Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
PRAMEF1	65121	broad.mit.edu	37	1	12854536	12854536	+	Missense_Mutation	SNP	C	T	T	rs1063777		TCGA-41-2573-01	TCGA-41-2573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:12854536C>T	uc001auj.1	+	3	863	c.760C>T	c.(760-762)CGG>TGG	p.R254W		NM_023013	NP_075389	O95521	PRAM1_HUMAN	PRAME family member 1	254											0	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.0042)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		ACTCCAAGGACGGTTAGTTGC	0.438													46	139	---	---	---	---	capture	Missense_Mutation	SNP	12854536	12854536	PRAMEF1	1	C	T	T	T	1	0	0	0	0	1	0	0	0	243	19	1	1	12326	252
KIF17	57576	broad.mit.edu	37	1	21016727	21016727	+	Silent	SNP	A	G	G	rs143130602		TCGA-41-2573-01	TCGA-41-2573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:21016727A>G	uc001bdr.3	-	7	1453	c.1335T>C	c.(1333-1335)TAT>TAC	p.Y445Y	KIF17_uc009vpx.2_Missense_Mutation_p.M1T|KIF17_uc001bds.3_Silent_p.Y445Y	NM_020816	NP_065867	Q9P2E2	KIF17_HUMAN	kinesin family member 17 isoform a	445	Potential.				microtubule-based movement|protein transport	cytoplasm|microtubule	ATP binding			ovary(3)|skin(1)	4		all_lung(284;2.99e-05)|Lung NSC(340;3.26e-05)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|COAD - Colon adenocarcinoma(152;1.43e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000168)|Kidney(64;0.000221)|GBM - Glioblastoma multiforme(114;0.000651)|KIRC - Kidney renal clear cell carcinoma(64;0.0031)|STAD - Stomach adenocarcinoma(196;0.00336)|READ - Rectum adenocarcinoma(331;0.0686)|Lung(427;0.209)		GCCTGACGTCATATGAGTTGC	0.627													3	103	---	---	---	---	capture	Silent	SNP	21016727	21016727	KIF17	1	A	G	G	G	1	0	0	0	0	0	0	0	1	102	8	3	3	8201	252
SLC44A5	204962	broad.mit.edu	37	1	75708631	75708631	+	Missense_Mutation	SNP	T	A	A			TCGA-41-2573-01	TCGA-41-2573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:75708631T>A	uc001dgu.2	-	8	555	c.411A>T	c.(409-411)AAA>AAT	p.K137N	SLC44A5_uc001dgt.2_Missense_Mutation_p.K137N|SLC44A5_uc001dgs.2_Missense_Mutation_p.K95N|SLC44A5_uc001dgr.2_Missense_Mutation_p.K95N|SLC44A5_uc010oqz.1_Missense_Mutation_p.K176N|SLC44A5_uc010ora.1_Missense_Mutation_p.K131N|SLC44A5_uc010orb.1_Missense_Mutation_p.K7N	NM_152697	NP_689910	Q8NCS7	CTL5_HUMAN	solute carrier family 44, member 5 isoform A	137	Extracellular (Potential).					integral to membrane|plasma membrane	choline transmembrane transporter activity			ovary(2)|skin(2)	4						AGCTTTTGTCTTTTGTGTACA	0.393													49	161	---	---	---	---	capture	Missense_Mutation	SNP	75708631	75708631	SLC44A5	1	T	A	A	A	1	0	0	0	0	1	0	0	0	725	56	4	4	14531	252
PLA2G4A	5321	broad.mit.edu	37	1	186863259	186863259	+	Missense_Mutation	SNP	G	A	A			TCGA-41-2573-01	TCGA-41-2573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:186863259G>A	uc001gsc.2	+	5	499	c.294G>A	c.(292-294)ATG>ATA	p.M98I	PLA2G4A_uc010pos.1_Missense_Mutation_p.M98I	NM_024420	NP_077734	P47712	PA24A_HUMAN	cytosolic phospholipase A2, group IVA	98	C2.|Phospholipid binding (Probable).				phospholipid catabolic process|platelet activating factor biosynthetic process|platelet activation	cytosol|endoplasmic reticulum membrane	calcium ion binding|calcium-dependent phospholipid binding|lysophospholipase activity			lung(2)|breast(1)	3					Flunisolide(DB00180)|Fluocinolone Acetonide(DB00591)|Fluocinonide(DB01047)|Fluorometholone(DB00324)|Flurandrenolide(DB00846)|Fluticasone Propionate(DB00588)|Medrysone(DB00253)|Quinacrine(DB01103)	ATTATGTCATGGATGAAACTC	0.338													53	58	---	---	---	---	capture	Missense_Mutation	SNP	186863259	186863259	PLA2G4A	1	G	A	A	A	1	0	0	0	0	1	0	0	0	611	47	2	2	11904	252
RYR2	6262	broad.mit.edu	37	1	237632425	237632425	+	Missense_Mutation	SNP	C	G	G			TCGA-41-2573-01	TCGA-41-2573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:237632425C>G	uc001hyl.1	+	17	1766	c.1646C>G	c.(1645-1647)GCT>GGT	p.A549G		NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	549	Cytoplasmic (By similarity).				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			AAAAACTGTGCTCAATTTTCT	0.373													13	69	---	---	---	---	capture	Missense_Mutation	SNP	237632425	237632425	RYR2	1	C	G	G	G	1	0	0	0	0	1	0	0	0	364	28	4	4	13661	252
PTEN	5728	broad.mit.edu	37	10	89692800	89692800	+	Missense_Mutation	SNP	C	T	T			TCGA-41-2573-01	TCGA-41-2573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:89692800C>T	uc001kfb.2	+	6	1315	c.284C>T	c.(283-285)CCA>CTA	p.P95L		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog	95	Phosphatase tensin-type.				activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.R55fs*1(4)|p.P95S(4)|p.P95L(3)|p.?(2)|p.Y27fs*1(2)|p.Y27_N212>Y(2)|p.H93fs*5(1)|p.Q87_P96del(1)|p.N82_P95del(1)|p.F90_P95>L(1)|p.F56fs*2(1)		endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		GACCATAACCCACCACAGCTA	0.348		31	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			63	33	---	---	---	---	capture	Missense_Mutation	SNP	89692800	89692800	PTEN	10	C	T	T	T	1	0	0	0	0	1	0	0	0	273	21	2	2	12633	252
PHRF1	57661	broad.mit.edu	37	11	608268	608268	+	Missense_Mutation	SNP	C	T	T			TCGA-41-2573-01	TCGA-41-2573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:608268C>T	uc001lqe.2	+	14	2943	c.2812C>T	c.(2812-2814)CCA>TCA	p.P938S	PHRF1_uc010qwc.1_Missense_Mutation_p.P937S|PHRF1_uc010qwd.1_Missense_Mutation_p.P936S|PHRF1_uc010qwe.1_Missense_Mutation_p.P934S|PHRF1_uc009ybz.1_Missense_Mutation_p.P728S|PHRF1_uc009yca.1_RNA	NM_020901	NP_065952	Q9P1Y6	PHRF1_HUMAN	PHD and ring finger domains 1	938							RNA polymerase binding|zinc ion binding				0						GCCATCCCCCCCAGAGCCCTG	0.697													13	14	---	---	---	---	capture	Missense_Mutation	SNP	608268	608268	PHRF1	11	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	11764	252
