Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
UBE4B	10277	broad.mit.edu	37	1	10221285	10221285	+	Nonsense_Mutation	SNP	C	T	T			TCGA-41-3392-01	TCGA-41-3392-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:10221285C>T	uc001aqs.3	+	23	3852	c.3139C>T	c.(3139-3141)CGA>TGA	p.R1047*	UBE4B_uc001aqr.3_Nonsense_Mutation_p.R918*|UBE4B_uc010oai.1_RNA|UBE4B_uc010oaj.1_Nonsense_Mutation_p.R502*	NM_001105562	NP_001099032	O95155	UBE4B_HUMAN	ubiquitination factor E4B isoform 1	1047					apoptosis|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|response to UV	cytoplasm|ubiquitin ligase complex	enzyme binding			ovary(2)|skin(2)	4		all_lung(284;1.13e-05)|Lung NSC(185;1.74e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0268)|Colorectal(212;1.42e-07)|COAD - Colon adenocarcinoma(227;2.77e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000435)|Kidney(185;0.000482)|KIRC - Kidney renal clear cell carcinoma(229;0.00164)|STAD - Stomach adenocarcinoma(132;0.0117)|READ - Rectum adenocarcinoma(331;0.046)		GTCTCTGAAGCGAATCCATGA	0.493													35	83	---	---	---	---	capture	Nonsense_Mutation	SNP	10221285	10221285	UBE4B	1	C	T	T	T	1	0	0	0	0	0	1	0	0	347	27	5	1	16765	254
NGF	4803	broad.mit.edu	37	1	115828973	115828973	+	Silent	SNP	G	A	A			TCGA-41-3392-01	TCGA-41-3392-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:115828973G>A	uc001efu.1	-	3	613	c.444C>T	c.(442-444)ACC>ACT	p.T148T		NM_002506	NP_002497	P01138	NGF_HUMAN	nerve growth factor, beta polypeptide precursor	148					activation of MAPKK activity|activation of phospholipase C activity|anti-apoptosis|apoptosis|induction of apoptosis by extracellular signals|negative regulation of cell cycle|nerve growth factor processing|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|Ras protein signal transduction	endosome|Golgi lumen	growth factor activity|nerve growth factor receptor binding			upper_aerodigestive_tract(2)	2	Lung SC(450;0.211)	all_cancers(81;1.07e-06)|all_epithelial(167;4.43e-06)|all_lung(203;2.86e-05)|Lung NSC(69;4.99e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)|all cancers(265;0.159)|Epithelial(280;0.179)	Clenbuterol(DB01407)	TGTCTGTGGCGGTGGTCTTAT	0.527													8	109	---	---	---	---	capture	Silent	SNP	115828973	115828973	NGF	1	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	10302	254
GJA8	2703	broad.mit.edu	37	1	147380211	147380211	+	Silent	SNP	C	T	T			TCGA-41-3392-01	TCGA-41-3392-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:147380211C>T	uc001epu.1	+	2	192	c.129C>T	c.(127-129)TTC>TTT	p.F43F		NM_005267	NP_005258	P48165	CXA8_HUMAN	connexin 50	43	Helical; (Potential).				cell communication|visual perception	connexon complex|integral to plasma membrane	channel activity			ovary(2)|large_intestine(2)|breast(1)|skin(1)	6	all_hematologic(923;0.0276)					CCGCAGAGTTCGTGTGGGGGG	0.592													56	56	---	---	---	---	capture	Silent	SNP	147380211	147380211	GJA8	1	C	T	T	T	1	0	0	0	0	0	0	0	1	402	31	1	1	6342	254
FLG	2312	broad.mit.edu	37	1	152278815	152278815	+	Silent	SNP	G	A	A			TCGA-41-3392-01	TCGA-41-3392-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152278815G>A	uc001ezu.1	-	3	8583	c.8547C>T	c.(8545-8547)GAC>GAT	p.D2849D		NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	2849	Ser-rich.|Filaggrin 17.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GCCTGGAGCCGTCTCCTGATT	0.567									Ichthyosis				162	765	---	---	---	---	capture	Silent	SNP	152278815	152278815	FLG	1	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	5867	254
SPTA1	6708	broad.mit.edu	37	1	158604390	158604390	+	Missense_Mutation	SNP	A	C	C			TCGA-41-3392-01	TCGA-41-3392-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:158604390A>C	uc001fst.1	-	39	5707	c.5508T>G	c.(5506-5508)AAT>AAG	p.N1836K		NM_003126	NP_003117	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	1836	Spectrin 18.				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8	all_hematologic(112;0.0378)					CATTCTTTTCATTGATCCAAG	0.418													6	245	---	---	---	---	capture	Missense_Mutation	SNP	158604390	158604390	SPTA1	1	A	C	C	C	1	0	0	0	0	1	0	0	0	102	8	4	4	15008	254
REN	5972	broad.mit.edu	37	1	204129738	204129738	+	Missense_Mutation	SNP	G	A	A			TCGA-41-3392-01	TCGA-41-3392-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:204129738G>A	uc001haq.2	-	4	486	c.442C>T	c.(442-444)CGC>TGC	p.R148C		NM_000537	NP_000528	P00797	RENI_HUMAN	renin preproprotein	148					angiotensin maturation|regulation of MAPKKK cascade	extracellular space|membrane	aspartic-type endopeptidase activity			skin(3)|central_nervous_system(1)	4	all_cancers(21;0.00965)|Breast(84;0.116)|all_epithelial(62;0.157)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.109)		Aliskiren(DB01258)|Remikiren(DB00212)	GTTGAATAGCGGAGGGTGAGT	0.562													28	55	---	---	---	---	capture	Missense_Mutation	SNP	204129738	204129738	REN	1	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	13119	254
RASSF5	83593	broad.mit.edu	37	1	206760184	206760184	+	Silent	SNP	T	G	G			TCGA-41-3392-01	TCGA-41-3392-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:206760184T>G	uc001hed.2	+	6	1188	c.1131T>G	c.(1129-1131)CTT>CTG	p.L377L	RASSF5_uc001hec.1_3'UTR|RASSF5_uc001hee.2_3'UTR|RASSF5_uc001hef.2_Silent_p.L224L|RASSF5_uc001heg.1_3'UTR	NM_182663	NP_872604	Q8WWW0	RASF5_HUMAN	Ras association (RalGDS/AF-6) domain family 5	377	SARAH.				apoptosis|intracellular signal transduction	cytoplasm|microtubule	metal ion binding|protein binding			ovary(1)	1	Breast(84;0.183)		BRCA - Breast invasive adenocarcinoma(75;0.166)			TCCCTGAACTTCAGAACTTCC	0.458													45	180	---	---	---	---	capture	Silent	SNP	206760184	206760184	RASSF5	1	T	G	G	G	1	0	0	0	0	0	0	0	1	795	62	4	4	12984	254
IRF6	3664	broad.mit.edu	37	1	209963984	209963984	+	Missense_Mutation	SNP	C	T	T			TCGA-41-3392-01	TCGA-41-3392-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:209963984C>T	uc001hhq.1	-	7	1179	c.916G>A	c.(916-918)GTC>ATC	p.V306I	IRF6_uc010psm.1_Missense_Mutation_p.V211I|IRF6_uc009xct.1_Missense_Mutation_p.V306I	NM_006147	NP_006138	O14896	IRF6_HUMAN	interferon regulatory factor 6	306					cell cycle arrest|interferon-gamma-mediated signaling pathway|mammary gland epithelial cell differentiation|negative regulation of cell proliferation|positive regulation of transcription, DNA-dependent|type I interferon-mediated signaling pathway	cytoplasm|nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(2)	2				OV - Ovarian serous cystadenocarcinoma(81;0.0351)		TGACCGCTGACCTCCAGGATC	0.532										HNSCC(57;0.16)			44	62	---	---	---	---	capture	Missense_Mutation	SNP	209963984	209963984	IRF6	1	C	T	T	T	1	0	0	0	0	1	0	0	0	234	18	2	2	7757	254
OR2T12	127064	broad.mit.edu	37	1	248458187	248458187	+	Missense_Mutation	SNP	G	A	A			TCGA-41-3392-01	TCGA-41-3392-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:248458187G>A	uc010pzj.1	-	1	694	c.694C>T	c.(694-696)CGC>TGC	p.R232C		NM_001004692	NP_001004692	Q8NG77	O2T12_HUMAN	olfactory receptor, family 2, subfamily T,	232	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)	3	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0201)			GCCTTCTTGCGGGCTTCTGTA	0.522													52	48	---	---	---	---	capture	Missense_Mutation	SNP	248458187	248458187	OR2T12	1	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	10923	254
ADARB2	105	broad.mit.edu	37	10	1263025	1263025	+	Silent	SNP	G	A	A			TCGA-41-3392-01	TCGA-41-3392-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:1263025G>A	uc009xhq.2	-	7	1922	c.1548C>T	c.(1546-1548)CGC>CGT	p.R516R		NM_018702	NP_061172	Q9NS39	RED2_HUMAN	adenosine deaminase, RNA-specific, B2	516	A to I editase.				mRNA processing	mitochondrion|nucleus	adenosine deaminase activity|double-stranded RNA binding|metal ion binding|single-stranded RNA binding			large_intestine(2)|central_nervous_system(1)	3		all_epithelial(10;0.059)|Colorectal(49;0.0815)		all cancers(11;0.0224)|GBM - Glioblastoma multiforme(2;0.0414)|Epithelial(11;0.165)		GCAGGTGCCCGCGGAACTTCC	0.657													9	2	---	---	---	---	capture	Silent	SNP	1263025	1263025	ADARB2	10	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	283	254
HPSE2	60495	broad.mit.edu	37	10	100249866	100249866	+	Missense_Mutation	SNP	G	T	T			TCGA-41-3392-01	TCGA-41-3392-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:100249866G>T	uc001kpn.1	-	10	1468	c.1408C>A	c.(1408-1410)CCT>ACT	p.P470T	HPSE2_uc009xwc.1_Missense_Mutation_p.P460T|HPSE2_uc001kpo.1_Missense_Mutation_p.P402T|HPSE2_uc009xwd.1_Missense_Mutation_p.P348T	NM_021828	NP_068600	Q8WWQ2	HPSE2_HUMAN	heparanase 2	470					carbohydrate metabolic process	intracellular|membrane	cation binding|heparanase activity			ovary(1)	1				Epithelial(162;1.8e-09)|all cancers(201;4.72e-07)		ACTCGGCCAGGCCGTGGCTTC	0.562													14	61	---	---	---	---	capture	Missense_Mutation	SNP	100249866	100249866	HPSE2	10	G	T	T	T	1	0	0	0	0	1	0	0	0	546	42	4	4	7270	254
TPH1	7166	broad.mit.edu	37	11	18047154	18047154	+	Missense_Mutation	SNP	C	T	T	rs145855109	byFrequency	TCGA-41-3392-01	TCGA-41-3392-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:18047154C>T	uc001mnp.2	-	7	924	c.898G>A	c.(898-900)GCT>ACT	p.A300T	TPH1_uc009yhe.2_RNA	NM_004179	NP_004170	P17752	TPH1_HUMAN	tryptophan hydroxylase 1	300					aromatic amino acid family metabolic process|hormone biosynthetic process|serotonin biosynthetic process	cytosol	amino acid binding|iron ion binding|tryptophan 5-monooxygenase activity				0					L-Tryptophan(DB00150)|Tetrahydrobiopterin(DB00360)	TCCTCTGAAGCGCCAAGAGAA	0.438													12	131	---	---	---	---	capture	Missense_Mutation	SNP	18047154	18047154	TPH1	11	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	16284	254
