Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
ZNF642	339559	broad.mit.edu	37	1	40945132	40945132	+	Silent	SNP	G	A	A			TCGA-41-5651-01	TCGA-41-5651-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:40945132G>A	uc001cfo.2	+	2	393	c.99G>A	c.(97-99)GAG>GAA	p.E33E	ZNF642_uc009vwb.2_Silent_p.E33E|ZNF642_uc010ojk.1_Silent_p.E33E	NM_198494	NP_940896	Q49AA0	ZN642_HUMAN	zinc finger protein 642	33	SCAN box.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;8.81e-19)			CCCTGTGGGAGGATGTGACTA	0.532													16	21	---	---	---	---	capture	Silent	SNP	40945132	40945132	ZNF642	1	G	A	A	A	1	0	0	0	0	0	0	0	1	451	35	2	2	17936	258
FLG	2312	broad.mit.edu	37	1	152275826	152275826	+	Missense_Mutation	SNP	C	T	T	rs143233744		TCGA-41-5651-01	TCGA-41-5651-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152275826C>T	uc001ezu.1	-	3	11572	c.11536G>A	c.(11536-11538)GGC>AGC	p.G3846S		NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	3846	Filaggrin 23.|Ser-rich.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TCACCCTGGCCGGACTGTGAG	0.592									Ichthyosis				178	113	---	---	---	---	capture	Missense_Mutation	SNP	152275826	152275826	FLG	1	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	5867	258
FLG	2312	broad.mit.edu	37	1	152275878	152275878	+	Silent	SNP	C	T	T			TCGA-41-5651-01	TCGA-41-5651-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152275878C>T	uc001ezu.1	-	3	11520	c.11484G>A	c.(11482-11484)TCG>TCA	p.S3828S		NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	3828	Filaggrin 23.|Ser-rich.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CATGGTGACGCGACCCTGAGT	0.587									Ichthyosis				123	241	---	---	---	---	capture	Silent	SNP	152275878	152275878	FLG	1	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	5867	258
SPTA1	6708	broad.mit.edu	37	1	158627401	158627401	+	Nonsense_Mutation	SNP	G	A	A			TCGA-41-5651-01	TCGA-41-5651-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:158627401G>A	uc001fst.1	-	19	2870	c.2671C>T	c.(2671-2673)CGA>TGA	p.R891*		NM_003126	NP_003117	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	891	Spectrin 9.				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8	all_hematologic(112;0.0378)					TCATTTTGTCGCCTAGCAGCT	0.463													25	118	---	---	---	---	capture	Nonsense_Mutation	SNP	158627401	158627401	SPTA1	1	G	A	A	A	1	0	0	0	0	0	1	0	0	493	38	5	1	15008	258
SPTA1	6708	broad.mit.edu	37	1	158637763	158637763	+	Missense_Mutation	SNP	C	G	G			TCGA-41-5651-01	TCGA-41-5651-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:158637763C>G	uc001fst.1	-	15	2122	c.1923G>C	c.(1921-1923)CAG>CAC	p.Q641H		NM_003126	NP_003117	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	641	Spectrin 7.				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8	all_hematologic(112;0.0378)					GGCCAGTTTTCTGTATGTTTT	0.473													80	33	---	---	---	---	capture	Missense_Mutation	SNP	158637763	158637763	SPTA1	1	C	G	G	G	1	0	0	0	0	1	0	0	0	415	32	4	4	15008	258
ARMC3	219681	broad.mit.edu	37	10	23321938	23321938	+	Missense_Mutation	SNP	G	T	T			TCGA-41-5651-01	TCGA-41-5651-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:23321938G>T	uc001irm.3	+	18	2478	c.2395G>T	c.(2395-2397)GCT>TCT	p.A799S	ARMC3_uc010qcv.1_Missense_Mutation_p.A792S|ARMC3_uc010qcw.1_Missense_Mutation_p.A536S	NM_173081	NP_775104	Q5W041	ARMC3_HUMAN	armadillo repeat containing 3	799							binding				0						CTACCATCGAGCTTTGCTTTT	0.353													4	53	---	---	---	---	capture	Missense_Mutation	SNP	23321938	23321938	ARMC3	10	G	T	T	T	1	0	0	0	0	1	0	0	0	442	34	4	4	945	258
C10orf119	79892	broad.mit.edu	37	10	121600464	121600464	+	Missense_Mutation	SNP	C	A	A			TCGA-41-5651-01	TCGA-41-5651-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:121600464C>A	uc001ler.2	-	11	1437	c.1139G>T	c.(1138-1140)AGA>ATA	p.R380I	C10orf119_uc001leq.1_Missense_Mutation_p.R205I|C10orf119_uc001les.1_Missense_Mutation_p.R205I	NM_024834	NP_079110	Q9BTE3	MCMBP_HUMAN	chromosome 10 open reading frame 119	380					cell division|DNA-dependent DNA replication|mitosis|S phase of mitotic cell cycle|sister chromatid cohesion	nucleus	chromatin binding				0		Lung NSC(174;0.109)|all_lung(145;0.142)		all cancers(201;0.0044)		GACATCTCTTCTTGTATATCT	0.328													15	6	---	---	---	---	capture	Missense_Mutation	SNP	121600464	121600464	C10orf119	10	C	A	A	A	1	0	0	0	0	1	0	0	0	416	32	4	4	1576	258
CHRNA10	57053	broad.mit.edu	37	11	3690464	3690464	+	Silent	SNP	G	A	A			TCGA-41-5651-01	TCGA-41-5651-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:3690464G>A	uc001lyf.2	-	3	396	c.324C>T	c.(322-324)AGC>AGT	p.S108S	CHRNA10_uc010qxt.1_5'UTR|CHRNA10_uc010qxu.1_5'UTR	NM_020402	NP_065135	Q9GZZ6	ACH10_HUMAN	cholinergic receptor, nicotinic, alpha 10	108	Extracellular (Potential).				elevation of cytosolic calcium ion concentration|regulation of cell proliferation|synaptic transmission, cholinergic	cell junction|postsynaptic membrane	calcium channel activity|receptor activity|receptor binding			ovary(1)	1		Medulloblastoma(188;0.0075)|Breast(177;0.0164)|all_neural(188;0.0577)		BRCA - Breast invasive adenocarcinoma(625;0.0344)|LUSC - Lung squamous cell carcinoma(625;0.192)	Chloroprocaine(DB01161)|Methadone(DB00333)|Nicotine(DB00184)|Pentolinium(DB01090)|Procaine(DB00721)|Trimethaphan(DB01116)	ACACAAGACTGCTGGGGATGC	0.567													27	31	---	---	---	---	capture	Silent	SNP	3690464	3690464	CHRNA10	11	G	A	A	A	1	0	0	0	0	0	0	0	1	594	46	2	2	3347	258
MICAL2	9645	broad.mit.edu	37	11	12241780	12241780	+	Silent	SNP	G	A	A			TCGA-41-5651-01	TCGA-41-5651-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:12241780G>A	uc001mjz.2	+	9	1269	c.981G>A	c.(979-981)GCG>GCA	p.A327A	MICAL2_uc010rch.1_Silent_p.A327A|MICAL2_uc001mka.2_Silent_p.A327A|MICAL2_uc010rci.1_Silent_p.A327A|MICAL2_uc001mkb.2_Silent_p.A327A|MICAL2_uc001mkc.2_Silent_p.A327A|MICAL2_uc001mkd.2_Silent_p.A156A|MICAL2_uc010rcj.1_5'Flank	NM_014632	NP_055447	O94851	MICA2_HUMAN	microtubule associated monoxygenase, calponin	327						cytoplasm|cytoskeleton	monooxygenase activity|zinc ion binding			upper_aerodigestive_tract(2)	2				Epithelial(150;0.00552)		TGCTGTGTGCGGAGAACGTGA	0.527													3	67	---	---	---	---	capture	Silent	SNP	12241780	12241780	MICAL2	11	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	9482	258
PYGM	5837	broad.mit.edu	37	11	64514249	64514249	+	Missense_Mutation	SNP	C	T	T			TCGA-41-5651-01	TCGA-41-5651-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:64514249C>T	uc001oax.3	-	20	3228	c.2411G>A	c.(2410-2412)CGG>CAG	p.R804Q	RASGRP2_uc009ypu.2_5'Flank|RASGRP2_uc009ypv.2_5'Flank|RASGRP2_uc009ypw.2_5'Flank|RASGRP2_uc001oaw.1_5'Flank|PYGM_uc001oay.3_Missense_Mutation_p.R716Q	NM_005609	NP_005600	P11217	PYGM_HUMAN	muscle glycogen phosphorylase isoform 1	804					glucose metabolic process|glycogen catabolic process	cytosol	glycogen phosphorylase activity|protein binding			ovary(2)	2					Pyridoxal Phosphate(DB00114)	GGCTATGTTCCGGATCACCAT	0.607													35	38	---	---	---	---	capture	Missense_Mutation	SNP	64514249	64514249	PYGM	11	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	12757	258
PDGFD	80310	broad.mit.edu	37	11	103780460	103780460	+	Nonsense_Mutation	SNP	G	A	A			TCGA-41-5651-01	TCGA-41-5651-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:103780460G>A	uc001phq.2	-	7	1447	c.1075C>T	c.(1075-1077)CGA>TGA	p.R359*	PDGFD_uc001php.2_Nonsense_Mutation_p.R353*	NM_025208	NP_079484	Q9GZP0	PDGFD_HUMAN	platelet derived growth factor D isoform 1	359					positive regulation of cell division	endoplasmic reticulum lumen|extracellular region|Golgi membrane	growth factor activity			upper_aerodigestive_tract(1)|large_intestine(1)	2		Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.0017)|Melanoma(852;0.0563)|all_neural(303;0.165)		BRCA - Breast invasive adenocarcinoma(274;0.00136)|Epithelial(105;0.111)		CAATCACATCGTTCATGGTGA	0.448													85	89	---	---	---	---	capture	Nonsense_Mutation	SNP	103780460	103780460	PDGFD	11	G	A	A	A	1	0	0	0	0	0	1	0	0	519	40	5	1	11563	258
NLRX1	79671	broad.mit.edu	37	11	119054075	119054075	+	Missense_Mutation	SNP	G	A	A			TCGA-41-5651-01	TCGA-41-5651-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:119054075G>A	uc001pvu.2	+	10	3070	c.2855G>A	c.(2854-2856)CGC>CAC	p.R952H	NLRX1_uc001pvv.2_Intron|NLRX1_uc001pvw.2_Missense_Mutation_p.R952H|NLRX1_uc001pvx.2_Missense_Mutation_p.R952H|PDZD3_uc001pvy.2_5'Flank|PDZD3_uc001pvz.2_5'Flank|PDZD3_uc010rzd.1_5'Flank|PDZD3_uc001pwa.2_5'Flank|PDZD3_uc001pwb.2_5'Flank	NM_024618	NP_078894	Q86UT6	NLRX1_HUMAN	NLR family member X1 isoform 1	952	Required for the repression of MAVS- induced interferon signaling.				innate immune response|interspecies interaction between organisms|negative regulation of type I interferon production	mitochondrial outer membrane	ATP binding			ovary(1)|skin(1)	2	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.7e-05)		AATCCTTGGCGCAAGGCCCAG	0.637													30	35	---	---	---	---	capture	Missense_Mutation	SNP	119054075	119054075	NLRX1	11	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	10392	258
ARHGAP32	9743	broad.mit.edu	37	11	128910863	128910863	+	Missense_Mutation	SNP	T	A	A			TCGA-41-5651-01	TCGA-41-5651-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:128910863T>A	uc009zcp.2	-	10	963	c.963A>T	c.(961-963)CAA>CAT	p.Q321H	ARHGAP32_uc009zcq.1_Missense_Mutation_p.Q281H|ARHGAP32_uc001qfb.2_Missense_Mutation_p.Q106H	NM_001142685	NP_001136157	A7KAX9	RHG32_HUMAN	Rho GTPase-activating protein isoform 1	321	SH3.				cell communication|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cell cortex|cell junction|cytosol|dendritic spine|endoplasmic reticulum membrane|endosome membrane|Golgi membrane|postsynaptic density|postsynaptic membrane	GTPase activator activity|phosphatidylinositol binding			lung(3)|ovary(2)	5						GGGGAACTTTTTGGTTAATTA	0.393													8	8	---	---	---	---	capture	Missense_Mutation	SNP	128910863	128910863	ARHGAP32	11	T	A	A	A	1	0	0	0	0	1	0	0	0	829	64	4	4	874	258
KLRG1	10219	broad.mit.edu	37	12	9142272	9142272	+	Missense_Mutation	SNP	C	T	T			TCGA-41-5651-01	TCGA-41-5651-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:9142272C>T	uc001qvh.2	+	1	52	c.41C>T	c.(40-42)ACG>ATG	p.T14M	KLRG1_uc001qvg.2_Missense_Mutation_p.T14M	NM_005810	NP_005801	Q96E93	KLRG1_HUMAN	killer cell lectin-like receptor subfamily G,	14	Cytoplasmic (Potential).				cell surface receptor linked signaling pathway|cellular defense response|inflammatory response|regulation of immune response	integral to membrane	receptor activity|sugar binding			central_nervous_system(1)	1						GAGTTGCCTACGGCAACCCAA	0.413													26	39	---	---	---	---	capture	Missense_Mutation	SNP	9142272	9142272	KLRG1	12	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	8341	258