OR51D1	390038	broad.mit.edu	37	11	4661911	4661911	+	Silent	SNP	T	A	A			TCGA-41-2573-01	TCGA-41-2573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:4661911T>A	uc010qyk.1	+	1	891	c.891T>A	c.(889-891)CCT>CCA	p.P297P		NM_001004751	NP_001004751	Q8NGF3	O51D1_HUMAN	olfactory receptor, family 51, subfamily D,	297	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;2.74e-13)|BRCA - Breast invasive adenocarcinoma(625;0.00435)|GBM - Glioblastoma multiforme(2;0.0841)|LUSC - Lung squamous cell carcinoma(625;0.19)		TGCTACCACCTGTAGTCAACC	0.522													55	78	---	---	---	---	capture	Silent	SNP	4661911	4661911	OR51D1	11	T	A	A	A	1	0	0	0	0	0	0	0	1	704	55	4	4	10997	252
OR51T1	401665	broad.mit.edu	37	11	4904034	4904034	+	Missense_Mutation	SNP	G	A	A	rs151076376	byFrequency	TCGA-41-2573-01	TCGA-41-2573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:4904034G>A	uc010qyp.1	+	1	986	c.986G>A	c.(985-987)CGC>CAC	p.R329H		NM_001004759	NP_001004759	Q8NGJ9	O51T1_HUMAN	olfactory receptor, family 51, subfamily T,	302	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|large_intestine(1)	3		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;4.77e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00435)|LUSC - Lung squamous cell carcinoma(625;0.19)		AAGACAATCCGCCAGGCTATG	0.483													43	110	---	---	---	---	capture	Missense_Mutation	SNP	4904034	4904034	OR51T1	11	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	11010	252
SLC17A6	57084	broad.mit.edu	37	11	22399231	22399231	+	Missense_Mutation	SNP	T	C	C			TCGA-41-2573-01	TCGA-41-2573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:22399231T>C	uc001mqk.2	+	12	2107	c.1694T>C	c.(1693-1695)GTA>GCA	p.V565A		NM_020346	NP_065079	Q9P2U8	VGLU2_HUMAN	solute carrier family 17 (sodium-dependent	565	Cytoplasmic (Potential).				sodium ion transport	cell junction|integral to membrane|synaptic vesicle membrane|synaptosome	L-glutamate transmembrane transporter activity|symporter activity			ovary(3)|breast(1)	4						GAGGAATTTGTACAAGGAGAA	0.353													28	25	---	---	---	---	capture	Missense_Mutation	SNP	22399231	22399231	SLC17A6	11	T	C	C	C	1	0	0	0	0	1	0	0	0	741	57	3	3	14314	252
OR4C15	81309	broad.mit.edu	37	11	55322570	55322570	+	Missense_Mutation	SNP	A	T	T			TCGA-41-2573-01	TCGA-41-2573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:55322570A>T	uc010rig.1	+	1	788	c.788A>T	c.(787-789)AAC>ATC	p.N263I		NM_001001920	NP_001001920	Q8NGM1	OR4CF_HUMAN	olfactory receptor, family 4, subfamily C,	209	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2						TGCATCATAAACTTCTCCTTG	0.478										HNSCC(20;0.049)			41	91	---	---	---	---	capture	Missense_Mutation	SNP	55322570	55322570	OR4C15	11	A	T	T	T	1	0	0	0	0	1	0	0	0	26	2	4	4	10952	252
VWF	7450	broad.mit.edu	37	12	6138532	6138532	+	Silent	SNP	G	A	A			TCGA-41-2573-01	TCGA-41-2573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:6138532G>A	uc001qnn.1	-	22	3193	c.2943C>T	c.(2941-2943)TCC>TCT	p.S981S	VWF_uc010set.1_Intron	NM_000552	NP_000543	P04275	VWF_HUMAN	von Willebrand factor preproprotein	981	VWFD 3.				blood coagulation, intrinsic pathway|cell-substrate adhesion|platelet activation|platelet degranulation|protein homooligomerization	endoplasmic reticulum|platelet alpha granule lumen|proteinaceous extracellular matrix|Weibel-Palade body	chaperone binding|collagen binding|glycoprotein binding|immunoglobulin binding|integrin binding|protease binding|protein homodimerization activity|protein N-terminus binding			skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|breast(1)	12					Antihemophilic Factor(DB00025)	TCAGGACCACGGAGATGCTCA	0.522													46	75	---	---	---	---	capture	Silent	SNP	6138532	6138532	VWF	12	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	17128	252
A2M	2	broad.mit.edu	37	12	9225468	9225468	+	Splice_Site	SNP	C	A	A			TCGA-41-2573-01	TCGA-41-2573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:9225468C>A	uc001qvk.1	-	30	3870	c.3757_splice	c.e30-1	p.D1253_splice	A2M_uc001qvj.1_Splice_Site_p.D295_splice|A2M_uc009zgk.1_Splice_Site_p.D1103_splice	NM_000014	NP_000005	P01023	A2MG_HUMAN	alpha-2-macroglobulin precursor						blood coagulation, intrinsic pathway|negative regulation of complement activation, lectin pathway|platelet activation|platelet degranulation|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|extracellular space|platelet alpha granule lumen	enzyme binding|GTPase activator activity|interleukin-1 binding|interleukin-8 binding|serine-type endopeptidase inhibitor activity|tumor necrosis factor binding			central_nervous_system(4)|skin(1)	5					Bacitracin(DB00626)|Becaplermin(DB00102)	CCACTGTGTCCTGTTAGAGAC	0.478													9	33	---	---	---	---	capture	Splice_Site	SNP	9225468	9225468	A2M	12	C	A	A	A	1	0	0	0	0	0	0	1	0	312	24	5	4	4	252
YARS2	51067	broad.mit.edu	37	12	32908585	32908585	+	Missense_Mutation	SNP	G	C	C			TCGA-41-2573-01	TCGA-41-2573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:32908585G>C	uc001rli.2	-	1	290	c.224C>G	c.(223-225)ACC>AGC	p.T75S		NM_001040436	NP_001035526	Q9Y2Z4	SYYM_HUMAN	tyrosyl-tRNA synthetase 2, mitochondrial	75					tyrosyl-tRNA aminoacylation	mitochondrial matrix	ATP binding|protein binding|RNA binding|tyrosine-tRNA ligase activity				0	Lung NSC(5;2.43e-07)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.239)				L-Tyrosine(DB00135)	ACAGTAAATGGTTTGGGGAAA	0.577											OREG0021729	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	80	95	---	---	---	---	capture	Missense_Mutation	SNP	32908585	32908585	YARS2	12	G	C	C	C	1	0	0	0	0	1	0	0	0	572	44	4	4	17349	252
CPNE8	144402	broad.mit.edu	37	12	39079420	39079420	+	Splice_Site	SNP	C	A	A			TCGA-41-2573-01	TCGA-41-2573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:39079420C>A	uc001rls.1	-	16	1228	c.1144_splice	c.e16-1	p.N382_splice	CPNE8_uc001rlr.1_Splice_Site_p.N41_splice	NM_153634	NP_705898	Q86YQ8	CPNE8_HUMAN	copine VIII											pancreas(1)	1	Esophageal squamous(101;0.187)	Lung NSC(34;0.137)|Melanoma(24;0.152)|all_lung(34;0.157)				GATTCCCATTCTGTAGAAATT	0.383													40	138	---	---	---	---	capture	Splice_Site	SNP	39079420	39079420	CPNE8	12	C	A	A	A	1	0	0	0	0	0	0	1	0	416	32	5	4	3783	252
