Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
LRRC47	57470	broad.mit.edu	37	1	3699235	3699235	+	Missense_Mutation	SNP	T	C	C			TCGA-41-2575-01	TCGA-41-2575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:3699235T>C	uc001akx.1	-	5	1431	c.1403A>G	c.(1402-1404)GAG>GGG	p.E468G		NM_020710	NP_065761	Q8N1G4	LRC47_HUMAN	leucine rich repeat containing 47	468					translation		phenylalanine-tRNA ligase activity|RNA binding			large_intestine(1)|ovary(1)	2	all_cancers(77;0.0375)|Ovarian(185;0.0634)|all_lung(157;0.208)|Lung NSC(156;0.21)	all_epithelial(116;1.34e-16)|all_lung(118;2.53e-06)|Lung NSC(185;0.00028)|Renal(390;0.00357)|Breast(487;0.00446)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Lung SC(97;0.0743)|Ovarian(437;0.127)		Epithelial(90;5.49e-39)|OV - Ovarian serous cystadenocarcinoma(86;1.43e-22)|GBM - Glioblastoma multiforme(42;3.69e-16)|Colorectal(212;1.21e-05)|COAD - Colon adenocarcinoma(227;5.87e-05)|Kidney(185;0.000367)|BRCA - Breast invasive adenocarcinoma(365;0.000704)|KIRC - Kidney renal clear cell carcinoma(229;0.00567)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.124)		CTTTGTCTTCTCACTGTTGGT	0.398													3	51	---	---	---	---	capture	Missense_Mutation	SNP	3699235	3699235	LRRC47	1	T	C	C	C	1	0	0	0	0	1	0	0	0	702	54	3	3	8919	253
PRAMEF12	390999	broad.mit.edu	37	1	12837263	12837263	+	Missense_Mutation	SNP	G	C	C			TCGA-41-2575-01	TCGA-41-2575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:12837263G>C	uc001aui.2	+	3	1000	c.973G>C	c.(973-975)GAC>CAC	p.D325H		NM_001080830	NP_001074299	O95522	PRA12_HUMAN	PRAME family member 12	325	LRR 1.									ovary(3)	3	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.0042)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00818)|Colorectal(212;5.04e-06)|Kidney(185;4.99e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000198)|COAD - Colon adenocarcinoma(227;0.000245)|BRCA - Breast invasive adenocarcinoma(304;0.000295)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		AAAAGAGCTAGACCTGAGGGG	0.577													94	119	---	---	---	---	capture	Missense_Mutation	SNP	12837263	12837263	PRAMEF12	1	G	C	C	C	1	0	0	0	0	1	0	0	0	429	33	4	4	12329	253
FHL3	2275	broad.mit.edu	37	1	38464646	38464646	+	Missense_Mutation	SNP	C	T	T			TCGA-41-2575-01	TCGA-41-2575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:38464646C>T	uc001ccj.2	-	3	418	c.331G>A	c.(331-333)GGG>AGG	p.G111R	FHL3_uc001cck.2_Missense_Mutation_p.G111R|FHL3_uc001ccl.2_Missense_Mutation_p.G111R|FHL3_uc001ccm.2_Missense_Mutation_p.G3R|FHL3_uc009vvl.1_Missense_Mutation_p.G111R	NM_004468	NP_004459	Q13643	FHL3_HUMAN	four and a half LIM domains 3	111	LIM zinc-binding 2.				muscle organ development		zinc ion binding				0	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)				GAACACATACCAGGCATGACA	0.527													28	73	---	---	---	---	capture	Missense_Mutation	SNP	38464646	38464646	FHL3	1	C	T	T	T	1	0	0	0	0	1	0	0	0	273	21	2	2	5826	253
CDCP2	200008	broad.mit.edu	37	1	54605733	54605733	+	Silent	SNP	G	A	A			TCGA-41-2575-01	TCGA-41-2575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:54605733G>A	uc001cwv.1	-	4	1658	c.810C>T	c.(808-810)AGC>AGT	p.S270S		NM_201546	NP_963840	Q5VXM1	CDCP2_HUMAN	CUB domain containing protein 2 precursor	270	CUB 3.					extracellular region				ovary(1)	1						GGTACTGTGGGCTGGAGAAGT	0.617													31	50	---	---	---	---	capture	Silent	SNP	54605733	54605733	CDCP2	1	G	A	A	A	1	0	0	0	0	0	0	0	1	542	42	2	2	3065	253
RPF1	80135	broad.mit.edu	37	1	84962001	84962001	+	Missense_Mutation	SNP	T	C	C			TCGA-41-2575-01	TCGA-41-2575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:84962001T>C	uc001djv.3	+	8	1001	c.956T>C	c.(955-957)CTT>CCT	p.L319P		NM_025065	NP_079341	Q9H9Y2	RPF1_HUMAN	RNA processing factor 1	319	RNA-binding (By similarity).|Brix.				rRNA processing|translation	nucleolus	aminoacyl-tRNA ligase activity|ATP binding|rRNA binding				0						TTAAGGTCTCTTCAGAAAGGA	0.323													54	67	---	---	---	---	capture	Missense_Mutation	SNP	84962001	84962001	RPF1	1	T	C	C	C	1	0	0	0	0	1	0	0	0	728	56	3	3	13438	253
FLG	2312	broad.mit.edu	37	1	152282534	152282534	+	Missense_Mutation	SNP	G	A	A			TCGA-41-2575-01	TCGA-41-2575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152282534G>A	uc001ezu.1	-	3	4864	c.4828C>T	c.(4828-4830)CGG>TGG	p.R1610W		NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	1610	Ser-rich.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GACTCAGACCGCCTCTCAGAG	0.572									Ichthyosis				169	156	---	---	---	---	capture	Missense_Mutation	SNP	152282534	152282534	FLG	1	G	A	A	A	1	0	0	0	0	1	0	0	0	493	38	1	1	5867	253
NCSTN	23385	broad.mit.edu	37	1	160318815	160318815	+	Missense_Mutation	SNP	A	G	G			TCGA-41-2575-01	TCGA-41-2575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:160318815A>G	uc001fvx.2	+	3	341	c.217A>G	c.(217-219)ATC>GTC	p.I73V	NCSTN_uc009wtk.1_RNA|NCSTN_uc001fvy.2_Missense_Mutation_p.I53V|NCSTN_uc010pjf.1_Missense_Mutation_p.I73V|NCSTN_uc001fvz.2_5'Flank|NCSTN_uc010pjg.1_5'Flank	NM_015331	NP_056146	Q92542	NICA_HUMAN	nicastrin precursor	73	Extracellular (Potential).				amyloid precursor protein catabolic process|apoptosis|induction of apoptosis by extracellular signals|membrane protein ectodomain proteolysis|membrane protein intracellular domain proteolysis|nerve growth factor receptor signaling pathway|Notch receptor processing|Notch signaling pathway|positive regulation of catalytic activity|protein processing	endoplasmic reticulum|Golgi apparatus|integral to plasma membrane|melanosome	protein binding			ovary(1)|lung(1)	2	all_cancers(52;8.15e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			CACAGGGGTTATCCACGTAGT	0.468													4	101	---	---	---	---	capture	Missense_Mutation	SNP	160318815	160318815	NCSTN	1	A	G	G	G	1	0	0	0	0	1	0	0	0	208	16	3	3	10148	253
RYR2	6262	broad.mit.edu	37	1	237780610	237780610	+	Missense_Mutation	SNP	T	C	C			TCGA-41-2575-01	TCGA-41-2575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:237780610T>C	uc001hyl.1	+	38	5860	c.5740T>C	c.(5740-5742)TGT>CGT	p.C1914R		NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	1914	Cytoplasmic (By similarity).|4 X approximate repeats.				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			TCAGTACCTCTGTGACTGCCA	0.383													12	10	---	---	---	---	capture	Missense_Mutation	SNP	237780610	237780610	RYR2	1	T	C	C	C	1	0	0	0	0	1	0	0	0	715	55	3	3	13661	253
RET	5979	broad.mit.edu	37	10	43597850	43597850	+	Missense_Mutation	SNP	G	A	A	rs138265837		TCGA-41-2575-01	TCGA-41-2575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:43597850G>A	uc001jal.2	+	3	588	c.398G>A	c.(397-399)CGT>CAT	p.R133H	RET_uc001jak.1_Missense_Mutation_p.R133H|RET_uc010qez.1_5'Flank	NM_020975	NP_066124	P07949	RET_HUMAN	ret proto-oncogene isoform a	133	Extracellular (Potential).				homophilic cell adhesion|positive regulation of metanephric glomerulus development|positive regulation of transcription, DNA-dependent|posterior midgut development	integral to membrane	ATP binding|calcium ion binding|transmembrane receptor protein tyrosine kinase activity			thyroid(404)|adrenal_gland(20)|lung(9)|large_intestine(5)|breast(4)|ovary(4)|central_nervous_system(3)|urinary_tract(1)|NS(1)	451		Ovarian(717;0.0423)			Sunitinib(DB01268)	ACATCCCTTCGTGAGGGCGAG	0.617		1	T|Mis|N|F	H4|PRKAR1A|NCOA4|PCM1|GOLGA5|TRIM33|KTN1|TRIM27|HOOK3	medullary thyroid| papillary thyroid|pheochromocytoma	medullary thyroid| papillary thyroid|pheochromocytoma	Hirschsprung disease		Multiple_Endocrine_Neoplasia_type_2B|Multiple_Endocrine_Neoplasia_type_2A|Familial_Medullary_Thyroid_Carcinoma				5	67	---	---	---	---	capture	Missense_Mutation	SNP	43597850	43597850	RET	10	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	13130	253
FAM13C	220965	broad.mit.edu	37	10	61022289	61022289	+	Missense_Mutation	SNP	G	C	C			TCGA-41-2575-01	TCGA-41-2575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:61022289G>C	uc001jkn.2	-	11	1275	c.1141C>G	c.(1141-1143)CCG>GCG	p.P381A	FAM13C_uc001jko.2_Intron|FAM13C_uc010qid.1_Missense_Mutation_p.P298A|FAM13C_uc010qie.1_Missense_Mutation_p.P298A|FAM13C_uc010qif.1_Missense_Mutation_p.P403A|FAM13C_uc001jkp.2_Missense_Mutation_p.P298A	NM_198215	NP_937858	Q8NE31	FA13C_HUMAN	hypothetical protein LOC220965 isoform 1	381										ovary(2)	2						CTTGGCTCCGGGCCCGCAGCT	0.547													48	24	---	---	---	---	capture	Missense_Mutation	SNP	61022289	61022289	FAM13C	10	G	C	C	C	1	0	0	0	0	1	0	0	0	559	43	4	4	5408	253