KIF5A	3798	broad.mit.edu	37	12	57963411	57963411	+	Silent	SNP	G	A	A			TCGA-41-5651-01	TCGA-41-5651-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:57963411G>A	uc001sor.1	+	11	1270	c.1062G>A	c.(1060-1062)AAG>AAA	p.K354K	KIF5A_uc010srr.1_Silent_p.K265K	NM_004984	NP_004975	Q12840	KIF5A_HUMAN	kinesin family member 5A	354					blood coagulation|cell death|microtubule-based movement|synaptic transmission	cytosol|kinesin complex|membrane fraction|microtubule|perinuclear region of cytoplasm	ATP binding|microtubule motor activity			ovary(2)|skin(1)	3						agaagacaaaggcccagaagg	0.423													32	539	---	---	---	---	capture	Silent	SNP	57963411	57963411	KIF5A	12	G	A	A	A	1	0	0	0	0	0	0	0	1	451	35	2	2	8227	258
OS9	10956	broad.mit.edu	37	12	58109576	58109576	+	Missense_Mutation	SNP	G	A	A			TCGA-41-5651-01	TCGA-41-5651-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:58109576G>A	uc001spj.2	+	6	672	c.613G>A	c.(613-615)GAC>AAC	p.D205N	OS9_uc010srx.1_Intron|OS9_uc001spk.2_Missense_Mutation_p.D205N|OS9_uc001spl.2_Missense_Mutation_p.D205N|OS9_uc001spm.2_Missense_Mutation_p.D205N|OS9_uc001spn.2_Missense_Mutation_p.D205N|OS9_uc010sry.1_Missense_Mutation_p.D172N|OS9_uc010srz.1_Missense_Mutation_p.D146N	NM_006812	NP_006803	Q13438	OS9_HUMAN	osteosarcoma amplified 9, endoplasmic reticulum	205					ER-associated protein catabolic process|protein retention in ER lumen|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|response to endoplasmic reticulum stress	endoplasmic reticulum lumen|Hrd1p ubiquitin ligase complex	glycoprotein binding|protein binding|sugar binding			ovary(1)	1	all_neural(12;0.00548)|Glioma(12;0.0126)|Melanoma(17;0.122)		BRCA - Breast invasive adenocarcinoma(9;0.109)			TATCTCTGGGGACTACATCGA	0.517													40	588	---	---	---	---	capture	Missense_Mutation	SNP	58109576	58109576	OS9	12	G	A	A	A	1	0	0	0	0	1	0	0	0	533	41	2	2	11176	258
AVIL	10677	broad.mit.edu	37	12	58204641	58204641	+	Silent	SNP	G	A	A			TCGA-41-5651-01	TCGA-41-5651-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:58204641G>A	uc001sqj.1	-	5	545	c.516C>T	c.(514-516)ATC>ATT	p.I172I	AVIL_uc009zqe.1_Silent_p.I165I|AVIL_uc001sqk.1_5'Flank|AVIL_uc001sql.3_Silent_p.I149I	NM_006576	NP_006567	O75366	AVIL_HUMAN	advillin	172	Gelsolin-like 2.|Core (By similarity).				actin filament capping|cilium morphogenesis|cytoskeleton organization|positive regulation of neuron projection development	actin cytoskeleton|axon|cytoplasm	actin binding			central_nervous_system(1)	1	Glioma(12;6.95e-05)|all_neural(12;0.00016)|Melanoma(17;0.122)					CATTCCATTGGATGATGACTT	0.502													29	881	---	---	---	---	capture	Silent	SNP	58204641	58204641	AVIL	12	G	A	A	A	1	0	0	0	0	0	0	0	1	525	41	2	2	1217	258
ACIN1	22985	broad.mit.edu	37	14	23564497	23564497	+	Translation_Start_Site	SNP	G	A	A			TCGA-41-5651-01	TCGA-41-5651-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:23564497G>A	uc001wit.3	-	1	327	c.-1C>T	c.(-3-1)AACGA>AATGA		ACIN1_uc010akg.2_Translation_Start_Site|ACIN1_uc010tnj.1_Translation_Start_Site|C14orf119_uc001wiu.2_5'Flank	NM_014977	NP_055792	Q9UKV3	ACINU_HUMAN	apoptotic chromatin condensation inducer 1						apoptotic chromosome condensation|erythrocyte differentiation|positive regulation of monocyte differentiation	cytosol	ATPase activity|enzyme binding|nucleic acid binding|nucleotide binding			ovary(2)|large_intestine(1)|skin(1)	4	all_cancers(95;1.36e-05)			GBM - Glioblastoma multiforme(265;0.00816)		TCTCCACATCGTTACCAATCA	0.542													26	51	---	---	---	---	capture	Translation_Start_Site	SNP	23564497	23564497	ACIN1	14	G	A	A	A	1	0	0	0	0	0	0	0	0	508	40	1	1	142	258
MYH6	4624	broad.mit.edu	37	14	23857466	23857466	+	Silent	SNP	G	C	C			TCGA-41-5651-01	TCGA-41-5651-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:23857466G>C	uc001wjv.2	-	30	4324	c.4257C>G	c.(4255-4257)ACC>ACG	p.T1419T		NM_002471	NP_002462	P13533	MYH6_HUMAN	myosin heavy chain 6	1419	Potential.				adult heart development|atrial cardiac muscle tissue morphogenesis|cardiac muscle fiber development|in utero embryonic development|muscle filament sliding|regulation of ATPase activity|regulation of blood pressure|regulation of heart rate|regulation of the force of heart contraction|sarcomere organization|striated muscle contraction|ventricular cardiac muscle tissue morphogenesis|visceral muscle development	cytosol|focal adhesion|muscle myosin complex|myosin filament|nucleus|sarcomere	actin binding|actin-dependent ATPase activity|ATP binding|calmodulin binding|microfilament motor activity|protein kinase binding|structural constituent of muscle			pancreas(2)|ovary(1)|skin(1)	4	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00764)|READ - Rectum adenocarcinoma(4;0.0289)|Colorectal(4;0.0441)		GCCGGTGCTTGGTCTTCTCCA	0.572													7	129	---	---	---	---	capture	Silent	SNP	23857466	23857466	MYH6	14	G	C	C	C	1	0	0	0	0	0	0	0	1	600	47	4	4	9948	258
KCNH5	27133	broad.mit.edu	37	14	63468087	63468087	+	Missense_Mutation	SNP	G	A	A			TCGA-41-5651-01	TCGA-41-5651-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:63468087G>A	uc001xfx.2	-	4	446	c.395C>T	c.(394-396)ACG>ATG	p.T132M	KCNH5_uc001xfy.2_Missense_Mutation_p.T132M|KCNH5_uc001xfz.1_Missense_Mutation_p.T74M|KCNH5_uc001xga.2_Missense_Mutation_p.T74M	NM_139318	NP_647479	Q8NCM2	KCNH5_HUMAN	potassium voltage-gated channel, subfamily H,	132	PAC.|Cytoplasmic (Potential).				regulation of transcription, DNA-dependent	integral to membrane	calmodulin binding|two-component sensor activity|voltage-gated potassium channel activity			ovary(4)|skin(4)|central_nervous_system(1)	9				OV - Ovarian serous cystadenocarcinoma(108;0.00958)|BRCA - Breast invasive adenocarcinoma(234;0.168)		TTTGAACAACGTAATATCCTT	0.343													6	10	---	---	---	---	capture	Missense_Mutation	SNP	63468087	63468087	KCNH5	14	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	7957	258
LTBP2	4053	broad.mit.edu	37	14	74971518	74971518	+	Silent	SNP	C	T	T			TCGA-41-5651-01	TCGA-41-5651-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:74971518C>T	uc001xqa.2	-	30	4803	c.4416G>A	c.(4414-4416)GTG>GTA	p.V1472V		NM_000428	NP_000419	Q14767	LTBP2_HUMAN	latent transforming growth factor beta binding	1472					protein secretion|protein targeting|transforming growth factor beta receptor signaling pathway	extracellular space|proteinaceous extracellular matrix	calcium ion binding|growth factor binding			liver(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(234;0.00219)|READ - Rectum adenocarcinoma(1;0.0649)		AGGCTCCTTCCACAGGAATGT	0.562													25	36	---	---	---	---	capture	Silent	SNP	74971518	74971518	LTBP2	14	C	T	T	T	1	0	0	0	0	0	0	0	1	262	21	2	2	8989	258
STON2	85439	broad.mit.edu	37	14	81744722	81744722	+	Silent	SNP	T	G	G			TCGA-41-5651-01	TCGA-41-5651-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:81744722T>G	uc010tvu.1	-	4	1134	c.933A>C	c.(931-933)GCA>GCC	p.A311A	STON2_uc001xvk.1_Silent_p.A311A|STON2_uc010tvt.1_Silent_p.A108A	NM_033104	NP_149095	Q8WXE9	STON2_HUMAN	stonin 2	311					endocytosis|intracellular protein transport|regulation of endocytosis	clathrin adaptor complex|nucleolus	protein binding			skin(3)|pancreas(2)	5				BRCA - Breast invasive adenocarcinoma(234;0.0348)		AAGGGTTGGTTGCCCTCCAAG	0.498													6	120	---	---	---	---	capture	Silent	SNP	81744722	81744722	STON2	14	T	G	G	G	1	0	0	0	0	0	0	0	1	808	63	4	4	15208	258
KIAA1409	57578	broad.mit.edu	37	14	94069684	94069684	+	Missense_Mutation	SNP	G	A	A			TCGA-41-5651-01	TCGA-41-5651-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:94069684G>A	uc001ybv.1	+	23	3226	c.3143G>A	c.(3142-3144)CGT>CAT	p.R1048H	KIAA1409_uc001ybs.1_Missense_Mutation_p.R1048H	NM_020818	NP_065869	Q9P2D8	UNC79_HUMAN	hypothetical protein LOC57578	1225						integral to membrane				ovary(10)|skin(4)|large_intestine(3)	17		all_cancers(154;0.0354)|all_epithelial(191;0.216)		Epithelial(152;0.188)		AAGAGTGTACGTTCCCTGAGG	0.527													28	27	---	---	---	---	capture	Missense_Mutation	SNP	94069684	94069684	KIAA1409	14	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	8152	258
SERPINA12	145264	broad.mit.edu	37	14	94953697	94953697	+	Silent	SNP	G	A	A			TCGA-41-5651-01	TCGA-41-5651-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:94953697G>A	uc001ydj.2	-	6	1984	c.1188C>T	c.(1186-1188)AGC>AGT	p.S396S		NM_173850	NP_776249	Q8IW75	SPA12_HUMAN	serine (or cysteine) proteinase inhibitor, clade	396					regulation of proteolysis	extracellular region	serine-type endopeptidase inhibitor activity			central_nervous_system(2)|ovary(1)|lung(1)	4				COAD - Colon adenocarcinoma(157;0.235)		GTATTTTCTCGCTGTAAATCA	0.527													66	48	---	---	---	---	capture	Silent	SNP	94953697	94953697	SERPINA12	14	G	A	A	A	1	0	0	0	0	0	0	0	1	490	38	1	1	13982	258
AHNAK2	113146	broad.mit.edu	37	14	105411658	105411658	+	Missense_Mutation	SNP	G	A	A			TCGA-41-5651-01	TCGA-41-5651-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:105411658G>A	uc010axc.1	-	7	10250	c.10130C>T	c.(10129-10131)CCG>CTG	p.P3377L	AHNAK2_uc001ypx.2_Missense_Mutation_p.P3277L	NM_138420	NP_612429	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	3377						nucleus				ovary(1)	1		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			GTGGCCCTCCGGGAGCTTCAC	0.637													109	116	---	---	---	---	capture	Missense_Mutation	SNP	105411658	105411658	AHNAK2	14	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	415	258
SHC4	399694	broad.mit.edu	37	15	49217141	49217141	+	Missense_Mutation	SNP	C	A	A			TCGA-41-5651-01	TCGA-41-5651-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:49217141C>A	uc001zxb.1	-	2	1020	c.591G>T	c.(589-591)ATG>ATT	p.M197I		NM_203349	NP_976224	Q6S5L8	SHC4_HUMAN	rai-like protein	197	PID.				intracellular signal transduction	cell junction|postsynaptic membrane				ovary(3)|pancreas(2)	5		all_lung(180;0.00466)		all cancers(107;9.4e-08)|GBM - Glioblastoma multiforme(94;5.94e-07)		CAACACAGCCCATGTACTACA	0.413													21	8	---	---	---	---	capture	Missense_Mutation	SNP	49217141	49217141	SHC4	15	C	A	A	A	1	0	0	0	0	1	0	0	0	273	21	4	4	14166	258
MYO5C	55930	broad.mit.edu	37	15	52537563	52537563	+	Silent	SNP	G	A	A			TCGA-41-5651-01	TCGA-41-5651-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:52537563G>A	uc010bff.2	-	18	2303	c.2166C>T	c.(2164-2166)CAC>CAT	p.H722H	MYO5C_uc010uga.1_RNA|MYO5C_uc010ugb.1_RNA	NM_018728	NP_061198	Q9NQX4	MYO5C_HUMAN	myosin VC	722	Myosin head-like.					myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			ovary(7)|central_nervous_system(3)|large_intestine(2)|skin(2)	14				all cancers(107;0.0137)		GGATGAGTCTGTGTAAAACCA	0.483													45	8	---	---	---	---	capture	Silent	SNP	52537563	52537563	MYO5C	15	G	A	A	A	1	0	0	0	0	0	0	0	1	620	48	2	2	9990	258
CD276	80381	broad.mit.edu	37	15	73994767	73994767	+	Missense_Mutation	SNP	A	G	G			TCGA-41-5651-01	TCGA-41-5651-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:73994767A>G	uc002avv.1	+	3	485	c.251A>G	c.(250-252)GAC>GGC	p.D84G	CD276_uc010bjd.1_5'UTR|CD276_uc002avu.1_Missense_Mutation_p.D84G|CD276_uc002avw.1_Missense_Mutation_p.D84G|CD276_uc010ulb.1_Missense_Mutation_p.D30G|CD276_uc002avx.2_5'Flank	NM_001024736	NP_001019907	Q5ZPR3	CD276_HUMAN	CD276 antigen isoform a	84	Ig-like V-type 1.|Extracellular (Potential).				cell proliferation|immune response|positive regulation of interferon-gamma biosynthetic process|positive regulation of T cell proliferation|regulation of immune response|T cell activation	external side of plasma membrane|integral to membrane	receptor binding			skin(1)	1						GAGGGCCAGGACCAGGGCAGC	0.647													12	6	---	---	---	---	capture	Missense_Mutation	SNP	73994767	73994767	CD276	15	A	G	G	G	1	0	0	0	0	1	0	0	0	130	10	3	3	2963	258
