Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
AADACL4	343066	broad.mit.edu	37	1	12726355	12726355	+	Nonsense_Mutation	SNP	G	A	A			TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:12726355G>A	uc001auf.2	+	4	833	c.833G>A	c.(832-834)TGG>TAG	p.W278*		NM_001013630	NP_001013652	Q5VUY2	ADCL4_HUMAN	arylacetamide deacetylase-like 4	278	Lumenal (Potential).					integral to membrane	carboxylesterase activity				0	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.000937)|all_lung(284;0.00122)|Colorectal(325;0.00215)|Breast(348;0.0042)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.81e-07)|COAD - Colon adenocarcinoma(227;0.000274)|BRCA - Breast invasive adenocarcinoma(304;0.000311)|Kidney(185;0.00217)|KIRC - Kidney renal clear cell carcinoma(229;0.00579)|STAD - Stomach adenocarcinoma(313;0.00743)|READ - Rectum adenocarcinoma(331;0.0384)		CCAGACGTCTGGAGGAAGTAC	0.532													55	171	---	---	---	---	capture	Nonsense_Mutation	SNP	12726355	12726355	AADACL4	1	G	A	A	A	1	0	0	0	0	0	1	0	0	611	47	5	2	13	246
LAPTM5	7805	broad.mit.edu	37	1	31210478	31210478	+	Silent	SNP	G	A	A	rs144620246	byFrequency	TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:31210478G>A	uc001bsc.2	-	6	670	c.579C>T	c.(577-579)ATC>ATT	p.I193I		NM_006762	NP_006753	Q13571	LAPM5_HUMAN	lysosomal protein transmembrane 5	193	Helical; (Potential).				transport	integral to plasma membrane|lysosomal membrane					0		Colorectal(325;0.0199)|Myeloproliferative disorder(586;0.0393)|all_neural(195;0.0966)|Medulloblastoma(700;0.151)|Ovarian(437;0.192)		STAD - Stomach adenocarcinoma(196;0.0196)|READ - Rectum adenocarcinoma(331;0.0649)		TGATGAAGGCGATGGAAAAGA	0.542													4	98	---	---	---	---	capture	Silent	SNP	31210478	31210478	LAPTM5	1	G	A	A	A	1	0	0	0	0	0	0	0	1	473	37	1	1	8546	246
GJA9	81025	broad.mit.edu	37	1	39340374	39340374	+	Missense_Mutation	SNP	T	C	C			TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:39340374T>C	uc001cct.1	-	2	1678	c.1397A>G	c.(1396-1398)GAC>GGC	p.D466G	RRAGC_uc001ccr.2_5'Flank|MYCBP_uc001ccs.2_5'Flank	NM_030772	NP_110399	P57773	CXA9_HUMAN	gap junction protein, alpha 9, 59kDa	466	Cytoplasmic (Potential).				cell communication	connexon complex|integral to membrane					0	Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	OV - Ovarian serous cystadenocarcinoma(33;8.23e-17)			GTTTGGAATGTCAAGTGATTG	0.493													40	103	---	---	---	---	capture	Missense_Mutation	SNP	39340374	39340374	GJA9	1	T	C	C	C	1	0	0	0	0	1	0	0	0	754	58	3	3	6343	246
DMBX1	127343	broad.mit.edu	37	1	46976216	46976216	+	Missense_Mutation	SNP	G	A	A			TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:46976216G>A	uc001cpx.2	+	2	253	c.238G>A	c.(238-240)GCT>ACT	p.A80T	DMBX1_uc001cpw.2_Missense_Mutation_p.A75T	NM_147192	NP_671725	Q8NFW5	DMBX1_HUMAN	diencephalon/mesencephalon homeobox 1 isoform b	80	Homeobox.|Interacts with OXT2 and is required for repressor activity (By similarity).				brain development|developmental growth|negative regulation of transcription, DNA-dependent	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1	Acute lymphoblastic leukemia(166;0.155)					AGCGTTCACGGCTCAGCAGCT	0.582													3	69	---	---	---	---	capture	Missense_Mutation	SNP	46976216	46976216	DMBX1	1	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	4536	246
SPTA1	6708	broad.mit.edu	37	1	158647548	158647548	+	Missense_Mutation	SNP	C	G	G			TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:158647548C>G	uc001fst.1	-	7	1088	c.889G>C	c.(889-891)GTT>CTT	p.V297L		NM_003126	NP_003117	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	297	Spectrin 4.				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8	all_hematologic(112;0.0378)					TCAGAGGCAACAAGGTCTTTG	0.478													3	101	---	---	---	---	capture	Missense_Mutation	SNP	158647548	158647548	SPTA1	1	C	G	G	G	1	0	0	0	0	1	0	0	0	221	17	4	4	15008	246
USH2A	7399	broad.mit.edu	37	1	215848824	215848824	+	Silent	SNP	C	T	T			TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:215848824C>T	uc001hku.1	-	63	12816	c.12429G>A	c.(12427-12429)TCG>TCA	p.S4143S		NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	4143	Fibronectin type-III 26.|Extracellular (Potential).				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		GCTGAGGCGCCGAGTGTGCAC	0.572										HNSCC(13;0.011)			27	61	---	---	---	---	capture	Silent	SNP	215848824	215848824	USH2A	1	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	16918	246
WDR26	80232	broad.mit.edu	37	1	224586247	224586247	+	Silent	SNP	G	A	A			TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:224586247G>A	uc001hop.3	-	11	1539	c.1173C>T	c.(1171-1173)GGC>GGT	p.G391G	WDR26_uc001hoq.3_Silent_p.G375G|WDR26_uc010pvh.1_Silent_p.G98G	NM_025160	NP_079436	Q9H7D7	WDR26_HUMAN	WD repeat domain 26 isoform a	538	WD 4.					cytoplasm|nucleus					0				GBM - Glioblastoma multiforme(131;0.0104)		AAGCTAATCGGCCATTTTTTG	0.274													3	97	---	---	---	---	capture	Silent	SNP	224586247	224586247	WDR26	1	G	A	A	A	1	0	0	0	0	0	0	0	1	535	42	2	2	17164	246
RYR2	6262	broad.mit.edu	37	1	237777926	237777926	+	Missense_Mutation	SNP	T	C	C			TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:237777926T>C	uc001hyl.1	+	37	5618	c.5498T>C	c.(5497-5499)ATC>ACC	p.I1833T		NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	1833	Cytoplasmic (By similarity).|4 X approximate repeats.				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			ATCATGGGCATCTTTCACAAC	0.498													101	196	---	---	---	---	capture	Missense_Mutation	SNP	237777926	237777926	RYR2	1	T	C	C	C	1	0	0	0	0	1	0	0	0	650	50	3	3	13661	246
ARMC3	219681	broad.mit.edu	37	10	23235138	23235138	+	Silent	SNP	A	G	G			TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:23235138A>G	uc001irm.3	+	3	197	c.114A>G	c.(112-114)GAA>GAG	p.E38E	ARMC3_uc010qcv.1_Silent_p.E38E|ARMC3_uc010qcw.1_Intron	NM_173081	NP_775104	Q5W041	ARMC3_HUMAN	armadillo repeat containing 3	38	ARM 1.						binding				0						ATTCTCCAGAAGAGGAAATTT	0.303													11	99	---	---	---	---	capture	Silent	SNP	23235138	23235138	ARMC3	10	A	G	G	G	1	0	0	0	0	0	0	0	1	37	3	3	3	945	246
ARMC4	55130	broad.mit.edu	37	10	28283881	28283881	+	Missense_Mutation	SNP	G	A	A			TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:28283881G>A	uc009xky.2	-	2	289	c.191C>T	c.(190-192)GCG>GTG	p.A64V	ARMC4_uc001itz.2_Missense_Mutation_p.A64V	NM_018076	NP_060546	Q5T2S8	ARMC4_HUMAN	armadillo repeat containing 4	64							binding			ovary(4)|skin(2)	6						TGCTGAGGGCGCCAAACTTGT	0.358													4	69	---	---	---	---	capture	Missense_Mutation	SNP	28283881	28283881	ARMC4	10	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	946	246
DNTT	1791	broad.mit.edu	37	10	98084132	98084132	+	Missense_Mutation	SNP	G	A	A			TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:98084132G>A	uc001kmf.2	+	6	1030	c.860G>A	c.(859-861)CGA>CAA	p.R287Q	DNTT_uc001kmg.2_Missense_Mutation_p.R287Q	NM_004088	NP_004079	P04053	TDT_HUMAN	terminal deoxynucleotidyltransferase isoform 1	287	Mediates interaction with DNTTIP2.				DNA modification	nucleus	DNA binding|DNA nucleotidylexotransferase activity|DNA-directed DNA polymerase activity|metal ion binding			ovary(1)	1		Colorectal(252;0.0815)|all_hematologic(284;0.224)		Epithelial(162;7.97e-08)|all cancers(201;1.89e-06)		AAATTTACACGAATGCAGAAA	0.453													54	54	---	---	---	---	capture	Missense_Mutation	SNP	98084132	98084132	DNTT	10	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	4636	246
ITPRIP	85450	broad.mit.edu	37	10	106075308	106075308	+	Missense_Mutation	SNP	C	T	T			TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:106075308C>T	uc001kye.2	-	2	575	c.502G>A	c.(502-504)GTG>ATG	p.V168M	ITPRIP_uc001kyf.2_Missense_Mutation_p.V168M|ITPRIP_uc001kyg.2_Missense_Mutation_p.V168M	NM_033397	NP_203755	Q8IWB1	IPRI_HUMAN	inositol 1,4,5-triphosphate receptor interacting	168						plasma membrane					0						AAGTCATCCACGAAGCCTTCC	0.622													37	38	---	---	---	---	capture	Missense_Mutation	SNP	106075308	106075308	ITPRIP	10	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	7846	246
MRGPRX2	117194	broad.mit.edu	37	11	19077216	19077216	+	Missense_Mutation	SNP	A	G	G			TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:19077216A>G	uc001mph.2	-	2	822	c.734T>C	c.(733-735)CTA>CCA	p.L245P		NM_054030	NP_473371	Q96LB1	MRGX2_HUMAN	MAS-related GPR, member X2	245	Helical; Name=6; (Potential).				sensory perception of pain|sleep	plasma membrane	G-protein coupled receptor activity|neuropeptide binding			ovary(1)	1						CCATAATATTAGGAACCACTG	0.498													3	110	---	---	---	---	capture	Missense_Mutation	SNP	19077216	19077216	MRGPRX2	11	A	G	G	G	1	0	0	0	0	1	0	0	0	195	15	3	3	9677	246
C11orf94	143678	broad.mit.edu	37	11	45928455	45928455	+	Missense_Mutation	SNP	A	G	G			TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:45928455A>G	uc001nbs.3	-	2	177	c.140T>C	c.(139-141)CTG>CCG	p.L47P		NM_001080446	NP_001073915	C9JXX5	CK094_HUMAN	hypothetical protein LOC143678	47						extracellular region					0						CGAGAGTTCCAGGGGGGCGGA	0.617													3	155	---	---	---	---	capture	Missense_Mutation	SNP	45928455	45928455	C11orf94	11	A	G	G	G	1	0	0	0	0	1	0	0	0	91	7	3	3	1659	246
SMTNL1	219537	broad.mit.edu	37	11	57314061	57314061	+	Missense_Mutation	SNP	G	C	C			TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:57314061G>C	uc009ymh.1	+	7	1330	c.1330G>C	c.(1330-1332)GAC>CAC	p.D444H		NM_001105565	NP_001099035	E9PPJ3	E9PPJ3_HUMAN	smoothelin-like 1	426										ovary(1)	1						TGACGCCTTTGACTACGCAGA	0.587													3	96	---	---	---	---	capture	Missense_Mutation	SNP	57314061	57314061	SMTNL1	11	G	C	C	C	1	0	0	0	0	1	0	0	0	585	45	4	4	14707	246
NUMA1	4926	broad.mit.edu	37	11	71729532	71729532	+	Missense_Mutation	SNP	C	T	T			TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:71729532C>T	uc001orl.1	-	11	942	c.770G>A	c.(769-771)CGC>CAC	p.R257H	NUMA1_uc009ysw.1_5'Flank|NUMA1_uc001ork.1_Missense_Mutation_p.R257H|NUMA1_uc001orm.1_Missense_Mutation_p.R257H|NUMA1_uc001orn.2_5'Flank|NUMA1_uc009ysx.1_Missense_Mutation_p.R257H|NUMA1_uc001oro.1_Missense_Mutation_p.R257H|NUMA1_uc009ysy.1_Missense_Mutation_p.R257H|NUMA1_uc001orp.2_Missense_Mutation_p.R257H|NUMA1_uc001orq.2_Missense_Mutation_p.R257H	NM_006185	NP_006176	Q14980	NUMA1_HUMAN	nuclear mitotic apparatus protein 1	257	Potential.				G2/M transition of mitotic cell cycle|mitotic anaphase|nucleus organization	chromosome|cytosol|nucleoplasm|spindle microtubule|spindle pole	protein binding|structural molecule activity			ovary(3)|lung(2)|skin(2)|central_nervous_system(1)	8						GCGGTCAATGCGCTGCTGCAT	0.557			T	RARA	APL								3	96	---	---	---	---	capture	Missense_Mutation	SNP	71729532	71729532	NUMA1	11	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	10657	246
ADAMTS20	80070	broad.mit.edu	37	12	43846340	43846340	+	Missense_Mutation	SNP	C	G	G			TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:43846340C>G	uc010skx.1	-	13	1919	c.1919G>C	c.(1918-1920)AGG>ACG	p.R640T		NM_025003	NP_079279	P59510	ATS20_HUMAN	a disintegrin-like and metalloprotease with	640	Cys-rich.					proteinaceous extracellular matrix	zinc ion binding			central_nervous_system(5)|ovary(4)|lung(3)|large_intestine(2)|skin(2)|urinary_tract(1)|kidney(1)|pancreas(1)	19	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		TGGAAGCCACCTCACATTAGA	0.368													389	41	---	---	---	---	capture	Missense_Mutation	SNP	43846340	43846340	ADAMTS20	12	C	G	G	G	1	0	0	0	0	1	0	0	0	312	24	4	4	266	246
