-13)		ACTATCCAAGGTATGGATCGA	0.403													33	173	---	---	---	---	capture	Splice_Site	SNP	151117039	151117039	PLEKHG1	6	G	T	T	T	1	0	0	0	0	0	0	1	0	572	44	5	4	11971	245
SYNE1	23345	broad.mit.edu	37	6	152792795	152792795	+	Silent	SNP	C	T	T			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:152792795C>T	uc010kiw.2	-	16	2171	c.1569G>A	c.(1567-1569)CTG>CTA	p.L523L	SYNE1_uc003qot.3_Silent_p.L530L|SYNE1_uc003qou.3_Silent_p.L523L|SYNE1_uc010kjb.1_Silent_p.L506L|SYNE1_uc003qpa.1_Silent_p.L523L|SYNE1_uc003qox.1_Silent_p.L39L|SYNE1_uc003qoz.2_5'UTR|SYNE1_uc003qoy.2_Silent_p.L90L	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	523	Cytoplasmic (Potential).				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TCCAAGACTTCAGCTTTGACT	0.438										HNSCC(10;0.0054)			42	175	---	---	---	---	capture	Silent	SNP	152792795	152792795	SYNE1	6	C	T	T	T	1	0	0	0	0	0	0	0	1	366	29	2	2	15333	245
SLC29A4	222962	broad.mit.edu	37	7	5330388	5330388	+	Silent	SNP	C	T	T			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:5330388C>T	uc003sod.2	+	3	356	c.195C>T	c.(193-195)GAC>GAT	p.D65D	SLC29A4_uc011jwg.1_RNA|SLC29A4_uc003soc.2_Silent_p.D65D|SLC29A4_uc003soe.2_Silent_p.D65D	NM_153247	NP_694979	Q7RTT9	S29A4_HUMAN	solute carrier family 29 (nucleoside	65	Extracellular (Potential).				nucleobase, nucleoside and nucleotide metabolic process	apical plasma membrane|integral to membrane	nucleoside transmembrane transporter activity			liver(1)	1		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0903)|OV - Ovarian serous cystadenocarcinoma(56;2.65e-15)		TGCCCGATGACCGTTATCACG	0.587													9	111	---	---	---	---	capture	Silent	SNP	5330388	5330388	SLC29A4	7	C	T	T	T	1	0	0	0	0	0	0	0	1	233	18	2	2	14429	245
CPVL	54504	broad.mit.edu	37	7	29134756	29134756	+	Missense_Mutation	SNP	G	A	A			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:29134756G>A	uc003szv.2	-	5	525	c.406C>T	c.(406-408)CGT>TGT	p.R136C	CPVL_uc003szw.2_Missense_Mutation_p.R136C|CPVL_uc003szx.2_Missense_Mutation_p.R136C	NM_031311	NP_112601	Q9H3G5	CPVL_HUMAN	serine carboxypeptidase vitellogenic-like	136					proteolysis		protein binding|serine-type carboxypeptidase activity			ovary(2)	2						TCTCTGTCACGCACTGTGAAA	0.547													18	162	---	---	---	---	capture	Missense_Mutation	SNP	29134756	29134756	CPVL	7	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	3800	245
RABGEF1	27342	broad.mit.edu	37	7	66270262	66270262	+	Missense_Mutation	SNP	T	C	C			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:66270262T>C	uc011kee.1	+	8	1162	c.998T>C	c.(997-999)CTC>CCC	p.L333P	RABGEF1_uc003tvf.2_Missense_Mutation_p.L192P|RABGEF1_uc003tvg.2_Missense_Mutation_p.L127P|RABGEF1_uc010lag.2_Missense_Mutation_p.L319P|RABGEF1_uc003tvh.2_Missense_Mutation_p.L319P|RABGEF1_uc003tvi.2_Missense_Mutation_p.L153P	NM_014504	NP_055319	Q9UJ41	RABX5_HUMAN	RAB guanine nucleotide exchange factor (GEF) 1	536	VPS9.				endocytosis|protein transport	early endosome|recycling endosome	DNA binding|protein binding|zinc ion binding			ovary(1)	1						CTCCCCACCCTCATCTACATT	0.522													4	295	---	---	---	---	capture	Missense_Mutation	SNP	66270262	66270262	RABGEF1	7	T	C	C	C	1	0	0	0	0	1	0	0	0	702	54	3	3	12861	245
