Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
MIB2	142678	broad.mit.edu	37	1	1563429	1563429	+	Missense_Mutation	SNP	G	A	A			TCGA-32-5222-01	TCGA-32-5222-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:1563429G>A	uc001agg.2	+	14	2012	c.1885G>A	c.(1885-1887)GCC>ACC	p.A629T	MIB2_uc001agh.2_Missense_Mutation_p.A615T|MIB2_uc001agi.2_Missense_Mutation_p.A625T|MIB2_uc001agj.2_Missense_Mutation_p.A470T|MIB2_uc001agk.2_Missense_Mutation_p.A564T|MIB2_uc001agl.1_Missense_Mutation_p.A585T|MIB2_uc001agm.2_Missense_Mutation_p.A506T|MIB2_uc010nyq.1_Missense_Mutation_p.A585T|MIB2_uc009vkh.2_Missense_Mutation_p.A435T|MIB2_uc001agn.2_Missense_Mutation_p.A261T|MIB2_uc001ago.2_5'Flank	NM_080875	NP_543151	Q96AX9	MIB2_HUMAN	mindbomb homolog 2	629	ANK 4.				Notch signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade	endosome	actin binding|signal transducer activity|ubiquitin-protein ligase activity|zinc ion binding				0	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;6.04e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;5.26e-37)|OV - Ovarian serous cystadenocarcinoma(86;2.54e-23)|GBM - Glioblastoma multiforme(42;9e-08)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|STAD - Stomach adenocarcinoma(132;0.00644)|BRCA - Breast invasive adenocarcinoma(365;0.00786)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)		CCTGCACTCCGCCATCTCGGC	0.652													4	124	---	---	---	---	capture	Missense_Mutation	SNP	1563429	1563429	MIB2	1	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	9479	249
BARHL2	343472	broad.mit.edu	37	1	91182732	91182732	+	Silent	SNP	G	A	A			TCGA-32-5222-01	TCGA-32-5222-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:91182732G>A	uc001dns.2	-	1	63	c.21C>T	c.(19-21)AGC>AGT	p.S7S		NM_020063	NP_064447	Q9NY43	BARH2_HUMAN	BarH-like homeobox 2	7						nucleus	sequence-specific DNA binding			ovary(1)	1		all_lung(203;0.0263)|Lung SC(238;0.128)		all cancers(265;0.000897)|Epithelial(280;0.00516)|OV - Ovarian serous cystadenocarcinoma(397;0.211)		AACTCGACCCGCTGGCCCCTT	0.562													10	303	---	---	---	---	capture	Silent	SNP	91182732	91182732	BARHL2	1	G	A	A	A	1	0	0	0	0	0	0	0	1	490	38	1	1	1303	249
NBPF9	400818	broad.mit.edu	37	1	144828704	144828704	+	Missense_Mutation	SNP	T	G	G			TCGA-32-5222-01	TCGA-32-5222-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:144828704T>G	uc009wig.1	+	23	2825	c.2749T>G	c.(2749-2751)TAC>GAC	p.Y917D	NBPF9_uc010oxn.1_Missense_Mutation_p.Y815D|NBPF9_uc010oxo.1_Missense_Mutation_p.Y842D|NBPF9_uc010oxr.1_Missense_Mutation_p.Y944D|NBPF9_uc010oxt.1_Missense_Mutation_p.Y732D|NBPF9_uc001ekg.1_Missense_Mutation_p.Y244D|NBPF9_uc001ekk.1_Missense_Mutation_p.Y488D|NBPF10_uc009wir.2_Intron|NBPF9_uc010oyd.1_Missense_Mutation_p.Y244D|NBPF9_uc010oye.1_Intron|NBPF9_uc001eli.3_RNA|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|NBPF9_uc001elp.2_Missense_Mutation_p.Y577D|uc001elr.3_5'Flank	NM_001037675	NP_001032764	Q3BBV1	NBPFK_HUMAN	hypothetical protein LOC400818	917	NBPF 7.					cytoplasm					0						CTTCGCCCTTTACGTGGACAA	0.438													8	485	---	---	---	---	capture	Missense_Mutation	SNP	144828704	144828704	NBPF9	1	T	G	G	G	1	0	0	0	0	1	0	0	0	793	61	4	4	10106	249
FLG2	388698	broad.mit.edu	37	1	152325929	152325929	+	Nonsense_Mutation	SNP	G	A	A			TCGA-32-5222-01	TCGA-32-5222-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152325929G>A	uc001ezw.3	-	3	4406	c.4333C>T	c.(4333-4335)CAA>TAA	p.Q1445*	uc001ezv.2_Intron	NM_001014342	NP_001014364	Q5D862	FILA2_HUMAN	filaggrin family member 2	1445							calcium ion binding|structural molecule activity			ovary(10)|skin(5)|upper_aerodigestive_tract(1)|breast(1)	17	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CCATGAGTTTGTTCTTGTGAT	0.522													235	628	---	---	---	---	capture	Nonsense_Mutation	SNP	152325929	152325929	FLG2	1	G	A	A	A	1	0	0	0	0	0	1	0	0	624	48	5	2	5868	249
SPTA1	6708	broad.mit.edu	37	1	158632643	158632643	+	Missense_Mutation	SNP	C	G	G			TCGA-32-5222-01	TCGA-32-5222-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:158632643C>G	uc001fst.1	-	17	2512	c.2313G>C	c.(2311-2313)TTG>TTC	p.L771F		NM_003126	NP_003117	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	771	Spectrin 8.				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8	all_hematologic(112;0.0378)					ATCGGCATACCAAGGACTCTT	0.468													118	104	---	---	---	---	capture	Missense_Mutation	SNP	158632643	158632643	SPTA1	1	C	G	G	G	1	0	0	0	0	1	0	0	0	272	21	4	4	15008	249
ABL2	27	broad.mit.edu	37	1	179084044	179084044	+	Silent	SNP	G	A	A			TCGA-32-5222-01	TCGA-32-5222-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:179084044G>A	uc001gmj.3	-	9	1817	c.1530C>T	c.(1528-1530)TGC>TGT	p.C510C	ABL2_uc010pnf.1_Silent_p.C510C|ABL2_uc010png.1_Silent_p.C489C|ABL2_uc010pnh.1_Silent_p.C489C|ABL2_uc009wxe.2_Silent_p.C489C|ABL2_uc001gmg.3_Silent_p.C495C|ABL2_uc001gmi.3_Silent_p.C495C|ABL2_uc001gmh.3_Silent_p.C474C|ABL2_uc010pne.1_Silent_p.C474C	NM_007314	NP_009298	P42684	ABL2_HUMAN	arg tyrosine kinase isoform b	510	Protein kinase.				axon guidance|cell adhesion|peptidyl-tyrosine phosphorylation|positive regulation of oxidoreductase activity|signal transduction	cytoskeleton|cytosol	ATP binding|magnesium ion binding|manganese ion binding|non-membrane spanning protein tyrosine kinase activity|protein binding	p.P476fs*7(1)		lung(8)|breast(3)|ovary(2)|central_nervous_system(1)	14					Adenosine triphosphate(DB00171)|Dasatinib(DB01254)	CCTTAGGGGGGCATCCCTCAG	0.383			T	ETV6	AML								5	344	---	---	---	---	capture	Silent	SNP	179084044	179084044	ABL2	1	G	A	A	A	1	0	0	0	0	0	0	0	1	542	42	2	2	93	249
USH2A	7399	broad.mit.edu	37	1	216256823	216256823	+	Missense_Mutation	SNP	T	C	C			TCGA-32-5222-01	TCGA-32-5222-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:216256823T>C	uc001hku.1	-	26	5660	c.5273A>G	c.(5272-5274)AAC>AGC	p.N1758S		NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	1758	Laminin G-like 2.|Extracellular (Potential).				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		TCCATCTTTGTTATAAACGAA	0.303										HNSCC(13;0.011)			112	318	---	---	---	---	capture	Missense_Mutation	SNP	216256823	216256823	USH2A	1	T	C	C	C	1	0	0	0	0	1	0	0	0	780	60	3	3	16918	249
PTEN	5728	broad.mit.edu	37	10	89692902	89692902	+	Missense_Mutation	SNP	G	A	A	rs121909218		TCGA-32-5222-01	TCGA-32-5222-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:89692902G>A	uc001kfb.2	+	6	1417	c.386G>A	c.(385-387)GGA>GAA	p.G129E		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog	129	Phosphatase tensin-type.		G -> E (in CD; no lipid phosphatase activity but retains protein phosphatase activity; retains ability to inhibit focal adhesion formation).|G -> R (in glioblastoma; severely reduced protein phosphatase activity; loss of phosphatase activity towards Ins(1,3,4,5)P4).		activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.G129R(6)|p.R55fs*1(4)|p.G129*(3)|p.K128_R130del(3)|p.?(2)|p.Y27fs*1(2)|p.Y27_N212>Y(2)|p.G129V(1)|p.K128fs*47(1)|p.A121_F145del(1)|p.G129E(1)|p.G129fs*5(1)|p.G127fs*5(1)|p.G129fs*50(1)|p.F56fs*2(1)|p.G129fs*51(1)		endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		GCTGGAAAGGGACGAACTGGT	0.413		31	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			81	51	---	---	---	---	capture	Missense_Mutation	SNP	89692902	89692902	PTEN	10	G	A	A	A	1	0	0	0	0	1	0	0	0	533	41	2	2	12633	249
UBQLN3	50613	broad.mit.edu	37	11	5529018	5529018	+	Missense_Mutation	SNP	G	A	A			TCGA-32-5222-01	TCGA-32-5222-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:5529018G>A	uc001may.1	-	2	1857	c.1771C>T	c.(1771-1773)CTT>TTT	p.L591F	HBG2_uc001mak.1_Intron|HBE1_uc001mam.1_5'Flank|OR51B5_uc001maq.1_5'Flank	NM_017481	NP_059509	Q9H347	UBQL3_HUMAN	ubiquilin 3	591										ovary(3)	3		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;1.74e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GGAGGGGAAAGGAAGCCCAGC	0.527													42	150	---	---	---	---	capture	Missense_Mutation	SNP	5529018	5529018	UBQLN3	11	G	A	A	A	1	0	0	0	0	1	0	0	0	455	35	2	2	16780	249
PAMR1	25891	broad.mit.edu	37	11	35454046	35454046	+	Missense_Mutation	SNP	G	A	A			TCGA-32-5222-01	TCGA-32-5222-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:35454046G>A	uc001mwg.2	-	11	2064	c.2021C>T	c.(2020-2022)CCG>CTG	p.P674L	PAMR1_uc001mwf.2_Missense_Mutation_p.P691L|PAMR1_uc010rew.1_Missense_Mutation_p.P563L|PAMR1_uc010rex.1_Missense_Mutation_p.P634L	NM_001001991	NP_001001991	Q6UXH9	PAMR1_HUMAN	regeneration associated muscle protease isoform	674	Peptidase S1.				proteolysis	extracellular region	serine-type endopeptidase activity			ovary(2)	2						TGCTCGTCCCGGGAAGGACAC	0.567													43	92	---	---	---	---	capture	Missense_Mutation	SNP	35454046	35454046	PAMR1	11	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	11317	249
ALX4	60529	broad.mit.edu	37	11	44331575	44331575	+	Missense_Mutation	SNP	G	A	A			TCGA-32-5222-01	TCGA-32-5222-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:44331575G>A	uc001myb.2	-	1	142	c.38C>T	c.(37-39)CCG>CTG	p.P13L		NM_021926	NP_068745	Q9H161	ALX4_HUMAN	aristaless-like homeobox 4	13					hair follicle development						0						GGCAGCGGCCGGCGACTCGCA	0.682													5	8	---	---	---	---	capture	Missense_Mutation	SNP	44331575	44331575	ALX4	11	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	558	249
SLC22A11	55867	broad.mit.edu	37	11	64335161	64335161	+	Silent	SNP	C	T	T			TCGA-32-5222-01	TCGA-32-5222-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:64335161C>T	uc001oai.2	+	7	1523	c.1149C>T	c.(1147-1149)GCC>GCT	p.A383A	SLC22A11_uc001oaj.2_Silent_p.A383A|SLC22A11_uc009ypq.2_Intron	NM_018484	NP_060954	Q9NSA0	S22AB_HUMAN	solute carrier family 22 member 11	383	Helical; (Potential).				urate metabolic process	apical plasma membrane|external side of plasma membrane|integral to plasma membrane	inorganic anion exchanger activity|protein binding|sodium-independent organic anion transmembrane transporter activity			ovary(1)|central_nervous_system(1)	2					Probenecid(DB01032)	TCTTCGGGGCCGTGGACTTCC	0.642													5	178	---	---	---	---	capture	Silent	SNP	64335161	64335161	SLC22A11	11	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	14335	249