DCTN2	10540	broad.mit.edu	37	12	57939864	57939864	+	Missense_Mutation	SNP	C	T	T			TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:57939864C>T	uc001som.1	-	2	184	c.52G>A	c.(52-54)GAT>AAT	p.D18N	DCTN2_uc009zpu.1_Missense_Mutation_p.D18N|DCTN2_uc009zpv.1_5'UTR|DCTN2_uc009zpw.1_5'UTR|DCTN2_uc001soo.1_RNA|DCTN2_uc001son.1_5'UTR|DCTN2_uc001sop.1_5'UTR|DCTN2_uc001soq.1_RNA|DCTN2_uc009zpx.1_Missense_Mutation_p.D18N	NM_006400	NP_006391	Q13561	DCTN2_HUMAN	dynactin 2	18					cell proliferation|G2/M transition of mitotic cell cycle|mitosis	centrosome|cytosol|dynactin complex|dynein complex|kinetochore|membrane|microtubule|vesicle	motor activity|protein binding			ovary(1)	1						TCATAAACATCTGGCTCATTC	0.517													648	79	---	---	---	---	capture	Missense_Mutation	SNP	57939864	57939864	DCTN2	12	C	T	T	T	1	0	0	0	0	1	0	0	0	416	32	2	2	4266	246
TMTC2	160335	broad.mit.edu	37	12	83251229	83251229	+	Nonsense_Mutation	SNP	C	G	G			TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:83251229C>G	uc001szt.2	+	2	956	c.524C>G	c.(523-525)TCA>TGA	p.S175*	TMTC2_uc001szr.1_Nonsense_Mutation_p.S175*|TMTC2_uc001szs.1_Nonsense_Mutation_p.S175*|TMTC2_uc010suk.1_Intron	NM_152588	NP_689801	Q8N394	TMTC2_HUMAN	transmembrane and tetratricopeptide repeat	175	Helical; (Potential).					endoplasmic reticulum|integral to membrane	binding			ovary(2)	2						TTCCTGGGGTCAGGACTGTGC	0.507													22	686	---	---	---	---	capture	Nonsense_Mutation	SNP	83251229	83251229	TMTC2	12	C	G	G	G	1	0	0	0	0	0	1	0	0	377	29	5	4	16144	246
TMTC2	160335	broad.mit.edu	37	12	83251308	83251308	+	Silent	SNP	C	G	G			TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:83251308C>G	uc001szt.2	+	2	1035	c.603C>G	c.(601-603)GTC>GTG	p.V201V	TMTC2_uc001szr.1_Silent_p.V201V|TMTC2_uc001szs.1_Silent_p.V201V|TMTC2_uc010suk.1_Intron	NM_152588	NP_689801	Q8N394	TMTC2_HUMAN	transmembrane and tetratricopeptide repeat	201	Helical; (Potential).					endoplasmic reticulum|integral to membrane	binding			ovary(2)	2						TTTATGATGTCTTTGTCTTTC	0.443													21	814	---	---	---	---	capture	Silent	SNP	83251308	83251308	TMTC2	12	C	G	G	G	1	0	0	0	0	0	0	0	1	405	32	4	4	16144	246
TMTC2	160335	broad.mit.edu	37	12	83251314	83251314	+	Silent	SNP	C	G	G	rs138847027		TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:83251314C>G	uc001szt.2	+	2	1041	c.609C>G	c.(607-609)GTC>GTG	p.V203V	TMTC2_uc001szr.1_Silent_p.V203V|TMTC2_uc001szs.1_Silent_p.V203V|TMTC2_uc010suk.1_Intron	NM_152588	NP_689801	Q8N394	TMTC2_HUMAN	transmembrane and tetratricopeptide repeat	203	Helical; (Potential).					endoplasmic reticulum|integral to membrane	binding			ovary(2)	2						ATGTCTTTGTCTTTCACAGGC	0.428													21	811	---	---	---	---	capture	Silent	SNP	83251314	83251314	TMTC2	12	C	G	G	G	1	0	0	0	0	0	0	0	1	405	32	4	4	16144	246
HVCN1	84329	broad.mit.edu	37	12	111089040	111089040	+	Missense_Mutation	SNP	C	A	A			TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:111089040C>A	uc001trs.1	-	6	790	c.625G>T	c.(625-627)GTG>TTG	p.V209L	HVCN1_uc001trq.1_Missense_Mutation_p.V209L|HVCN1_uc001trt.1_Missense_Mutation_p.V209L|HVCN1_uc010syd.1_Missense_Mutation_p.V189L	NM_032369	NP_115745	Q96D96	HVCN1_HUMAN	hydrogen voltage-gated channel 1	209	Helical; Name=Segment S4; (By similarity).				response to pH|response to zinc ion	integral to membrane	voltage-gated proton channel activity			skin(1)	1						ATCCGGGCCACCCGCCACAGC	0.602													3	93	---	---	---	---	capture	Missense_Mutation	SNP	111089040	111089040	HVCN1	12	C	A	A	A	1	0	0	0	0	1	0	0	0	234	18	4	4	7387	246
TBX5	6910	broad.mit.edu	37	12	114832609	114832609	+	Silent	SNP	C	T	T	rs139329918	byFrequency	TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:114832609C>T	uc001tvo.2	-	6	1095	c.600G>A	c.(598-600)GCG>GCA	p.A200A	TBX5_uc001tvp.2_Silent_p.A200A|TBX5_uc001tvq.2_Silent_p.A150A|TBX5_uc010syv.1_Silent_p.A200A	NM_181486	NP_852259	Q99593	TBX5_HUMAN	T-box 5 isoform 1	200	T-box.				cardiac left ventricle formation|cell migration involved in coronary vasculogenesis|cell-cell signaling|embryonic arm morphogenesis|induction of apoptosis|negative regulation of cardiac muscle cell proliferation|negative regulation of cell migration|negative regulation of epithelial to mesenchymal transition|pericardium development|positive regulation of cardioblast differentiation|positive regulation of transcription from RNA polymerase II promoter|ventricular septum development	cytoplasm|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding			ovary(6)|pancreas(1)|skin(1)	8	Medulloblastoma(191;0.163)|all_neural(191;0.178)			BRCA - Breast invasive adenocarcinoma(302;0.0893)		GAGTGCAGAACGCTGTATTTT	0.433													21	431	---	---	---	---	capture	Silent	SNP	114832609	114832609	TBX5	12	C	T	T	T	1	0	0	0	0	0	0	0	1	236	19	1	1	15548	246
GCN1L1	10985	broad.mit.edu	37	12	120596393	120596393	+	Missense_Mutation	SNP	G	A	A			TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:120596393G>A	uc001txo.2	-	25	2789	c.2776C>T	c.(2776-2778)CGC>TGC	p.R926C		NM_006836	NP_006827	Q92616	GCN1L_HUMAN	GCN1 general control of amino-acid synthesis	926					regulation of translation	ribosome	protein binding|translation factor activity, nucleic acid binding			ovary(4)	4	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					TTCAGCAGGCGCAGGGTCACG	0.582													7	21	---	---	---	---	capture	Missense_Mutation	SNP	120596393	120596393	GCN1L1	12	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	6239	246
SYT16	83851	broad.mit.edu	37	14	62547880	62547880	+	Missense_Mutation	SNP	G	A	A			TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:62547880G>A	uc001xfu.1	+	4	1519	c.1322G>A	c.(1321-1323)CGG>CAG	p.R441Q	SYT16_uc010tsd.1_3'UTR|SYT16_uc010tse.1_5'UTR	NM_031914	NP_114120	Q17RD7	SYT16_HUMAN	synaptotagmin XIV-like	441	C2 1.									central_nervous_system(1)	1				OV - Ovarian serous cystadenocarcinoma(108;0.0438)|BRCA - Breast invasive adenocarcinoma(234;0.118)		TACGCTGCCCGGAAGATGACC	0.567													18	29	---	---	---	---	capture	Missense_Mutation	SNP	62547880	62547880	SYT16	14	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	15360	246
NRXN3	9369	broad.mit.edu	37	14	80130234	80130234	+	Silent	SNP	C	T	T			TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:80130234C>T	uc001xun.2	+	14	2930	c.2439C>T	c.(2437-2439)AAC>AAT	p.N813N	NRXN3_uc001xum.1_RNA|NRXN3_uc001xup.2_RNA|NRXN3_uc001xuq.2_Silent_p.N181N|NRXN3_uc010asw.2_Silent_p.N181N|NRXN3_uc001xur.3_Silent_p.N181N	NM_004796	NP_004787	Q9Y4C0	NRX3A_HUMAN	neurexin 3 isoform 1 precursor	1186	Extracellular (Potential).|Laminin G-like 6.				axon guidance|cell adhesion	integral to plasma membrane	metal ion binding|receptor activity			ovary(3)|upper_aerodigestive_tract(2)|pancreas(2)|central_nervous_system(1)|breast(1)|skin(1)	10		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)		TCACCAGGAACGGCGGCAACG	0.488													19	50	---	---	---	---	capture	Silent	SNP	80130234	80130234	NRXN3	14	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	10574	246
JAG2	3714	broad.mit.edu	37	14	105609172	105609172	+	Missense_Mutation	SNP	C	T	T			TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:105609172C>T	uc001yqg.2	-	26	3981	c.3577G>A	c.(3577-3579)GCG>ACG	p.A1193T	JAG2_uc010axf.2_Silent_p.R16R|JAG2_uc001yqf.2_Missense_Mutation_p.A597T|JAG2_uc001yqh.2_Missense_Mutation_p.A1155T	NM_002226	NP_002217	Q9Y219	JAG2_HUMAN	jagged 2 isoform a precursor	1193	Cytoplasmic (Potential).				auditory receptor cell fate commitment|cell communication|cell cycle|Notch receptor processing|Notch signaling pathway|regulation of cell migration|regulation of cell proliferation|spermatogenesis|thymic T cell selection	integral to plasma membrane	calcium ion binding|growth factor activity|Notch binding			lung(3)|breast(2)	5		all_cancers(154;0.0336)|all_epithelial(191;0.0729)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.00989)|all cancers(16;0.0114)|Epithelial(46;0.0272)	Epithelial(152;0.047)|OV - Ovarian serous cystadenocarcinoma(161;0.148)|all cancers(159;0.208)		AACTTCTCCGCCTCCAGGGAG	0.512													6	22	---	---	---	---	capture	Missense_Mutation	SNP	105609172	105609172	JAG2	14	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	7858	246
SLC28A2	9153	broad.mit.edu	37	15	45556870	45556870	+	Silent	SNP	G	A	A			TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:45556870G>A	uc001zva.2	+	7	671	c.606G>A	c.(604-606)GTG>GTA	p.V202V		NM_004212	NP_004203	O43868	S28A2_HUMAN	solute carrier family 28 (sodium-coupled	202	Helical; (Potential).				nucleobase, nucleoside and nucleotide metabolic process	integral to plasma membrane|membrane fraction	nucleoside binding|nucleoside:sodium symporter activity|purine nucleoside transmembrane transporter activity			ovary(4)	4		all_cancers(109;8.53e-07)|all_epithelial(112;1.39e-05)|Lung NSC(122;8.3e-05)|all_lung(180;0.000547)|Melanoma(134;0.0417)		all cancers(107;3.77e-16)|GBM - Glioblastoma multiforme(94;2.71e-06)		GGAGGACAGTGTTTTCGGGCC	0.433													68	73	---	---	---	---	capture	Silent	SNP	45556870	45556870	SLC28A2	15	G	A	A	A	1	0	0	0	0	0	0	0	1	613	48	2	2	14424	246
HERC1	8925	broad.mit.edu	37	15	63970125	63970125	+	Missense_Mutation	SNP	C	T	T			TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:63970125C>T	uc002amp.2	-	37	7137	c.6989G>A	c.(6988-6990)CGC>CAC	p.R2330H		NM_003922	NP_003913	Q15751	HERC1_HUMAN	hect domain and RCC1-like domain 1	2330					protein modification process|transport	cytosol|Golgi apparatus|membrane	acid-amino acid ligase activity|ARF guanyl-nucleotide exchange factor activity			ovary(6)|breast(6)|lung(5)|central_nervous_system(2)	19						CGTGGCATGGCGCCCAGTTTG	0.527													99	131	---	---	---	---	capture	Missense_Mutation	SNP	63970125	63970125	HERC1	15	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	6983	246
TLE3	7090	broad.mit.edu	37	15	70347545	70347545	+	Missense_Mutation	SNP	G	A	A			TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:70347545G>A	uc002asm.2	-	15	2549	c.1430C>T	c.(1429-1431)GCC>GTC	p.A477V	TLE3_uc002ask.2_Missense_Mutation_p.A404V|TLE3_uc002asl.2_Missense_Mutation_p.A477V|TLE3_uc010ukd.1_Missense_Mutation_p.A467V|TLE3_uc010bik.1_Missense_Mutation_p.A58V|TLE3_uc010bil.1_Missense_Mutation_p.A474V|TLE3_uc002asn.2_Missense_Mutation_p.A465V|TLE3_uc002asp.2_Missense_Mutation_p.A469V|TLE3_uc002aso.2_Missense_Mutation_p.A472V	NM_005078	NP_005069	Q04726	TLE3_HUMAN	transducin-like enhancer protein 3 isoform a	477					organ morphogenesis|regulation of transcription, DNA-dependent|transcription, DNA-dependent|Wnt receptor signaling pathway	nucleus	protein binding|protein binding			lung(2)	2						GATCTGCCGGGCGTGCCTCGG	0.642													3	72	---	---	---	---	capture	Missense_Mutation	SNP	70347545	70347545	TLE3	15	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	15825	246
WFIKKN1	117166	broad.mit.edu	37	16	683877	683877	+	Nonsense_Mutation	SNP	C	A	A			TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:683877C>A	uc002cht.1	+	2	1709	c.1467C>A	c.(1465-1467)TGC>TGA	p.C489*	WFIKKN1_uc002chs.1_3'UTR|uc010uuk.1_5'Flank	NM_053284	NP_444514	Q96NZ8	WFKN1_HUMAN	WAP, follistatin/kazal, immunoglobulin, kunitz	489	NTR.					extracellular region	metalloendopeptidase inhibitor activity|protein binding|serine-type endopeptidase inhibitor activity				0		Hepatocellular(780;0.00335)				ACTGGGCCTGCCCCTGCCCCA	0.677													3	5	---	---	---	---	capture	Nonsense_Mutation	SNP	683877	683877	WFIKKN1	16	C	A	A	A	1	0	0	0	0	0	1	0	0	337	26	5	4	17239	246