RNH1	6050	broad.mit.edu	37	11	494709	494709	+	Silent	SNP	G	A	A			TCGA-41-2575-01	TCGA-41-2575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:494709G>A	uc001lpk.1	-	9	2776	c.1368C>T	c.(1366-1368)TCC>TCT	p.S456S	RNH1_uc001lpl.1_Silent_p.S456S|RNH1_uc001lpm.1_Silent_p.S456S|RNH1_uc001lpn.1_Silent_p.S456S|RNH1_uc001lpo.1_Silent_p.S456S|RNH1_uc009ybw.1_RNA|RNH1_uc001lpp.1_Silent_p.S456S|RNH1_uc001lpt.1_Silent_p.S213S|RNH1_uc001lpq.1_Silent_p.S456S|RNH1_uc001lpr.1_Silent_p.S456S|RNH1_uc001lps.1_Silent_p.S456S	NM_203389	NP_976323	P13489	RINI_HUMAN	ribonuclease/angiogenin inhibitor	456					mRNA catabolic process|regulation of angiogenesis	angiogenin-PRI complex|cytoplasm	protein binding|ribonuclease inhibitor activity				0		all_cancers(49;3.02e-09)|all_epithelial(84;2.09e-06)|Breast(177;0.000162)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)		all cancers(45;1.26e-26)|Epithelial(43;1.34e-25)|OV - Ovarian serous cystadenocarcinoma(40;5.31e-20)|BRCA - Breast invasive adenocarcinoma(625;8.01e-05)|Lung(200;0.0378)|LUSC - Lung squamous cell carcinoma(625;0.0703)		TGACCCTCAGGGATGGCTTGT	0.647													79	97	---	---	---	---	capture	Silent	SNP	494709	494709	RNH1	11	G	A	A	A	1	0	0	0	0	0	0	0	1	548	43	2	2	13396	253
CD59	966	broad.mit.edu	37	11	33731856	33731856	+	Missense_Mutation	SNP	T	C	C			TCGA-41-2575-01	TCGA-41-2575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:33731856T>C	uc001mus.3	-	3	485	c.203A>G	c.(202-204)GAG>GGG	p.E68G	CD59_uc009yjx.2_Missense_Mutation_p.E68G|CD59_uc009yjy.2_Missense_Mutation_p.E68G|CD59_uc009yjz.2_Missense_Mutation_p.E68G|CD59_uc001mut.3_Missense_Mutation_p.E68G|CD59_uc009yka.2_Missense_Mutation_p.E68G|CD59_uc001muu.3_Missense_Mutation_p.E68G|CD59_uc001muv.3_Missense_Mutation_p.E68G|CD59_uc001mux.3_Missense_Mutation_p.S109G	NM_001127223	NP_001120695	P13987	CD59_HUMAN	CD59 antigen preproprotein	68	UPAR/Ly6.				blood coagulation|cell surface receptor linked signaling pathway	anchored to external side of plasma membrane|extracellular region|membrane fraction					0						ATTGCAATGCTCAAACTTCCA	0.433													3	98	---	---	---	---	capture	Missense_Mutation	SNP	33731856	33731856	CD59	11	T	C	C	C	1	0	0	0	0	1	0	0	0	702	54	3	3	2997	253
OR5AK2	390181	broad.mit.edu	37	11	56756567	56756567	+	Missense_Mutation	SNP	A	G	G			TCGA-41-2575-01	TCGA-41-2575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:56756567A>G	uc010rjp.1	+	1	179	c.179A>G	c.(178-180)TAC>TGC	p.Y60C		NM_001005323	NP_001005323	Q8NH90	O5AK2_HUMAN	olfactory receptor, family 5, subfamily AK,	60	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(3)	3						ACACTCACGTACTTTTTTCTA	0.358													67	105	---	---	---	---	capture	Missense_Mutation	SNP	56756567	56756567	OR5AK2	11	A	G	G	G	1	0	0	0	0	1	0	0	0	182	14	3	3	11046	253
PC	5091	broad.mit.edu	37	11	66618277	66618277	+	Missense_Mutation	SNP	C	A	A			TCGA-41-2575-01	TCGA-41-2575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:66618277C>A	uc001ojn.1	-	16	2390	c.2341G>T	c.(2341-2343)GCA>TCA	p.A781S	PC_uc001ojo.1_Missense_Mutation_p.A781S|PC_uc001ojp.1_Missense_Mutation_p.A781S|PC_uc001ojm.1_5'Flank	NM_022172	NP_071504	P11498	PYC_HUMAN	pyruvate carboxylase precursor	781	Carboxyltransferase.				gluconeogenesis|lipid biosynthetic process	mitochondrial matrix	ATP binding|biotin binding|biotin carboxylase activity|metal ion binding|pyruvate carboxylase activity			ovary(2)|lung(1)|kidney(1)	4		Melanoma(852;0.0525)		Lung(977;0.153)|LUSC - Lung squamous cell carcinoma(976;0.227)	Biotin(DB00121)|Pyruvic acid(DB00119)	AGCATGGCTGCCACGCCTGCC	0.657													15	9	---	---	---	---	capture	Missense_Mutation	SNP	66618277	66618277	PC	11	C	A	A	A	1	0	0	0	0	1	0	0	0	338	26	4	4	11400	253
SLC38A4	55089	broad.mit.edu	37	12	47163207	47163207	+	Missense_Mutation	SNP	C	T	T			TCGA-41-2575-01	TCGA-41-2575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:47163207C>T	uc001rpi.2	-	15	1703	c.1304G>A	c.(1303-1305)CGT>CAT	p.R435H	SLC38A4_uc001rpj.2_Missense_Mutation_p.R435H	NM_018018	NP_060488	Q969I6	S38A4_HUMAN	solute carrier family 38, member 4	435	Cytoplasmic (Potential).				cellular nitrogen compound metabolic process|sodium ion transport	integral to membrane|plasma membrane	amino acid transmembrane transporter activity|symporter activity			ovary(2)|central_nervous_system(1)|skin(1)	4	Lung SC(27;0.192)|Renal(347;0.236)					CACTGATGTACGAATCTTAAA	0.353													68	90	---	---	---	---	capture	Missense_Mutation	SNP	47163207	47163207	SLC38A4	12	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	14498	253
TFCP2	7024	broad.mit.edu	37	12	51501060	51501060	+	Missense_Mutation	SNP	C	T	T			TCGA-41-2575-01	TCGA-41-2575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:51501060C>T	uc001rxw.2	-	7	1246	c.787G>A	c.(787-789)GAG>AAG	p.E263K	TFCP2_uc001rxv.1_Missense_Mutation_p.E263K|TFCP2_uc009zlx.1_Missense_Mutation_p.E212K|TFCP2_uc001rxx.2_Missense_Mutation_p.E263K|TFCP2_uc009zly.1_Missense_Mutation_p.E165K	NM_005653	NP_005644	Q12800	TFCP2_HUMAN	transcription factor CP2	263	DNA-binding.				regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1						TGATATTTCTCCTTTTCATGA	0.323													5	387	---	---	---	---	capture	Missense_Mutation	SNP	51501060	51501060	TFCP2	12	C	T	T	T	1	0	0	0	0	1	0	0	0	390	30	2	2	15680	253
FARP1	10160	broad.mit.edu	37	13	99061722	99061722	+	Silent	SNP	G	A	A			TCGA-41-2575-01	TCGA-41-2575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:99061722G>A	uc001vnj.2	+	14	1881	c.1545G>A	c.(1543-1545)CCG>CCA	p.P515P	FARP1_uc001vnh.2_Silent_p.P515P	NM_005766	NP_005757	Q9Y4F1	FARP1_HUMAN	FERM, RhoGEF, and pleckstrin domain protein 1	515					regulation of Rho protein signal transduction	cytoplasm|cytoskeleton|extrinsic to membrane	cytoskeletal protein binding|Rho guanyl-nucleotide exchange factor activity			breast(2)	2	all_neural(89;0.0982)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		BRCA - Breast invasive adenocarcinoma(86;0.233)			TGATCAGCCCGCTGCTGAATG	0.652													23	32	---	---	---	---	capture	Silent	SNP	99061722	99061722	FARP1	13	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	5622	253
RNASE2	6036	broad.mit.edu	37	14	21424331	21424331	+	Missense_Mutation	SNP	A	T	T			TCGA-41-2575-01	TCGA-41-2575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:21424331A>T	uc010aif.2	+	2	470	c.401A>T	c.(400-402)TAT>TTT	p.Y134F	RNASE2_uc001vyl.1_Missense_Mutation_p.Y134F	NM_002934	NP_002925	P10153	RNAS2_HUMAN	ribonuclease, RNase A family, 2 (liver,	134					chemotaxis|RNA catabolic process	extracellular region|lysosome	nucleic acid binding|pancreatic ribonuclease activity			ovary(1)	1	all_cancers(95;0.00381)		OV - Ovarian serous cystadenocarcinoma(11;6.3e-09)|Epithelial(56;1.42e-07)|all cancers(55;5.48e-07)	GBM - Glioblastoma multiforme(265;0.0187)		AACATGTTCTATATAGTTGCA	0.463													4	124	---	---	---	---	capture	Missense_Mutation	SNP	21424331	21424331	RNASE2	14	A	T	T	T	1	0	0	0	0	1	0	0	0	208	16	4	4	13296	253
JUB	84962	broad.mit.edu	37	14	23444297	23444297	+	Missense_Mutation	SNP	C	T	T			TCGA-41-2575-01	TCGA-41-2575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:23444297C>T	uc001whz.2	-	5	1632	c.1256G>A	c.(1255-1257)GGG>GAG	p.G419E	JUB_uc001why.2_Missense_Mutation_p.G2E	NM_032876	NP_116265	Q96IF1	JUB_HUMAN	ajuba isoform 1	419	LIM zinc-binding 2.				cell cycle|gene silencing by miRNA|positive regulation of protein complex assembly	cell-cell junction|cytoplasmic mRNA processing body|microtubule organizing center	alpha-catenin binding|zinc ion binding				0	all_cancers(95;4.6e-05)			GBM - Glioblastoma multiforme(265;0.0122)		ATAGGACTTCCCCATTGCTTG	0.502													30	7	---	---	---	---	capture	Missense_Mutation	SNP	23444297	23444297	JUB	14	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	7891	253
KCNH5	27133	broad.mit.edu	37	14	63316419	63316419	+	Missense_Mutation	SNP	A	T	T			TCGA-41-2575-01	TCGA-41-2575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:63316419A>T	uc001xfx.2	-	8	1572	c.1521T>A	c.(1519-1521)GAT>GAA	p.D507E	KCNH5_uc001xfy.2_Missense_Mutation_p.D507E|KCNH5_uc001xfz.1_Missense_Mutation_p.D449E	NM_139318	NP_647479	Q8NCM2	KCNH5_HUMAN	potassium voltage-gated channel, subfamily H,	507	Cytoplasmic (Potential).				regulation of transcription, DNA-dependent	integral to membrane	calmodulin binding|two-component sensor activity|voltage-gated potassium channel activity			ovary(4)|skin(4)|central_nervous_system(1)	9				OV - Ovarian serous cystadenocarcinoma(108;0.00958)|BRCA - Breast invasive adenocarcinoma(234;0.168)		AGACAATATAATCCATGACTC	0.378													69	40	---	---	---	---	capture	Missense_Mutation	SNP	63316419	63316419	KCNH5	14	A	T	T	T	1	0	0	0	0	1	0	0	0	50	4	4	4	7957	253