CIITA	4261	broad.mit.edu	37	16	11004047	11004047	+	Missense_Mutation	SNP	C	T	T			TCGA-41-5651-01	TCGA-41-5651-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:11004047C>T	uc002dai.3	+	13	2952	c.2819C>T	c.(2818-2820)ACG>ATG	p.T940M	CIITA_uc002daj.3_Missense_Mutation_p.T941M|CIITA_uc002dak.3_Missense_Mutation_p.T356M|CIITA_uc010bup.1_Nonsense_Mutation_p.R337*	NM_000246	NP_000237	P33076	C2TA_HUMAN	class II transactivator	940			Missing (in BLS2).		interferon-gamma-mediated signaling pathway|negative regulation of transcription from RNA polymerase II promoter|positive regulation of MHC class I biosynthetic process|positive regulation of transcription from RNA polymerase II promoter|response to antibiotic|transcription, DNA-dependent	nucleus	activating transcription factor binding|ATP binding|protein C-terminus binding|protein complex binding|transcription coactivator activity|transcription regulatory region DNA binding			central_nervous_system(1)	1						CTCTCCAGGACGAGAAGTTCC	0.572			T	FLJ27352|CD274|CD273|RALGDS|RUNDC2A|C16orf75	PMBL|Hodgkin Lymphona|								8	14	---	---	---	---	capture	Missense_Mutation	SNP	11004047	11004047	CIITA	16	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	3393	258
IL4R	3566	broad.mit.edu	37	16	27373866	27373866	+	Missense_Mutation	SNP	G	C	C			TCGA-41-5651-01	TCGA-41-5651-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:27373866G>C	uc002don.2	+	11	1435	c.1193G>C	c.(1192-1194)GGA>GCA	p.G398A	IL4R_uc002dop.3_Missense_Mutation_p.G383A|IL4R_uc010bxy.2_Missense_Mutation_p.G398A|IL4R_uc002doo.2_Missense_Mutation_p.G238A	NM_000418	NP_000409	P24394	IL4RA_HUMAN	interleukin 4 receptor alpha chain isoform a	398	Cytoplasmic (Potential).				immune response|production of molecular mediator involved in inflammatory response	integral to plasma membrane	identical protein binding|interleukin-4 receptor activity|receptor signaling protein activity			ovary(1)|skin(1)	2						TTCCAGGAGGGAAGGGAGGGC	0.597													27	33	---	---	---	---	capture	Missense_Mutation	SNP	27373866	27373866	IL4R	16	G	C	C	C	1	0	0	0	0	1	0	0	0	533	41	4	4	7621	258
ELMO3	79767	broad.mit.edu	37	16	67235531	67235531	+	Missense_Mutation	SNP	G	A	A			TCGA-41-5651-01	TCGA-41-5651-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:67235531G>A	uc002esa.2	+	10	1106	c.1063G>A	c.(1063-1065)GAC>AAC	p.D355N	ELMO3_uc002esb.2_Missense_Mutation_p.D338N|ELMO3_uc002esc.2_Missense_Mutation_p.D189N	NM_024712	NP_078988	Q96BJ8	ELMO3_HUMAN	engulfment and cell motility 3	302					apoptosis|phagocytosis	cytoplasm|cytoskeleton	SH3 domain binding				0		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00067)|Epithelial(162;0.00442)|all cancers(182;0.0417)		GACGCCCCTGGACCCCTACAG	0.612													34	43	---	---	---	---	capture	Missense_Mutation	SNP	67235531	67235531	ELMO3	16	G	A	A	A	1	0	0	0	0	1	0	0	0	533	41	2	2	5022	258
RLTPR	146206	broad.mit.edu	37	16	67681849	67681849	+	Silent	SNP	C	T	T			TCGA-41-5651-01	TCGA-41-5651-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:67681849C>T	uc002etn.2	+	13	1179	c.1059C>T	c.(1057-1059)TCC>TCT	p.S353S	RLTPR_uc010cel.1_Silent_p.S353S|RLTPR_uc010vjr.1_Silent_p.S353S	NM_001013838	NP_001013860	Q6F5E8	LR16C_HUMAN	RGD motif, leucine rich repeats, tropomodulin	353	LRR 6.									breast(1)	1		Acute lymphoblastic leukemia(13;3.23e-05)|all_hematologic(13;0.00251)|Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0146)|Epithelial(162;0.0481)|all cancers(182;0.232)		TGGGGGCCTCCGAGGACAGTG	0.662													14	11	---	---	---	---	capture	Silent	SNP	67681849	67681849	RLTPR	16	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	13286	258
TP53	7157	broad.mit.edu	37	17	7578555	7578555	+	Splice_Site	SNP	C	T	T			TCGA-41-5651-01	TCGA-41-5651-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7578555C>T	uc002gim.2	-	5	570	c.376_splice	c.e5-1	p.Y126_splice	TP53_uc002gig.1_Splice_Site_p.Y126_splice|TP53_uc002gih.2_Splice_Site_p.Y126_splice|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_5'UTR|TP53_uc010cng.1_5'UTR|TP53_uc002gii.1_5'UTR|TP53_uc010cnh.1_Splice_Site_p.Y126_splice|TP53_uc010cni.1_Splice_Site_p.Y126_splice|TP53_uc002gij.2_Splice_Site_p.Y126_splice|TP53_uc010cnj.1_Splice_Site|TP53_uc002gin.2_Splice_Site_p.Y33_splice|TP53_uc002gio.2_Splice_Site|TP53_uc010vug.1_Splice_Site_p.Y87_splice	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a						activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.?(31)|p.0?(7)|p.V73fs*9(1)|p.Y126fs*11(1)|p.P13fs*18(1)|p.T125_Y126insX(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		CAGGGGAGTACTGTAGGAAGA	0.552		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			13	1	---	---	---	---	capture	Splice_Site	SNP	7578555	7578555	TP53	17	C	T	T	T	1	0	0	0	0	0	0	1	0	260	20	5	2	16264	258
C17orf46	124783	broad.mit.edu	37	17	43332647	43332647	+	Missense_Mutation	SNP	C	T	T	rs144271763		TCGA-41-5651-01	TCGA-41-5651-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:43332647C>T	uc002iis.1	-	4	998	c.902G>A	c.(901-903)CGC>CAC	p.R301H	LOC100133991_uc010dah.2_Intron|C17orf46_uc010wjk.1_Missense_Mutation_p.R280H	NM_152343	NP_689556	Q96LK8	CQ046_HUMAN	hypothetical protein LOC124783	301										large_intestine(1)|ovary(1)	2						TCTGGCTTCGCGTGGTTTCTC	0.567													66	102	---	---	---	---	capture	Missense_Mutation	SNP	43332647	43332647	C17orf46	17	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	1842	258
SCN4A	6329	broad.mit.edu	37	17	62034852	62034852	+	Silent	SNP	C	T	T			TCGA-41-5651-01	TCGA-41-5651-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:62034852C>T	uc002jds.1	-	13	2123	c.2046G>A	c.(2044-2046)TCG>TCA	p.S682S		NM_000334	NP_000325	P35499	SCN4A_HUMAN	voltage-gated sodium channel type 4 alpha	682	Helical; Voltage-sensor; Name=S4 of repeat II; (Potential).|II.				muscle contraction	voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(1)|pancreas(1)|skin(1)	3					Lamotrigine(DB00555)	GCGTTGGCCACGACTTGGCCA	0.592													7	13	---	---	---	---	capture	Silent	SNP	62034852	62034852	SCN4A	17	C	T	T	T	1	0	0	0	0	0	0	0	1	236	19	1	1	13813	258
EVPL	2125	broad.mit.edu	37	17	74011625	74011625	+	Missense_Mutation	SNP	C	T	T			TCGA-41-5651-01	TCGA-41-5651-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:74011625C>T	uc002jqi.2	-	15	2023	c.1795G>A	c.(1795-1797)GTG>ATG	p.V599M	EVPL_uc010wss.1_Missense_Mutation_p.V621M|EVPL_uc010wst.1_Missense_Mutation_p.V69M	NM_001988	NP_001979	Q92817	EVPL_HUMAN	envoplakin	599	Globular 1.				keratinization|peptide cross-linking	cornified envelope|cytoplasm|desmosome	protein binding, bridging|structural molecule activity			pancreas(2)|central_nervous_system(1)|skin(1)	4						GCGGGGCCCACGGGCCGCGTG	0.647													16	34	---	---	---	---	capture	Missense_Mutation	SNP	74011625	74011625	EVPL	17	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	5247	258
SLC14A2	8170	broad.mit.edu	37	18	43262345	43262345	+	Missense_Mutation	SNP	C	T	T			TCGA-41-5651-01	TCGA-41-5651-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:43262345C>T	uc010dnj.2	+	21	2945	c.2624C>T	c.(2623-2625)ACG>ATG	p.T875M	SLC14A2_uc002lbe.2_Missense_Mutation_p.T875M	NM_007163	NP_009094	Q15849	UT2_HUMAN	solute carrier family 14 (urea transporter),	875						apical plasma membrane|integral to membrane|membrane fraction	protein binding|urea transmembrane transporter activity			upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)|skin(1)	4						CTGCTCCTGACGACCAATAAC	0.547													6	203	---	---	---	---	capture	Missense_Mutation	SNP	43262345	43262345	SLC14A2	18	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	14290	258
MUC16	94025	broad.mit.edu	37	19	9033637	9033637	+	Silent	SNP	G	A	A			TCGA-41-5651-01	TCGA-41-5651-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:9033637G>A	uc002mkp.2	-	9	36504	c.36300C>T	c.(36298-36300)AAC>AAT	p.N12100N		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	12102	SEA 1.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						TCTCTGTGGCGTTGAACTTCC	0.597													22	51	---	---	---	---	capture	Silent	SNP	9033637	9033637	MUC16	19	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	9883	258
ZNF439	90594	broad.mit.edu	37	19	11978931	11978931	+	Silent	SNP	T	C	C			TCGA-41-5651-01	TCGA-41-5651-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:11978931T>C	uc002mss.2	+	3	1175	c.1047T>C	c.(1045-1047)TCT>TCC	p.S349S	ZNF439_uc002msr.2_Silent_p.S213S	NM_152262	NP_689475	Q8NDP4	ZN439_HUMAN	zinc finger protein 439	349					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(1)	1						GAATGCACTCTGGAGAAAGAC	0.373													29	85	---	---	---	---	capture	Silent	SNP	11978931	11978931	ZNF439	19	T	C	C	C	1	0	0	0	0	0	0	0	1	704	55	3	3	17791	258
SLC1A6	6511	broad.mit.edu	37	19	15083572	15083572	+	Missense_Mutation	SNP	G	A	A			TCGA-41-5651-01	TCGA-41-5651-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:15083572G>A	uc002naa.1	-	1	159	c.151C>T	c.(151-153)CGC>TGC	p.R51C	SLC1A6_uc010dzu.1_Missense_Mutation_p.R51C|SLC1A6_uc010xod.1_Missense_Mutation_p.A55V|SLC1A6_uc002nab.2_Missense_Mutation_p.R51C|SLC1A6_uc002nac.2_Missense_Mutation_p.R51C|SLC1A6_uc002nad.1_Missense_Mutation_p.R51C	NM_005071	NP_005062	P48664	EAA4_HUMAN	solute carrier family 1 (high affinity	51	Cytoplasmic (Potential).				synaptic transmission	integral to plasma membrane|membrane fraction	high-affinity glutamate transmembrane transporter activity|L-aspartate transmembrane transporter activity|sodium:dicarboxylate symporter activity			pancreas(3)|ovary(2)|skin(1)	6					L-Glutamic Acid(DB00142)	CGCAGGAAGCGCAGCACGTGC	0.677													12	19	---	---	---	---	capture	Missense_Mutation	SNP	15083572	15083572	SLC1A6	19	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	14329	258
CYP2A13	1553	broad.mit.edu	37	19	41597756	41597756	+	Silent	SNP	G	A	A			TCGA-41-5651-01	TCGA-41-5651-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:41597756G>A	uc002opt.2	+	5	783	c.774G>A	c.(772-774)ACG>ACA	p.T258T		NM_000766	NP_000757	Q16696	CP2AD_HUMAN	cytochrome P450, family 2, subfamily A,	258					xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|coumarin 7-hydroxylase activity|electron carrier activity|heme binding			ovary(2)|skin(1)	3					Clomipramine(DB01242)|Nicotine(DB00184)	ACCAGCGCACGCTGGATCCCA	0.587													22	8	---	---	---	---	capture	Silent	SNP	41597756	41597756	CYP2A13	19	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	4121	258