NOD2	64127	broad.mit.edu	37	16	50763750	50763750	+	Silent	SNP	C	T	T			TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:50763750C>T	uc002egm.1	+	11	3093	c.2988C>T	c.(2986-2988)ACC>ACT	p.T996T	NOD2_uc010vgq.1_Silent_p.T41T	NM_022162	NP_071445	Q9HC29	NOD2_HUMAN	nucleotide-binding oligomerization domain	996	LRR 8.				activation of MAPK activity involved in innate immune response|cytokine production involved in immune response|detection of bacterium|detection of muramyl dipeptide|JNK cascade|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of macrophage apoptosis|nucleotide-binding oligomerization domain containing 2 signaling pathway|positive regulation of B cell activation|positive regulation of dendritic cell antigen processing and presentation|positive regulation of epithelial cell proliferation|positive regulation of ERK1 and ERK2 cascade|positive regulation of gamma-delta T cell activation|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interleukin-1 beta secretion|positive regulation of interleukin-10 production|positive regulation of interleukin-17 production|positive regulation of interleukin-6 production|positive regulation of JNK cascade|positive regulation of NF-kappaB transcription factor activity|positive regulation of nitric-oxide synthase biosynthetic process|positive regulation of Notch signaling pathway|positive regulation of phosphatidylinositol 3-kinase activity|positive regulation of prostaglandin-E synthase activity|positive regulation of prostaglandin-endoperoxide synthase activity|positive regulation of stress-activated MAPK cascade|positive regulation of tumor necrosis factor production|positive regulation of type 2 immune response|protein oligomerization|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cell surface|cytosol|plasma membrane|vesicle	ATP binding|CARD domain binding|muramyl dipeptide binding|protein kinase binding			ovary(3)|skin(1)	4		all_cancers(37;0.0156)				ACTGCATCACCTACCTAGGGG	0.408													7	106	---	---	---	---	capture	Silent	SNP	50763750	50763750	NOD2	16	C	T	T	T	1	0	0	0	0	0	0	0	1	301	24	2	2	10424	246
KLHL36	79786	broad.mit.edu	37	16	84691222	84691222	+	Missense_Mutation	SNP	C	A	A			TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:84691222C>A	uc002fig.2	+	3	950	c.809C>A	c.(808-810)GCC>GAC	p.A270D	KLHL36_uc010chl.2_Missense_Mutation_p.A269D	NM_024731	NP_079007	Q8N4N3	KLH36_HUMAN	kelch-like 36	270										skin(2)	2						ATCGAGGAGGCCGTGCGCTAC	0.677													4	52	---	---	---	---	capture	Missense_Mutation	SNP	84691222	84691222	KLHL36	16	C	A	A	A	1	0	0	0	0	1	0	0	0	338	26	4	4	8309	246
ZC3H18	124245	broad.mit.edu	37	16	88643657	88643657	+	Silent	SNP	G	A	A			TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:88643657G>A	uc002fky.2	+	2	326	c.126G>A	c.(124-126)GGG>GGA	p.G42G	ZC3H18_uc010voy.1_Silent_p.G42G|ZC3H18_uc010voz.1_Silent_p.G42G|ZC3H18_uc010vpa.1_Silent_p.G42G	NM_144604	NP_653205	Q86VM9	ZCH18_HUMAN	zinc finger CCCH-type containing 18	42						nucleus	nucleic acid binding|zinc ion binding			skin(1)	1				BRCA - Breast invasive adenocarcinoma(80;0.0542)		ACGGGGCGGGGGTGAGGGCTT	0.612													3	81	---	---	---	---	capture	Silent	SNP	88643657	88643657	ZC3H18	16	G	A	A	A	1	0	0	0	0	0	0	0	1	548	43	2	2	17448	246
NLRP1	22861	broad.mit.edu	37	17	5461860	5461860	+	Missense_Mutation	SNP	A	G	G			TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:5461860A>G	uc002gci.2	-	4	2711	c.2156T>C	c.(2155-2157)CTC>CCC	p.L719P	NLRP1_uc002gcg.1_Missense_Mutation_p.L719P|NLRP1_uc002gck.2_Missense_Mutation_p.L719P|NLRP1_uc002gcj.2_Missense_Mutation_p.L719P|NLRP1_uc002gcl.2_Missense_Mutation_p.L719P|NLRP1_uc002gch.3_Missense_Mutation_p.L719P|NLRP1_uc010clh.2_Missense_Mutation_p.L719P	NM_033004	NP_127497	Q9C000	NALP1_HUMAN	NLR family, pyrin domain containing 1 isoform 1	719					defense response to bacterium|induction of apoptosis|neuron apoptosis|positive regulation of interleukin-1 beta secretion|response to muramyl dipeptide	cytoplasm|NALP1 inflammasome complex|nucleus	ATP binding|caspase activator activity|enzyme binding|protein domain specific binding			lung(4)|breast(2)|ovary(1)|central_nervous_system(1)|skin(1)	9		Colorectal(1115;3.48e-05)				CAAGCAGTGGAGGGACTCCAG	0.537													3	80	---	---	---	---	capture	Missense_Mutation	SNP	5461860	5461860	NLRP1	17	A	G	G	G	1	0	0	0	0	1	0	0	0	143	11	3	3	10378	246
DNAH2	146754	broad.mit.edu	37	17	7643075	7643075	+	Missense_Mutation	SNP	G	A	A			TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7643075G>A	uc002giu.1	+	8	1209	c.1195G>A	c.(1195-1197)GCC>ACC	p.A399T	DNAH2_uc002git.2_Missense_Mutation_p.A481T|DNAH2_uc010vuk.1_Missense_Mutation_p.A399T	NM_020877	NP_065928	Q9P225	DYH2_HUMAN	dynein heavy chain domain 3	399	Stem (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(6)|skin(6)|central_nervous_system(1)	13		all_cancers(10;4.66e-07)|Prostate(122;0.081)				GTATCACTTCGCCCGCTGGGA	0.488													12	62	---	---	---	---	capture	Missense_Mutation	SNP	7643075	7643075	DNAH2	17	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	4559	246
TP53I13	90313	broad.mit.edu	37	17	27899699	27899699	+	Silent	SNP	C	T	T			TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:27899699C>T	uc002hee.2	+	6	1091	c.1053C>T	c.(1051-1053)AGC>AGT	p.S351S		NM_138349	NP_612358	Q8NBR0	P5I13_HUMAN	tumor protein p53 inducible protein 13	351	Cytoplasmic (Potential).					cytoplasm|integral to membrane|plasma membrane					0				READ - Rectum adenocarcinoma(3;0.236)		CAGCGGACAGCCAGGACACAG	0.701													2	6	---	---	---	---	capture	Silent	SNP	27899699	27899699	TP53I13	17	C	T	T	T	1	0	0	0	0	0	0	0	1	337	26	2	2	16269	246
RHBDL3	162494	broad.mit.edu	37	17	30611787	30611787	+	Missense_Mutation	SNP	C	T	T			TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:30611787C>T	uc002hhe.1	+	3	259	c.245C>T	c.(244-246)GCC>GTC	p.A82V	RHBDL3_uc010csw.1_Missense_Mutation_p.A74V|RHBDL3_uc010csx.1_Missense_Mutation_p.A82V|RHBDL3_uc010csy.1_Intron|RHBDL3_uc002hhf.1_Intron	NM_138328	NP_612201	P58872	RHBL3_HUMAN	rhomboid protease 3	82	EF-hand 2.				proteolysis	integral to membrane	calcium ion binding|serine-type endopeptidase activity			ovary(1)	1		Breast(31;0.116)|Ovarian(249;0.182)				CTGGCTCTTGCCGACAGCCAC	0.592													3	121	---	---	---	---	capture	Missense_Mutation	SNP	30611787	30611787	RHBDL3	17	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	13215	246
ZNF207	7756	broad.mit.edu	37	17	30685561	30685561	+	Missense_Mutation	SNP	C	T	T			TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:30685561C>T	uc002hhh.3	+	3	356	c.208C>T	c.(208-210)CCT>TCT	p.P70S	ZNF207_uc002hhj.3_Missense_Mutation_p.P70S|ZNF207_uc002hhi.3_Missense_Mutation_p.P70S|ZNF207_uc010csz.2_Missense_Mutation_p.P73S|ZNF207_uc002hhk.1_Missense_Mutation_p.P70S|ZNF207_uc002hhl.1_5'Flank	NM_003457	NP_003448	O43670	ZN207_HUMAN	zinc finger protein 207 isoform a	70						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		Breast(31;0.116)|Ovarian(249;0.182)	BRCA - Breast invasive adenocarcinoma(9;0.239)			AAATGCAATACCTGGAAGAAC	0.333													24	115	---	---	---	---	capture	Missense_Mutation	SNP	30685561	30685561	ZNF207	17	C	T	T	T	1	0	0	0	0	1	0	0	0	234	18	2	2	17645	246
KRTAP4-9	100132386	broad.mit.edu	37	17	39261693	39261693	+	Missense_Mutation	SNP	A	T	T	rs113059833	by1000genomes	TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:39261693A>T	uc010wfp.1	+	1	53	c.53A>T	c.(52-54)GAC>GTC	p.D18V		NM_001146041	NP_001139513	Q9BYQ8	KRA49_HUMAN	keratin associated protein 4-9	18						keratin filament					0						TGCGGCCAAGACCTCTGTCAG	0.627													9	37	---	---	---	---	capture	Missense_Mutation	SNP	39261693	39261693	KRTAP4-9	17	A	T	T	T	1	0	0	0	0	1	0	0	0	130	10	4	4	8477	246
KRT9	3857	broad.mit.edu	37	17	39725742	39725742	+	Missense_Mutation	SNP	C	T	T			TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:39725742C>T	uc002hxe.3	-	4	1046	c.980G>A	c.(979-981)CGT>CAT	p.R327H	JUP_uc010wfs.1_Intron	NM_000226	NP_000217	P35527	K1C9_HUMAN	keratin 9	327	Rod.|Coil 2.				intermediate filament organization|skin development		protein binding|structural constituent of cytoskeleton			ovary(1)|central_nervous_system(1)|pancreas(1)	3		Breast(137;0.000307)				ATACTCCTGACGCATGTCATT	0.448													44	82	---	---	---	---	capture	Missense_Mutation	SNP	39725742	39725742	KRT9	17	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	8421	246
ACLY	47	broad.mit.edu	37	17	40065323	40065323	+	Splice_Site	SNP	T	G	G			TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:40065323T>G	uc002hyg.2	-	6	700	c.537_splice	c.e6-1	p.E179_splice	ACLY_uc002hyh.2_Splice_Site_p.E179_splice|ACLY_uc002hyi.2_Splice_Site_p.E233_splice|ACLY_uc010wfx.1_Splice_Site_p.E233_splice|ACLY_uc010wfy.1_Intron	NM_001096	NP_001087	P53396	ACLY_HUMAN	ATP citrate lyase isoform 1						ATP catabolic process|cellular carbohydrate metabolic process|citrate metabolic process|coenzyme A metabolic process|energy reserve metabolic process|long-chain fatty-acyl-CoA biosynthetic process|positive regulation of cellular metabolic process|triglyceride biosynthetic process	citrate lyase complex|cytosol|nucleus	ATP binding|ATP citrate synthase activity|citrate (pro-3S)-lyase activity|metal ion binding|protein binding|succinate-CoA ligase (ADP-forming) activity			ovary(2)|central_nervous_system(1)	3		Breast(137;0.000143)				GCCAGAATTCTAGAGGTGGGA	0.562													2	31	---	---	---	---	capture	Splice_Site	SNP	40065323	40065323	ACLY	17	T	G	G	G	1	0	0	0	0	0	0	1	0	689	53	5	4	143	246
SMCHD1	23347	broad.mit.edu	37	18	2752502	2752502	+	Missense_Mutation	SNP	G	A	A			TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:2752502G>A	uc002klm.3	+	34	4487	c.4298G>A	c.(4297-4299)TGT>TAT	p.C1433Y	SMCHD1_uc002klk.3_RNA|SMCHD1_uc002kll.3_RNA	NM_015295	NP_056110	A6NHR9	SMHD1_HUMAN	structural maintenance of chromosomes flexible	1433					chromosome organization		ATP binding				0						ACATTTAGTTGTAATAAAATA	0.303													11	45	---	---	---	---	capture	Missense_Mutation	SNP	2752502	2752502	SMCHD1	18	G	A	A	A	1	0	0	0	0	1	0	0	0	624	48	2	2	14680	246
LAMA1	284217	broad.mit.edu	37	18	7036079	7036079	+	Silent	SNP	C	T	T			TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:7036079C>T	uc002knm.2	-	13	1840	c.1746G>A	c.(1744-1746)GCG>GCA	p.A582A	LAMA1_uc010wzj.1_Silent_p.A58A	NM_005559	NP_005550	P25391	LAMA1_HUMAN	laminin, alpha 1 precursor	582	Laminin IV type A 1.				axon guidance|cell adhesion|cell surface receptor linked signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	extracellular space|laminin-1 complex|laminin-3 complex	extracellular matrix structural constituent|receptor binding			ovary(8)|large_intestine(4)|upper_aerodigestive_tract(2)|breast(2)|skin(2)|pancreas(2)|central_nervous_system(1)	21		Colorectal(10;0.172)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	ATCCGCCAAACGCAGTCAGCT	0.463													19	53	---	---	---	---	capture	Silent	SNP	7036079	7036079	LAMA1	18	C	T	T	T	1	0	0	0	0	0	0	0	1	236	19	1	1	8525	246
PTBP1	5725	broad.mit.edu	37	19	804908	804908	+	Missense_Mutation	SNP	C	T	T			TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:804908C>T	uc002lpr.2	+	7	792	c.686C>T	c.(685-687)GCG>GTG	p.A229V	PTBP1_uc002lpp.2_Missense_Mutation_p.A229V|PTBP1_uc002lpq.2_Missense_Mutation_p.A229V|PTBP1_uc002lps.2_Intron|PTBP1_uc002lpt.2_RNA|PTBP1_uc002lpu.1_Missense_Mutation_p.A199V	NM_031991	NP_114368	P26599	PTBP1_HUMAN	polypyrimidine tract-binding protein 1 isoform	229	RRM 2.				negative regulation of muscle cell differentiation|nuclear mRNA splicing, via spliceosome|regulation of alternative nuclear mRNA splicing, via spliceosome	heterogeneous nuclear ribonucleoprotein complex|nucleolus|nucleoplasm	mRNA binding|nucleotide binding|poly-pyrimidine tract binding|protein binding			kidney(1)|skin(1)	2		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;6.59e-06)|all_lung(49;9.97e-06)|Breast(49;0.000172)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CTGCAGTATGCGGACCCCGTG	0.662													3	126	---	---	---	---	capture	Missense_Mutation	SNP	804908	804908	PTBP1	19	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	12620	246