ADAMTS7	11173	broad.mit.edu	37	15	79059849	79059849	+	Missense_Mutation	SNP	C	T	T			TCGA-41-2575-01	TCGA-41-2575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:79059849C>T	uc002bej.3	-	18	2942	c.2731G>A	c.(2731-2733)GTG>ATG	p.V911M	ADAMTS7_uc010und.1_Intron	NM_014272	NP_055087	Q9UKP4	ATS7_HUMAN	ADAM metallopeptidase with thrombospondin type 1	911	TSP type-1 3.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding				0						TCCAGCCCCACGCTGCGGATG	0.706													8	8	---	---	---	---	capture	Missense_Mutation	SNP	79059849	79059849	ADAMTS7	15	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	271	253
ADAMTS17	170691	broad.mit.edu	37	15	100591784	100591784	+	Silent	SNP	G	A	A	rs146325180	by1000genomes	TCGA-41-2575-01	TCGA-41-2575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:100591784G>A	uc002bvv.1	-	17	2527	c.2448C>T	c.(2446-2448)TGC>TGT	p.C816C		NM_139057	NP_620688	Q8TE56	ATS17_HUMAN	ADAM metallopeptidase with thrombospondin type 1	816	TSP type-1 2.				proteolysis	intracellular|proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(2)|central_nervous_system(1)	3	Lung NSC(78;0.00299)|all_lung(78;0.00457)|Melanoma(26;0.00571)		OV - Ovarian serous cystadenocarcinoma(32;0.0013)|LUSC - Lung squamous cell carcinoma(107;0.132)|Lung(145;0.161)	COAD - Colon adenocarcinoma(1;0.111)|all cancers(203;0.219)		CACCTCCGCCGCACTGCACAC	0.567													101	138	---	---	---	---	capture	Silent	SNP	100591784	100591784	ADAMTS17	15	G	A	A	A	1	0	0	0	0	0	0	0	1	490	38	1	1	262	253
IL4R	3566	broad.mit.edu	37	16	27374437	27374437	+	Silent	SNP	G	A	A			TCGA-41-2575-01	TCGA-41-2575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:27374437G>A	uc002don.2	+	11	2006	c.1764G>A	c.(1762-1764)CAG>CAA	p.Q588Q	IL4R_uc002dop.3_Silent_p.Q573Q|IL4R_uc010bxy.2_Silent_p.Q588Q|IL4R_uc002doo.2_Silent_p.Q428Q	NM_000418	NP_000409	P24394	IL4RA_HUMAN	interleukin 4 receptor alpha chain isoform a	588	Required for IL4-induced gene expression.|Cytoplasmic (Potential).				immune response|production of molecular mediator involved in inflammatory response	integral to plasma membrane	identical protein binding|interleukin-4 receptor activity|receptor signaling protein activity			ovary(1)|skin(1)	2						GTGGCACCCAGGCCAGTGCGG	0.637													3	76	---	---	---	---	capture	Silent	SNP	27374437	27374437	IL4R	16	G	A	A	A	1	0	0	0	0	0	0	0	1	451	35	2	2	7621	253
YWHAE	7531	broad.mit.edu	37	17	1303395	1303395	+	Nonsense_Mutation	SNP	G	A	A			TCGA-41-2575-01	TCGA-41-2575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:1303395G>A	uc002fsj.2	-	1	162	c.10C>T	c.(10-12)CGA>TGA	p.R4*	YWHAE_uc002fsk.2_5'UTR|YWHAE_uc010vqh.1_RNA|YWHAE_uc010vqi.1_RNA	NM_006761	NP_006752	P62258	1433E_HUMAN	tyrosine 3/tryptophan 5 -monooxygenase	4					apoptosis|G2/M transition of mitotic cell cycle|induction of apoptosis by extracellular signals|interspecies interaction between organisms|intracellular signal transduction|nerve growth factor receptor signaling pathway	cytosol|melanosome	histone deacetylase binding|phosphoserine binding			lung(2)|ovary(1)	3			OV - Ovarian serous cystadenocarcinoma(18;0.203)	UCEC - Uterine corpus endometrioid carcinoma (25;0.0887)		AGATCCTCTCGATCATCCATA	0.657													33	63	---	---	---	---	capture	Nonsense_Mutation	SNP	1303395	1303395	YWHAE	17	G	A	A	A	1	0	0	0	0	0	1	0	0	480	37	5	1	17383	253
YBX2	51087	broad.mit.edu	37	17	7194458	7194458	+	Missense_Mutation	SNP	A	G	G			TCGA-41-2575-01	TCGA-41-2575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7194458A>G	uc002gfq.2	-	4	470	c.413T>C	c.(412-414)GTT>GCT	p.V138A		NM_015982	NP_057066	Q9Y2T7	YBOX2_HUMAN	Y box binding protein 2	138	CSD.|Required for cytoplasmic retention (By similarity).				regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter|translational attenuation	cytoplasm|nucleus	DNA binding				0						CCCATCTCCAACGCTGCGCAG	0.502													54	68	---	---	---	---	capture	Missense_Mutation	SNP	7194458	7194458	YBX2	17	A	G	G	G	1	0	0	0	0	1	0	0	0	26	2	3	3	17351	253
TP53	7157	broad.mit.edu	37	17	7577609	7577609	+	Splice_Site	SNP	C	G	G			TCGA-41-2575-01	TCGA-41-2575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7577609C>G	uc002gim.2	-	7	867	c.673_splice	c.e7-1	p.V225_splice	TP53_uc002gig.1_Splice_Site_p.V225_splice|TP53_uc002gih.2_Splice_Site_p.V225_splice|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Splice_Site_p.V93_splice|TP53_uc010cng.1_Splice_Site_p.V93_splice|TP53_uc002gii.1_Splice_Site_p.V93_splice|TP53_uc010cnh.1_Splice_Site_p.V225_splice|TP53_uc010cni.1_Splice_Site_p.V225_splice|TP53_uc002gij.2_Splice_Site_p.V225_splice|TP53_uc010cnj.1_Intron|TP53_uc002gin.2_Intron|TP53_uc002gio.2_Intron	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a						activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.?(12)|p.0?(7)|p.V225fs*24(1)|p.E224_V225insXX(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		CAGAGCCAACCTAGGAGATAA	0.488		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			45	33	---	---	---	---	capture	Splice_Site	SNP	7577609	7577609	TP53	17	C	G	G	G	1	0	0	0	0	0	0	1	0	312	24	5	4	16264	253
WDR16	146845	broad.mit.edu	37	17	9546402	9546402	+	Missense_Mutation	SNP	G	T	T			TCGA-41-2575-01	TCGA-41-2575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:9546402G>T	uc002gly.2	+	14	1819	c.1750G>T	c.(1750-1752)GTG>TTG	p.V584L	USP43_uc002gma.3_5'Flank|USP43_uc010cod.2_5'Flank|USP43_uc010vva.1_5'Flank|WDR16_uc002glz.2_Missense_Mutation_p.V516L|WDR16_uc010coc.2_Missense_Mutation_p.V594L	NM_145054	NP_659491	Q8N1V2	WDR16_HUMAN	WD40-repeat protein upregulated in HCC isoform	584						cytoplasm|intracellular membrane-bounded organelle	protein binding			skin(2)|ovary(1)|central_nervous_system(1)	4						TCACGTTGGGGTGGGACACAG	0.443													30	65	---	---	---	---	capture	Missense_Mutation	SNP	9546402	9546402	WDR16	17	G	T	T	T	1	0	0	0	0	1	0	0	0	572	44	4	4	17157	253
BRCA1	672	broad.mit.edu	37	17	41245683	41245683	+	Missense_Mutation	SNP	G	A	A	rs56039126		TCGA-41-2575-01	TCGA-41-2575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:41245683G>A	uc002icq.2	-	10	2097	c.1865C>T	c.(1864-1866)GCG>GTG	p.A622V	BRCA1_uc010whp.1_Intron|BRCA1_uc010whl.1_Intron|BRCA1_uc010whm.1_Intron|BRCA1_uc002icp.3_Missense_Mutation_p.A551V|BRCA1_uc002icu.2_Intron|BRCA1_uc010cyx.2_Missense_Mutation_p.A575V|BRCA1_uc002ict.2_Missense_Mutation_p.A622V|BRCA1_uc010whn.1_Intron|BRCA1_uc010who.1_Intron|BRCA1_uc010whq.1_Intron|BRCA1_uc002idc.1_Intron|BRCA1_uc010whr.1_Intron|BRCA1_uc002idd.2_Missense_Mutation_p.A622V|BRCA1_uc002ide.1_Missense_Mutation_p.A453V|BRCA1_uc010cyy.1_Missense_Mutation_p.A622V|BRCA1_uc010whs.1_Missense_Mutation_p.A622V|BRCA1_uc010cyz.2_Missense_Mutation_p.A575V|BRCA1_uc010cza.2_Missense_Mutation_p.A596V|BRCA1_uc010wht.1_Missense_Mutation_p.A326V	NM_007294	NP_009225	P38398	BRCA1_HUMAN	breast cancer 1, early onset isoform 1	622					androgen receptor signaling pathway|apoptosis|cellular response to indole-3-methanol|chromosome segregation|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|DNA damage response, signal transduction resulting in induction of apoptosis|double-strand break repair via homologous recombination|fatty acid biosynthetic process|G2/M transition DNA damage checkpoint|negative regulation of centriole replication|negative regulation of fatty acid biosynthetic process|negative regulation of histone H3-K9 methylation|negative regulation of transcription, DNA-dependent|positive regulation of cell cycle arrest|positive regulation of DNA repair|positive regulation of histone acetylation|positive regulation of histone H3-K4 methylation|positive regulation of histone H4-K20 methylation|positive regulation of protein ubiquitination|positive regulation of transcription from RNA polymerase II promoter|postreplication repair|protein autoubiquitination|protein K6-linked ubiquitination|regulation of cell motility|regulation of cell proliferation|regulation of transcription from RNA polymerase III promoter|response to estrogen stimulus|response to ionizing radiation|substrate adhesion-dependent cell spreading	BRCA1-A complex|BRCA1-BARD1 complex|gamma-tubulin ring complex|nucleoplasm|plasma membrane|ribonucleoprotein complex|ruffle	androgen receptor binding|identical protein binding|protein binding|RNA binding|transcription coactivator activity|transcription regulatory region DNA binding|tubulin binding|ubiquitin protein ligase binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(24)|breast(21)|lung(4)|central_nervous_system(1)|endometrium(1)|urinary_tract(1)	52		Breast(137;0.000717)		BRCA - Breast invasive adenocarcinoma(366;0.126)		TAGTTCAAGCGCATGAATATG	0.358			D|Mis|N|F|S		ovarian	breast|ovarian		Homologous_recombination	Hereditary_Breast-Ovarian_Cancer_BRCA1_type	TCGA Ovarian(2;0.000030)			5	247	---	---	---	---	capture	Missense_Mutation	SNP	41245683	41245683	BRCA1	17	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	1486	253