OR5B17	219965	broad.mit.edu	37	11	58126152	58126152	+	Missense_Mutation	SNP	T	C	C			TCGA-41-3392-01	TCGA-41-3392-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:58126152T>C	uc010rke.1	-	1	391	c.391A>G	c.(391-393)ACC>GCC	p.T131A		NM_001005489	NP_001005489	Q8NGF7	OR5BH_HUMAN	olfactory receptor, family 5, subfamily B,	131	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3	Esophageal squamous(5;0.0027)	Breast(21;0.0778)				ATGGTGGTGGTATAATGTAGG	0.448													30	60	---	---	---	---	capture	Missense_Mutation	SNP	58126152	58126152	OR5B17	11	T	C	C	C	1	0	0	0	0	1	0	0	0	741	57	3	3	11053	254
CD6	923	broad.mit.edu	37	11	60786743	60786743	+	Missense_Mutation	SNP	C	G	G			TCGA-41-3392-01	TCGA-41-3392-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:60786743C>G	uc001nqq.2	+	13	2183	c.1960C>G	c.(1960-1962)CCT>GCT	p.P654A	CD6_uc001nqr.2_Missense_Mutation_p.P587A|CD6_uc001nqs.2_RNA|CD6_uc001nqt.2_Missense_Mutation_p.P578A	NM_006725	NP_006716	P30203	CD6_HUMAN	CD6 molecule precursor	654	Cytoplasmic (Potential).				cell adhesion	cell surface|integral to plasma membrane	scavenger receptor activity			pancreas(1)	1						CAGCCCTCAGCCTGACTCCAC	0.657													15	30	---	---	---	---	capture	Missense_Mutation	SNP	60786743	60786743	CD6	11	C	G	G	G	1	0	0	0	0	1	0	0	0	338	26	4	4	2999	254
CALCOCO1	57658	broad.mit.edu	37	12	54117525	54117525	+	Missense_Mutation	SNP	C	T	T			TCGA-41-3392-01	TCGA-41-3392-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:54117525C>T	uc001sef.2	-	4	446	c.302G>A	c.(301-303)CGA>CAA	p.R101Q	CALCOCO1_uc010som.1_Intron|CALCOCO1_uc010son.1_5'UTR|CALCOCO1_uc001seh.2_Missense_Mutation_p.R101Q|CALCOCO1_uc009znd.2_Missense_Mutation_p.R101Q|CALCOCO1_uc001seg.2_Intron|CALCOCO1_uc010soo.1_Missense_Mutation_p.R94Q	NM_020898	NP_065949	Q9P1Z2	CACO1_HUMAN	coiled-coil transcriptional coactivator isoform	101	N-terminal AD (CTNNB1 binding site) (By similarity).				steroid hormone receptor signaling pathway|transcription, DNA-dependent|Wnt receptor signaling pathway	cytoplasm	armadillo repeat domain binding|beta-catenin binding|ligand-dependent nuclear receptor transcription coactivator activity|protein C-terminus binding|sequence-specific DNA binding|transcription regulatory region DNA binding			ovary(1)	1						GTTCACATATCGGAACTGGTA	0.602													26	39	---	---	---	---	capture	Missense_Mutation	SNP	54117525	54117525	CALCOCO1	12	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	2553	254
HOXC11	3227	broad.mit.edu	37	12	54369092	54369092	+	Silent	SNP	C	T	T	rs141170619		TCGA-41-3392-01	TCGA-41-3392-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:54369092C>T	uc001sem.2	+	2	926	c.810C>T	c.(808-810)AAC>AAT	p.N270N		NM_014212	NP_055027	O43248	HXC11_HUMAN	homeobox C11	270	Homeobox.				endoderm development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1						GGATGCTGAACCTGACGGACC	0.478			T	NUP98	AML								31	52	---	---	---	---	capture	Silent	SNP	54369092	54369092	HOXC11	12	C	T	T	T	1	0	0	0	0	0	0	0	1	233	18	2	2	7235	254
OR6C4	341418	broad.mit.edu	37	12	55945591	55945591	+	Missense_Mutation	SNP	A	G	G			TCGA-41-3392-01	TCGA-41-3392-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:55945591A>G	uc010spp.1	+	1	581	c.581A>G	c.(580-582)GAA>GGA	p.E194G		NM_001005494	NP_001005494	Q8NGE1	OR6C4_HUMAN	olfactory receptor, family 6, subfamily C,	194	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						AGCCTCTTAGAACTGATGGTC	0.468													51	86	---	---	---	---	capture	Missense_Mutation	SNP	55945591	55945591	OR6C4	12	A	G	G	G	1	0	0	0	0	1	0	0	0	117	9	3	3	11097	254
B4GALNT1	2583	broad.mit.edu	37	12	58020574	58020574	+	Missense_Mutation	SNP	G	A	A			TCGA-41-3392-01	TCGA-41-3392-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:58020574G>A	uc001spg.1	-	11	1987	c.1555C>T	c.(1555-1557)CGG>TGG	p.R519W	B4GALNT1_uc010sru.1_Missense_Mutation_p.R464W	NM_001478	NP_001469	Q00973	B4GN1_HUMAN	beta-1,4-N-acetyl-galactosaminyl transferase 1	519	Lumenal (Potential).				lipid glycosylation	integral to Golgi membrane|membrane fraction	(N-acetylneuraminyl)-galactosylglucosylceramide N-acetylgalactosaminyltransferase activity				0	Melanoma(17;0.122)		BRCA - Breast invasive adenocarcinoma(9;0.109)			AAGAGCAGCCGGTGTTTGGCC	0.597													51	95	---	---	---	---	capture	Missense_Mutation	SNP	58020574	58020574	B4GALNT1	12	G	A	A	A	1	0	0	0	0	1	0	0	0	506	39	1	1	1255	254
PHLDA1	22822	broad.mit.edu	37	12	76424413	76424413	+	Missense_Mutation	SNP	G	A	A			TCGA-41-3392-01	TCGA-41-3392-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:76424413G>A	uc001sxu.2	-	1	1144	c.1109C>T	c.(1108-1110)CCG>CTG	p.P370L		NM_007350	NP_031376	Q8WV24	PHLA1_HUMAN	pleckstrin homology-like domain, family A,	370	14 X 2 AA repeats of P-H.				apoptosis	cytoplasmic vesicle membrane|nucleolus|plasma membrane	protein binding				0		Colorectal(145;0.09)				atgcgggtgcgggtgagggtg	0.139													14	13	---	---	---	---	capture	Missense_Mutation	SNP	76424413	76424413	PHLDA1	12	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	11751	254
ACACB	32	broad.mit.edu	37	12	109665288	109665288	+	Missense_Mutation	SNP	C	A	A			TCGA-41-3392-01	TCGA-41-3392-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:109665288C>A	uc001tob.2	+	28	4114	c.3995C>A	c.(3994-3996)CCA>CAA	p.P1332Q	ACACB_uc001toc.2_Missense_Mutation_p.P1332Q|ACACB_uc010sxl.1_5'Flank|ACACB_uc001tod.2_5'Flank|ACACB_uc010sxm.1_5'Flank	NM_001093	NP_001084	O00763	ACACB_HUMAN	acetyl-Coenzyme A carboxylase beta	1332					acetyl-CoA metabolic process|carnitine shuttle|energy reserve metabolic process|fatty acid biosynthetic process|positive regulation of cellular metabolic process|protein homotetramerization|regulation of fatty acid oxidation	cytosol|endomembrane system|Golgi apparatus|membrane	acetyl-CoA carboxylase activity|ATP binding|biotin carboxylase activity|metal ion binding|protein binding			ovary(5)|upper_aerodigestive_tract(1)|pancreas(1)|skin(1)	8					Biotin(DB00121)	TCCTCCCACCCAAACCGGTAT	0.587													3	60	---	---	---	---	capture	Missense_Mutation	SNP	109665288	109665288	ACACB	12	C	A	A	A	1	0	0	0	0	1	0	0	0	273	21	4	4	107	254
C12orf51	283450	broad.mit.edu	37	12	112620944	112620944	+	Missense_Mutation	SNP	C	G	G			TCGA-41-3392-01	TCGA-41-3392-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:112620944C>G	uc009zwc.2	-	55	9658	c.9640G>C	c.(9640-9642)GTG>CTG	p.V3214L		NM_001109662	NP_001103132			chromosome 12 open reading frame 51											ovary(1)|lung(1)	2						ACTACAGACACGGTTAGAATC	0.353													100	180	---	---	---	---	capture	Missense_Mutation	SNP	112620944	112620944	C12orf51	12	C	G	G	G	1	0	0	0	0	1	0	0	0	247	19	4	4	1682	254
CLYBL	171425	broad.mit.edu	37	13	100425263	100425263	+	Missense_Mutation	SNP	A	C	C			TCGA-41-3392-01	TCGA-41-3392-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:100425263A>C	uc001vok.2	+	2	262	c.248A>C	c.(247-249)AAG>ACG	p.K83T	CLYBL_uc010tix.1_Missense_Mutation_p.K83T|CLYBL_uc010tiy.1_Missense_Mutation_p.K83T	NM_206808	NP_996531	Q8N0X4	CLYBL_HUMAN	citrate lyase beta like precursor	83					cellular aromatic compound metabolic process	citrate lyase complex|mitochondrion	citrate (pro-3S)-lyase activity|metal ion binding				0	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					GCAAACAAAAAGGTAATGGCA	0.383													61	48	---	---	---	---	capture	Missense_Mutation	SNP	100425263	100425263	CLYBL	13	A	C	C	C	1	0	0	0	0	1	0	0	0	39	3	4	4	3538	254
OR11G2	390439	broad.mit.edu	37	14	20665689	20665689	+	Silent	SNP	C	G	G			TCGA-41-3392-01	TCGA-41-3392-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:20665689C>G	uc010tlb.1	+	1	195	c.195C>G	c.(193-195)CTC>CTG	p.L65L		NM_001005503	NP_001005503	Q8NGC1	O11G2_HUMAN	olfactory receptor, family 11, subfamily G,	65	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2	all_cancers(95;0.00108)		Epithelial(56;9.76e-07)|all cancers(55;5.61e-06)	GBM - Glioblastoma multiforme(265;0.0144)		AGATCCTCCTCTTTGTGCTCT	0.552													19	66	---	---	---	---	capture	Silent	SNP	20665689	20665689	OR11G2	14	C	G	G	G	1	0	0	0	0	0	0	0	1	405	32	4	4	10829	254
ESR2	2100	broad.mit.edu	37	14	64723980	64723980	+	Missense_Mutation	SNP	C	T	T			TCGA-41-3392-01	TCGA-41-3392-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:64723980C>T	uc001xha.1	-	6	1523	c.1055G>A	c.(1054-1056)GGC>GAC	p.G352D	ESR2_uc001xgu.2_Missense_Mutation_p.G352D|ESR2_uc001xgv.2_Missense_Mutation_p.G352D|ESR2_uc001xgw.2_Intron|ESR2_uc001xgx.2_Missense_Mutation_p.G352D|ESR2_uc001xgy.1_Missense_Mutation_p.G352D|ESR2_uc001xgz.1_Missense_Mutation_p.G352D|ESR2_uc010aqb.1_RNA|ESR2_uc010aqc.1_Intron|ESR2_uc010aqd.1_RNA	NM_001437	NP_001428	Q92731	ESR2_HUMAN	estrogen receptor beta isoform 1	352	Steroid-binding.				cell-cell signaling|negative regulation of cell growth|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	mitochondrion|nucleoplasm	enzyme binding|estrogen receptor activity|receptor antagonist activity|sequence-specific DNA binding transcription factor activity|steroid binding|transcription coactivator activity|zinc ion binding			central_nervous_system(2)|ovary(1)	3				all cancers(60;0.00916)|OV - Ovarian serous cystadenocarcinoma(108;0.0111)|BRCA - Breast invasive adenocarcinoma(234;0.0437)	Bicalutamide(DB01128)|Estradiol(DB00783)|Estramustine(DB01196)|Raloxifene(DB00481)|Tamoxifen(DB00675)|Trilostane(DB01108)	GATGAGCTTGCCGGGGTGGTC	0.488													5	177	---	---	---	---	capture	Missense_Mutation	SNP	64723980	64723980	ESR2	14	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	5212	254
