Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
CHD5	26038	broad.mit.edu	37	1	6171855	6171855	+	Nonsense_Mutation	SNP	C	T	T			TCGA-32-4213-01	TCGA-32-4213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:6171855C>T	uc001amb.1	-	36	5329	c.5229G>A	c.(5227-5229)TGG>TGA	p.W1743*	CHD5_uc001alz.1_Nonsense_Mutation_p.W600*|CHD5_uc001ama.1_RNA	NM_015557	NP_056372	Q8TDI0	CHD5_HUMAN	chromodomain helicase DNA binding protein 5	1743					chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ATP binding|ATP-dependent helicase activity|DNA binding|zinc ion binding			central_nervous_system(3)|breast(3)|ovary(2)|upper_aerodigestive_tract(1)|lung(1)|skin(1)|pancreas(1)	12	Ovarian(185;0.0634)	all_cancers(23;5.36e-32)|all_epithelial(116;2.32e-17)|all_neural(13;3.68e-06)|all_lung(118;3.94e-06)|all_hematologic(16;2.39e-05)|Lung NSC(185;5.33e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00373)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;3.08e-37)|GBM - Glioblastoma multiforme(13;1.36e-31)|OV - Ovarian serous cystadenocarcinoma(86;7.7e-19)|Colorectal(212;9.97e-08)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(185;6.16e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00109)|BRCA - Breast invasive adenocarcinoma(365;0.0012)|STAD - Stomach adenocarcinoma(132;0.00346)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.193)		CCGCCAGCAGCCAGTAGTCAT	0.577													3	62	---	---	---	---	capture	Nonsense_Mutation	SNP	6171855	6171855	CHD5	1	C	T	T	T	1	0	0	0	0	0	1	0	0	338	26	5	2	3294	247
CDA	978	broad.mit.edu	37	1	20944973	20944973	+	Missense_Mutation	SNP	C	T	T			TCGA-32-4213-01	TCGA-32-4213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:20944973C>T	uc001bdk.2	+	4	532	c.353C>T	c.(352-354)ACC>ATC	p.T118I	CDA_uc001bdl.2_RNA|CDA_uc009vpv.2_RNA	NM_001785	NP_001776	P32320	CDD_HUMAN	cytidine deaminase	118					cell surface receptor linked signaling pathway|cytosine metabolic process|negative regulation of cell growth|negative regulation of nucleotide metabolic process|protein homotetramerization|pyrimidine nucleoside salvage	cytosol|extracellular region	cytidine deaminase activity|nucleoside binding|protein homodimerization activity|zinc ion binding			ovary(1)	1		Lung NSC(340;1.75e-08)|all_lung(284;5.99e-08)|Colorectal(325;3.46e-05)|Renal(390;0.000147)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|GBM - Glioblastoma multiforme(114;1.06e-08)|COAD - Colon adenocarcinoma(152;1.22e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000148)|Kidney(64;0.000184)|KIRC - Kidney renal clear cell carcinoma(64;0.0027)|STAD - Stomach adenocarcinoma(196;0.00308)|READ - Rectum adenocarcinoma(331;0.0652)|Lung(427;0.199)	Azacitidine(DB00928)|Capecitabine(DB01101)|Cytarabine(DB00987)|Gemcitabine(DB00441)	GTGTACATGACCAAGCCGGAT	0.378													4	51	---	---	---	---	capture	Missense_Mutation	SNP	20944973	20944973	CDA	1	C	T	T	T	1	0	0	0	0	1	0	0	0	234	18	2	2	3023	247
HNRNPR	10236	broad.mit.edu	37	1	23660032	23660032	+	Silent	SNP	C	T	T			TCGA-32-4213-01	TCGA-32-4213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:23660032C>T	uc001bgr.3	-	5	636	c.477G>A	c.(475-477)GTG>GTA	p.V159V	HNRNPR_uc001bgp.3_Silent_p.V159V|HNRNPR_uc009vqk.2_Silent_p.V58V|HNRNPR_uc001bgs.3_Silent_p.V58V|HNRNPR_uc010odw.1_Intron|HNRNPR_uc010odx.1_Silent_p.V58V|HNRNPR_uc009vql.2_Intron	NM_005826	NP_005817	O43390	HNRPR_HUMAN	heterogeneous nuclear ribonucleoprotein R	159						catalytic step 2 spliceosome|cytoplasm|heterogeneous nuclear ribonucleoprotein complex|nucleoplasm	nucleotide binding|protein binding|RNA binding			upper_aerodigestive_tract(1)|skin(1)	2		Colorectal(325;3.46e-05)|Lung NSC(340;4.15e-05)|all_lung(284;6.64e-05)|Renal(390;0.000219)|Breast(348;0.00394)|Ovarian(437;0.00539)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;6.83e-27)|Colorectal(126;6.01e-08)|COAD - Colon adenocarcinoma(152;3.32e-06)|GBM - Glioblastoma multiforme(114;6.69e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00101)|KIRC - Kidney renal clear cell carcinoma(1967;0.00357)|STAD - Stomach adenocarcinoma(196;0.0131)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0875)|LUSC - Lung squamous cell carcinoma(448;0.19)		TTCCAGGTTGCACGCCAGAGT	0.453													36	77	---	---	---	---	capture	Silent	SNP	23660032	23660032	HNRNPR	1	C	T	T	T	1	0	0	0	0	0	0	0	1	314	25	2	2	7197	247
TXNIP	10628	broad.mit.edu	37	1	145439907	145439907	+	Silent	SNP	C	T	T			TCGA-32-4213-01	TCGA-32-4213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:145439907C>T	uc001enn.3	+	3	794	c.453C>T	c.(451-453)GTC>GTT	p.V151V	NBPF10_uc001emp.3_Intron|TXNIP_uc001enm.1_Intron|TXNIP_uc010oys.1_Silent_p.V96V	NM_006472	NP_006463	Q9H3M7	TXNIP_HUMAN	thioredoxin interacting protein	151					cell cycle|keratinocyte differentiation|transcription, DNA-dependent		ubiquitin protein ligase binding			ovary(2)	2	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					TGGTGGATGTCAATACCCCTG	0.433													60	204	---	---	---	---	capture	Silent	SNP	145439907	145439907	TXNIP	1	C	T	T	T	1	0	0	0	0	0	0	0	1	366	29	2	2	16685	247
RXFP4	339403	broad.mit.edu	37	1	155911855	155911855	+	Missense_Mutation	SNP	A	C	C			TCGA-32-4213-01	TCGA-32-4213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:155911855A>C	uc010pgs.1	+	1	376	c.355A>C	c.(355-357)ACG>CCG	p.T119P		NM_181885	NP_871001	Q8TDU9	RL3R2_HUMAN	relaxin 3 receptor 2	119	Helical; Name=3; (Potential).					integral to membrane|plasma membrane	angiotensin type II receptor activity				0	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)					GATGGTTCTGACGGCCACTGT	0.632													4	98	---	---	---	---	capture	Missense_Mutation	SNP	155911855	155911855	RXFP4	1	A	C	C	C	1	0	0	0	0	1	0	0	0	130	10	4	4	13654	247
NME7	29922	broad.mit.edu	37	1	169256604	169256604	+	Missense_Mutation	SNP	C	T	T			TCGA-32-4213-01	TCGA-32-4213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:169256604C>T	uc001gfu.2	-	7	929	c.691G>A	c.(691-693)GCA>ACA	p.A231T	NME7_uc010plq.1_RNA|NME7_uc001gft.2_Missense_Mutation_p.A195T|NME7_uc001gfv.1_Missense_Mutation_p.A231T	NM_013330	NP_037462	Q9Y5B8	NDK7_HUMAN	nucleoside diphosphate kinase 7 isoform a	231					CTP biosynthetic process|GTP biosynthetic process|UTP biosynthetic process	centrosome	ATP binding|metal ion binding|nucleoside diphosphate kinase activity			central_nervous_system(1)	1	all_hematologic(923;0.208)					GCAGTGTTTGCCGGCCCACAA	0.358													7	514	---	---	---	---	capture	Missense_Mutation	SNP	169256604	169256604	NME7	1	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	10403	247
GPRIN2	9721	broad.mit.edu	37	10	46999948	46999948	+	Silent	SNP	G	A	A			TCGA-32-4213-01	TCGA-32-4213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:46999948G>A	uc001jec.2	+	3	1203	c.1068G>A	c.(1066-1068)GCG>GCA	p.A356A	GPRIN2_uc010qfq.1_Silent_p.A119A	NM_014696	NP_055511	O60269	GRIN2_HUMAN	G protein-regulated inducer of neurite outgrowth	356											0						CCCTGGAAGCGCCTGCAGCCC	0.677													20	86	---	---	---	---	capture	Silent	SNP	46999948	46999948	GPRIN2	10	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	6663	247
TYSND1	219743	broad.mit.edu	37	10	71905229	71905229	+	Missense_Mutation	SNP	G	A	A			TCGA-32-4213-01	TCGA-32-4213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:71905229G>A	uc001jqr.2	-	1	1268	c.1114C>T	c.(1114-1116)CAC>TAC	p.H372Y	TYSND1_uc001jqq.2_Intron|TYSND1_uc001jqs.2_Missense_Mutation_p.H372Y|TYSND1_uc001jqt.2_Intron	NM_173555	NP_775826	Q2T9J0	TYSD1_HUMAN	trypsin domain containing 1 isoform a	372	Serine protease.	Charge relay system (By similarity).			proteolysis	peroxisome	serine-type endopeptidase activity			large_intestine(1)	1						GGGGACACGTGCCGACAGGTC	0.677													7	5	---	---	---	---	capture	Missense_Mutation	SNP	71905229	71905229	TYSND1	10	G	A	A	A	1	0	0	0	0	1	0	0	0	598	46	2	2	16699	247
TAF5	6877	broad.mit.edu	37	10	105145152	105145152	+	Silent	SNP	G	A	A			TCGA-32-4213-01	TCGA-32-4213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:105145152G>A	uc001kwv.2	+	8	1757	c.1734G>A	c.(1732-1734)TTG>TTA	p.L578L	TAF5_uc010qqq.1_Intron	NM_006951	NP_008882	Q15542	TAF5_HUMAN	TBP-associated factor 5	578	WD 2.				histone acetylation|interspecies interaction between organisms|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|viral reproduction	actin cytoskeleton|transcription factor TFIID complex|transcription factor TFTC complex	protein dimerization activity|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding			ovary(2)	2		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;1.83e-09)|all cancers(201;1.4e-08)|BRCA - Breast invasive adenocarcinoma(275;0.198)		TTACTTGTTTGGTGGGATATA	0.423													3	61	---	---	---	---	capture	Silent	SNP	105145152	105145152	TAF5	10	G	A	A	A	1	0	0	0	0	0	0	0	1	607	47	2	2	15416	247
TCF7L2	6934	broad.mit.edu	37	10	114711317	114711317	+	Missense_Mutation	SNP	T	C	C			TCGA-32-4213-01	TCGA-32-4213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:114711317T>C	uc001lae.3	+	3	839	c.332T>C	c.(331-333)CTG>CCG	p.L111P	TCF7L2_uc001lac.3_Missense_Mutation_p.L111P|TCF7L2_uc010qrk.1_Missense_Mutation_p.L111P|TCF7L2_uc010qrl.1_Missense_Mutation_p.L111P|TCF7L2_uc010qrm.1_Missense_Mutation_p.L111P|TCF7L2_uc010qrn.1_Missense_Mutation_p.L111P|TCF7L2_uc001lad.3_Missense_Mutation_p.L111P|TCF7L2_uc001lag.3_Missense_Mutation_p.L111P|TCF7L2_uc001laf.3_Missense_Mutation_p.L111P|TCF7L2_uc010qro.1_Missense_Mutation_p.L111P|TCF7L2_uc001lah.2_Missense_Mutation_p.L111P|TCF7L2_uc010qrp.1_Missense_Mutation_p.L111P|TCF7L2_uc010qrq.1_Missense_Mutation_p.L111P|TCF7L2_uc010qrr.1_Missense_Mutation_p.L5P|TCF7L2_uc010qrs.1_Missense_Mutation_p.L5P|TCF7L2_uc010qrt.1_Missense_Mutation_p.L5P	NM_001146274	NP_001139746	Q9NQB0	TF7L2_HUMAN	transcription factor 7-like 2 isoform 1	111					anti-apoptosis|blood vessel development|canonical Wnt receptor signaling pathway involved in positive regulation of epithelial to mesenchymal transition|cell cycle arrest|cell proliferation|fat cell differentiation|glucose homeostasis|maintenance of DNA repeat elements|myoblast cell fate commitment|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|pancreas development|positive regulation of heparan sulfate proteoglycan biosynthetic process|positive regulation of insulin secretion|positive regulation of protein binding|positive regulation of protein export from nucleus|positive regulation of protein kinase B signaling cascade|positive regulation of transcription from RNA polymerase II promoter|regulation of hormone metabolic process|regulation of smooth muscle cell proliferation|response to glucose stimulus	beta-catenin-TCF7L2 complex|PML body|protein-DNA complex	armadillo repeat domain binding|beta-catenin binding|gamma-catenin binding|nuclear hormone receptor binding|protein kinase binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding|transcription regulatory region DNA binding			large_intestine(3)|ovary(1)	4		Breast(234;0.058)|Colorectal(252;0.0615)		Epithelial(162;0.00554)|all cancers(201;0.02)		ATCCCCGACCTGACGAGCCCC	0.532													2	10	---	---	---	---	capture	Missense_Mutation	SNP	114711317	114711317	TCF7L2	10	T	C	C	C	1	0	0	0	0	1	0	0	0	715	55	3	3	15583	247