PIH1D2	120379	broad.mit.edu	37	11	111943820	111943820	+	Missense_Mutation	SNP	G	A	A			TCGA-32-5222-01	TCGA-32-5222-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:111943820G>A	uc001pmq.3	-	2	161	c.79C>T	c.(79-81)CCT>TCT	p.P27S	PIH1D2_uc009yyl.2_Missense_Mutation_p.P27S|PIH1D2_uc001pmp.3_Missense_Mutation_p.P27S|PIH1D2_uc010rws.1_Missense_Mutation_p.P27S|C11orf57_uc001pmu.2_5'Flank|C11orf57_uc001pmw.3_5'Flank|C11orf57_uc001pmt.3_5'Flank|C11orf57_uc001pmr.3_5'Flank|C11orf57_uc001pmv.3_5'Flank|C11orf57_uc001pms.3_5'Flank	NM_138789	NP_620144	Q8WWB5	PIHD2_HUMAN	PIH1 domain containing 2 isoform 1	27										ovary(1)	1		all_cancers(61;1.09e-14)|all_epithelial(67;7.64e-09)|Melanoma(852;1.91e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		Epithelial(105;3.19e-07)|BRCA - Breast invasive adenocarcinoma(274;6.17e-07)|all cancers(92;6.18e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.0508)		TAGCCCTCAGGGTCACTCTGA	0.463													58	42	---	---	---	---	capture	Missense_Mutation	SNP	111943820	111943820	PIH1D2	11	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	11810	249
ST14	6768	broad.mit.edu	37	11	130064098	130064098	+	Missense_Mutation	SNP	C	A	A			TCGA-32-5222-01	TCGA-32-5222-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:130064098C>A	uc001qfw.2	+	8	1123	c.930C>A	c.(928-930)AAC>AAA	p.N310K	ST14_uc010sca.1_Missense_Mutation_p.N120K	NM_021978	NP_068813	Q9Y5Y6	ST14_HUMAN	matriptase	310	Extracellular (Potential).|CUB 1.				proteolysis	integral to plasma membrane	serine-type endopeptidase activity			ovary(2)|skin(2)|central_nervous_system(1)	5	all_hematologic(175;0.0429)	Lung NSC(97;0.000602)|Breast(109;0.000962)|all_lung(97;0.00126)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0183)|Lung(977;0.228)	Urokinase(DB00013)	CCTCCCAGAACGTCCTGCTCA	0.587													64	162	---	---	---	---	capture	Missense_Mutation	SNP	130064098	130064098	ST14	11	C	A	A	A	1	0	0	0	0	1	0	0	0	246	19	4	4	15101	249
C3AR1	719	broad.mit.edu	37	12	8212173	8212173	+	Silent	SNP	C	T	T	rs138822577		TCGA-32-5222-01	TCGA-32-5222-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:8212173C>T	uc001qtv.1	-	2	701	c.609G>A	c.(607-609)CCG>CCA	p.P203P		NM_004054	NP_004045	Q16581	C3AR_HUMAN	complement component 3a receptor 1	203	Extracellular (Potential).			P -> R (in Ref. 1; AAC50374).	blood circulation|chemotaxis|elevation of cytosolic calcium ion concentration|inflammatory response	integral to plasma membrane	C3a anaphylatoxin receptor activity|complement component C3a receptor activity|phosphatidylinositol phospholipase C activity			ovary(1)	1				Kidney(36;0.0893)		TTTCTCCAGGCGGCTGAACAA	0.408													13	389	---	---	---	---	capture	Silent	SNP	8212173	8212173	C3AR1	12	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	2185	249
KRT8	3856	broad.mit.edu	37	12	53292563	53292563	+	Missense_Mutation	SNP	C	T	T			TCGA-32-5222-01	TCGA-32-5222-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:53292563C>T	uc001sbd.2	-	6	1205	c.1102G>A	c.(1102-1104)GCG>ACG	p.A368T	KRT8_uc009zmj.2_Intron|KRT8_uc009zmk.1_Missense_Mutation_p.A396T|KRT8_uc009zml.1_Missense_Mutation_p.A368T|KRT8_uc009zmm.1_Missense_Mutation_p.A368T	NM_002273	NP_002264	P05787	K2C8_HUMAN	keratin 8	368	Necessary for interaction with PNN.|Rod.|Coil 2.				cytoskeleton organization|interspecies interaction between organisms	cytoplasm|keratin filament|nuclear matrix|nucleoplasm	protein binding|structural molecule activity			ovary(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(357;0.108)	Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	AGCTGCCGCGCCATGTCCTGC	0.637													77	144	---	---	---	---	capture	Missense_Mutation	SNP	53292563	53292563	KRT8	12	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	8413	249
RPS26	6231	broad.mit.edu	37	12	56436346	56436346	+	Silent	SNP	C	T	T			TCGA-32-5222-01	TCGA-32-5222-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:56436346C>T	uc001sjf.2	+	2	406	c.141C>T	c.(139-141)GCC>GCT	p.A47A		NM_001029	NP_001020	P62854	RS26_HUMAN	ribosomal protein S26	47					endocrine pancreas development|negative regulation of RNA splicing|translational elongation|translational termination|viral transcription	cytosolic small ribosomal subunit	mRNA binding|protein binding|structural constituent of ribosome			breast(1)	1			OV - Ovarian serous cystadenocarcinoma(18;0.123)			TAGTGGAGGCCGCAGCAGTCA	0.557													28	107	---	---	---	---	capture	Silent	SNP	56436346	56436346	RPS26	12	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	13529	249
TSPAN8	7103	broad.mit.edu	37	12	71523126	71523126	+	Silent	SNP	T	C	C			TCGA-32-5222-01	TCGA-32-5222-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:71523126T>C	uc009zrt.1	-	7	807	c.645A>G	c.(643-645)GGA>GGG	p.G215G	TSPAN8_uc001swk.1_Silent_p.G215G|TSPAN8_uc001swj.1_Silent_p.G215G	NM_004616	NP_004607	P19075	TSN8_HUMAN	transmembrane 4 superfamily member 3	215	Helical; (Potential).				protein glycosylation	integral to membrane|lysosome	signal transducer activity			skin(2)|lung(1)|central_nervous_system(1)	4			LUSC - Lung squamous cell carcinoma(43;0.24)|OV - Ovarian serous cystadenocarcinoma(12;0.244)			TAACTGCCAGTCCAAATGATA	0.274													42	117	---	---	---	---	capture	Silent	SNP	71523126	71523126	TSPAN8	12	T	C	C	C	1	0	0	0	0	0	0	0	1	743	58	3	3	16536	249
CCDC63	160762	broad.mit.edu	37	12	111336859	111336859	+	Silent	SNP	C	T	T	rs115748204	by1000genomes	TCGA-32-5222-01	TCGA-32-5222-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:111336859C>T	uc001trv.1	+	10	1467	c.1272C>T	c.(1270-1272)GAC>GAT	p.D424D	CCDC63_uc010sye.1_Silent_p.D384D|CCDC63_uc001trw.1_Silent_p.D339D	NM_152591	NP_689804	Q8NA47	CCD63_HUMAN	coiled-coil domain containing 63	424										skin(6)|ovary(1)|pancreas(1)	8						TAAACTGTGACGCCACCAAGA	0.498													47	104	---	---	---	---	capture	Silent	SNP	111336859	111336859	CCDC63	12	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	2808	249
USP12	219333	broad.mit.edu	37	13	27664021	27664021	+	Missense_Mutation	SNP	G	A	A			TCGA-32-5222-01	TCGA-32-5222-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:27664021G>A	uc001uqy.2	-	6	986	c.733C>T	c.(733-735)CGG>TGG	p.R245W		NM_182488	NP_872294	O75317	UBP12_HUMAN	ubiquitin thiolesterase 12	245					protein deubiquitination|ubiquitin-dependent protein catabolic process		cysteine-type endopeptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			lung(1)	1		Lung SC(185;0.0161)		all cancers(112;0.0508)|GBM - Glioblastoma multiforme(144;0.168)|Epithelial(112;0.244)|OV - Ovarian serous cystadenocarcinoma(117;0.246)		TAAAATTACCGTTTGTGTGCT	0.353													35	79	---	---	---	---	capture	Missense_Mutation	SNP	27664021	27664021	USP12	13	G	A	A	A	1	0	0	0	0	1	0	0	0	519	40	1	1	16925	249
SOHLH2	54937	broad.mit.edu	37	13	36748890	36748890	+	Missense_Mutation	SNP	C	T	T			TCGA-32-5222-01	TCGA-32-5222-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:36748890C>T	uc001uvj.2	-	7	847	c.758G>A	c.(757-759)CGG>CAG	p.R253Q	SOHLH2_uc010tei.1_Missense_Mutation_p.R330Q	NM_017826	NP_060296	Q9NX45	SOLH2_HUMAN	spermatogenesis and oogenesis specific basic	253	Helix-loop-helix motif.				cell differentiation|multicellular organismal development|oogenesis|regulation of transcription, DNA-dependent|spermatogenesis|transcription, DNA-dependent	nucleus	DNA binding				0		Breast(139;0.0615)|Lung SC(185;0.0743)|Prostate(109;0.184)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;4.63e-08)|Epithelial(112;2.67e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00272)|BRCA - Breast invasive adenocarcinoma(63;0.00685)|GBM - Glioblastoma multiforme(144;0.0273)		GATTTTCTCCCGGATATATTT	0.403													52	86	---	---	---	---	capture	Missense_Mutation	SNP	36748890	36748890	SOHLH2	13	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	14816	249
RCBTB2	1102	broad.mit.edu	37	13	49070369	49070369	+	Missense_Mutation	SNP	A	T	T			TCGA-32-5222-01	TCGA-32-5222-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:49070369A>T	uc001vch.2	-	14	1844	c.1473T>A	c.(1471-1473)AAT>AAA	p.N491K	RCBTB2_uc010tgg.1_Missense_Mutation_p.N496K|RCBTB2_uc001vci.2_Missense_Mutation_p.N467K|RCBTB2_uc010tgh.1_Missense_Mutation_p.N217K|RCBTB2_uc001vcj.2_Missense_Mutation_p.N443K	NM_001268	NP_001259	O95199	RCBT2_HUMAN	regulator of chromosome condensation and BTB	491	BTB 2.						Ran guanyl-nucleotide exchange factor activity			ovary(2)|lung(2)|skin(1)	5		all_cancers(8;4.86e-71)|all_epithelial(8;2.11e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;2.3e-10)|Lung NSC(96;1.07e-07)|Breast(56;1.53e-05)|Prostate(109;0.00174)|Hepatocellular(98;0.00826)|Myeloproliferative disorder(33;0.0179)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(99;1.8e-09)|LUSC - Lung squamous cell carcinoma(3;0.116)		GAGCGATGGCATTCTCCTCGC	0.502													7	158	---	---	---	---	capture	Missense_Mutation	SNP	49070369	49070369	RCBTB2	13	A	T	T	T	1	0	0	0	0	1	0	0	0	102	8	4	4	13067	249
PCDH17	27253	broad.mit.edu	37	13	58207833	58207833	+	Missense_Mutation	SNP	G	A	A			TCGA-32-5222-01	TCGA-32-5222-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:58207833G>A	uc001vhq.1	+	1	2045	c.1153G>A	c.(1153-1155)GGA>AGA	p.G385R	PCDH17_uc010aec.1_Missense_Mutation_p.G385R	NM_001040429	NP_001035519	O14917	PCD17_HUMAN	protocadherin 17 precursor	385	Extracellular (Potential).|Gly-rich.|Cadherin 4.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding|protein binding			ovary(3)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	7		Lung NSC(96;0.027)|Prostate(109;0.0453)|Breast(118;0.128)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;1.06e-05)		TGGCAAGAACGGACAGCTGCA	0.557													3	41	---	---	---	---	capture	Missense_Mutation	SNP	58207833	58207833	PCDH17	13	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	11415	249
PCDH17	27253	broad.mit.edu	37	13	58208729	58208729	+	Silent	SNP	G	A	A			TCGA-32-5222-01	TCGA-32-5222-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:58208729G>A	uc001vhq.1	+	1	2941	c.2049G>A	c.(2047-2049)TCG>TCA	p.S683S	PCDH17_uc010aec.1_Silent_p.S683S	NM_001040429	NP_001035519	O14917	PCD17_HUMAN	protocadherin 17 precursor	683	Extracellular (Potential).|Cadherin 6.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding|protein binding			ovary(3)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	7		Lung NSC(96;0.027)|Prostate(109;0.0453)|Breast(118;0.128)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;1.06e-05)		TCATCCGCTCGGTGAGCGGAT	0.632													96	135	---	---	---	---	capture	Silent	SNP	58208729	58208729	PCDH17	13	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	11415	249