PLEKHH1	57475	broad.mit.edu	37	14	68035891	68035891	+	Missense_Mutation	SNP	C	T	T			TCGA-41-3392-01	TCGA-41-3392-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:68035891C>T	uc001xjl.1	+	8	1442	c.1300C>T	c.(1300-1302)CGG>TGG	p.R434W	PLEKHH1_uc010tsw.1_Missense_Mutation_p.R2W|PLEKHH1_uc001xjm.1_5'Flank|PLEKHH1_uc001xjn.1_5'Flank	NM_020715	NP_065766	Q9ULM0	PKHH1_HUMAN	pleckstrin homology domain containing, family H	434						cytoskeleton	binding				0				all cancers(60;0.000771)|OV - Ovarian serous cystadenocarcinoma(108;0.00502)|BRCA - Breast invasive adenocarcinoma(234;0.011)		ATCGGGCATGCGGCTCTCAGA	0.592													3	55	---	---	---	---	capture	Missense_Mutation	SNP	68035891	68035891	PLEKHH1	14	C	T	T	T	1	0	0	0	0	1	0	0	0	347	27	1	1	11979	254
ADAM20	8748	broad.mit.edu	37	14	70989515	70989515	+	Missense_Mutation	SNP	A	T	T	rs113965969		TCGA-41-3392-01	TCGA-41-3392-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:70989515A>T	uc001xme.2	-	2	2355	c.2110T>A	c.(2110-2112)TGC>AGC	p.C704S		NM_003814	NP_003805	O43506	ADA20_HUMAN	ADAM metallopeptidase domain 20 preproprotein	654	EGF-like.|Extracellular (Potential).				proteolysis|single fertilization	integral to membrane	metalloendopeptidase activity|zinc ion binding			skin(1)	1			KIRC - Kidney renal clear cell carcinoma(12;0.133)|Kidney(31;0.188)	all cancers(60;0.00294)|BRCA - Breast invasive adenocarcinoma(234;0.00668)|OV - Ovarian serous cystadenocarcinoma(108;0.0344)		TCATGGTTGCAGTGACAGTGT	0.483													148	310	---	---	---	---	capture	Missense_Mutation	SNP	70989515	70989515	ADAM20	14	A	T	T	T	1	0	0	0	0	1	0	0	0	91	7	4	4	242	254
ACOT4	122970	broad.mit.edu	37	14	74058995	74058995	+	Missense_Mutation	SNP	G	A	A			TCGA-41-3392-01	TCGA-41-3392-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:74058995G>A	uc001xoo.2	+	1	586	c.332G>A	c.(331-333)GGC>GAC	p.G111D		NM_152331	NP_689544	Q8N9L9	ACOT4_HUMAN	acyl-CoA thioesterase 4	111					acyl-CoA metabolic process|dicarboxylic acid metabolic process|long-chain fatty acid metabolic process|saturated monocarboxylic acid metabolic process|short-chain fatty acid metabolic process|succinyl-CoA metabolic process|unsaturated monocarboxylic acid metabolic process|very long-chain fatty acid metabolic process	peroxisome	carboxylesterase activity|palmitoyl-CoA hydrolase activity				0				BRCA - Breast invasive adenocarcinoma(234;0.00331)		GTGCTGGACGGCCACGACCCC	0.682													3	12	---	---	---	---	capture	Missense_Mutation	SNP	74058995	74058995	ACOT4	14	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	153	254
RASGRF1	5923	broad.mit.edu	37	15	79296158	79296158	+	Missense_Mutation	SNP	G	A	A			TCGA-41-3392-01	TCGA-41-3392-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:79296158G>A	uc002beq.2	-	16	2858	c.2483C>T	c.(2482-2484)GCG>GTG	p.A828V	RASGRF1_uc002bep.2_Missense_Mutation_p.A812V|RASGRF1_uc010blm.1_Missense_Mutation_p.A737V|RASGRF1_uc002ber.3_Missense_Mutation_p.A812V|RASGRF1_uc010unh.1_Missense_Mutation_p.A223V|RASGRF1_uc002beo.2_Missense_Mutation_p.A44V	NM_002891	NP_002882	Q13972	RGRF1_HUMAN	Ras protein-specific guanine	830					activation of Rac GTPase activity|apoptosis|induction of apoptosis by extracellular signals|long-term memory|nerve growth factor receptor signaling pathway|neuron projection development|regulation of Rac protein signal transduction|small GTPase mediated signal transduction|synaptic transmission	cytosol|growth cone|plasma membrane|synaptosome	Rho guanyl-nucleotide exchange factor activity			skin(4)|ovary(1)|central_nervous_system(1)	6						CTTGCTGAGCGCTGAAGGGTC	0.637													41	41	---	---	---	---	capture	Missense_Mutation	SNP	79296158	79296158	RASGRF1	15	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	12967	254
PHLPP2	23035	broad.mit.edu	37	16	71689260	71689260	+	Missense_Mutation	SNP	C	T	T			TCGA-41-3392-01	TCGA-41-3392-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:71689260C>T	uc002fax.2	-	16	2474	c.2468G>A	c.(2467-2469)CGA>CAA	p.R823Q	PHLPP2_uc002fav.2_RNA|PHLPP2_uc010cgf.2_Missense_Mutation_p.R756Q	NM_015020	NP_055835	Q6ZVD8	PHLP2_HUMAN	PH domain and leucine rich repeat protein	823	PP2C-like.					cytoplasm|membrane|nucleus	metal ion binding|phosphoprotein phosphatase activity			ovary(1)|central_nervous_system(1)	2						CTCCTCATTTCGGTCTCCATC	0.483													115	121	---	---	---	---	capture	Missense_Mutation	SNP	71689260	71689260	PHLPP2	16	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	11758	254
CDH15	1013	broad.mit.edu	37	16	89256722	89256722	+	Silent	SNP	G	A	A			TCGA-41-3392-01	TCGA-41-3392-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:89256722G>A	uc002fmt.2	+	8	1127	c.1050G>A	c.(1048-1050)GCG>GCA	p.A350A		NM_004933	NP_004924	P55291	CAD15_HUMAN	cadherin 15 preproprotein	350	Cadherin 3.|Extracellular (Potential).				adherens junction organization|cell junction assembly|homophilic cell adhesion|muscle cell differentiation|positive regulation of muscle cell differentiation	integral to membrane|plasma membrane	calcium ion binding			skin(1)	1				BRCA - Breast invasive adenocarcinoma(80;0.0261)		CGCTGCAGGCGGCTGCCCTTA	0.637													9	8	---	---	---	---	capture	Silent	SNP	89256722	89256722	CDH15	16	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	3071	254
CARD14	79092	broad.mit.edu	37	17	78157817	78157817	+	Missense_Mutation	SNP	G	A	A			TCGA-41-3392-01	TCGA-41-3392-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:78157817G>A	uc002jxw.1	+	4	650	c.455G>A	c.(454-456)CGG>CAG	p.R152Q	CARD14_uc002jxt.1_RNA|CARD14_uc002jxv.2_Missense_Mutation_p.R152Q|CARD14_uc010wud.1_RNA	NM_024110	NP_077015	Q9BXL6	CAR14_HUMAN	caspase recruitment domain protein 14 isoform 1	152	Potential.				activation of NF-kappaB-inducing kinase activity|positive regulation of protein phosphorylation|regulation of apoptosis	aggresome|cytoplasm|plasma membrane	CARD domain binding			ovary(4)|skin(1)	5	all_neural(118;0.0952)		OV - Ovarian serous cystadenocarcinoma(97;0.017)|BRCA - Breast invasive adenocarcinoma(99;0.0908)			CTGCTGCGGCGGTGCCAGCAG	0.667													2	3	---	---	---	---	capture	Missense_Mutation	SNP	78157817	78157817	CARD14	17	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	2622	254
BAIAP2	10458	broad.mit.edu	37	17	79080620	79080620	+	Silent	SNP	C	T	T			TCGA-41-3392-01	TCGA-41-3392-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:79080620C>T	uc002jzg.2	+	12	1521	c.1413C>T	c.(1411-1413)TAC>TAT	p.Y471Y	BAIAP2_uc002jyz.3_Silent_p.Y471Y|BAIAP2_uc002jza.2_Silent_p.Y471Y|BAIAP2_uc002jzc.2_Silent_p.Y472Y|BAIAP2_uc002jzb.2_Silent_p.Y228Y|BAIAP2_uc002jzd.2_Silent_p.Y471Y|BAIAP2_uc002jzf.2_Silent_p.Y471Y|BAIAP2_uc002jze.2_Silent_p.Y504Y|BAIAP2_uc010wuh.1_Silent_p.Y393Y|BAIAP2_uc002jzh.2_Silent_p.Y472Y|BAIAP2_uc010wui.1_Silent_p.Y334Y	NM_017451	NP_059345	Q9UQB8	BAIP2_HUMAN	BAI1-associated protein 2 isoform 2	471					axonogenesis|filopodium assembly|insulin receptor signaling pathway|regulation of actin cytoskeleton organization|response to bacterium	cell junction|cytoskeleton|cytosol|filopodium|nucleus|ruffle	cytoskeletal adaptor activity|proline-rich region binding|protein C-terminus binding|SH3 domain binding				0	all_neural(118;0.101)		BRCA - Breast invasive adenocarcinoma(99;0.0228)|OV - Ovarian serous cystadenocarcinoma(97;0.0524)			CCCCCGATTACGGCGCCGCCT	0.697													20	27	---	---	---	---	capture	Silent	SNP	79080620	79080620	BAIAP2	17	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	1290	254
FECH	2235	broad.mit.edu	37	18	55230200	55230200	+	Missense_Mutation	SNP	T	C	C			TCGA-41-3392-01	TCGA-41-3392-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:55230200T>C	uc002lgq.3	-	6	728	c.611A>G	c.(610-612)AAT>AGT	p.N204S	FECH_uc002lgp.3_Missense_Mutation_p.N210S|FECH_uc002lgr.3_Missense_Mutation_p.N62S	NM_000140	NP_000131	P22830	HEMH_HUMAN	ferrochelatase isoform b precursor	204					generation of precursor metabolites and energy|heme biosynthetic process|protoporphyrinogen IX metabolic process|response to light stimulus	mitochondrial inner membrane|mitochondrial matrix	2 iron, 2 sulfur cluster binding|ferrochelatase activity|ferrous iron binding|protein binding			central_nervous_system(1)	1		Colorectal(73;0.227)				GTAAATGGCATTTAAGCTGCT	0.408													15	36	---	---	---	---	capture	Missense_Mutation	SNP	55230200	55230200	FECH	18	T	C	C	C	1	0	0	0	0	1	0	0	0	676	52	3	3	5754	254
ZNF236	7776	broad.mit.edu	37	18	74635065	74635065	+	Missense_Mutation	SNP	G	A	A			TCGA-41-3392-01	TCGA-41-3392-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:74635065G>A	uc002lmi.2	+	21	3788	c.3590G>A	c.(3589-3591)TGT>TAT	p.C1197Y	ZNF236_uc002lmj.2_RNA	NM_007345	NP_031371	Q9UL36	ZN236_HUMAN	zinc finger protein 236	1197	C2H2-type 23.				cellular response to glucose stimulus	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(4)	4		Prostate(75;0.0405)|Esophageal squamous(42;0.129)|Melanoma(33;0.132)		OV - Ovarian serous cystadenocarcinoma(15;4.36e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0686)		CCATACAAATGTGATGAATGT	0.368													7	75	---	---	---	---	capture	Missense_Mutation	SNP	74635065	74635065	ZNF236	18	G	A	A	A	1	0	0	0	0	1	0	0	0	624	48	2	2	17669	254