CD6	923	broad.mit.edu	37	11	60785322	60785322	+	Silent	SNP	G	C	C	rs137857404		TCGA-32-4213-01	TCGA-32-4213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:60785322G>C	uc001nqq.2	+	11	1897	c.1674G>C	c.(1672-1674)CCG>CCC	p.P558P	CD6_uc001nqp.2_Silent_p.P558P|CD6_uc001nqr.2_Silent_p.P526P|CD6_uc001nqs.2_RNA|CD6_uc001nqt.2_Silent_p.P517P	NM_006725	NP_006716	P30203	CD6_HUMAN	CD6 molecule precursor	558	Cytoplasmic (Potential).				cell adhesion	cell surface|integral to plasma membrane	scavenger receptor activity			pancreas(1)	1						AGTATCACCCGAGGAGCAACA	0.552													47	122	---	---	---	---	capture	Silent	SNP	60785322	60785322	CD6	11	G	C	C	C	1	0	0	0	0	0	0	0	1	470	37	4	4	2999	247
ARHGEF17	9828	broad.mit.edu	37	11	73076830	73076830	+	Missense_Mutation	SNP	A	T	T			TCGA-32-4213-01	TCGA-32-4213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:73076830A>T	uc001otu.2	+	20	5854	c.5833A>T	c.(5833-5835)ACC>TCC	p.T1945S		NM_014786	NP_055601	Q96PE2	ARHGH_HUMAN	Rho guanine nucleotide exchange factor (GEF) 17	1945					actin cytoskeleton organization|apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	Rho guanyl-nucleotide exchange factor activity				0						TGTCGTCCTCACCATGCCCAC	0.657													17	52	---	---	---	---	capture	Missense_Mutation	SNP	73076830	73076830	ARHGEF17	11	A	T	T	T	1	0	0	0	0	1	0	0	0	78	6	4	4	893	247
KDM4D	55693	broad.mit.edu	37	11	94731887	94731887	+	Missense_Mutation	SNP	C	T	T			TCGA-32-4213-01	TCGA-32-4213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:94731887C>T	uc001pfe.2	+	3	2183	c.1351C>T	c.(1351-1353)CGT>TGT	p.R451C		NM_018039	NP_060509	Q6B0I6	KDM4D_HUMAN	jumonji domain containing 2D	451					chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen				0						AAATGGCAGACGTGGTCGTGG	0.602													11	157	---	---	---	---	capture	Missense_Mutation	SNP	94731887	94731887	KDM4D	11	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	8053	247
LST-3TM12	338821	broad.mit.edu	37	12	21201833	21201833	+	Silent	SNP	C	A	A			TCGA-32-4213-01	TCGA-32-4213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:21201833C>A	uc010sin.1	+	8	1182	c.1182C>A	c.(1180-1182)ACC>ACA	p.T394T	SLCO1B3_uc010sil.1_Intron|LST-3TM12_uc010sim.1_Silent_p.T441T	NM_001009562	NP_001009562	Q71QF0	Q71QF0_HUMAN	liver-specific organic anion transporter 3TM12	394						membrane	transporter activity				0						TAACCTTGACCTATGATGGGT	0.318													10	40	---	---	---	---	capture	Silent	SNP	21201833	21201833	LST-3TM12	12	C	A	A	A	1	0	0	0	0	0	0	0	1	301	24	4	4	8981	247
AAAS	8086	broad.mit.edu	37	12	53709176	53709176	+	Silent	SNP	G	A	A			TCGA-32-4213-01	TCGA-32-4213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:53709176G>A	uc001scr.3	-	4	505	c.342C>T	c.(340-342)GCC>GCT	p.A114A	AAAS_uc001scs.3_Silent_p.A114A	NM_015665	NP_056480	Q9NRG9	AAAS_HUMAN	achalasia, adrenocortical insufficiency,	114					carbohydrate metabolic process|glucose transport|nucleocytoplasmic transport|regulation of glucose transport|regulation of nucleocytoplasmic transport|transmembrane transport|viral reproduction	nuclear pore				ovary(1)	1						AGAGTGCCAGGGCCCAGCCGG	0.562													33	45	---	---	---	---	capture	Silent	SNP	53709176	53709176	AAAS	12	G	A	A	A	1	0	0	0	0	0	0	0	1	548	43	2	2	8	247
POC1B	282809	broad.mit.edu	37	12	89864247	89864247	+	Missense_Mutation	SNP	A	G	G			TCGA-32-4213-01	TCGA-32-4213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:89864247A>G	uc001tbc.2	-	7	806	c.701T>C	c.(700-702)ATA>ACA	p.I234T	POC1B_uc001tba.2_Missense_Mutation_p.I192T|POC1B_uc001tbb.2_Missense_Mutation_p.I104T|POC1B_uc010sun.1_RNA|POC1B_uc009zsp.2_RNA|POC1B_uc009zsq.2_Intron	NM_172240	NP_758440	Q8TC44	POC1B_HUMAN	WD repeat domain 51B	234	WD 6.				cell projection organization	centriole|microtubule basal body				ovary(1)	1						ATGGAATGATATGCAATTAAC	0.388													57	107	---	---	---	---	capture	Missense_Mutation	SNP	89864247	89864247	POC1B	12	A	G	G	G	1	0	0	0	0	1	0	0	0	208	16	3	3	12079	247
TESC	54997	broad.mit.edu	37	12	117486887	117486887	+	Missense_Mutation	SNP	G	A	A			TCGA-32-4213-01	TCGA-32-4213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:117486887G>A	uc001twh.2	-	4	450	c.445C>T	c.(445-447)CGG>TGG	p.R149W	TESC_uc001twi.2_RNA	NM_017899	NP_060369	Q96BS2	TESC_HUMAN	tescalcin	96					negative regulation of cell proliferation|positive regulation of megakaryocyte differentiation|positive regulation of transcription, DNA-dependent|regulation of cell adhesion mediated by integrin	cytoplasm|lamellipodium|nucleus|plasma membrane|ruffle	calcium ion binding|magnesium ion binding|phosphatase inhibitor activity|protein binding				0	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.0297)		TCGATGGGCCGGAAGTAGGAC	0.587													3	122	---	---	---	---	capture	Missense_Mutation	SNP	117486887	117486887	TESC	12	G	A	A	A	1	0	0	0	0	1	0	0	0	506	39	1	1	15651	247
SBNO1	55206	broad.mit.edu	37	12	123780522	123780522	+	Missense_Mutation	SNP	G	A	A			TCGA-32-4213-01	TCGA-32-4213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:123780522G>A	uc010tap.1	-	31	4115	c.4115C>T	c.(4114-4116)GCG>GTG	p.A1372V	SBNO1_uc009zxv.2_RNA|SBNO1_uc010tao.1_Missense_Mutation_p.A1371V|SBNO1_uc010taq.1_Missense_Mutation_p.A323V	NM_018183	NP_060653	A3KN83	SBNO1_HUMAN	sno, strawberry notch homolog 1	1372							ATP binding|DNA binding|hydrolase activity			breast(5)|skin(2)|ovary(1)|kidney(1)	9	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000701)|Epithelial(86;0.00197)		CTGTTGGACCGCAAGCTGTTG	0.433													7	504	---	---	---	---	capture	Missense_Mutation	SNP	123780522	123780522	SBNO1	12	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	13754	247
GLT1D1	144423	broad.mit.edu	37	12	129360490	129360490	+	Missense_Mutation	SNP	G	A	A	rs146263464	byFrequency	TCGA-32-4213-01	TCGA-32-4213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:129360490G>A	uc010tbh.1	+	2	76	c.67G>A	c.(67-69)GTT>ATT	p.V23I	GLT1D1_uc001uhx.1_Missense_Mutation_p.V34I|GLT1D1_uc001uhy.1_RNA	NM_144669	NP_653270	Q96MS3	GL1D1_HUMAN	glycosyltransferase 1 domain containing 1	34					biosynthetic process	extracellular region	transferase activity, transferring glycosyl groups				0	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;3.97e-06)|Epithelial(86;3.97e-05)|all cancers(50;0.00019)		GCACGTGTGCGTTTTGAAGGA	0.473													112	215	---	---	---	---	capture	Missense_Mutation	SNP	129360490	129360490	GLT1D1	12	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	6401	247
TUBA3C	7278	broad.mit.edu	37	13	19751585	19751585	+	Missense_Mutation	SNP	C	T	T			TCGA-32-4213-01	TCGA-32-4213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:19751585C>T	uc009zzj.2	-	4	587	c.538G>A	c.(538-540)GCC>ACC	p.A180T		NM_006001	NP_005992	Q13748	TBA3C_HUMAN	tubulin, alpha 3c	180					'de novo' posttranslational protein folding|microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|protein binding|structural molecule activity			ovary(3)|skin(2)	5		all_cancers(29;1.31e-20)|all_epithelial(30;1.59e-20)|all_lung(29;6.91e-20)|Lung NSC(5;9.25e-17)|Hepatocellular(1;0.0207)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;6.78e-06)|Epithelial(112;3.79e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00172)|Lung(94;0.0186)|LUSC - Lung squamous cell carcinoma(192;0.108)		TCCACCACGGCCGTGGAGACC	0.547													50	276	---	---	---	---	capture	Missense_Mutation	SNP	19751585	19751585	TUBA3C	13	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	16628	247
HOMEZ	57594	broad.mit.edu	37	14	23746303	23746303	+	Missense_Mutation	SNP	G	A	A			TCGA-32-4213-01	TCGA-32-4213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:23746303G>A	uc001wja.2	-	2	282	c.134C>T	c.(133-135)CCT>CTT	p.P45L	HOMEZ_uc001wjb.2_Missense_Mutation_p.P47L	NM_020834	NP_065885	Q8IX15	HOMEZ_HUMAN	homeodomain leucine zipper protein	45						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0	all_cancers(95;5.54e-06)			GBM - Glioblastoma multiforme(265;0.00643)		AGAGATTGGAGGGAGGCAGAT	0.532													3	69	---	---	---	---	capture	Missense_Mutation	SNP	23746303	23746303	HOMEZ	14	G	A	A	A	1	0	0	0	0	1	0	0	0	455	35	2	2	7206	247
ADAM20	8748	broad.mit.edu	37	14	70990596	70990596	+	Silent	SNP	A	G	G			TCGA-32-4213-01	TCGA-32-4213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:70990596A>G	uc001xme.2	-	2	1274	c.1029T>C	c.(1027-1029)CAT>CAC	p.H343H		NM_003814	NP_003805	O43506	ADA20_HUMAN	ADAM metallopeptidase domain 20 preproprotein	293	Peptidase M12B.|Extracellular (Potential).				proteolysis|single fertilization	integral to membrane	metalloendopeptidase activity|zinc ion binding			skin(1)	1			KIRC - Kidney renal clear cell carcinoma(12;0.133)|Kidney(31;0.188)	all cancers(60;0.00294)|BRCA - Breast invasive adenocarcinoma(234;0.00668)|OV - Ovarian serous cystadenocarcinoma(108;0.0344)		GTGCAACATCATGTTGTAGTC	0.368													3	115	---	---	---	---	capture	Silent	SNP	70990596	70990596	ADAM20	14	A	G	G	G	1	0	0	0	0	0	0	0	1	102	8	3	3	242	247