AHNAK2	113146	broad.mit.edu	37	14	105417209	105417209	+	Missense_Mutation	SNP	C	T	T			TCGA-32-5222-01	TCGA-32-5222-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:105417209C>T	uc010axc.1	-	7	4699	c.4579G>A	c.(4579-4581)GTG>ATG	p.V1527M	AHNAK2_uc001ypx.2_Missense_Mutation_p.V1427M	NM_138420	NP_612429	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	1527						nucleus				ovary(1)	1		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			GGGAGGCTCACGTCGGCCTCC	0.622													53	93	---	---	---	---	capture	Missense_Mutation	SNP	105417209	105417209	AHNAK2	14	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	415	249
AHNAK2	113146	broad.mit.edu	37	14	105418199	105418199	+	Missense_Mutation	SNP	C	T	T			TCGA-32-5222-01	TCGA-32-5222-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:105418199C>T	uc010axc.1	-	7	3709	c.3589G>A	c.(3589-3591)GTG>ATG	p.V1197M	AHNAK2_uc001ypx.2_Missense_Mutation_p.V1097M	NM_138420	NP_612429	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	1197						nucleus				ovary(1)	1		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			GGGAGACTCACGTCGGCCTCC	0.617													60	171	---	---	---	---	capture	Missense_Mutation	SNP	105418199	105418199	AHNAK2	14	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	415	249
MAP1A	4130	broad.mit.edu	37	15	43818898	43818898	+	Missense_Mutation	SNP	C	T	T			TCGA-32-5222-01	TCGA-32-5222-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:43818898C>T	uc001zrt.2	+	4	5694	c.5227C>T	c.(5227-5229)CGG>TGG	p.R1743W		NM_002373	NP_002364	P78559	MAP1A_HUMAN	microtubule-associated protein 1A	1743						cytoplasm|microtubule|microtubule associated complex	protein binding|structural molecule activity			ovary(3)|breast(3)|pancreas(2)|skin(1)	9		all_cancers(109;1.03e-14)|all_epithelial(112;2.23e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.05e-06)	Estramustine(DB01196)	AGTACCCCTGCGGGAACACGC	0.597													69	130	---	---	---	---	capture	Missense_Mutation	SNP	43818898	43818898	MAP1A	15	C	T	T	T	1	0	0	0	0	1	0	0	0	347	27	1	1	9141	249
BNC1	646	broad.mit.edu	37	15	83935703	83935703	+	Missense_Mutation	SNP	C	T	T			TCGA-32-5222-01	TCGA-32-5222-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:83935703C>T	uc002bjt.1	-	3	408	c.320G>A	c.(319-321)CGC>CAC	p.R107H	BNC1_uc010uos.1_Missense_Mutation_p.R95H	NM_001717	NP_001708	Q01954	BNC1_HUMAN	basonuclin 1	107					epidermis development|positive regulation of cell proliferation	cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	p.R107C(1)		ovary(3)	3						GATTTTTAGGCGAACGGGGAT	0.507													78	115	---	---	---	---	capture	Missense_Mutation	SNP	83935703	83935703	BNC1	15	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	1462	249
PCSK6	5046	broad.mit.edu	37	15	101929721	101929721	+	Missense_Mutation	SNP	A	G	G			TCGA-32-5222-01	TCGA-32-5222-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:101929721A>G	uc002bwy.2	-	10	1572	c.1258T>C	c.(1258-1260)TCA>CCA	p.S420P	PCSK6_uc010bpd.2_Missense_Mutation_p.S290P|PCSK6_uc010bpe.2_Missense_Mutation_p.S420P|PCSK6_uc002bxa.2_Missense_Mutation_p.S420P|PCSK6_uc002bxb.2_Missense_Mutation_p.S420P|PCSK6_uc002bxc.1_Missense_Mutation_p.S420P|PCSK6_uc002bxd.1_Missense_Mutation_p.S420P|PCSK6_uc002bxe.2_Missense_Mutation_p.S420P|PCSK6_uc002bxg.1_Missense_Mutation_p.S420P	NM_002570	NP_002561	P29122	PCSK6_HUMAN	paired basic amino acid cleaving system 4	420	Catalytic.	Charge relay system (By similarity).			glycoprotein metabolic process|nerve growth factor processing|nerve growth factor production|nerve growth factor receptor signaling pathway|regulation of BMP signaling pathway|secretion by cell	cell surface|endomembrane system|endoplasmic reticulum|extracellular matrix|extracellular space|Golgi lumen|membrane|soluble fraction	eukaryotic cell surface binding|heparin binding|nerve growth factor binding|serine-type endopeptidase activity			pancreas(2)	2	Lung NSC(78;0.00102)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.000803)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			GCAGAGACTGAGGTCCCAGTG	0.507													59	124	---	---	---	---	capture	Missense_Mutation	SNP	101929721	101929721	PCSK6	15	A	G	G	G	1	0	0	0	0	1	0	0	0	143	11	3	3	11507	249
TBL3	10607	broad.mit.edu	37	16	2025082	2025082	+	Silent	SNP	C	T	T			TCGA-32-5222-01	TCGA-32-5222-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:2025082C>T	uc002cnu.1	+	7	720	c.618C>T	c.(616-618)GAC>GAT	p.D206D	TBL3_uc002cnv.1_Silent_p.D92D|TBL3_uc010bsb.1_Missense_Mutation_p.R21W|TBL3_uc010bsc.1_Silent_p.D92D|TBL3_uc010uvt.1_Translation_Start_Site|TBL3_uc002cnw.1_5'Flank	NM_006453	NP_006444	Q12788	TBL3_HUMAN	transducin beta-like 3	206	WD 4.				G-protein signaling, coupled to cGMP nucleotide second messenger|rRNA processing	nucleolus|small-subunit processome	receptor signaling protein activity				0						TCAGCGCCGACGGCCACACCA	0.652													44	59	---	---	---	---	capture	Silent	SNP	2025082	2025082	TBL3	16	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	15530	249
CCDC113	29070	broad.mit.edu	37	16	58287944	58287944	+	Missense_Mutation	SNP	C	T	T			TCGA-32-5222-01	TCGA-32-5222-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:58287944C>T	uc002ene.2	+	3	350	c.271C>T	c.(271-273)CGT>TGT	p.R91C	CCDC113_uc010vid.1_Intron	NM_014157	NP_054876	Q9H0I3	CC113_HUMAN	coiled-coil domain containing 113 isoform 1	91						protein complex					0						AGGTATGGACCGTGGGGTAGG	0.507													56	118	---	---	---	---	capture	Missense_Mutation	SNP	58287944	58287944	CCDC113	16	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	2724	249
FLCN	201163	broad.mit.edu	37	17	17119805	17119805	+	Missense_Mutation	SNP	C	T	T			TCGA-32-5222-01	TCGA-32-5222-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:17119805C>T	uc002gra.3	-	11	1693	c.1189G>A	c.(1189-1191)GTG>ATG	p.V397M	PLD6_uc010cpn.2_RNA	NM_144997	NP_659434	Q8NFG4	FLCN_HUMAN	folliculin isoform 1	397					regulation of protein phosphorylation	cytoplasm|nucleus|plasma membrane	protein binding			thyroid(1)|haematopoietic_and_lymphoid_tissue(1)|lung(1)	3						ACGCAGCCCACGGGAAGCATG	0.637									Birt-Hogg-Dub__syndrome|Familial_Non-VHL_Clear_Cell_Renal_Cancer				18	29	---	---	---	---	capture	Missense_Mutation	SNP	17119805	17119805	FLCN	17	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	5866	249
KRT37	8688	broad.mit.edu	37	17	39578590	39578590	+	Missense_Mutation	SNP	G	A	A			TCGA-32-5222-01	TCGA-32-5222-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:39578590G>A	uc002hwp.1	-	4	876	c.829C>T	c.(829-831)CGG>TGG	p.R277W	uc002hwo.1_Intron	NM_003770	NP_003761	O76014	KRT37_HUMAN	keratin 37	277	Coil 2.|Rod.					intermediate filament	structural molecule activity			skin(1)	1		Breast(137;0.000496)				TACTGAGCCCGCATCTCCCCC	0.582													5	370	---	---	---	---	capture	Missense_Mutation	SNP	39578590	39578590	KRT37	17	G	A	A	A	1	0	0	0	0	1	0	0	0	493	38	1	1	8394	249
G6PC	2538	broad.mit.edu	37	17	41063121	41063121	+	Missense_Mutation	SNP	T	C	C			TCGA-32-5222-01	TCGA-32-5222-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:41063121T>C	uc002icb.1	+	5	831	c.752T>C	c.(751-753)GTC>GCC	p.V251A	G6PC_uc010whf.1_3'UTR	NM_000151	NP_000142	P35575	G6PC_HUMAN	glucose-6-phosphatase, catalytic subunit	251	Lumenal (Potential).				gluconeogenesis|glucose homeostasis|transmembrane transport	integral to endoplasmic reticulum membrane	glucose-6-phosphatase activity|phosphate binding			ovary(1)|breast(1)|kidney(1)|skin(1)	4		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.113)		CCAGAATGGGTCCACATTGAC	0.582									Glycogen_Storage_Disease_type_Ia				3	125	---	---	---	---	capture	Missense_Mutation	SNP	41063121	41063121	G6PC	17	T	C	C	C	1	0	0	0	0	1	0	0	0	754	58	3	3	6085	249
C17orf57	124989	broad.mit.edu	37	17	45471419	45471419	+	Silent	SNP	C	T	T			TCGA-32-5222-01	TCGA-32-5222-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:45471419C>T	uc002iln.2	+	16	2166	c.1755C>T	c.(1753-1755)TTC>TTT	p.F585F	C17orf57_uc002ilm.2_Silent_p.F489F	NM_152347	NP_689560	Q8IY85	CQ057_HUMAN	hypothetical protein LOC124989	585							calcium ion binding			breast(1)|central_nervous_system(1)|skin(1)	3						TTAAAGAATTCATTGATACTA	0.259													81	188	---	---	---	---	capture	Silent	SNP	45471419	45471419	C17orf57	17	C	T	T	T	1	0	0	0	0	0	0	0	1	376	29	2	2	1850	249
GPR142	350383	broad.mit.edu	37	17	72368116	72368116	+	Missense_Mutation	SNP	C	T	T	rs149042051	byFrequency	TCGA-32-5222-01	TCGA-32-5222-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:72368116C>T	uc010wqy.1	+	4	766	c.766C>T	c.(766-768)CGC>TGC	p.R256C	GPR142_uc010wqx.1_Missense_Mutation_p.R168C	NM_181790	NP_861455	Q7Z601	GP142_HUMAN	G protein-coupled receptor 142	256	Cytoplasmic (Potential).					cell junction|cytoplasm|integral to membrane	G-protein coupled receptor activity			ovary(2)|central_nervous_system(1)|skin(1)	4						CACGGTTGACCGCTACACTGC	0.687													34	39	---	---	---	---	capture	Missense_Mutation	SNP	72368116	72368116	GPR142	17	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	6584	249
CDH7	1005	broad.mit.edu	37	18	63547824	63547824	+	Silent	SNP	G	A	A			TCGA-32-5222-01	TCGA-32-5222-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:63547824G>A	uc002ljz.2	+	12	2377	c.2052G>A	c.(2050-2052)AGG>AGA	p.R684R	CDH7_uc002lkb.2_Silent_p.R684R	NM_033646	NP_387450	Q9ULB5	CADH7_HUMAN	cadherin 7, type 2 preproprotein	684	Cytoplasmic (Potential).				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)|pancreas(1)|skin(1)	4		Esophageal squamous(42;0.129)				AGACCCGGAGGGATGTGACTC	0.473													78	261	---	---	---	---	capture	Silent	SNP	63547824	63547824	CDH7	18	G	A	A	A	1	0	0	0	0	0	0	0	1	555	43	2	2	3086	249