CSH2	1443	broad.mit.edu	37	17	61950623	61950623	+	Silent	SNP	G	A	A			TCGA-41-2575-01	TCGA-41-2575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:61950623G>A	uc002jch.2	-	2	202	c.87C>T	c.(85-87)ACC>ACT	p.T29T	CSH2_uc002jcg.2_Silent_p.T29T|CSH2_uc002jci.2_Silent_p.T29T|GH2_uc002jcj.2_Intron|CSH2_uc002jck.2_Silent_p.T29T	NM_020991	NP_066271	P01243	CSH_HUMAN	chorionic somatomammotropin hormone 2 isoform 1	29					female pregnancy|signal transduction	extracellular region	hormone activity|metal ion binding				0						ATAACGGAACGGTTTGGACGG	0.597													34	120	---	---	---	---	capture	Silent	SNP	61950623	61950623	CSH2	17	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	3906	253
BPTF	2186	broad.mit.edu	37	17	65888098	65888098	+	Missense_Mutation	SNP	A	T	T			TCGA-41-2575-01	TCGA-41-2575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:65888098A>T	uc002jgf.2	+	5	2064	c.2003A>T	c.(2002-2004)CAG>CTG	p.Q668L	BPTF_uc002jge.2_Missense_Mutation_p.Q794L|BPTF_uc010wqm.1_Missense_Mutation_p.Q731L	NM_182641	NP_872579	Q12830	BPTF_HUMAN	bromodomain PHD finger transcription factor	794					brain development|chromatin remodeling|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|NURF complex	sequence-specific DNA binding|transcription factor binding|zinc ion binding			ovary(2)|skin(2)	4	all_cancers(12;6e-11)		BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|Colorectal(3;0.0984)|LUSC - Lung squamous cell carcinoma(166;0.24)			AAGAGCCAGCAGGTGGCAGCC	0.433													28	26	---	---	---	---	capture	Missense_Mutation	SNP	65888098	65888098	BPTF	17	A	T	T	T	1	0	0	0	0	1	0	0	0	91	7	4	4	1483	253
ABCA6	23460	broad.mit.edu	37	17	67077247	67077247	+	Silent	SNP	G	A	A			TCGA-41-2575-01	TCGA-41-2575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:67077247G>A	uc002jhw.1	-	37	4831	c.4656C>T	c.(4654-4656)GAC>GAT	p.D1552D		NM_080284	NP_525023	Q8N139	ABCA6_HUMAN	ATP-binding cassette, sub-family A, member 6	1552					transport	integral to membrane	ATP binding|ATPase activity			upper_aerodigestive_tract(2)|large_intestine(2)|ovary(2)|skin(1)	7	Breast(10;5.65e-12)					GAGGGTAAACGTCTGCCACGG	0.373													92	127	---	---	---	---	capture	Silent	SNP	67077247	67077247	ABCA6	17	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	36	253
SERPINB3	6317	broad.mit.edu	37	18	61323102	61323102	+	Missense_Mutation	SNP	C	T	T	rs140650845	by1000genomes	TCGA-41-2575-01	TCGA-41-2575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:61323102C>T	uc002lji.2	-	8	1106	c.962G>A	c.(961-963)CGC>CAC	p.R321H	SERPINB4_uc002ljg.2_Intron|SERPINB3_uc010dqa.2_Missense_Mutation_p.R269H	NM_006919	NP_008850	P29508	SPB3_HUMAN	serine (or cysteine) proteinase inhibitor, clade	321					regulation of proteolysis	cytoplasm|extracellular region	protein binding|serine-type endopeptidase inhibitor activity			ovary(1)|central_nervous_system(1)|skin(1)	3						CACGAGACCGCGGCTCCCGGT	0.542													137	98	---	---	---	---	capture	Missense_Mutation	SNP	61323102	61323102	SERPINB3	18	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	13995	253
VAV1	7409	broad.mit.edu	37	19	6828653	6828653	+	Silent	SNP	C	T	T			TCGA-41-2575-01	TCGA-41-2575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:6828653C>T	uc002mfu.1	+	12	1210	c.1113C>T	c.(1111-1113)AAC>AAT	p.N371N	VAV1_uc010xjh.1_Silent_p.N339N|VAV1_uc010dva.1_Silent_p.N371N|VAV1_uc002mfv.1_Silent_p.N316N	NM_005428	NP_005419	P15498	VAV_HUMAN	vav 1 guanine nucleotide exchange factor	371	DH.				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|platelet activation|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|T cell costimulation	cytosol|plasma membrane	metal ion binding|protein binding|sequence-specific DNA binding transcription factor activity			lung(4)|ovary(4)|breast(3)|central_nervous_system(2)|kidney(2)|skin(1)	16						AGTGCGTGAACGAGGTCAAGC	0.637													134	209	---	---	---	---	capture	Silent	SNP	6828653	6828653	VAV1	19	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	17013	253
TMEM205	374882	broad.mit.edu	37	19	11453778	11453778	+	Missense_Mutation	SNP	T	G	G			TCGA-41-2575-01	TCGA-41-2575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:11453778T>G	uc002mrb.2	-	4	471	c.283A>C	c.(283-285)AGC>CGC	p.S95R	TMEM205_uc002mra.2_Missense_Mutation_p.S95R|TMEM205_uc002mqz.2_Missense_Mutation_p.S95R|TMEM205_uc002mrc.2_Missense_Mutation_p.S95R	NM_001145416	NP_001138888	Q6UW68	TM205_HUMAN	transmembrane protein 205	95	Helical; (Potential).					integral to membrane					0						AGCGTAAGGCTCAGGAACAGC	0.642													29	45	---	---	---	---	capture	Missense_Mutation	SNP	11453778	11453778	TMEM205	19	T	G	G	G	1	0	0	0	0	1	0	0	0	702	54	4	4	16013	253
MLL4	9757	broad.mit.edu	37	19	36210728	36210728	+	Missense_Mutation	SNP	C	A	A			TCGA-41-2575-01	TCGA-41-2575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:36210728C>A	uc010eei.2	+	3	479	c.479C>A	c.(478-480)CCC>CAC	p.P160H		NM_014727	NP_055542	Q9UMN6	MLL4_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 4	160					chromatin-mediated maintenance of transcription		DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			central_nervous_system(6)|breast(2)|ovary(1)|kidney(1)|skin(1)	11	all_lung(56;3.33e-07)|Lung NSC(56;5.02e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			AAGACGACCCCCCTTCCTCCT	0.612													96	148	---	---	---	---	capture	Missense_Mutation	SNP	36210728	36210728	MLL4	19	C	A	A	A	1	0	0	0	0	1	0	0	0	286	22	4	4	9535	253
LILRA4	23547	broad.mit.edu	37	19	54848149	54848149	+	Silent	SNP	C	G	G			TCGA-41-2575-01	TCGA-41-2575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:54848149C>G	uc002qfj.2	-	6	1275	c.1218G>C	c.(1216-1218)CTG>CTC	p.L406L	LILRA4_uc002qfi.2_Silent_p.L340L	NM_012276	NP_036408	P59901	LIRA4_HUMAN	leukocyte immunoglobulin-like receptor subfamily	406	Ig-like C2-type 4.|Extracellular (Potential).					integral to membrane	receptor activity			upper_aerodigestive_tract(1)|central_nervous_system(1)	2	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.0565)		TGGGGTGAGACAGCAGGTAGG	0.592													42	28	---	---	---	---	capture	Silent	SNP	54848149	54848149	LILRA4	19	C	G	G	G	1	0	0	0	0	0	0	0	1	210	17	4	4	8707	253
ZIM3	114026	broad.mit.edu	37	19	57646590	57646590	+	Missense_Mutation	SNP	A	T	T			TCGA-41-2575-01	TCGA-41-2575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:57646590A>T	uc002qnz.1	-	5	1501	c.1115T>A	c.(1114-1116)TTT>TAT	p.F372Y		NM_052882	NP_443114	Q96PE6	ZIM3_HUMAN	zinc finger, imprinted 3	372	C2H2-type 8.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			pancreas(1)|skin(1)	2		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.243)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		CTTCTGGATAAAGGTATTTCC	0.378													98	54	---	---	---	---	capture	Missense_Mutation	SNP	57646590	57646590	ZIM3	19	A	T	T	T	1	0	0	0	0	1	0	0	0	13	1	4	4	17565	253
ASXL2	55252	broad.mit.edu	37	2	25966927	25966927	+	Missense_Mutation	SNP	G	T	T			TCGA-41-2575-01	TCGA-41-2575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:25966927G>T	uc002rgs.2	-	12	2500	c.2279C>A	c.(2278-2280)CCA>CAA	p.P760Q	ASXL2_uc002rgt.1_Missense_Mutation_p.P500Q	NM_018263	NP_060733	Q76L83	ASXL2_HUMAN	additional sex combs like 2	760					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding|protein binding			pancreas(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TGCCTGGCTTGGGGTGGTCTT	0.587													6	144	---	---	---	---	capture	Missense_Mutation	SNP	25966927	25966927	ASXL2	2	G	T	T	T	1	0	0	0	0	1	0	0	0	611	47	4	4	1058	253
TMEM214	54867	broad.mit.edu	37	2	27263616	27263616	+	Missense_Mutation	SNP	A	T	T			TCGA-41-2575-01	TCGA-41-2575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:27263616A>T	uc002ria.3	+	17	2091	c.1981A>T	c.(1981-1983)AGT>TGT	p.S661C	TMEM214_uc010yle.1_RNA|TMEM214_uc002rib.3_Missense_Mutation_p.S616C	NM_017727	NP_060197	Q6NUQ4	TM214_HUMAN	transmembrane protein 214 isoform 1	661						integral to membrane	protein binding				0						GACACAGCTCAGTGAGGCTGT	0.532													38	75	---	---	---	---	capture	Missense_Mutation	SNP	27263616	27263616	TMEM214	2	A	T	T	T	1	0	0	0	0	1	0	0	0	91	7	4	4	16020	253
THSD7B	80731	broad.mit.edu	37	2	138421119	138421119	+	Missense_Mutation	SNP	G	T	T			TCGA-41-2575-01	TCGA-41-2575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:138421119G>T	uc002tva.1	+	25	4538	c.4538G>T	c.(4537-4539)GGA>GTA	p.G1513V	THSD7B_uc010zbj.1_RNA	NM_001080427	NP_001073896			thrombospondin, type I, domain containing 7B											ovary(4)|central_nervous_system(2)|pancreas(1)	7				BRCA - Breast invasive adenocarcinoma(221;0.19)		ATTTTTAAAGGATGGTCTCTT	0.368													8	9	---	---	---	---	capture	Missense_Mutation	SNP	138421119	138421119	THSD7B	2	G	T	T	T	1	0	0	0	0	1	0	0	0	533	41	4	4	15765	253