ALX1	8092	broad.mit.edu	37	12	85695101	85695101	+	Missense_Mutation	SNP	C	T	T			TCGA-41-2573-01	TCGA-41-2573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:85695101C>T	uc001tae.3	+	4	833	c.829C>T	c.(829-831)CTC>TTC	p.L277F		NM_006982	NP_008913	Q15699	ALX1_HUMAN	cartilage paired-class homeoprotein 1	277					brain development|cartilage condensation|negative regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter		sequence-specific DNA binding transcription factor activity|transcription corepressor activity			ovary(1)|central_nervous_system(1)	2				GBM - Glioblastoma multiforme(134;0.134)		CCACGTGCCCCTCAACAATTT	0.473													26	100	---	---	---	---	capture	Missense_Mutation	SNP	85695101	85695101	ALX1	12	C	T	T	T	1	0	0	0	0	1	0	0	0	312	24	2	2	556	252
ZNF10	7556	broad.mit.edu	37	12	133732883	133732883	+	Missense_Mutation	SNP	T	C	C			TCGA-41-2573-01	TCGA-41-2573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:133732883T>C	uc009zzb.2	+	5	1498	c.1051T>C	c.(1051-1053)TGT>CGT	p.C351R	ZNF268_uc010tbv.1_Intron|ZNF10_uc001ulq.2_Missense_Mutation_p.C351R	NM_015394	NP_056209	P21506	ZNF10_HUMAN	zinc finger protein 10	351	C2H2-type 5.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			breast(1)|central_nervous_system(1)|skin(1)	3	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_cancers(7;1.28e-06)|all_epithelial(31;0.0051)|Lung NSC(355;0.00948)		OV - Ovarian serous cystadenocarcinoma(86;3.58e-08)|Epithelial(86;6.6e-07)|all cancers(50;2.28e-05)		ACTGTACACATGTAATCAGTG	0.413													46	147	---	---	---	---	capture	Missense_Mutation	SNP	133732883	133732883	ZNF10	12	T	C	C	C	1	0	0	0	0	1	0	0	0	663	51	3	3	17592	252
RYR3	6263	broad.mit.edu	37	15	33822868	33822868	+	Splice_Site	SNP	G	A	A			TCGA-41-2573-01	TCGA-41-2573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:33822868G>A	uc001zhi.2	+	4	424	c.354_splice	c.e4+1	p.M118_splice	RYR3_uc010bar.2_Splice_Site_p.M118_splice	NM_001036	NP_001027	Q15413	RYR3_HUMAN	ryanodine receptor 3						cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(5)|central_nervous_system(4)|lung(1)	10		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		CAGCGGAATGGTAAGCAGCTC	0.498													7	25	---	---	---	---	capture	Splice_Site	SNP	33822868	33822868	RYR3	15	G	A	A	A	1	0	0	0	0	0	0	1	0	572	44	5	2	13662	252
MGRN1	23295	broad.mit.edu	37	16	4731741	4731741	+	Missense_Mutation	SNP	G	A	A			TCGA-41-2573-01	TCGA-41-2573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:4731741G>A	uc002cwz.2	+	13	1458	c.1322G>A	c.(1321-1323)CGC>CAC	p.R441H	MGRN1_uc002cxa.2_Missense_Mutation_p.R441H|MGRN1_uc010btx.2_Missense_Mutation_p.R420H|MGRN1_uc010btw.2_Missense_Mutation_p.R420H|MGRN1_uc002cxb.2_Missense_Mutation_p.R480H|MGRN1_uc010uxo.1_Missense_Mutation_p.R419H|MGRN1_uc010uxp.1_Missense_Mutation_p.R419H|MGRN1_uc010uxq.1_RNA	NM_001142290	NP_001135762	O60291	MGRN1_HUMAN	mahogunin, ring finger 1 isoform 3	441					endosome to lysosome transport|negative regulation of cAMP-mediated signaling|negative regulation of G-protein coupled receptor protein signaling pathway|protein monoubiquitination	cytosol|early endosome|nucleus|plasma membrane|plasma membrane	protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)|skin(1)	2						GACAGCAGCCGCCAGAAGGGC	0.662													9	20	---	---	---	---	capture	Missense_Mutation	SNP	4731741	4731741	MGRN1	16	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	9471	252
ATP6V0D1	9114	broad.mit.edu	37	16	67472549	67472549	+	Missense_Mutation	SNP	C	T	T			TCGA-41-2573-01	TCGA-41-2573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:67472549C>T	uc002ete.1	-	8	1038	c.938G>A	c.(937-939)GGT>GAT	p.G313D	ATP6V0D1_uc010vjo.1_Missense_Mutation_p.G354D|ATP6V0D1_uc010vjn.1_Missense_Mutation_p.G236D	NM_004691	NP_004682	P61421	VA0D1_HUMAN	ATPase, H+ transporting, lysosomal, V0 subunit	313					ATP hydrolysis coupled proton transport|cellular iron ion homeostasis|insulin receptor signaling pathway|transferrin transport	endosome membrane|proton-transporting V-type ATPase, V0 domain|vacuolar proton-transporting V-type ATPase complex					0		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0439)|Epithelial(162;0.101)		ATAGAAGACACCAAAGTGGAA	0.547													39	87	---	---	---	---	capture	Missense_Mutation	SNP	67472549	67472549	ATP6V0D1	16	C	T	T	T	1	0	0	0	0	1	0	0	0	234	18	2	2	1164	252
FA2H	79152	broad.mit.edu	37	16	74750318	74750318	+	Silent	SNP	C	T	T			TCGA-41-2573-01	TCGA-41-2573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:74750318C>T	uc002fde.1	-	6	1034	c.966G>A	c.(964-966)TCG>TCA	p.S322S	FA2H_uc002fdd.1_Silent_p.S95S|FA2H_uc010vmy.1_RNA	NM_024306	NP_077282	Q7L5A8	FA2H_HUMAN	fatty acid 2-hydroxylase	322					cell death|electron transport chain|fatty acid biosynthetic process|sphingolipid metabolic process|transport	endoplasmic reticulum membrane|integral to membrane|microsome	heme binding|oxidoreductase activity				0						CCTTGTGCGGCGAGCCAAAGT	0.602													8	58	---	---	---	---	capture	Silent	SNP	74750318	74750318	FA2H	16	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	5306	252
USP6	9098	broad.mit.edu	37	17	5042870	5042870	+	Missense_Mutation	SNP	T	A	A			TCGA-41-2573-01	TCGA-41-2573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:5042870T>A	uc002gau.1	+	22	3629	c.1399T>A	c.(1399-1401)TGG>AGG	p.W467R	USP6_uc002gav.1_Missense_Mutation_p.W467R|USP6_uc010ckz.1_Missense_Mutation_p.W150R|uc002gbd.2_5'Flank	NM_004505	NP_004496	P35125	UBP6_HUMAN	ubiquitin specific protease 6	467					protein deubiquitination|regulation of vesicle-mediated transport|ubiquitin-dependent protein catabolic process	lysosome|plasma membrane|recycling endosome	calmodulin binding|cysteine-type endopeptidase activity|nucleic acid binding|protein binding|Rab GTPase activator activity|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			skin(2)|upper_aerodigestive_tract(1)|lung(1)|breast(1)	5						AGGGGGCCCTTGGTTCCCCCA	0.617			T	COL1A1|CDH11|ZNF9|OMD	aneurysmal bone cysts								58	27	---	---	---	---	capture	Missense_Mutation	SNP	5042870	5042870	USP6	17	T	A	A	A	1	0	0	0	0	1	0	0	0	819	63	4	4	16968	252