MED16	10025	broad.mit.edu	37	19	868170	868170	+	Silent	SNP	C	T	T			TCGA-32-5222-01	TCGA-32-5222-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:868170C>T	uc002lqd.1	-	16	2716	c.2565G>A	c.(2563-2565)CCG>CCA	p.P855P	MED16_uc010drw.1_3'UTR|MED16_uc002lqe.2_3'UTR|MED16_uc002lqf.2_3'UTR	NM_005481	NP_005472	Q9Y2X0	MED16_HUMAN	mediator complex subunit 16	855					androgen receptor signaling pathway|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	receptor activity|thyroid hormone receptor binding|thyroid hormone receptor coactivator activity|vitamin D receptor binding				0		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;6.59e-06)|all_lung(49;9.97e-06)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GTGTGGACTGCGGGCCCAGCT	0.677													3	49	---	---	---	---	capture	Silent	SNP	868170	868170	MED16	19	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	9347	249
CCDC124	115098	broad.mit.edu	37	19	18054397	18054397	+	Missense_Mutation	SNP	C	T	T			TCGA-32-5222-01	TCGA-32-5222-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:18054397C>T	uc010xpz.1	+	5	590	c.545C>T	c.(544-546)CCG>CTG	p.P182L	CCDC124_uc002nhs.2_Missense_Mutation_p.P182L	NM_001136203	NP_001129675	Q96CT7	CC124_HUMAN	coiled-coil domain containing 124	182							DNA binding				0						GCCCAGCTGCCGCGGCTCAAA	0.637													21	55	---	---	---	---	capture	Missense_Mutation	SNP	18054397	18054397	CCDC124	19	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	2734	249
UPF1	5976	broad.mit.edu	37	19	18961017	18961017	+	Missense_Mutation	SNP	G	A	A			TCGA-32-5222-01	TCGA-32-5222-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:18961017G>A	uc002nkg.2	+	4	870	c.595G>A	c.(595-597)GCC>ACC	p.A199T	UPF1_uc002nkf.2_Missense_Mutation_p.A199T	NM_002911	NP_002902	Q92900	RENT1_HUMAN	regulator of nonsense transcripts 1	199	Sufficient for interaction with RENT2.|C4-type.				cell cycle|DNA repair|DNA replication|histone mRNA catabolic process|mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of translational termination	chromatin|cytoplasmic mRNA processing body|exon-exon junction complex	ATP binding|ATP-dependent RNA helicase activity|chromatin binding|DNA binding|protein binding|protein binding|RNA binding|zinc ion binding			ovary(1)|central_nervous_system(1)	2						CTTCATCCCGGCCAAAGCTGA	0.612													5	255	---	---	---	---	capture	Missense_Mutation	SNP	18961017	18961017	UPF1	19	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	16885	249
PRODH2	58510	broad.mit.edu	37	19	36303168	36303168	+	Silent	SNP	C	T	T			TCGA-32-5222-01	TCGA-32-5222-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:36303168C>T	uc002obx.1	-	4	624	c.606G>A	c.(604-606)GCG>GCA	p.A202A		NM_021232	NP_067055	Q9UF12	PROD2_HUMAN	kidney and liver proline oxidase 1	202					glutamate biosynthetic process|proline catabolic process		proline dehydrogenase activity			ovary(2)	2	all_lung(56;2.87e-07)|Lung NSC(56;4.32e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			CCTCATACCACGCCTCACTGC	0.672													52	202	---	---	---	---	capture	Silent	SNP	36303168	36303168	PRODH2	19	C	T	T	T	1	0	0	0	0	0	0	0	1	236	19	1	1	12445	249
RYR1	6261	broad.mit.edu	37	19	38991601	38991601	+	Missense_Mutation	SNP	G	A	A			TCGA-32-5222-01	TCGA-32-5222-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:38991601G>A	uc002oit.2	+	47	7715	c.7585G>A	c.(7585-7587)GAC>AAC	p.D2529N	RYR1_uc002oiu.2_Missense_Mutation_p.D2529N|RYR1_uc002oiv.1_5'UTR	NM_000540	NP_000531	P21817	RYR1_HUMAN	skeletal muscle ryanodine receptor isoform 1	2529	Cytoplasmic.|6 X approximate repeats.				muscle contraction|release of sequestered calcium ion into cytosol|response to caffeine|response to hypoxia	cell cortex|cytosol|I band|integral to plasma membrane|junctional sarcoplasmic reticulum membrane|smooth endoplasmic reticulum|terminal cisterna	calcium ion binding|calmodulin binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(7)|pancreas(2)|breast(1)|central_nervous_system(1)|skin(1)	12	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Dantrolene(DB01219)	GTTCCTGCCCGACATGAGGGC	0.642													16	38	---	---	---	---	capture	Missense_Mutation	SNP	38991601	38991601	RYR1	19	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	13660	249
FCGBP	8857	broad.mit.edu	37	19	40384053	40384053	+	Missense_Mutation	SNP	T	C	C			TCGA-32-5222-01	TCGA-32-5222-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:40384053T>C	uc002omp.3	-	21	9565	c.9557A>G	c.(9556-9558)GAG>GGG	p.E3186G		NM_003890	NP_003881	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein precursor	3186	TIL 7.					extracellular region	protein binding			ovary(4)|skin(4)|central_nervous_system(1)	9	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			CTGGCAGCCCTCCACACAGGG	0.652													11	92	---	---	---	---	capture	Missense_Mutation	SNP	40384053	40384053	FCGBP	19	T	C	C	C	1	0	0	0	0	1	0	0	0	702	54	3	3	5724	249
CNTD2	79935	broad.mit.edu	37	19	40730663	40730663	+	Missense_Mutation	SNP	C	T	T			TCGA-32-5222-01	TCGA-32-5222-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:40730663C>T	uc010xvi.1	-	2	372	c.323G>A	c.(322-324)CGC>CAC	p.R108H	CNTD2_uc002ond.2_Intron	NM_024877	NP_079153	Q9H8S5	CNTD2_HUMAN	cyclin N-terminal domain containing 2 isoform 2	108					regulation of cyclin-dependent protein kinase activity		protein kinase binding				0						CACCAGGGCGCGCATCTCCGG	0.682													4	5	---	---	---	---	capture	Missense_Mutation	SNP	40730663	40730663	CNTD2	19	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	3601	249
LYPD4	147719	broad.mit.edu	37	19	42342041	42342041	+	Missense_Mutation	SNP	G	A	A			TCGA-32-5222-01	TCGA-32-5222-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:42342041G>A	uc002orp.1	-	4	1490	c.506C>T	c.(505-507)ACG>ATG	p.T169M	LYPD4_uc002orq.1_Missense_Mutation_p.T134M	NM_173506	NP_775777	Q6UWN0	LYPD4_HUMAN	LY6/PLAUR domain containing 4 precursor	169	UPAR/Ly6.					anchored to membrane|plasma membrane				ovary(1)	1						ACTGTAACACGTAGAAGCAGC	0.403													24	65	---	---	---	---	capture	Missense_Mutation	SNP	42342041	42342041	LYPD4	19	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	9027	249
PHLDB3	653583	broad.mit.edu	37	19	44008217	44008217	+	Missense_Mutation	SNP	T	G	G			TCGA-32-5222-01	TCGA-32-5222-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:44008217T>G	uc002own.3	-	2	313	c.54A>C	c.(52-54)GAA>GAC	p.E18D	PHLDB3_uc002owo.2_Missense_Mutation_p.E18D	NM_198850	NP_942147	Q6NSJ2	PHLB3_HUMAN	pleckstrin homology-like domain, family B,	18											0		Prostate(69;0.0153)				CCACGTCGCATTCCGGGACCA	0.736													9	44	---	---	---	---	capture	Missense_Mutation	SNP	44008217	44008217	PHLDB3	19	T	G	G	G	1	0	0	0	0	1	0	0	0	673	52	4	4	11756	249
KLK15	55554	broad.mit.edu	37	19	51330300	51330300	+	Silent	SNP	G	A	A			TCGA-32-5222-01	TCGA-32-5222-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:51330300G>A	uc002ptl.2	-	3	346	c.315C>T	c.(313-315)AAC>AAT	p.N105N	KLK15_uc002ptm.2_Silent_p.N105N|KLK15_uc002ptn.2_Silent_p.N105N|KLK15_uc002pto.2_Silent_p.N104N|KLK15_uc010ych.1_RNA|KLK15_uc010yci.1_Silent_p.N104N|KLK15_uc010eod.2_RNA	NM_017509	NP_059979	Q9H2R5	KLK15_HUMAN	kallikrein-related peptidase 15 isoform 4	105	Peptidase S1.				proteolysis	extracellular region	serine-type endopeptidase activity			lung(1)|breast(1)	2		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00758)|GBM - Glioblastoma multiforme(134;0.0143)		ACATGATGTCGTTGCGGTGGC	0.687													55	114	---	---	---	---	capture	Silent	SNP	51330300	51330300	KLK15	19	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	8323	249
SIGLEC6	946	broad.mit.edu	37	19	52034114	52034114	+	Missense_Mutation	SNP	G	A	A			TCGA-32-5222-01	TCGA-32-5222-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:52034114G>A	uc002pwy.2	-	3	689	c.527C>T	c.(526-528)ACG>ATG	p.T176M	SIGLEC6_uc002pwz.2_Missense_Mutation_p.T176M|SIGLEC6_uc002pxa.2_Missense_Mutation_p.T176M|SIGLEC6_uc010ydb.1_Missense_Mutation_p.T129M|SIGLEC6_uc010ydc.1_Missense_Mutation_p.T165M|SIGLEC6_uc010eoz.1_Missense_Mutation_p.T154M|SIGLEC6_uc010epb.1_Missense_Mutation_p.T129M|SIGLEC6_uc010epa.1_Missense_Mutation_p.T165M	NM_001245	NP_001236	O43699	SIGL6_HUMAN	sialic acid binding Ig-like lectin 6 isoform 1	176	Ig-like C2-type 1.|Extracellular (Potential).				cell adhesion|cell-cell signaling	cytoplasm|extracellular region|integral to plasma membrane|membrane fraction|nucleus				ovary(1)	1		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.00115)|OV - Ovarian serous cystadenocarcinoma(262;0.0165)		GATGGGGGGCGTCCCCTGCTC	0.667													75	204	---	---	---	---	capture	Missense_Mutation	SNP	52034114	52034114	SIGLEC6	19	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	14205	249
LILRB1	10859	broad.mit.edu	37	19	55143056	55143056	+	Missense_Mutation	SNP	G	A	A			TCGA-32-5222-01	TCGA-32-5222-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:55143056G>A	uc002qgj.2	+	5	516	c.176G>A	c.(175-177)CGT>CAT	p.R59H	LILRB1_uc010erp.1_Intron|LILRB1_uc002qgl.2_Missense_Mutation_p.R59H|LILRB1_uc002qgk.2_Missense_Mutation_p.R59H|LILRB1_uc002qgm.2_Missense_Mutation_p.R59H|LILRB1_uc010erq.2_Missense_Mutation_p.R59H|LILRB1_uc010err.2_RNA	NM_006669	NP_006660	Q8NHL6	LIRB1_HUMAN	leukocyte immunoglobulin-like receptor,	59	Ig-like C2-type 1.|Extracellular (Potential).				regulation of immune response|response to virus	integral to membrane|plasma membrane	protein phosphatase 1 binding|receptor activity			large_intestine(1)|ovary(1)|skin(1)	3				GBM - Glioblastoma multiforme(193;0.0188)		CAGGAGTACCGTCTATATAGA	0.572										HNSCC(37;0.09)			94	268	---	---	---	---	capture	Missense_Mutation	SNP	55143056	55143056	LILRB1	19	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	8710	249
CEP68	23177	broad.mit.edu	37	2	65296813	65296813	+	Missense_Mutation	SNP	C	T	T			TCGA-32-5222-01	TCGA-32-5222-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:65296813C>T	uc002sdl.3	+	2	449	c.235C>T	c.(235-237)CAC>TAC	p.H79Y	CEP68_uc002sdj.2_Missense_Mutation_p.H79Y|CEP68_uc010yqb.1_Missense_Mutation_p.H79Y|CEP68_uc002sdk.3_Missense_Mutation_p.H79Y|CEP68_uc010yqc.1_Missense_Mutation_p.H79Y|CEP68_uc010yqd.1_Missense_Mutation_p.H79Y	NM_015147	NP_055962	Q76N32	CEP68_HUMAN	centrosomal protein 68kDa	79					centrosome organization	centrosome				skin(1)	1						CTCTAGAGCCCACCAGCCACA	0.637													28	96	---	---	---	---	capture	Missense_Mutation	SNP	65296813	65296813	CEP68	2	C	T	T	T	1	0	0	0	0	1	0	0	0	273	21	2	2	3226	249