PLIN4	729359	broad.mit.edu	37	19	4511216	4511216	+	Missense_Mutation	SNP	G	T	T			TCGA-41-3392-01	TCGA-41-3392-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:4511216G>T	uc002mar.1	-	3	2714	c.2714C>A	c.(2713-2715)ACC>AAC	p.T905N	PLIN4_uc010dub.1_5'UTR	NM_001080400	NP_001073869	Q96Q06	PLIN4_HUMAN	plasma membrane associated protein, S3-12	905	27 X 33 AA approximate tandem repeat.|25.					lipid particle|plasma membrane					0						AGTCTTGCTGGTGTCCACGCC	0.577													49	86	---	---	---	---	capture	Missense_Mutation	SNP	4511216	4511216	PLIN4	19	G	T	T	T	1	0	0	0	0	1	0	0	0	572	44	4	4	11995	254
CYP4F8	11283	broad.mit.edu	37	19	15728930	15728930	+	Silent	SNP	C	T	T			TCGA-41-3392-01	TCGA-41-3392-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:15728930C>T	uc002nbi.2	+	3	382	c.318C>T	c.(316-318)ATC>ATT	p.I106I	CYP4F8_uc010xoi.1_Silent_p.I106I|CYP4F8_uc010xoj.1_Intron	NM_007253	NP_009184	P98187	CP4F8_HUMAN	cytochrome P450, family 4, subfamily F,	106					prostaglandin metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	alkane 1-monooxygenase activity|aromatase activity|electron carrier activity|heme binding|oxygen binding|protein binding			large_intestine(1)	1						ACCCTGACATCGTCCGATCTG	0.567													73	94	---	---	---	---	capture	Silent	SNP	15728930	15728930	CYP4F8	19	C	T	T	T	1	0	0	0	0	0	0	0	1	395	31	1	1	4151	254
KCNA7	3743	broad.mit.edu	37	19	49573469	49573469	+	Missense_Mutation	SNP	C	T	T			TCGA-41-3392-01	TCGA-41-3392-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:49573469C>T	uc002pmg.2	-	2	1578	c.1222G>A	c.(1222-1224)GAA>AAA	p.E408K		NM_031886	NP_114092	Q96RP8	KCNA7_HUMAN	potassium voltage-gated channel, shaker-related	408						voltage-gated potassium channel complex	voltage-gated potassium channel activity			central_nervous_system(1)	1		all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_epithelial(76;3.83e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		all cancers(93;0.000397)|OV - Ovarian serous cystadenocarcinoma(262;0.000519)|GBM - Glioblastoma multiforme(486;0.00541)|Epithelial(262;0.0441)		CCAGCCTCTTCGCCCTCTGTC	0.597													20	47	---	---	---	---	capture	Missense_Mutation	SNP	49573469	49573469	KCNA7	19	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	7930	254
RPL13A	23521	broad.mit.edu	37	19	49994303	49994303	+	Missense_Mutation	SNP	C	T	T			TCGA-41-3392-01	TCGA-41-3392-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:49994303C>T	uc002pny.2	+	6	371	c.349C>T	c.(349-351)CGG>TGG	p.R117W	RPL13A_uc002pnz.2_Missense_Mutation_p.R56W|RPL13A_uc002poa.2_Missense_Mutation_p.R107W|SNORD35A_uc010enb.1_5'Flank	NM_012423	NP_036555	P40429	RL13A_HUMAN	ribosomal protein L13a	117					endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosol|large ribosomal subunit	structural constituent of ribosome				0		all_lung(116;1.62e-07)|Lung NSC(112;8.47e-07)|all_neural(266;0.0381)|Ovarian(192;0.0392)		OV - Ovarian serous cystadenocarcinoma(262;0.00154)|GBM - Glioblastoma multiforme(486;0.0246)		ACAGAAAAAGCGGATGGTGGT	0.562													8	72	---	---	---	---	capture	Missense_Mutation	SNP	49994303	49994303	RPL13A	19	C	T	T	T	1	0	0	0	0	1	0	0	0	347	27	1	1	13452	254
PRPF31	26121	broad.mit.edu	37	19	54627985	54627985	+	Missense_Mutation	SNP	C	T	T			TCGA-41-3392-01	TCGA-41-3392-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:54627985C>T	uc002qdh.2	+	8	1201	c.805C>T	c.(805-807)CCC>TCC	p.P269S	PRPF31_uc010yek.1_Missense_Mutation_p.P269S	NM_015629	NP_056444	Q8WWY3	PRP31_HUMAN	pre-mRNA processing factor 31 homolog	269	Nop.				assembly of spliceosomal tri-snRNP	Cajal body|MLL1 complex|nuclear speck|U4 snRNP|U4/U6 x U5 tri-snRNP complex|U4atac snRNP	RNA binding|snRNP binding			ovary(1)	1	all_cancers(19;0.00681)|all_epithelial(19;0.00362)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)					CTCAGTGCTGCCCCACACCGG	0.672													6	64	---	---	---	---	capture	Missense_Mutation	SNP	54627985	54627985	PRPF31	19	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	12462	254
PPP1R12C	54776	broad.mit.edu	37	19	55603589	55603589	+	Splice_Site	SNP	C	G	G			TCGA-41-3392-01	TCGA-41-3392-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:55603589C>G	uc002qix.2	-	19	2176	c.2160_splice	c.e19+1	p.Q720_splice	PPP1R12C_uc010yfs.1_Splice_Site_p.Q645_splice|PPP1R12C_uc002qiy.2_Splice_Site_p.Q718_splice	NM_017607	NP_060077	Q9BZL4	PP12C_HUMAN	protein phosphatase 1, regulatory subunit 12C							cytoplasm				ovary(1)|central_nervous_system(1)	2			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0449)		GGCGCCCTTACCTGCGTGGCC	0.721													2	9	---	---	---	---	capture	Splice_Site	SNP	55603589	55603589	PPP1R12C	19	C	G	G	G	1	0	0	0	0	0	0	1	0	234	18	5	4	12257	254
NBAS	51594	broad.mit.edu	37	2	15615941	15615941	+	Missense_Mutation	SNP	G	A	A			TCGA-41-3392-01	TCGA-41-3392-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:15615941G>A	uc002rcc.1	-	14	1237	c.1211C>T	c.(1210-1212)GCT>GTT	p.A404V	NBAS_uc002rcd.1_RNA	NM_015909	NP_056993	A2RRP1	NBAS_HUMAN	neuroblastoma-amplified protein	404										ovary(2)|liver(1)|skin(1)	4						AGAGCATCGAGCTAAAGTCAC	0.398													7	70	---	---	---	---	capture	Missense_Mutation	SNP	15615941	15615941	NBAS	2	G	A	A	A	1	0	0	0	0	1	0	0	0	442	34	2	2	10093	254
WDR92	116143	broad.mit.edu	37	2	68358402	68358402	+	Missense_Mutation	SNP	C	G	G			TCGA-41-3392-01	TCGA-41-3392-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:68358402C>G	uc002see.1	-	8	1123	c.1042G>C	c.(1042-1044)GTA>CTA	p.V348L	WDR92_uc002sed.1_Intron	NM_138458	NP_612467	Q96MX6	WDR92_HUMAN	monad	348	WD 6.				apoptosis|histone lysine methylation		methylated histone residue binding				0						ACGATCAGTACTCTCACCGTT	0.323													20	201	---	---	---	---	capture	Missense_Mutation	SNP	68358402	68358402	WDR92	2	C	G	G	G	1	0	0	0	0	1	0	0	0	260	20	4	4	17220	254
TTC31	64427	broad.mit.edu	37	2	74710499	74710499	+	Missense_Mutation	SNP	C	T	T			TCGA-41-3392-01	TCGA-41-3392-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:74710499C>T	uc002slt.2	+	2	114	c.91C>T	c.(91-93)CTT>TTT	p.L31F	TTC31_uc002sls.2_5'UTR|TTC31_uc010yrv.1_5'UTR|TTC31_uc002slu.2_5'UTR|CCDC142_uc002slo.2_5'Flank|CCDC142_uc002slq.2_5'Flank|CCDC142_uc002slr.2_5'Flank|CCDC142_uc002slp.2_5'Flank	NM_022492	NP_071937	Q49AM3	TTC31_HUMAN	tetratricopeptide repeat domain 31	31							binding				0						TGCACCCAAACTTTGCAAGGA	0.582											OREG0014719	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	31	91	---	---	---	---	capture	Missense_Mutation	SNP	74710499	74710499	TTC31	2	C	T	T	T	1	0	0	0	0	1	0	0	0	260	20	2	2	16582	254
RAB3GAP1	22930	broad.mit.edu	37	2	135890504	135890504	+	Missense_Mutation	SNP	G	C	C			TCGA-41-3392-01	TCGA-41-3392-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:135890504G>C	uc002tuj.2	+	14	1301	c.1276G>C	c.(1276-1278)GGA>CGA	p.G426R	RAB3GAP1_uc010fnf.2_Missense_Mutation_p.G426R|RAB3GAP1_uc010fng.2_Missense_Mutation_p.G251R|RAB3GAP1_uc010fnh.1_RNA	NM_012233	NP_036365	Q15042	RB3GP_HUMAN	RAB3 GTPase-activating protein	426						centrosome|nucleus|soluble fraction	Rab GTPase activator activity|Rab GTPase binding			ovary(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(221;0.117)		ACCATTAGATGGAACTACTTC	0.308													4	134	---	---	---	---	capture	Missense_Mutation	SNP	135890504	135890504	RAB3GAP1	2	G	C	C	C	1	0	0	0	0	1	0	0	0	611	47	4	4	12830	254
NEB	4703	broad.mit.edu	37	2	152580858	152580858	+	Nonsense_Mutation	SNP	C	T	T			TCGA-41-3392-01	TCGA-41-3392-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:152580858C>T	uc010fnx.2	-	8	719	c.528G>A	c.(526-528)TGG>TGA	p.W176*		NM_004543	NP_004534	P20929	NEBU_HUMAN	nebulin isoform 3	176	Nebulin 3.				muscle filament sliding|muscle organ development|regulation of actin filament length|somatic muscle development	actin cytoskeleton|cytosol|Z disc	actin binding|structural constituent of muscle			ovary(8)|large_intestine(5)|breast(3)|central_nervous_system(2)|skin(1)|pancreas(1)	20				BRCA - Breast invasive adenocarcinoma(221;0.219)		TGGTGTCTTCCCAGTTCTGCT	0.493													11	23	---	---	---	---	capture	Nonsense_Mutation	SNP	152580858	152580858	NEB	2	C	T	T	T	1	0	0	0	0	0	1	0	0	286	22	5	2	10209	254
TTN	7273	broad.mit.edu	37	2	179610717	179610717	+	Missense_Mutation	SNP	C	T	T			TCGA-41-3392-01	TCGA-41-3392-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179610717C>T	uc002unb.2	-	46	16634	c.16410G>A	c.(16408-16410)ATG>ATA	p.M5470I	TTN_uc010zfg.1_Intron|TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Intron	NM_133379	NP_596870	Q8WZ42	TITIN_HUMAN	titin isoform novex-3	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CAGAATCTCCCATGGTGAGGA	0.398													15	248	---	---	---	---	capture	Missense_Mutation	SNP	179610717	179610717	TTN	2	C	T	T	T	1	0	0	0	0	1	0	0	0	273	21	2	2	16617	254
C2orf83	56918	broad.mit.edu	37	2	228476292	228476292	+	Missense_Mutation	SNP	T	A	A			TCGA-41-3392-01	TCGA-41-3392-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:228476292T>A	uc002vph.2	-	3	506	c.271A>T	c.(271-273)ATT>TTT	p.I91F	C2orf83_uc010zlu.1_3'UTR	NM_020161	NP_064546	Q53S99	CB083_HUMAN	hypothetical protein LOC56918 isoform 1	91						membrane	folic acid binding|reduced folate carrier activity				0						GCAGGGTGAATGAAGGTCAGC	0.517													11	99	---	---	---	---	capture	Missense_Mutation	SNP	228476292	228476292	C2orf83	2	T	A	A	A	1	0	0	0	0	1	0	0	0	663	51	4	4	2178	254