MYH1	4619	broad.mit.edu	37	17	10412802	10412802	+	Silent	SNP	C	T	T			TCGA-41-2573-01	TCGA-41-2573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:10412802C>T	uc002gmo.2	-	15	1681	c.1587G>A	c.(1585-1587)AAG>AAA	p.K529K	uc002gml.1_Intron	NM_005963	NP_005954	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult	529	Myosin head-like.					muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity			ovary(10)|skin(6)|breast(3)|upper_aerodigestive_tract(1)|kidney(1)	21						GCAAGCCAACCTTCTCGATGA	0.433													88	45	---	---	---	---	capture	Silent	SNP	10412802	10412802	MYH1	17	C	T	T	T	1	0	0	0	0	0	0	0	1	311	24	2	2	9939	252
FKBP10	60681	broad.mit.edu	37	17	39969482	39969482	+	Missense_Mutation	SNP	C	T	T			TCGA-41-2573-01	TCGA-41-2573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:39969482C>T	uc002hxv.2	+	1	521	c.196C>T	c.(196-198)CGC>TGC	p.R66C	SC65_uc002hxt.2_5'Flank|SC65_uc002hxu.2_5'Flank	NM_021939	NP_068758	Q96AY3	FKB10_HUMAN	FK506 binding protein 10 precursor	66	PPIase FKBP-type 1.				protein folding	endoplasmic reticulum lumen|membrane	calcium ion binding|FK506 binding|peptidyl-prolyl cis-trans isomerase activity			ovary(1)	1		Breast(137;0.00122)		BRCA - Breast invasive adenocarcinoma(366;0.148)		GGATTTTGTGCGCTACCACTA	0.502													4	183	---	---	---	---	capture	Missense_Mutation	SNP	39969482	39969482	FKBP10	17	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	5847	252
PPM1D	8493	broad.mit.edu	37	17	58725371	58725371	+	Silent	SNP	A	T	T			TCGA-41-2573-01	TCGA-41-2573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:58725371A>T	uc002iyt.1	+	4	1167	c.945A>T	c.(943-945)GGA>GGT	p.G315G	PPM1D_uc010ddm.1_RNA	NM_003620	NP_003611	O15297	PPM1D_HUMAN	protein phosphatase 1D	315	PP2C-like.				negative regulation of cell proliferation|protein dephosphorylation|response to radiation	nucleus|protein serine/threonine phosphatase complex	metal ion binding|protein binding|protein serine/threonine phosphatase activity			upper_aerodigestive_tract(1)	1	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;6.75e-12)|all cancers(12;1.96e-10)			GGAGTGATGGACTTTGGAATA	0.413													52	51	---	---	---	---	capture	Silent	SNP	58725371	58725371	PPM1D	17	A	T	T	T	1	0	0	0	0	0	0	0	1	119	10	4	4	12238	252
DNAH17	8632	broad.mit.edu	37	17	76420172	76420172	+	Missense_Mutation	SNP	C	T	T			TCGA-41-2573-01	TCGA-41-2573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:76420172C>T	uc010dhp.1	-	26	4426	c.4204G>A	c.(4204-4206)GCC>ACC	p.A1402T	PGS1_uc002jvm.2_3'UTR|PGS1_uc010wtt.1_RNA|PGS1_uc010dho.2_RNA|PGS1_uc002jvn.2_3'UTR|PGS1_uc002jvo.2_RNA|DNAH17_uc002jvq.2_Missense_Mutation_p.A687T|DNAH17_uc002jvs.2_RNA					SubName: Full=DNAH17 variant protein; Flags: Fragment;											ovary(6)|breast(2)|skin(1)	9			BRCA - Breast invasive adenocarcinoma(99;0.00294)|OV - Ovarian serous cystadenocarcinoma(97;0.0656)			ACAGGCATGGCCGGGGTCAGC	0.602													4	116	---	---	---	---	capture	Missense_Mutation	SNP	76420172	76420172	DNAH17	17	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	4558	252
KIAA1012	22878	broad.mit.edu	37	18	29435678	29435678	+	Missense_Mutation	SNP	T	C	C			TCGA-41-2573-01	TCGA-41-2573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:29435678T>C	uc002kxc.3	-	21	3645	c.3281A>G	c.(3280-3282)GAA>GGA	p.E1094G	KIAA1012_uc002kxb.3_Missense_Mutation_p.E1040G|KIAA1012_uc002kxd.3_RNA	NM_014939	NP_055754	Q9Y2L5	TPPC8_HUMAN	hypothetical protein LOC22878	1094					ER to Golgi vesicle-mediated transport	cis-Golgi network					0						TCTGCCTTCTTCATTTTCAAG	0.353													3	206	---	---	---	---	capture	Missense_Mutation	SNP	29435678	29435678	KIAA1012	18	T	C	C	C	1	0	0	0	0	1	0	0	0	806	62	3	3	8126	252
NBAS	51594	broad.mit.edu	37	2	15564456	15564456	+	Missense_Mutation	SNP	C	G	G			TCGA-41-2573-01	TCGA-41-2573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:15564456C>G	uc002rcc.1	-	23	2586	c.2560G>C	c.(2560-2562)GAG>CAG	p.E854Q	NBAS_uc010exl.1_Missense_Mutation_p.E46Q|NBAS_uc002rcd.1_RNA	NM_015909	NP_056993	A2RRP1	NBAS_HUMAN	neuroblastoma-amplified protein	854										ovary(2)|liver(1)|skin(1)	4						GCATAATGCTCTATTTCCTCT	0.502													3	95	---	---	---	---	capture	Missense_Mutation	SNP	15564456	15564456	NBAS	2	C	G	G	G	1	0	0	0	0	1	0	0	0	416	32	4	4	10093	252
XDH	7498	broad.mit.edu	37	2	31588885	31588885	+	Missense_Mutation	SNP	G	A	A	rs140007233		TCGA-41-2573-01	TCGA-41-2573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:31588885G>A	uc002rnv.1	-	22	2492	c.2413C>T	c.(2413-2415)CGG>TGG	p.R805W		NM_000379	NP_000370	P47989	XDH_HUMAN	xanthine dehydrogenase	805					purine nucleotide catabolic process|xanthine catabolic process	cytosol|extracellular region|peroxisome	2 iron, 2 sulfur cluster binding|electron carrier activity|flavin adenine dinucleotide binding|iron ion binding|molybdopterin cofactor binding|protein homodimerization activity|xanthine dehydrogenase activity|xanthine oxidase activity			skin(4)|breast(2)|ovary(1)|central_nervous_system(1)	8	Acute lymphoblastic leukemia(172;0.155)				Allopurinol(DB00437)|Carvedilol(DB01136)|Daunorubicin(DB00694)|Deferoxamine(DB00746)|Desflurane(DB01189)|Menadione(DB00170)|Mercaptopurine(DB01033)|Methotrexate(DB00563)|NADH(DB00157)|Nitrofurazone(DB00336)|Papaverine(DB01113)|Procarbazine(DB01168)|Pyrazinamide(DB00339)|Rasburicase(DB00049)|Spermine(DB00127)|Trifluoperazine(DB00831)|Vitamin E(DB00163)	ACAGTGCTCCGGGTCTCCTTG	0.527													60	83	---	---	---	---	capture	Missense_Mutation	SNP	31588885	31588885	XDH	2	G	A	A	A	1	0	0	0	0	1	0	0	0	506	39	1	1	17307	252