SBNO2	22904	broad.mit.edu	37	19	1119057	1119057	+	Missense_Mutation	SNP	G	A	A			TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:1119057G>A	uc002lrk.3	-	14	1718	c.1480C>T	c.(1480-1482)CCG>TCG	p.P494S	SBNO2_uc002lrj.3_Missense_Mutation_p.P437S|SBNO2_uc010dse.2_Missense_Mutation_p.P487S|SBNO2_uc010xgj.1_Intron|SBNO2_uc010dsf.2_Missense_Mutation_p.P437S	NM_014963	NP_055778	Q9Y2G9	SBNO2_HUMAN	strawberry notch homolog 2 isoform 1	494					macrophage activation involved in immune response|negative regulation of transcription, DNA-dependent|regulation of inflammatory response|transcription, DNA-dependent						0		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGGGCCAGCGGGATCTCCTCG	0.657													2	22	---	---	---	---	capture	Missense_Mutation	SNP	1119057	1119057	SBNO2	19	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	13755	246
TLE2	7089	broad.mit.edu	37	19	3013710	3013710	+	Missense_Mutation	SNP	G	A	A			TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:3013710G>A	uc002lww.2	-	11	1093	c.830C>T	c.(829-831)TCT>TTT	p.S277F	TLE2_uc010xhb.1_5'UTR|TLE2_uc010dth.2_Missense_Mutation_p.S278F|TLE2_uc010xhc.1_Missense_Mutation_p.S155F|TLE2_uc010dti.2_Missense_Mutation_p.S291F|TLE2_uc010xhd.1_Missense_Mutation_p.S185F	NM_003260	NP_003251	Q04725	TLE2_HUMAN	transducin-like enhancer protein 2 isoform 1	277	Pro/Ser-rich.				negative regulation of canonical Wnt receptor signaling pathway|negative regulation of transcription, DNA-dependent|organ morphogenesis|transcription, DNA-dependent|Wnt receptor signaling pathway	nucleus	protein binding|transcription corepressor activity				0				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCCAAGGCTAGAGGCCAAGGA	0.642													20	69	---	---	---	---	capture	Missense_Mutation	SNP	3013710	3013710	TLE2	19	G	A	A	A	1	0	0	0	0	1	0	0	0	429	33	2	2	15824	246
MUC16	94025	broad.mit.edu	37	19	8997446	8997446	+	Missense_Mutation	SNP	T	G	G			TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:8997446T>G	uc002mkp.2	-	59	41180	c.40976A>C	c.(40975-40977)AAG>ACG	p.K13659T	MUC16_uc010dwi.2_RNA|MUC16_uc010dwj.2_Missense_Mutation_p.K476T|MUC16_uc010xki.1_RNA	NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	13661	Extracellular (Potential).|SEA 11.			Missing (in Ref. 3; AAK74120).	cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						GGTGTTGAACTTCCTGGAGCC	0.567													8	204	---	---	---	---	capture	Missense_Mutation	SNP	8997446	8997446	MUC16	19	T	G	G	G	1	0	0	0	0	1	0	0	0	728	56	4	4	9883	246
ZNF527	84503	broad.mit.edu	37	19	37880558	37880558	+	Missense_Mutation	SNP	G	A	A			TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:37880558G>A	uc010efk.1	+	5	1718	c.1607G>A	c.(1606-1608)AGT>AAT	p.S536N	ZNF527_uc002ogf.3_Missense_Mutation_p.S504N|ZNF527_uc010xtq.1_RNA	NM_032453	NP_115829	Q8NB42	ZN527_HUMAN	zinc finger protein 527	536	C2H2-type 10.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			AAGGCCTTCAGTTGTGGCTCA	0.398													57	122	---	---	---	---	capture	Missense_Mutation	SNP	37880558	37880558	ZNF527	19	G	A	A	A	1	0	0	0	0	1	0	0	0	468	36	2	2	17847	246
ZNF229	7772	broad.mit.edu	37	19	44933459	44933459	+	Silent	SNP	A	G	G			TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:44933459A>G	uc002oze.1	-	6	1931	c.1497T>C	c.(1495-1497)AGT>AGC	p.S499S	ZNF229_uc010ejk.1_Silent_p.S153S|ZNF229_uc010ejl.1_Silent_p.S493S	NM_014518	NP_055333	Q9UJW7	ZN229_HUMAN	zinc finger protein 229	499	C2H2-type 7.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(2)|ovary(1)|pancreas(1)	4		Prostate(69;0.0352)				ACGAGTTGTGACTGAAACCTT	0.517													58	208	---	---	---	---	capture	Silent	SNP	44933459	44933459	ZNF229	19	A	G	G	G	1	0	0	0	0	0	0	0	1	128	10	3	3	17662	246
ZNF816A	125893	broad.mit.edu	37	19	53454033	53454033	+	Missense_Mutation	SNP	C	T	T			TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:53454033C>T	uc002qal.1	-	5	1296	c.995G>A	c.(994-996)CGT>CAT	p.R332H	ZNF321_uc010eqj.2_Intron|ZNF321_uc002qak.1_Intron|ZNF816A_uc002qam.1_Missense_Mutation_p.R316H	NM_001031665	NP_001026835	Q0VGE8	ZN816_HUMAN	zinc finger protein 816A	332	C2H2-type 4.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0				GBM - Glioblastoma multiforme(134;0.0313)		ATGAAGTCTACGATGGCATCT	0.423													136	244	---	---	---	---	capture	Missense_Mutation	SNP	53454033	53454033	ZNF816A	19	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	18053	246
TPO	7173	broad.mit.edu	37	2	1459947	1459947	+	Missense_Mutation	SNP	G	A	A			TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:1459947G>A	uc002qww.2	+	7	803	c.712G>A	c.(712-714)GAC>AAC	p.D238N	TPO_uc010ewj.2_Intron|TPO_uc002qwu.2_Missense_Mutation_p.D238N|TPO_uc002qwr.2_Missense_Mutation_p.D238N|TPO_uc002qwx.2_Missense_Mutation_p.D238N|TPO_uc010yio.1_Missense_Mutation_p.D238N|TPO_uc010yip.1_Missense_Mutation_p.D238N	NM_000547	NP_000538	P07202	PERT_HUMAN	thyroid peroxidase isoform a	238	Extracellular (Potential).	Heme (covalent; via 2 links) (By similarity).			cellular nitrogen compound metabolic process|hormone biosynthetic process|hydrogen peroxide catabolic process	cell surface|cytoplasm|integral to plasma membrane	calcium ion binding|heme binding|iodide peroxidase activity			ovary(7)|pancreas(6)|skin(5)|lung(1)|kidney(1)	20	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.0338)		all cancers(51;0.0356)|OV - Ovarian serous cystadenocarcinoma(76;0.0748)|Epithelial(75;0.12)	Carbimazole(DB00389)|Methimazole(DB00763)|Propylthiouracil(DB00550)	ACAATACATCGACCACGACAT	0.522													43	82	---	---	---	---	capture	Missense_Mutation	SNP	1459947	1459947	TPO	2	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	16293	246
NT5C1B	93034	broad.mit.edu	37	2	18765887	18765887	+	Missense_Mutation	SNP	C	T	T			TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:18765887C>T	uc002rcz.2	-	5	900	c.796G>A	c.(796-798)GAG>AAG	p.E266K	NT5C1B_uc002rcy.2_Missense_Mutation_p.E266K|NT5C1B_uc010exr.2_Missense_Mutation_p.E208K|NT5C1B_uc010yju.1_Missense_Mutation_p.E206K|NT5C1B_uc002rda.2_Missense_Mutation_p.E206K|NT5C1B_uc010yjv.1_Missense_Mutation_p.E283K|NT5C1B_uc010yjw.1_Missense_Mutation_p.E249K|NT5C1B_uc010exs.2_Missense_Mutation_p.E268K|NT5C1B_uc002rdb.1_Missense_Mutation_p.E58K	NM_001002006	NP_001002006	Q96P26	5NT1B_HUMAN	5' nucleotidase, cytosolic IB isoform 1	266					purine base metabolic process|purine nucleotide catabolic process	cytosol	5'-nucleotidase activity|magnesium ion binding|nucleotide binding			skin(2)|ovary(1)	3	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.177)	Ovarian(717;0.208)				TGCTGCTGCTCGGACAGAGAG	0.652													3	13	---	---	---	---	capture	Missense_Mutation	SNP	18765887	18765887	NT5C1B	2	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	10593	246
APOB	338	broad.mit.edu	37	2	21231021	21231021	+	Missense_Mutation	SNP	G	A	A			TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:21231021G>A	uc002red.2	-	26	8847	c.8719C>T	c.(8719-8721)CGC>TGC	p.R2907C		NM_000384	NP_000375	P04114	APOB_HUMAN	apolipoprotein B precursor	2907					cholesterol homeostasis|cholesterol metabolic process|leukocyte migration|low-density lipoprotein particle clearance|low-density lipoprotein particle remodeling|platelet activation|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis|response to virus	chylomicron remnant|clathrin-coated endocytic vesicle membrane|endoplasmic reticulum lumen|endoplasmic reticulum membrane|endosome lumen|endosome membrane|intermediate-density lipoprotein particle|low-density lipoprotein particle|mature chylomicron|microsome|plasma membrane|very-low-density lipoprotein particle	cholesterol transporter activity|enzyme binding|heparin binding|low-density lipoprotein particle receptor binding|phospholipid binding|protein heterodimerization activity			ovary(11)|skin(9)|central_nervous_system(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)	27	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Atorvastatin(DB01076)	ATCTCGTTGCGCAGGTCAGCC	0.468													16	497	---	---	---	---	capture	Missense_Mutation	SNP	21231021	21231021	APOB	2	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	778	246
ALK	238	broad.mit.edu	37	2	29443572	29443572	+	Silent	SNP	C	T	T			TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:29443572C>T	uc002rmy.2	-	23	4552	c.3645G>A	c.(3643-3645)CCG>CCA	p.P1215P	ALK_uc010ymo.1_Silent_p.P147P	NM_004304	NP_004295	Q9UM73	ALK_HUMAN	anaplastic lymphoma kinase precursor	1215	Protein kinase.|Cytoplasmic (Potential).				protein autophosphorylation|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|protein binding|transmembrane receptor protein tyrosine kinase activity		NPM1/ALK(632)|EML4/ALK(246)|CLTC/ALK(44)|TPM3/ALK(33)|ATIC/ALK(24)|RANBP2/ALK(16)|TPM4/ALK(12)|TFG/ALK(7)|MSN/ALK(6)|CARS/ALK(5)|VCL/ALK(4)|KIF5B/ALK(4)|PPFIBP1/ALK(3)|SEC31A/ALK(3)|SQSTM1/ALK(2)	haematopoietic_and_lymphoid_tissue(726)|lung(262)|autonomic_ganglia(148)|soft_tissue(61)|breast(4)|kidney(4)|large_intestine(3)|skin(3)|ovary(3)|thyroid(2)|central_nervous_system(1)|pancreas(1)	1218	Acute lymphoblastic leukemia(172;0.155)				Adenosine triphosphate(DB00171)	TCTCACTCACCGGGCGAGGGC	0.612			T|Mis|A	NPM1|TPM3|TFG|TPM4|ATIC|CLTC|MSN|ALO17|CARS|EML4	ALCL|NSCLC|Neuroblastoma	neuroblastoma			Neuroblastoma_Familial_Clustering_of|Congenital_Central_Hypoventilation_Syndrome				3	82	---	---	---	---	capture	Silent	SNP	29443572	29443572	ALK	2	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	525	246
RGPD3	653489	broad.mit.edu	37	2	107049631	107049631	+	Silent	SNP	C	T	T			TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:107049631C>T	uc010ywi.1	-	16	2373	c.2316G>A	c.(2314-2316)GCG>GCA	p.A772A		NM_001144013	NP_001137485	A6NKT7	RGPD3_HUMAN	RANBP2-like and GRIP domain containing 3	772					intracellular transport		binding			ovary(1)	1						TTTCTGAATCCGCATTTCGCA	0.373													5	292	---	---	---	---	capture	Silent	SNP	107049631	107049631	RGPD3	2	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	13180	246
POTEF	728378	broad.mit.edu	37	2	130877830	130877830	+	Missense_Mutation	SNP	C	T	T			TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:130877830C>T	uc010fmh.2	-	3	659	c.259G>A	c.(259-261)GAC>AAC	p.D87N		NM_001099771	NP_001093241	A5A3E0	POTEF_HUMAN	prostate, ovary, testis expressed protein on	87						cell cortex	ATP binding			skin(3)|ovary(2)	5						GCAGAGTCGTCGTGGTCTCCA	0.602													22	342	---	---	---	---	capture	Missense_Mutation	SNP	130877830	130877830	POTEF	2	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	12166	246
POTEE	445582	broad.mit.edu	37	2	131976234	131976234	+	Missense_Mutation	SNP	G	A	A			TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:131976234G>A	uc002tsn.2	+	1	311	c.259G>A	c.(259-261)GAC>AAC	p.D87N	PLEKHB2_uc002tsh.2_Intron|POTEE_uc002tsk.2_5'UTR|POTEE_uc002tsl.2_5'UTR	NM_001083538	NP_001077007	Q6S8J3	POTEE_HUMAN	protein expressed in prostate, ovary, testis,	87							ATP binding				0						TGGAGACCACGACGACTCTGC	0.602													44	122	---	---	---	---	capture	Missense_Mutation	SNP	131976234	131976234	POTEE	2	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	12165	246
SCN1A	6323	broad.mit.edu	37	2	166850722	166850722	+	Missense_Mutation	SNP	G	A	A	rs121917993		TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:166850722G>A	uc010zcz.1	-	25	4771	c.4753C>T	c.(4753-4755)CGC>TGC	p.R1585C		NM_006920	NP_008851	P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha	1596	IV.					voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(6)|skin(6)|large_intestine(1)	13					Lamotrigine(DB00555)|Levetiracetam(DB01202)|Phenacemide(DB01121)|Phenytoin(DB00252)|Topiramate(DB00273)|Zonisamide(DB00909)	TAATAATGGCGTAGAGAGATG	0.338													24	50	---	---	---	---	capture	Missense_Mutation	SNP	166850722	166850722	SCN1A	2	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	13807	246