CDC42BPB	9578	broad.mit.edu	37	14	103447154	103447154	+	Missense_Mutation	SNP	C	A	A			TCGA-32-4213-01	TCGA-32-4213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:103447154C>A	uc001ymi.1	-	8	1328	c.1096G>T	c.(1096-1098)GAC>TAC	p.D366Y		NM_006035	NP_006026	Q9Y5S2	MRCKB_HUMAN	CDC42-binding protein kinase beta	366	AGC-kinase C-terminal.				actin cytoskeleton reorganization|establishment or maintenance of cell polarity|intracellular signal transduction	cell leading edge|cell-cell junction|cytoplasm|cytoskeleton	ATP binding|magnesium ion binding|protein serine/threonine kinase activity|small GTPase regulator activity			large_intestine(3)|skin(3)|lung(2)|stomach(1)|breast(1)|ovary(1)	11		Melanoma(154;0.155)		Colorectal(3;0.0129)|READ - Rectum adenocarcinoma(2;0.0419)|Epithelial(152;0.0474)|all cancers(159;0.199)		TTGGATGTGTCAGAGGGACTG	0.463													36	72	---	---	---	---	capture	Missense_Mutation	SNP	103447154	103447154	CDC42BPB	14	C	A	A	A	1	0	0	0	0	1	0	0	0	377	29	4	4	3044	247
AHNAK2	113146	broad.mit.edu	37	14	105415172	105415172	+	Missense_Mutation	SNP	G	T	T			TCGA-32-4213-01	TCGA-32-4213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:105415172G>T	uc010axc.1	-	7	6736	c.6616C>A	c.(6616-6618)CTT>ATT	p.L2206I	AHNAK2_uc001ypx.2_Missense_Mutation_p.L2106I	NM_138420	NP_612429	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	2206						nucleus				ovary(1)	1		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			TCGGCGGAAAGGGGCTGAATG	0.642													88	151	---	---	---	---	capture	Missense_Mutation	SNP	105415172	105415172	AHNAK2	14	G	T	T	T	1	0	0	0	0	1	0	0	0	455	35	4	4	415	247
RYR3	6263	broad.mit.edu	37	15	34080624	34080624	+	Silent	SNP	C	T	T			TCGA-32-4213-01	TCGA-32-4213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:34080624C>T	uc001zhi.2	+	67	9865	c.9795C>T	c.(9793-9795)TTC>TTT	p.F3265F	RYR3_uc010bar.2_Silent_p.F3265F	NM_001036	NP_001027	Q15413	RYR3_HUMAN	ryanodine receptor 3	3265					cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(5)|central_nervous_system(4)|lung(1)	10		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		TCTATGCCTTCTACCCCATGC	0.557													31	70	---	---	---	---	capture	Silent	SNP	34080624	34080624	RYR3	15	C	T	T	T	1	0	0	0	0	0	0	0	1	415	32	2	2	13662	247
MAN2A2	4122	broad.mit.edu	37	15	91454437	91454437	+	Missense_Mutation	SNP	C	T	T	rs114870914	by1000genomes	TCGA-32-4213-01	TCGA-32-4213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:91454437C>T	uc010bnz.2	+	13	2027	c.1912C>T	c.(1912-1914)CGC>TGC	p.R638C	MAN2A2_uc010boa.2_Missense_Mutation_p.R680C|MAN2A2_uc002bqc.2_Missense_Mutation_p.R638C|MAN2A2_uc010uql.1_Missense_Mutation_p.R300C|MAN2A2_uc010uqm.1_Missense_Mutation_p.R217C|MAN2A2_uc010uqn.1_5'Flank	NM_006122	NP_006113	P49641	MA2A2_HUMAN	mannosidase, alpha, class 2A, member 2	638	Lumenal (Potential).				mannose metabolic process|post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane	alpha-mannosidase activity|carbohydrate binding|mannosyl-oligosaccharide 1,3-1,6-alpha-mannosidase activity|zinc ion binding			large_intestine(2)|ovary(1)	3	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.229)			CCTCCCAGAGCGCACGGTGAT	0.617													12	21	---	---	---	---	capture	Missense_Mutation	SNP	91454437	91454437	MAN2A2	15	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	9129	247
ADCY9	115	broad.mit.edu	37	16	4042213	4042213	+	Missense_Mutation	SNP	G	T	T			TCGA-32-4213-01	TCGA-32-4213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:4042213G>T	uc002cvx.2	-	5	2680	c.2141C>A	c.(2140-2142)CCG>CAG	p.P714Q		NM_001116	NP_001107	O60503	ADCY9_HUMAN	adenylate cyclase 9	714	Cytoplasmic (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to plasma membrane	adenylate cyclase activity|ATP binding|metal ion binding			ovary(4)|large_intestine(1)|central_nervous_system(1)	6						GAACCTCAGCGGAAGGAGAGC	0.542													43	110	---	---	---	---	capture	Missense_Mutation	SNP	4042213	4042213	ADCY9	16	G	T	T	T	1	0	0	0	0	1	0	0	0	507	39	4	4	301	247
SOCS1	8651	broad.mit.edu	37	16	11348719	11348719	+	Missense_Mutation	SNP	G	T	T			TCGA-32-4213-01	TCGA-32-4213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:11348719G>T	uc002dar.1	-	2	771	c.617C>A	c.(616-618)TCC>TAC	p.S206Y	C16orf75_uc002daq.1_Intron	NM_003745	NP_003736	O15524	SOCS1_HUMAN	suppressor of cytokine signaling 1	206	SOCS box.				interferon-gamma-mediated signaling pathway|JAK-STAT cascade|negative regulation of insulin receptor signaling pathway|negative regulation of tyrosine phosphorylation of Stat3 protein|regulation of growth|regulation of interferon-gamma-mediated signaling pathway|regulation of type I interferon-mediated signaling pathway|type I interferon-mediated signaling pathway	cytosol	insulin-like growth factor receptor binding|protein kinase binding|protein kinase inhibitor activity	p.S206P(1)|p.R127_*212del(1)		haematopoietic_and_lymphoid_tissue(64)|lung(3)|breast(1)|central_nervous_system(1)	69						GAAGGGGAAGGAGCTCAGGTA	0.627			F|O		Hodgkin Lymphoma|PMBL								5	18	---	---	---	---	capture	Missense_Mutation	SNP	11348719	11348719	SOCS1	16	G	T	T	T	1	0	0	0	0	1	0	0	0	533	41	4	4	14805	247
SEZ6L2	26470	broad.mit.edu	37	16	29908260	29908260	+	Missense_Mutation	SNP	G	A	A			TCGA-32-4213-01	TCGA-32-4213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:29908260G>A	uc002duq.3	-	3	634	c.394C>T	c.(394-396)CCA>TCA	p.P132S	uc002dtf.2_Intron|BOLA2_uc010bzb.1_Intron|SEZ6L2_uc002dup.3_Intron|SEZ6L2_uc002dur.3_Intron|SEZ6L2_uc002dus.3_Missense_Mutation_p.P132S|SEZ6L2_uc010vec.1_Missense_Mutation_p.P132S|SEZ6L2_uc010ved.1_Missense_Mutation_p.P88S	NM_201575	NP_963869	Q6UXD5	SE6L2_HUMAN	seizure related 6 homolog (mouse)-like 2 isoform	132	Pro-rich.|Extracellular (Potential).					endoplasmic reticulum membrane|integral to membrane|plasma membrane				ovary(1)|skin(1)	2						GGTGGGGGTGGGGCTGTGGTT	0.687													3	38	---	---	---	---	capture	Missense_Mutation	SNP	29908260	29908260	SEZ6L2	16	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	14037	247
CHD9	80205	broad.mit.edu	37	16	53358755	53358755	+	Missense_Mutation	SNP	C	A	A			TCGA-32-4213-01	TCGA-32-4213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:53358755C>A	uc002ehb.2	+	38	8806	c.8642C>A	c.(8641-8643)TCT>TAT	p.S2881Y	CHD9_uc002egy.2_Missense_Mutation_p.S2865Y|CHD9_uc002ehc.2_Missense_Mutation_p.S2866Y|CHD9_uc002ehf.2_Missense_Mutation_p.S1979Y|CHD9_uc010cbw.2_Missense_Mutation_p.S947Y	NM_025134	NP_079410	Q3L8U1	CHD9_HUMAN	chromodomain helicase DNA binding protein 9	2881	Poly-Ser.				cellular lipid metabolic process|chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleoplasm	ATP binding|DNA binding|helicase activity|protein binding			lung(2)|central_nervous_system(1)|breast(1)|skin(1)|ovary(1)|kidney(1)	7		all_cancers(37;0.0212)				TCATCTGGATCTGATAGTACA	0.388													9	27	---	---	---	---	capture	Missense_Mutation	SNP	53358755	53358755	CHD9	16	C	A	A	A	1	0	0	0	0	1	0	0	0	416	32	4	4	3298	247
CDH8	1006	broad.mit.edu	37	16	61687800	61687800	+	Missense_Mutation	SNP	C	A	A			TCGA-32-4213-01	TCGA-32-4213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:61687800C>A	uc002eog.1	-	12	2364	c.2112G>T	c.(2110-2112)TTG>TTT	p.L704F		NM_001796	NP_001787	P55286	CADH8_HUMAN	cadherin 8, type 2 preproprotein	704	Cytoplasmic (Potential).				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(6)|skin(2)|breast(1)	9		Ovarian(137;0.0799)|Melanoma(118;0.16)		UCEC - Uterine corpus endometrioid carcinoma (183;0.196)|Epithelial(162;0.0155)|all cancers(182;0.0305)|OV - Ovarian serous cystadenocarcinoma(108;0.0499)|BRCA - Breast invasive adenocarcinoma(181;0.249)		GCATAAACTGCAAATCTGGTT	0.428													9	284	---	---	---	---	capture	Missense_Mutation	SNP	61687800	61687800	CDH8	16	C	A	A	A	1	0	0	0	0	1	0	0	0	324	25	4	4	3087	247
DPH1	1801	broad.mit.edu	37	17	1936938	1936938	+	Silent	SNP	C	A	A			TCGA-32-4213-01	TCGA-32-4213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:1936938C>A	uc002fts.2	+	2	234	c.216C>A	c.(214-216)GCC>GCA	p.A72A	DPH1_uc002ftr.1_RNA|DPH1_uc002ftt.2_Silent_p.A67A|DPH1_uc010cjx.2_5'UTR|DPH1_uc010vqs.1_Silent_p.A82A	NM_001383	NP_001374	Q9BZG8	DPH1_HUMAN	diptheria toxin resistance protein required for	72					peptidyl-diphthamide biosynthetic process from peptidyl-histidine|translation	cytoplasm|nucleus				pancreas(1)	1						TCCAACAAGCCCAGGCCAAGA	0.582													4	148	---	---	---	---	capture	Silent	SNP	1936938	1936938	DPH1	17	C	A	A	A	1	0	0	0	0	0	0	0	1	275	22	4	4	4674	247
KRT38	8687	broad.mit.edu	37	17	39594785	39594785	+	Silent	SNP	C	T	T			TCGA-32-4213-01	TCGA-32-4213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:39594785C>T	uc002hwq.1	-	5	1401	c.978G>A	c.(976-978)ACG>ACA	p.T326T		NM_006771	NP_006762	O76015	KRT38_HUMAN	keratin 38	326	Coil 2.|Rod.					intermediate filament	structural molecule activity			skin(2)	2		Breast(137;0.000496)				GGGCATTCACCGTGCATCTCA	0.597													37	108	---	---	---	---	capture	Silent	SNP	39594785	39594785	KRT38	17	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	8395	247
KRT16	3868	broad.mit.edu	37	17	39768925	39768925	+	Missense_Mutation	SNP	G	A	A			TCGA-32-4213-01	TCGA-32-4213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:39768925G>A	uc002hxg.3	-	1	155	c.16C>T	c.(16-18)CGC>TGC	p.R6C	JUP_uc010wfs.1_Intron	NM_005557	NP_005548	P08779	K1C16_HUMAN	keratin 16	6	Head.				cell proliferation|epidermis development	intermediate filament	protein binding|structural constituent of cytoskeleton			skin(1)	1		Breast(137;0.000307)				GTGAACTGGCGGCTGCAGGTG	0.657													4	13	---	---	---	---	capture	Missense_Mutation	SNP	39768925	39768925	KRT16	17	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	8373	247
KLHL11	55175	broad.mit.edu	37	17	40010614	40010614	+	Missense_Mutation	SNP	C	T	T			TCGA-32-4213-01	TCGA-32-4213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:40010614C>T	uc002hyf.1	-	2	1511	c.1505G>A	c.(1504-1506)CGG>CAG	p.R502Q		NM_018143	NP_060613	Q9NVR0	KLH11_HUMAN	kelch-like 11 precursor	502						extracellular region					0		Breast(137;0.00156)				GTATACAAACCGGTCTTCAAT	0.443													3	107	---	---	---	---	capture	Missense_Mutation	SNP	40010614	40010614	KLHL11	17	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	8287	247