SUCLG1	8802	broad.mit.edu	37	2	84652596	84652596	+	Missense_Mutation	SNP	C	A	A			TCGA-32-5222-01	TCGA-32-5222-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:84652596C>A	uc002son.2	-	8	1150	c.957G>T	c.(955-957)CAG>CAT	p.Q319H		NM_003849	NP_003840	P53597	SUCA_HUMAN	succinate-CoA ligase, GDP-forming alpha subunit	319					tricarboxylic acid cycle		ATP citrate synthase activity|GTP binding|succinate-CoA ligase (GDP-forming) activity				0					Succinic acid(DB00139)	CTCCTGCACTCTGAAGGGCAG	0.532													132	183	---	---	---	---	capture	Missense_Mutation	SNP	84652596	84652596	SUCLG1	2	C	A	A	A	1	0	0	0	0	1	0	0	0	415	32	4	4	15254	249
CD8B	926	broad.mit.edu	37	2	87073862	87073862	+	Silent	SNP	C	G	G			TCGA-32-5222-01	TCGA-32-5222-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:87073862C>G	uc002srz.2	-	4	578	c.528G>C	c.(526-528)CTG>CTC	p.L176L	RMND5A_uc002srs.3_Intron|CD8B_uc002srw.2_Silent_p.L176L|CD8B_uc002srx.2_Silent_p.L176L|CD8B_uc002sry.2_Intron|CD8B_uc010fgt.2_Intron|CD8B_uc002ssa.2_Silent_p.L176L|CD8B_uc010yto.1_Silent_p.L176L	NM_004931	NP_004922	P10966	CD8B_HUMAN	CD8b antigen isoform 5 precursor	176	Helical; (Potential).				immune response|regulation of defense response to virus by virus|regulation of immune response|T cell activation|transmembrane receptor protein tyrosine kinase signaling pathway|viral reproduction	early endosome|extracellular region|integral to plasma membrane|T cell receptor complex	coreceptor activity|MHC class I protein binding			upper_aerodigestive_tract(1)|skin(1)	2						CGCCAGCCACCAGCAGGCCAA	0.532													4	16	---	---	---	---	capture	Silent	SNP	87073862	87073862	CD8B	2	C	G	G	G	1	0	0	0	0	0	0	0	1	262	21	4	4	3016	249
TBC1D8	11138	broad.mit.edu	37	2	101670635	101670635	+	Missense_Mutation	SNP	C	T	T			TCGA-32-5222-01	TCGA-32-5222-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:101670635C>T	uc010fiv.2	-	4	652	c.521G>A	c.(520-522)CGC>CAC	p.R174H	TBC1D8_uc010yvw.1_Missense_Mutation_p.R189H|TBC1D8_uc002tau.3_5'UTR	NM_001102426	NP_001095896	O95759	TBCD8_HUMAN	TBC1 domain family, member 8	174	GRAM 1.				blood circulation|positive regulation of cell proliferation	intracellular|membrane	calcium ion binding|Rab GTPase activator activity			ovary(3)	3						CCAGCCCTGGCGGGGCACCCT	0.587													16	35	---	---	---	---	capture	Missense_Mutation	SNP	101670635	101670635	TBC1D8	2	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	15512	249
IL1R2	7850	broad.mit.edu	37	2	102644815	102644815	+	Silent	SNP	A	G	G			TCGA-32-5222-01	TCGA-32-5222-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:102644815A>G	uc002tbm.2	+	9	1387	c.1158A>G	c.(1156-1158)CTA>CTG	p.L386L	IL1R2_uc002tbn.2_Silent_p.L386L	NM_004633	NP_004624	P27930	IL1R2_HUMAN	interleukin 1 receptor, type II precursor	386	Cytoplasmic (Potential).				immune response	integral to membrane|plasma membrane	interleukin-1, Type II, blocking receptor activity			ovary(1)|breast(1)	2					Anakinra(DB00026)	TGACTGTGCTATGGCCTCATC	0.448													53	84	---	---	---	---	capture	Silent	SNP	102644815	102644815	IL1R2	2	A	G	G	G	1	0	0	0	0	0	0	0	1	197	16	3	3	7582	249
IL18RAP	8807	broad.mit.edu	37	2	103040874	103040874	+	Silent	SNP	G	A	A			TCGA-32-5222-01	TCGA-32-5222-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:103040874G>A	uc002tbx.2	+	5	1063	c.579G>A	c.(577-579)AAG>AAA	p.K193K	IL18RAP_uc010fiz.2_Silent_p.K51K	NM_003853	NP_003844	O95256	I18RA_HUMAN	interleukin 18 receptor accessory protein	193	Ig-like C2-type 1.|Extracellular (Potential).				cell surface receptor linked signaling pathway|inflammatory response|innate immune response	integral to membrane	transmembrane receptor activity			skin(3)|ovary(2)	5						CCTGGTACAAGGTAAGAGTGA	0.313													54	113	---	---	---	---	capture	Silent	SNP	103040874	103040874	IL18RAP	2	G	A	A	A	1	0	0	0	0	0	0	0	1	451	35	2	2	7571	249
IRS1	3667	broad.mit.edu	37	2	227660008	227660008	+	Silent	SNP	C	T	T			TCGA-32-5222-01	TCGA-32-5222-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:227660008C>T	uc002voh.3	-	1	3499	c.3447G>A	c.(3445-3447)GTG>GTA	p.V1149V		NM_005544	NP_005535	P35568	IRS1_HUMAN	insulin receptor substrate 1	1149					fibroblast growth factor receptor signaling pathway|glucose homeostasis|insulin receptor signaling pathway|negative regulation of insulin receptor signaling pathway|negative regulation of insulin secretion|nerve growth factor receptor signaling pathway|phosphatidylinositol 3-kinase cascade|phosphatidylinositol-mediated signaling|positive regulation of fatty acid beta-oxidation|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of insulin receptor signaling pathway|positive regulation of phosphatidylinositol 3-kinase activity	caveola|cytosol|insulin receptor complex|microsome|nucleus	insulin receptor binding|insulin-like growth factor receptor binding|phosphatidylinositol 3-kinase binding|protein kinase C binding|SH2 domain binding|transmembrane receptor protein tyrosine kinase adaptor activity			lung(5)|central_nervous_system(4)|ovary(2)|pancreas(1)	12		Renal(207;0.023)|all_lung(227;0.0994)|all_hematologic(139;0.118)|Esophageal squamous(248;0.23)		Epithelial(121;3.03e-11)|all cancers(144;2.42e-08)|Lung(261;0.00712)|LUSC - Lung squamous cell carcinoma(224;0.0137)		GCCTCAGCCACACATTCTCAA	0.617													50	81	---	---	---	---	capture	Silent	SNP	227660008	227660008	IRS1	2	C	T	T	T	1	0	0	0	0	0	0	0	1	210	17	2	2	7763	249
C20orf94	128710	broad.mit.edu	37	20	10603963	10603963	+	Missense_Mutation	SNP	A	G	G			TCGA-32-5222-01	TCGA-32-5222-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:10603963A>G	uc010zre.1	+	8	1343	c.1163A>G	c.(1162-1164)GAA>GGA	p.E388G		NM_001009608	NP_001009608	Q5VYV7	CT094_HUMAN	hypothetical protein LOC128710	388							protein binding				0						ACAAACACTGAAAGATTATCT	0.428													33	92	---	---	---	---	capture	Missense_Mutation	SNP	10603963	10603963	C20orf94	20	A	G	G	G	1	0	0	0	0	1	0	0	0	117	9	3	3	2102	249
PYGB	5834	broad.mit.edu	37	20	25255279	25255279	+	Missense_Mutation	SNP	C	T	T			TCGA-32-5222-01	TCGA-32-5222-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:25255279C>T	uc002wup.2	+	5	689	c.580C>T	c.(580-582)CGG>TGG	p.R194W		NM_002862	NP_002853	P11216	PYGB_HUMAN	brain glycogen phosphorylase	194					glucose metabolic process|glycogen catabolic process	cytoplasm	glycogen phosphorylase activity|pyridoxal phosphate binding			central_nervous_system(1)|skin(1)	2					Pyridoxal Phosphate(DB00114)	GGAGAAAGCGCGGCCTGAGTA	0.622													6	324	---	---	---	---	capture	Missense_Mutation	SNP	25255279	25255279	PYGB	20	C	T	T	T	1	0	0	0	0	1	0	0	0	347	27	1	1	12755	249
TGM2	7052	broad.mit.edu	37	20	36760804	36760804	+	Missense_Mutation	SNP	T	A	A			TCGA-32-5222-01	TCGA-32-5222-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:36760804T>A	uc002xhr.2	-	11	1814	c.1714A>T	c.(1714-1716)ATC>TTC	p.I572F	TGM2_uc002xhq.2_Missense_Mutation_p.I173F|TGM2_uc010zvx.1_Missense_Mutation_p.I491F|TGM2_uc010zvy.1_Missense_Mutation_p.I512F|TGM2_uc002xhs.1_Missense_Mutation_p.I548F	NM_004613	NP_004604	P21980	TGM2_HUMAN	transglutaminase 2 isoform a	572					apoptotic cell clearance|peptide cross-linking|positive regulation of cell adhesion		acyltransferase activity|metal ion binding|protein binding|protein-glutamine gamma-glutamyltransferase activity			large_intestine(1)|lung(1)|ovary(1)	3		Myeloproliferative disorder(115;0.00878)			L-Glutamine(DB00130)	TAGCTGTTGATAACTGGCTCC	0.567													8	625	---	---	---	---	capture	Missense_Mutation	SNP	36760804	36760804	TGM2	20	T	A	A	A	1	0	0	0	0	1	0	0	0	637	49	4	4	15715	249
ARFGEF2	10564	broad.mit.edu	37	20	47585807	47585807	+	Missense_Mutation	SNP	G	A	A			TCGA-32-5222-01	TCGA-32-5222-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:47585807G>A	uc002xtx.3	+	9	1335	c.1183G>A	c.(1183-1185)GAC>AAC	p.D395N		NM_006420	NP_006411	Q9Y6D5	BIG2_HUMAN	ADP-ribosylation factor guanine	395					exocytosis|intracellular signal transduction|regulation of ARF protein signal transduction	cytosol|Golgi membrane	ARF guanyl-nucleotide exchange factor activity			breast(3)|upper_aerodigestive_tract(1)	4			BRCA - Breast invasive adenocarcinoma(12;0.00148)|Colorectal(8;0.198)			AGGCCCTCCAGACCCAAAGTA	0.527													51	143	---	---	---	---	capture	Missense_Mutation	SNP	47585807	47585807	ARFGEF2	20	G	A	A	A	1	0	0	0	0	1	0	0	0	429	33	2	2	846	249
ARFGEF2	10564	broad.mit.edu	37	20	47591341	47591341	+	Silent	SNP	G	A	A			TCGA-32-5222-01	TCGA-32-5222-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:47591341G>A	uc002xtx.3	+	13	1856	c.1704G>A	c.(1702-1704)GTG>GTA	p.V568V		NM_006420	NP_006411	Q9Y6D5	BIG2_HUMAN	ADP-ribosylation factor guanine	568					exocytosis|intracellular signal transduction|regulation of ARF protein signal transduction	cytosol|Golgi membrane	ARF guanyl-nucleotide exchange factor activity			breast(3)|upper_aerodigestive_tract(1)	4			BRCA - Breast invasive adenocarcinoma(12;0.00148)|Colorectal(8;0.198)			AGTGCCTCGTGTCCATTCTCA	0.517													55	48	---	---	---	---	capture	Silent	SNP	47591341	47591341	ARFGEF2	20	G	A	A	A	1	0	0	0	0	0	0	0	1	613	48	2	2	846	249
ZFP64	55734	broad.mit.edu	37	20	50769893	50769893	+	Missense_Mutation	SNP	C	T	T			TCGA-32-5222-01	TCGA-32-5222-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:50769893C>T	uc002xwl.2	-	6	1187	c.838G>A	c.(838-840)GTG>ATG	p.V280M	ZFP64_uc002xwk.2_Intron|ZFP64_uc002xwm.2_Missense_Mutation_p.V278M|ZFP64_uc002xwn.2_Missense_Mutation_p.V226M	NM_018197	NP_060667	Q9NPA5	ZF64A_HUMAN	zinc finger protein 64 isoform a	280	C2H2-type 4.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			upper_aerodigestive_tract(1)|ovary(1)	2						CCCGAGTGCACCCGCATGTGC	0.552													36	113	---	---	---	---	capture	Missense_Mutation	SNP	50769893	50769893	ZFP64	20	C	T	T	T	1	0	0	0	0	1	0	0	0	234	18	2	2	17532	249
SLC17A9	63910	broad.mit.edu	37	20	61596500	61596500	+	Silent	SNP	G	A	A			TCGA-32-5222-01	TCGA-32-5222-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:61596500G>A	uc002yea.3	+	9	1111	c.927G>A	c.(925-927)ACG>ACA	p.T309T	SLC17A9_uc002ydz.3_Silent_p.T303T|SLC17A9_uc011aap.1_Silent_p.T329T	NM_022082	NP_071365	Q9BYT1	S17A9_HUMAN	vesicular nucleotide transporter SLC17A9	309					exocytosis|transmembrane transport	integral to membrane	transporter activity			ovary(1)|skin(1)	2						GAGCCATCACGGTGCGGAAGC	0.587													4	191	---	---	---	---	capture	Silent	SNP	61596500	61596500	SLC17A9	20	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	14317	249