TTN	7273	broad.mit.edu	37	2	179587016	179587016	+	Missense_Mutation	SNP	C	T	T			TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179587016C>T	uc010zfg.1	-	74	18990	c.18766G>A	c.(18766-18768)GCA>ACA	p.A6256T	TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Missense_Mutation_p.A2917T	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	7183							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTAGAAGATGCTGTTCCAAGT	0.408													3	71	---	---	---	---	capture	Missense_Mutation	SNP	179587016	179587016	TTN	2	C	T	T	T	1	0	0	0	0	1	0	0	0	364	28	2	2	16617	246
UBE2E3	10477	broad.mit.edu	37	2	181846854	181846854	+	Missense_Mutation	SNP	G	A	A			TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:181846854G>A	uc002unq.1	+	3	304	c.85G>A	c.(85-87)GCT>ACT	p.A29T	UBE2E3_uc002unr.1_Missense_Mutation_p.A29T|UBE2E3_uc010fri.1_Missense_Mutation_p.A29T	NM_182678	NP_872619	Q969T4	UB2E3_HUMAN	ubiquitin-conjugating enzyme E2E 3	29					protein K11-linked ubiquitination|protein K48-linked ubiquitination|protein K63-linked ubiquitination|regulation of growth	cytoplasm|nucleolus	ATP binding|protein binding|ubiquitin-protein ligase activity			ovary(1)	1						AGACCCAGCCGCTCCAGAGCC	0.507													4	84	---	---	---	---	capture	Missense_Mutation	SNP	181846854	181846854	UBE2E3	2	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	16736	246
HIBCH	26275	broad.mit.edu	37	2	191110923	191110923	+	Missense_Mutation	SNP	C	T	T			TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:191110923C>T	uc002uru.2	-	10	849	c.766G>A	c.(766-768)GAC>AAC	p.D256N	HIBCH_uc002urv.2_Missense_Mutation_p.D256N	NM_014362	NP_055177	Q6NVY1	HIBCH_HUMAN	3-hydroxyisobutyryl-Coenzyme A hydrolase isoform	256					branched chain family amino acid catabolic process	mitochondrial matrix	3-hydroxyisobutyryl-CoA hydrolase activity|protein binding				0			OV - Ovarian serous cystadenocarcinoma(117;0.000586)|Epithelial(96;0.0286)|all cancers(119;0.0814)			AAAGACTTGTCTCGATCAATC	0.254													12	35	---	---	---	---	capture	Missense_Mutation	SNP	191110923	191110923	HIBCH	2	C	T	T	T	1	0	0	0	0	1	0	0	0	416	32	2	2	7025	246
PRIC285	85441	broad.mit.edu	37	20	62198405	62198405	+	Missense_Mutation	SNP	C	T	T			TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:62198405C>T	uc002yfm.2	-	7	3198	c.2306G>A	c.(2305-2307)GGC>GAC	p.G769D	PRIC285_uc002yfl.1_Missense_Mutation_p.G200D	NM_001037335	NP_001032412	Q9BYK8	PR285_HUMAN	PPAR-alpha interacting complex protein 285	769					cellular lipid metabolic process|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleoplasm	ATP binding|DNA binding|helicase activity|ribonuclease activity|RNA binding|transcription coactivator activity|zinc ion binding			central_nervous_system(2)	2	all_cancers(38;2.51e-11)|all_epithelial(29;8.27e-13)		Epithelial(9;1.27e-08)|all cancers(9;7.32e-08)|BRCA - Breast invasive adenocarcinoma(10;5.15e-06)			CGGAACCTTGCCCCTGGCGTG	0.652													7	122	---	---	---	---	capture	Missense_Mutation	SNP	62198405	62198405	PRIC285	20	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	12381	246
KRTAP20-2	337976	broad.mit.edu	37	21	32007617	32007617	+	Missense_Mutation	SNP	G	A	A			TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:32007617G>A	uc011adg.1	+	1	35	c.35G>A	c.(34-36)CGT>CAT	p.R12H		NM_181616	NP_853647	Q3LI61	KR202_HUMAN	keratin associated protein 20-2	12						intermediate filament				central_nervous_system(1)	1						GGTGGTCTGCGTTATGGCTAT	0.522													36	101	---	---	---	---	capture	Missense_Mutation	SNP	32007617	32007617	KRTAP20-2	21	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	8457	246
ICOSLG	23308	broad.mit.edu	37	21	45657002	45657002	+	Missense_Mutation	SNP	C	T	T			TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:45657002C>T	uc002zee.2	-	3	288	c.154G>A	c.(154-156)GTA>ATA	p.V52I	ICOSLG_uc011afc.1_Intron|ICOSLG_uc002zef.2_Intron|ICOSLG_uc010gpp.1_Missense_Mutation_p.V52I	NM_015259	NP_056074	O75144	ICOSL_HUMAN	inducible T-cell co-stimulator ligand precursor	52	Ig-like V-type.|Extracellular (Potential).				B cell activation|defense response|hyperosmotic response|positive regulation of activated T cell proliferation|signal transduction|T cell activation|T cell costimulation		receptor binding				0				Colorectal(79;0.0163)|READ - Rectum adenocarcinoma(84;0.0772)		TGCCAATATACGTAAACATCA	0.522													15	130	---	---	---	---	capture	Missense_Mutation	SNP	45657002	45657002	ICOSLG	21	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	7412	246
C21orf29	54084	broad.mit.edu	37	21	45945664	45945664	+	Missense_Mutation	SNP	A	G	G			TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:45945664A>G	uc002zfe.1	-	8	1274	c.1208T>C	c.(1207-1209)ATT>ACT	p.I403T	C21orf29_uc010gpv.1_Missense_Mutation_p.I335T	NM_144991	NP_659428	Q8WU66	TSEAR_HUMAN	chromosome 21 open reading frame 29 precursor	403	EAR 2.				cell adhesion	extracellular region	structural molecule activity				0						CCATTTGTAAATGACAGAGAA	0.522													7	475	---	---	---	---	capture	Missense_Mutation	SNP	45945664	45945664	C21orf29	21	A	G	G	G	1	0	0	0	0	1	0	0	0	52	4	3	3	2105	246
PCBP3	54039	broad.mit.edu	37	21	47355174	47355174	+	Silent	SNP	C	T	T			TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:47355174C>T	uc002zhq.1	+	12	989	c.864C>T	c.(862-864)GAC>GAT	p.D288D	PCBP3_uc010gqb.2_Silent_p.D288D|PCBP3_uc002zhp.1_Silent_p.D268D|PCBP3_uc002zhs.1_Silent_p.D262D|PCBP3_uc002zhr.1_Silent_p.D287D|PCBP3_uc002zht.1_Silent_p.D278D	NM_020528	NP_065389	P57721	PCBP3_HUMAN	poly(rC) binding protein 3 isoform 1	288					mRNA metabolic process	cytosol|mitochondrion|nucleus|ribonucleoprotein complex	DNA binding|RNA binding			skin(1)	1	all_hematologic(128;0.24)			Colorectal(79;0.0411)|READ - Rectum adenocarcinoma(84;0.0649)		CAGGTCTGGACGCCAGCCCAC	0.577													14	44	---	---	---	---	capture	Silent	SNP	47355174	47355174	PCBP3	21	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	11405	246
RFPL2	10739	broad.mit.edu	37	22	32586778	32586778	+	Missense_Mutation	SNP	C	T	T			TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:32586778C>T	uc003amg.3	-	5	2054	c.1118G>A	c.(1117-1119)CGT>CAT	p.R373H	RFPL2_uc003ame.3_Missense_Mutation_p.R312H|RFPL2_uc003amf.3_Missense_Mutation_p.R283H|RFPL2_uc003amh.3_Missense_Mutation_p.R283H	NM_001098527	NP_001091997	O75678	RFPL2_HUMAN	ret finger protein-like 2 isoform 2	373							zinc ion binding			skin(1)	1						CTCCCCAGGACGGACTGGAGC	0.463													61	217	---	---	---	---	capture	Missense_Mutation	SNP	32586778	32586778	RFPL2	22	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	13149	246
RFPL3	10738	broad.mit.edu	37	22	32756800	32756800	+	Missense_Mutation	SNP	G	A	A			TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:32756800G>A	uc003amj.2	+	2	1140	c.935G>A	c.(934-936)CGT>CAT	p.R312H	RFPL3_uc010gwn.2_Missense_Mutation_p.R283H|RFPL3S_uc003amk.2_RNA|RFPL3S_uc003aml.2_RNA	NM_001098535	NP_001092005	O75679	RFPL3_HUMAN	ret finger protein-like 3 isoform 1	312							zinc ion binding			ovary(1)	1						GCTCCAGTCCGTCCTGGGGAG	0.458													6	131	---	---	---	---	capture	Missense_Mutation	SNP	32756800	32756800	RFPL3	22	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	13150	246
NBEAL2	23218	broad.mit.edu	37	3	47041457	47041457	+	Missense_Mutation	SNP	C	T	T			TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:47041457C>T	uc003cqp.2	+	27	4047	c.3868C>T	c.(3868-3870)CGG>TGG	p.R1290W	NBEAL2_uc010hjm.1_Intron|NBEAL2_uc010hjn.1_5'Flank	NM_015175	NP_055990	Q6ZNJ1	NBEL2_HUMAN	neurobeachin-like 2	1290							binding			ovary(1)	1		Acute lymphoblastic leukemia(5;0.0534)		BRCA - Breast invasive adenocarcinoma(193;0.0012)|KIRC - Kidney renal clear cell carcinoma(197;0.00575)|Kidney(197;0.00656)		TGTGCTGACCCGGCTATATGT	0.637													3	26	---	---	---	---	capture	Missense_Mutation	SNP	47041457	47041457	NBEAL2	3	C	T	T	T	1	0	0	0	0	1	0	0	0	295	23	1	1	10096	246
CACNA2D2	9254	broad.mit.edu	37	3	50414925	50414925	+	Missense_Mutation	SNP	G	T	T			TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:50414925G>T	uc003daq.2	-	17	1637	c.1599C>A	c.(1597-1599)GAC>GAA	p.D533E	CACNA2D2_uc003dap.2_Missense_Mutation_p.D533E	NM_006030	NP_006021	Q9NY47	CA2D2_HUMAN	calcium channel, voltage-dependent, alpha	533	Cache.|Extracellular (Potential).				energy reserve metabolic process|regulation of insulin secretion	integral to membrane|plasma membrane	calcium channel activity|metal ion binding|voltage-gated ion channel activity			lung(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.000365)|KIRC - Kidney renal clear cell carcinoma(197;0.00862)|Kidney(197;0.01)	Gabapentin(DB00996)	GCCTCTTGATGTCATTCAGAG	0.597													3	74	---	---	---	---	capture	Missense_Mutation	SNP	50414925	50414925	CACNA2D2	3	G	T	T	T	1	0	0	0	0	1	0	0	0	620	48	4	4	2525	246
NR1I2	8856	broad.mit.edu	37	3	119536025	119536025	+	Missense_Mutation	SNP	T	C	C			TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:119536025T>C	uc003edj.2	+	9	3110	c.1271T>C	c.(1270-1272)CTC>CCC	p.L424P	NR1I2_uc003edi.2_Missense_Mutation_p.L387P|NR1I2_uc003edk.2_Missense_Mutation_p.L463P|NR1I2_uc003edl.2_Missense_Mutation_p.L312P	NM_003889	NP_003880	O75469	NR1I2_HUMAN	nuclear receptor subfamily 1, group I, member 2	424	Ligand-binding.				drug export|exogenous drug catabolic process|negative regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|steroid metabolic process|xenobiotic metabolic process|xenobiotic transport	nucleoplasm	drug binding|protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|transcription coactivator activity|zinc ion binding			ovary(2)	2				GBM - Glioblastoma multiforme(114;0.175)	Estradiol(DB00783)|Ethinyl Estradiol(DB00977)|Rifampin(DB01045)|Vitamin E(DB00163)	GCTACGCCCCTCATGCAGGAG	0.622													4	127	---	---	---	---	capture	Missense_Mutation	SNP	119536025	119536025	NR1I2	3	T	C	C	C	1	0	0	0	0	1	0	0	0	702	54	3	3	10527	246
CSTA	1475	broad.mit.edu	37	3	122060340	122060340	+	Missense_Mutation	SNP	G	A	A			TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:122060340G>A	uc003eex.2	+	3	352	c.223G>A	c.(223-225)GGA>AGA	p.G75R		NM_005213	NP_005204	P01040	CYTA_HUMAN	cystatin A	75					keratinocyte differentiation|peptide cross-linking	cornified envelope|cytoplasm|nucleus	cysteine-type endopeptidase inhibitor activity|protease binding|protein binding, bridging|structural molecule activity				0				GBM - Glioblastoma multiforme(114;0.155)		AAGTCTTCCCGGACAAAATGA	0.378													49	140	---	---	---	---	capture	Missense_Mutation	SNP	122060340	122060340	CSTA	3	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	3946	246
CLSTN2	64084	broad.mit.edu	37	3	140178466	140178466	+	Silent	SNP	C	T	T			TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:140178466C>T	uc003etn.2	+	7	1267	c.1077C>T	c.(1075-1077)GAC>GAT	p.D359D	CLSTN2_uc003etm.2_Silent_p.D359D	NM_022131	NP_071414	Q9H4D0	CSTN2_HUMAN	calsyntenin 2 precursor	359	Extracellular (Potential).				homophilic cell adhesion	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|plasma membrane	calcium ion binding			skin(3)|large_intestine(2)|pancreas(1)|central_nervous_system(1)	7						TCAAGTTTGACGGCAGGCAGG	0.577										HNSCC(16;0.037)			33	67	---	---	---	---	capture	Silent	SNP	140178466	140178466	CLSTN2	3	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	3527	246