ATP1A3	478	broad.mit.edu	37	19	42489240	42489240	+	Missense_Mutation	SNP	C	T	T			TCGA-41-5651-01	TCGA-41-5651-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:42489240C>T	uc002osg.2	-	8	977	c.823G>A	c.(823-825)GCC>ACC	p.A275T	ATP1A3_uc010xwf.1_Missense_Mutation_p.A286T|ATP1A3_uc010xwg.1_Missense_Mutation_p.A245T|ATP1A3_uc010xwh.1_Missense_Mutation_p.A288T|ATP1A3_uc002osh.2_Missense_Mutation_p.A275T	NM_152296	NP_689509	P13637	AT1A3_HUMAN	Na+/K+ -ATPase alpha 3 subunit	275	Cytoplasmic (Potential).				ATP biosynthetic process	endoplasmic reticulum|Golgi apparatus	ATP binding|metal ion binding|sodium:potassium-exchanging ATPase activity			ovary(1)|pancreas(1)	2						ATCTCGATGGCGATGGGCGTC	0.632													4	2	---	---	---	---	capture	Missense_Mutation	SNP	42489240	42489240	ATP1A3	19	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	1121	258
ZNF324	25799	broad.mit.edu	37	19	58982200	58982200	+	Missense_Mutation	SNP	G	A	A			TCGA-41-5651-01	TCGA-41-5651-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:58982200G>A	uc002qsw.1	+	4	435	c.341G>A	c.(340-342)GGT>GAT	p.G114D	ZNF324_uc002qsx.1_5'Flank	NM_014347	NP_055162	O75467	Z324A_HUMAN	zinc finger protein 324	114					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_cancers(17;1.81e-17)|all_epithelial(17;1.21e-12)|Lung NSC(17;2.8e-05)|all_lung(17;0.000139)|Colorectal(82;0.000147)|Renal(17;0.00528)|all_neural(62;0.0133)|Ovarian(87;0.156)|Medulloblastoma(540;0.232)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0164)|Lung(386;0.179)		CCTGTTGCCGGTGCCTGCCAC	0.567													4	104	---	---	---	---	capture	Missense_Mutation	SNP	58982200	58982200	ZNF324	19	G	A	A	A	1	0	0	0	0	1	0	0	0	572	44	2	2	17724	258
C2orf65	130951	broad.mit.edu	37	2	74842218	74842218	+	Missense_Mutation	SNP	T	C	C			TCGA-41-5651-01	TCGA-41-5651-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:74842218T>C	uc002smy.2	-	3	416	c.299A>G	c.(298-300)CAG>CGG	p.Q100R	C2orf65_uc010ysa.1_Missense_Mutation_p.Q100R|C2orf65_uc002smz.2_Missense_Mutation_p.Q100R	NM_138804	NP_620159	Q8TC57	CB065_HUMAN	hypothetical protein LOC130951	100					chromatin assembly|female gamete generation|RNA processing|spermatogenesis	integral to membrane				ovary(1)|pancreas(1)	2						CCCTTCTCTCTGTAACATGCG	0.483													60	50	---	---	---	---	capture	Missense_Mutation	SNP	74842218	74842218	C2orf65	2	T	C	C	C	1	0	0	0	0	1	0	0	0	715	55	3	3	2164	258
IL18RAP	8807	broad.mit.edu	37	2	103039783	103039783	+	Nonsense_Mutation	SNP	C	T	T			TCGA-41-5651-01	TCGA-41-5651-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:103039783C>T	uc002tbx.2	+	3	530	c.46C>T	c.(46-48)CGA>TGA	p.R16*	IL18RAP_uc010fiz.2_5'UTR	NM_003853	NP_003844	O95256	I18RA_HUMAN	interleukin 18 receptor accessory protein	16					cell surface receptor linked signaling pathway|inflammatory response|innate immune response	integral to membrane	transmembrane receptor activity			skin(3)|ovary(2)	5						TGCAGGAGAGCGAATTAAAGG	0.408													61	97	---	---	---	---	capture	Nonsense_Mutation	SNP	103039783	103039783	IL18RAP	2	C	T	T	T	1	0	0	0	0	0	1	0	0	347	27	5	1	7571	258
ACOXL	55289	broad.mit.edu	37	2	111850527	111850527	+	Missense_Mutation	SNP	C	T	T			TCGA-41-5651-01	TCGA-41-5651-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:111850527C>T	uc002tgr.3	+	18	1840	c.1616C>T	c.(1615-1617)ACG>ATG	p.T539M	ACOXL_uc010fkc.2_Missense_Mutation_p.T509M|ACOXL_uc010yxk.1_Missense_Mutation_p.T509M	NM_001105516	NP_001098986	Q9NUZ1	ACOXL_HUMAN	acyl-Coenzyme A oxidase-like 2	539					fatty acid beta-oxidation	peroxisome	acyl-CoA dehydrogenase activity|acyl-CoA oxidase activity				0						ATGGCCAGCACGAGGATCAGG	0.483													25	31	---	---	---	---	capture	Missense_Mutation	SNP	111850527	111850527	ACOXL	2	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	161	258
ABCA12	26154	broad.mit.edu	37	2	215855594	215855594	+	Silent	SNP	C	T	T			TCGA-41-5651-01	TCGA-41-5651-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:215855594C>T	uc002vew.2	-	24	3676	c.3456G>A	c.(3454-3456)TCG>TCA	p.S1152S	ABCA12_uc002vev.2_Silent_p.S834S|ABCA12_uc010zjn.1_Silent_p.S79S	NM_173076	NP_775099	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A, member 12	1152	Helical; (Potential).				cellular homeostasis|lipid transport	integral to membrane	ATP binding|ATPase activity			ovary(6)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|skin(1)|pancreas(1)	11		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		AGCTGTAGTCCGAAAAATACA	0.388													32	33	---	---	---	---	capture	Silent	SNP	215855594	215855594	ABCA12	2	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	30	258
GLB1L	79411	broad.mit.edu	37	2	220108249	220108249	+	Missense_Mutation	SNP	A	T	T			TCGA-41-5651-01	TCGA-41-5651-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:220108249A>T	uc002vkm.2	-	2	286	c.47T>A	c.(46-48)CTC>CAC	p.L16H	GLB1L_uc010zkx.1_Missense_Mutation_p.L16H|GLB1L_uc002vkn.2_Missense_Mutation_p.L16H|STK16_uc002vko.2_5'Flank|STK16_uc002vks.2_5'Flank|STK16_uc010zky.1_5'Flank|STK16_uc010fwf.2_5'Flank|STK16_uc002vkp.2_5'Flank|STK16_uc002vkr.2_5'Flank|STK16_uc002vkq.2_5'Flank	NM_024506	NP_078782	Q6UWU2	GLB1L_HUMAN	galactosidase, beta 1-like precursor	16					carbohydrate metabolic process	extracellular region	cation binding|hydrolase activity, hydrolyzing O-glycosyl compounds				0		all_lung(227;1.19e-05)|Lung NSC(271;2.76e-05)|Medulloblastoma(418;0.0208)|Esophageal squamous(248;0.0559)		Epithelial(149;1.3e-11)|all cancers(144;2.07e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CGTCAGGCTGAGCGGCAGCAG	0.612													30	44	---	---	---	---	capture	Missense_Mutation	SNP	220108249	220108249	GLB1L	2	A	T	T	T	1	0	0	0	0	1	0	0	0	143	11	4	4	6364	258
ACSL3	2181	broad.mit.edu	37	2	223781199	223781199	+	Missense_Mutation	SNP	A	G	G			TCGA-41-5651-01	TCGA-41-5651-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:223781199A>G	uc002vni.2	+	5	992	c.541A>G	c.(541-543)ATG>GTG	p.M181V	ACSL3_uc002vnj.2_Missense_Mutation_p.M181V	NM_004457	NP_004448	O95573	ACSL3_HUMAN	acyl-CoA synthetase long-chain family member 3	181	Cytoplasmic (Potential).				long-chain fatty-acyl-CoA biosynthetic process|triglyceride biosynthetic process	endoplasmic reticulum membrane|integral to membrane|microsome|mitochondrial outer membrane|peroxisomal membrane	ATP binding|fatty-acyl-CoA synthase activity|long-chain fatty acid-CoA ligase activity|protein binding			ovary(2)	2		Renal(207;0.0183)		Epithelial(121;1.28e-10)|all cancers(144;8.06e-08)|Lung(261;0.00834)|LUSC - Lung squamous cell carcinoma(224;0.00864)	Icosapent(DB00159)	GGCGTGTTTTATGTATAATTT	0.383			T	ETV1	prostate								29	34	---	---	---	---	capture	Missense_Mutation	SNP	223781199	223781199	ACSL3	2	A	G	G	G	1	0	0	0	0	1	0	0	0	208	16	3	3	178	258
UGT1A5	54579	broad.mit.edu	37	2	234681031	234681031	+	Silent	SNP	C	T	T	rs28900406	byFrequency;by1000genomes	TCGA-41-5651-01	TCGA-41-5651-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:234681031C>T	uc002vuw.2	+	5	1431	c.1431C>T	c.(1429-1431)CCC>CCT	p.P477P	UGT1A8_uc002vup.2_Silent_p.P473P|UGT1A10_uc002vur.2_Silent_p.P473P|UGT1A9_uc002vus.2_Silent_p.P473P|UGT1A7_uc002vut.2_Silent_p.P473P|UGT1A6_uc002vuu.2_Silent_p.P208P|UGT1A6_uc002vuv.3_Silent_p.P475P|UGT1A4_uc002vux.2_Silent_p.P477P|UGT1A3_uc002vuy.2_Silent_p.P477P|UGT1A9_uc002vva.2_RNA|UGT1A1_uc002vvb.2_Silent_p.P476P	NM_019078	NP_061951	P35504	UD15_HUMAN	UDP glycosyltransferase 1 family, polypeptide A5	477					xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity			skin(1)	1		Breast(86;0.000765)|all_lung(227;0.00267)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0328)|Lung NSC(271;0.0457)|Lung SC(224;0.128)		Epithelial(121;4.51e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000523)|Lung(119;0.00271)|LUSC - Lung squamous cell carcinoma(224;0.00645)		ACCTGCGCCCCGCAGCCCACG	0.602													34	54	---	---	---	---	capture	Silent	SNP	234681031	234681031	UGT1A5	2	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	16830	258
KIF16B	55614	broad.mit.edu	37	20	16254013	16254013	+	Missense_Mutation	SNP	G	A	A			TCGA-41-5651-01	TCGA-41-5651-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:16254013G>A	uc002wpg.1	-	26	3997	c.3839C>T	c.(3838-3840)ACA>ATA	p.T1280I	KIF16B_uc002wpe.1_Missense_Mutation_p.T632I|KIF16B_uc002wpf.1_Missense_Mutation_p.T621I|KIF16B_uc010gch.1_Missense_Mutation_p.T1229I	NM_024704	NP_078980	Q96L93	KI16B_HUMAN	kinesin-like motor protein C20orf23	1280	PX.				cell communication|early endosome to late endosome transport|endoderm development|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|formation of primary germ layer|Golgi to endosome transport|microtubule-based movement|receptor catabolic process|regulation of receptor recycling	early endosome membrane|microtubule	ATP binding|phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3,4-bisphosphate binding|phosphatidylinositol-3,5-bisphosphate binding|phosphatidylinositol-3-phosphate binding|plus-end-directed microtubule motor activity			skin(2)|large_intestine(1)|central_nervous_system(1)|lung(1)|breast(1)|ovary(1)|kidney(1)	8						GAGGGGAGATGTTGCGGACTG	0.398													30	44	---	---	---	---	capture	Missense_Mutation	SNP	16254013	16254013	KIF16B	20	G	A	A	A	1	0	0	0	0	1	0	0	0	624	48	2	2	8200	258
SEC23B	10483	broad.mit.edu	37	20	18507120	18507120	+	Missense_Mutation	SNP	G	A	A			TCGA-41-5651-01	TCGA-41-5651-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:18507120G>A	uc002wqz.1	+	8	1381	c.938G>A	c.(937-939)CGT>CAT	p.R313H	SEC23B_uc002wra.1_Missense_Mutation_p.R313H|SEC23B_uc002wrb.1_Missense_Mutation_p.R313H|SEC23B_uc010zsb.1_Missense_Mutation_p.R295H|SEC23B_uc002wrc.1_Missense_Mutation_p.R313H	NM_006363	NP_006354	Q15437	SC23B_HUMAN	Sec23 homolog B	313			R -> H.		ER to Golgi vesicle-mediated transport|intracellular protein transport	COPII vesicle coat|endoplasmic reticulum membrane|ER-Golgi intermediate compartment membrane|Golgi membrane	zinc ion binding			ovary(1)	1						ATTCCTATTCGTTCTTGGCAT	0.458													34	85	---	---	---	---	capture	Missense_Mutation	SNP	18507120	18507120	SEC23B	20	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	13885	258
SLC12A5	57468	broad.mit.edu	37	20	44674611	44674611	+	Missense_Mutation	SNP	A	G	G			TCGA-41-5651-01	TCGA-41-5651-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:44674611A>G	uc010zxl.1	+	13	1809	c.1733A>G	c.(1732-1734)GAC>GGC	p.D578G	SLC12A5_uc010zxm.1_RNA|SLC12A5_uc002xrb.2_Missense_Mutation_p.D555G	NM_001134771	NP_001128243	Q9H2X9	S12A5_HUMAN	solute carrier family 12 (potassium-chloride	578	Helical; (Potential).				potassium ion transport|sodium ion transport	integral to membrane	potassium:chloride symporter activity			ovary(2)|large_intestine(1)|central_nervous_system(1)|skin(1)	5		Myeloproliferative disorder(115;0.0122)			Bumetanide(DB00887)|Potassium Chloride(DB00761)	GCATCCCTCGACGAGGTGGCC	0.597													58	131	---	---	---	---	capture	Missense_Mutation	SNP	44674611	44674611	SLC12A5	20	A	G	G	G	1	0	0	0	0	1	0	0	0	130	10	3	3	14279	258