C7orf64	84060	broad.mit.edu	37	7	92158936	92158936	+	Silent	SNP	T	C	C			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:92158936T>C	uc003ulz.2	+	2	299	c.258T>C	c.(256-258)TTT>TTC	p.F86F	PEX1_uc003uly.2_5'Flank|PEX1_uc011khr.1_5'Flank|PEX1_uc010ley.2_5'Flank|PEX1_uc011khs.1_5'Flank|C7orf64_uc011khu.1_Silent_p.F86F|C7orf64_uc003uma.2_Silent_p.F86F	NM_032120	NP_115496	Q5RL73	CG064_HUMAN	hypothetical protein LOC84060	86							nucleotide binding			ovary(2)	2						CAGAAGACTTTACTGAAGTTT	0.353													4	250	---	---	---	---	capture	Silent	SNP	92158936	92158936	C7orf64	7	T	C	C	C	1	0	0	0	0	0	0	0	1	790	61	3	3	2387	245
HEPACAM2	253012	broad.mit.edu	37	7	92821587	92821587	+	Silent	SNP	G	A	A			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:92821587G>A	uc003umm.2	-	9	1388	c.1365C>T	c.(1363-1365)GCC>GCT	p.A455A	HEPACAM2_uc003uml.2_Silent_p.A443A|HEPACAM2_uc010lff.2_Missense_Mutation_p.P435L|HEPACAM2_uc011khy.1_Silent_p.A478A	NM_001039372	NP_001034461	A8MVW5	HECA2_HUMAN	HEPACAM family member 2 isoform 1	455	Cytoplasmic (Potential).					integral to membrane				ovary(3)|breast(1)|kidney(1)	5						CTTGCTGCTGGGCAGGGATGT	0.453													85	187	---	---	---	---	capture	Silent	SNP	92821587	92821587	HEPACAM2	7	G	A	A	A	1	0	0	0	0	0	0	0	1	548	43	2	2	6979	245
CALCR	799	broad.mit.edu	37	7	93055835	93055835	+	Missense_Mutation	SNP	G	A	A			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:93055835G>A	uc003umv.1	-	15	1621	c.1360C>T	c.(1360-1362)CGC>TGC	p.R454C	CALCR_uc011kia.1_Missense_Mutation_p.R234C|CALCR_uc003ums.1_RNA|CALCR_uc003umt.1_RNA|CALCR_uc003umu.1_Missense_Mutation_p.R420C|CALCR_uc003umw.2_Missense_Mutation_p.R420C	NM_001742	NP_001733	P30988	CALCR_HUMAN	calcitonin receptor isoform 2 precursor	436	Cytoplasmic (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|elevation of cytosolic calcium ion concentration|positive regulation of adenylate cyclase activity|response to glucocorticoid stimulus	integral to plasma membrane	calcitonin binding|calcitonin binding|calcitonin receptor activity|calcitonin receptor activity|protein binding			ovary(3)|lung(3)|skin(2)|pancreas(1)	9	all_cancers(62;3.18e-12)|all_epithelial(64;1.34e-11)|Breast(17;0.000675)|Lung NSC(181;0.207)		STAD - Stomach adenocarcinoma(171;0.000244)		Salmon Calcitonin(DB00017)	TTGGAGGGGCGCCTCCCCCAA	0.557													77	166	---	---	---	---	capture	Missense_Mutation	SNP	93055835	93055835	CALCR	7	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	2555	245
ANKRD7	56311	broad.mit.edu	37	7	117864828	117864828	+	Translation_Start_Site	SNP	C	T	T			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:117864828C>T	uc003vji.2	+	1	117	c.-56C>T	c.(-58--54)GACGG>GATGG			NM_019644	NP_062618	Q92527	ANKR7_HUMAN	ankyrin repeat domain 7						male gonad development						0						GCAGGGCGGACGGCTAGGAGT	0.602													40	72	---	---	---	---	capture	Translation_Start_Site	SNP	117864828	117864828	ANKRD7	7	C	T	T	T	1	0	0	0	0	0	0	0	0	235	19	1	1	681	245