ETV5	2119	broad.mit.edu	37	3	185766628	185766628	+	Missense_Mutation	SNP	A	G	G			TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:185766628A>G	uc003fpz.2	-	13	1580	c.1333T>C	c.(1333-1335)TAC>CAC	p.Y445H	ETV5_uc003fpy.2_Missense_Mutation_p.Y487H	NM_004454	NP_004445	P41161	ETV5_HUMAN	ets variant gene 5 (ets-related molecule)	445	ETS.				cellular response to oxidative stress	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding	p.Y445C(2)		ovary(2)|skin(2)|breast(1)	5	all_cancers(143;4.06e-12)|Ovarian(172;0.0386)|Breast(254;0.247)		OV - Ovarian serous cystadenocarcinoma(80;1.62e-24)			ACAAATTTGTAGACGTATCGC	0.562			T	TMPRSS2|SCL45A3	Prostate 								3	65	---	---	---	---	capture	Missense_Mutation	SNP	185766628	185766628	ETV5	3	A	G	G	G	1	0	0	0	0	1	0	0	0	195	15	3	3	5237	246
SST	6750	broad.mit.edu	37	3	187387016	187387016	+	Missense_Mutation	SNP	G	A	A	rs149673471		TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:187387016G>A	uc003frn.2	-	2	310	c.188C>T	c.(187-189)ACG>ATG	p.T63M		NM_001048	NP_001039	P61278	SMS_HUMAN	somatostatin preproprotein	63					digestion|G-protein coupled receptor protein signaling pathway|induction of apoptosis by hormones|negative regulation of cell proliferation|response to nutrient|synaptic transmission	extracellular space	hormone activity			pancreas(1)	1	all_cancers(143;4.06e-12)|Ovarian(172;0.0418)		OV - Ovarian serous cystadenocarcinoma(80;1.76e-18)	GBM - Glioblastoma multiforme(93;0.00444)	Bromocriptine(DB01200)|Cysteamine(DB00847)	ATCATTCTCCGTCTGGTTGGG	0.517													12	660	---	---	---	---	capture	Missense_Mutation	SNP	187387016	187387016	SST	3	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	15088	246
ZNF718	255403	broad.mit.edu	37	4	155819	155819	+	Missense_Mutation	SNP	T	G	G			TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:155819T>G	uc003fzt.3	+	8	1477	c.1344T>G	c.(1342-1344)GAT>GAG	p.D448E	ZNF595_uc003fzu.1_Intron|ZNF718_uc010iaz.2_RNA|ZNF718_uc003fzw.3_3'UTR	NM_001039127	NP_001034216	Q3SXZ3	ZN718_HUMAN	zinc finger protein 718	448					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_cancers(4;0.0738)|all_epithelial(65;0.139)		Lung(54;0.0681)|Epithelial(2;0.0838)|all cancers(2;0.135)|LUSC - Lung squamous cell carcinoma(95;0.18)		ACACTGTAGATAAACCCTACA	0.353													3	21	---	---	---	---	capture	Missense_Mutation	SNP	155819	155819	ZNF718	4	T	G	G	G	1	0	0	0	0	1	0	0	0	634	49	4	4	17996	246
FGFRL1	53834	broad.mit.edu	37	4	1018886	1018886	+	Silent	SNP	G	A	A			TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:1018886G>A	uc003gce.2	+	7	1427	c.1266G>A	c.(1264-1266)ACG>ACA	p.T422T	FGFRL1_uc003gcf.2_Silent_p.T422T|FGFRL1_uc003gcg.2_Silent_p.T422T|FGFRL1_uc010ibo.2_Silent_p.T422T	NM_021923	NP_068742	Q8N441	FGRL1_HUMAN	fibroblast growth factor receptor-like 1	422	Cytoplasmic (Potential).				regulation of cell growth	integral to membrane|plasma membrane	fibroblast growth factor receptor activity|heparin binding				0			OV - Ovarian serous cystadenocarcinoma(23;0.0158)			CGCCGGGGACGGCCCGCGACC	0.731													11	12	---	---	---	---	capture	Silent	SNP	1018886	1018886	FGFRL1	4	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	5815	246
TLR6	10333	broad.mit.edu	37	4	38829218	38829218	+	Missense_Mutation	SNP	C	T	T			TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:38829218C>T	uc003gtm.2	-	1	1943	c.1877G>A	c.(1876-1878)CGC>CAC	p.R626H	TLR6_uc010ifg.1_Missense_Mutation_p.R626H	NM_006068	NP_006059	Q9Y2C9	TLR6_HUMAN	toll-like receptor 6 precursor	626	Cytoplasmic (Potential).				activation of NF-kappaB-inducing kinase activity|cellular response to diacyl bacterial lipopeptide|defense response to bacterium|detection of diacyl bacterial lipopeptide|inflammatory response|innate immune response|MyD88-dependent toll-like receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interleukin-6 biosynthetic process|positive regulation of JUN kinase activity|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	integral to plasma membrane|phagocytic vesicle membrane	lipopeptide binding|transmembrane receptor activity			ovary(2)	2						CCTGGCCCTGCGCCGAGTCTG	0.502													8	238	---	---	---	---	capture	Missense_Mutation	SNP	38829218	38829218	TLR6	4	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	15840	246
PITX2	5308	broad.mit.edu	37	4	111553638	111553638	+	Splice_Site	SNP	T	A	A			TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:111553638T>A	uc003iad.2	-	3	629	c.47_splice	c.e3-1	p.G16_splice	PITX2_uc003iae.2_Intron|PITX2_uc010iml.2_Splice_Site|PITX2_uc003iaf.2_Splice_Site_p.G16_splice	NM_153426	NP_700475	Q99697	PITX2_HUMAN	paired-like homeodomain transcription factor 2						determination of left/right symmetry|organ morphogenesis	transcription factor complex	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding|transcription factor binding				0		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.00222)		GCTGCACGCCTGGGCCACGCG	0.687													29	53	---	---	---	---	capture	Splice_Site	SNP	111553638	111553638	PITX2	4	T	A	A	A	1	0	0	0	0	0	0	1	0	715	55	5	4	11858	246
ANK2	287	broad.mit.edu	37	4	114251595	114251595	+	Missense_Mutation	SNP	G	A	A			TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:114251595G>A	uc003ibe.3	+	27	3194	c.3094G>A	c.(3094-3096)GAA>AAA	p.E1032K	ANK2_uc003ibd.3_Missense_Mutation_p.E1023K|ANK2_uc003ibf.3_Missense_Mutation_p.E1032K|ANK2_uc011cgc.1_Missense_Mutation_p.E241K|ANK2_uc003ibg.3_Missense_Mutation_p.E60K|ANK2_uc003ibc.2_Missense_Mutation_p.E1008K|ANK2_uc011cgb.1_Missense_Mutation_p.E1047K	NM_001148	NP_001139	Q01484	ANK2_HUMAN	ankyrin 2 isoform 1	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					axon guidance|signal transduction	apical plasma membrane|basolateral plasma membrane|cytoskeleton|cytosol|sarcomere	protein binding|protein binding			central_nervous_system(7)|ovary(3)|large_intestine(2)|breast(1)|skin(1)	14		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		TCGCCTGATCGAAGTTGGACC	0.532													20	59	---	---	---	---	capture	Missense_Mutation	SNP	114251595	114251595	ANK2	4	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	618	246
GPM6A	2823	broad.mit.edu	37	4	176594942	176594942	+	Missense_Mutation	SNP	G	C	C			TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:176594942G>C	uc003iuf.2	-	3	1080	c.276C>G	c.(274-276)TTC>TTG	p.F92L	GPM6A_uc011ckj.1_Missense_Mutation_p.F85L|GPM6A_uc003iug.2_Missense_Mutation_p.F92L|GPM6A_uc003iuh.2_Missense_Mutation_p.F81L	NM_201591	NP_963885	P51674	GPM6A_HUMAN	glycoprotein M6A isoform 2	92	Helical; (Potential).					cell surface|integral to membrane					0		Breast(14;7.35e-05)|Melanoma(52;0.00909)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;9.21e-19)|Epithelial(43;3.01e-17)|OV - Ovarian serous cystadenocarcinoma(60;2.02e-09)|STAD - Stomach adenocarcinoma(60;0.00083)|GBM - Glioblastoma multiforme(59;0.00168)|LUSC - Lung squamous cell carcinoma(193;0.0388)		CATACACAAAGAACGCAGCTG	0.418													35	71	---	---	---	---	capture	Missense_Mutation	SNP	176594942	176594942	GPM6A	4	G	C	C	C	1	0	0	0	0	1	0	0	0	425	33	4	4	6549	246
DNAH5	1767	broad.mit.edu	37	5	13809274	13809274	+	Missense_Mutation	SNP	G	A	A			TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:13809274G>A	uc003jfd.2	-	46	7673	c.7631C>T	c.(7630-7632)ACG>ATG	p.T2544M		NM_001369	NP_001360	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	2544					microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31	Lung NSC(4;0.00476)					CTGGGTACGCGTGTTCCAGTG	0.438									Kartagener_syndrome				12	237	---	---	---	---	capture	Missense_Mutation	SNP	13809274	13809274	DNAH5	5	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	4561	246
GRAMD3	65983	broad.mit.edu	37	5	125822670	125822670	+	Splice_Site	SNP	G	T	T			TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:125822670G>T	uc003ktu.2	+	12	1593	c.1163_splice	c.e12+1	p.E388_splice	GRAMD3_uc011cwt.1_Splice_Site_p.E403_splice|GRAMD3_uc011cwv.1_Splice_Site_p.E396_splice|GRAMD3_uc011cww.1_Splice_Site_p.E284_splice|GRAMD3_uc011cwx.1_Splice_Site|GRAMD3_uc011cwy.1_Splice_Site_p.E279_splice|GRAMD3_uc011cwz.1_Splice_Site_p.E372_splice	NM_023927	NP_076416	Q96HH9	GRAM3_HUMAN	GRAM domain containing 3 isoform 2											central_nervous_system(1)	1		Prostate(80;0.0928)	KIRC - Kidney renal clear cell carcinoma(527;0.0584)|Kidney(363;0.0934)	Epithelial(69;0.0401)|OV - Ovarian serous cystadenocarcinoma(64;0.0604)|all cancers(49;0.108)		ATAATACTGAGTAAGACGATT	0.403													3	61	---	---	---	---	capture	Splice_Site	SNP	125822670	125822670	GRAMD3	5	G	T	T	T	1	0	0	0	0	0	0	1	0	468	36	5	4	6684	246
ADAM19	8728	broad.mit.edu	37	5	156916128	156916128	+	Silent	SNP	C	T	T			TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:156916128C>T	uc003lwz.2	-	20	2371	c.2307G>A	c.(2305-2307)ACG>ACA	p.T769T	ADAM19_uc003lww.1_Silent_p.T502T|ADAM19_uc003lwy.2_Silent_p.T368T|ADAM19_uc011ddr.1_Silent_p.T700T	NM_033274	NP_150377	Q9H013	ADA19_HUMAN	ADAM metallopeptidase domain 19 preproprotein	769	Cytoplasmic (Potential).				proteolysis	integral to membrane	metalloendopeptidase activity|SH3 domain binding|zinc ion binding			ovary(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)|skin(1)	8	Renal(175;0.00488)	Medulloblastoma(196;0.0359)|all_neural(177;0.14)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			TGCCCTGGGGCGTCTGCAGCT	0.453													5	57	---	---	---	---	capture	Silent	SNP	156916128	156916128	ADAM19	5	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	240	246
IRF4	3662	broad.mit.edu	37	6	398917	398917	+	Missense_Mutation	SNP	G	A	A			TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:398917G>A	uc003msz.3	+	6	840	c.727G>A	c.(727-729)GAA>AAA	p.E243K	IRF4_uc010jne.1_Missense_Mutation_p.E243K|IRF4_uc003mta.3_RNA|IRF4_uc003mtb.3_Missense_Mutation_p.E242K|IRF4_uc003mtc.1_Missense_Mutation_p.E73K	NM_002460	NP_002451	Q15306	IRF4_HUMAN	interferon regulatory factor 4	243					interferon-gamma-mediated signaling pathway|positive regulation of interleukin-10 biosynthetic process|positive regulation of interleukin-13 biosynthetic process|positive regulation of interleukin-2 biosynthetic process|positive regulation of interleukin-4 biosynthetic process|positive regulation of transcription, DNA-dependent|regulation of T-helper cell differentiation|T cell activation|type I interferon-mediated signaling pathway	cytoplasm	DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding			ovary(1)	1		Breast(5;0.0155)|all_lung(73;0.0691)|all_hematologic(90;0.0895)		OV - Ovarian serous cystadenocarcinoma(45;0.03)|BRCA - Breast invasive adenocarcinoma(62;0.0702)		AAGGTCTGCCGAAGCCTTGGC	0.592			T	IGH@	MM 								10	29	---	---	---	---	capture	Missense_Mutation	SNP	398917	398917	IRF4	6	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	7755	246
F13A1	2162	broad.mit.edu	37	6	6225003	6225003	+	Missense_Mutation	SNP	C	T	T			TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:6225003C>T	uc003mwv.2	-	7	1012	c.889G>A	c.(889-891)GTT>ATT	p.V297I	F13A1_uc011dib.1_Missense_Mutation_p.V234I	NM_000129	NP_000120	P00488	F13A_HUMAN	coagulation factor XIII A1 subunit precursor	297					peptide cross-linking|platelet activation|platelet degranulation	extracellular region|platelet alpha granule lumen	acyltransferase activity|metal ion binding|protein-glutamine gamma-glutamyltransferase activity			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|pancreas(1)|skin(1)	6	Ovarian(93;0.0816)	all_hematologic(90;0.152)			L-Glutamine(DB00130)	AGAATGTCAACGCTTCCAGTC	0.488													29	141	---	---	---	---	capture	Missense_Mutation	SNP	6225003	6225003	F13A1	6	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	5294	246