NFATC2	4773	broad.mit.edu	37	20	50159018	50159018	+	Silent	SNP	C	T	T			TCGA-41-5651-01	TCGA-41-5651-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:50159018C>T	uc002xwd.2	-	1	241	c.21G>A	c.(19-21)CAG>CAA	p.Q7Q	NFATC2_uc002xwc.2_Silent_p.Q7Q|NFATC2_uc010zyv.1_5'UTR|NFATC2_uc010zyw.1_5'UTR|NFATC2_uc010zyx.1_Intron|NFATC2_uc010zyy.1_Intron|NFATC2_uc010zyz.1_Intron|NFATC2_uc002xwe.2_Intron	NM_173091	NP_775114	Q13469	NFAC2_HUMAN	nuclear factor of activated T-cells,	7					B cell receptor signaling pathway|positive regulation of B cell proliferation|response to DNA damage stimulus|response to drug	actin cytoskeleton|nucleus|plasma membrane	protein binding|sequence-specific DNA binding transcription factor activity			ovary(2)	2	Hepatocellular(150;0.248)					CGGGTTGGGGCTGCCGCTCGG	0.582													4	12	---	---	---	---	capture	Silent	SNP	50159018	50159018	NFATC2	20	C	T	T	T	1	0	0	0	0	0	0	0	1	363	28	2	2	10269	258
OPRL1	4987	broad.mit.edu	37	20	62729401	62729401	+	Silent	SNP	C	T	T	rs143380233		TCGA-41-5651-01	TCGA-41-5651-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:62729401C>T	uc002yic.2	+	4	882	c.480C>T	c.(478-480)GAC>GAT	p.D160D	OPRL1_uc002yid.2_Silent_p.D160D|OPRL1_uc002yif.3_Silent_p.D155D	NM_182647	NP_872588	P41146	OPRX_HUMAN	opiate receptor-like 1	160	Cytoplasmic (Potential).				elevation of cytosolic calcium ion concentration|inhibition of adenylate cyclase activity by G-protein signaling pathway|sensory perception	integral to plasma membrane	protein binding|X-opioid receptor activity			central_nervous_system(1)|skin(1)	2	all_cancers(38;4.74e-11)|all_epithelial(29;1.33e-12)|Lung NSC(23;3.27e-09)|all_lung(23;1.02e-08)					GTGCCCTCGACGTCCGCACGT	0.587													21	60	---	---	---	---	capture	Silent	SNP	62729401	62729401	OPRL1	20	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	10790	258
ITSN1	6453	broad.mit.edu	37	21	35231057	35231057	+	Missense_Mutation	SNP	A	C	C			TCGA-41-5651-01	TCGA-41-5651-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:35231057A>C	uc002yta.1	+	31	4119	c.3851A>C	c.(3850-3852)AAC>ACC	p.N1284T	DONSON_uc002ysn.1_Intron|ITSN1_uc002ytb.1_Missense_Mutation_p.N1279T|ITSN1_uc002ytj.2_Missense_Mutation_p.N1279T|ITSN1_uc010gmm.1_RNA	NM_003024	NP_003015	Q15811	ITSN1_HUMAN	intersectin 1 isoform ITSN-l	1284	DH.				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|synaptic vesicle endocytosis	cell junction|coated pit|cytosol|lamellipodium|synapse|synaptosome	calcium ion binding|proline-rich region binding|protein complex scaffold|Rho guanyl-nucleotide exchange factor activity			ovary(3)|skin(1)	4						ATTTTTGTGAACTGGAAGGAG	0.453													18	96	---	---	---	---	capture	Missense_Mutation	SNP	35231057	35231057	ITSN1	21	A	C	C	C	1	0	0	0	0	1	0	0	0	26	2	4	4	7849	258
IGSF5	150084	broad.mit.edu	37	21	41137664	41137664	+	Silent	SNP	C	T	T	rs145170006		TCGA-41-5651-01	TCGA-41-5651-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:41137664C>T	uc002yyo.2	+	3	406	c.303C>T	c.(301-303)GGC>GGT	p.G101G		NM_001080444	NP_001073913	Q9NSI5	IGSF5_HUMAN	immunoglobulin superfamily 5 like	101	Ig-like V-type 1.|Extracellular (Potential).					integral to membrane|tight junction					0		Prostate(19;5.35e-06)				ACGACCAGGGCGGGAACTTCA	0.557													13	12	---	---	---	---	capture	Silent	SNP	41137664	41137664	IGSF5	21	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	7526	258
ITGB2	3689	broad.mit.edu	37	21	46320382	46320382	+	Silent	SNP	G	A	A			TCGA-41-5651-01	TCGA-41-5651-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:46320382G>A	uc002zgd.2	-	6	794	c.750C>T	c.(748-750)ATC>ATT	p.I250I	ITGB2_uc002zge.2_Silent_p.I250I|ITGB2_uc002zgf.3_Silent_p.I250I|ITGB2_uc011afl.1_Silent_p.I172I|ITGB2_uc010gpw.2_Silent_p.I193I|ITGB2_uc002zgg.2_Silent_p.I250I	NM_001127491	NP_001120963	P05107	ITB2_HUMAN	integrin, beta 2 precursor	250	Extracellular (Potential).|VWFA.				apoptosis|blood coagulation|cell-cell signaling|cell-matrix adhesion|inflammatory response|integrin-mediated signaling pathway|leukocyte cell-cell adhesion|multicellular organismal development|neutrophil chemotaxis|regulation of cell shape|regulation of immune response|regulation of peptidyl-tyrosine phosphorylation	integrin complex	glycoprotein binding|protein kinase binding|receptor activity			ovary(4)|central_nervous_system(3)|breast(2)	9				Colorectal(79;0.0669)	Simvastatin(DB00641)	TGCGCCAGCCGATTTCCTCCT	0.647													21	27	---	---	---	---	capture	Silent	SNP	46320382	46320382	ITGB2	21	G	A	A	A	1	0	0	0	0	0	0	0	1	473	37	1	1	7817	258
SEC14L3	266629	broad.mit.edu	37	22	30856050	30856050	+	Silent	SNP	G	A	A	rs116181219	by1000genomes	TCGA-41-5651-01	TCGA-41-5651-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:30856050G>A	uc003ahy.2	-	12	1250	c.1161C>T	c.(1159-1161)GAC>GAT	p.D387D	SEC14L3_uc003ahz.2_Silent_p.D310D|SEC14L3_uc003aia.2_Silent_p.D328D|SEC14L3_uc003aib.2_Silent_p.D328D	NM_174975	NP_777635	Q9UDX4	S14L3_HUMAN	SEC14-like 3	387						integral to membrane|intracellular	lipid binding|transporter activity			ovary(3)|pancreas(1)|skin(1)	5					Vitamin E(DB00163)	GCATGCCCTCGTCAGGGAGCA	0.502													21	30	---	---	---	---	capture	Silent	SNP	30856050	30856050	SEC14L3	22	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	13876	258
PES1	23481	broad.mit.edu	37	22	30980618	30980618	+	Missense_Mutation	SNP	T	C	C			TCGA-41-5651-01	TCGA-41-5651-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:30980618T>C	uc003aij.1	-	5	529	c.455A>G	c.(454-456)AAG>AGG	p.K152R	PES1_uc003aik.1_Missense_Mutation_p.K152R|PES1_uc003ail.1_Missense_Mutation_p.K152R|PES1_uc003aim.1_Missense_Mutation_p.K152R|PES1_uc003ain.1_Missense_Mutation_p.K13R|PES1_uc003aio.1_Missense_Mutation_p.K13R	NM_014303	NP_055118	O00541	PESC_HUMAN	pescadillo homolog 1, containing BRCT domain	152	Sufficient for nucleolar localization.				cell proliferation|maturation of 5.8S rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|maturation of LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|regulation of cell cycle	chromosome|nucleoplasm|PeBoW complex|preribosome, large subunit precursor	protein binding				0						CACGTGGCACTTGCCAGTCCG	0.612													8	16	---	---	---	---	capture	Missense_Mutation	SNP	30980618	30980618	PES1	22	T	C	C	C	1	0	0	0	0	1	0	0	0	728	56	3	3	11636	258
CYP8B1	1582	broad.mit.edu	37	3	42916203	42916203	+	Missense_Mutation	SNP	G	A	A			TCGA-41-5651-01	TCGA-41-5651-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:42916203G>A	uc003cmh.2	-	1	1431	c.1106C>T	c.(1105-1107)TCC>TTC	p.S369F	CCBP2_uc003cmd.1_Intron|CCBP2_uc003cmg.2_Intron|CYP8B1_uc010hif.2_Missense_Mutation_p.S369F	NM_004391	NP_004382	Q9UNU6	CP8B1_HUMAN	cytochrome P450, family 8, subfamily B,	369					bile acid biosynthetic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	7alpha-hydroxycholest-4-en-3-one 12alpha-hydroxylase activity|electron carrier activity|heme binding|oxygen binding|sterol 12-alpha-hydroxylase activity			ovary(2)	2				KIRC - Kidney renal clear cell carcinoma(284;0.213)|Kidney(284;0.249)		CTGCCCACTGGACATCTTCAG	0.592													40	39	---	---	---	---	capture	Missense_Mutation	SNP	42916203	42916203	CYP8B1	3	G	A	A	A	1	0	0	0	0	1	0	0	0	533	41	2	2	4158	258
ACY1	95	broad.mit.edu	37	3	52020670	52020670	+	Silent	SNP	T	C	C			TCGA-41-5651-01	TCGA-41-5651-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:52020670T>C	uc003dcp.2	+	8	637	c.576T>C	c.(574-576)AGT>AGC	p.S192S	ACY1_uc011bea.1_Silent_p.S282S|ACY1_uc011beb.1_Silent_p.S192S|ACY1_uc003dcq.2_Silent_p.S192S	NM_000666	NP_000657	Q03154	ACY1_HUMAN	aminoacylase 1	192					cellular amino acid metabolic process|proteolysis	cytosol	aminoacylase activity|metal ion binding|metallopeptidase activity			breast(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000534)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)	L-Aspartic Acid(DB00128)	GTGAGCGGAGTCCCTGGTGTA	0.368													40	65	---	---	---	---	capture	Silent	SNP	52020670	52020670	ACY1	3	T	C	C	C	1	0	0	0	0	0	0	0	1	751	58	3	3	226	258
PIK3CA	5290	broad.mit.edu	37	3	178916881	178916881	+	Missense_Mutation	SNP	T	G	G			TCGA-41-5651-01	TCGA-41-5651-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:178916881T>G	uc003fjk.2	+	2	425	c.268T>G	c.(268-270)TGT>GGT	p.C90G		NM_006218	NP_006209	P42336	PK3CA_HUMAN	phosphoinositide-3-kinase, catalytic, alpha	90	PI3K-ABD.				epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell costimulation|T cell receptor signaling pathway		1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity			breast(1564)|large_intestine(776)|endometrium(246)|urinary_tract(195)|ovary(141)|skin(112)|stomach(98)|thyroid(77)|central_nervous_system(69)|lung(65)|upper_aerodigestive_tract(58)|haematopoietic_and_lymphoid_tissue(27)|cervix(25)|biliary_tract(22)|liver(20)|oesophagus(17)|pancreas(11)|penis(8)|pituitary(8)|autonomic_ganglia(4)|prostate(3)|kidney(2)|meninges(1)|eye(1)|NS(1)|soft_tissue(1)|bone(1)	3553	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)			AAGACGACTTTGTGACCTTCG	0.373		57	Mis		colorectal|gastric|gliobastoma|breast					HNSCC(19;0.045)|TSP Lung(28;0.18)			37	63	---	---	---	---	capture	Missense_Mutation	SNP	178916881	178916881	PIK3CA	3	T	G	G	G	1	0	0	0	0	1	0	0	0	819	63	4	4	11816	258
ABCC5	10057	broad.mit.edu	37	3	183679309	183679309	+	Missense_Mutation	SNP	G	A	A			TCGA-41-5651-01	TCGA-41-5651-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:183679309G>A	uc003fmg.2	-	16	2534	c.2369C>T	c.(2368-2370)CCG>CTG	p.P790L	ABCC5_uc011bqt.1_Missense_Mutation_p.P318L|ABCC5_uc010hxl.2_Missense_Mutation_p.P790L	NM_005688	NP_005679	O15440	MRP5_HUMAN	ATP-binding cassette, sub-family C, member 5	790						integral to plasma membrane|membrane fraction	ATP binding|ATPase activity, coupled to transmembrane movement of substances|organic anion transmembrane transporter activity			ovary(2)|large_intestine(1)|central_nervous_system(1)	4	all_cancers(143;1.85e-10)|Ovarian(172;0.0303)		Epithelial(37;1.74e-35)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)			CTCAACTGGCGGTGTCTCTCC	0.478													11	24	---	---	---	---	capture	Missense_Mutation	SNP	183679309	183679309	ABCC5	3	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	56	258
RAB28	9364	broad.mit.edu	37	4	13481054	13481054	+	Nonsense_Mutation	SNP	C	A	A			TCGA-41-5651-01	TCGA-41-5651-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:13481054C>A	uc003gmu.2	-	2	387	c.172G>T	c.(172-174)GGA>TGA	p.G58*	RAB28_uc003gmt.2_Nonsense_Mutation_p.G58*|RAB28_uc011bwz.1_Nonsense_Mutation_p.G58*|RAB28_uc003gmv.2_RNA	NM_001017979	NP_001017979	P51157	RAB28_HUMAN	RAB28, member RAS oncogene family isoform 1	58					small GTPase mediated signal transduction	plasma membrane	GDP binding|GTP binding|GTPase activity			ovary(1)|skin(1)	2						AGTCTCTTACCTGGCAATGTT	0.328													15	24	---	---	---	---	capture	Nonsense_Mutation	SNP	13481054	13481054	RAB28	4	C	A	A	A	1	0	0	0	0	0	1	0	0	312	24	5	4	12811	258
GABRA4	2557	broad.mit.edu	37	4	46966998	46966998	+	Missense_Mutation	SNP	C	A	A			TCGA-41-5651-01	TCGA-41-5651-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:46966998C>A	uc003gxg.2	-	8	1262	c.1123G>T	c.(1123-1125)GCC>TCC	p.A375S		NM_000809	NP_000800	P48169	GBRA4_HUMAN	gamma-aminobutyric acid A receptor, alpha 4	375	Cytoplasmic (Probable).				gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			ovary(2)|upper_aerodigestive_tract(1)|breast(1)	4					Alprazolam(DB00404)|Ethchlorvynol(DB00189)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Lorazepam(DB00186)|Meprobamate(DB00371)|Midazolam(DB00683)	TGCAGAGGGGCTTCAGGATGC	0.408													10	14	---	---	---	---	capture	Missense_Mutation	SNP	46966998	46966998	GABRA4	4	C	A	A	A	1	0	0	0	0	1	0	0	0	364	28	4	4	6105	258