SCN3A	6328	broad.mit.edu	37	2	165996030	165996030	+	Missense_Mutation	SNP	T	C	C			TCGA-41-2575-01	TCGA-41-2575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:165996030T>C	uc002ucx.2	-	14	2600	c.2108A>G	c.(2107-2109)CAA>CGA	p.Q703R	SCN3A_uc002ucy.2_Missense_Mutation_p.Q654R|SCN3A_uc002ucz.2_Missense_Mutation_p.Q654R|SCN3A_uc002uda.1_Missense_Mutation_p.Q523R|SCN3A_uc002udb.1_Missense_Mutation_p.Q523R	NM_006922	NP_008853	Q9NY46	SCN3A_HUMAN	sodium channel, voltage-gated, type III, alpha	703						voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(4)|breast(3)|skin(2)|central_nervous_system(1)	10					Lamotrigine(DB00555)	CACGGCTCTTTGCCTTCCAGA	0.463													45	64	---	---	---	---	capture	Missense_Mutation	SNP	165996030	165996030	SCN3A	2	T	C	C	C	1	0	0	0	0	1	0	0	0	819	63	3	3	13811	253
TTN	7273	broad.mit.edu	37	2	179610349	179610349	+	Missense_Mutation	SNP	C	A	A			TCGA-41-2575-01	TCGA-41-2575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179610349C>A	uc002unb.2	-	46	17002	c.16778G>T	c.(16777-16779)GGA>GTA	p.G5593V	TTN_uc010zfg.1_Intron|TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Intron	NM_133379	NP_596870	Q8WZ42	TITIN_HUMAN	titin isoform novex-3	9063							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTCAGCCATTCCTGATTTGTT	0.378													53	79	---	---	---	---	capture	Missense_Mutation	SNP	179610349	179610349	TTN	2	C	A	A	A	1	0	0	0	0	1	0	0	0	390	30	4	4	16617	253
DNAJC10	54431	broad.mit.edu	37	2	183597246	183597246	+	Nonsense_Mutation	SNP	C	T	T			TCGA-41-2575-01	TCGA-41-2575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:183597246C>T	uc002uow.1	+	10	1241	c.826C>T	c.(826-828)CGA>TGA	p.R276*	DNAJC10_uc002uox.1_RNA|DNAJC10_uc002uoy.1_RNA|DNAJC10_uc002uoz.1_Nonsense_Mutation_p.R276*|DNAJC10_uc010fro.1_Intron	NM_018981	NP_061854	Q8IXB1	DJC10_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 10	276					apoptosis in response to endoplasmic reticulum stress|cell redox homeostasis|ER-associated protein catabolic process|glycerol ether metabolic process|negative regulation of protein phosphorylation|protein folding|response to endoplasmic reticulum stress	endoplasmic reticulum chaperone complex|endoplasmic reticulum lumen|extracellular region	ATPase activator activity|ATPase binding|chaperone binding|electron carrier activity|heat shock protein binding|misfolded protein binding|protein disulfide oxidoreductase activity|unfolded protein binding			ovary(1)|large_intestine(1)|breast(1)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.0942)|Epithelial(96;0.209)			TTCACAGACACGACTCAGGCT	0.348													81	120	---	---	---	---	capture	Nonsense_Mutation	SNP	183597246	183597246	DNAJC10	2	C	T	T	T	1	0	0	0	0	0	1	0	0	243	19	5	1	4585	253
MOBKL3	25843	broad.mit.edu	37	2	198415097	198415097	+	Missense_Mutation	SNP	T	C	C			TCGA-41-2575-01	TCGA-41-2575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:198415097T>C	uc002uun.3	+	7	573	c.533T>C	c.(532-534)TTT>TCT	p.F178S	MOBKL3_uc002uum.3_Missense_Mutation_p.F146S|MOBKL3_uc010fsn.2_Missense_Mutation_p.F157S|MOBKL3_uc010fso.2_Missense_Mutation_p.F79S|MOBKL3_uc010zgz.1_Missense_Mutation_p.F79S	NM_015387	NP_056202	Q9Y3A3	MOBL3_HUMAN	Mps One Binder kinase activator-like 3 isoform	178					transport	Golgi cisterna membrane|perinuclear region of cytoplasm	metal ion binding|protein binding				0			Epithelial(96;0.225)			CGGCAGATATTTGATGAATAT	0.313													33	42	---	---	---	---	capture	Missense_Mutation	SNP	198415097	198415097	MOBKL3	2	T	C	C	C	1	0	0	0	0	1	0	0	0	832	64	3	3	9599	253
PLCL1	5334	broad.mit.edu	37	2	198950332	198950332	+	Silent	SNP	G	A	A	rs147854527	by1000genomes	TCGA-41-2575-01	TCGA-41-2575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:198950332G>A	uc010fsp.2	+	2	2382	c.2091G>A	c.(2089-2091)CCG>CCA	p.P697P	PLCL1_uc002uuv.3_Silent_p.P618P	NM_001114661	NP_001108133	Q15111	PLCL1_HUMAN	RecName: Full=Inactive phospholipase C-like protein 1;          Short=PLC-L1; AltName: Full=Phospholipase C-deleted in lung carcinoma; AltName: Full=Phospholipase C-related but catalytically inactive protein;          Short=PRIP;	697	PI-PLC Y-box.				intracellular signal transduction|lipid metabolic process	cytoplasm	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity			ovary(1)|skin(1)	2					Quinacrine(DB01103)	TTCTAAGGCCGTCTATAATGC	0.458													118	170	---	---	---	---	capture	Silent	SNP	198950332	198950332	PLCL1	2	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	11942	253
ZDBF2	57683	broad.mit.edu	37	2	207174816	207174816	+	Missense_Mutation	SNP	T	G	G			TCGA-41-2575-01	TCGA-41-2575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:207174816T>G	uc002vbp.2	+	5	5814	c.5564T>G	c.(5563-5565)TTC>TGC	p.F1855C		NM_020923	NP_065974	Q9HCK1	ZDBF2_HUMAN	zinc finger, DBF-type containing 2	1855							nucleic acid binding|zinc ion binding			ovary(3)	3						GAAGGTCGTTTCCACTGTTAC	0.418													37	33	---	---	---	---	capture	Missense_Mutation	SNP	207174816	207174816	ZDBF2	2	T	G	G	G	1	0	0	0	0	1	0	0	0	806	62	4	4	17479	253
SEMG1	6406	broad.mit.edu	37	20	43836974	43836974	+	Missense_Mutation	SNP	A	G	G			TCGA-41-2575-01	TCGA-41-2575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:43836974A>G	uc002xni.2	+	2	1093	c.1036A>G	c.(1036-1038)ATA>GTA	p.I346V	SEMG1_uc002xnj.2_Missense_Mutation_p.I286V|SEMG2_uc010ggz.2_Intron|SEMG1_uc002xnh.2_Intron	NM_003007	NP_002998	P04279	SEMG1_HUMAN	semenogelin I preproprotein	346	58 AA repeat 2.				insemination|sexual reproduction	extracellular space|stored secretory granule	structural molecule activity			skin(2)	2		Myeloproliferative disorder(115;0.0122)				GGCAAATAAAATATCATACCA	0.393													4	61	---	---	---	---	capture	Missense_Mutation	SNP	43836974	43836974	SEMG1	20	A	G	G	G	1	0	0	0	0	1	0	0	0	52	4	3	3	13937	253
UBASH3A	53347	broad.mit.edu	37	21	43846877	43846877	+	Missense_Mutation	SNP	G	A	A			TCGA-41-2575-01	TCGA-41-2575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:43846877G>A	uc002zbe.2	+	8	1154	c.1118G>A	c.(1117-1119)GGG>GAG	p.G373E	UBASH3A_uc002zbf.2_Missense_Mutation_p.G335E|UBASH3A_uc010gpc.2_RNA|UBASH3A_uc010gpd.2_RNA|UBASH3A_uc010gpe.2_Missense_Mutation_p.G335E	NM_018961	NP_061834	P57075	UBS3A_HUMAN	ubiquitin associated and SH3 domain containing,	373						cytosol|nucleus				ovary(3)	3						AGATGCAGCGGGGAATTTCTT	0.473													61	113	---	---	---	---	capture	Missense_Mutation	SNP	43846877	43846877	UBASH3A	21	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	16721	253
GRAP2	9402	broad.mit.edu	37	22	40364194	40364194	+	Missense_Mutation	SNP	A	C	C			TCGA-41-2575-01	TCGA-41-2575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:40364194A>C	uc003ayh.1	+	6	871	c.608A>C	c.(607-609)CAG>CCG	p.Q203P	GRAP2_uc003ayi.2_RNA|GRAP2_uc011aom.1_Missense_Mutation_p.Q177P|GRAP2_uc011aon.1_Missense_Mutation_p.Q137P|GRAP2_uc010gya.1_Missense_Mutation_p.Q203P|GRAP2_uc011aoo.1_Missense_Mutation_p.Q131P|GRAP2_uc011aop.1_Missense_Mutation_p.Q163P|GRAP2_uc011aoq.1_Missense_Mutation_p.Q90P|GRAP2_uc003ayj.1_Missense_Mutation_p.Q203P	NM_004810	NP_004801	O75791	GRAP2_HUMAN	GRB2-related adaptor protein 2	203					cell-cell signaling|Ras protein signal transduction|T cell costimulation|T cell receptor signaling pathway	cytosol	SH3/SH2 adaptor activity			upper_aerodigestive_tract(1)|central_nervous_system(1)	2						caccagccacagcctccgcaa	0.299													2	11	---	---	---	---	capture	Missense_Mutation	SNP	40364194	40364194	GRAP2	22	A	C	C	C	1	0	0	0	0	1	0	0	0	91	7	4	4	6687	253
FBLN2	2199	broad.mit.edu	37	3	13679178	13679178	+	Missense_Mutation	SNP	G	A	A			TCGA-41-2575-01	TCGA-41-2575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:13679178G>A	uc011avb.1	+	17	3439	c.3314G>A	c.(3313-3315)CGC>CAC	p.R1105H	FBLN2_uc011auz.1_Missense_Mutation_p.R1131H|FBLN2_uc011ava.1_Missense_Mutation_p.R1152H|FBLN2_uc011avc.1_Missense_Mutation_p.R1152H	NM_001998	NP_001989	P98095	FBLN2_HUMAN	fibulin 2 isoform b precursor	1105	Domain III.					proteinaceous extracellular matrix	calcium ion binding|extracellular matrix structural constituent			ovary(1)	1			UCEC - Uterine corpus endometrioid carcinoma (1;0.00416)			CATATCTTCCGCATTGGCCCC	0.617													21	21	---	---	---	---	capture	Missense_Mutation	SNP	13679178	13679178	FBLN2	3	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	5645	253