NPTX1	4884	broad.mit.edu	37	17	78447110	78447110	+	Missense_Mutation	SNP	C	T	T			TCGA-32-4213-01	TCGA-32-4213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:78447110C>T	uc002jyp.1	-	3	945	c.787G>A	c.(787-789)GCC>ACC	p.A263T		NM_002522	NP_002513	Q15818	NPTX1_HUMAN	neuronal pentraxin I precursor	263	Pentaxin.				central nervous system development|synaptic transmission|transport	transport vesicle	metal ion binding				0	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0232)|OV - Ovarian serous cystadenocarcinoma(97;0.0487)			CCTGGCGTGGCGCTGGACTTG	0.587													107	222	---	---	---	---	capture	Missense_Mutation	SNP	78447110	78447110	NPTX1	17	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	10509	247
POTEC	388468	broad.mit.edu	37	18	14533125	14533125	+	Silent	SNP	A	G	G			TCGA-32-4213-01	TCGA-32-4213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:14533125A>G	uc010dln.2	-	5	1444	c.990T>C	c.(988-990)GAT>GAC	p.D330D	POTEC_uc010xaj.1_RNA	NM_001137671	NP_001131143	B2RU33	POTEC_HUMAN	ANKRD26-like family B, member 2	330	ANK 6.									skin(3)	3						GAGAAGATACATCAACATTTT	0.373													105	205	---	---	---	---	capture	Silent	SNP	14533125	14533125	POTEC	18	A	G	G	G	1	0	0	0	0	0	0	0	1	102	8	3	3	12164	247
STXBP2	6813	broad.mit.edu	37	19	7707143	7707143	+	Missense_Mutation	SNP	G	A	A			TCGA-32-4213-01	TCGA-32-4213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:7707143G>A	uc002mha.3	+	9	763	c.718G>A	c.(718-720)GTG>ATG	p.V240M	STXBP2_uc002mhb.3_Missense_Mutation_p.V237M|STXBP2_uc010dvj.2_RNA|STXBP2_uc010xjr.1_Missense_Mutation_p.V251M|STXBP2_uc010dvk.2_Missense_Mutation_p.V208M|STXBP2_uc002mhc.3_Missense_Mutation_p.V8M|STXBP2_uc002mhe.1_5'Flank	NM_006949	NP_008880	Q15833	STXB2_HUMAN	syntaxin binding protein 2 isoform a	240					leukocyte mediated cytotoxicity|neutrophil degranulation|protein transport|regulation of mast cell degranulation|vesicle docking involved in exocytosis	azurophil granule|cytolytic granule|cytosol|specific granule|tertiary granule	syntaxin-3 binding			central_nervous_system(1)	1						AGCTGACCCCGTGTCCCCACT	0.607													24	68	---	---	---	---	capture	Missense_Mutation	SNP	7707143	7707143	STXBP2	19	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	15243	247
USE1	55850	broad.mit.edu	37	19	17330166	17330166	+	Silent	SNP	C	T	T			TCGA-32-4213-01	TCGA-32-4213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:17330166C>T	uc002nfo.2	+	7	627	c.567C>T	c.(565-567)GCC>GCT	p.A189A	USE1_uc010eal.1_Intron	NM_018467	NP_060937	Q9NZ43	USE1_HUMAN	unconventional SNARE in the ER 1 homolog	189	Cytoplasmic (Potential).|Potential.				lysosomal transport|protein catabolic process|protein transport|secretion by cell|vesicle-mediated transport	endoplasmic reticulum membrane|integral to membrane	protein binding				0						ATACCCTGGCCGcccagagtg	0.303													3	13	---	---	---	---	capture	Silent	SNP	17330166	17330166	USE1	19	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	16913	247
ZNF85	7639	broad.mit.edu	37	19	21131689	21131689	+	Silent	SNP	G	A	A			TCGA-32-4213-01	TCGA-32-4213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:21131689G>A	uc002npg.3	+	4	496	c.369G>A	c.(367-369)GAG>GAA	p.E123E	ZNF85_uc010ecn.2_Silent_p.E58E|ZNF85_uc010eco.2_Silent_p.E71E|ZNF85_uc002npi.2_Silent_p.E64E	NM_003429	NP_003420	Q03923	ZNF85_HUMAN	zinc finger protein 85	123						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity|zinc ion binding			central_nervous_system(1)	1						GTATGGATGAGTGTAAGATGC	0.328													29	66	---	---	---	---	capture	Silent	SNP	21131689	21131689	ZNF85	19	G	A	A	A	1	0	0	0	0	0	0	0	1	464	36	2	2	18069	247
MLL4	9757	broad.mit.edu	37	19	36223857	36223857	+	Missense_Mutation	SNP	T	A	A			TCGA-32-4213-01	TCGA-32-4213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:36223857T>A	uc010eei.2	+	29	6407	c.6407T>A	c.(6406-6408)CTC>CAC	p.L2136H		NM_014727	NP_055542	Q9UMN6	MLL4_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 4	2136					chromatin-mediated maintenance of transcription		DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			central_nervous_system(6)|breast(2)|ovary(1)|kidney(1)|skin(1)	11	all_lung(56;3.33e-07)|Lung NSC(56;5.02e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			GAGGAGTCACTCCCCCCGGCG	0.662													2	7	---	---	---	---	capture	Missense_Mutation	SNP	36223857	36223857	MLL4	19	T	A	A	A	1	0	0	0	0	1	0	0	0	702	54	4	4	9535	247
YSK4	80122	broad.mit.edu	37	2	135738775	135738775	+	Missense_Mutation	SNP	T	C	C			TCGA-32-4213-01	TCGA-32-4213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:135738775T>C	uc002tue.1	-	9	3567	c.3536A>G	c.(3535-3537)GAG>GGG	p.E1179G	YSK4_uc002tuf.1_Missense_Mutation_p.E361G|YSK4_uc010fnc.1_Missense_Mutation_p.E313G|YSK4_uc010fnd.1_Missense_Mutation_p.E1066G|YSK4_uc010zbg.1_Missense_Mutation_p.E311G|YSK4_uc002tuh.3_Missense_Mutation_p.E907G|YSK4_uc002tui.3_3'UTR	NM_025052	NP_079328	Q56UN5	YSK4_HUMAN	Yeast Sps1/Ste20-related kinase 4 isoform 1	1179	Protein kinase.						ATP binding|protein serine/threonine kinase activity			stomach(2)|urinary_tract(1)|ovary(1)|breast(1)	5				BRCA - Breast invasive adenocarcinoma(221;0.112)		CACACAGTTCTCATGGAGATA	0.413													6	260	---	---	---	---	capture	Missense_Mutation	SNP	135738775	135738775	YSK4	2	T	C	C	C	1	0	0	0	0	1	0	0	0	702	54	3	3	17376	247
TTN	7273	broad.mit.edu	37	2	179413171	179413171	+	Missense_Mutation	SNP	C	T	T			TCGA-32-4213-01	TCGA-32-4213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179413171C>T	uc010zfg.1	-	288	85702	c.85478G>A	c.(85477-85479)CGT>CAT	p.R28493H	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.R22188H|TTN_uc010zfi.1_Missense_Mutation_p.R22121H|TTN_uc010zfj.1_Missense_Mutation_p.R21996H	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	29420							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTGCCAACTACGGCGACTTGC	0.498													145	316	---	---	---	---	capture	Missense_Mutation	SNP	179413171	179413171	TTN	2	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	16617	247
SPAG16	79582	broad.mit.edu	37	2	214204919	214204919	+	Missense_Mutation	SNP	A	G	G			TCGA-32-4213-01	TCGA-32-4213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:214204919A>G	uc002veq.2	+	6	661	c.569A>G	c.(568-570)AAA>AGA	p.K190R	SPAG16_uc010fuz.1_Missense_Mutation_p.K41R|SPAG16_uc002ver.2_Missense_Mutation_p.K136R|SPAG16_uc010zjk.1_Missense_Mutation_p.K96R|SPAG16_uc002vep.1_Intron|SPAG16_uc002ves.1_Missense_Mutation_p.K159R	NM_024532	NP_078808	Q8N0X2	SPG16_HUMAN	sperm associated antigen 16 isoform 1	190	Potential.				cilium assembly	cilium axoneme|flagellar axoneme				ovary(1)|skin(1)	2		Renal(323;0.00461)		UCEC - Uterine corpus endometrioid carcinoma (47;0.0525)|Epithelial(149;7.07e-07)|all cancers(144;7.96e-05)|Lung(261;0.00255)|LUSC - Lung squamous cell carcinoma(224;0.00599)		AAAATTCAGAAAGAACGTGAT	0.294													15	30	---	---	---	---	capture	Missense_Mutation	SNP	214204919	214204919	SPAG16	2	A	G	G	G	1	0	0	0	0	1	0	0	0	13	1	3	3	14870	247
FN1	2335	broad.mit.edu	37	2	216300455	216300455	+	Missense_Mutation	SNP	G	A	A			TCGA-32-4213-01	TCGA-32-4213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:216300455G>A	uc002vfa.2	-	1	337	c.71C>T	c.(70-72)ACG>ATG	p.T24M	FN1_uc002vfb.2_Missense_Mutation_p.T24M|FN1_uc002vfc.2_Missense_Mutation_p.T24M|FN1_uc002vfd.2_Missense_Mutation_p.T24M|FN1_uc002vfe.2_Missense_Mutation_p.T24M|FN1_uc002vff.2_Missense_Mutation_p.T24M|FN1_uc002vfg.2_Missense_Mutation_p.T24M|FN1_uc002vfh.2_Missense_Mutation_p.T24M|FN1_uc002vfi.2_Missense_Mutation_p.T24M|FN1_uc002vfj.2_Missense_Mutation_p.T24M|FN1_uc002vfl.2_Missense_Mutation_p.T24M	NM_212482	NP_997647	P02751	FINC_HUMAN	fibronectin 1 isoform 1 preproprotein	24					acute-phase response|angiogenesis|leukocyte migration|peptide cross-linking|platelet activation|platelet degranulation|regulation of cell shape|substrate adhesion-dependent cell spreading	ER-Golgi intermediate compartment|fibrinogen complex|platelet alpha granule lumen|proteinaceous extracellular matrix	collagen binding|extracellular matrix structural constituent|heparin binding			central_nervous_system(7)|large_intestine(2)|breast(2)|ovary(1)|pancreas(1)	13		Renal(323;0.127)		Epithelial(149;9.59e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	CGAGGCTCCCGTGGAGGGCAC	0.667													2	14	---	---	---	---	capture	Missense_Mutation	SNP	216300455	216300455	FN1	2	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	5906	247
FAM134A	79137	broad.mit.edu	37	2	220046155	220046155	+	Silent	SNP	C	T	T			TCGA-32-4213-01	TCGA-32-4213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:220046155C>T	uc002vjw.3	+	7	985	c.849C>T	c.(847-849)AGC>AGT	p.S283S	FAM134A_uc010fwc.2_Silent_p.S76S|FAM134A_uc002vjx.2_Silent_p.S76S	NM_024293	NP_077269	Q8NC44	F134A_HUMAN	hypothetical protein LOC79137	283						endoplasmic reticulum|integral to membrane				ovary(1)|central_nervous_system(1)	2		Renal(207;0.0915)		Epithelial(149;8.92e-07)|all cancers(144;0.000151)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		AGAGTGAAAGCGAGGCAGAGC	0.542													34	72	---	---	---	---	capture	Silent	SNP	220046155	220046155	FAM134A	2	C	T	T	T	1	0	0	0	0	0	0	0	1	350	27	1	1	5399	247
SP100	6672	broad.mit.edu	37	2	231406616	231406616	+	Missense_Mutation	SNP	G	A	A			TCGA-32-4213-01	TCGA-32-4213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:231406616G>A	uc002vqu.1	+	28	2554	c.2413G>A	c.(2413-2415)GGG>AGG	p.G805R	SP100_uc010fxp.1_Missense_Mutation_p.G123R	NM_001080391	NP_001073860	P23497	SP100_HUMAN	nuclear antigen Sp100 isoform 1	Error:Variant_position_missing_in_P23497_after_alignment					DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|interspecies interaction between organisms|negative regulation of cellular component movement|negative regulation of DNA binding|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|negative regulation of transcription, DNA-dependent|negative regulation of viral transcription|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|response to cytokine stimulus|response to retinoic acid|response to type I interferon	cytoplasm|nuclear periphery|nucleolus|PML body	chromo shadow domain binding|DNA binding|identical protein binding|kinase binding|protein homodimerization activity|transcription coactivator activity|transcription corepressor activity|transcription factor binding			ovary(4)|central_nervous_system(1)	5		Renal(207;0.0112)|all_lung(227;0.0335)|all_hematologic(139;0.0749)|Lung NSC(271;0.142)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.13e-12)|all cancers(144;2.71e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)		GAACAGAGAGGGGTCTCAGGG	0.403													31	83	---	---	---	---	capture	Missense_Mutation	SNP	231406616	231406616	SP100	2	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	14852	247