CDH12	1010	broad.mit.edu	37	5	21817224	21817224	+	Missense_Mutation	SNP	C	A	A			TCGA-41-5651-01	TCGA-41-5651-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:21817224C>A	uc010iuc.2	-	6	1290	c.832G>T	c.(832-834)GTT>TTT	p.V278F	CDH12_uc011cno.1_Missense_Mutation_p.V238F|CDH12_uc003jgk.2_Missense_Mutation_p.V278F	NM_004061	NP_004052	P55289	CAD12_HUMAN	cadherin 12, type 2 preproprotein	278	Extracellular (Potential).|Cadherin 3.				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)	2						GACTCAGGAACTTTCAAGTGG	0.363										HNSCC(59;0.17)			26	19	---	---	---	---	capture	Missense_Mutation	SNP	21817224	21817224	CDH12	5	C	A	A	A	1	0	0	0	0	1	0	0	0	260	20	4	4	3069	258
HEATR7B2	133558	broad.mit.edu	37	5	41049447	41049447	+	Missense_Mutation	SNP	A	T	T			TCGA-41-5651-01	TCGA-41-5651-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:41049447A>T	uc003jmj.3	-	14	1926	c.1436T>A	c.(1435-1437)ATG>AAG	p.M479K	HEATR7B2_uc003jmi.3_Missense_Mutation_p.M34K	NM_173489	NP_775760	Q7Z745	HTRB2_HUMAN	HEAT repeat family member 7B2	479							binding			ovary(6)|central_nervous_system(2)	8						CTCCTCTGCCATAATCAGAAT	0.463													12	12	---	---	---	---	capture	Missense_Mutation	SNP	41049447	41049447	HEATR7B2	5	A	T	T	T	1	0	0	0	0	1	0	0	0	104	8	4	4	6961	258
MAP1B	4131	broad.mit.edu	37	5	71494424	71494424	+	Missense_Mutation	SNP	G	T	T			TCGA-41-5651-01	TCGA-41-5651-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:71494424G>T	uc003kbw.3	+	5	5483	c.5242G>T	c.(5242-5244)GAT>TAT	p.D1748Y	MAP1B_uc010iyw.1_Missense_Mutation_p.D1765Y|MAP1B_uc010iyx.1_Missense_Mutation_p.D1622Y|MAP1B_uc010iyy.1_Missense_Mutation_p.D1622Y	NM_005909	NP_005900	P46821	MAP1B_HUMAN	microtubule-associated protein 1B	1748						microtubule|microtubule associated complex	structural molecule activity			large_intestine(2)|ovary(1)|central_nervous_system(1)|pancreas(1)	5		Lung NSC(167;0.00202)|Ovarian(174;0.0175)|Prostate(461;0.142)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;7.99e-54)		TCTCCAAGAAGATACTCTATC	0.478													47	71	---	---	---	---	capture	Missense_Mutation	SNP	71494424	71494424	MAP1B	5	G	T	T	T	1	0	0	0	0	1	0	0	0	429	33	4	4	9142	258
LHFPL2	10184	broad.mit.edu	37	5	77784735	77784735	+	Silent	SNP	C	G	G			TCGA-41-5651-01	TCGA-41-5651-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:77784735C>G	uc003kfo.2	-	5	1348	c.672G>C	c.(670-672)CTG>CTC	p.L224L		NM_005779	NP_005770	Q6ZUX7	LHPL2_HUMAN	lipoma HMGIC fusion partner-like 2	224						integral to membrane					0		all_lung(232;0.000409)|Lung NSC(167;0.00108)|Ovarian(174;0.0107)|Prostate(461;0.218)		OV - Ovarian serous cystadenocarcinoma(54;6.48e-46)|Epithelial(54;8.43e-42)|all cancers(79;1.42e-36)		GGAGGCAGATCAGATTTTTCC	0.418													38	49	---	---	---	---	capture	Silent	SNP	77784735	77784735	LHFPL2	5	C	G	G	G	1	0	0	0	0	0	0	0	1	366	29	4	4	8685	258
PKD2L2	27039	broad.mit.edu	37	5	137257377	137257377	+	Missense_Mutation	SNP	C	G	G			TCGA-41-5651-01	TCGA-41-5651-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:137257377C>G	uc003lby.2	+	9	1437	c.1381C>G	c.(1381-1383)CAA>GAA	p.Q461E	PKD2L2_uc003lbw.1_Missense_Mutation_p.Q461E|PKD2L2_uc003lbx.2_Intron|PKD2L2_uc011cyi.1_Missense_Mutation_p.Q69E	NM_014386	NP_055201	Q9NZM6	PK2L2_HUMAN	polycystic kidney disease 2-like 2	461	Extracellular (Potential).					integral to membrane	calcium ion binding|ion channel activity				0			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			TGGTATTCAGCAAGCCAATCC	0.308													19	22	---	---	---	---	capture	Missense_Mutation	SNP	137257377	137257377	PKD2L2	5	C	G	G	G	1	0	0	0	0	1	0	0	0	325	25	4	4	11871	258
ODZ2	57451	broad.mit.edu	37	5	167551889	167551889	+	Silent	SNP	A	G	G			TCGA-41-5651-01	TCGA-41-5651-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:167551889A>G	uc010jjd.2	+	11	2043	c.2043A>G	c.(2041-2043)GGA>GGG	p.G681G	ODZ2_uc003lzr.3_Silent_p.G449G|ODZ2_uc003lzt.3_Silent_p.G45G|ODZ2_uc010jje.2_5'UTR|uc003lzs.1_Intron	NM_001122679	NP_001116151			odz, odd Oz/ten-m homolog 2											ovary(6)|central_nervous_system(4)	10	Renal(175;0.00124)|Lung NSC(126;0.136)|all_lung(126;0.242)	Medulloblastoma(196;0.0241)|all_neural(177;0.026)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0444)|OV - Ovarian serous cystadenocarcinoma(192;0.0694)|Epithelial(171;0.124)		CCAGCCACGGAGTCTGTGTGA	0.512													5	10	---	---	---	---	capture	Silent	SNP	167551889	167551889	ODZ2	5	A	G	G	G	1	0	0	0	0	0	0	0	1	132	11	3	3	10740	258
TRIM10	10107	broad.mit.edu	37	6	30126364	30126364	+	Missense_Mutation	SNP	C	T	T			TCGA-41-5651-01	TCGA-41-5651-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:30126364C>T	uc003npo.3	-	3	644	c.568G>A	c.(568-570)GCA>ACA	p.A190T	TRIM10_uc003npn.2_Missense_Mutation_p.A190T	NM_006778	NP_006769	Q9UDY6	TRI10_HUMAN	tripartite motif-containing 10 isoform 1	190						cytoplasm	zinc ion binding				0						CTCAGGTGTGCGAACTCAGAA	0.512													5	254	---	---	---	---	capture	Missense_Mutation	SNP	30126364	30126364	TRIM10	6	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	16369	258
TAP2	6891	broad.mit.edu	37	6	32782142	32782142	+	Missense_Mutation	SNP	G	C	C			TCGA-41-5651-01	TCGA-41-5651-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:32782142G>C	uc011dqf.1	-	14	2541	c.2419C>G	c.(2419-2421)CTT>GTT	p.L807V	HLA-DOB_uc003oca.2_Missense_Mutation_p.L200V|HLA-DOB_uc011dqg.1_Missense_Mutation_p.L200V	NM_018833	NP_061313	Q03519	TAP2_HUMAN	transporter 2, ATP-binding cassette, sub-family	Error:Variant_position_missing_in_Q03519_after_alignment					antigen processing and presentation of endogenous peptide antigen via MHC class I via ER pathway, TAP-dependent|antigen processing and presentation of endogenous peptide antigen via MHC class Ib via ER pathway, TAP-dependent|antigen processing and presentation of exogenous protein antigen via MHC class Ib, TAP-dependent|cytosol to ER transport|intracellular transport of viral proteins in host cell|peptide antigen transport|positive regulation of antigen processing and presentation of peptide antigen via MHC class I|positive regulation of T cell mediated cytotoxicity	nucleus|plasma membrane|TAP complex	ATP binding|MHC class I protein binding|oligopeptide-transporting ATPase activity|peptide antigen binding|peptide antigen-transporting ATPase activity|TAP1 binding|TAP2 binding|tapasin binding				0						TGATCGACAAGGCAGGTGTAG	0.502													28	34	---	---	---	---	capture	Missense_Mutation	SNP	32782142	32782142	TAP2	6	G	C	C	C	1	0	0	0	0	1	0	0	0	455	35	4	4	15439	258
DNAH8	1769	broad.mit.edu	37	6	38840400	38840400	+	Missense_Mutation	SNP	A	G	G			TCGA-41-5651-01	TCGA-41-5651-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:38840400A>G	uc003ooe.1	+	48	7028	c.6428A>G	c.(6427-6429)AAG>AGG	p.K2143R		NM_001371	NP_001362			dynein, axonemal, heavy polypeptide 8											skin(8)|ovary(7)|lung(2)|large_intestine(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	21						ATTCTAATGAAGGCGCAAACA	0.453													34	45	---	---	---	---	capture	Missense_Mutation	SNP	38840400	38840400	DNAH8	6	A	G	G	G	1	0	0	0	0	1	0	0	0	39	3	3	3	4563	258
KCNK5	8645	broad.mit.edu	37	6	39159464	39159464	+	Silent	SNP	C	A	A			TCGA-41-5651-01	TCGA-41-5651-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:39159464C>A	uc003oon.2	-	5	1066	c.702G>T	c.(700-702)GGG>GGT	p.G234G		NM_003740	NP_003731	O95279	KCNK5_HUMAN	potassium channel, subfamily K, member 5	234	Helical; (Potential).				excretion	integral to plasma membrane	potassium channel activity|voltage-gated ion channel activity			central_nervous_system(1)|skin(1)	2						GCCAGGCCAGCCCCAAGTAGA	0.577													9	105	---	---	---	---	capture	Silent	SNP	39159464	39159464	KCNK5	6	C	A	A	A	1	0	0	0	0	0	0	0	1	327	26	4	4	7991	258
LRFN2	57497	broad.mit.edu	37	6	40360425	40360425	+	Missense_Mutation	SNP	C	T	T			TCGA-41-5651-01	TCGA-41-5651-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:40360425C>T	uc003oph.1	-	3	2092	c.1627G>A	c.(1627-1629)GTG>ATG	p.V543M		NM_020737	NP_065788	Q9ULH4	LRFN2_HUMAN	leucine rich repeat and fibronectin type III	543	Helical; (Potential).					cell junction|integral to membrane|postsynaptic membrane				ovary(2)|skin(1)	3	Ovarian(28;0.0418)|Colorectal(47;0.196)					AGCGTGGCCACGATGATGCCC	0.607													14	27	---	---	---	---	capture	Missense_Mutation	SNP	40360425	40360425	LRFN2	6	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	8854	258
TREML1	340205	broad.mit.edu	37	6	41121571	41121571	+	Missense_Mutation	SNP	C	T	T			TCGA-41-5651-01	TCGA-41-5651-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:41121571C>T	uc011duc.1	-	2	345	c.301G>A	c.(301-303)GAG>AAG	p.E101K	TREML1_uc003opx.2_Missense_Mutation_p.E101K|TREML1_uc011dud.1_Intron	NM_178174	NP_835468	Q86YW5	TRML1_HUMAN	triggering receptor expressed on myeloid	101	Ig-like V-type.|Extracellular (Potential).				calcium-mediated signaling|innate immune response|platelet activation	cell surface|integral to membrane|plasma membrane|platelet alpha granule	protein binding|receptor activity			breast(1)	1	Ovarian(28;0.0418)|Colorectal(47;0.196)					CAGCCATACTCGCCAGCATCC	0.602													23	30	---	---	---	---	capture	Missense_Mutation	SNP	41121571	41121571	TREML1	6	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	16355	258
TDRD6	221400	broad.mit.edu	37	6	46658201	46658201	+	Missense_Mutation	SNP	C	G	G			TCGA-41-5651-01	TCGA-41-5651-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:46658201C>G	uc003oyj.2	+	1	2336	c.2336C>G	c.(2335-2337)TCT>TGT	p.S779C	TDRD6_uc010jze.2_Missense_Mutation_p.S773C	NM_001010870	NP_001010870	O60522	TDRD6_HUMAN	tudor domain containing 6	779					cell differentiation|multicellular organismal development|spermatogenesis	chromatoid body	nucleic acid binding			breast(3)|ovary(2)|skin(1)	6			Lung(136;0.192)			GTCAGAGTGTCTTATGTTGAA	0.388													22	27	---	---	---	---	capture	Missense_Mutation	SNP	46658201	46658201	TDRD6	6	C	G	G	G	1	0	0	0	0	1	0	0	0	416	32	4	4	15619	258
KIF25	3834	broad.mit.edu	37	6	168443352	168443352	+	Missense_Mutation	SNP	C	T	T			TCGA-41-5651-01	TCGA-41-5651-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:168443352C>T	uc003qwk.1	+	8	1203	c.941C>T	c.(940-942)CCG>CTG	p.P314L	KIF25_uc003qwl.1_Intron	NM_030615	NP_085118	Q9UIL4	KIF25_HUMAN	kinesin family member 25 isoform 1	314					microtubule-based movement|mitotic sister chromatid segregation	cytoplasm|kinesin complex|microtubule	ATP binding|microtubule motor activity			ovary(1)|pancreas(1)	2		Breast(66;1.07e-05)|Ovarian(120;0.0728)		Epithelial(4;7.7e-30)|OV - Ovarian serous cystadenocarcinoma(33;5.82e-22)|BRCA - Breast invasive adenocarcinoma(4;1.38e-10)|GBM - Glioblastoma multiforme(31;0.000756)		GGCCATGCCCCGTACCGGAAC	0.652													20	32	---	---	---	---	capture	Missense_Mutation	SNP	168443352	168443352	KIF25	6	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	8215	258