CASR	846	broad.mit.edu	37	3	121981197	121981197	+	Missense_Mutation	SNP	C	A	A			TCGA-41-2575-01	TCGA-41-2575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:121981197C>A	uc003eev.3	+	4	1687	c.1315C>A	c.(1315-1317)CCT>ACT	p.P439T	CASR_uc003eew.3_Missense_Mutation_p.P439T	NM_000388	NP_000379	P41180	CASR_HUMAN	calcium-sensing receptor precursor	439	Extracellular (Potential).				anatomical structure morphogenesis|calcium ion import|cellular calcium ion homeostasis|chemosensory behavior|detection of calcium ion|ossification	integral to plasma membrane	G-protein coupled receptor activity|phosphatidylinositol phospholipase C activity			ovary(4)|skin(2)|upper_aerodigestive_tract(1)	7				GBM - Glioblastoma multiforme(114;0.226)	Cinacalcet(DB01012)	TACCTGCTTACCTGGGAGAGG	0.453													71	100	---	---	---	---	capture	Missense_Mutation	SNP	121981197	121981197	CASR	3	C	A	A	A	1	0	0	0	0	1	0	0	0	234	18	4	4	2658	253
FETUB	26998	broad.mit.edu	37	3	186362631	186362631	+	Silent	SNP	C	T	T			TCGA-41-2575-01	TCGA-41-2575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:186362631C>T	uc010hyq.2	+	5	777	c.516C>T	c.(514-516)ACC>ACT	p.T172T	FETUB_uc011brz.1_Silent_p.T24T|FETUB_uc003fqn.2_Silent_p.T172T|FETUB_uc003fqo.2_Silent_p.T67T|FETUB_uc010hyr.2_Silent_p.T135T|FETUB_uc010hys.2_Silent_p.T24T|FETUB_uc003fqp.3_Silent_p.T107T	NM_014375	NP_055190	Q9UGM5	FETUB_HUMAN	fetuin B precursor	172	Cystatin fetuin-B-type 2.					extracellular space	cysteine-type endopeptidase inhibitor activity			ovary(1)|lung(1)	2	all_cancers(143;6.64e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;5.73e-20)	GBM - Glioblastoma multiforme(93;0.0479)		AGGCTGCCACCGAGTCTCTTG	0.473													49	180	---	---	---	---	capture	Silent	SNP	186362631	186362631	FETUB	3	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	5767	253
RAB28	9364	broad.mit.edu	37	4	13383174	13383174	+	Missense_Mutation	SNP	G	C	C	rs139395840	byFrequency	TCGA-41-2575-01	TCGA-41-2575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:13383174G>C	uc003gmu.2	-	5	651	c.436C>G	c.(436-438)CGG>GGG	p.R146G	RAB28_uc003gmt.2_Missense_Mutation_p.R146G|RAB28_uc011bwz.1_Missense_Mutation_p.R146G|RAB28_uc003gmv.2_RNA	NM_001017979	NP_001017979	P51157	RAB28_HUMAN	RAB28, member RAS oncogene family isoform 1	146					small GTPase mediated signal transduction	plasma membrane	GDP binding|GTP binding|GTPase activity	p.R146W(1)		ovary(1)|skin(1)	2						TGGCAAAACCGTAAGTGTTTT	0.328													3	148	---	---	---	---	capture	Missense_Mutation	SNP	13383174	13383174	RAB28	4	G	C	C	C	1	0	0	0	0	1	0	0	0	519	40	4	4	12811	253
NCAPG	64151	broad.mit.edu	37	4	17819684	17819684	+	Missense_Mutation	SNP	C	T	T			TCGA-41-2575-01	TCGA-41-2575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:17819684C>T	uc003gpp.2	+	7	1267	c.1091C>T	c.(1090-1092)CCT>CTT	p.P364L	NCAPG_uc011bxj.1_5'UTR	NM_022346	NP_071741	Q9BPX3	CND3_HUMAN	chromosome condensation protein G	364					cell division|mitotic chromosome condensation	condensin complex|cytoplasm|nucleus	protein binding			large_intestine(1)	1				STAD - Stomach adenocarcinoma(129;0.18)		TTGCCAGAGCCTGTAGTATAT	0.368													54	265	---	---	---	---	capture	Missense_Mutation	SNP	17819684	17819684	NCAPG	4	C	T	T	T	1	0	0	0	0	1	0	0	0	312	24	2	2	10114	253
UGT2B10	7365	broad.mit.edu	37	4	69870669	69870669	+	Missense_Mutation	SNP	C	A	A			TCGA-41-2575-01	TCGA-41-2575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:69870669C>A	uc011cao.1	-	9	1517	c.1381G>T	c.(1381-1383)GCT>TCT	p.A461S	UGT2B10_uc011can.1_Missense_Mutation_p.A377S			P36537	UDB10_HUMAN	RecName: Full=UDP-glucuronosyltransferase 2B28;          Short=UDPGT 2B28;          EC=2.4.1.17; Flags: Precursor;	498	Helical; (Potential).				lipid metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity			skin(3)|ovary(2)	5						GCCACACAGGCCAGCAGGAAC	0.448													11	201	---	---	---	---	capture	Missense_Mutation	SNP	69870669	69870669	UGT2B10	4	C	A	A	A	1	0	0	0	0	1	0	0	0	338	26	4	4	16838	253
ENAM	10117	broad.mit.edu	37	4	71508380	71508380	+	Missense_Mutation	SNP	G	T	T			TCGA-41-2575-01	TCGA-41-2575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:71508380G>T	uc011caw.1	+	9	1518	c.1237G>T	c.(1237-1239)GTA>TTA	p.V413L		NM_031889	NP_114095	Q9NRM1	ENAM_HUMAN	enamelin precursor	413					bone mineralization|odontogenesis	proteinaceous extracellular matrix	structural constituent of tooth enamel			ovary(3)	3			Lung(101;0.235)			TAAACACCCTGTAGGAACTAC	0.468													7	210	---	---	---	---	capture	Missense_Mutation	SNP	71508380	71508380	ENAM	4	G	T	T	T	1	0	0	0	0	1	0	0	0	624	48	4	4	5067	253
HEATR7B2	133558	broad.mit.edu	37	5	41009468	41009468	+	Missense_Mutation	SNP	C	G	G			TCGA-41-2575-01	TCGA-41-2575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:41009468C>G	uc003jmj.3	-	32	3824	c.3334G>C	c.(3334-3336)GCC>CCC	p.A1112P	HEATR7B2_uc003jmi.3_Missense_Mutation_p.A667P	NM_173489	NP_775760	Q7Z745	HTRB2_HUMAN	HEAT repeat family member 7B2	1112	HEAT 12.						binding			ovary(6)|central_nervous_system(2)	8						CCACTGGAGGCTGGCTTTTCA	0.498													60	63	---	---	---	---	capture	Missense_Mutation	SNP	41009468	41009468	HEATR7B2	5	C	G	G	G	1	0	0	0	0	1	0	0	0	364	28	4	4	6961	253
PCDHGA3	56112	broad.mit.edu	37	5	140724302	140724302	+	Missense_Mutation	SNP	T	G	G			TCGA-41-2575-01	TCGA-41-2575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140724302T>G	uc003ljm.1	+	1	702	c.702T>G	c.(700-702)GAT>GAG	p.D234E	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc010jfx.1_5'UTR|PCDHGA3_uc011dap.1_Missense_Mutation_p.D234E	NM_018916	NP_061739	Q9Y5H0	PCDG3_HUMAN	protocadherin gamma subfamily A, 3 isoform 1	234	Extracellular (Potential).|Cadherin 2.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TAGTCCTGGATGCAAATGACA	0.527													40	49	---	---	---	---	capture	Missense_Mutation	SNP	140724302	140724302	PCDHGA3	5	T	G	G	G	1	0	0	0	0	1	0	0	0	660	51	4	4	11458	253
PCDHGB4	8641	broad.mit.edu	37	5	140768648	140768648	+	Silent	SNP	G	A	A			TCGA-41-2575-01	TCGA-41-2575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140768648G>A	uc003lkc.1	+	1	1197	c.1197G>A	c.(1195-1197)ACG>ACA	p.T399T	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc011dav.1_Silent_p.T399T	NM_003736	NP_003727	Q9UN71	PCDGG_HUMAN	protocadherin gamma subfamily B, 4 isoform 1	399	Cadherin 4.|Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CAAGAAACACGTATAAATTAG	0.433													4	192	---	---	---	---	capture	Silent	SNP	140768648	140768648	PCDHGB4	5	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	11468	253
RNF130	55819	broad.mit.edu	37	5	179390508	179390508	+	Missense_Mutation	SNP	T	G	G			TCGA-41-2575-01	TCGA-41-2575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:179390508T>G	uc003mll.1	-	8	1614	c.1207A>C	c.(1207-1209)ATG>CTG	p.M403L	RNF130_uc003mlm.1_Intron	NM_018434	NP_060904	Q86XS8	GOLI_HUMAN	ring finger protein 130 precursor	403	Cytoplasmic (Potential).				apoptosis	cytoplasm|integral to membrane|nucleus	ubiquitin-protein ligase activity|zinc ion binding			lung(2)|ovary(1)	3	all_cancers(89;5.49e-05)|all_epithelial(37;1.94e-05)|Renal(175;0.000159)|Lung NSC(126;0.00118)|all_lung(126;0.00212)	all_cancers(40;0.0294)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CTGATGATCATGTAGCAGAGT	0.443													27	27	---	---	---	---	capture	Missense_Mutation	SNP	179390508	179390508	RNF130	5	T	G	G	G	1	0	0	0	0	1	0	0	0	663	51	4	4	13330	253
TRIM7	81786	broad.mit.edu	37	5	180625194	180625194	+	Missense_Mutation	SNP	T	A	A			TCGA-41-2575-01	TCGA-41-2575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:180625194T>A	uc003mmz.1	-	6	1080	c.1013A>T	c.(1012-1014)AAA>ATA	p.K338I	TRIM7_uc003mmv.1_Missense_Mutation_p.K156I|TRIM7_uc003mmw.1_Missense_Mutation_p.K130I|TRIM7_uc003mmx.1_Missense_Mutation_p.K130I|TRIM7_uc003mmy.1_Missense_Mutation_p.K130I	NM_203293	NP_976038	Q9C029	TRIM7_HUMAN	tripartite motif-containing 7 isoform 1	338	B30.2/SPRY.					cytoplasm|nucleus	zinc ion binding			ovary(2)|skin(1)	3	all_cancers(89;6.03e-06)|all_epithelial(37;7.1e-07)|Renal(175;0.000159)|Lung NSC(126;0.00354)|all_lung(126;0.00609)|Breast(19;0.0684)	all_cancers(40;0.000172)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_lung(500;0.0221)|all_hematologic(541;0.0433)|Lung NSC(249;0.132)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;2e-06)|Epithelial(171;1.35e-05)|OV - Ovarian serous cystadenocarcinoma(192;0.000128)|Kidney(146;0.0674)|GBM - Glioblastoma multiforme(465;0.0802)		TTTCTCCTCTTTCTCCAGCTC	0.517													5	30	---	---	---	---	capture	Missense_Mutation	SNP	180625194	180625194	TRIM7	5	T	A	A	A	1	0	0	0	0	1	0	0	0	832	64	4	4	16426	253
LY6G6C	80740	broad.mit.edu	37	6	31687971	31687971	+	Missense_Mutation	SNP	C	A	A			TCGA-41-2575-01	TCGA-41-2575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:31687971C>A	uc003nwh.2	-	2	116	c.62G>T	c.(61-63)CGC>CTC	p.R21L	LY6G6C_uc010jtd.2_RNA	NM_025261	NP_079537	O95867	LY66C_HUMAN	lymphocyte antigen 6 complex G6C precursor	21	UPAR/Ly6.					anchored to membrane|plasma membrane					0						GGAGTGACAGCGAATGTCAGC	0.592													4	115	---	---	---	---	capture	Missense_Mutation	SNP	31687971	31687971	LY6G6C	6	C	A	A	A	1	0	0	0	0	1	0	0	0	351	27	4	4	9009	253