HDAC4	9759	broad.mit.edu	37	2	240002804	240002804	+	Silent	SNP	A	G	G			TCGA-32-4213-01	TCGA-32-4213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:240002804A>G	uc002vyk.3	-	22	3514	c.2722T>C	c.(2722-2724)TTG>CTG	p.L908L	HDAC4_uc010fyy.2_Silent_p.L865L	NM_006037	NP_006028	P56524	HDAC4_HUMAN	histone deacetylase 4	908	Histone deacetylase.				B cell differentiation|cardiac muscle hypertrophy in response to stress|chromatin remodeling|histone H3 deacetylation|histone H4 deacetylation|inflammatory response|negative regulation of glycolysis|negative regulation of myotube differentiation|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|nervous system development|peptidyl-lysine deacetylation|positive regulation of cell proliferation|positive regulation of protein sumoylation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|regulation of protein binding|response to denervation involved in regulation of muscle adaptation|response to interleukin-1|transcription, DNA-dependent	histone deacetylase complex|transcriptional repressor complex	activating transcription factor binding|histone deacetylase activity (H3-K16 specific)|histone deacetylase binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|potassium ion binding|repressing transcription factor binding|zinc ion binding			breast(3)|skin(2)|ovary(1)	6		all_epithelial(40;1.45e-17)|Breast(86;1.53e-05)|Renal(207;0.000355)|all_lung(227;0.0121)|Ovarian(221;0.0183)|Lung NSC(271;0.0413)|Melanoma(123;0.0749)|all_hematologic(139;0.159)		Epithelial(121;6.38e-25)|OV - Ovarian serous cystadenocarcinoma(60;2.48e-12)|Kidney(56;6.04e-08)|KIRC - Kidney renal clear cell carcinoma(57;1.18e-06)|BRCA - Breast invasive adenocarcinoma(100;3.99e-05)|Lung(119;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.04)		AAGGCCGCCAAGTACTCAGCG	0.602													2	28	---	---	---	---	capture	Silent	SNP	240002804	240002804	HDAC4	2	A	G	G	G	1	0	0	0	0	0	0	0	1	37	3	3	3	6936	247
TPTE	7179	broad.mit.edu	37	21	10934961	10934961	+	Missense_Mutation	SNP	G	T	T			TCGA-32-4213-01	TCGA-32-4213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:10934961G>T	uc002yip.1	-	15	1200	c.832C>A	c.(832-834)CAC>AAC	p.H278N	TPTE_uc002yis.1_RNA|TPTE_uc002yiq.1_Missense_Mutation_p.H260N|TPTE_uc002yir.1_Missense_Mutation_p.H240N|TPTE_uc010gkv.1_Missense_Mutation_p.H140N	NM_199261	NP_954870	P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology	278	Phosphatase tensin-type.				signal transduction	integral to membrane	ion channel activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(2)|lung(1)|breast(1)|skin(1)	5			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		ACTCGATAGTGGTTTCGGTGT	0.348													17	104	---	---	---	---	capture	Missense_Mutation	SNP	10934961	10934961	TPTE	21	G	T	T	T	1	0	0	0	0	1	0	0	0	611	47	4	4	16313	247
C21orf7	56911	broad.mit.edu	37	21	30547106	30547106	+	Missense_Mutation	SNP	G	A	A			TCGA-32-4213-01	TCGA-32-4213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:30547106G>A	uc002yne.2	+	8	893	c.622G>A	c.(622-624)GAG>AAG	p.E208K	C21orf7_uc011acr.1_RNA|C21orf7_uc002ynd.2_RNA|C21orf7_uc010gln.2_RNA|C21orf7_uc002ynf.2_Missense_Mutation_p.E208K|C21orf7_uc010glo.2_Missense_Mutation_p.E53K|C21orf7_uc002yng.2_Missense_Mutation_p.E108K|C21orf7_uc010glp.2_RNA	NM_020152	NP_064537	P57077	TAK1L_HUMAN	chromosome 21 open reading frame 7	208						cytosol|nucleus	protein binding			ovary(2)	2				Colorectal(56;0.248)		TCGGGAATTCGAGGCTCTGAC	0.517													35	85	---	---	---	---	capture	Missense_Mutation	SNP	30547106	30547106	C21orf7	21	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	2113	247
SON	6651	broad.mit.edu	37	21	34925244	34925244	+	Missense_Mutation	SNP	A	G	G			TCGA-32-4213-01	TCGA-32-4213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:34925244A>G	uc002yse.1	+	3	3756	c.3707A>G	c.(3706-3708)GAT>GGT	p.D1236G	SON_uc002ysb.1_Missense_Mutation_p.D1236G|SON_uc002ysc.2_Missense_Mutation_p.D1236G|SON_uc002ysd.2_Missense_Mutation_p.D227G|SON_uc002ysf.1_Intron|SON_uc002ysg.2_Missense_Mutation_p.D227G	NM_138927	NP_620305	P18583	SON_HUMAN	SON DNA-binding protein isoform F	1236					anti-apoptosis|cytokinesis|mRNA processing|regulation of cell cycle|regulation of RNA splicing|RNA splicing|spindle pole body separation	nuclear speck	DNA binding|double-stranded RNA binding			ovary(4)|skin(2)	6						TCAGCATCAGATCCCTCAGTT	0.478													108	246	---	---	---	---	capture	Missense_Mutation	SNP	34925244	34925244	SON	21	A	G	G	G	1	0	0	0	0	1	0	0	0	156	12	3	3	14818	247
TRAPPC10	7109	broad.mit.edu	37	21	45503036	45503036	+	Silent	SNP	A	G	G			TCGA-32-4213-01	TCGA-32-4213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:45503036A>G	uc002zea.2	+	14	2260	c.2091A>G	c.(2089-2091)AGA>AGG	p.R697R	TRAPPC10_uc010gpo.2_Silent_p.R408R|TRAPPC10_uc011afa.1_Silent_p.R116R	NM_003274	NP_003265	P48553	TPC10_HUMAN	trafficking protein particle complex 10	697					vesicle-mediated transport	Golgi apparatus|integral to membrane	binding|sodium ion transmembrane transporter activity			ovary(1)|skin(1)	2						TTATCTGCAGAAACGTCCACA	0.547													51	101	---	---	---	---	capture	Silent	SNP	45503036	45503036	TRAPPC10	21	A	G	G	G	1	0	0	0	0	0	0	0	1	115	9	3	3	16340	247
COL6A2	1292	broad.mit.edu	37	21	47531965	47531965	+	Missense_Mutation	SNP	C	T	T			TCGA-32-4213-01	TCGA-32-4213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:47531965C>T	uc002zia.1	+	3	270	c.188C>T	c.(187-189)ACG>ATG	p.T63M	COL6A2_uc002zhy.1_Missense_Mutation_p.T63M|COL6A2_uc002zhz.1_Missense_Mutation_p.T63M|COL6A2_uc002zib.1_Intron	NM_001849	NP_001840	P12110	CO6A2_HUMAN	alpha 2 type VI collagen isoform 2C2 precursor	63	VWFA 1.|Nonhelical region.				axon guidance|cell-cell adhesion|extracellular matrix organization|protein heterotrimerization	collagen|extracellular space|protein complex	extracellular matrix structural constituent|protein binding, bridging			central_nervous_system(7)|ovary(1)	8	Breast(49;0.245)			Colorectal(79;0.0303)|READ - Rectum adenocarcinoma(84;0.0649)		CAGTCCCCCACGGACATCCTG	0.612													31	67	---	---	---	---	capture	Missense_Mutation	SNP	47531965	47531965	COL6A2	21	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	3665	247
YDJC	150223	broad.mit.edu	37	22	21984158	21984158	+	Missense_Mutation	SNP	G	A	A			TCGA-32-4213-01	TCGA-32-4213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:21984158G>A	uc002zvb.2	-	1	183	c.146C>T	c.(145-147)GCG>GTG	p.A49V	YDJC_uc002zvc.2_RNA|YDJC_uc002zvd.2_Missense_Mutation_p.A49V|CCDC116_uc011aih.1_5'Flank|CCDC116_uc002zve.2_5'Flank	NM_001017964	NP_001017964	A8MPS7	YDJC_HUMAN	YdjC homolog	49					carbohydrate metabolic process		hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds				0	Colorectal(54;0.105)					CAGCTCCGCCGCGCTCTCCGT	0.731													2	5	---	---	---	---	capture	Missense_Mutation	SNP	21984158	21984158	YDJC	22	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	17352	247
TYMP	1890	broad.mit.edu	37	22	50967631	50967631	+	Silent	SNP	G	A	A			TCGA-32-4213-01	TCGA-32-4213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:50967631G>A	uc003bmb.3	-	2	471	c.351C>T	c.(349-351)TCC>TCT	p.S117S	TYMP_uc003bmc.3_Silent_p.S117S|TYMP_uc003bmd.3_Silent_p.S117S|TYMP_uc010hbd.2_Silent_p.S117S|TYMP_uc003bme.3_Silent_p.S117S|TYMP_uc003bmf.3_Silent_p.S117S|TYMP_uc011arz.1_Silent_p.S117S	NM_001113756	NP_001107228	P19971	TYPH_HUMAN	endothelial cell growth factor 1	117					angiogenesis|cell differentiation|chemotaxis|DNA replication|mitochondrial genome maintenance|pyrimidine base metabolic process|pyrimidine nucleoside catabolic process|pyrimidine nucleoside salvage|pyrimidine nucleotide metabolic process	cytosol	growth factor activity|platelet-derived growth factor receptor binding|pyrimidine-nucleoside phosphorylase activity|thymidine phosphorylase activity			ovary(1)	1		all_cancers(38;4.58e-14)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.206)|LUAD - Lung adenocarcinoma(64;0.247)	Capecitabine(DB01101)|Docetaxel(DB01248)|Floxuridine(DB00322)|Fluorouracil(DB00544)|Sulfasalazine(DB00795)|Tamoxifen(DB00675)	CACCCCCTGTGGAATGCTTGT	0.637													27	55	---	---	---	---	capture	Silent	SNP	50967631	50967631	TYMP	22	G	A	A	A	1	0	0	0	0	0	0	0	1	600	47	2	2	16693	247
CHRD	8646	broad.mit.edu	37	3	184099068	184099068	+	Missense_Mutation	SNP	A	G	G			TCGA-32-4213-01	TCGA-32-4213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:184099068A>G	uc003fov.2	+	3	544	c.298A>G	c.(298-300)AAG>GAG	p.K100E	CHRD_uc003fow.2_5'UTR|CHRD_uc003fox.2_Missense_Mutation_p.K100E|CHRD_uc003foy.2_5'UTR|CHRD_uc010hyc.2_5'UTR|CHRD_uc011brr.1_5'Flank	NM_003741	NP_003732	Q9H2X0	CHRD_HUMAN	chordin precursor	100	VWFC 1.				BMP signaling pathway involved in spinal cord dorsal/ventral patterning|floor plate development|negative regulation of BMP signaling pathway|negative regulation of cell migration|positive regulation of cell adhesion|skeletal system development	extracellular space	cytokine binding			skin(2)|ovary(1)	3	all_cancers(143;6.33e-11)|Ovarian(172;0.0339)		Epithelial(37;4.96e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			GGTCAGCTGCAAGAACATCAA	0.647													2	38	---	---	---	---	capture	Missense_Mutation	SNP	184099068	184099068	CHRD	3	A	G	G	G	1	0	0	0	0	1	0	0	0	65	5	3	3	3337	247