PTPRT	11122	broad.mit.edu	37	20	41100999	41100999	+	Missense_Mutation	SNP	G	A	A			TCGA-41-3392-01	TCGA-41-3392-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:41100999G>A	uc002xkg.2	-	8	1541	c.1357C>T	c.(1357-1359)CGC>TGC	p.R453C	PTPRT_uc010ggj.2_Missense_Mutation_p.R453C	NM_007050	NP_008981	O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T	453	Extracellular (Potential).|Fibronectin type-III 2.		R -> C (in a gastric cancer).		homophilic cell adhesion|transmembrane receptor protein tyrosine kinase signaling pathway	cell surface|integral to membrane|plasma membrane	alpha-catenin binding|beta-catenin binding|cadherin binding|delta-catenin binding|gamma-catenin binding|protein tyrosine phosphatase activity|receptor activity			skin(8)|ovary(7)|lung(5)	20		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				ATGAAGGGGCGCAGGCCTCGC	0.607													48	69	---	---	---	---	capture	Missense_Mutation	SNP	41100999	41100999	PTPRT	20	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	12707	254
SLC13A3	64849	broad.mit.edu	37	20	45204315	45204315	+	Missense_Mutation	SNP	G	C	C			TCGA-41-3392-01	TCGA-41-3392-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:45204315G>C	uc002xsf.1	-	10	1267	c.1229C>G	c.(1228-1230)ACA>AGA	p.T410R	SLC13A3_uc010ghn.1_Missense_Mutation_p.T379R|SLC13A3_uc010zxw.1_Missense_Mutation_p.T360R|SLC13A3_uc002xsg.1_Missense_Mutation_p.T363R|SLC13A3_uc010gho.1_Missense_Mutation_p.T328R|SLC13A3_uc010zxx.1_Missense_Mutation_p.T312R|SLC13A3_uc010zxv.1_Intron	NM_022829	NP_073740	Q8WWT9	S13A3_HUMAN	solute carrier family 13 member 3 isoform a	410	Cytoplasmic (Potential).					integral to membrane|plasma membrane	high affinity sodium:dicarboxylate symporter activity			ovary(1)	1		Myeloproliferative disorder(115;0.0122)			Succinic acid(DB00139)	CTCTGTCTCTGTGTTGGGAGC	0.622													8	3	---	---	---	---	capture	Missense_Mutation	SNP	45204315	45204315	SLC13A3	20	G	C	C	C	1	0	0	0	0	1	0	0	0	624	48	4	4	14286	254
KRTAP10-1	386677	broad.mit.edu	37	21	45959481	45959481	+	Missense_Mutation	SNP	C	T	T			TCGA-41-3392-01	TCGA-41-3392-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:45959481C>T	uc002zfh.1	-	1	598	c.553G>A	c.(553-555)GTG>ATG	p.V185M	C21orf29_uc002zfe.1_Intron|C21orf29_uc010gpv.1_Intron	NM_198691	NP_941964	P60331	KR101_HUMAN	keratin associated protein 10-1	185	16.|24 X 5 AA repeats of C-C-X(3).					keratin filament				skin(1)	1						CGGACGGGCACGCAGCAGGCC	0.627													55	115	---	---	---	---	capture	Missense_Mutation	SNP	45959481	45959481	KRTAP10-1	21	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	8425	254
RIMBP3	85376	broad.mit.edu	37	22	20458153	20458153	+	Missense_Mutation	SNP	G	A	A			TCGA-41-3392-01	TCGA-41-3392-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:20458153G>A	uc002zsd.3	-	1	3634	c.3149C>T	c.(3148-3150)ACG>ATG	p.T1050M		NM_015672	NP_056487			RIMS binding protein 3												0	Colorectal(54;0.0993)|Melanoma(16;0.165)		LUSC - Lung squamous cell carcinoma(15;0.0405)|Lung(15;0.224)			CCGGTAGTGCGTGCCGGGGCA	0.642													3	34	---	---	---	---	capture	Missense_Mutation	SNP	20458153	20458153	RIMBP3	22	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	13256	254
CABIN1	23523	broad.mit.edu	37	22	24439394	24439394	+	Missense_Mutation	SNP	A	G	G			TCGA-41-3392-01	TCGA-41-3392-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:24439394A>G	uc002zzi.1	+	6	501	c.374A>G	c.(373-375)AAC>AGC	p.N125S	CABIN1_uc002zzj.1_Missense_Mutation_p.N125S|CABIN1_uc002zzl.1_Missense_Mutation_p.N125S|CABIN1_uc010guk.1_Missense_Mutation_p.N80S|CABIN1_uc002zzk.1_Missense_Mutation_p.N80S	NM_012295	NP_036427	Q9Y6J0	CABIN_HUMAN	calcineurin binding protein 1	125	TPR 3.				cell surface receptor linked signaling pathway|chromatin modification	nucleus	protein phosphatase inhibitor activity			ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	5						ACAGATGTCAACCTCTGGTAT	0.443													46	53	---	---	---	---	capture	Missense_Mutation	SNP	24439394	24439394	CABIN1	22	A	G	G	G	1	0	0	0	0	1	0	0	0	26	2	3	3	2504	254
TADA3	10474	broad.mit.edu	37	3	9825867	9825867	+	Silent	SNP	G	A	A			TCGA-41-3392-01	TCGA-41-3392-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:9825867G>A	uc003bsx.1	-	8	1499	c.951C>T	c.(949-951)CGC>CGT	p.R317R	TADA3_uc010hcn.1_Silent_p.R317R|TADA3_uc003bsy.2_Silent_p.R317R|TADA3_uc003bsw.1_Silent_p.R146R	NM_006354	NP_006345	O75528	TADA3_HUMAN	transcriptional adaptor 3 isoform a	317					estrogen receptor signaling pathway|histone H3 acetylation|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter	Ada2/Gcn5/Ada3 transcription activator complex|STAGA complex|transcription factor TFTC complex	ligand-dependent nuclear receptor binding|protein domain specific binding|sequence-specific DNA binding transcription factor activity				0						CCTCCTTGATGCGGCTCTCCA	0.622													31	36	---	---	---	---	capture	Silent	SNP	9825867	9825867	TADA3	3	G	A	A	A	1	0	0	0	0	0	0	0	1	587	46	2	2	15400	254
PLCL2	23228	broad.mit.edu	37	3	17052411	17052411	+	Missense_Mutation	SNP	A	T	T			TCGA-41-3392-01	TCGA-41-3392-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:17052411A>T	uc011awc.1	+	5	1654	c.1549A>T	c.(1549-1551)ATT>TTT	p.I517F	PLCL2_uc010het.1_Missense_Mutation_p.H126L|PLCL2_uc011awd.1_Missense_Mutation_p.I399F	NM_001144382	NP_001137854	Q9UPR0	PLCL2_HUMAN	phospholipase C-like 2 isoform 1	525	PI-PLC X-box.				intracellular signal transduction|lipid metabolic process	cytoplasm	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity			skin(2)|ovary(1)|lung(1)	4						CCACTGTTCCATTAAACAACA	0.373													44	68	---	---	---	---	capture	Missense_Mutation	SNP	17052411	17052411	PLCL2	3	A	T	T	T	1	0	0	0	0	1	0	0	0	104	8	4	4	11943	254
SEC22C	9117	broad.mit.edu	37	3	42602655	42602655	+	Silent	SNP	C	G	G			TCGA-41-3392-01	TCGA-41-3392-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:42602655C>G	uc003clj.2	-	4	598	c.480G>C	c.(478-480)GTG>GTC	p.V160V	SEC22C_uc003clh.2_Silent_p.V160V|SEC22C_uc011azo.1_Silent_p.V90V|SEC22C_uc010hic.2_Silent_p.V160V|SEC22C_uc003cli.2_Silent_p.V160V	NM_032970	NP_116752	Q9BRL7	SC22C_HUMAN	SEC22 vesicle trafficking protein homolog C	160	Cytoplasmic (Potential).				ER to Golgi vesicle-mediated transport|protein transport	endoplasmic reticulum membrane|integral to membrane					0				KIRC - Kidney renal clear cell carcinoma(284;0.222)		CCCCATTTGCCACATCTGTGT	0.468													62	78	---	---	---	---	capture	Silent	SNP	42602655	42602655	SEC22C	3	C	G	G	G	1	0	0	0	0	0	0	0	1	262	21	4	4	13883	254
ARIH2	10425	broad.mit.edu	37	3	48965232	48965232	+	Missense_Mutation	SNP	G	T	T			TCGA-41-3392-01	TCGA-41-3392-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:48965232G>T	uc003cvb.2	+	3	553	c.241G>T	c.(241-243)GCT>TCT	p.A81S	ARIH2_uc003cvc.2_Missense_Mutation_p.A81S|ARIH2_uc003cvf.2_5'UTR|ARIH2_uc010hkl.2_Missense_Mutation_p.A81S|ARIH2_uc003cvd.1_Missense_Mutation_p.A81S|ARIH2_uc003cve.1_Missense_Mutation_p.A81S	NM_006321	NP_006312	O95376	ARI2_HUMAN	ariadne homolog 2	81					developmental cell growth|hemopoietic stem cell proliferation|protein K48-linked ubiquitination|protein K63-linked ubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	nucleic acid binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;9.42e-05)|Kidney(197;0.00258)|KIRC - Kidney renal clear cell carcinoma(197;0.00269)		GACCAGCTTAGCTTCTGTCCT	0.483													33	81	---	---	---	---	capture	Missense_Mutation	SNP	48965232	48965232	ARIH2	3	G	T	T	T	1	0	0	0	0	1	0	0	0	442	34	4	4	917	254
ROBO2	6092	broad.mit.edu	37	3	77147196	77147196	+	Silent	SNP	G	A	A			TCGA-41-3392-01	TCGA-41-3392-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:77147196G>A	uc003dpy.3	+	2	736	c.93G>A	c.(91-93)CCG>CCA	p.P31P	ROBO2_uc003dpz.2_Silent_p.P31P|ROBO2_uc011bgj.1_RNA|ROBO2_uc011bgk.1_Silent_p.P31P	NM_002942	NP_002933	Q9HCK4	ROBO2_HUMAN	roundabout, axon guidance receptor, homolog 2	31	Ig-like C2-type 1.|Extracellular (Potential).				apoptosis involved in luteolysis|axon midline choice point recognition|cellular response to hormone stimulus|homophilic cell adhesion|metanephros development|negative regulation of negative chemotaxis|negative regulation of synaptogenesis|olfactory bulb interneuron development|positive regulation of axonogenesis|retinal ganglion cell axon guidance|ureteric bud development	axolemma|cell surface|integral to membrane	axon guidance receptor activity|identical protein binding			lung(5)|skin(3)|ovary(1)|large_intestine(1)|liver(1)	11				Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)		ACTTTCCCCCGCGGATTGTGG	0.537													5	21	---	---	---	---	capture	Silent	SNP	77147196	77147196	ROBO2	3	G	A	A	A	1	0	0	0	0	0	0	0	1	494	38	1	1	13406	254
ADCY5	111	broad.mit.edu	37	3	123036910	123036910	+	Missense_Mutation	SNP	C	T	T			TCGA-41-3392-01	TCGA-41-3392-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:123036910C>T	uc003egh.1	-	11	2311	c.2311G>A	c.(2311-2313)GTC>ATC	p.V771I	ADCY5_uc003egg.1_Missense_Mutation_p.V404I|ADCY5_uc003egi.1_Missense_Mutation_p.V330I	NM_183357	NP_899200	O95622	ADCY5_HUMAN	adenylate cyclase 5	771	Helical; (Potential).				activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane|plasma membrane	adenylate cyclase activity|ATP binding|metal ion binding			ovary(4)	4				GBM - Glioblastoma multiforme(114;0.0342)		AAGAGGAAGACGAGCGAGGCA	0.602													4	61	---	---	---	---	capture	Missense_Mutation	SNP	123036910	123036910	ADCY5	3	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	297	254