DQX1	165545	broad.mit.edu	37	2	74747143	74747143	+	Missense_Mutation	SNP	C	T	T			TCGA-41-2573-01	TCGA-41-2573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:74747143C>T	uc010yrw.1	-	9	1679	c.1514G>A	c.(1513-1515)CGT>CAT	p.R505H	DQX1_uc002smc.2_Missense_Mutation_p.R66H	NM_133637	NP_598376	Q8TE96	DQX1_HUMAN	DEAQ box polypeptide 1 (RNA-dependent ATPase)	505						nucleus	ATP binding|helicase activity|nucleic acid binding			ovary(2)	2						GAGTGGAGGACGGGTAAACCC	0.527													27	119	---	---	---	---	capture	Missense_Mutation	SNP	74747143	74747143	DQX1	2	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	4706	252
GDF5	8200	broad.mit.edu	37	20	34022173	34022173	+	Missense_Mutation	SNP	C	T	T			TCGA-41-2573-01	TCGA-41-2573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:34022173C>T	uc002xck.1	-	2	1359	c.1040G>A	c.(1039-1041)CGC>CAC	p.R347H	GDF5_uc010gfc.1_Missense_Mutation_p.R347H|uc002xcj.2_Missense_Mutation_p.A195V|GDF5_uc010zvc.1_Missense_Mutation_p.R347H	NM_000557	NP_000548	P43026	GDF5_HUMAN	growth differentiation factor 5 preproprotein	347					cartilage development|cell-cell signaling|growth|transforming growth factor beta receptor signaling pathway	extracellular space	cytokine activity|growth factor activity				0	Lung NSC(9;0.00642)|all_lung(11;0.0094)		BRCA - Breast invasive adenocarcinoma(18;0.00663)			TTTCTTGGTGCGGCCAAACAC	0.632													16	90	---	---	---	---	capture	Missense_Mutation	SNP	34022173	34022173	GDF5	20	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	6256	252
LAMA5	3911	broad.mit.edu	37	20	60900398	60900398	+	Missense_Mutation	SNP	C	T	T			TCGA-41-2573-01	TCGA-41-2573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:60900398C>T	uc002ycq.2	-	41	5570	c.5503G>A	c.(5503-5505)GCC>ACC	p.A1835T		NM_005560	NP_005551	O15230	LAMA5_HUMAN	laminin alpha 5 precursor	1835	Laminin EGF-like 16; second part.				angiogenesis|cell proliferation|cell recognition|cytoskeleton organization|endothelial cell differentiation|focal adhesion assembly|integrin-mediated signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development|substrate adhesion-dependent cell spreading	extracellular space|laminin-1 complex|laminin-10 complex|laminin-11 complex	integrin binding			ovary(1)|pancreas(1)|skin(1)	3	Breast(26;1.57e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)		Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	CGGTAGCTGGCGGGGCACAGG	0.672													3	20	---	---	---	---	capture	Missense_Mutation	SNP	60900398	60900398	LAMA5	20	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	8529	252
OSBPL10	114884	broad.mit.edu	37	3	31921180	31921180	+	Missense_Mutation	SNP	A	G	G			TCGA-41-2573-01	TCGA-41-2573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:31921180A>G	uc003cev.2	-	3	805	c.424T>C	c.(424-426)TAC>CAC	p.Y142H	OSBPL10_uc011axf.1_Missense_Mutation_p.Y142H	NM_017784	NP_060254	Q9BXB5	OSB10_HUMAN	oxysterol-binding protein-like protein 10	142	PH.				lipid transport		lipid binding			skin(1)	1				STAD - Stomach adenocarcinoma(1;0.00406)		TTAGCAGAGTACACCACCAGC	0.483													3	120	---	---	---	---	capture	Missense_Mutation	SNP	31921180	31921180	OSBPL10	3	A	G	G	G	1	0	0	0	0	1	0	0	0	182	14	3	3	11179	252
IMPDH2	3615	broad.mit.edu	37	3	49064276	49064276	+	Silent	SNP	G	A	A			TCGA-41-2573-01	TCGA-41-2573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:49064276G>A	uc003cvt.2	-	7	755	c.663C>T	c.(661-663)ATC>ATT	p.I221I		NM_000884	NP_000875	P12268	IMDH2_HUMAN	inosine monophosphate dehydrogenase 2	221	CBS 2.				GMP biosynthetic process|purine base metabolic process	cytosol|nucleus	IMP dehydrogenase activity|metal ion binding|nucleotide binding|protein binding			lung(1)	1				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00216)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)	Mycophenolate mofetil(DB00688)|Mycophenolic acid(DB01024)|NADH(DB00157)	TCCGGGCAATGATGGCCACAA	0.527													175	60	---	---	---	---	capture	Silent	SNP	49064276	49064276	IMPDH2	3	G	A	A	A	1	0	0	0	0	0	0	0	1	577	45	2	2	7650	252
HCLS1	3059	broad.mit.edu	37	3	121351248	121351248	+	Missense_Mutation	SNP	C	T	T			TCGA-41-2573-01	TCGA-41-2573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:121351248C>T	uc003eeh.3	-	12	1296	c.1171G>A	c.(1171-1173)GAT>AAT	p.D391N	HCLS1_uc011bjj.1_Missense_Mutation_p.D354N|HCLS1_uc011bjk.1_RNA	NM_005335	NP_005326	P14317	HCLS1_HUMAN	hematopoietic cell-specific Lyn substrate 1	391					erythrocyte differentiation|intracellular signal transduction|positive regulation of cell proliferation|positive regulation of tyrosine phosphorylation of STAT protein|response to hormone stimulus	mitochondrion|nucleus|plasma membrane	DNA binding|sequence-specific DNA binding transcription factor activity				0				GBM - Glioblastoma multiforme(114;0.0912)		TCTGGTTCATCCTCCTGCTCA	0.413													217	96	---	---	---	---	capture	Missense_Mutation	SNP	121351248	121351248	HCLS1	3	C	T	T	T	1	0	0	0	0	1	0	0	0	390	30	2	2	6921	252
LEKR1	389170	broad.mit.edu	37	3	156763431	156763431	+	Silent	SNP	C	T	T			TCGA-41-2573-01	TCGA-41-2573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:156763431C>T	uc003fba.1	+	14	2394	c.1059C>T	c.(1057-1059)GGC>GGT	p.G353G		NM_001004316	NP_001004316	Q6ZMV7	LEKR1_HUMAN	leucine, glutamate and lysine rich 1	Error:Variant_position_missing_in_D3DNK7_after_alignment											0			LUSC - Lung squamous cell carcinoma(72;0.0461)|Lung(72;0.0465)			TTAGATCAGGCGTGCCCATTC	0.537													93	37	---	---	---	---	capture	Silent	SNP	156763431	156763431	LEKR1	3	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	8637	252