RASSF6	166824	broad.mit.edu	37	4	74464408	74464408	+	Silent	SNP	G	T	T			TCGA-32-4213-01	TCGA-32-4213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:74464408G>T	uc003hhd.1	-	3	312	c.189C>A	c.(187-189)ACC>ACA	p.T63T	RASSF6_uc003hhc.1_Silent_p.T31T|RASSF6_uc010iik.1_Silent_p.T31T|RASSF6_uc010iil.1_Intron	NM_201431	NP_958834	Q6ZTQ3	RASF6_HUMAN	Ras association (RalGDS/AF-6) domain family 6	63					apoptosis|signal transduction		protein binding			pancreas(2)	2	Breast(15;0.00102)		all cancers(17;0.00104)|Lung(101;0.128)|LUSC - Lung squamous cell carcinoma(112;0.187)			AAATGTTATAGGTCTTCAATA	0.269													3	10	---	---	---	---	capture	Silent	SNP	74464408	74464408	RASSF6	4	G	T	T	T	1	0	0	0	0	0	0	0	1	444	35	4	4	12985	247
EGF	1950	broad.mit.edu	37	4	110882086	110882086	+	Missense_Mutation	SNP	C	A	A			TCGA-32-4213-01	TCGA-32-4213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:110882086C>A	uc003hzy.3	+	7	1582	c.1130C>A	c.(1129-1131)TCC>TAC	p.S377Y	EGF_uc011cfu.1_Missense_Mutation_p.S335Y|EGF_uc011cfv.1_Missense_Mutation_p.S377Y	NM_001963	NP_001954	P01133	EGF_HUMAN	epidermal growth factor precursor	377	EGF-like 2; calcium-binding (Potential).|Extracellular (Potential).				angiogenesis|DNA replication|epidermal growth factor receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway|negative regulation of secretion|platelet activation|platelet degranulation|positive regulation of catenin import into nucleus|positive regulation of epidermal growth factor receptor activity|positive regulation of MAP kinase activity|positive regulation of mitosis|regulation of calcium ion import|regulation of protein localization at cell surface	integral to membrane|plasma membrane|platelet alpha granule lumen	calcium ion binding|epidermal growth factor receptor binding|growth factor activity|transmembrane receptor protein tyrosine kinase activator activity			ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	4		Hepatocellular(203;0.0893)		OV - Ovarian serous cystadenocarcinoma(123;9.87e-06)	Sulindac(DB00605)	ACCCCTGGATCCTATTACTGC	0.398													51	91	---	---	---	---	capture	Missense_Mutation	SNP	110882086	110882086	EGF	4	C	A	A	A	1	0	0	0	0	1	0	0	0	390	30	4	4	4917	247
DNAH5	1767	broad.mit.edu	37	5	13883072	13883072	+	Nonsense_Mutation	SNP	C	A	A			TCGA-32-4213-01	TCGA-32-4213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:13883072C>A	uc003jfd.2	-	20	3157	c.3115G>T	c.(3115-3117)GAG>TAG	p.E1039*		NM_001369	NP_001360	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	1039	Stem (By similarity).				microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31	Lung NSC(4;0.00476)					ATGATGCACTCCACGGCTTTG	0.537									Kartagener_syndrome				93	140	---	---	---	---	capture	Nonsense_Mutation	SNP	13883072	13883072	DNAH5	5	C	A	A	A	1	0	0	0	0	0	1	0	0	390	30	5	4	4561	247
AP3B1	8546	broad.mit.edu	37	5	77473219	77473219	+	Silent	SNP	T	G	G			TCGA-32-4213-01	TCGA-32-4213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:77473219T>G	uc003kfj.2	-	9	1109	c.984A>C	c.(982-984)CCA>CCC	p.P328P		NM_003664	NP_003655	O00203	AP3B1_HUMAN	adaptor-related protein complex 3, beta 1	328					endocytosis|melanosome organization	clathrin coated vesicle membrane|Golgi apparatus|membrane coat	protein phosphatase binding|protein transporter activity			central_nervous_system(1)	1		all_lung(232;0.000397)|Lung NSC(167;0.00106)|Ovarian(174;0.0105)|Prostate(461;0.215)		OV - Ovarian serous cystadenocarcinoma(54;8.23e-47)|Epithelial(54;2.74e-41)|all cancers(79;4.8e-36)		CTTCAGATTTTGGTGATATGT	0.348									Hermansky-Pudlak_syndrome				4	164	---	---	---	---	capture	Silent	SNP	77473219	77473219	AP3B1	5	T	G	G	G	1	0	0	0	0	0	0	0	1	808	63	4	4	737	247
GABRG2	2566	broad.mit.edu	37	5	161524689	161524689	+	Missense_Mutation	SNP	C	T	T			TCGA-32-4213-01	TCGA-32-4213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:161524689C>T	uc003lyz.3	+	4	731	c.373C>T	c.(373-375)CGT>TGT	p.R125C	GABRG2_uc010jjc.2_Missense_Mutation_p.R125C|GABRG2_uc003lyy.3_Missense_Mutation_p.R125C|GABRG2_uc011dej.1_Missense_Mutation_p.R30C	NM_000816	NP_000807	P18507	GBRG2_HUMAN	gamma-aminobutyric acid A receptor, gamma 2	125	Extracellular (Probable).				gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity|protein binding			ovary(4)|skin(1)	5	Renal(175;0.000319)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0734)|OV - Ovarian serous cystadenocarcinoma(192;0.135)|Epithelial(171;0.136)		GTATGACAGACGTTTGAAATT	0.328													67	135	---	---	---	---	capture	Missense_Mutation	SNP	161524689	161524689	GABRG2	5	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	6114	247
HLA-DRA	3122	broad.mit.edu	37	6	32410459	32410459	+	Missense_Mutation	SNP	C	T	T			TCGA-32-4213-01	TCGA-32-4213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:32410459C>T	uc003obh.2	+	2	398	c.317C>T	c.(316-318)CCG>CTG	p.P106L	HLA-DRA_uc003obi.2_Missense_Mutation_p.P106L	NM_019111	NP_061984	P01903	DRA_HUMAN	major histocompatibility complex, class II, DR	106	Extracellular (Potential).|Alpha-1.				antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|interferon-gamma-mediated signaling pathway|T cell costimulation|T cell receptor signaling pathway	endoplasmic reticulum membrane|Golgi apparatus|integral to plasma membrane|late endosome membrane|lysosomal membrane|MHC class II protein complex	MHC class II receptor activity			ovary(1)|skin(1)	2						AACTATACTCCGATCACCAAT	0.463									T-cell_Lymphoma_(Cutaneous)__Familial_Clustering_of|Kaposi_Sarcoma_Familial_Clustering_of				76	178	---	---	---	---	capture	Missense_Mutation	SNP	32410459	32410459	HLA-DRA	6	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	7132	247
HEY2	23493	broad.mit.edu	37	6	126080811	126080811	+	Missense_Mutation	SNP	G	A	A			TCGA-32-4213-01	TCGA-32-4213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:126080811G>A	uc003qad.2	+	5	1068	c.877G>A	c.(877-879)GCA>ACA	p.A293T	HEY2_uc011ebr.1_Missense_Mutation_p.A247T	NM_012259	NP_036391	Q9UBP5	HEY2_HUMAN	hairy/enhancer-of-split related with YRPW motif	293	Ala-rich.				negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription initiation from RNA polymerase II promoter|negative regulation of transcription regulatory region DNA binding|Notch signaling pathway|smooth muscle cell differentiation|transcription, DNA-dependent	transcriptional repressor complex	histone deacetylase binding|RNA polymerase II activating transcription factor binding|sequence-specific DNA binding			breast(1)	1				UCEC - Uterine corpus endometrioid carcinoma (4;0.0608)|GBM - Glioblastoma multiforme(226;0.0361)|all cancers(137;0.193)		TCCCCCAAACGCAGCAGCAGC	0.647													76	157	---	---	---	---	capture	Missense_Mutation	SNP	126080811	126080811	HEY2	6	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	7004	247
USP42	84132	broad.mit.edu	37	7	6189851	6189851	+	Missense_Mutation	SNP	C	T	T			TCGA-32-4213-01	TCGA-32-4213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:6189851C>T	uc011jwo.1	+	13	2147	c.2024C>T	c.(2023-2025)GCG>GTG	p.A675V	USP42_uc010kth.1_Missense_Mutation_p.A608V|USP42_uc011jwp.1_Missense_Mutation_p.A675V|USP42_uc011jwq.1_Missense_Mutation_p.A482V|USP42_uc011jwr.1_Missense_Mutation_p.A520V	NM_032172	NP_115548	Q9H9J4	UBP42_HUMAN	ubiquitin specific peptidase 42	675					cell differentiation|protein deubiquitination|spermatogenesis|ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|ubiquitin thiolesterase activity			skin(2)|ovary(1)|pancreas(1)|breast(1)	5		Ovarian(82;0.0423)		UCEC - Uterine corpus endometrioid carcinoma (126;0.108)|OV - Ovarian serous cystadenocarcinoma(56;5.77e-14)		AACGGCCTAGCGCCTGATGGT	0.562													11	29	---	---	---	---	capture	Missense_Mutation	SNP	6189851	6189851	USP42	7	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	16955	247
ZNF479	90827	broad.mit.edu	37	7	57194352	57194352	+	Missense_Mutation	SNP	C	T	T			TCGA-32-4213-01	TCGA-32-4213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:57194352C>T	uc010kzo.2	-	3	384	c.113G>A	c.(112-114)CGG>CAG	p.R38Q		NM_033273	NP_150376	Q96JC4	ZN479_HUMAN	zinc finger protein 479	38	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(3)|skin(1)	4			GBM - Glioblastoma multiforme(1;9.18e-12)			ATATAAATTCCGCTGAGCACA	0.398													45	109	---	---	---	---	capture	Missense_Mutation	SNP	57194352	57194352	ZNF479	7	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	17812	247
WBSCR17	64409	broad.mit.edu	37	7	70597882	70597882	+	Missense_Mutation	SNP	G	A	A			TCGA-32-4213-01	TCGA-32-4213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:70597882G>A	uc003tvy.2	+	1	94	c.94G>A	c.(94-96)GCG>ACG	p.A32T		NM_022479	NP_071924	Q6IS24	GLTL3_HUMAN	UDP-GalNAc:polypeptide	32	Lumenal (Potential).					Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			skin(3)|upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)|central_nervous_system(1)	7		all_cancers(73;0.2)|Lung NSC(55;0.094)|all_lung(88;0.125)				CCGGCCCATCGCGGTGCGCAG	0.637													13	21	---	---	---	---	capture	Missense_Mutation	SNP	70597882	70597882	WBSCR17	7	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	17145	247
MUC17	140453	broad.mit.edu	37	7	100684511	100684511	+	Missense_Mutation	SNP	C	T	T			TCGA-32-4213-01	TCGA-32-4213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:100684511C>T	uc003uxp.1	+	3	9867	c.9814C>T	c.(9814-9816)CCA>TCA	p.P3272S	MUC17_uc010lho.1_RNA	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN	mucin 17 precursor	3272	Extracellular (Potential).|Ser-rich.|53.|59 X approximate tandem repeats.					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity			ovary(14)|skin(8)|breast(3)|lung(2)	27	Lung NSC(181;0.136)|all_lung(186;0.182)					TACCAGCATGCCAACCTCAAC	0.502													7	567	---	---	---	---	capture	Missense_Mutation	SNP	100684511	100684511	MUC17	7	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	9884	247