PLAT	5327	broad.mit.edu	37	8	42037449	42037449	+	Missense_Mutation	SNP	T	G	G			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:42037449T>G	uc003xos.2	-	12	1567	c.1358A>C	c.(1357-1359)GAG>GCG	p.E453A	PLAT_uc010lxf.1_Missense_Mutation_p.E370A|PLAT_uc010lxg.1_Missense_Mutation_p.E278A|PLAT_uc003xot.2_Missense_Mutation_p.E407A|PLAT_uc011lcm.1_Missense_Mutation_p.E364A|PLAT_uc011lcn.1_Missense_Mutation_p.E327A	NM_000930	NP_000921	P00750	TPA_HUMAN	plasminogen activator, tissue isoform 1	453	Peptidase S1.				blood coagulation|fibrinolysis|negative regulation of proteolysis|protein modification process|proteolysis	cell surface|cytoplasm|extracellular space	protein binding|serine-type endopeptidase activity			breast(1)|skin(1)	2	all_cancers(6;3.84e-26)|all_epithelial(6;9.61e-28)|all_lung(13;7.2e-13)|Lung NSC(13;1.18e-11)|Ovarian(28;0.00438)|Prostate(17;0.0119)|Colorectal(14;0.0468)|Lung SC(25;0.211)	all_lung(54;0.000378)|Lung NSC(58;0.00145)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.0954)	BRCA - Breast invasive adenocarcinoma(8;5.23e-10)|OV - Ovarian serous cystadenocarcinoma(14;0.00135)|Colorectal(10;0.00165)|Lung(22;0.00467)|COAD - Colon adenocarcinoma(11;0.0171)|LUSC - Lung squamous cell carcinoma(45;0.024)		Alteplase(DB00009)|Aminocaproic Acid(DB00513)|Anistreplase(DB00029)|Iloprost(DB01088)|Reteplase(DB00015)|Tenecteplase(DB00031)|Tranexamic Acid(DB00302)|Urokinase(DB00013)	CTTACAGGCCTCATGCTTGCC	0.652													2	10	---	---	---	---	capture	Missense_Mutation	SNP	42037449	42037449	PLAT	8	T	G	G	G	1	0	0	0	0	1	0	0	0	702	54	4	4	11924	245
CYP7B1	9420	broad.mit.edu	37	8	65517238	65517238	+	Splice_Site	SNP	C	A	A			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:65517238C>A	uc003xvj.2	-	5	1437	c.1233_splice	c.e5+1	p.E411_splice		NM_004820	NP_004811	O75881	CP7B1_HUMAN	cytochrome P450, family 7, subfamily B,						bile acid biosynthetic process|cell death|cholesterol metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	25-hydroxycholesterol 7alpha-hydroxylase activity|electron carrier activity|heme binding|oxysterol 7-alpha-hydroxylase activity			ovary(3)	3		all_cancers(86;0.217)|Lung NSC(129;0.0521)|all_lung(136;0.0906)|all_epithelial(80;0.215)				TGTTTACTTACCTCTGGAGCT	0.493													12	112	---	---	---	---	capture	Splice_Site	SNP	65517238	65517238	CYP7B1	8	C	A	A	A	1	0	0	0	0	0	0	1	0	234	18	5	4	4157	245
TRAPPC9	83696	broad.mit.edu	37	8	141461384	141461384	+	Missense_Mutation	SNP	T	C	C			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:141461384T>C	uc003yvj.2	-	2	223	c.89A>G	c.(88-90)AAC>AGC	p.N30S	TRAPPC9_uc003yvh.2_Missense_Mutation_p.N128S|TRAPPC9_uc003yvi.1_Missense_Mutation_p.N30S	NM_001160372	NP_001153844	Q96Q05	TPPC9_HUMAN	trafficking protein particle complex 9 isoform	30					cell differentiation	endoplasmic reticulum|Golgi apparatus				skin(2)	2						CCTGAAGAAGTTCTCCTCGGA	0.567													50	48	---	---	---	---	capture	Missense_Mutation	SNP	141461384	141461384	TRAPPC9	8	T	C	C	C	1	0	0	0	0	1	0	0	0	780	60	3	3	16348	245