JARID2	3720	broad.mit.edu	37	6	15504806	15504806	+	Missense_Mutation	SNP	G	T	T			TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:15504806G>T	uc003nbj.2	+	9	2768	c.2524G>T	c.(2524-2526)GCC>TCC	p.A842S	JARID2_uc011div.1_Missense_Mutation_p.A670S|JARID2_uc011diw.1_Missense_Mutation_p.A804S	NM_004973	NP_004964	Q92833	JARD2_HUMAN	jumonji, AT rich interactive domain 2 protein	842					central nervous system development|chromatin modification|negative regulation of histone methylation|positive regulation of histone H3-K9 methylation|stem cell differentiation|transcription, DNA-dependent		chromatin binding			ovary(2)|lung(1)|pancreas(1)	4	Breast(50;0.0142)|Ovarian(93;0.103)	all_hematologic(90;0.00612)				CAAGGAGCCTGCCCCAGCCGA	0.522													11	48	---	---	---	---	capture	Missense_Mutation	SNP	15504806	15504806	JARID2	6	G	T	T	T	1	0	0	0	0	1	0	0	0	598	46	4	4	7868	246
KIF13A	63971	broad.mit.edu	37	6	17800257	17800257	+	Missense_Mutation	SNP	T	G	G			TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:17800257T>G	uc003ncg.3	-	21	2647	c.2542A>C	c.(2542-2544)AGT>CGT	p.S848R	KIF13A_uc003ncf.2_Missense_Mutation_p.S848R|KIF13A_uc003nch.3_Missense_Mutation_p.S848R|KIF13A_uc003nci.3_Missense_Mutation_p.S848R	NM_022113	NP_071396	Q9H1H9	KI13A_HUMAN	kinesin family member 13A isoform a	848					cargo loading into vesicle|cell cycle|cytokinesis|endosome to lysosome transport|Golgi to plasma membrane protein transport|melanosome organization|plus-end-directed vesicle transport along microtubule	centrosome|endosome membrane|microtubule|midbody|trans-Golgi network membrane	ATP binding|microtubule motor activity|protein binding			large_intestine(2)|ovary(2)	4	Breast(50;0.0107)|Ovarian(93;0.016)	all_hematologic(90;0.125)	all cancers(50;0.0865)|Epithelial(50;0.0974)			CCACTTTCACTGGAATTCTCC	0.537													10	265	---	---	---	---	capture	Missense_Mutation	SNP	17800257	17800257	KIF13A	6	T	G	G	G	1	0	0	0	0	1	0	0	0	715	55	4	4	8196	246
ABCC10	89845	broad.mit.edu	37	6	43415637	43415637	+	Silent	SNP	C	T	T	rs144509707		TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:43415637C>T	uc003ouy.1	+	18	4136	c.3921C>T	c.(3919-3921)GAC>GAT	p.D1307D	ABCC10_uc003ouz.1_Silent_p.D1279D|ABCC10_uc010jyo.1_Silent_p.D413D	NM_033450	NP_258261	Q5T3U5	MRP7_HUMAN	ATP-binding cassette, sub-family C, member 10	1307	ABC transporter 2.					integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(6)|central_nervous_system(1)	7	all_lung(25;0.00536)		Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0152)|OV - Ovarian serous cystadenocarcinoma(102;0.0804)			TGCTGCTGGACGGCGTGGACA	0.632													25	51	---	---	---	---	capture	Silent	SNP	43415637	43415637	ABCC10	6	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	50	246
ENPP4	22875	broad.mit.edu	37	6	46111073	46111073	+	Missense_Mutation	SNP	G	C	C			TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:46111073G>C	uc003oxy.2	+	4	1317	c.1058G>C	c.(1057-1059)GGA>GCA	p.G353A		NM_014936	NP_055751	Q9Y6X5	ENPP4_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase	353	Extracellular (Potential).					integral to membrane	hydrolase activity			ovary(3)|skin(1)	4						GCTGCCCACGGACCTGCATTT	0.388													58	214	---	---	---	---	capture	Missense_Mutation	SNP	46111073	46111073	ENPP4	6	G	C	C	C	1	0	0	0	0	1	0	0	0	533	41	4	4	5087	246
SYNJ2	8871	broad.mit.edu	37	6	158438287	158438287	+	Missense_Mutation	SNP	C	T	T	rs143362296	byFrequency	TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:158438287C>T	uc003qqx.1	+	2	254	c.179C>T	c.(178-180)GCG>GTG	p.A60V	SYNJ2_uc011efm.1_RNA|SYNJ2_uc003qqw.1_Missense_Mutation_p.A60V|SYNJ2_uc003qqy.1_5'UTR|SYNJ2_uc011efn.1_5'Flank|SYNJ2_uc010kjo.1_5'Flank	NM_003898	NP_003889	O15056	SYNJ2_HUMAN	synaptojanin 2	60							nucleotide binding|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity|RNA binding			skin(1)	1				OV - Ovarian serous cystadenocarcinoma(65;4.42e-18)|BRCA - Breast invasive adenocarcinoma(81;4.23e-05)		CTCACGGACGCGTACGGCTGC	0.602													8	30	---	---	---	---	capture	Missense_Mutation	SNP	158438287	158438287	SYNJ2	6	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	15341	246
FNDC1	84624	broad.mit.edu	37	6	159653361	159653361	+	Missense_Mutation	SNP	C	T	T			TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:159653361C>T	uc010kjv.2	+	11	2017	c.1817C>T	c.(1816-1818)ACG>ATG	p.T606M	FNDC1_uc010kjw.1_Missense_Mutation_p.T491M	NM_032532	NP_115921	Q4ZHG4	FNDC1_HUMAN	fibronectin type III domain containing 1	606						extracellular region				large_intestine(4)|ovary(3)|central_nervous_system(1)	8		Breast(66;0.000781)|Ovarian(120;0.0308)|Prostate(117;0.195)		OV - Ovarian serous cystadenocarcinoma(65;2.6e-16)|BRCA - Breast invasive adenocarcinoma(81;1.06e-05)		TCCCTGGCCACGCAGCCCCGC	0.706													5	22	---	---	---	---	capture	Missense_Mutation	SNP	159653361	159653361	FNDC1	6	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	5912	246
RPS6KA2	6196	broad.mit.edu	37	6	166844032	166844032	+	Missense_Mutation	SNP	C	T	T			TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:166844032C>T	uc003qvb.1	-	16	1709	c.1490G>A	c.(1489-1491)CGC>CAC	p.R497H	RPS6KA2_uc011ego.1_Missense_Mutation_p.R408H|RPS6KA2_uc010kkl.1_Missense_Mutation_p.R408H|RPS6KA2_uc003qvc.1_Missense_Mutation_p.R505H|RPS6KA2_uc003qvd.1_Missense_Mutation_p.R522H	NM_021135	NP_066958	Q15349	KS6A2_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide	497	Protein kinase 2.				axon guidance|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|stress-activated MAPK cascade|synaptic transmission|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|magnesium ion binding|protein serine/threonine kinase activity			ovary(2)|lung(2)|skin(2)|large_intestine(1)|central_nervous_system(1)	8		Breast(66;2.04e-05)|Ovarian(120;0.0652)|Prostate(117;0.105)		OV - Ovarian serous cystadenocarcinoma(33;2.76e-18)|GBM - Glioblastoma multiforme(31;9.94e-06)|BRCA - Breast invasive adenocarcinoma(81;1.36e-05)		CCGGAGGATGCGGTCCAGGAG	0.592													3	116	---	---	---	---	capture	Missense_Mutation	SNP	166844032	166844032	RPS6KA2	6	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	13543	246
TTLL2	83887	broad.mit.edu	37	6	167754158	167754158	+	Missense_Mutation	SNP	G	A	A	rs34053826		TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:167754158G>A	uc003qvs.1	+	3	858	c.770G>A	c.(769-771)CGC>CAC	p.R257H	TTLL2_uc011egr.1_RNA	NM_031949	NP_114155	Q9BWV7	TTLL2_HUMAN	tubulin tyrosine ligase-like family, member 2	257	TTL.				protein modification process		ATP binding|tubulin-tyrosine ligase activity			ovary(1)|central_nervous_system(1)|skin(1)	3		Breast(66;7.8e-06)|Ovarian(120;0.024)		OV - Ovarian serous cystadenocarcinoma(33;2.22e-20)|BRCA - Breast invasive adenocarcinoma(81;6.17e-07)|GBM - Glioblastoma multiforme(31;0.00492)		TGTGATCTCCGCATCTATGTT	0.358													22	285	---	---	---	---	capture	Missense_Mutation	SNP	167754158	167754158	TTLL2	6	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	16609	246
GPR141	353345	broad.mit.edu	37	7	37780661	37780661	+	Nonsense_Mutation	SNP	G	A	A			TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:37780661G>A	uc003tfm.1	+	1	666	c.666G>A	c.(664-666)TGG>TGA	p.W222*	uc003tfl.2_Intron	NM_181791	NP_861456	Q7Z602	GP141_HUMAN	G protein-coupled receptor 141	222	Cytoplasmic (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(3)	3						AGGAGTTCTGGGCTCAGCTGA	0.433													106	401	---	---	---	---	capture	Nonsense_Mutation	SNP	37780661	37780661	GPR141	7	G	A	A	A	1	0	0	0	0	0	1	0	0	559	43	5	2	6583	246
C7orf57	136288	broad.mit.edu	37	7	48092478	48092478	+	Missense_Mutation	SNP	C	A	A			TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:48092478C>A	uc003toh.3	+	7	999	c.787C>A	c.(787-789)CTC>ATC	p.L263I	C7orf57_uc003toi.3_Missense_Mutation_p.L121I	NM_001100159	NP_001093629	Q8NEG2	CG057_HUMAN	hypothetical protein LOC136288	263										ovary(1)	1						TGCAGCCAGGCTCCAGGATGC	0.572													11	124	---	---	---	---	capture	Missense_Mutation	SNP	48092478	48092478	C7orf57	7	C	A	A	A	1	0	0	0	0	1	0	0	0	364	28	4	4	2381	246
POM121	9883	broad.mit.edu	37	7	72413425	72413425	+	Missense_Mutation	SNP	G	A	A			TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:72413425G>A	uc003twk.2	+	11	2893	c.2893G>A	c.(2893-2895)GGA>AGA	p.G965R	POM121_uc003twj.2_Missense_Mutation_p.G700R|POM121_uc010lam.1_Missense_Mutation_p.G700R	NM_172020	NP_742017	Q96HA1	P121A_HUMAN	nuclear pore membrane protein 121	965	Pore side (Potential).				carbohydrate metabolic process|glucose transport|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	endoplasmic reticulum membrane|nuclear membrane|nuclear pore					0		Lung NSC(55;0.163)				ATCATATCCGGGAGCCAACCC	0.647													13	119	---	---	---	---	capture	Missense_Mutation	SNP	72413425	72413425	POM121	7	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	12141	246
GNAT3	346562	broad.mit.edu	37	7	80088106	80088106	+	Missense_Mutation	SNP	C	T	T			TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:80088106C>T	uc011kgu.1	-	8	946	c.946G>A	c.(946-948)GAT>AAT	p.D316N	CD36_uc003uhc.2_Intron	NM_001102386	NP_001095856	A8MTJ3	GNAT3_HUMAN	guanine nucleotide binding protein, alpha	316					detection of chemical stimulus involved in sensory perception of bitter taste|G-protein signaling, coupled to cAMP nucleotide second messenger|rhodopsin mediated phototransduction|sensory perception of sweet taste|sensory perception of umami taste	cytoplasm|heterotrimeric G-protein complex|photoreceptor inner segment|photoreceptor outer segment	G-protein beta/gamma-subunit complex binding|G-protein-coupled receptor binding|GTP binding|GTPase activity|signal transducer activity			ovary(1)	1						ATTTCCTTATCTTCTTTTTTT	0.323													7	43	---	---	---	---	capture	Missense_Mutation	SNP	80088106	80088106	GNAT3	7	C	T	T	T	1	0	0	0	0	1	0	0	0	416	32	2	2	6449	246
DLX6	1750	broad.mit.edu	37	7	96637111	96637111	+	Missense_Mutation	SNP	C	G	G			TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:96637111C>G	uc003uom.2	+	3	514	c.514C>G	c.(514-516)CTG>GTG	p.L172V	DLX6AS_uc003uol.2_Intron|DLX6AS_uc010lfo.1_Intron	NM_005222	NP_005213	P56179	DLX6_HUMAN	distal-less homeobox 6	82	Homeobox.				nervous system development|skeletal system development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(2)	2	all_cancers(62;9.56e-09)|all_epithelial(64;7.38e-09)|Esophageal squamous(72;0.0125)|all_lung(186;0.0855)|Lung NSC(181;0.0858)					GAGAGCCGAACTGGCAGCTTC	0.532													2	39	---	---	---	---	capture	Missense_Mutation	SNP	96637111	96637111	DLX6	7	C	G	G	G	1	0	0	0	0	1	0	0	0	259	20	4	4	4533	246
SLC26A3	1811	broad.mit.edu	37	7	107434196	107434196	+	Missense_Mutation	SNP	C	T	T			TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:107434196C>T	uc003ver.2	-	3	473	c.262G>A	c.(262-264)GTA>ATA	p.V88I	SLC26A3_uc003ves.2_Missense_Mutation_p.V53I	NM_000111	NP_000102	P40879	S26A3_HUMAN	solute carrier family 26, member 3	88	Helical; (Potential).				excretion	integral to membrane|membrane fraction	inorganic anion exchanger activity|secondary active sulfate transmembrane transporter activity|sequence-specific DNA binding transcription factor activity|transcription cofactor activity			ovary(3)|skin(1)	4						ccttGTAGTACGGCCACAATC	0.254													19	98	---	---	---	---	capture	Missense_Mutation	SNP	107434196	107434196	SLC26A3	7	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	14410	246
ATP6V0A4	50617	broad.mit.edu	37	7	138432176	138432176	+	Missense_Mutation	SNP	G	T	T			TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:138432176G>T	uc003vuf.2	-	12	1552	c.1314C>A	c.(1312-1314)GAC>GAA	p.D438E	ATP6V0A4_uc003vug.2_Missense_Mutation_p.D438E|ATP6V0A4_uc003vuh.2_Missense_Mutation_p.D438E	NM_130841	NP_570856	Q9HBG4	VPP4_HUMAN	ATPase, H+ transporting, lysosomal V0 subunit	438	Lumenal (Potential).				cellular iron ion homeostasis|excretion|insulin receptor signaling pathway|ossification|regulation of pH|sensory perception of sound|transferrin transport	apical plasma membrane|brush border membrane|endosome membrane|integral to membrane|proton-transporting two-sector ATPase complex, proton-transporting domain	ATPase binding|hydrogen ion transmembrane transporter activity			pancreas(1)	1						TCACCTCATTGTCTGTCTTCT	0.428													35	121	---	---	---	---	capture	Missense_Mutation	SNP	138432176	138432176	ATP6V0A4	7	G	T	T	T	1	0	0	0	0	1	0	0	0	620	48	4	4	1161	246