FOXP2	93986	broad.mit.edu	37	7	114303551	114303551	+	Missense_Mutation	SNP	G	A	A			TCGA-32-4213-01	TCGA-32-4213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:114303551G>A	uc003vhb.2	+	15	2190	c.1816G>A	c.(1816-1818)GCA>ACA	p.A606T	FOXP2_uc003vgu.2_RNA|FOXP2_uc003vgz.2_Missense_Mutation_p.A631T|FOXP2_uc003vha.2_Missense_Mutation_p.A514T|FOXP2_uc011kmu.1_Missense_Mutation_p.A623T|FOXP2_uc011kmv.1_Missense_Mutation_p.A605T|FOXP2_uc010ljz.1_Missense_Mutation_p.A421T|FOXP2_uc003vhe.1_Missense_Mutation_p.A176T	NM_014491	NP_055306	O15409	FOXP2_HUMAN	forkhead box P2 isoform I	606					camera-type eye development|caudate nucleus development|cerebellum development|cerebral cortex development|embryo development|growth|lung alveolus development|negative regulation of transcription, DNA-dependent|pattern specification process|positive regulation of epithelial cell proliferation involved in lung morphogenesis|positive regulation of mesenchymal cell proliferation|post-embryonic development|putamen development|regulation of sequence-specific DNA binding transcription factor activity|righting reflex|skeletal muscle tissue development|smooth muscle tissue development|vocal learning	cytoplasm|transcription factor complex	chromatin binding|DNA bending activity|double-stranded DNA binding|promoter binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding|zinc ion binding			ovary(4)|pancreas(1)|lung(1)|breast(1)|skin(1)	8						AGGCTATGGAGCAGCTCTTAA	0.303													59	127	---	---	---	---	capture	Missense_Mutation	SNP	114303551	114303551	FOXP2	7	G	A	A	A	1	0	0	0	0	1	0	0	0	442	34	2	2	5971	247
TMEM209	84928	broad.mit.edu	37	7	129843871	129843871	+	Missense_Mutation	SNP	A	C	C			TCGA-32-4213-01	TCGA-32-4213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:129843871A>C	uc003vpn.2	-	2	206	c.83T>G	c.(82-84)GTG>GGG	p.V28G	TMEM209_uc010lmc.1_Missense_Mutation_p.V28G|TMEM209_uc003vpo.2_Missense_Mutation_p.V28G	NM_032842	NP_116231	Q96SK2	TM209_HUMAN	transmembrane protein 209	28	Helical; (Potential).					integral to membrane				ovary(2)|large_intestine(1)	3	Melanoma(18;0.0435)					GGCTAAGACCACTTTCCTAGC	0.408													2	31	---	---	---	---	capture	Missense_Mutation	SNP	129843871	129843871	TMEM209	7	A	C	C	C	1	0	0	0	0	1	0	0	0	78	6	4	4	16017	247
EPHX2	2053	broad.mit.edu	37	8	27362585	27362585	+	Silent	SNP	G	A	A	rs146337543		TCGA-32-4213-01	TCGA-32-4213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:27362585G>A	uc003xfu.2	+	4	540	c.459G>A	c.(457-459)TCG>TCA	p.S153S	EPHX2_uc010lut.1_Silent_p.S153S|EPHX2_uc010luu.2_Silent_p.S153S|EPHX2_uc010luv.2_Silent_p.S87S|EPHX2_uc003xfv.2_Silent_p.S100S|EPHX2_uc010luw.2_Silent_p.S87S|EPHX2_uc011lam.1_Silent_p.S9S	NM_001979	NP_001970	P34913	HYES_HUMAN	epoxide hydrolase 2, cytoplasmic	153	Phosphatase.				aromatic compound catabolic process|cellular calcium ion homeostasis|drug metabolic process|inflammatory response|positive regulation of vasodilation|reactive oxygen species metabolic process|regulation of blood pressure|response to toxin|xenobiotic metabolic process	cytosol|focal adhesion|Golgi apparatus|nucleolus|peroxisome|soluble fraction	epoxide hydrolase activity|metal ion binding|protein homodimerization activity			ovary(1)	1		Ovarian(32;2.61e-05)|all_epithelial(46;0.207)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0226)|Epithelial(17;1.12e-09)|Colorectal(74;0.157)	Tamoxifen(DB00675)	TGATAGAGTCGTGTCAGGTGG	0.547													24	56	---	---	---	---	capture	Silent	SNP	27362585	27362585	EPHX2	8	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	5135	247
SLC7A13	157724	broad.mit.edu	37	8	87229698	87229698	+	Splice_Site	SNP	C	T	T	rs139960114		TCGA-32-4213-01	TCGA-32-4213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:87229698C>T	uc003ydq.1	-	3	1277	c.1179_splice	c.e3+1	p.K393_splice	SLC7A13_uc003ydr.1_Splice_Site_p.K384_splice	NM_138817	NP_620172	Q8TCU3	S7A13_HUMAN	solute carrier family 7, (cationic amino acid							integral to membrane	amino acid transmembrane transporter activity			central_nervous_system(1)	1						TCCAATTTTACCTTATAAGGT	0.289													9	25	---	---	---	---	capture	Splice_Site	SNP	87229698	87229698	SLC7A13	8	C	T	T	T	1	0	0	0	0	0	0	1	0	234	18	5	2	14587	247
DOCK8	81704	broad.mit.edu	37	9	441311	441311	+	Missense_Mutation	SNP	A	G	G			TCGA-32-4213-01	TCGA-32-4213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:441311A>G	uc003zgf.2	+	41	5361	c.5249A>G	c.(5248-5250)GAG>GGG	p.E1750G	DOCK8_uc010mgu.2_Missense_Mutation_p.E1052G|DOCK8_uc010mgv.2_Missense_Mutation_p.E1650G|DOCK8_uc003zgk.2_Missense_Mutation_p.E1208G	NM_203447	NP_982272	Q8NF50	DOCK8_HUMAN	dedicator of cytokinesis 8	1750	DHR-2.				blood coagulation	cytosol	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			ovary(3)|central_nervous_system(3)	6		all_cancers(5;2.13e-17)|all_epithelial(5;2.15e-12)|all_lung(10;6.69e-11)|Lung NSC(10;1.08e-10)|Acute lymphoblastic leukemia(5;0.000242)|all_hematologic(5;0.00317)|Breast(48;0.0151)|Prostate(43;0.128)		all cancers(5;9.3e-07)|GBM - Glioblastoma multiforme(5;2.41e-06)|Epithelial(6;0.00557)|Lung(218;0.00942)		ACAGTTAATGAGGTCTACAAG	0.473													3	96	---	---	---	---	capture	Missense_Mutation	SNP	441311	441311	DOCK8	9	A	G	G	G	1	0	0	0	0	1	0	0	0	143	11	3	3	4649	247
UNC13B	10497	broad.mit.edu	37	9	35396552	35396552	+	Nonsense_Mutation	SNP	C	A	A			TCGA-32-4213-01	TCGA-32-4213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:35396552C>A	uc003zwq.2	+	26	3433	c.3141C>A	c.(3139-3141)TAC>TAA	p.Y1047*	UNC13B_uc003zwr.2_Nonsense_Mutation_p.Y1047*	NM_006377	NP_006368	O14795	UN13B_HUMAN	UNC13 (C. elegans)-like	1047	MHD1.				excretion|induction of apoptosis|intracellular signal transduction	cell junction|Golgi apparatus|synapse	metal ion binding|receptor activity			ovary(3)|large_intestine(1)|skin(1)	5	all_epithelial(49;0.212)		LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)|STAD - Stomach adenocarcinoma(86;0.194)			ACAATGAATACGTGCGGGATC	0.552													3	87	---	---	---	---	capture	Nonsense_Mutation	SNP	35396552	35396552	UNC13B	9	C	A	A	A	1	0	0	0	0	0	1	0	0	246	19	5	4	16867	247
CACNA1B	774	broad.mit.edu	37	9	140953153	140953153	+	Missense_Mutation	SNP	A	G	G			TCGA-32-4213-01	TCGA-32-4213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:140953153A>G	uc004cog.2	+	29	4586	c.4441A>G	c.(4441-4443)ATA>GTA	p.I1481V	CACNA1B_uc011mfd.1_Missense_Mutation_p.I1011V|CACNA1B_uc004coi.2_Missense_Mutation_p.I695V	NM_000718	NP_000709	Q00975	CAC1B_HUMAN	calcium channel, voltage-dependent, N type,	1481	Helical; Name=S1 of repeat IV; (Potential).|IV.				membrane depolarization|synaptic transmission	voltage-gated calcium channel complex	ATP binding|protein C-terminus binding|voltage-gated calcium channel activity			breast(3)|large_intestine(2)|ovary(1)	6	all_cancers(76;0.166)			OV - Ovarian serous cystadenocarcinoma(145;1.16e-05)|Epithelial(140;0.000476)	Amlodipine(DB00381)|Gabapentin(DB00996)	CATGGCCATGATAGCCCTCAA	0.562													2	16	---	---	---	---	capture	Missense_Mutation	SNP	140953153	140953153	CACNA1B	9	A	G	G	G	1	0	0	0	0	1	0	0	0	156	12	3	3	2515	247
FAM9A	171482	broad.mit.edu	37	X	8766427	8766427	+	Missense_Mutation	SNP	G	T	T			TCGA-32-4213-01	TCGA-32-4213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:8766427G>T	uc004csg.2	-	4	425	c.314C>A	c.(313-315)CCT>CAT	p.P105H		NM_174951	NP_777611	Q8IZU1	FAM9A_HUMAN	family with sequence similarity 9, member A	105						nucleolus					0		Hepatocellular(5;0.219)				TTCAGCAAAAGGTTCTCTTTC	0.423													148	355	---	---	---	---	capture	Missense_Mutation	SNP	8766427	8766427	FAM9A	23	G	T	T	T	1	0	0	0	0	1	0	0	0	455	35	4	4	5605	247
MED14	9282	broad.mit.edu	37	X	40562700	40562700	+	Silent	SNP	T	C	C			TCGA-32-4213-01	TCGA-32-4213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:40562700T>C	uc004dex.3	-	11	1547	c.1407A>G	c.(1405-1407)GGA>GGG	p.G469G		NM_004229	NP_004220	O60244	MED14_HUMAN	mediator complex subunit 14	469	Interaction with STAT2.				androgen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			breast(2)|kidney(1)|skin(1)	4						ACTTACCAAGTCCATAAAGCA	0.303													2	44	---	---	---	---	capture	Silent	SNP	40562700	40562700	MED14	23	T	C	C	C	1	0	0	0	0	0	0	0	1	743	58	3	3	9345	247
PFKFB1	5207	broad.mit.edu	37	X	54986282	54986282	+	Missense_Mutation	SNP	C	T	T			TCGA-32-4213-01	TCGA-32-4213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:54986282C>T	uc004dty.1	-	4	433	c.362G>A	c.(361-363)AGC>AAC	p.S121N	PFKFB1_uc010nkd.1_Missense_Mutation_p.S107N|PFKFB1_uc011mol.1_Missense_Mutation_p.S56N	NM_002625	NP_002616	P16118	F261_HUMAN	6-phosphofructo-2-kinase/fructose-2,	121	6-phosphofructo-2-kinase.				energy reserve metabolic process|fructose 2,6-bisphosphate metabolic process|gluconeogenesis|glycolysis|intracellular protein kinase cascade	6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 1 complex	6-phosphofructo-2-kinase activity|ATP binding|fructose-2,6-bisphosphate 2-phosphatase activity|identical protein binding			ovary(1)	1						TTCCTCATGGCTGAGATAGTT	0.388													26	49	---	---	---	---	capture	Missense_Mutation	SNP	54986282	54986282	PFKFB1	23	C	T	T	T	1	0	0	0	0	1	0	0	0	364	28	2	2	11663	247
SPIN3	169981	broad.mit.edu	37	X	57020821	57020821	+	Missense_Mutation	SNP	C	T	T			TCGA-32-4213-01	TCGA-32-4213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:57020821C>T	uc010nkj.2	-	2	846	c.560G>A	c.(559-561)CGC>CAC	p.R187H	SPIN3_uc004duu.3_Intron|SPIN3_uc004duw.3_Intron|SPIN3_uc004duv.3_Intron|SPIN3_uc004dux.1_Missense_Mutation_p.R187H	NM_001010862	NP_001010862	Q5JUX0	SPIN3_HUMAN	spindlin family, member 3	187					gamete generation					ovary(1)|central_nervous_system(1)	2						TTGAAGGATGCGGAGGTCACC	0.443													47	105	---	---	---	---	capture	Missense_Mutation	SNP	57020821	57020821	SPIN3	23	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	14947	247
ZC3H12B	340554	broad.mit.edu	37	X	64722249	64722249	+	Silent	SNP	C	T	T			TCGA-32-4213-01	TCGA-32-4213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:64722249C>T	uc010nko.2	+	5	1647	c.1638C>T	c.(1636-1638)ATC>ATT	p.I546I		NM_001010888	NP_001010888	Q5HYM0	ZC12B_HUMAN	zinc finger CCCH-type containing 12B	546							endonuclease activity|nucleic acid binding|zinc ion binding			lung(1)|kidney(1)|pancreas(1)	3						AACTGAACATCAACAGCATGC	0.483													7	77	---	---	---	---	capture	Silent	SNP	64722249	64722249	ZC3H12B	23	C	T	T	T	1	0	0	0	0	0	0	0	1	369	29	2	2	17442	247