ZNF595	152687	broad.mit.edu	37	4	60030	60030	+	Silent	SNP	A	T	T			TCGA-41-2573-01	TCGA-41-2573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:60030A>T	uc003fzv.1	+	3	366	c.210A>T	c.(208-210)ACA>ACT	p.T70T	ZNF595_uc003fzu.1_RNA|ZNF718_uc003fzt.3_Silent_p.T70T|ZNF595_uc010iay.1_RNA|ZNF595_uc011bus.1_Intron|ZNF595_uc011but.1_Intron	NM_182524	NP_872330	Q7Z3I0	Q7Z3I0_HUMAN	zinc finger protein 595	70					regulation of transcription, DNA-dependent	intracellular	nucleic acid binding|zinc ion binding				0		all_cancers(4;0.0738)|all_epithelial(65;0.139)		Lung(54;0.0654)|Epithelial(2;0.0921)|all cancers(2;0.146)|LUSC - Lung squamous cell carcinoma(95;0.173)		TACATGAGACAGCAGCCAAAC	0.468													4	150	---	---	---	---	capture	Silent	SNP	60030	60030	ZNF595	4	A	T	T	T	1	0	0	0	0	0	0	0	1	80	7	4	4	17903	252
UGT2A3	79799	broad.mit.edu	37	4	69795704	69795704	+	Missense_Mutation	SNP	C	A	A			TCGA-41-2573-01	TCGA-41-2573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:69795704C>A	uc003hef.2	-	6	1442	c.1411G>T	c.(1411-1413)GCC>TCC	p.A471S	UGT2A3_uc010ihp.1_RNA	NM_024743	NP_079019	Q6UWM9	UD2A3_HUMAN	UDP glucuronosyltransferase 2 family,	471	Extracellular (Potential).					integral to membrane	glucuronosyltransferase activity			ovary(1)|skin(1)	2						AGGTGCTTGGCTCCTTTGTGG	0.488													60	73	---	---	---	---	capture	Missense_Mutation	SNP	69795704	69795704	UGT2A3	4	C	A	A	A	1	0	0	0	0	1	0	0	0	364	28	4	4	16837	252
HSPB3	8988	broad.mit.edu	37	5	53751481	53751481	+	Translation_Start_Site	SNP	T	G	G			TCGA-41-2573-01	TCGA-41-2573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:53751481T>G	uc003jph.1	+	1	37	c.-138T>G	c.(-140--136)ATTGC>ATGGC			NM_006308	NP_006299	Q12988	HSPB3_HUMAN	heat shock 27kDa protein 3						cell death|response to heat|response to unfolded protein	cytoplasm|nucleus					0		Lung NSC(810;0.00104)				ATTAAGTGATTGCGTCTGGGC	0.488													2	20	---	---	---	---	capture	Translation_Start_Site	SNP	53751481	53751481	HSPB3	5	T	G	G	G	1	0	0	0	0	0	0	0	0	807	63	4	4	7346	252
MAP3K1	4214	broad.mit.edu	37	5	56179395	56179395	+	Silent	SNP	G	A	A			TCGA-41-2573-01	TCGA-41-2573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:56179395G>A	uc003jqw.3	+	15	4209	c.3708G>A	c.(3706-3708)CCG>CCA	p.P1236P		NM_005921	NP_005912	Q13233	M3K1_HUMAN	mitogen-activated protein kinase kinase kinase	1236					cellular response to mechanical stimulus|innate immune response|MyD88-dependent toll-like receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	cytosol	ATP binding|zinc ion binding			ovary(1)|skin(1)	2		Lung NSC(810;4.65e-05)|Prostate(74;0.0132)|Breast(144;0.0321)|Ovarian(174;0.223)		OV - Ovarian serous cystadenocarcinoma(10;6.08e-40)		CAAAACAACCGTATAGAGAAG	0.383													41	62	---	---	---	---	capture	Silent	SNP	56179395	56179395	MAP3K1	5	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	9157	252
GPR98	84059	broad.mit.edu	37	5	89985863	89985863	+	Missense_Mutation	SNP	G	C	C			TCGA-41-2573-01	TCGA-41-2573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:89985863G>C	uc003kju.2	+	30	6772	c.6676G>C	c.(6676-6678)GAG>CAG	p.E2226Q	GPR98_uc003kjt.2_5'UTR	NM_032119	NP_115495	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98 precursor	2226	Extracellular (Potential).				cell communication|cell-cell adhesion|maintenance of organ identity|neuropeptide signaling pathway|photoreceptor cell maintenance	cell surface|cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(11)|central_nervous_system(3)|pancreas(2)	16		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		CATTATTATTGAGGCCTCTGA	0.378													2	11	---	---	---	---	capture	Missense_Mutation	SNP	89985863	89985863	GPR98	5	G	C	C	C	1	0	0	0	0	1	0	0	0	585	45	4	4	6654	252
FTMT	94033	broad.mit.edu	37	5	121187869	121187869	+	Missense_Mutation	SNP	A	G	G			TCGA-41-2573-01	TCGA-41-2573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:121187869A>G	uc003kss.2	+	1	220	c.211A>G	c.(211-213)AAC>GAC	p.N71D		NM_177478	NP_803431	Q8N4E7	FTMT_HUMAN	ferritin mitochondrial precursor	71	Ferritin-like diiron.				cellular iron ion homeostasis|iron ion transport|positive regulation of cell proliferation|positive regulation of lyase activity|positive regulation of oxidoreductase activity|positive regulation of transferase activity	mitochondrion	ferric iron binding|ferroxidase activity			ovary(1)	1		all_cancers(142;0.0124)|Prostate(80;0.0322)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	Epithelial(69;0.000171)|OV - Ovarian serous cystadenocarcinoma(64;0.000188)|all cancers(49;0.0027)		GGTGCGCCAGAACTTCCACCC	0.692													14	29	---	---	---	---	capture	Missense_Mutation	SNP	121187869	121187869	FTMT	5	A	G	G	G	1	0	0	0	0	1	0	0	0	117	9	3	3	6027	252
KCNMB1	3779	broad.mit.edu	37	5	169805757	169805757	+	Missense_Mutation	SNP	G	A	A			TCGA-41-2573-01	TCGA-41-2573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:169805757G>A	uc003maq.1	-	4	927	c.527C>T	c.(526-528)GCC>GTC	p.A176V	KCNIP1_uc003map.2_Intron	NM_004137	NP_004128	Q16558	KCMB1_HUMAN	potassium large conductance calcium-activated	176	Helical; Name=2; (Potential).				platelet activation|synaptic transmission		calcium-activated potassium channel activity|potassium channel regulator activity			ovary(2)	2	Renal(175;0.000159)|Lung NSC(126;0.0165)|all_lung(126;0.026)	Medulloblastoma(196;0.0109)|all_neural(177;0.0146)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.175)		CTTCACCATGGCGATAATGAG	0.612													21	97	---	---	---	---	capture	Missense_Mutation	SNP	169805757	169805757	KCNMB1	5	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	7996	252
DSP	1832	broad.mit.edu	37	6	7581800	7581800	+	Missense_Mutation	SNP	G	A	A			TCGA-41-2573-01	TCGA-41-2573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:7581800G>A	uc003mxp.1	+	23	5656	c.5377G>A	c.(5377-5379)GAG>AAG	p.E1793K	DSP_uc003mxq.1_Intron	NM_004415	NP_004406	P15924	DESP_HUMAN	desmoplakin isoform I	1793	Central fibrous rod domain.|Potential.				cellular component disassembly involved in apoptosis|keratinocyte differentiation|peptide cross-linking	cornified envelope|cytoplasm|desmosome	protein binding, bridging|structural constituent of cytoskeleton			central_nervous_system(6)|ovary(2)|skin(1)	9	Ovarian(93;0.0584)	all_hematologic(90;0.236)		OV - Ovarian serous cystadenocarcinoma(45;0.000508)		GCAGGCTTTAGAGGTATTCAC	0.383													25	69	---	---	---	---	capture	Missense_Mutation	SNP	7581800	7581800	DSP	6	G	A	A	A	1	0	0	0	0	1	0	0	0	429	33	2	2	4736	252