ZNF280A	129025	broad.mit.edu	37	22	22868791	22868791	+	Missense_Mutation	SNP	C	A	A			TCGA-32-5222-01	TCGA-32-5222-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:22868791C>A	uc002zwe.2	-	2	1417	c.1164G>T	c.(1162-1164)AAG>AAT	p.K388N	LOC96610_uc011aim.1_Intron	NM_080740	NP_542778	P59817	Z280A_HUMAN	zinc finger protein 280A	388					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1	all_hematologic(9;0.0135)|Acute lymphoblastic leukemia(84;0.17)	all_hematologic(6;1.74e-30)|Acute lymphoblastic leukemia(6;7.75e-22)		READ - Rectum adenocarcinoma(21;0.145)		TTTCGCCAGGCTTATGATGGT	0.458													46	137	---	---	---	---	capture	Missense_Mutation	SNP	22868791	22868791	ZNF280A	22	C	A	A	A	1	0	0	0	0	1	0	0	0	363	28	4	4	17694	249
SAPS2	9701	broad.mit.edu	37	22	50860803	50860803	+	Silent	SNP	G	A	A			TCGA-32-5222-01	TCGA-32-5222-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:50860803G>A	uc003blb.1	+	10	1388	c.966G>A	c.(964-966)CCG>CCA	p.P322P	SAPS2_uc003bky.1_Silent_p.P322P|SAPS2_uc003bkz.1_Silent_p.P322P|SAPS2_uc003blc.2_Silent_p.P322P|SAPS2_uc003bla.1_Silent_p.P323P|uc011arw.1_5'Flank	NM_014678	NP_055493	O75170	PP6R2_HUMAN	SAPS domain family, member 2	322						cytoplasm|intracellular membrane-bounded organelle	protein binding				0		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.222)		TGCTCAACCCGCCCAAGGTAA	0.582													4	162	---	---	---	---	capture	Silent	SNP	50860803	50860803	SAPS2	22	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	13729	249
CAMK1	8536	broad.mit.edu	37	3	9802446	9802446	+	Silent	SNP	G	A	A	rs138951531		TCGA-32-5222-01	TCGA-32-5222-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:9802446G>A	uc003bst.2	-	8	817	c.639C>T	c.(637-639)TGC>TGT	p.C213C	OGG1_uc003bsk.2_Intron|OGG1_uc003bsl.2_Intron|OGG1_uc003bsm.2_Intron|OGG1_uc003bsn.2_Intron|OGG1_uc003bso.2_Intron|CAMK1_uc003bsu.2_RNA|CAMK1_uc003bss.2_5'Flank|uc003bsv.1_RNA	NM_003656	NP_003647	Q14012	KCC1A_HUMAN	calcium/calmodulin-dependent protein kinase I	213	Protein kinase.				cell differentiation|nervous system development|positive regulation of muscle cell differentiation|signal transduction	cytoplasm|nucleus	ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity			ovary(1)|skin(1)	2	Medulloblastoma(99;0.227)			OV - Ovarian serous cystadenocarcinoma(96;0.0475)		GAGGGTAACCGCAGAGCCTGG	0.557													4	110	---	---	---	---	capture	Silent	SNP	9802446	9802446	CAMK1	3	G	A	A	A	1	0	0	0	0	0	0	0	1	490	38	1	1	2572	249
ENTPD3	956	broad.mit.edu	37	3	40457378	40457378	+	Silent	SNP	G	A	A			TCGA-32-5222-01	TCGA-32-5222-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:40457378G>A	uc003ckd.3	+	7	737	c.645G>A	c.(643-645)ACG>ACA	p.T215T	ENTPD3_uc010hhy.2_Silent_p.T215T|uc003cke.3_Intron	NM_001248	NP_001239	O75355	ENTP3_HUMAN	ectonucleoside triphosphate diphosphohydrolase	215	Extracellular (Potential).					integral to membrane	ATP binding|hydrolase activity			ovary(1)	1				KIRC - Kidney renal clear cell carcinoma(284;0.0605)|Kidney(284;0.0758)		TGGAAACCACGGGTGCCCTGG	0.537													45	72	---	---	---	---	capture	Silent	SNP	40457378	40457378	ENTPD3	3	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	5095	249
TRAK1	22906	broad.mit.edu	37	3	42261046	42261046	+	Missense_Mutation	SNP	G	A	A			TCGA-32-5222-01	TCGA-32-5222-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:42261046G>A	uc003cky.2	+	15	2240	c.2024G>A	c.(2023-2025)CGC>CAC	p.R675H	TRAK1_uc011azi.1_Missense_Mutation_p.R654H	NM_001042646	NP_001036111	Q9UPV9	TRAK1_HUMAN	OGT(O-Glc-NAc transferase)-interacting protein	675					endosome to lysosome transport|protein O-linked glycosylation|protein targeting|regulation of transcription from RNA polymerase II promoter	early endosome|mitochondrion|nucleus				ovary(1)	1						ACCACCTGTCGCATCCTGCAT	0.552													11	400	---	---	---	---	capture	Missense_Mutation	SNP	42261046	42261046	TRAK1	3	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	16332	249
DOCK3	1795	broad.mit.edu	37	3	51418534	51418534	+	Silent	SNP	C	T	T			TCGA-32-5222-01	TCGA-32-5222-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:51418534C>T	uc011bds.1	+	53	5660	c.5637C>T	c.(5635-5637)GAC>GAT	p.D1879D		NM_004947	NP_004938	Q8IZD9	DOCK3_HUMAN	dedicator of cytokinesis 3	1879						cytoplasm	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity|SH3 domain binding				0				BRCA - Breast invasive adenocarcinoma(193;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00449)|Kidney(197;0.00518)		CAGGTCTGGACGGCAGCAACT	0.617													69	124	---	---	---	---	capture	Silent	SNP	51418534	51418534	DOCK3	3	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	4644	249
POLQ	10721	broad.mit.edu	37	3	121208947	121208947	+	Missense_Mutation	SNP	A	C	C			TCGA-32-5222-01	TCGA-32-5222-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:121208947A>C	uc003eee.3	-	16	2960	c.2831T>G	c.(2830-2832)TTT>TGT	p.F944C	POLQ_uc003eed.2_Missense_Mutation_p.F116C	NM_199420	NP_955452	O75417	DPOLQ_HUMAN	DNA polymerase theta	944					DNA repair|DNA replication	nucleoplasm	ATP binding|ATP-dependent helicase activity|damaged DNA binding|DNA-directed DNA polymerase activity|single-stranded DNA-dependent ATPase activity			ovary(4)|breast(3)|lung(2)|upper_aerodigestive_tract(1)|skin(1)	11				GBM - Glioblastoma multiforme(114;0.0915)		AGAATCACTAAATATTGTGTT	0.289								DNA_polymerases_(catalytic_subunits)					3	112	---	---	---	---	capture	Missense_Mutation	SNP	121208947	121208947	POLQ	3	A	C	C	C	1	0	0	0	0	1	0	0	0	13	1	4	4	12111	249
ARMC8	25852	broad.mit.edu	37	3	137964018	137964018	+	Missense_Mutation	SNP	G	A	A			TCGA-32-5222-01	TCGA-32-5222-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:137964018G>A	uc003esa.1	+	13	1452	c.1085G>A	c.(1084-1086)CGG>CAG	p.R362Q	ARMC8_uc003erw.2_Missense_Mutation_p.R362Q|ARMC8_uc003erx.2_Missense_Mutation_p.R362Q|ARMC8_uc003ery.2_Missense_Mutation_p.R334Q|ARMC8_uc003erz.2_Missense_Mutation_p.R334Q|ARMC8_uc011bmf.1_Missense_Mutation_p.R345Q|ARMC8_uc011bmg.1_Missense_Mutation_p.R309Q|ARMC8_uc011bmh.1_Missense_Mutation_p.R303Q|ARMC8_uc003esb.1_Missense_Mutation_p.R334Q|ARMC8_uc003esc.1_Missense_Mutation_p.R134Q	NM_015396	NP_056211	Q8IUR7	ARMC8_HUMAN	armadillo repeat containing 8 isoform 2	376	ARM 8.						binding				0						GAAGACATCCGGAAGAAGGTG	0.522													4	157	---	---	---	---	capture	Missense_Mutation	SNP	137964018	137964018	ARMC8	3	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	950	249
SERPINI1	5274	broad.mit.edu	37	3	167508226	167508226	+	Missense_Mutation	SNP	T	C	C			TCGA-32-5222-01	TCGA-32-5222-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:167508226T>C	uc003ffa.3	+	3	515	c.317T>C	c.(316-318)ATG>ACG	p.M106T	SERPINI1_uc003ffb.3_Missense_Mutation_p.M106T	NM_001122752	NP_001116224	Q99574	NEUS_HUMAN	neuroserpin precursor	106					central nervous system development|peripheral nervous system development|regulation of proteolysis	extracellular region	serine-type endopeptidase inhibitor activity			skin(1)	1						CAATATGTGATGAAAATTGCC	0.318													80	129	---	---	---	---	capture	Missense_Mutation	SNP	167508226	167508226	SERPINI1	3	T	C	C	C	1	0	0	0	0	1	0	0	0	663	51	3	3	14011	249
MUC4	4585	broad.mit.edu	37	3	195515449	195515449	+	Missense_Mutation	SNP	A	T	T			TCGA-32-5222-01	TCGA-32-5222-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:195515449A>T	uc011bto.1	-	2	3462	c.3002T>A	c.(3001-3003)GTA>GAA	p.V1001E	MUC4_uc003fvo.2_Intron|MUC4_uc003fvp.2_Intron|MUC4_uc010hzu.1_Intron	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		ACCTGTGGATACTGAGGAAGC	0.587													3	15	---	---	---	---	capture	Missense_Mutation	SNP	195515449	195515449	MUC4	3	A	T	T	T	1	0	0	0	0	1	0	0	0	182	14	4	4	9888	249
ZNF330	27309	broad.mit.edu	37	4	142155058	142155058	+	Missense_Mutation	SNP	C	T	T			TCGA-32-5222-01	TCGA-32-5222-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:142155058C>T	uc003iiq.3	+	10	1098	c.878C>T	c.(877-879)ACT>ATT	p.T293I	ZNF330_uc011chl.1_Missense_Mutation_p.T233I	NM_014487	NP_055302	Q9Y3S2	ZN330_HUMAN	zinc finger protein 330	293						chromosome, centromeric region|midbody|nucleolus	protein binding|zinc ion binding				0	all_hematologic(180;0.162)					GATTCAGATACTGAGTCATCA	0.308													59	91	---	---	---	---	capture	Missense_Mutation	SNP	142155058	142155058	ZNF330	4	C	T	T	T	1	0	0	0	0	1	0	0	0	260	20	2	2	17728	249
SPOCK3	50859	broad.mit.edu	37	4	167656162	167656162	+	Silent	SNP	A	G	G			TCGA-32-5222-01	TCGA-32-5222-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:167656162A>G	uc003iri.1	-	12	1362	c.1221T>C	c.(1219-1221)GAT>GAC	p.D407D	SPOCK3_uc011cjp.1_Silent_p.D364D|SPOCK3_uc011cjq.1_Silent_p.D416D|SPOCK3_uc011cjr.1_Silent_p.D287D|SPOCK3_uc003irj.1_Silent_p.D404D|SPOCK3_uc011cjs.1_Silent_p.D356D|SPOCK3_uc011cjt.1_Silent_p.D315D|SPOCK3_uc011cju.1_Silent_p.D300D|SPOCK3_uc011cjv.1_Silent_p.D309D	NM_016950	NP_058646	Q9BQ16	TICN3_HUMAN	testican 3 isoform 2	407	Asp-rich.				signal transduction	proteinaceous extracellular matrix	calcium ion binding|metalloendopeptidase inhibitor activity			large_intestine(1)|ovary(1)|central_nervous_system(1)	3	all_hematologic(180;0.221)	Prostate(90;0.0181)|Renal(120;0.0184)|Melanoma(52;0.0198)		GBM - Glioblastoma multiforme(119;0.02)		cattcataatatcgtcttcat	0.070													42	71	---	---	---	---	capture	Silent	SNP	167656162	167656162	SPOCK3	4	A	G	G	G	1	0	0	0	0	0	0	0	1	206	16	3	3	14973	249
DNAH5	1767	broad.mit.edu	37	5	13766102	13766102	+	Missense_Mutation	SNP	A	T	T			TCGA-32-5222-01	TCGA-32-5222-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:13766102A>T	uc003jfd.2	-	59	10126	c.10084T>A	c.(10084-10086)TTT>ATT	p.F3362I	DNAH5_uc003jfc.2_5'UTR	NM_001369	NP_001360	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	3362	Stalk (By similarity).				microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31	Lung NSC(4;0.00476)					TTCTGTAAAAAGTTCCCTGCA	0.418									Kartagener_syndrome				9	353	---	---	---	---	capture	Missense_Mutation	SNP	13766102	13766102	DNAH5	5	A	T	T	T	1	0	0	0	0	1	0	0	0	39	3	4	4	4561	249