TNFSF10	8743	broad.mit.edu	37	3	172241153	172241153	+	Missense_Mutation	SNP	C	A	A			TCGA-41-3392-01	TCGA-41-3392-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:172241153C>A	uc003fid.2	-	1	117	c.22G>T	c.(22-24)GGG>TGG	p.G8W	TNFSF10_uc003fie.2_Missense_Mutation_p.G8W|TNFSF10_uc010hwu.1_RNA	NM_003810	NP_003801	P50591	TNF10_HUMAN	tumor necrosis factor (ligand) superfamily,	8	Cytoplasmic (Potential).				activation of caspase activity|activation of pro-apoptotic gene products|cell-cell signaling|immune response|induction of apoptosis by extracellular signals|positive regulation of I-kappaB kinase/NF-kappaB cascade|signal transduction	extracellular space|integral to plasma membrane|soluble fraction	cytokine activity|metal ion binding|tumor necrosis factor receptor binding			skin(4)|lung(1)	5	Ovarian(172;0.00197)|Breast(254;0.158)		Lung(28;1.67e-15)|LUSC - Lung squamous cell carcinoma(14;1.48e-14)|STAD - Stomach adenocarcinoma(35;0.235)			CTGGGTCCCCCCTGGACCTCC	0.527													38	83	---	---	---	---	capture	Missense_Mutation	SNP	172241153	172241153	TNFSF10	3	C	A	A	A	1	0	0	0	0	1	0	0	0	286	22	4	4	16184	254
MUC4	4585	broad.mit.edu	37	3	195505836	195505836	+	Missense_Mutation	SNP	G	C	C			TCGA-41-3392-01	TCGA-41-3392-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:195505836G>C	uc011bto.1	-	3	12691	c.12231C>G	c.(12229-12231)CAC>CAG	p.H4077Q	MUC4_uc003fva.2_5'Flank|MUC4_uc003fvb.2_5'Flank|MUC4_uc003fvc.2_5'Flank|MUC4_uc003fvd.2_5'Flank|MUC4_uc003fve.2_5'Flank|MUC4_uc010hzr.2_5'Flank|MUC4_uc011btf.1_Intron|MUC4_uc011btg.1_Intron|MUC4_uc011bth.1_Intron|MUC4_uc011bti.1_Intron|MUC4_uc011btj.1_Intron|MUC4_uc011btk.1_Intron|MUC4_uc011btl.1_Intron|MUC4_uc011btm.1_Intron|MUC4_uc011btn.1_Intron|MUC4_uc003fvo.2_Intron|MUC4_uc003fvp.2_Intron|MUC4_uc010hzu.1_Intron	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GAGGGGTGGCGTGACCTGTGG	0.597													4	3	---	---	---	---	capture	Missense_Mutation	SNP	195505836	195505836	MUC4	3	G	C	C	C	1	0	0	0	0	1	0	0	0	516	40	4	4	9888	254
MUC4	4585	broad.mit.edu	37	3	195516064	195516064	+	Missense_Mutation	SNP	C	T	T			TCGA-41-3392-01	TCGA-41-3392-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:195516064C>T	uc011bto.1	-	2	2847	c.2387G>A	c.(2386-2388)CGA>CAA	p.R796Q	MUC4_uc003fvo.2_Intron|MUC4_uc003fvp.2_Intron|MUC4_uc010hzu.1_Missense_Mutation_p.R678Q	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a	801	Ser-rich.				cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TGAGGTGGTTCGTGACCCTGA	0.602													59	82	---	---	---	---	capture	Missense_Mutation	SNP	195516064	195516064	MUC4	3	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	9888	254
SH3TC1	54436	broad.mit.edu	37	4	8233729	8233729	+	Missense_Mutation	SNP	T	A	A			TCGA-41-3392-01	TCGA-41-3392-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:8233729T>A	uc003gkv.3	+	13	3078	c.2977T>A	c.(2977-2979)TGC>AGC	p.C993S	SH3TC1_uc003gkw.3_Missense_Mutation_p.C917S|SH3TC1_uc003gkx.3_RNA|SH3TC1_uc003gky.2_RNA	NM_018986	NP_061859	Q8TE82	S3TC1_HUMAN	SH3 domain and tetratricopeptide repeats 1	993							binding			large_intestine(2)|pancreas(1)	3						CCAGCGGCTGTGCCACTTCTA	0.642													34	59	---	---	---	---	capture	Missense_Mutation	SNP	8233729	8233729	SH3TC1	4	T	A	A	A	1	0	0	0	0	1	0	0	0	767	59	4	4	14154	254
CPEB2	132864	broad.mit.edu	37	4	15060838	15060838	+	Missense_Mutation	SNP	G	A	A			TCGA-41-3392-01	TCGA-41-3392-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:15060838G>A	uc003gni.1	+	9	1360	c.1273G>A	c.(1273-1275)GAT>AAT	p.D425N	CPEB2_uc003gnj.1_Missense_Mutation_p.D395N|CPEB2_uc003gnk.1_Missense_Mutation_p.D433N|CPEB2_uc003gnl.1_Missense_Mutation_p.D406N|CPEB2_uc003gnm.1_Missense_Mutation_p.D403N|CPEB2_uc003gnn.1_Missense_Mutation_p.D398N	NM_182485	NP_872291	Q7Z5Q1	CPEB2_HUMAN	cytoplasmic polyadenylation element binding	425					regulation of translation	cytoplasm	nucleotide binding|RNA binding			skin(1)	1						GAATTTAAGTGATAGTGATTT	0.373													20	150	---	---	---	---	capture	Missense_Mutation	SNP	15060838	15060838	CPEB2	4	G	A	A	A	1	0	0	0	0	1	0	0	0	585	45	2	2	3766	254
GABRA4	2557	broad.mit.edu	37	4	46979123	46979123	+	Missense_Mutation	SNP	C	T	T			TCGA-41-3392-01	TCGA-41-3392-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:46979123C>T	uc003gxg.2	-	5	671	c.532G>A	c.(532-534)GAT>AAT	p.D178N		NM_000809	NP_000800	P48169	GBRA4_HUMAN	gamma-aminobutyric acid A receptor, alpha 4	178	Extracellular (Probable).				gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			ovary(2)|upper_aerodigestive_tract(1)|breast(1)	4					Alprazolam(DB00404)|Ethchlorvynol(DB00189)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Lorazepam(DB00186)|Meprobamate(DB00371)|Midazolam(DB00683)	ATGGGAAAATCCACCAATCTC	0.333													32	37	---	---	---	---	capture	Missense_Mutation	SNP	46979123	46979123	GABRA4	4	C	T	T	T	1	0	0	0	0	1	0	0	0	390	30	2	2	6105	254
SLC10A4	201780	broad.mit.edu	37	4	48490671	48490671	+	Silent	SNP	C	T	T			TCGA-41-3392-01	TCGA-41-3392-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:48490671C>T	uc003gyc.2	+	3	1248	c.1029C>T	c.(1027-1029)CTC>CTT	p.L343L	ZAR1_uc003gyd.2_5'Flank	NM_152679	NP_689892	Q96EP9	NTCP4_HUMAN	solute carrier family 10, member 4	343	Cytoplasmic (Potential).					integral to membrane	bile acid:sodium symporter activity			central_nervous_system(1)	1						ATGTGCAGCTCTGTACAGCCA	0.473													79	126	---	---	---	---	capture	Silent	SNP	48490671	48490671	SLC10A4	4	C	T	T	T	1	0	0	0	0	0	0	0	1	405	32	2	2	14269	254
DNAH5	1767	broad.mit.edu	37	5	13886073	13886073	+	Missense_Mutation	SNP	C	T	T			TCGA-41-3392-01	TCGA-41-3392-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:13886073C>T	uc003jfd.2	-	18	2785	c.2743G>A	c.(2743-2745)GCA>ACA	p.A915T		NM_001369	NP_001360	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	915	Stem (By similarity).				microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31	Lung NSC(4;0.00476)					CATCTCTTACCTGAACTTTCA	0.289									Kartagener_syndrome				29	84	---	---	---	---	capture	Missense_Mutation	SNP	13886073	13886073	DNAH5	5	C	T	T	T	1	0	0	0	0	1	0	0	0	312	24	2	2	4561	254
CD14	929	broad.mit.edu	37	5	140012230	140012230	+	Silent	SNP	T	A	A			TCGA-41-3392-01	TCGA-41-3392-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140012230T>A	uc003lgi.1	-	2	693	c.339A>T	c.(337-339)CTA>CTT	p.L113L	CD14_uc003lgj.1_Silent_p.L113L	NM_000591	NP_000582	P08571	CD14_HUMAN	CD14 antigen precursor	113	LRR 2.				apoptosis|cellular response to lipopolysaccharide|cellular response to lipoteichoic acid|inflammatory response|innate immune response|phagocytosis|positive regulation of tumor necrosis factor production|Toll signaling pathway	anchored to membrane|plasma membrane	lipopolysaccharide binding|lipoteichoic acid binding|opsonin receptor activity|peptidoglycan receptor activity				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGGAGTACGCTAGCACACGCA	0.622													25	42	---	---	---	---	capture	Silent	SNP	140012230	140012230	CD14	5	T	A	A	A	1	0	0	0	0	0	0	0	1	678	53	4	4	2935	254
PCDHA1	56147	broad.mit.edu	37	5	140166089	140166089	+	Missense_Mutation	SNP	A	G	G			TCGA-41-3392-01	TCGA-41-3392-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140166089A>G	uc003lhb.2	+	1	214	c.214A>G	c.(214-216)AGG>GGG	p.R72G	PCDHA1_uc003lha.2_Missense_Mutation_p.R72G|PCDHA1_uc003lgz.2_Missense_Mutation_p.R72G	NM_018900	NP_061723	Q9Y5I3	PCDA1_HUMAN	protocadherin alpha 1 isoform 1 precursor	72	Cadherin 1.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	extracellular region|integral to plasma membrane	calcium ion binding|protein binding			skin(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CAAAACACACAGGGACCTTCT	0.592													11	157	---	---	---	---	capture	Missense_Mutation	SNP	140166089	140166089	PCDHA1	5	A	G	G	G	1	0	0	0	0	1	0	0	0	88	7	3	3	11422	254
PCDHA13	56136	broad.mit.edu	37	5	140263838	140263838	+	Missense_Mutation	SNP	C	T	T			TCGA-41-3392-01	TCGA-41-3392-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140263838C>T	uc003lif.2	+	1	1985	c.1985C>T	c.(1984-1986)ACG>ATG	p.T662M	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lhu.2_Intron|PCDHA10_uc003lhw.2_Intron|PCDHA10_uc003lhx.2_Intron|PCDHA11_uc003lia.2_Intron|PCDHA12_uc003lic.2_Intron|PCDHA13_uc003lie.1_Missense_Mutation_p.T662M|PCDHA13_uc003lid.2_Missense_Mutation_p.T662M	NM_018904	NP_061727	Q9Y5I0	PCDAD_HUMAN	protocadherin alpha 13 isoform 1 precursor	662	Cadherin 6.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(3)|skin(2)|central_nervous_system(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTGACGGCCACGGCAACGGTG	0.701													9	89	---	---	---	---	capture	Missense_Mutation	SNP	140263838	140263838	PCDHA13	5	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	11426	254
ODZ2	57451	broad.mit.edu	37	5	167420177	167420177	+	Silent	SNP	G	A	A			TCGA-41-3392-01	TCGA-41-3392-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:167420177G>A	uc010jjd.2	+	5	1176	c.1176G>A	c.(1174-1176)GCG>GCA	p.A392A	ODZ2_uc003lzq.2_Silent_p.A271A|ODZ2_uc003lzr.3_Silent_p.A201A	NM_001122679	NP_001116151			odz, odd Oz/ten-m homolog 2											ovary(6)|central_nervous_system(4)	10	Renal(175;0.00124)|Lung NSC(126;0.136)|all_lung(126;0.242)	Medulloblastoma(196;0.0241)|all_neural(177;0.026)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0444)|OV - Ovarian serous cystadenocarcinoma(192;0.0694)|Epithelial(171;0.124)		TTTTGCTGGCGTATTTCATAG	0.537													27	40	---	---	---	---	capture	Silent	SNP	167420177	167420177	ODZ2	5	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	10740	254