DNAH8	1769	broad.mit.edu	37	6	38805720	38805720	+	Silent	SNP	C	A	A			TCGA-41-2575-01	TCGA-41-2575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:38805720C>A	uc003ooe.1	+	31	4317	c.3717C>A	c.(3715-3717)GCC>GCA	p.A1239A		NM_001371	NP_001362			dynein, axonemal, heavy polypeptide 8											skin(8)|ovary(7)|lung(2)|large_intestine(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	21						TGTTACAGGCCAGTTTCGATG	0.264													30	54	---	---	---	---	capture	Silent	SNP	38805720	38805720	DNAH8	6	C	A	A	A	1	0	0	0	0	0	0	0	1	262	21	4	4	4563	253
TAAR1	134864	broad.mit.edu	37	6	132966395	132966395	+	Missense_Mutation	SNP	C	G	G			TCGA-41-2575-01	TCGA-41-2575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:132966395C>G	uc003qdm.1	-	1	748	c.748G>C	c.(748-750)GTG>CTG	p.V250L		NM_138327	NP_612200	Q96RJ0	TAAR1_HUMAN	trace amine associated receptor 1	250	Cytoplasmic (Potential).					plasma membrane					0	Breast(56;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00616)|GBM - Glioblastoma multiforme(226;0.0154)	Amphetamine(DB00182)	AATGTCTTCACAGCTTTCCTT	0.393													4	129	---	---	---	---	capture	Missense_Mutation	SNP	132966395	132966395	TAAR1	6	C	G	G	G	1	0	0	0	0	1	0	0	0	221	17	4	4	15377	253
C6orf211	79624	broad.mit.edu	37	6	151789913	151789913	+	Missense_Mutation	SNP	A	C	C			TCGA-41-2575-01	TCGA-41-2575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:151789913A>C	uc003qok.1	+	5	1253	c.994A>C	c.(994-996)AAT>CAT	p.N332H	C6orf211_uc011ees.1_Missense_Mutation_p.N213H	NM_024573	NP_078849	Q9H993	CF211_HUMAN	hypothetical protein LOC79624	332							protein binding				0			BRCA - Breast invasive adenocarcinoma(37;0.183)	OV - Ovarian serous cystadenocarcinoma(155;5.27e-11)		GGTTTACCACAATCATATATT	0.383													7	157	---	---	---	---	capture	Missense_Mutation	SNP	151789913	151789913	C6orf211	6	A	C	C	C	1	0	0	0	0	1	0	0	0	65	5	4	4	2331	253
MRPL32	64983	broad.mit.edu	37	7	42977023	42977023	+	Nonsense_Mutation	SNP	C	T	T			TCGA-41-2575-01	TCGA-41-2575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:42977023C>T	uc003tia.2	+	3	462	c.415C>T	c.(415-417)CGA>TGA	p.R139*	MRPL32_uc003tib.2_RNA|MRPL32_uc003tic.2_Nonsense_Mutation_p.R86*	NM_031903	NP_114109	Q9BYC8	RM32_HUMAN	mitochondrial ribosomal protein L32 precursor	139					translation	large ribosomal subunit|mitochondrial ribosome	structural constituent of ribosome				0						AGAAATCAGACGACAGATAGG	0.493													55	159	---	---	---	---	capture	Nonsense_Mutation	SNP	42977023	42977023	MRPL32	7	C	T	T	T	1	0	0	0	0	0	1	0	0	243	19	5	1	9705	253
MYO1G	64005	broad.mit.edu	37	7	45016575	45016575	+	Missense_Mutation	SNP	G	C	C			TCGA-41-2575-01	TCGA-41-2575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:45016575G>C	uc003tmh.2	-	2	335	c.191C>G	c.(190-192)GCC>GGC	p.A64G	MYO1G_uc003tmg.2_5'Flank|MYO1G_uc010kym.2_Intron|MYO1G_uc003tmi.1_5'UTR|MYO1G_uc003tmj.2_5'UTR	NM_033054	NP_149043	B0I1T2	MYO1G_HUMAN	myosin IG	64	Myosin head-like.					myosin complex|plasma membrane	actin binding|ATP binding|calmodulin binding|motor activity			breast(2)|ovary(1)|pancreas(1)	4						CTGGTACCTGGCGATGGCCTC	0.627													30	112	---	---	---	---	capture	Missense_Mutation	SNP	45016575	45016575	MYO1G	7	G	C	C	C	1	0	0	0	0	1	0	0	0	546	42	4	4	9984	253
FZD1	8321	broad.mit.edu	37	7	90895152	90895152	+	Silent	SNP	G	A	A			TCGA-41-2575-01	TCGA-41-2575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:90895152G>A	uc003ula.2	+	1	1370	c.957G>A	c.(955-957)TCG>TCA	p.S319S		NM_003505	NP_003496	Q9UP38	FZD1_HUMAN	frizzled 1 precursor	319	Extracellular (Potential).				autocrine signaling|axonogenesis|brain development|canonical Wnt receptor signaling pathway involved in mesenchymal stem cell differentiation|canonical Wnt receptor signaling pathway involved in osteoblast differentiation|embryo development|epithelial cell differentiation|G-protein signaling, coupled to cGMP nucleotide second messenger|gonad development|lung alveolus development|negative regulation of BMP signaling pathway|negative regulation of canonical Wnt receptor signaling pathway|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription, DNA-dependent|response to drug|vasculature development|Wnt receptor signaling pathway, calcium modulating pathway	apical part of cell|cell surface|cytoplasm|integral to membrane|neuron projection membrane	G-protein coupled receptor activity|PDZ domain binding|receptor binding|Wnt receptor activity|Wnt-protein binding				0	all_cancers(62;3.1e-10)|all_epithelial(64;1.66e-08)|Breast(17;0.000635)|Lung NSC(181;0.153)|all_lung(186;0.154)|all_hematologic(106;0.215)		STAD - Stomach adenocarcinoma(171;0.0134)			TGCGCTTCTCGCGCACCTGGA	0.617													46	117	---	---	---	---	capture	Silent	SNP	90895152	90895152	FZD1	7	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	6070	253
TAF6	6878	broad.mit.edu	37	7	99705016	99705016	+	Silent	SNP	A	G	G			TCGA-41-2575-01	TCGA-41-2575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:99705016A>G	uc003uti.2	-	15	1968	c.1887T>C	c.(1885-1887)CCT>CCC	p.P629P	AP4M1_uc003utd.2_Intron|TAF6_uc003utg.2_Silent_p.P551P|TAF6_uc003uth.2_Silent_p.P686P|TAF6_uc003utk.2_Silent_p.P629P|TAF6_uc011kji.1_Silent_p.P666P|TAF6_uc003utj.2_Silent_p.P619P|TAF6_uc003utl.2_Silent_p.P619P|TAF6_uc003utm.2_Silent_p.P629P	NM_139315	NP_647476	P49848	TAF6_HUMAN	TBP-associated factor 6 isoform alpha	629					negative regulation of cell cycle|negative regulation of cell proliferation|regulation of sequence-specific DNA binding transcription factor activity|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|viral reproduction	cytoplasm|MLL1 complex|transcription factor TFIID complex|transcription factor TFIID complex|transcription factor TFTC complex	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(1)|central_nervous_system(1)	2	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					ATGCCGGGGGAGGAACTGGAG	0.647													3	137	---	---	---	---	capture	Silent	SNP	99705016	99705016	TAF6	7	A	G	G	G	1	0	0	0	0	0	0	0	1	132	11	3	3	15418	253
ZCWPW1	55063	broad.mit.edu	37	7	100017408	100017408	+	Missense_Mutation	SNP	C	A	A			TCGA-41-2575-01	TCGA-41-2575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:100017408C>A	uc003uut.2	-	4	375	c.127G>T	c.(127-129)GGG>TGG	p.G43W	ZCWPW1_uc011kjq.1_5'Flank|ZCWPW1_uc003uur.2_5'Flank|ZCWPW1_uc003uus.2_5'UTR|ZCWPW1_uc011kjr.1_Missense_Mutation_p.G42W|ZCWPW1_uc003uuu.1_Missense_Mutation_p.G42W|ZCWPW1_uc011kjs.1_5'Flank|ZCWPW1_uc011kjt.1_Missense_Mutation_p.G42W|ZCWPW1_uc011kju.1_Missense_Mutation_p.G42W	NM_017984	NP_060454	Q9H0M4	ZCPW1_HUMAN	zinc finger, CW type with PWWP domain 1	43							zinc ion binding				0	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					GAACTGATCCCCGGGGTCTCC	0.493													72	87	---	---	---	---	capture	Missense_Mutation	SNP	100017408	100017408	ZCWPW1	7	C	A	A	A	1	0	0	0	0	1	0	0	0	286	22	4	4	17477	253
KCNU1	157855	broad.mit.edu	37	8	36766969	36766969	+	Missense_Mutation	SNP	G	T	T			TCGA-41-2575-01	TCGA-41-2575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:36766969G>T	uc010lvw.2	+	21	2334	c.2247G>T	c.(2245-2247)AAG>AAT	p.K749N	KCNU1_uc003xjw.2_RNA	NM_001031836	NP_001027006	A8MYU2	KCNU1_HUMAN	potassium channel, subfamily U, member 1	749	Cytoplasmic (Potential).					voltage-gated potassium channel complex	binding|large conductance calcium-activated potassium channel activity|voltage-gated potassium channel activity			ovary(1)	1				KIRC - Kidney renal clear cell carcinoma(67;0.0504)|Kidney(114;0.0634)		AGGAGCTGAAGGACATAGTGT	0.458													107	247	---	---	---	---	capture	Missense_Mutation	SNP	36766969	36766969	KCNU1	8	G	T	T	T	1	0	0	0	0	1	0	0	0	451	35	4	4	8015	253