PCDHA13	56136	broad.mit.edu	37	5	140263516	140263516	+	Missense_Mutation	SNP	G	A	A			TCGA-32-5222-01	TCGA-32-5222-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140263516G>A	uc003lif.2	+	1	1663	c.1663G>A	c.(1663-1665)GTG>ATG	p.V555M	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lhu.2_Intron|PCDHA10_uc003lhw.2_Intron|PCDHA10_uc003lhx.2_Intron|PCDHA11_uc003lia.2_Intron|PCDHA12_uc003lic.2_Intron|PCDHA13_uc003lie.1_Missense_Mutation_p.V555M|PCDHA13_uc003lid.2_Missense_Mutation_p.V555M	NM_018904	NP_061727	Q9Y5I0	PCDAD_HUMAN	protocadherin alpha 13 isoform 1 precursor	555	Cadherin 5.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(3)|skin(2)|central_nervous_system(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCAGGTGTTCGTGCTGGACGA	0.697													70	143	---	---	---	---	capture	Missense_Mutation	SNP	140263516	140263516	PCDHA13	5	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	11426	249
PCDHGA8	9708	broad.mit.edu	37	5	140774370	140774370	+	Missense_Mutation	SNP	G	A	A	rs143444747	by1000genomes	TCGA-32-5222-01	TCGA-32-5222-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140774370G>A	uc003lkd.1	+	1	2888	c.1990G>A	c.(1990-1992)GTG>ATG	p.V664M	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkb.3_Missense_Mutation_p.V664M	NM_032088	NP_114477	Q9Y5G5	PCDG8_HUMAN	protocadherin gamma subfamily A, 8 isoform 1	664	Extracellular (Potential).|Cadherin 6.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CACCGTAGCCGTGGCTGACAG	0.627													33	40	---	---	---	---	capture	Missense_Mutation	SNP	140774370	140774370	PCDHGA8	5	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	11463	249
OR10C1	442194	broad.mit.edu	37	6	29408448	29408448	+	Missense_Mutation	SNP	G	T	T	rs74711365		TCGA-32-5222-01	TCGA-32-5222-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:29408448G>T	uc011dlp.1	+	1	656	c.656G>T	c.(655-657)CGT>CTT	p.R219L	OR11A1_uc010jrh.1_Intron	NM_013941	NP_039229	Q96KK4	O10C1_HUMAN	olfactory receptor, family 10, subfamily C,	219	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						TCCTACGGGCGTATCCTCGTT	0.582													187	322	---	---	---	---	capture	Missense_Mutation	SNP	29408448	29408448	OR10C1	6	G	T	T	T	1	0	0	0	0	1	0	0	0	520	40	4	4	10802	249
KIF6	221458	broad.mit.edu	37	6	39513399	39513399	+	Missense_Mutation	SNP	G	A	A			TCGA-32-5222-01	TCGA-32-5222-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:39513399G>A	uc003oot.2	-	11	1342	c.1247C>T	c.(1246-1248)GCG>GTG	p.A416V	KIF6_uc010jxa.1_Missense_Mutation_p.A207V|KIF6_uc011dua.1_Missense_Mutation_p.A416V|KIF6_uc010jxb.1_Missense_Mutation_p.A416V	NM_145027	NP_659464	Q6ZMV9	KIF6_HUMAN	kinesin family member 6	416					microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity|protein binding			breast(2)|central_nervous_system(1)	3						ACGCATATCCGCGCCAACCTC	0.363													5	237	---	---	---	---	capture	Missense_Mutation	SNP	39513399	39513399	KIF6	6	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	8230	249
TMEM63B	55362	broad.mit.edu	37	6	44122464	44122464	+	Silent	SNP	G	A	A			TCGA-32-5222-01	TCGA-32-5222-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:44122464G>A	uc003owr.2	+	24	2407	c.2343G>A	c.(2341-2343)GTG>GTA	p.V781V	TMEM63B_uc003ows.2_Silent_p.V684V|TMEM63B_uc010jyz.2_RNA	NM_018426	NP_060896	Q5T3F8	TM63B_HUMAN	transmembrane protein 63B	781						integral to membrane	nucleotide binding|protein binding			pancreas(2)|central_nervous_system(1)	3	all_cancers(18;1.66e-06)|Lung NSC(15;0.00108)|all_lung(25;0.00278)|Hepatocellular(11;0.00309)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0215)			ACTCAGAGGTGGACGGGGATG	0.607													51	91	---	---	---	---	capture	Silent	SNP	44122464	44122464	TMEM63B	6	G	A	A	A	1	0	0	0	0	0	0	0	1	600	47	2	2	16074	249
TDRD6	221400	broad.mit.edu	37	6	46656737	46656737	+	Missense_Mutation	SNP	C	T	T			TCGA-32-5222-01	TCGA-32-5222-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:46656737C>T	uc003oyj.2	+	1	872	c.872C>T	c.(871-873)ACG>ATG	p.T291M	TDRD6_uc010jze.2_Missense_Mutation_p.T285M	NM_001010870	NP_001010870	O60522	TDRD6_HUMAN	tudor domain containing 6	291					cell differentiation|multicellular organismal development|spermatogenesis	chromatoid body	nucleic acid binding			breast(3)|ovary(2)|skin(1)	6			Lung(136;0.192)			CGGGGTTCCACGGGGACAGGG	0.637													40	47	---	---	---	---	capture	Missense_Mutation	SNP	46656737	46656737	TDRD6	6	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	15619	249
GSTA1	2938	broad.mit.edu	37	6	52659006	52659006	+	Missense_Mutation	SNP	C	T	T	rs1051733		TCGA-32-5222-01	TCGA-32-5222-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:52659006C>T	uc003paz.2	-	5	443	c.331G>A	c.(331-333)GTA>ATA	p.V111I		NM_145740	NP_665683	P08263	GSTA1_HUMAN	glutathione S-transferase alpha 1	111	GST C-terminal.				glutathione metabolic process|xenobiotic metabolic process	cytosol	glutathione transferase activity			ovary(1)	1	Lung NSC(77;0.118)				Amsacrine(DB00276)|Busulfan(DB01008)|Glutathione(DB00143)	GGTGGACATACGGGCAGAAGG	0.393													161	314	---	---	---	---	capture	Missense_Mutation	SNP	52659006	52659006	GSTA1	6	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	6762	249
DPPA5	340168	broad.mit.edu	37	6	74063914	74063914	+	Missense_Mutation	SNP	G	A	A			TCGA-32-5222-01	TCGA-32-5222-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:74063914G>A	uc003pgs.1	-	1	40	c.35C>T	c.(34-36)CCG>CTG	p.P12L		NM_001025290	NP_001020461	A6NC42	DPPA5_HUMAN	developmental pluripotency associated 5	12					multicellular organismal development	cytoplasm	RNA binding				0						TTTCACCCACGGCGGGATATG	0.582													45	69	---	---	---	---	capture	Missense_Mutation	SNP	74063914	74063914	DPPA5	6	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	4692	249
KIAA1009	22832	broad.mit.edu	37	6	84911454	84911454	+	Splice_Site	SNP	C	G	G			TCGA-32-5222-01	TCGA-32-5222-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:84911454C>G	uc010kbp.2	-	8	815	c.718_splice	c.e8+1	p.V240_splice	KIAA1009_uc003pkj.3_Splice_Site_p.V164_splice|KIAA1009_uc003pkk.2_Splice_Site_p.V240_splice	NM_014895	NP_055710	Q5TB80	QN1_HUMAN	KIAA1009 protein						cell division|mitosis	centrosome|nucleus|plasma membrane|spindle	protein binding			ovary(1)	1		all_cancers(76;1.5e-06)|Acute lymphoblastic leukemia(125;2.69e-07)|all_hematologic(105;0.000151)|all_epithelial(107;0.00258)		BRCA - Breast invasive adenocarcinoma(397;0.089)		ATAATATTTACCATTAGCAAG	0.264													2	4	---	---	---	---	capture	Splice_Site	SNP	84911454	84911454	KIAA1009	6	C	G	G	G	1	0	0	0	0	0	0	1	0	234	18	5	4	8125	249
RAET1G	353091	broad.mit.edu	37	6	150240886	150240886	+	Missense_Mutation	SNP	G	A	A			TCGA-32-5222-01	TCGA-32-5222-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:150240886G>A	uc010kii.1	-	2	220	c.152C>T	c.(151-153)GCG>GTG	p.A51V	RAET1G_uc003qnm.2_RNA	NM_001001788	NP_001001788	Q6H3X3	RET1G_HUMAN	retinoic acid early transcript 1G precursor	51	MHC class I alpha-1 like.|Extracellular (Potential).				antigen processing and presentation|immune response	integral to membrane|MHC class I protein complex	protein binding				0		Ovarian(120;0.0907)	BRCA - Breast invasive adenocarcinoma(37;0.193)	OV - Ovarian serous cystadenocarcinoma(155;2.73e-12)		GCCTTGAACCGCACACCACCG	0.532													6	315	---	---	---	---	capture	Missense_Mutation	SNP	150240886	150240886	RAET1G	6	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	12895	249
HECW1	23072	broad.mit.edu	37	7	43484403	43484403	+	Silent	SNP	G	A	A			TCGA-32-5222-01	TCGA-32-5222-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:43484403G>A	uc003tid.1	+	11	2237	c.1632G>A	c.(1630-1632)ACG>ACA	p.T544T	HECW1_uc011kbi.1_Silent_p.T544T	NM_015052	NP_055867	Q76N89	HECW1_HUMAN	NEDD4-like ubiquitin-protein ligase 1	544					protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	ubiquitin-protein ligase activity			ovary(8)|lung(6)|breast(4)|skin(4)|pancreas(1)	23						AGCTGGAGACGGTGATCGCGT	0.672													26	114	---	---	---	---	capture	Silent	SNP	43484403	43484403	HECW1	7	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	6968	249
SEMA3C	10512	broad.mit.edu	37	7	80433421	80433421	+	Splice_Site	SNP	C	G	G			TCGA-32-5222-01	TCGA-32-5222-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:80433421C>G	uc003uhj.2	-	8	1363	c.801_splice	c.e8+1	p.P267_splice	SEMA3C_uc011kgw.1_Splice_Site_p.P285_splice|SEMA3C_uc011kgx.1_Splice_Site_p.P119_splice	NM_006379	NP_006370	Q99985	SEM3C_HUMAN	semaphorin 3C precursor						immune response|response to drug	membrane	receptor activity			ovary(1)	1						TTAATACTTACAGGACATATT	0.323													8	313	---	---	---	---	capture	Splice_Site	SNP	80433421	80433421	SEMA3C	7	C	G	G	G	1	0	0	0	0	0	0	1	0	221	17	5	4	13919	249
PCLO	27445	broad.mit.edu	37	7	82585982	82585982	+	Silent	SNP	A	G	G			TCGA-32-5222-01	TCGA-32-5222-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:82585982A>G	uc003uhx.2	-	5	4576	c.4287T>C	c.(4285-4287)GAT>GAC	p.D1429D	PCLO_uc003uhv.2_Silent_p.D1429D	NM_033026	NP_149015	Q9Y6V0	PCLO_HUMAN	piccolo isoform 1	1360					cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity			ovary(7)	7						CTGACTTTTCATCAGCAAGTG	0.398													56	186	---	---	---	---	capture	Silent	SNP	82585982	82585982	PCLO	7	A	G	G	G	1	0	0	0	0	0	0	0	1	102	8	3	3	11486	249
ADAM28	10863	broad.mit.edu	37	8	24178776	24178776	+	Missense_Mutation	SNP	T	C	C			TCGA-32-5222-01	TCGA-32-5222-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:24178776T>C	uc003xdy.2	+	8	777	c.694T>C	c.(694-696)TTT>CTT	p.F232L	ADAM28_uc003xdx.2_Missense_Mutation_p.F232L|ADAM28_uc011kzz.1_5'UTR|ADAM28_uc011laa.1_Intron	NM_014265	NP_055080	Q9UKQ2	ADA28_HUMAN	ADAM metallopeptidase domain 28 isoform 1	232	Peptidase M12B.|Extracellular (Potential).				proteolysis|spermatogenesis	extracellular region|integral to membrane|plasma membrane	metalloendopeptidase activity|zinc ion binding			skin(3)|lung(1)|central_nervous_system(1)	5		Prostate(55;0.0959)		Colorectal(74;0.0129)|COAD - Colon adenocarcinoma(73;0.0434)|BRCA - Breast invasive adenocarcinoma(99;0.175)		AAAGAGGGTATTTGAGATGGC	0.323													82	124	---	---	---	---	capture	Missense_Mutation	SNP	24178776	24178776	ADAM28	8	T	C	C	C	1	0	0	0	0	1	0	0	0	676	52	3	3	246	249