SLIT3	6586	broad.mit.edu	37	5	168149967	168149967	+	Silent	SNP	G	T	T			TCGA-41-3392-01	TCGA-41-3392-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:168149967G>T	uc003mab.2	-	22	2802	c.2382C>A	c.(2380-2382)ACC>ACA	p.T794T	SLIT3_uc010jjg.2_Silent_p.T794T	NM_003062	NP_003053	O75094	SLIT3_HUMAN	slit homolog 3 precursor	794	LRR 18.				apoptosis involved in luteolysis|axon extension involved in axon guidance|cellular response to hormone stimulus|negative chemotaxis|negative regulation of cell growth|negative regulation of chemokine-mediated signaling pathway|response to cortisol stimulus|Roundabout signaling pathway	extracellular space|mitochondrion	calcium ion binding|Roundabout binding			ovary(3)|skin(1)	4	Renal(175;0.000159)|Lung NSC(126;0.0174)|all_lung(126;0.0392)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TGTTACTGAAGGTGTAATTGG	0.478													39	113	---	---	---	---	capture	Silent	SNP	168149967	168149967	SLIT3	5	G	T	T	T	1	0	0	0	0	0	0	0	1	444	35	4	4	14633	254
MAS1L	116511	broad.mit.edu	37	6	29455303	29455303	+	Missense_Mutation	SNP	G	A	A			TCGA-41-3392-01	TCGA-41-3392-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:29455303G>A	uc011dlq.1	-	1	377	c.377C>T	c.(376-378)TCG>TTG	p.S126L		NM_052967	NP_443199	P35410	MAS1L_HUMAN	MAS1 oncogene-like	126	Helical; Name=2; (Potential).					cytoplasm|integral to membrane|nucleus|plasma membrane	G-protein coupled receptor activity			ovary(7)|lung(2)	9						CCCCACTGCCGAGCAGCAAAG	0.502													29	53	---	---	---	---	capture	Missense_Mutation	SNP	29455303	29455303	MAS1L	6	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	9234	254
SKIV2L	6499	broad.mit.edu	37	6	31937127	31937127	+	Missense_Mutation	SNP	C	T	T			TCGA-41-3392-01	TCGA-41-3392-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:31937127C>T	uc003nyn.1	+	27	3859	c.3470C>T	c.(3469-3471)ACG>ATG	p.T1157M	SKIV2L_uc011dou.1_Missense_Mutation_p.T999M|SKIV2L_uc011dov.1_Missense_Mutation_p.T964M|STK19_uc003nyt.2_5'Flank|STK19_uc011dow.1_5'Flank|STK19_uc011dox.1_5'Flank|STK19_uc003nyv.2_5'Flank|STK19_uc003nyw.2_5'Flank|STK19_uc010jtn.1_5'Flank	NM_006929	NP_008860	Q15477	SKIV2_HUMAN	superkiller viralicidic activity 2-like homolog	1157						nucleus	ATP binding|ATP-dependent RNA helicase activity|protein binding|RNA binding			ovary(1)|large_intestine(1)|breast(1)|central_nervous_system(1)	4						CTGAACCAGACGGTGGAGGAA	0.557													31	42	---	---	---	---	capture	Missense_Mutation	SNP	31937127	31937127	SKIV2L	6	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	14252	254
NOTCH4	4855	broad.mit.edu	37	6	32165183	32165183	+	Missense_Mutation	SNP	C	T	T			TCGA-41-3392-01	TCGA-41-3392-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:32165183C>T	uc003obb.2	-	27	5084	c.4945G>A	c.(4945-4947)GCT>ACT	p.A1649T	GPSM3_uc003oaz.2_5'Flank|NOTCH4_uc011dpt.1_Missense_Mutation_p.A58T|NOTCH4_uc003oba.2_Missense_Mutation_p.A309T|NOTCH4_uc011dpu.1_RNA|NOTCH4_uc011dpv.1_RNA|NOTCH4_uc011dpw.1_Missense_Mutation_p.A58T	NM_004557	NP_004548	Q99466	NOTC4_HUMAN	notch4 preproprotein	1649	Cytoplasmic (Potential).|ANK 1.				cell fate determination|embryo development|hemopoiesis|mammary gland development|negative regulation of endothelial cell differentiation|Notch receptor processing|Notch signaling pathway|patterning of blood vessels|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cell surface|cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to plasma membrane|nucleoplasm	calcium ion binding|protein heterodimerization activity|receptor activity			lung(8)|ovary(5)|breast(4)|central_nervous_system(3)|upper_aerodigestive_tract(1)|skin(1)	22						CGGCGGGCAGCGGTTGGCCGG	0.697													4	47	---	---	---	---	capture	Missense_Mutation	SNP	32165183	32165183	NOTCH4	6	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	10458	254
CD164	8763	broad.mit.edu	37	6	109690088	109690088	+	Missense_Mutation	SNP	C	A	A			TCGA-41-3392-01	TCGA-41-3392-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:109690088C>A	uc003pte.2	-	6	741	c.560G>T	c.(559-561)TGC>TTC	p.C187F	CD164_uc003ptd.2_Intron|CD164_uc003ptf.2_Missense_Mutation_p.C168F|CD164_uc011eap.1_Intron|CD164_uc010kdn.2_Missense_Mutation_p.C174F	NM_006016	NP_006007	Q04900	MUC24_HUMAN	CD164 molecule, sialomucin isoform 1	187	Cytoplasmic (Potential).				hemopoiesis|heterophilic cell-cell adhesion|immune response|muscle organ development|negative regulation of cell adhesion|negative regulation of cell proliferation|signal transduction	endosome membrane|extracellular region|integral to plasma membrane|lysosomal membrane	protein binding				0		all_cancers(87;4.65e-22)|all_epithelial(87;2.54e-20)|all_lung(197;1.6e-05)|Lung NSC(302;2.92e-05)|Colorectal(196;3.46e-05)|Ovarian(999;0.0175)		Epithelial(106;7.83e-46)|all cancers(137;1.15e-45)|OV - Ovarian serous cystadenocarcinoma(136;2.89e-26)|BRCA - Breast invasive adenocarcinoma(108;0.00128)|GBM - Glioblastoma multiforme(226;0.16)		TTTAGATTTGCAGAATTTATA	0.383													6	34	---	---	---	---	capture	Missense_Mutation	SNP	109690088	109690088	CD164	6	C	A	A	A	1	0	0	0	0	1	0	0	0	325	25	4	4	2940	254
DYNC1I1	1780	broad.mit.edu	37	7	95664970	95664970	+	Missense_Mutation	SNP	G	A	A			TCGA-41-3392-01	TCGA-41-3392-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:95664970G>A	uc003uoc.3	+	13	1598	c.1321G>A	c.(1321-1323)GCT>ACT	p.A441T	DYNC1I1_uc003uod.3_Missense_Mutation_p.A424T|DYNC1I1_uc003uob.2_Missense_Mutation_p.A404T|DYNC1I1_uc003uoe.3_Missense_Mutation_p.A421T|DYNC1I1_uc010lfl.2_Missense_Mutation_p.A430T	NM_004411	NP_004402	O14576	DC1I1_HUMAN	dynein, cytoplasmic 1, intermediate chain 1	441	WD 4.				vesicle transport along microtubule	condensed chromosome kinetochore|cytoplasmic dynein complex|microtubule|perinuclear region of cytoplasm|spindle pole|vesicle	microtubule binding|microtubule motor activity			ovary(3)|kidney(1)	4	all_cancers(62;9.39e-10)|all_epithelial(64;2.28e-09)|Lung NSC(181;0.165)|all_lung(186;0.191)		STAD - Stomach adenocarcinoma(171;0.0957)			CAAGCCTGTCGCTGTTACCGG	0.498													67	364	---	---	---	---	capture	Missense_Mutation	SNP	95664970	95664970	DYNC1I1	7	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	4797	254
RBM28	55131	broad.mit.edu	37	7	127964701	127964701	+	Missense_Mutation	SNP	G	A	A			TCGA-41-3392-01	TCGA-41-3392-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:127964701G>A	uc003vmp.2	-	12	1365	c.1250C>T	c.(1249-1251)GCG>GTG	p.A417V	RBM28_uc003vmo.2_Missense_Mutation_p.A34V|RBM28_uc011koj.1_Missense_Mutation_p.A276V|RBM28_uc011kok.1_Missense_Mutation_p.A364V	NM_018077	NP_060547	Q9NW13	RBM28_HUMAN	RNA binding motif protein 28	417	RRM 3.				mRNA processing|RNA splicing	Golgi apparatus|nucleolus|spliceosomal complex	nucleotide binding|RNA binding			ovary(2)	2						ACGGGTCACCGCCAAGTCAAC	0.488													9	521	---	---	---	---	capture	Missense_Mutation	SNP	127964701	127964701	RBM28	7	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	13023	254
AHCYL2	23382	broad.mit.edu	37	7	129040182	129040182	+	Missense_Mutation	SNP	G	A	A			TCGA-41-3392-01	TCGA-41-3392-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:129040182G>A	uc011kov.1	+	6	929	c.875G>A	c.(874-876)TGT>TAT	p.C292Y	AHCYL2_uc003vot.2_Missense_Mutation_p.C291Y|AHCYL2_uc003vov.2_Missense_Mutation_p.C189Y|AHCYL2_uc011kow.1_Missense_Mutation_p.C190Y|AHCYL2_uc011kox.1_Missense_Mutation_p.C189Y	NM_015328	NP_056143	Q96HN2	SAHH3_HUMAN	S-adenosylhomocysteine hydrolase-like 2 isoform	292					one-carbon metabolic process		adenosylhomocysteinase activity			ovary(2)	2						TTTTGGTGGTGTATCGATAGA	0.463													47	221	---	---	---	---	capture	Missense_Mutation	SNP	129040182	129040182	AHCYL2	7	G	A	A	A	1	0	0	0	0	1	0	0	0	624	48	2	2	411	254
DPP6	1804	broad.mit.edu	37	7	154561187	154561187	+	Missense_Mutation	SNP	A	G	G			TCGA-41-3392-01	TCGA-41-3392-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:154561187A>G	uc003wlk.2	+	9	1073	c.944A>G	c.(943-945)TAC>TGC	p.Y315C	DPP6_uc003wli.2_Missense_Mutation_p.Y251C|DPP6_uc003wlm.2_Missense_Mutation_p.Y253C|DPP6_uc011kvq.1_Missense_Mutation_p.Y208C	NM_130797	NP_570629	P42658	DPP6_HUMAN	dipeptidyl-peptidase 6 isoform 1	315	Extracellular (Potential).				cell death|proteolysis	integral to membrane	dipeptidyl-peptidase activity|serine-type peptidase activity			pancreas(3)|breast(1)	4	all_neural(206;0.181)	all_hematologic(28;0.0044)|all_lung(21;0.0176)|Lung NSC(21;0.0204)	OV - Ovarian serous cystadenocarcinoma(82;0.0562)			AGACTCGCCTACGCCGCCATC	0.527													10	138	---	---	---	---	capture	Missense_Mutation	SNP	154561187	154561187	DPP6	7	A	G	G	G	1	0	0	0	0	1	0	0	0	182	14	3	3	4685	254
ZFAT	57623	broad.mit.edu	37	8	135622736	135622736	+	Nonsense_Mutation	SNP	A	T	T			TCGA-41-3392-01	TCGA-41-3392-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:135622736A>T	uc003yup.2	-	4	786	c.611T>A	c.(610-612)TTA>TAA	p.L204*	ZFAT_uc003yun.2_Nonsense_Mutation_p.L192*|ZFAT_uc003yuo.2_Nonsense_Mutation_p.L192*|ZFAT_uc010meh.2_Nonsense_Mutation_p.L192*|ZFAT_uc010mei.2_RNA|ZFAT_uc003yuq.2_Nonsense_Mutation_p.L192*|ZFAT_uc010mej.2_Intron|ZFAT_uc003yur.2_Nonsense_Mutation_p.L192*	NM_020863	NP_065914	Q9P243	ZFAT_HUMAN	zinc finger protein 406 isoform ZFAT-1	204					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|nucleus	DNA binding|zinc ion binding			central_nervous_system(1)	1	all_epithelial(106;8.26e-19)|Lung NSC(106;3.47e-07)|all_lung(105;1.39e-06)|Ovarian(258;0.0102)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0432)			GTGTGCAGTTAAAACCACACT	0.502													6	94	---	---	---	---	capture	Nonsense_Mutation	SNP	135622736	135622736	ZFAT	8	A	T	T	T	1	0	0	0	0	0	1	0	0	169	13	5	4	17512	254