ZDHHC4	55146	broad.mit.edu	37	7	6628405	6628405	+	Missense_Mutation	SNP	G	A	A			TCGA-41-5651-01	TCGA-41-5651-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:6628405G>A	uc003sqi.2	+	9	1257	c.899G>A	c.(898-900)CGT>CAT	p.R300H	ZDHHC4_uc003sql.2_Missense_Mutation_p.R300H|ZDHHC4_uc003sqh.2_Missense_Mutation_p.R300H|ZDHHC4_uc003sqj.2_Missense_Mutation_p.R300H|ZDHHC4_uc003sqk.2_Missense_Mutation_p.R300H|ZDHHC4_uc003sqm.2_Missense_Mutation_p.R300H|uc011jwy.1_5'Flank|C7orf26_uc003sqo.1_5'Flank|C7orf26_uc003sqp.1_5'Flank|C7orf26_uc003sqq.1_5'Flank	NM_001134388	NP_001127860	Q9NPG8	ZDHC4_HUMAN	zinc finger, DHHC-type containing 4	300						integral to membrane	acyltransferase activity|zinc ion binding			breast(1)|pancreas(1)	2		Ovarian(82;0.232)		UCEC - Uterine corpus endometrioid carcinoma (126;0.1)		TGGTGCCAGCGTTGTCCCCTT	0.577													39	92	---	---	---	---	capture	Missense_Mutation	SNP	6628405	6628405	ZDHHC4	7	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	17497	258
GHRHR	2692	broad.mit.edu	37	7	31014610	31014610	+	Silent	SNP	C	T	T			TCGA-41-5651-01	TCGA-41-5651-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:31014610C>T	uc003tbx.2	+	9	885	c.837C>T	c.(835-837)TCC>TCT	p.S279S	GHRHR_uc003tbw.1_Silent_p.S279S|GHRHR_uc003tby.2_Silent_p.S215S|GHRHR_uc003tbz.2_Missense_Mutation_p.P46S	NM_000823	NP_000814	Q02643	GHRHR_HUMAN	growth hormone releasing hormone receptor	279	Extracellular (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|positive regulation of cAMP biosynthetic process|positive regulation of cell proliferation|positive regulation of growth hormone secretion|positive regulation of insulin-like growth factor receptor signaling pathway|positive regulation of multicellular organism growth|response to estrogen stimulus|response to glucocorticoid stimulus	cell surface|integral to membrane|nuclear inner membrane|nuclear matrix|nuclear outer membrane|plasma membrane|stored secretory granule	growth factor binding|growth hormone-releasing hormone receptor activity|peptide hormone binding			ovary(2)|lung(1)|breast(1)|large_intestine(1)	5					Sermorelin(DB00010)	ACGACACCTCCCCCTACTGGT	0.587											OREG0017943	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	44	81	---	---	---	---	capture	Silent	SNP	31014610	31014610	GHRHR	7	C	T	T	T	1	0	0	0	0	0	0	0	1	275	22	2	2	6312	258
SAMD9L	219285	broad.mit.edu	37	7	92765183	92765183	+	Silent	SNP	C	T	T			TCGA-41-5651-01	TCGA-41-5651-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:92765183C>T	uc003umh.1	-	5	1318	c.102G>A	c.(100-102)GGG>GGA	p.G34G	SAMD9L_uc003umj.1_Silent_p.G34G|SAMD9L_uc003umi.1_Silent_p.G34G|SAMD9L_uc010lfb.1_Silent_p.G34G|SAMD9L_uc003umk.1_Silent_p.G34G|SAMD9L_uc010lfc.1_Silent_p.G34G|SAMD9L_uc010lfd.1_Silent_p.G34G|SAMD9L_uc011khx.1_Silent_p.G25G	NM_152703	NP_689916	Q8IVG5	SAM9L_HUMAN	sterile alpha motif domain containing 9-like	34	SAM.									ovary(4)	4	all_cancers(62;4.15e-11)|all_epithelial(64;2.29e-10)|Breast(17;0.000675)|Lung NSC(181;0.0755)|all_lung(186;0.0989)		STAD - Stomach adenocarcinoma(171;0.000302)			GCAGAATTTGCCCGTATTGCT	0.403													4	135	---	---	---	---	capture	Silent	SNP	92765183	92765183	SAMD9L	7	C	T	T	T	1	0	0	0	0	0	0	0	1	327	26	2	2	13719	258
CNTNAP2	26047	broad.mit.edu	37	7	147844679	147844679	+	Missense_Mutation	SNP	G	A	A			TCGA-41-5651-01	TCGA-41-5651-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:147844679G>A	uc003weu.1	+	17	3167	c.2651G>A	c.(2650-2652)CGG>CAG	p.R884Q		NM_014141	NP_054860	Q9UHC6	CNTP2_HUMAN	cell recognition molecule Caspr2 precursor	884	Laminin G-like 3.|Extracellular (Potential).				behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding			ovary(9)|central_nervous_system(1)|pancreas(1)	11	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			CAGTGGCACCGGGTCACTGCA	0.582										HNSCC(39;0.1)			36	108	---	---	---	---	capture	Missense_Mutation	SNP	147844679	147844679	CNTNAP2	7	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	3612	258
UBE3C	9690	broad.mit.edu	37	7	156963055	156963055	+	Missense_Mutation	SNP	G	A	A			TCGA-41-5651-01	TCGA-41-5651-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:156963055G>A	uc010lqs.2	+	4	565	c.253G>A	c.(253-255)GCT>ACT	p.A85T	UBE3C_uc003wnf.2_Missense_Mutation_p.A42T|UBE3C_uc003wng.2_Missense_Mutation_p.A85T	NM_014671	NP_055486	Q15386	UBE3C_HUMAN	ubiquitin protein ligase E3C	85					protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus|proteasome complex	protein binding|ubiquitin-protein ligase activity			ovary(2)|lung(2)|large_intestine(1)	5		all_hematologic(28;0.0185)|all_epithelial(9;0.0664)	OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.19)		GTCCGGGGGCGCTTTTCCCAT	0.398													63	112	---	---	---	---	capture	Missense_Mutation	SNP	156963055	156963055	UBE3C	7	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	16763	258
ADAM28	10863	broad.mit.edu	37	8	24199261	24199261	+	Silent	SNP	C	T	T	rs149263503	byFrequency	TCGA-41-5651-01	TCGA-41-5651-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:24199261C>T	uc003xdy.2	+	16	1904	c.1821C>T	c.(1819-1821)GGC>GGT	p.G607G	ADAM28_uc011laa.1_RNA|ADAM28_uc010lua.2_Silent_p.G294G	NM_014265	NP_055080	Q9UKQ2	ADA28_HUMAN	ADAM metallopeptidase domain 28 isoform 1	607	Extracellular (Potential).|Cys-rich.				proteolysis|spermatogenesis	extracellular region|integral to membrane|plasma membrane	metalloendopeptidase activity|zinc ion binding			skin(3)|lung(1)|central_nervous_system(1)	5		Prostate(55;0.0959)		Colorectal(74;0.0129)|COAD - Colon adenocarcinoma(73;0.0434)|BRCA - Breast invasive adenocarcinoma(99;0.175)		CTAAGTGTGGCGATAACAAGG	0.408													22	39	---	---	---	---	capture	Silent	SNP	24199261	24199261	ADAM28	8	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	246	258
PXDNL	137902	broad.mit.edu	37	8	52387699	52387699	+	Missense_Mutation	SNP	C	T	T			TCGA-41-5651-01	TCGA-41-5651-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:52387699C>T	uc003xqu.3	-	7	628	c.527G>A	c.(526-528)CGT>CAT	p.R176H		NM_144651	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog-like precursor	176					hydrogen peroxide catabolic process	extracellular space	heme binding|peroxidase activity			ovary(1)|pancreas(1)	2		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)				GGAATCCAGACGCCTAGGCAT	0.468													16	24	---	---	---	---	capture	Missense_Mutation	SNP	52387699	52387699	PXDNL	8	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	12743	258
C8orf38	137682	broad.mit.edu	37	8	96047748	96047748	+	Missense_Mutation	SNP	G	A	A			TCGA-41-5651-01	TCGA-41-5651-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:96047748G>A	uc003yhj.2	+	3	380	c.364G>A	c.(364-366)GAA>AAA	p.E122K	C8orf38_uc003yhe.1_RNA|C8orf38_uc003yhf.2_Missense_Mutation_p.E30K|C8orf38_uc011lgs.1_RNA|C8orf38_uc003yhi.2_Missense_Mutation_p.E70K|C8orf38_uc003yhk.2_RNA|C8orf38_uc003yhl.2_Missense_Mutation_p.E30K	NM_152416	NP_689629	Q330K2	CH038_HUMAN	hypothetical protein LOC137682 precursor	122					biosynthetic process	mitochondrion	transferase activity				0	Breast(36;3.32e-06)					AAAAACTGTGGAAGATATATA	0.328													30	40	---	---	---	---	capture	Missense_Mutation	SNP	96047748	96047748	C8orf38	8	G	A	A	A	1	0	0	0	0	1	0	0	0	533	41	2	2	2401	258
PKHD1L1	93035	broad.mit.edu	37	8	110454293	110454293	+	Missense_Mutation	SNP	C	A	A			TCGA-41-5651-01	TCGA-41-5651-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:110454293C>A	uc003yne.2	+	35	4366	c.4262C>A	c.(4261-4263)ACA>AAA	p.T1421K		NM_177531	NP_803875	Q86WI1	PKHL1_HUMAN	fibrocystin L precursor	1421	Extracellular (Potential).|IPT/TIG 7.				immune response	cytosol|extracellular space|integral to membrane	receptor activity			ovary(9)|central_nervous_system(2)|large_intestine(1)|breast(1)|pancreas(1)	14			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			GTGGGGGACACAGTGGCATGG	0.418										HNSCC(38;0.096)			26	26	---	---	---	---	capture	Missense_Mutation	SNP	110454293	110454293	PKHD1L1	8	C	A	A	A	1	0	0	0	0	1	0	0	0	221	17	4	4	11875	258
DEPDC6	64798	broad.mit.edu	37	8	120977651	120977651	+	Splice_Site	SNP	G	T	T			TCGA-41-5651-01	TCGA-41-5651-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:120977651G>T	uc003yow.3	+	4	791	c.604_splice	c.e4+1	p.V202_splice	DEPDC6_uc011lid.1_Splice_Site_p.V101_splice	NM_022783	NP_073620	Q8TB45	DPTOR_HUMAN	DEP domain containing 6						intracellular signal transduction|negative regulation of cell size|negative regulation of protein kinase activity|negative regulation of TOR signaling cascade|regulation of apoptosis	intracellular	protein binding				0	Lung NSC(37;9.35e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00185)			ATCCAGCATGGTGAGCgtatt	0.303													27	58	---	---	---	---	capture	Splice_Site	SNP	120977651	120977651	DEPDC6	8	G	T	T	T	1	0	0	0	0	0	0	1	0	572	44	5	4	4401	258
ADCY8	114	broad.mit.edu	37	8	132002709	132002709	+	Missense_Mutation	SNP	C	T	T			TCGA-41-5651-01	TCGA-41-5651-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:132002709C>T	uc003ytd.3	-	2	1296	c.1040G>A	c.(1039-1041)CGC>CAC	p.R347H	ADCY8_uc010mds.2_Missense_Mutation_p.R347H	NM_001115	NP_001106	P40145	ADCY8_HUMAN	adenylate cyclase 8	347	Cytoplasmic (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane|membrane fraction|plasma membrane	ATP binding|calcium- and calmodulin-responsive adenylate cyclase activity|metal ion binding			skin(4)|large_intestine(1)|central_nervous_system(1)	6	Esophageal squamous(12;0.00693)|Ovarian(258;0.00707)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000538)			GAAAGCTTGGCGCTGGGCCCG	0.522										HNSCC(32;0.087)			105	93	---	---	---	---	capture	Missense_Mutation	SNP	132002709	132002709	ADCY8	8	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	300	258
ACO1	48	broad.mit.edu	37	9	32430435	32430435	+	Missense_Mutation	SNP	G	T	T			TCGA-41-5651-01	TCGA-41-5651-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:32430435G>T	uc003zqw.3	+	14	1744	c.1589G>T	c.(1588-1590)GGA>GTA	p.G530V	ACO1_uc010mjh.1_Missense_Mutation_p.G364V|ACO1_uc003zqx.3_Missense_Mutation_p.G530V|ACO1_uc003zqy.3_RNA	NM_002197	NP_002188	P21399	ACOC_HUMAN	aconitase 1	530					citrate metabolic process|response to iron(II) ion|tricarboxylic acid cycle	cytosol|endoplasmic reticulum|Golgi apparatus	4 iron, 4 sulfur cluster binding|aconitate hydratase activity|citrate hydro-lyase (cis-aconitate-forming) activity|iron-responsive element binding|isocitrate hydro-lyase (cis-aconitate-forming) activity|metal ion binding|protein binding				0			LUSC - Lung squamous cell carcinoma(29;0.00813)	GBM - Glioblastoma multiforme(74;3.94e-06)		GTAGCTGTTGGAGTACTATCT	0.453													45	60	---	---	---	---	capture	Missense_Mutation	SNP	32430435	32430435	ACO1	9	G	T	T	T	1	0	0	0	0	1	0	0	0	533	41	4	4	146	258