ST18	9705	broad.mit.edu	37	8	53044717	53044717	+	Missense_Mutation	SNP	C	T	T			TCGA-32-5222-01	TCGA-32-5222-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:53044717C>T	uc003xqz.2	-	17	2623	c.2467G>A	c.(2467-2469)GGC>AGC	p.G823S	ST18_uc011ldq.1_Missense_Mutation_p.G470S|ST18_uc011ldr.1_Missense_Mutation_p.G788S|ST18_uc011lds.1_Missense_Mutation_p.G728S|ST18_uc003xra.2_Missense_Mutation_p.G823S	NM_014682	NP_055497	O60284	ST18_HUMAN	suppression of tumorigenicity 18	823	C2HC-type 5.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(4)|skin(1)	5		Lung NSC(129;0.131)|all_epithelial(80;0.217)|all_lung(136;0.229)				TGACCTTGGCCATCACACCCT	0.498													32	48	---	---	---	---	capture	Missense_Mutation	SNP	53044717	53044717	ST18	8	C	T	T	T	1	0	0	0	0	1	0	0	0	273	21	2	2	15102	249
ZNF623	9831	broad.mit.edu	37	8	144732707	144732707	+	Missense_Mutation	SNP	T	C	C			TCGA-32-5222-01	TCGA-32-5222-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:144732707T>C	uc003yzd.2	+	1	754	c.665T>C	c.(664-666)CTG>CCG	p.L222P	ZNF623_uc011lkp.1_Missense_Mutation_p.L182P|ZNF623_uc003yzc.2_Missense_Mutation_p.L182P	NM_014789	NP_055604	O75123	ZN623_HUMAN	zinc finger protein 623 isoform 1	222	C2H2-type 4.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;5.28e-40)|all cancers(56;5.23e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.146)			AGTTCAGACCTGATTAGGCAC	0.478													3	185	---	---	---	---	capture	Missense_Mutation	SNP	144732707	144732707	ZNF623	8	T	C	C	C	1	0	0	0	0	1	0	0	0	715	55	3	3	17925	249
PLEC	5339	broad.mit.edu	37	8	144994985	144994985	+	Nonsense_Mutation	SNP	G	A	A	rs137853161		TCGA-32-5222-01	TCGA-32-5222-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:144994985G>A	uc003zaf.1	-	32	9585	c.9415C>T	c.(9415-9417)CGA>TGA	p.R3139*	PLEC_uc003zab.1_Nonsense_Mutation_p.R3002*|PLEC_uc003zac.1_Nonsense_Mutation_p.R3006*|PLEC_uc003zad.2_Nonsense_Mutation_p.R3002*|PLEC_uc003zae.1_Nonsense_Mutation_p.R2970*|PLEC_uc003zag.1_Nonsense_Mutation_p.R2980*|PLEC_uc003zah.2_Nonsense_Mutation_p.R2988*|PLEC_uc003zaj.2_Nonsense_Mutation_p.R3029*	NM_201380	NP_958782	Q15149	PLEC_HUMAN	plectin isoform 1	3139	Plectin 6.|Globular 2.				cellular component disassembly involved in apoptosis|hemidesmosome assembly	cytosol|focal adhesion|hemidesmosome|intermediate filament cytoskeleton|sarcolemma	actin binding|structural constituent of muscle|structural constituent of muscle			large_intestine(2)|ovary(2)|pancreas(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	9						CGCTCACCTCGCTGCAGCTGC	0.687													40	51	---	---	---	---	capture	Nonsense_Mutation	SNP	144994985	144994985	PLEC	8	G	A	A	A	1	0	0	0	0	0	1	0	0	493	38	5	1	11955	249
HEMGN	55363	broad.mit.edu	37	9	100692686	100692686	+	Missense_Mutation	SNP	C	T	T			TCGA-32-5222-01	TCGA-32-5222-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:100692686C>T	uc004axy.2	-	3	1099	c.991G>A	c.(991-993)GAA>AAA	p.E331K	HEMGN_uc004axz.2_Missense_Mutation_p.E331K	NM_197978	NP_932095	Q9BXL5	HEMGN_HUMAN	hemogen	331					cell differentiation|multicellular organismal development					ovary(1)	1		Acute lymphoblastic leukemia(62;0.0559)				ACAATAATTTCGTTACATGTT	0.358													175	322	---	---	---	---	capture	Missense_Mutation	SNP	100692686	100692686	HEMGN	9	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	6976	249
OR13C3	138803	broad.mit.edu	37	9	107298286	107298286	+	Missense_Mutation	SNP	G	A	A	rs145157195		TCGA-32-5222-01	TCGA-32-5222-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:107298286G>A	uc004bcb.1	-	1	809	c.809C>T	c.(808-810)ACG>ATG	p.T270M		NM_001001961	NP_001001961	Q8NGS6	O13C3_HUMAN	olfactory receptor, family 13, subfamily C,	270	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			pancreas(1)	1						AGCTGAGCACGTGGAAAATGC	0.428													109	163	---	---	---	---	capture	Missense_Mutation	SNP	107298286	107298286	OR13C3	9	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	10839	249
OR13C8	138802	broad.mit.edu	37	9	107331551	107331551	+	Missense_Mutation	SNP	T	C	C			TCGA-32-5222-01	TCGA-32-5222-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:107331551T>C	uc011lvo.1	+	1	103	c.103T>C	c.(103-105)TAC>CAC	p.Y35H		NM_001004483	NP_001004483	Q8NGS7	O13C8_HUMAN	olfactory receptor, family 13, subfamily C,	35	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2						TTTGTGGATGTACCTGATGAT	0.443													219	356	---	---	---	---	capture	Missense_Mutation	SNP	107331551	107331551	OR13C8	9	T	C	C	C	1	0	0	0	0	1	0	0	0	741	57	3	3	10842	249
FAM48B1	100130302	broad.mit.edu	37	X	24381779	24381779	+	Missense_Mutation	SNP	C	T	T			TCGA-32-5222-01	TCGA-32-5222-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:24381779C>T	uc011mjx.1	+	1	902	c.902C>T	c.(901-903)GCC>GTC	p.A301V		NM_001136234	NP_001129706			hypothetical protein LOC100130302											kidney(1)	1						TGTGATTTGGCCGTGCCTTCA	0.512													4	176	---	---	---	---	capture	Missense_Mutation	SNP	24381779	24381779	FAM48B1	23	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	5521	249
DMD	1756	broad.mit.edu	37	X	32380981	32380981	+	Missense_Mutation	SNP	C	T	T			TCGA-32-5222-01	TCGA-32-5222-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:32380981C>T	uc004dda.1	-	37	5493	c.5249G>A	c.(5248-5250)AGG>AAG	p.R1750K	DMD_uc004dcw.2_Missense_Mutation_p.R406K|DMD_uc004dcx.2_Missense_Mutation_p.R409K|DMD_uc004dcz.2_Missense_Mutation_p.R1627K|DMD_uc004dcy.1_Missense_Mutation_p.R1746K|DMD_uc004ddb.1_Missense_Mutation_p.R1742K|DMD_uc010ngo.1_Intron	NM_004006	NP_003997	P11532	DMD_HUMAN	dystrophin Dp427m isoform	1750	Spectrin 12.|Interaction with SYNM (By similarity).				muscle filament sliding|peptide biosynthetic process	cell surface|costamere|cytoskeleton|cytosol|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|dystroglycan binding|nitric-oxide synthase binding|protein binding|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding			ovary(3)|pancreas(2)|large_intestine(1)	6		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				TACTAATTTCCTGCAGTGGTC	0.468													88	22	---	---	---	---	capture	Missense_Mutation	SNP	32380981	32380981	DMD	23	C	T	T	T	1	0	0	0	0	1	0	0	0	312	24	2	2	4538	249
PCDH19	57526	broad.mit.edu	37	X	99661954	99661954	+	Missense_Mutation	SNP	T	C	C			TCGA-32-5222-01	TCGA-32-5222-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:99661954T>C	uc010nmz.2	-	1	3318	c.1642A>G	c.(1642-1644)ACG>GCG	p.T548A	PCDH19_uc004efw.3_Missense_Mutation_p.T548A|PCDH19_uc004efx.3_Missense_Mutation_p.T548A	NM_020766	NP_001098713	Q8TAB3	PCD19_HUMAN	protocadherin 19 isoform b	548	Cadherin 5.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)|breast(2)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	7						ACCCGCACCGTAGCGTTGCTT	0.587													12	184	---	---	---	---	capture	Missense_Mutation	SNP	99661954	99661954	PCDH19	23	T	C	C	C	1	0	0	0	0	1	0	0	0	741	57	3	3	11417	249
STAG2	10735	broad.mit.edu	37	X	123202507	123202507	+	Splice_Site	SNP	G	T	T			TCGA-32-5222-01	TCGA-32-5222-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:123202507G>T	uc004etz.3	+	23	2697	c.2358_splice	c.e23+1	p.Q786_splice	STAG2_uc004eua.2_Splice_Site_p.Q786_splice|STAG2_uc004eub.2_Splice_Site_p.Q786_splice|STAG2_uc004euc.2_Splice_Site_p.Q786_splice|STAG2_uc004eud.2_Splice_Site_p.Q786_splice|STAG2_uc004eue.2_Splice_Site_p.Q786_splice	NM_006603	NP_006594	Q8N3U4	STAG2_HUMAN	stromal antigen 2 isoform b						cell division|meiosis|mitotic metaphase/anaphase transition|mitotic prometaphase|negative regulation of DNA endoreduplication|sister chromatid cohesion	chromatin|chromosome, centromeric region|nucleoplasm	protein binding			ovary(4)|skin(1)	5						TAAGGAACAGGTTAGTAATTA	0.313													4	98	---	---	---	---	capture	Splice_Site	SNP	123202507	123202507	STAG2	23	G	T	T	T	1	0	0	0	0	0	0	1	0	572	44	5	4	15133	249
GABRA3	2556	broad.mit.edu	37	X	151533006	151533006	+	Missense_Mutation	SNP	T	C	C			TCGA-32-5222-01	TCGA-32-5222-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:151533006T>C	uc010ntk.1	-	2	277	c.37A>G	c.(37-39)AGC>GGC	p.S13G		NM_000808	NP_000799	P34903	GBRA3_HUMAN	gamma-aminobutyric acid A receptor, alpha 3	13					gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity|protein binding			ovary(1)	1	Acute lymphoblastic leukemia(192;6.56e-05)				Alprazolam(DB00404)|Diazepam(DB00829)|Ethchlorvynol(DB00189)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Lorazepam(DB00186)|Meprobamate(DB00371)|Midazolam(DB00683)	ATCCCAAGGCTGGTCATGTAA	0.423													142	36	---	---	---	---	capture	Missense_Mutation	SNP	151533006	151533006	GABRA3	23	T	C	C	C	1	0	0	0	0	1	0	0	0	715	55	3	3	6104	249
RCC1	1104	broad.mit.edu	37	1	28858379	28858379	+	Frame_Shift_Del	DEL	C	-	-			TCGA-32-5222-01	TCGA-32-5222-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:28858379delC	uc001bqg.1	+	3	223	c.138delC	c.(136-138)GGCfs	p.G46fs	SNHG3-RCC1_uc001bqa.1_Frame_Shift_Del_p.G46fs|SNHG3-RCC1_uc001bqb.1_Frame_Shift_Del_p.G46fs|SNHG3-RCC1_uc001bqc.1_Frame_Shift_Del_p.G46fs|RCC1_uc001bqe.1_Frame_Shift_Del_p.G63fs|RCC1_uc001bqf.1_Frame_Shift_Del_p.G77fs	NM_001269	NP_001260	P18754	RCC1_HUMAN	regulator of chromosome condensation 1 isoform	46	RCC1 1.				cell division|chromosome segregation|G1/S transition of mitotic cell cycle|mitosis|mitotic spindle organization|regulation of mitosis|regulation of S phase of mitotic cell cycle|spindle assembly|viral reproduction	condensed nuclear chromosome|cytoplasm|nuclear chromatin|nuclear membrane|nucleoplasm	histone binding|nucleosomal DNA binding|Ran guanyl-nucleotide exchange factor activity			ovary(1)	1		Colorectal(325;3.46e-05)|Lung NSC(340;0.000318)|all_lung(284;0.000434)|Renal(390;0.00121)|Breast(348;0.00345)|all_neural(195;0.00989)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0261)|Medulloblastoma(700;0.123)		Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|STAD - Stomach adenocarcinoma(196;0.00299)|KIRC - Kidney renal clear cell carcinoma(1967;0.0101)|BRCA - Breast invasive adenocarcinoma(304;0.022)|READ - Rectum adenocarcinoma(331;0.0649)		GCGACGTGGGCCAGCTGGGGC	0.607													67	181	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	28858379	28858379	RCC1	1	C	-	-	-	1	0	1	0	1	0	0	0	0	327	26	5	5	13068	249