MORN5	254956	broad.mit.edu	37	9	124936831	124936831	+	Missense_Mutation	SNP	G	A	A			TCGA-41-3392-01	TCGA-41-3392-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:124936831G>A	uc004blw.2	+	4	426	c.364G>A	c.(364-366)GAT>AAT	p.D122N	MORN5_uc011lyn.1_Missense_Mutation_p.D122N|MORN5_uc011lyo.1_Silent_p.T84T	NM_198469	NP_940871	Q5VZ52	MORN5_HUMAN	MORN repeat containing 5	122											0						GGGCTATTACGATTGTGGAGA	0.463													14	115	---	---	---	---	capture	Missense_Mutation	SNP	124936831	124936831	MORN5	9	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	9623	254
XKRX	402415	broad.mit.edu	37	X	100169504	100169504	+	Silent	SNP	A	G	G			TCGA-41-3392-01	TCGA-41-3392-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:100169504A>G	uc004egn.2	-	3	1778	c.1173T>C	c.(1171-1173)TAT>TAC	p.Y391Y	XKRX_uc011mre.1_Silent_p.Y187Y	NM_212559	NP_997724	Q6PP77	XKR2_HUMAN	XK, Kell blood group complex subunit-related,	391	Helical; (Potential).					integral to membrane|plasma membrane				breast(1)	1						TGGAAATCAGATAAGCAATAA	0.403													5	113	---	---	---	---	capture	Silent	SNP	100169504	100169504	XKRX	23	A	G	G	G	1	0	0	0	0	0	0	0	1	154	12	3	3	17320	254
SLITRK4	139065	broad.mit.edu	37	X	142718880	142718880	+	Silent	SNP	C	T	T			TCGA-41-3392-01	TCGA-41-3392-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:142718880C>T	uc004fbx.2	-	2	421	c.45G>A	c.(43-45)TCG>TCA	p.S15S	SLITRK4_uc004fby.2_Silent_p.S15S	NM_173078	NP_775101	Q8IW52	SLIK4_HUMAN	slit and trk like 4 protein precursor	15						integral to membrane				upper_aerodigestive_tract(1)|large_intestine(1)	2	Acute lymphoblastic leukemia(192;6.56e-05)					CTGCATTTGTCGAAGAAATCA	0.388													12	43	---	---	---	---	capture	Silent	SNP	142718880	142718880	SLITRK4	23	C	T	T	T	1	0	0	0	0	0	0	0	1	392	31	1	1	14637	254
RPTN	126638	broad.mit.edu	37	1	152128025	152128028	+	Frame_Shift_Del	DEL	TGTC	-	-			TCGA-41-3392-01	TCGA-41-3392-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152128025_152128028delTGTC	uc001ezs.1	-	3	1612_1615	c.1547_1550delGACA	c.(1546-1551)AGACAAfs	p.R516fs		NM_001122965	NP_001116437	Q6XPR3	RPTN_HUMAN	repetin	516_517	Gln-rich.					proteinaceous extracellular matrix	calcium ion binding				0						ACTCTGGCCTTGTCTGTCTGTCTG	0.500													7	1401	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	152128025	152128028	RPTN	1	TGTC	-	-	-	1	0	1	0	1	0	0	0	0	819	63	5	5	13556	254
HERC2	8924	broad.mit.edu	37	15	28514552	28514553	+	Frame_Shift_Ins	INS	-	C	C			TCGA-41-3392-01	TCGA-41-3392-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:28514552_28514553insC	uc001zbj.2	-	11	1393_1394	c.1287_1288insG	c.(1285-1290)GGGTTAfs	p.G429fs	HERC2_uc001zbl.1_Frame_Shift_Ins_p.G124fs	NM_004667	NP_004658	O95714	HERC2_HUMAN	hect domain and RLD 2	429_430					DNA repair|intracellular protein transport|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus	guanyl-nucleotide exchange factor activity|heme binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(4)|lung(4)|skin(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	13		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		CATCCTATTAACCCCCAACCTA	0.436													47	15	---	---	---	---	capture_indel	Frame_Shift_Ins	INS	28514552	28514553	HERC2	15	-	C	C	C	1	0	1	1	0	0	0	0	0	24	2	5	5	6984	254
NF1	4763	broad.mit.edu	37	17	29550520	29550543	+	In_Frame_Del	DEL	ACAGAAATTCTCAAGTGGTTGCGG	-	-			TCGA-41-3392-01	TCGA-41-3392-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:29550520_29550543delACAGAAATTCTCAAGTGGTTGCGG	uc002hgg.2	+	16	2113_2136	c.1780_1803delACAGAAATTCTCAAGTGGTTGCGG	c.(1780-1803)ACAGAAATTCTCAAGTGGTTGCGGdel	p.TEILKWLR594del	NF1_uc002hgh.2_In_Frame_Del_p.TEILKWLR594del|NF1_uc010csn.1_In_Frame_Del_p.TEILKWLR454del|NF1_uc002hgi.1_5'Flank	NM_001042492	NP_001035957	P21359	NF1_HUMAN	neurofibromin isoform 1	594_601					actin cytoskeleton organization|adrenal gland development|artery morphogenesis|camera-type eye morphogenesis|cerebral cortex development|collagen fibril organization|forebrain astrocyte development|forebrain morphogenesis|heart development|liver development|MAPKKK cascade|metanephros development|myelination in peripheral nervous system|negative regulation of cell migration|negative regulation of endothelial cell proliferation|negative regulation of MAP kinase activity|negative regulation of MAPKKK cascade|negative regulation of neuroblast proliferation|negative regulation of oligodendrocyte differentiation|negative regulation of transcription factor import into nucleus|osteoblast differentiation|phosphatidylinositol 3-kinase cascade|pigmentation|positive regulation of adenylate cyclase activity|positive regulation of neuron apoptosis|Ras protein signal transduction|regulation of blood vessel endothelial cell migration|regulation of bone resorption|response to hypoxia|smooth muscle tissue development|spinal cord development|sympathetic nervous system development|visual learning|wound healing	axon|cytoplasm|dendrite|intrinsic to internal side of plasma membrane|nucleus	protein binding|Ras GTPase activator activity	p.?(2)		soft_tissue(159)|central_nervous_system(56)|lung(28)|large_intestine(27)|haematopoietic_and_lymphoid_tissue(18)|ovary(18)|autonomic_ganglia(12)|breast(3)|skin(3)|stomach(2)|thyroid(1)|prostate(1)|kidney(1)|pancreas(1)	330		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		GCTTAGTAGCACAGAAATTCTCAAGTGGTTGCGGGAAATATTGA	0.312			D|Mis|N|F|S|O		neurofibroma|glioma	neurofibroma|glioma			Neurofibromatosis_type_1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)			13	75	---	---	---	---	capture_indel	In_Frame_Del	DEL	29550520	29550543	NF1	17	ACAGAAATTCTCAAGTGGTTGCGG	-	-	-	1	0	1	0	1	0	0	0	0	78	6	5	5	10263	254
MAPK8IP2	23542	broad.mit.edu	37	22	51042339	51042340	+	Frame_Shift_Del	DEL	GC	-	-			TCGA-41-3392-01	TCGA-41-3392-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:51042339_51042340delGC	uc003bmx.2	+	5	728_729	c.611_612delGC	c.(610-612)TGCfs	p.C204fs	MAPK8IP2_uc003bmy.2_Frame_Shift_Del_p.C177fs|MAPK8IP2_uc011asc.1_5'Flank	NM_012324	NP_036456	Q13387	JIP2_HUMAN	mitogen-activated protein kinase 8 interacting	204	JNK-binding domain (JBD).				behavioral fear response|dendrite morphogenesis|MAPKKK cascade|nonassociative learning|positive regulation of anti-apoptosis|regulation of excitatory postsynaptic membrane potential|regulation of JNK cascade|regulation of receptor activity|regulation of synaptic transmission, glutamatergic|signal complex assembly|social behavior	cytoplasm|postsynaptic density	beta-amyloid binding|kinesin binding|MAP-kinase scaffold activity|protein kinase activator activity|protein kinase binding			large_intestine(2)|central_nervous_system(1)	3		all_cancers(38;8.8e-15)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		OV - Ovarian serous cystadenocarcinoma(4;1.28e-70)|Epithelial(4;3.46e-65)|GBM - Glioblastoma multiforme(4;4.83e-06)|Lung(4;0.125)|BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		CGCCCGGGTTGCGACTGCGAAG	0.743													2	4	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	51042339	51042340	MAPK8IP2	22	GC	-	-	-	1	0	1	0	1	0	0	0	0	598	46	5	5	9198	254
ROS1	6098	broad.mit.edu	37	6	117686282	117686282	+	Frame_Shift_Del	DEL	G	-	-			TCGA-41-3392-01	TCGA-41-3392-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:117686282delG	uc003pxp.1	-	20	3258	c.3059delC	c.(3058-3060)CCTfs	p.P1020fs	ROS1_uc011ebi.1_RNA|GOPC_uc003pxq.1_Intron	NM_002944	NP_002935	P08922	ROS_HUMAN	proto-oncogene c-ros-1 protein precursor	1020	Fibronectin type-III 4.|Extracellular (Potential).				transmembrane receptor protein tyrosine kinase signaling pathway	membrane fraction|sodium:potassium-exchanging ATPase complex	ATP binding|transmembrane receptor protein tyrosine kinase activity			lung(8)|ovary(6)|central_nervous_system(3)|skin(3)|stomach(2)|breast(2)|large_intestine(1)	25		all_cancers(87;0.00846)|all_epithelial(87;0.0242)		GBM - Glioblastoma multiforme(226;0.0387)|OV - Ovarian serous cystadenocarcinoma(136;0.0954)|all cancers(137;0.137)		GTAGGTATAAGGAGTGACAGA	0.393			T	GOPC|ROS1	glioblastoma|NSCLC								16	62	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	117686282	117686282	ROS1	6	G	-	-	-	1	0	1	0	1	0	0	0	0	455	35	5	5	13423	254
LFNG	3955	broad.mit.edu	37	7	2559902	2559902	+	Frame_Shift_Del	DEL	C	-	-			TCGA-41-3392-01	TCGA-41-3392-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:2559902delC	uc003smf.2	+	1	424	c.407delC	c.(406-408)ACCfs	p.T136fs	LFNG_uc003smg.2_Frame_Shift_Del_p.T136fs	NM_001040167	NP_001035257	Q8NES3	LFNG_HUMAN	lunatic fringe isoform a	136	Lumenal (Potential).				organ morphogenesis	extracellular region|integral to Golgi membrane	O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase activity				0		Ovarian(82;0.0112)		OV - Ovarian serous cystadenocarcinoma(56;2.54e-14)		CTGCTGGAGACCTGGATCTCG	0.562													22	42	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	2559902	2559902	LFNG	7	C	-	-	-	1	0	1	0	1	0	0	0	0	234	18	5	5	8657	254