ZNF696	79943	broad.mit.edu	37	8	144378380	144378380	+	Missense_Mutation	SNP	A	G	G			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:144378380A>G	uc003yxy.3	+	3	944	c.535A>G	c.(535-537)AGG>GGG	p.R179G		NM_030895	NP_112157	Q9H7X3	ZN696_HUMAN	zinc finger protein 696	179					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	all_cancers(97;1.01e-10)|all_epithelial(106;4.86e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.156)|Colorectal(110;0.173)			CAGCGGGGAGAGGCCCTACGC	0.697													2	14	---	---	---	---	capture	Missense_Mutation	SNP	144378380	144378380	ZNF696	8	A	G	G	G	1	0	0	0	0	1	0	0	0	140	11	3	3	17977	245
ARHGAP39	80728	broad.mit.edu	37	8	145806268	145806268	+	Silent	SNP	C	G	G			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:145806268C>G	uc003zdt.1	-	4	1029	c.474G>C	c.(472-474)CGG>CGC	p.R158R	ARHGAP39_uc011llk.1_Silent_p.R158R|ARHGAP39_uc003zds.1_Silent_p.R158R	NM_025251	NP_079527	Q9C0H5	RHG39_HUMAN	KIAA1688 protein	158					axon guidance|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytoskeleton|cytosol|nucleus	GTPase activator activity				0						ACGCCGCGGGCCGCCCGGCCC	0.657													3	27	---	---	---	---	capture	Silent	SNP	145806268	145806268	ARHGAP39	8	C	G	G	G	1	0	0	0	0	0	0	0	1	327	26	4	4	877	245
ARID3C	138715	broad.mit.edu	37	9	34623425	34623425	+	Missense_Mutation	SNP	T	C	C			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:34623425T>C	uc011lon.1	-	4	862	c.862A>G	c.(862-864)AAA>GAA	p.K288E	DCTN3_uc003zuw.1_5'Flank|DCTN3_uc003zux.1_5'Flank	NM_001017363	NP_001017363	A6NKF2	ARI3C_HUMAN	AT rich interactive domain 3C (BRIGHT- like)	288	Pro-rich.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(1)	1	all_epithelial(49;0.102)		STAD - Stomach adenocarcinoma(86;0.178)	GBM - Glioblastoma multiforme(74;0.175)		CTCGCACCTTTCTTAATAGGG	0.592													158	78	---	---	---	---	capture	Missense_Mutation	SNP	34623425	34623425	ARID3C	9	T	C	C	C	1	0	0	0	0	1	0	0	0	806	62	3	3	911	245
FAM75A6	389730	broad.mit.edu	37	9	43628658	43628658	+	Missense_Mutation	SNP	G	A	A			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:43628658G>A	uc011lrb.1	-	3	313	c.284C>T	c.(283-285)TCG>TTG	p.S95L		NM_001145196	NP_001138668	Q5VVP1	F75A6_HUMAN	hypothetical protein LOC389730	95						integral to membrane					0						AAGAAGGTCCGAAGTCTCCTC	0.612													67	17	---	---	---	---	capture	Missense_Mutation	SNP	43628658	43628658	FAM75A6	9	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	5568	245