OR2A12	346525	broad.mit.edu	37	7	143792752	143792752	+	Silent	SNP	C	T	T			TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:143792752C>T	uc011kty.1	+	1	552	c.552C>T	c.(550-552)TTC>TTT	p.F184F		NM_001004135	NP_001004135	Q8NGT7	O2A12_HUMAN	olfactory receptor, family 2, subfamily A,	184	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|central_nervous_system(1)	3	Melanoma(164;0.0783)					TGTCCGTATTCAAATTGGCCT	0.493													96	391	---	---	---	---	capture	Silent	SNP	143792752	143792752	OR2A12	7	C	T	T	T	1	0	0	0	0	0	0	0	1	376	29	2	2	10879	246
OR2A7	401427	broad.mit.edu	37	7	143956670	143956670	+	Missense_Mutation	SNP	C	T	T			TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:143956670C>T	uc011kuc.1	-	1	52	c.52G>A	c.(52-54)GTT>ATT	p.V18I	OR2A9P_uc003wec.1_Intron|OR2A7_uc003wef.2_3'UTR	NM_001005328	NP_001005328	Q96R45	OR2A7_HUMAN	olfactory receptor, family 2, subfamily A,	18	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1	Melanoma(164;0.14)					CTTGGGCCAACGGGAAATCCC	0.498													35	678	---	---	---	---	capture	Missense_Mutation	SNP	143956670	143956670	OR2A7	7	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	10886	246
CYP7A1	1581	broad.mit.edu	37	8	59409723	59409723	+	Silent	SNP	C	T	T			TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:59409723C>T	uc003xtm.3	-	3	411	c.348G>A	c.(346-348)CCG>CCA	p.P116P		NM_000780	NP_000771	P22680	CP7A1_HUMAN	cytochrome P450, family 7, subfamily A,	116					bile acid biosynthetic process|cellular lipid metabolic process|cellular response to cholesterol|cellular response to glucose stimulus|cholesterol catabolic process|cholesterol homeostasis|regulation of bile acid biosynthetic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	cholesterol 7-alpha-monooxygenase activity|electron carrier activity|heme binding			ovary(1)	1		all_lung(136;0.0271)|Lung NSC(129;0.0351)|all_epithelial(80;0.0554)				TTCCATCCATCGGGTCAATGC	0.418									Neonatal_Giant_Cell_Hepatitis				44	96	---	---	---	---	capture	Silent	SNP	59409723	59409723	CYP7A1	8	C	T	T	T	1	0	0	0	0	0	0	0	1	392	31	1	1	4156	246
TRPA1	8989	broad.mit.edu	37	8	72948586	72948586	+	Missense_Mutation	SNP	T	A	A			TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:72948586T>A	uc003xza.2	-	21	2667	c.2492A>T	c.(2491-2493)CAG>CTG	p.Q831L	uc011lff.1_Intron|uc003xyy.2_Intron	NM_007332	NP_015628	O75762	TRPA1_HUMAN	ankyrin-like protein 1	831	Helical; Name=4; (Potential).					integral to plasma membrane				ovary(4)|lung(1)|kidney(1)	6			Epithelial(68;0.223)		Menthol(DB00825)	ACATTGCCACTGCAGATGAGC	0.353													14	18	---	---	---	---	capture	Missense_Mutation	SNP	72948586	72948586	TRPA1	8	T	A	A	A	1	0	0	0	0	1	0	0	0	715	55	4	4	16460	246
ZNF623	9831	broad.mit.edu	37	8	144733275	144733275	+	Silent	SNP	G	A	A			TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:144733275G>A	uc003yzd.2	+	1	1322	c.1233G>A	c.(1231-1233)GCG>GCA	p.A411A	ZNF623_uc011lkp.1_Silent_p.A371A|ZNF623_uc003yzc.2_Silent_p.A371A	NM_014789	NP_055604	O75123	ZN623_HUMAN	zinc finger protein 623 isoform 1	411	C2H2-type 11.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;5.28e-40)|all cancers(56;5.23e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.146)			GTGGGAAAGCGTTTCTCCAGA	0.478													58	137	---	---	---	---	capture	Silent	SNP	144733275	144733275	ZNF623	8	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	17925	246
KIAA0020	9933	broad.mit.edu	37	9	2829880	2829880	+	Missense_Mutation	SNP	G	A	A			TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:2829880G>A	uc003zhp.1	-	8	842	c.746C>T	c.(745-747)GCG>GTG	p.A249V	KIAA0020_uc010mhc.1_Missense_Mutation_p.A248V|KIAA0020_uc003zhq.1_Missense_Mutation_p.A248V	NM_014878	NP_055693	Q15397	K0020_HUMAN	KIAA0020 protein	249	Pumilio 3.|PUM-HD.					endoplasmic reticulum|nucleolus	RNA binding			ovary(1)	1				GBM - Glioblastoma multiforme(50;0.0319)		TGATGCTTCCGCATGCCGCAG	0.443													5	295	---	---	---	---	capture	Missense_Mutation	SNP	2829880	2829880	KIAA0020	9	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	8074	246
OR1L4	254973	broad.mit.edu	37	9	125486747	125486747	+	Missense_Mutation	SNP	G	A	A			TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:125486747G>A	uc004bmu.1	+	1	479	c.479G>A	c.(478-480)CGC>CAC	p.R160H		NM_001005235	NP_001005235	Q8NGR5	OR1L4_HUMAN	olfactory receptor, family 1, subfamily L,	160	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						TCCCTGTTCCGCGTGCTACTT	0.478													97	305	---	---	---	---	capture	Missense_Mutation	SNP	125486747	125486747	OR1L4	9	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	10869	246
WNK3	65267	broad.mit.edu	37	X	54275317	54275317	+	Missense_Mutation	SNP	C	A	A			TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:54275317C>A	uc004dtd.1	-	17	3903	c.3464G>T	c.(3463-3465)TGT>TTT	p.C1155F	WNK3_uc004dtc.1_Missense_Mutation_p.C1155F	NM_001002838	NP_001002838	Q9BYP7	WNK3_HUMAN	WNK lysine deficient protein kinase 3 isoform 2	1155					intracellular protein kinase cascade|positive regulation of establishment of protein localization in plasma membrane|positive regulation of peptidyl-threonine phosphorylation|positive regulation of rubidium ion transmembrane transporter activity|positive regulation of rubidium ion transport|positive regulation of sodium ion transmembrane transporter activity|positive regulation of sodium ion transport|protein autophosphorylation	adherens junction|tight junction	ATP binding|protein binding|protein serine/threonine kinase activity|rubidium ion transmembrane transporter activity|sodium ion transmembrane transporter activity			lung(4)|ovary(3)|kidney(2)|central_nervous_system(2)	11						TGTCACTGGACAGGAGAGGGT	0.458													3	161	---	---	---	---	capture	Missense_Mutation	SNP	54275317	54275317	WNK3	23	C	A	A	A	1	0	0	0	0	1	0	0	0	221	17	4	4	17260	246
SPIN3	169981	broad.mit.edu	37	X	57021377	57021377	+	Missense_Mutation	SNP	T	G	G			TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:57021377T>G	uc010nkj.2	-	2	290	c.4A>C	c.(4-6)AAG>CAG	p.K2Q	SPIN3_uc004duu.3_RNA|SPIN3_uc004duw.3_RNA|SPIN3_uc004duv.3_RNA|SPIN3_uc004dux.1_Missense_Mutation_p.K2Q	NM_001010862	NP_001010862	Q5JUX0	SPIN3_HUMAN	spindlin family, member 3	2					gamete generation					ovary(1)|central_nervous_system(1)	2						AACGGGGTCTTCATGCCTGCG	0.537													2	26	---	---	---	---	capture	Missense_Mutation	SNP	57021377	57021377	SPIN3	23	T	G	G	G	1	0	0	0	0	1	0	0	0	806	62	4	4	14947	246
TAF1	6872	broad.mit.edu	37	X	70680548	70680548	+	Missense_Mutation	SNP	T	G	G			TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:70680548T>G	uc004dzu.3	+	37	5342	c.5291T>G	c.(5290-5292)ATG>AGG	p.M1764R	BCYRN1_uc011mpt.1_Intron|TAF1_uc004dzt.3_Missense_Mutation_p.M1785R|TAF1_uc004dzv.3_Missense_Mutation_p.M972R|TAF1_uc010nle.1_RNA|TAF1_uc010nlf.1_Missense_Mutation_p.M189R|TAF1_uc004dzx.2_RNA|TAF1_uc004dzy.2_RNA|TAF1_uc004dzw.1_RNA|TAF1_uc010nlg.1_RNA	NM_138923	NP_620278	P21675	TAF1_HUMAN	TBP-associated factor 1 isoform 2	1764	Asp/Glu-rich (acidic tail).|Protein kinase 2.				G1 phase of mitotic cell cycle|interspecies interaction between organisms|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription initiation from RNA polymerase II promoter|protein autophosphorylation|regulation of transcription involved in G2/M-phase of mitotic cell cycle|RNA polymerase II transcriptional preinitiation complex assembly|transcription elongation from RNA polymerase II promoter|viral reproduction	MLL1 complex|transcription factor TFIID complex	ATP binding|histone acetyl-lysine binding|histone acetyltransferase activity|p53 binding|protein binding|protein serine/threonine kinase activity|sequence-specific DNA binding|TBP-class protein binding|transcription coactivator activity			ovary(7)|breast(4)|large_intestine(2)|central_nervous_system(2)|lung(1)|skin(1)	17	Renal(35;0.156)	all_lung(315;0.000321)				CAACCCCGCATGCTTCAGGAG	0.483													13	7	---	---	---	---	capture	Missense_Mutation	SNP	70680548	70680548	TAF1	23	T	G	G	G	1	0	0	0	0	1	0	0	0	663	51	4	4	15401	246
CDC27	996	broad.mit.edu	37	17	45219612	45219612	+	Frame_Shift_Del	DEL	A	-	-			TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:45219612delA	uc002ild.3	-	11	1488	c.1361delT	c.(1360-1362)CTAfs	p.L454fs	CDC27_uc002ile.3_Frame_Shift_Del_p.L460fs|CDC27_uc002ilf.3_Frame_Shift_Del_p.L454fs|CDC27_uc010wkp.1_Frame_Shift_Del_p.L393fs|CDC27_uc010wkq.1_Intron	NM_001256	NP_001247	P30260	CDC27_HUMAN	cell division cycle protein 27 isoform 2	454					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell proliferation|mitotic cell cycle spindle assembly checkpoint|mitotic metaphase/anaphase transition|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination	anaphase-promoting complex|centrosome|cytosol|nucleoplasm|spindle microtubule	protein phosphatase binding			lung(2)|breast(2)|ovary(1)	5						TGCTTTTTGTAGATTAAAGGC	0.308													11	82	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	45219612	45219612	CDC27	17	A	-	-	-	1	0	1	0	1	0	0	0	0	195	15	5	5	3037	246
TCF20	6942	broad.mit.edu	37	22	42610776	42610778	+	In_Frame_Del	DEL	TGC	-	-			TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:42610776_42610778delTGC	uc003bcj.1	-	1	668_670	c.534_536delGCA	c.(532-537)CAGCAA>CAA	p.178_179QQ>Q	TCF20_uc003bck.1_In_Frame_Del_p.178_179QQ>Q|TCF20_uc003bnt.2_In_Frame_Del_p.178_179QQ>Q	NM_005650	NP_005641	Q9UGU0	TCF20_HUMAN	transcription factor 20 isoform 1	178_179	Poly-Gln.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|transcription coactivator activity|zinc ion binding			ovary(4)|skin(1)	5						CTGCTGGACTTGCTGCTGCTGCT	0.571													7	194	---	---	---	---	capture_indel	In_Frame_Del	DEL	42610776	42610778	TCF20	22	TGC	-	-	-	1	0	1	0	1	0	0	0	0	819	63	5	5	15575	246
AMT	275	broad.mit.edu	37	3	49459869	49459870	+	Frame_Shift_Ins	INS	-	A	A			TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:49459869_49459870insA	uc003cww.2	-	1	143_144	c.14_15insT	c.(13-15)GTAfs	p.V5fs	AMT_uc011bcn.1_5'UTR|AMT_uc003cwx.2_Frame_Shift_Ins_p.V5fs|AMT_uc011bco.1_Frame_Shift_Ins_p.V5fs|AMT_uc003cwy.2_5'UTR|AMT_uc011bcp.1_5'UTR|AMT_uc011bcq.1_Frame_Shift_Ins_p.V5fs|NICN1_uc003cwz.1_3'UTR	NM_000481	NP_000472	P48728	GCST_HUMAN	aminomethyltransferase isoform 1 precursor	5					glycine catabolic process	mitochondrion	aminomethyltransferase activity|transaminase activity			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)	NADH(DB00157)|Tetrahydrofolic acid(DB00116)	CCACCACACTTACAGCCCTCTG	0.639													9	36	---	---	---	---	capture_indel	Frame_Shift_Ins	INS	49459869	49459870	AMT	3	-	A	A	A	1	0	1	1	0	0	0	0	0	782	61	5	5	589	246
TMEM70	54968	broad.mit.edu	37	8	74888704	74888704	+	Frame_Shift_Del	DEL	T	-	-			TCGA-32-4211-01	TCGA-32-4211-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:74888704delT	uc003yab.2	+	1	275	c.188delT	c.(187-189)CTCfs	p.L63fs	TMEM70_uc003yac.2_Frame_Shift_Del_p.L63fs	NM_017866	NP_060336	Q9BUB7	TMM70_HUMAN	transmembrane protein 70 isoform a	63					mitochondrial proton-transporting ATP synthase complex assembly	integral to mitochondrial membrane|mitochondrial inner membrane				ovary(1)	1	Breast(64;0.0311)		Epithelial(68;0.0186)|BRCA - Breast invasive adenocarcinoma(89;0.0499)|all cancers(69;0.0564)			GCGCGCCTTCTCCGGCGTCCG	0.766													2	4	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	74888704	74888704	TMEM70	8	T	-	-	-	1	0	1	0	1	0	0	0	0	702	54	5	5	16082	246