MAS1L	116511	broad.mit.edu	37	6	29455047	29455047	+	Silent	SNP	G	A	A			TCGA-41-2573-01	TCGA-41-2573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:29455047G>A	uc011dlq.1	-	1	633	c.633C>T	c.(631-633)TTC>TTT	p.F211F		NM_052967	NP_443199	P35410	MAS1L_HUMAN	MAS1 oncogene-like	211	Extracellular (Potential).					cytoplasm|integral to membrane|nucleus|plasma membrane	G-protein coupled receptor activity			ovary(7)|lung(2)	9						AGTAAGTTAGGAAAAGTGATT	0.433													35	47	---	---	---	---	capture	Silent	SNP	29455047	29455047	MAS1L	6	G	A	A	A	1	0	0	0	0	0	0	0	1	529	41	2	2	9234	252
MDN1	23195	broad.mit.edu	37	6	90360511	90360511	+	Missense_Mutation	SNP	G	A	A			TCGA-41-2573-01	TCGA-41-2573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:90360511G>A	uc003pnn.1	-	96	16087	c.15971C>T	c.(15970-15972)TCA>TTA	p.S5324L		NM_014611	NP_055426	Q9NU22	MDN1_HUMAN	MDN1, midasin homolog	5324					protein complex assembly|regulation of protein complex assembly	nucleus	ATP binding|ATPase activity|unfolded protein binding			ovary(8)|skin(2)	10		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		TAACCGTTGTGAAAGAGGCGC	0.493													37	37	---	---	---	---	capture	Missense_Mutation	SNP	90360511	90360511	MDN1	6	G	A	A	A	1	0	0	0	0	1	0	0	0	585	45	2	2	9328	252
TMEM200A	114801	broad.mit.edu	37	6	130762228	130762228	+	Nonsense_Mutation	SNP	C	T	T			TCGA-41-2573-01	TCGA-41-2573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:130762228C>T	uc003qca.2	+	3	1532	c.661C>T	c.(661-663)CGA>TGA	p.R221*	TMEM200A_uc010kfh.2_Nonsense_Mutation_p.R221*|TMEM200A_uc010kfi.2_Nonsense_Mutation_p.R221*|TMEM200A_uc003qcb.2_Nonsense_Mutation_p.R221*	NM_052913	NP_443145	Q86VY9	T200A_HUMAN	transmembrane protein 200A	221	Cytoplasmic (Potential).					integral to membrane				ovary(1)	1				GBM - Glioblastoma multiforme(226;0.0139)|OV - Ovarian serous cystadenocarcinoma(155;0.12)		GAGCAGTTTTCGAATGGACAG	0.478													20	46	---	---	---	---	capture	Nonsense_Mutation	SNP	130762228	130762228	TMEM200A	6	C	T	T	T	1	0	0	0	0	0	1	0	0	399	31	5	1	16006	252
SRCRB4D	136853	broad.mit.edu	37	7	76033672	76033672	+	Missense_Mutation	SNP	G	A	A			TCGA-41-2573-01	TCGA-41-2573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:76033672G>A	uc003ufb.2	-	2	433	c.85C>T	c.(85-87)CCT>TCT	p.P29S	ZP3_uc003ufc.3_Intron	NM_080744	NP_542782	Q8WTU2	SRB4D_HUMAN	scavenger receptor cysteine rich domain	29						extracellular region|membrane	scavenger receptor activity			pancreas(1)	1						AGGAAGGGAGGGGCAGCACTC	0.507													15	25	---	---	---	---	capture	Missense_Mutation	SNP	76033672	76033672	SRCRB4D	7	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	15029	252
AKR1B15	441282	broad.mit.edu	37	7	134254273	134254273	+	Missense_Mutation	SNP	G	A	A			TCGA-41-2573-01	TCGA-41-2573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:134254273G>A	uc011kpr.1	+	5	726	c.427G>A	c.(427-429)GGA>AGA	p.G143R	AKR1B15_uc003vrt.2_Missense_Mutation_p.G115R|AKR1B15_uc011kps.1_Missense_Mutation_p.G115R	NM_001080538	NP_001074007	C9JRZ8	AK1BF_HUMAN	aldo-keto reductase family 1, member B15	143							oxidoreductase activity			ovary(1)	1						CTGGCCACAGGGATTCAAGGT	0.358													15	164	---	---	---	---	capture	Missense_Mutation	SNP	134254273	134254273	AKR1B15	7	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	468	252
ZC3HAV1	56829	broad.mit.edu	37	7	138794019	138794019	+	Missense_Mutation	SNP	C	T	T			TCGA-41-2573-01	TCGA-41-2573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:138794019C>T	uc003vun.2	-	1	447	c.59G>A	c.(58-60)CGC>CAC	p.R20H	ZC3HAV1_uc003vup.2_Missense_Mutation_p.R20H	NM_020119	NP_064504	Q7Z2W4	ZCCHV_HUMAN	zinc finger antiviral protein isoform 1	20					response to virus	cytoplasm|nucleus	NAD+ ADP-ribosyltransferase activity|RNA binding|zinc ion binding			ovary(1)	1						CAGGGCCATGCGGCCCCCGTG	0.701													3	40	---	---	---	---	capture	Missense_Mutation	SNP	138794019	138794019	ZC3HAV1	7	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	17455	252
PRSS1	5644	broad.mit.edu	37	7	142459677	142459677	+	Missense_Mutation	SNP	G	A	A			TCGA-41-2573-01	TCGA-41-2573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:142459677G>A	uc003wak.2	+	3	270	c.253G>A	c.(253-255)GAG>AAG	p.E85K	uc011krr.1_Intron|uc003vzp.2_Intron|uc011ksh.1_Intron|uc011ksi.1_Intron|uc003vzw.1_Intron|uc010loj.1_Intron|uc003wad.2_Intron|uc003wag.1_Intron|TRY6_uc011ksn.1_Intron|PRSS1_uc011ksm.1_3'UTR|PRSS1_uc003wam.2_Missense_Mutation_p.E25K	NM_002769	NP_002760	P07477	TRY1_HUMAN	protease, serine, 1 preproprotein	85	Peptidase S1.	Calcium.			digestion|proteolysis	extracellular space	metal ion binding|protein binding|serine-type endopeptidase activity			large_intestine(1)|central_nervous_system(1)	2	Melanoma(164;0.047)	all_cancers(3;2.14e-49)|Acute lymphoblastic leukemia(3;7.3e-185)|all_hematologic(3;1.1e-165)	all cancers(2;0.000126)|Colorectal(2;0.000157)|Epithelial(2;0.000191)|COAD - Colon adenocarcinoma(2;0.00189)			GGAGGGGAATGAGCAGTTCAT	0.547									Hereditary_Pancreatitis				131	265	---	---	---	---	capture	Missense_Mutation	SNP	142459677	142459677	PRSS1	7	G	A	A	A	1	0	0	0	0	1	0	0	0	585	45	2	2	12509	252