SLC28A3	64078	broad.mit.edu	37	9	86928326	86928326	+	Missense_Mutation	SNP	T	A	A			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:86928326T>A	uc010mpz.2	-	2	229	c.104A>T	c.(103-105)AAC>ATC	p.N35I	SLC28A3_uc011lsy.1_5'UTR|SLC28A3_uc004anu.1_Missense_Mutation_p.N35I|SLC28A3_uc010mqb.2_5'UTR	NM_022127	NP_071410	Q9HAS3	S28A3_HUMAN	concentrative Na+-nucleoside cotransporter	35	Cytoplasmic (Potential).				nucleobase, nucleoside and nucleotide metabolic process	integral to membrane|plasma membrane	nucleoside binding			upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)|skin(1)	4						TCTTATTGAGTTGTTTCCTGA	0.418													52	132	---	---	---	---	capture	Missense_Mutation	SNP	86928326	86928326	SLC28A3	9	T	A	A	A	1	0	0	0	0	1	0	0	0	780	60	4	4	14425	245
ROR2	4920	broad.mit.edu	37	9	94487296	94487296	+	Missense_Mutation	SNP	C	T	T	rs138310082	byFrequency	TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:94487296C>T	uc004arj.1	-	9	1679	c.1480G>A	c.(1480-1482)GGC>AGC	p.G494S	ROR2_uc004ari.1_Missense_Mutation_p.G354S	NM_004560	NP_004551	Q01974	ROR2_HUMAN	receptor tyrosine kinase-like orphan receptor 2	494	Cytoplasmic (Potential).|Protein kinase.				negative regulation of cell proliferation|positive regulation of cell migration|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity|Wnt-protein binding			lung(8)|central_nervous_system(5)|ovary(3)|large_intestine(2)|stomach(1)|breast(1)	20						GGGGCAGGGCCGAACAGGTGA	0.602													367	202	---	---	---	---	capture	Missense_Mutation	SNP	94487296	94487296	ROR2	9	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	13419	245
ZBTB34	403341	broad.mit.edu	37	9	129643102	129643102	+	Missense_Mutation	SNP	T	G	G			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:129643102T>G	uc004bqm.3	+	2	1509	c.1412T>G	c.(1411-1413)GTG>GGG	p.V471G		NM_001099270	NP_001092740	Q8NCN2	ZBT34_HUMAN	zinc finger and BTB domain containing 34	471					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						GATGTGTACGTGGAACAGAAA	0.507													32	33	---	---	---	---	capture	Missense_Mutation	SNP	129643102	129643102	ZBTB34	9	T	G	G	G	1	0	0	0	0	1	0	0	0	767	59	4	4	17417	245
PRDM12	59335	broad.mit.edu	37	9	133556658	133556658	+	Missense_Mutation	SNP	G	A	A			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:133556658G>A	uc004bzt.1	+	5	766	c.706G>A	c.(706-708)GCG>ACG	p.A236T		NM_021619	NP_067632	Q9H4Q4	PRD12_HUMAN	PR domain containing 12	236					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_hematologic(13;0.0433)|Acute lymphoblastic leukemia(5;0.0534)		OV - Ovarian serous cystadenocarcinoma(145;0.000344)		GGCGGACTCGGCGGCTGGCCC	0.622													2	1	---	---	---	---	capture	Missense_Mutation	SNP	133556658	133556658	PRDM12	9	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	12349	245
ESX1	80712	broad.mit.edu	37	X	103495282	103495282	+	Missense_Mutation	SNP	G	A	A			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:103495282G>A	uc004ely.2	-	4	906	c.848C>T	c.(847-849)GCG>GTG	p.A283V		NM_153448	NP_703149	Q8N693	ESX1_HUMAN	extraembryonic, spermatogenesis, homeobox	283	5.|15 X 9 AA tandem repeats of P-P-x-x-P-x- P-P-x.				negative regulation of transcription, DNA-dependent|regulation of cell cycle	cytoplasm|nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1						TGGCACAGGCGCCATGCGTGA	0.498													98	5	---	---	---	---	capture	Missense_Mutation	SNP	103495282	103495282	ESX1	23	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	5218	245