FGFR1	2260	broad.mit.edu	37	8	38282202	38282202	+	Missense_Mutation	SNP	C	A	A			TCGA-41-2575-01	TCGA-41-2575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:38282202C>A	uc003xlp.2	-	7	1703	c.761G>T	c.(760-762)CGG>CTG	p.R254L	FGFR1_uc011lbo.1_Missense_Mutation_p.R252L|FGFR1_uc011lbp.1_Missense_Mutation_p.R165L|FGFR1_uc011lbq.1_Missense_Mutation_p.R163L|FGFR1_uc010lwk.2_Missense_Mutation_p.R246L|FGFR1_uc011lbr.1_RNA|FGFR1_uc011lbs.1_Missense_Mutation_p.R94L|FGFR1_uc011lbt.1_Missense_Mutation_p.R163L|FGFR1_uc011lbu.1_Missense_Mutation_p.R285L|FGFR1_uc011lbv.1_Missense_Mutation_p.R252L|FGFR1_uc011lbw.1_Missense_Mutation_p.R165L|FGFR1_uc011lbx.1_Missense_Mutation_p.R165L|FGFR1_uc003xlv.2_Missense_Mutation_p.R165L|FGFR1_uc003xlu.2_Missense_Mutation_p.R163L	NM_023110	NP_075598	P11362	FGFR1_HUMAN	fibroblast growth factor receptor 1 isoform 1	254	Extracellular (Potential).		R -> Q (in KAL2).		axon guidance|cell growth|insulin receptor signaling pathway|MAPKKK cascade|positive regulation of cell proliferation|skeletal system development	extracellular region|integral to plasma membrane|membrane fraction	ATP binding|fibroblast growth factor receptor activity|heparin binding|protein homodimerization activity			lung(5)|central_nervous_system(5)|stomach(2)|breast(2)|ovary(1)	15	all_cancers(2;9.05e-47)|all_epithelial(2;2.64e-50)|all_lung(3;1.71e-23)|Lung NSC(2;3.61e-23)|Colorectal(12;0.000442)	Breast(189;1.48e-05)|all_lung(54;0.00354)|Lung NSC(58;0.0138)|Hepatocellular(245;0.065)	Epithelial(3;3.96e-34)|all cancers(3;3.06e-30)|BRCA - Breast invasive adenocarcinoma(5;2.28e-21)|COAD - Colon adenocarcinoma(9;0.24)		Palifermin(DB00039)	CAGGATGGGCCGGTGAGGGGA	0.612		1	T	BCR|FOP|ZNF198|CEP1	MPD|NHL		Pfeiffer syndrome|Kallman syndrome						3	134	---	---	---	---	capture	Missense_Mutation	SNP	38282202	38282202	FGFR1	8	C	A	A	A	1	0	0	0	0	1	0	0	0	299	23	4	4	5809	253
FNTA	2339	broad.mit.edu	37	8	42927324	42927324	+	Missense_Mutation	SNP	G	C	C			TCGA-41-2575-01	TCGA-41-2575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:42927324G>C	uc003xps.2	+	5	555	c.507G>C	c.(505-507)TGG>TGC	p.W169C	FNTA_uc003xpt.2_Missense_Mutation_p.W78C|FNTA_uc003xpu.2_Missense_Mutation_p.W102C|FNTA_uc003xpv.2_RNA	NM_002027	NP_002018	P49354	FNTA_HUMAN	farnesyltransferase, CAAX box, alpha isoform a	169	PFTA 2.				cellular component disassembly involved in apoptosis|positive regulation of deacetylase activity|positive regulation of tubulin deacetylation|protein farnesylation|protein geranylgeranylation|transforming growth factor beta receptor signaling pathway	cytosol|microtubule associated complex	alpha-tubulin binding|CAAX-protein geranylgeranyltransferase activity|microtubule binding|protein farnesyltransferase activity			ovary(1)	1	Prostate(17;0.0119)|Ovarian(28;0.0172)|Lung SC(25;0.184)	all_cancers(86;0.000223)|all_epithelial(80;1.61e-07)|all_lung(54;0.00021)|Lung NSC(58;0.000778)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.129)	Lung(22;0.0777)|LUSC - Lung squamous cell carcinoma(45;0.17)			TGGGCTTTAGGCATCATAGGC	0.368													4	236	---	---	---	---	capture	Missense_Mutation	SNP	42927324	42927324	FNTA	8	G	C	C	C	1	0	0	0	0	1	0	0	0	546	42	4	4	5921	253
PXDNL	137902	broad.mit.edu	37	8	52339264	52339264	+	Missense_Mutation	SNP	T	G	G			TCGA-41-2575-01	TCGA-41-2575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:52339264T>G	uc003xqu.3	-	13	1681	c.1580A>C	c.(1579-1581)AAT>ACT	p.N527T		NM_144651	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog-like precursor	527	Ig-like C2-type 4.				hydrogen peroxide catabolic process	extracellular space	heme binding|peroxidase activity			ovary(1)|pancreas(1)	2		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)				AATGTTTATATTCTTTCCAAC	0.338													11	11	---	---	---	---	capture	Missense_Mutation	SNP	52339264	52339264	PXDNL	8	T	G	G	G	1	0	0	0	0	1	0	0	0	676	52	4	4	12743	253
UBXN2B	137886	broad.mit.edu	37	8	59345800	59345800	+	Missense_Mutation	SNP	G	T	T			TCGA-41-2575-01	TCGA-41-2575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:59345800G>T	uc003xtl.2	+	4	543	c.421G>T	c.(421-423)GAT>TAT	p.D141Y		NM_001077619	NP_001071087	Q14CS0	UBX2B_HUMAN	UBX domain protein 2B	141	SEP.					cytosol|endoplasmic reticulum|Golgi apparatus|nucleus				ovary(2)	2						TCAGCTGCAAGATGTAGGTAC	0.284													111	141	---	---	---	---	capture	Missense_Mutation	SNP	59345800	59345800	UBXN2B	8	G	T	T	T	1	0	0	0	0	1	0	0	0	429	33	4	4	16797	253
LRRCC1	85444	broad.mit.edu	37	8	86047170	86047170	+	Missense_Mutation	SNP	C	T	T			TCGA-41-2575-01	TCGA-41-2575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:86047170C>T	uc003ycw.2	+	13	2211	c.2057C>T	c.(2056-2058)TCC>TTC	p.S686F	LRRCC1_uc010maa.1_Missense_Mutation_p.S387F|LRRCC1_uc003ycx.2_Missense_Mutation_p.S593F|LRRCC1_uc003ycy.2_Missense_Mutation_p.S666F	NM_033402	NP_208325	Q9C099	LRCC1_HUMAN	sodium channel associated protein 2 isoform a	686					cell division|mitosis	centriole|nucleus					0						AATGAGTCTTCCTCTTTAATT	0.333													63	62	---	---	---	---	capture	Missense_Mutation	SNP	86047170	86047170	LRRCC1	8	C	T	T	T	1	0	0	0	0	1	0	0	0	390	30	2	2	8941	253
GRHL2	79977	broad.mit.edu	37	8	102649132	102649132	+	Missense_Mutation	SNP	A	G	G			TCGA-41-2575-01	TCGA-41-2575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:102649132A>G	uc010mbu.2	+	12	1823	c.1493A>G	c.(1492-1494)TAC>TGC	p.Y498C		NM_024915	NP_079191	Q6ISB3	GRHL2_HUMAN	transcription factor CP2-like 3	498						cytoplasm|nucleus	DNA binding			ovary(2)|skin(1)	3	all_cancers(14;4.39e-08)|all_epithelial(15;4.09e-10)|Lung NSC(17;7.11e-06)|all_lung(17;1.44e-05)		Epithelial(11;5.81e-09)|all cancers(13;3.81e-07)|OV - Ovarian serous cystadenocarcinoma(57;0.000213)			CAGGTGTATTACAACACGGAT	0.408													107	107	---	---	---	---	capture	Missense_Mutation	SNP	102649132	102649132	GRHL2	8	A	G	G	G	1	0	0	0	0	1	0	0	0	182	14	3	3	6697	253
PLEC	5339	broad.mit.edu	37	8	144996426	144996426	+	Silent	SNP	C	T	T			TCGA-41-2575-01	TCGA-41-2575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:144996426C>T	uc003zaf.1	-	32	8144	c.7974G>A	c.(7972-7974)CAG>CAA	p.Q2658Q	PLEC_uc003zab.1_Silent_p.Q2521Q|PLEC_uc003zac.1_Silent_p.Q2525Q|PLEC_uc003zad.2_Silent_p.Q2521Q|PLEC_uc003zae.1_Silent_p.Q2489Q|PLEC_uc003zag.1_Silent_p.Q2499Q|PLEC_uc003zah.2_Silent_p.Q2507Q|PLEC_uc003zaj.2_Silent_p.Q2548Q	NM_201380	NP_958782	Q15149	PLEC_HUMAN	plectin isoform 1	2658	Central fibrous rod domain.|Potential.				cellular component disassembly involved in apoptosis|hemidesmosome assembly	cytosol|focal adhesion|hemidesmosome|intermediate filament cytoskeleton|sarcolemma	actin binding|structural constituent of muscle|structural constituent of muscle			large_intestine(2)|ovary(2)|pancreas(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	9						CCACCTCGTCCTGGAAGAGCT	0.488													12	13	---	---	---	---	capture	Silent	SNP	144996426	144996426	PLEC	8	C	T	T	T	1	0	0	0	0	0	0	0	1	311	24	2	2	11955	253
FOXD4L5	653427	broad.mit.edu	37	9	70177706	70177706	+	Missense_Mutation	SNP	G	A	A			TCGA-41-2575-01	TCGA-41-2575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:70177706G>A	uc010moc.2	-	1	1110	c.278C>T	c.(277-279)CCG>CTG	p.P93L		NM_001126334	NP_001119806	Q5VV16	FX4L5_HUMAN	forkhead box D4-like 5	93					axon extension involved in axon guidance|cartilage development|dichotomous subdivision of terminal units involved in ureteric bud branching|embryo development|enteric nervous system development|iridophore differentiation|lateral line nerve glial cell development|melanocyte differentiation|neural crest cell migration|pattern specification process|peripheral nervous system development|positive regulation of BMP signaling pathway|positive regulation of kidney development|positive regulation of transcription from RNA polymerase II promoter|regulation of sequence-specific DNA binding transcription factor activity|sympathetic nervous system development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding				0						AGACCTTGGCGGTGCCCTGAA	0.682													45	89	---	---	---	---	capture	Missense_Mutation	SNP	70177706	70177706	FOXD4L5	9	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	5946	253
EIF2S3	1968	broad.mit.edu	37	X	24075581	24075581	+	Missense_Mutation	SNP	A	T	T			TCGA-41-2575-01	TCGA-41-2575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:24075581A>T	uc004dbc.2	+	3	198	c.177A>T	c.(175-177)AAA>AAT	p.K59N		NM_001415	NP_001406	P41091	IF2G_HUMAN	eukaryotic translation initiation factor 2,	59						cytosol	GTP binding|GTPase activity|protein binding|translation initiation factor activity			lung(1)	1						CAGTCGTCAAAGCTATTTCTG	0.328													65	12	---	---	---	---	capture	Missense_Mutation	SNP	24075581	24075581	EIF2S3	23	A	T	T	T	1	0	0	0	0	1	0	0	0	37	3	4	4	4966	253
PCDH9	5101	broad.mit.edu	37	13	67802278	67802279	+	Frame_Shift_Del	DEL	CA	-	-			TCGA-41-2575-01	TCGA-41-2575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:67802278_67802279delCA	uc001vik.2	-	2	986_987	c.294_295delTG	c.(292-297)TGTGCTfs	p.C98fs	PCDH9_uc001vil.2_Frame_Shift_Del_p.C98fs|PCDH9_uc010thl.1_Frame_Shift_Del_p.C98fs|PCDH9_uc001vin.3_Frame_Shift_Del_p.C98fs	NM_203487	NP_982354	Q9HC56	PCDH9_HUMAN	protocadherin 9 isoform 1 precursor	98_99	Extracellular (Potential).|Cadherin 1.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|pancreas(1)|skin(1)	6		Hepatocellular(98;0.0906)|Breast(118;0.107)		GBM - Glioblastoma multiforme(99;0.00819)		GAGGCGCCAGCACAGAGTTTTT	0.436													39	60	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	67802278	67802279	PCDH9	13	CA	-	-	-	1	0	1	0	1	0	0	0	0	325	25	5	5	11421	253