POLB	5423	broad.mit.edu	37	8	42220141	42220141	+	Silent	SNP	A	G	G			TCGA-41-2573-01	TCGA-41-2573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:42220141A>G	uc003xoz.1	+	11	746	c.633A>G	c.(631-633)TTA>TTG	p.L211L	POLB_uc003xpa.1_Intron|POLB_uc011lcs.1_Silent_p.L57L	NM_002690	NP_002681	P06746	DPOLB_HUMAN	DNA-directed DNA polymerase beta	211					DNA-dependent DNA replication	cytoplasm|nucleoplasm|spindle microtubule	DNA-(apurinic or apyrimidinic site) lyase activity|DNA-directed DNA polymerase activity|enzyme binding|metal ion binding|microtubule binding			ovary(1)|breast(1)	2	all_cancers(6;1.42e-24)|all_epithelial(6;1.02e-25)|all_lung(13;2.58e-12)|Lung NSC(13;4.24e-11)|Ovarian(28;0.00769)|Prostate(17;0.0119)|Colorectal(14;0.1)|Lung SC(25;0.211)	all_lung(54;0.00671)|Lung NSC(58;0.0184)|Esophageal squamous(32;0.131)|Hepatocellular(245;0.133)|Renal(179;0.151)	BRCA - Breast invasive adenocarcinoma(8;3.18e-11)|Lung(22;0.00467)|OV - Ovarian serous cystadenocarcinoma(14;0.00523)|LUSC - Lung squamous cell carcinoma(45;0.024)		Cytarabine(DB00987)	CAAAACTGTTACATCAGGTTG	0.303								DNA_polymerases_(catalytic_subunits)					48	76	---	---	---	---	capture	Silent	SNP	42220141	42220141	POLB	8	A	G	G	G	1	0	0	0	0	0	0	0	1	180	14	3	3	12092	252
FAM83H	286077	broad.mit.edu	37	8	144808347	144808347	+	Missense_Mutation	SNP	C	T	T			TCGA-41-2573-01	TCGA-41-2573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:144808347C>T	uc003yzk.2	-	5	3353	c.3284G>A	c.(3283-3285)CGC>CAC	p.R1095H	FAM83H_uc010mfk.1_RNA	NM_198488	NP_940890	Q6ZRV2	FA83H_HUMAN	FAM83H	1095					biomineral tissue development					lung(1)|central_nervous_system(1)|pancreas(1)	3	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.38e-41)|Epithelial(56;6.8e-40)|all cancers(56;6.43e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.146)			GCTGTCCGAGCGGAAGATGGC	0.697													12	19	---	---	---	---	capture	Missense_Mutation	SNP	144808347	144808347	FAM83H	8	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	5586	252
NFKBIL2	4796	broad.mit.edu	37	8	145661200	145661200	+	Silent	SNP	G	A	A			TCGA-41-2573-01	TCGA-41-2573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:145661200G>A	uc011llg.1	-	17	2631	c.2616C>T	c.(2614-2616)CCC>CCT	p.P872P	uc011llh.1_Intron	NM_013432	NP_038460	Q96HA7	TONSL_HUMAN	NF-kappa-B inhibitor-like protein 2	872					cytoplasmic sequestering of transcription factor|double-strand break repair via homologous recombination|replication fork processing	cytoplasm|nuclear replication fork	histone binding|transcription corepressor activity				0	all_cancers(97;4.61e-11)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.08e-41)|Epithelial(56;8.67e-41)|all cancers(56;1.1e-35)|BRCA - Breast invasive adenocarcinoma(115;0.035)|Colorectal(110;0.055)			CTCGGGCACGGGGCCTGCTCT	0.577													48	111	---	---	---	---	capture	Silent	SNP	145661200	145661200	NFKBIL2	8	G	A	A	A	1	0	0	0	0	0	0	0	1	548	43	2	2	10289	252
CEP110	11064	broad.mit.edu	37	9	123912528	123912528	+	Missense_Mutation	SNP	T	C	C	rs145241861	by1000genomes	TCGA-41-2573-01	TCGA-41-2573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:123912528T>C	uc004bkx.1	+	23	3761	c.3730T>C	c.(3730-3732)TAC>CAC	p.Y1244H	CEP110_uc004bky.1_Missense_Mutation_p.Y848H|CEP110_uc004bla.1_Missense_Mutation_p.Y692H|CEP110_uc010mvo.1_5'UTR|CEP110_uc004blb.1_5'Flank	NM_007018	NP_008949	Q7Z7A1	CNTRL_HUMAN	centrosomal protein 110kDa	1244	Pro-rich.				cell division|G2/M transition of mitotic cell cycle	centrosome|cytosol	protein binding				0						TCCTCCTGGATACATGATGTA	0.502													8	175	---	---	---	---	capture	Missense_Mutation	SNP	123912528	123912528	CEP110	9	T	C	C	C	1	0	0	0	0	1	0	0	0	637	49	3	3	3213	252
COL5A1	1289	broad.mit.edu	37	9	137591840	137591840	+	Silent	SNP	C	T	T			TCGA-41-2573-01	TCGA-41-2573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:137591840C>T	uc004cfe.2	+	3	745	c.363C>T	c.(361-363)AAC>AAT	p.N121N		NM_000093	NP_000084	P20908	CO5A1_HUMAN	alpha 1 type V collagen preproprotein	121	TSP N-terminal.|Laminin G-like.				axon guidance|cell adhesion|collagen biosynthetic process|collagen fibril organization|eye morphogenesis|fibril organization|integrin biosynthetic process|skin development|wound healing, spreading of epidermal cells	collagen type V	heparin binding|integrin binding|platelet-derived growth factor binding|proteoglycan binding			skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|kidney(1)	11		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)		CCATCTACAACGAGCAGGGTA	0.587													55	71	---	---	---	---	capture	Silent	SNP	137591840	137591840	COL5A1	9	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	3661	252
SOHLH1	402381	broad.mit.edu	37	9	138586241	138586241	+	Missense_Mutation	SNP	G	A	A			TCGA-41-2573-01	TCGA-41-2573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:138586241G>A	uc004cgl.2	-	7	999	c.938C>T	c.(937-939)TCG>TTG	p.S313L	SOHLH1_uc010nbe.2_Missense_Mutation_p.S313L	NM_001012415	NP_001012415	Q5JUK2	SOLH1_HUMAN	spermatogenesis and oogenesis specific basic	313					cell differentiation|multicellular organismal development|oogenesis|regulation of transcription, DNA-dependent|spermatogenesis|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding			breast(1)|central_nervous_system(1)	2		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;1.66e-07)|Epithelial(140;1.11e-06)|all cancers(34;6.45e-05)		ACCCGGCCACGAGCTGGGACC	0.637													55	45	---	---	---	---	capture	Missense_Mutation	SNP	138586241	138586241	SOHLH1	9	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	14815	252
ZNF727	442319	broad.mit.edu	37	7	63538251	63538252	+	Frame_Shift_Ins	INS	-	G	G			TCGA-41-2573-01	TCGA-41-2573-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:63538251_63538252insG	uc011kdm.1	+	4	1003_1004	c.824_825insG	c.(823-825)AAGfs	p.K275fs		NM_001159522	NP_001152994	A8MUV8	ZN727_HUMAN	zinc finger protein 727	275	C2H2-type 4.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						ACTAAACATAAGAGAATTCATA	0.391													7	17	---	---	---	---	capture_indel	Frame_Shift_Ins	INS	63538251	63538252	ZNF727	7	-	G	G	G	1	0	1	1	0	0	0	0	0	39	3	5	5	17999	252