GPC3	2719	broad.mit.edu	37	X	133087081	133087081	+	Missense_Mutation	SNP	G	C	C			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:133087081G>C	uc004exe.1	-	2	523	c.333C>G	c.(331-333)TTC>TTG	p.F111L	GPC3_uc010nrn.1_Missense_Mutation_p.F111L|GPC3_uc011mvh.1_Intron|GPC3_uc010nro.1_Intron|GPC3_uc010nrp.1_5'UTR	NM_004484	NP_004475	P51654	GPC3_HUMAN	glypican 3 isoform 2 precursor	111						extracellular space|integral to plasma membrane|proteinaceous extracellular matrix	heparan sulfate proteoglycan binding|peptidyl-dipeptidase inhibitor activity			lung(2)|prostate(1)|breast(1)|skin(1)	5	Acute lymphoblastic leukemia(192;0.000127)					ACTCACCTTGGAAAACCGCAG	0.373			T|D|Mis|N|F|S			Wilms tumour			Simpson-Golabi-Behmel_syndrome				12	337	---	---	---	---	capture	Missense_Mutation	SNP	133087081	133087081	GPC3	23	G	C	C	C	1	0	0	0	0	1	0	0	0	529	41	4	4	6533	245
NLGN4Y	22829	broad.mit.edu	37	Y	16952864	16952864	+	Missense_Mutation	SNP	C	G	G			TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrY:16952864C>G	uc004ftg.2	+	6	2425	c.2173C>G	c.(2173-2175)CAG>GAG	p.Q725E	NLGN4Y_uc004fte.2_Missense_Mutation_p.Q557E|NLGN4Y_uc011nas.1_Missense_Mutation_p.Q745E|NLGN4Y_uc004ftf.2_Missense_Mutation_p.Q418E|NLGN4Y_uc004fth.2_Missense_Mutation_p.Q725E	NM_014893	NP_055708	Q8NFZ3	NLGNY_HUMAN	neuroligin 4, Y-linked isoform 1	725	Cytoplasmic (Potential).				brainstem development|cell adhesion|cerebellum development|male courtship behavior|positive regulation of organ growth|social behavior|synapse assembly|territorial aggressive behavior|vocalization behavior	cell surface|integral to plasma membrane|synapse	neurexin binding|receptor activity				0						CACTCACATCCAGAACGAAGA	0.547													2	10	---	---	---	---	capture	Missense_Mutation	SNP	16952864	16952864	NLGN4Y	24	C	G	G	G	1	0	0	0	0	1	0	0	0	273	21	4	4	10372	245
MYH7	4625	broad.mit.edu	37	14	23889445	23889446	+	Splice_Site	INS	-	G	G	rs45504498		TCGA-32-4210-01	TCGA-32-4210-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:23889445_23889446insG	uc001wjx.2	-	27	3443	c.3337_splice	c.e27-1	p.A1113_splice	MIR208B_hsa-mir-208b|MI0005570_5'Flank	NM_000257	NP_000248	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta						adult heart development|muscle filament sliding|regulation of heart rate|ventricular cardiac muscle tissue morphogenesis	focal adhesion|muscle myosin complex|myosin filament|nucleus|sarcomere	actin binding|actin-dependent ATPase activity|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(3)|skin(1)	4	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		GATGCGTGCCTGGTCAGACACA	0.545													2	4	---	---	---	---	capture_indel	Splice_Site	INS	23889445	23889446	MYH7	14	-	G	G	G	1	0	1	1	0	0	0	1	0	715	55	5	5	9949	245