TGIF2LX	90316	broad.mit.edu	37	X	89177514	89177514	+	Missense_Mutation	SNP	G	A	A			TCGA-32-4213-01	TCGA-32-4213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:89177514G>A	uc004efe.2	+	2	479	c.430G>A	c.(430-432)GCC>ACC	p.A144T		NM_138960	NP_620410	Q8IUE1	TF2LX_HUMAN	TGFB-induced factor homeobox 2-like, X-linked	144						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)|skin(1)	2						GTCTGTGCCGGCCAAGTCAGG	0.582													3	112	---	---	---	---	capture	Missense_Mutation	SNP	89177514	89177514	TGIF2LX	23	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	15712	247
NRK	203447	broad.mit.edu	37	X	105181458	105181458	+	Missense_Mutation	SNP	C	A	A			TCGA-32-4213-01	TCGA-32-4213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:105181458C>A	uc004emd.2	+	22	3986	c.3683C>A	c.(3682-3684)TCT>TAT	p.S1228Y	NRK_uc010npc.1_Missense_Mutation_p.S896Y	NM_198465	NP_940867	Q7Z2Y5	NRK_HUMAN	Nik related kinase	1228	CNH.						ATP binding|protein serine/threonine kinase activity|small GTPase regulator activity			breast(7)|ovary(3)|lung(2)|large_intestine(1)|central_nervous_system(1)	14						GGAACCCGATCTAATCTATAT	0.353										HNSCC(51;0.14)			13	29	---	---	---	---	capture	Missense_Mutation	SNP	105181458	105181458	NRK	23	C	A	A	A	1	0	0	0	0	1	0	0	0	416	32	4	4	10562	247
COL4A6	1288	broad.mit.edu	37	X	107404862	107404862	+	Silent	SNP	A	G	G			TCGA-32-4213-01	TCGA-32-4213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:107404862A>G	uc004enw.3	-	42	4426	c.4323T>C	c.(4321-4323)CCT>CCC	p.P1441P	COL4A6_uc004env.3_Silent_p.P1440P|COL4A6_uc011msn.1_Silent_p.P1416P|COL4A6_uc010npk.2_Silent_p.P1383P|COL4A6_uc011msm.1_5'Flank|COL4A6_uc010npj.2_Intron	NM_001847	NP_001838	Q14031	CO4A6_HUMAN	type IV alpha 6 collagen isoform A precursor	1441	Triple-helical region.				cell adhesion|extracellular matrix organization	collagen type IV	extracellular matrix structural constituent|protein binding			ovary(6)|urinary_tract(1)|large_intestine(1)	8						CAAATCCTGGAGGGCCTTGCA	0.607									Alport_syndrome_with_Diffuse_Leiomyomatosis				3	164	---	---	---	---	capture	Silent	SNP	107404862	107404862	COL4A6	23	A	G	G	G	1	0	0	0	0	0	0	0	1	132	11	3	3	3660	247
KDM5B	10765	broad.mit.edu	37	1	202722182	202722182	+	Frame_Shift_Del	DEL	T	-	-			TCGA-32-4213-01	TCGA-32-4213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:202722182delT	uc001gyf.2	-	12	1668	c.1552delA	c.(1552-1554)ACCfs	p.T518fs	KDM5B_uc009xag.2_Frame_Shift_Del_p.T554fs|KDM5B_uc001gyg.1_Frame_Shift_Del_p.T360fs	NM_006618	NP_006609	Q9UGL1	KDM5B_HUMAN	jumonji, AT rich interactive domain 1B	518	JmjC.				negative regulation of transcription, DNA-dependent	nucleolus	DNA binding|histone demethylase activity (H3-dimethyl-K4 specific)|histone demethylase activity (H3-trimethyl-K4 specific)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity|zinc ion binding			ovary(2)|breast(2)|urinary_tract(1)	5						CCATACCAGGTTTTTGGCTCA	0.423													7	1867	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	202722182	202722182	KDM5B	1	T	-	-	-	1	0	1	0	1	0	0	0	0	780	60	5	5	8056	247
PTEN	5728	broad.mit.edu	37	10	89720805	89720806	+	Frame_Shift_Ins	INS	-	T	T			TCGA-32-4213-01	TCGA-32-4213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:89720805_89720806insT	uc001kfb.2	+	9	1987_1988	c.956_957insT	c.(955-957)ACTfs	p.T319fs		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog	319	C2 tensin-type.		Missing (in glioma; reduced tumor suppressor activity; fails to inactivate AKT/PKB).		activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.T319fs*1(22)|p.L318fs*2(11)|p.T319fs*6(6)|p.R55fs*1(4)|p.T319fs*24(4)|p.?(2)|p.N212fs*1(2)|p.Y27fs*1(2)|p.T319del(2)|p.T319_K332del(1)|p.G165_*404del(1)|p.G165_K342del(1)|p.L316fs*1(1)|p.T319fs*4(1)|p.T319fs*5(1)|p.W274_F341del(1)|p.V317_K322del(1)		endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		CTAGTACTTACTTTAACAAAAA	0.332		31	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			66	73	---	---	---	---	capture_indel	Frame_Shift_Ins	INS	89720805	89720806	PTEN	10	-	T	T	T	1	0	1	1	0	0	0	0	0	260	20	5	5	12633	247
RB1	5925	broad.mit.edu	37	13	48954327	48954328	+	Frame_Shift_Del	DEL	AT	-	-	rs5803433		TCGA-32-4213-01	TCGA-32-4213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:48954327_48954328delAT	uc001vcb.2	+	16	1614_1615	c.1448_1449delAT	c.(1447-1449)CATfs	p.H483fs		NM_000321	NP_000312	P06400	RB_HUMAN	retinoblastoma 1	483	Domain A.|Pocket; binds T and E1A.				androgen receptor signaling pathway|cell cycle arrest|chromatin remodeling|G1 phase of mitotic cell cycle|interspecies interaction between organisms|maintenance of mitotic sister chromatid cohesion|mitotic cell cycle G1/S transition checkpoint|myoblast differentiation|negative regulation of cell growth|negative regulation of protein kinase activity|negative regulation of S phase of mitotic cell cycle|negative regulation of sequence-specific DNA binding transcription factor activity|positive regulation of mitotic metaphase/anaphase transition|protein localization to chromosome, centromeric region|Ras protein signal transduction|regulation of centromere complex assembly|regulation of cohesin localization to chromatin|regulation of lipid kinase activity|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle|sister chromatid biorientation	chromatin|PML body|Rb-E2F complex|SWI/SNF complex	androgen receptor binding|DNA binding|kinase binding|phosphoprotein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription factor binding|ubiquitin protein ligase binding	p.?(7)|p.H483fs*9(1)		lung(94)|eye(89)|central_nervous_system(47)|bone(22)|breast(21)|urinary_tract(17)|haematopoietic_and_lymphoid_tissue(14)|ovary(10)|prostate(9)|soft_tissue(8)|skin(7)|endometrium(5)|cervix(3)|liver(3)|salivary_gland(2)|stomach(2)|oesophagus(1)|adrenal_gland(1)|kidney(1)|gastrointestinal_tract_(site_indeterminate)(1)|pituitary(1)	358		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	AACATTTTTCATATGTCTTTAT	0.203		6	D|Mis|N|F|S		retinoblastoma|sarcoma|breast|small cell lung	retinoblastoma|sarcoma|breast|small cell lung			Hereditary_Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)			14	16	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	48954327	48954328	RB1	13	AT	-	-	-	1	0	1	0	1	0	0	0	0	104	8	5	5	12993	247
FLJ10357	55701	broad.mit.edu	37	14	21552177	21552179	+	In_Frame_Del	DEL	CTG	-	-			TCGA-32-4213-01	TCGA-32-4213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:21552177_21552179delCTG	uc001vzp.2	+	17	3786_3788	c.3757_3759delCTG	c.(3757-3759)CTGdel	p.L1254del	FLJ10357_uc001vzo.1_In_Frame_Del_p.L333del|FLJ10357_uc010aij.2_RNA|FLJ10357_uc010tln.1_In_Frame_Del_p.L540del	NM_018071	NP_060541	Q8TER5	ARH40_HUMAN	hypothetical protein LOC55701	1254					regulation of Rho protein signal transduction	cytoplasm	Rho guanyl-nucleotide exchange factor activity				0	all_cancers(95;0.00185)		OV - Ovarian serous cystadenocarcinoma(11;5.79e-11)|Epithelial(56;8.35e-09)|all cancers(55;4.23e-08)	GBM - Glioblastoma multiforme(265;0.0197)		TGGCAGAGACCTGCTGGCCGTGG	0.606													11	33	---	---	---	---	capture_indel	In_Frame_Del	DEL	21552177	21552179	FLJ10357	14	CTG	-	-	-	1	0	1	0	1	0	0	0	0	311	24	5	5	5871	247
TIA1	7072	broad.mit.edu	37	2	70457951	70457951	+	Frame_Shift_Del	DEL	A	-	-			TCGA-32-4213-01	TCGA-32-4213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:70457951delA	uc002sgj.3	-	3	376	c.159delT	c.(157-159)TTTfs	p.F53fs	TIA1_uc002sgk.3_Frame_Shift_Del_p.F53fs|TIA1_uc002sgl.3_RNA|TIA1_uc002sgm.3_Frame_Shift_Del_p.F53fs|TIA1_uc010yqt.1_Frame_Shift_Del_p.F53fs	NM_022173	NP_071505	P31483	TIA1_HUMAN	TIA1 cytotoxic granule-associated RNA binding	53	RRM 1.				apoptosis|induction of apoptosis|regulation of nuclear mRNA splicing, via spliceosome	nucleus	nucleotide binding|poly(A) RNA binding|protein binding				0						GATGCTCATGAAACTCCACAA	0.398													71	154	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	70457951	70457951	TIA1	2	A	-	-	-	1	0	1	0	1	0	0	0	0	115	9	5	5	15772	247
CLOCK	9575	broad.mit.edu	37	4	56336954	56336954	+	Frame_Shift_Del	DEL	A	-	-			TCGA-32-4213-01	TCGA-32-4213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:56336954delA	uc003haz.1	-	9	1294	c.368delT	c.(367-369)TTAfs	p.L123fs	CLOCK_uc003hba.1_Frame_Shift_Del_p.L123fs	NM_004898	NP_004889	O15516	CLOCK_HUMAN	clock	123	PAS 1.				circadian rhythm|photoperiodism|positive regulation of transcription from RNA polymerase II promoter	cytoplasm|transcription factor complex	DNA binding|histone acetyltransferase activity|sequence-specific DNA binding transcription factor activity|signal transducer activity			central_nervous_system(2)|ovary(1)	3	Lung NSC(11;0.00335)|Glioma(25;0.08)|all_epithelial(27;0.0992)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(4;1.62e-07)|Lung(4;1.34e-06)|Epithelial(7;0.0107)			CATGATTGCTAAAAAAAAACC	0.289													7	148	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	56336954	56336954	CLOCK	4	A	-	-	-	1	0	1	0	1	0	0	0	0	169	13	5	5	3514	247
DNAH8	1769	broad.mit.edu	37	6	38773311	38773311	+	Frame_Shift_Del	DEL	A	-	-			TCGA-32-4213-01	TCGA-32-4213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:38773311delA	uc003ooe.1	+	21	3038	c.2438delA	c.(2437-2439)GACfs	p.D813fs		NM_001371	NP_001362			dynein, axonemal, heavy polypeptide 8											skin(8)|ovary(7)|lung(2)|large_intestine(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	21						GAAAACAATGACTATGAAGCT	0.308													54	134	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	38773311	38773311	DNAH8	6	A	-	-	-	1	0	1	0	1	0	0	0	0	130	10	5	5	4563	247
TAS2R5	54429	broad.mit.edu	37	7	141490298	141490298	+	Frame_Shift_Del	DEL	T	-	-			TCGA-32-4213-01	TCGA-32-4213-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:141490298delT	uc003vwr.1	+	1	282	c.137delT	c.(136-138)CTCfs	p.L46fs		NM_018980	NP_061853	Q9NYW4	TA2R5_HUMAN	taste receptor T2R5	46	Helical; Name=2; (Potential).				chemosensory behavior|sensory perception of taste		taste receptor activity				0	Melanoma(164;0.0171)					TCATATAACCTCATTATCCTG	0.468													65	119	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	141490298	141490298	TAS2R5	7	T	-	-	-	1	0	1	0	1	0	0	0	0	702	54	5	5	15471	247