DAPK1	1612	broad.mit.edu	37	9	90220082	90220082	+	Silent	SNP	C	T	T			TCGA-41-5651-01	TCGA-41-5651-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:90220082C>T	uc004apc.2	+	3	414	c.276C>T	c.(274-276)ATC>ATT	p.I92I	DAPK1_uc004ape.2_Silent_p.I92I|DAPK1_uc004apd.2_Silent_p.I92I|DAPK1_uc011ltg.1_Silent_p.I92I|DAPK1_uc011lth.1_5'UTR	NM_004938	NP_004929	P53355	DAPK1_HUMAN	death-associated protein kinase 1	92	Protein kinase.				apoptosis|induction of apoptosis by extracellular signals|intracellular protein kinase cascade	actin cytoskeleton|cytoplasm	ATP binding|calmodulin binding|protein serine/threonine kinase activity			ovary(1)|breast(1)	2						TCATCCTGATCTTGGAACTGT	0.612									Chronic_Lymphocytic_Leukemia_Familial_Clustering_of				21	22	---	---	---	---	capture	Silent	SNP	90220082	90220082	DAPK1	9	C	T	T	T	1	0	0	0	0	0	0	0	1	408	32	2	2	4194	258
SNX30	401548	broad.mit.edu	37	9	115580093	115580093	+	Missense_Mutation	SNP	C	G	G			TCGA-41-5651-01	TCGA-41-5651-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:115580093C>G	uc004bgj.3	+	3	605	c.457C>G	c.(457-459)CCC>GCC	p.P153A		NM_001012994	NP_001013012	Q5VWJ9	SNX30_HUMAN	sorting nexin family member 30	153	PX.				cell communication|protein transport	cytoplasm	phosphatidylinositol binding				0						TCATCTCATTCCCGTAGGTAG	0.458													19	19	---	---	---	---	capture	Missense_Mutation	SNP	115580093	115580093	SNX30	9	C	G	G	G	1	0	0	0	0	1	0	0	0	390	30	4	4	14792	258
OR1J1	347168	broad.mit.edu	37	9	125239495	125239495	+	Silent	SNP	G	A	A			TCGA-41-5651-01	TCGA-41-5651-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:125239495G>A	uc011lyu.1	-	1	711	c.711C>T	c.(709-711)GCC>GCT	p.A237A	OR1J2_uc004bmj.1_Intron	NM_001004451	NP_001004451	Q8NGS3	OR1J1_HUMAN	olfactory receptor, family 1, subfamily J,	237	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2						AAGTGGACAAGGCTTTGCATA	0.468													22	42	---	---	---	---	capture	Silent	SNP	125239495	125239495	OR1J1	9	G	A	A	A	1	0	0	0	0	0	0	0	1	444	35	2	2	10863	258
SDCCAG3	10807	broad.mit.edu	37	9	139299619	139299619	+	Missense_Mutation	SNP	A	G	G			TCGA-41-5651-01	TCGA-41-5651-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:139299619A>G	uc004chi.2	-	7	1134	c.929T>C	c.(928-930)ATG>ACG	p.M310T	SDCCAG3_uc004chj.2_Missense_Mutation_p.M287T|SDCCAG3_uc004chk.2_Missense_Mutation_p.M237T	NM_001039707	NP_001034796	Q96C92	SDCG3_HUMAN	serologically defined colon cancer antigen 3	310	Potential.					cytoplasm					0		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;8.18e-06)|Epithelial(140;9.31e-06)		CTCCTTGATCATTTTTGCTTC	0.463													38	62	---	---	---	---	capture	Missense_Mutation	SNP	139299619	139299619	SDCCAG3	9	A	G	G	G	1	0	0	0	0	1	0	0	0	104	8	3	3	13851	258
MXRA5	25878	broad.mit.edu	37	X	3235173	3235173	+	Silent	SNP	C	T	T			TCGA-41-5651-01	TCGA-41-5651-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:3235173C>T	uc004crg.3	-	6	6706	c.6549G>A	c.(6547-6549)CCG>CCA	p.P2183P		NM_015419	NP_056234	Q9NR99	MXRA5_HUMAN	adlican precursor	2183	Ig-like C2-type 6.					extracellular region				ovary(5)|lung(1)|central_nervous_system(1)|skin(1)	8		all_lung(23;0.00031)|Lung NSC(23;0.000946)				TCCTCTTGGACGGCAGCCTCC	0.637													4	9	---	---	---	---	capture	Silent	SNP	3235173	3235173	MXRA5	23	C	T	T	T	1	0	0	0	0	0	0	0	1	236	19	1	1	9913	258
TLR7	51284	broad.mit.edu	37	X	12905182	12905182	+	Missense_Mutation	SNP	C	A	A			TCGA-41-5651-01	TCGA-41-5651-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:12905182C>A	uc004cvc.2	+	3	1694	c.1555C>A	c.(1555-1557)CTC>ATC	p.L519I		NM_016562	NP_057646	Q9NYK1	TLR7_HUMAN	toll-like receptor 7 precursor	519	Extracellular (Potential).|LRR 17.				cellular response to mechanical stimulus|defense response to virus|I-kappaB phosphorylation|inflammatory response|innate immune response|positive regulation of chemokine production|positive regulation of interferon-alpha biosynthetic process|positive regulation of interferon-beta biosynthetic process|positive regulation of interferon-gamma biosynthetic process|positive regulation of interleukin-8 biosynthetic process|positive regulation of interleukin-8 production|positive regulation of NF-kappaB import into nucleus	early phagosome|endoplasmic reticulum membrane|endosome membrane|integral to membrane|lysosome|plasma membrane	double-stranded RNA binding|single-stranded RNA binding|siRNA binding|transmembrane receptor activity			ovary(2)|lung(2)|breast(1)	5					Imiquimod(DB00724)	TCTTTCTTTCCTCAAATGCCT	0.378													28	442	---	---	---	---	capture	Missense_Mutation	SNP	12905182	12905182	TLR7	23	C	A	A	A	1	0	0	0	0	1	0	0	0	312	24	4	4	15841	258
DDX53	168400	broad.mit.edu	37	X	23019720	23019720	+	Missense_Mutation	SNP	G	A	A			TCGA-41-5651-01	TCGA-41-5651-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:23019720G>A	uc004daj.2	+	1	1634	c.1546G>A	c.(1546-1548)GGA>AGA	p.G516R		NM_182699	NP_874358	Q86TM3	DDX53_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 53	516	Helicase C-terminal.					nucleus	ATP binding|ATP-dependent helicase activity|RNA binding			large_intestine(1)|ovary(1)|kidney(1)	3						CTTTAAAAGCGGAAACATAAA	0.373													11	183	---	---	---	---	capture	Missense_Mutation	SNP	23019720	23019720	DDX53	23	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	4329	258
CXorf21	80231	broad.mit.edu	37	X	30577750	30577750	+	Silent	SNP	C	T	T			TCGA-41-5651-01	TCGA-41-5651-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:30577750C>T	uc004dcg.1	-	3	999	c.723G>A	c.(721-723)GCG>GCA	p.A241A		NM_025159	NP_079435	Q9HAI6	CX021_HUMAN	hypothetical protein LOC80231	241										ovary(1)	1						TGAGTTCAGACGCCAGAATCT	0.438													40	109	---	---	---	---	capture	Silent	SNP	30577750	30577750	CXorf21	23	C	T	T	T	1	0	0	0	0	0	0	0	1	236	19	1	1	4061	258
GRIPAP1	56850	broad.mit.edu	37	X	48839756	48839756	+	Missense_Mutation	SNP	G	A	A			TCGA-41-5651-01	TCGA-41-5651-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:48839756G>A	uc004dly.1	-	16	1404	c.1369C>T	c.(1369-1371)CGG>TGG	p.R457W	GRIPAP1_uc004dlz.2_Missense_Mutation_p.R347W|GRIPAP1_uc004dma.2_Missense_Mutation_p.R404W	NM_020137	NP_064522	Q4V328	GRAP1_HUMAN	GRIP1 associated protein 1 isoform 1	457	Potential.					early endosome				breast(2)|kidney(1)	3						TTCTCATGCCGTAGACGAACT	0.597													37	111	---	---	---	---	capture	Missense_Mutation	SNP	48839756	48839756	GRIPAP1	23	G	A	A	A	1	0	0	0	0	1	0	0	0	519	40	1	1	6722	258
ITIH5L	347365	broad.mit.edu	37	X	54785423	54785423	+	Missense_Mutation	SNP	C	T	T			TCGA-41-5651-01	TCGA-41-5651-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:54785423C>T	uc004dtj.2	-	8	1114	c.1084G>A	c.(1084-1086)GTC>ATC	p.V362I		NM_198510	NP_940912	Q6UXX5	ITH5L_HUMAN	inter-alpha (globulin) inhibitor H5-like	362	VWFA.				hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity			lung(2)|skin(2)|ovary(1)|breast(1)	6						GCTGAGTTGACGTCTGTCCCT	0.547													4	7	---	---	---	---	capture	Missense_Mutation	SNP	54785423	54785423	ITIH5L	23	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	7831	258
ZXDA	7789	broad.mit.edu	37	X	57936065	57936065	+	Missense_Mutation	SNP	C	T	T			TCGA-41-5651-01	TCGA-41-5651-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:57936065C>T	uc004dve.2	-	1	1003	c.790G>A	c.(790-792)GTG>ATG	p.V264M		NM_007156	NP_009087	P98168	ZXDA_HUMAN	zinc finger, X-linked, duplicated A	264					positive regulation of transcription, DNA-dependent	nucleus	C2H2 zinc finger domain binding|identical protein binding|nucleic acid binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1						TACAGCACCACGCCTGGACCA	0.726													3	13	---	---	---	---	capture	Missense_Mutation	SNP	57936065	57936065	ZXDA	23	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	18126	258
TAF1	6872	broad.mit.edu	37	X	70613222	70613222	+	Silent	SNP	A	C	C			TCGA-41-5651-01	TCGA-41-5651-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:70613222A>C	uc004dzu.3	+	21	3171	c.3120A>C	c.(3118-3120)GGA>GGC	p.G1040G	BCYRN1_uc011mpt.1_Intron|TAF1_uc004dzt.3_Silent_p.G1061G|TAF1_uc004dzv.3_Silent_p.G214G	NM_138923	NP_620278	P21675	TAF1_HUMAN	TBP-associated factor 1 isoform 2	1040					G1 phase of mitotic cell cycle|interspecies interaction between organisms|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription initiation from RNA polymerase II promoter|protein autophosphorylation|regulation of transcription involved in G2/M-phase of mitotic cell cycle|RNA polymerase II transcriptional preinitiation complex assembly|transcription elongation from RNA polymerase II promoter|viral reproduction	MLL1 complex|transcription factor TFIID complex	ATP binding|histone acetyl-lysine binding|histone acetyltransferase activity|p53 binding|protein binding|protein serine/threonine kinase activity|sequence-specific DNA binding|TBP-class protein binding|transcription coactivator activity			ovary(7)|breast(4)|large_intestine(2)|central_nervous_system(2)|lung(1)|skin(1)	17	Renal(35;0.156)	all_lung(315;0.000321)				CTCGTTCTGGAGAGGGGCCCA	0.448													31	72	---	---	---	---	capture	Silent	SNP	70613222	70613222	TAF1	23	A	C	C	C	1	0	0	0	0	0	0	0	1	132	11	4	4	15401	258
ABCB7	22	broad.mit.edu	37	X	74291376	74291376	+	Missense_Mutation	SNP	A	T	T			TCGA-41-5651-01	TCGA-41-5651-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:74291376A>T	uc004eca.2	-	9	1200	c.1175T>A	c.(1174-1176)ATA>AAA	p.I392K	ABCB7_uc004ebz.2_Missense_Mutation_p.I393K|ABCB7_uc011mqn.1_Missense_Mutation_p.I366K|ABCB7_uc010nls.2_Missense_Mutation_p.I353K|ABCB7_uc010nlt.2_Missense_Mutation_p.I352K	NM_004299	NP_004290	O75027	ABCB7_HUMAN	ATP-binding cassette, sub-family B, member 7	392	ABC transmembrane type-1.|Helical; (Potential).				cellular iron ion homeostasis	integral to membrane|mitochondrial inner membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances|heme transporter activity			ovary(1)	1						GAGCACCATTATAGCTGTTAA	0.388													18	51	---	---	---	---	capture	Missense_Mutation	SNP	74291376	74291376	ABCB7	23	A	T	T	T	1	0	0	0	0	1	0	0	0	208	16	4	4	46	258
RPL36A	6173	broad.mit.edu	37	X	100646453	100646453	+	Missense_Mutation	SNP	G	A	A			TCGA-41-5651-01	TCGA-41-5651-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:100646453G>A	uc004ehk.2	+	2	94	c.10G>A	c.(10-12)GTC>ATC	p.V4I	BTK_uc010nno.2_5'Flank|RPL36A_uc004ehj.1_Missense_Mutation_p.V4I	NM_021029	NP_066357	P83881	RL36A_HUMAN	ribosomal protein L36a	4					endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosol|ribosome	protein binding|structural constituent of ribosome				0						CTAGGTTAACGTCCCTAAAAC	0.498													90	224	---	---	---	---	capture	Missense_Mutation	SNP	100646453	100646453	RPL36A	23	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	13479	258
KIAA1210	57481	broad.mit.edu	37	X	118238988	118238988	+	Missense_Mutation	SNP	C	A	A			TCGA-41-5651-01	TCGA-41-5651-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:118238988C>A	uc004era.3	-	7	1035	c.1035G>T	c.(1033-1035)AAG>AAT	p.K345N		NM_020721	NP_065772	Q9ULL0	K1210_HUMAN	hypothetical protein LOC57481	345										ovary(4)|skin(1)	5						GTGGTAAAGCCTTCTTTTGTG	0.418													75	216	---	---	---	---	capture	Missense_Mutation	SNP	118238988	118238988	KIAA1210	23	C	A	A	A	1	0	0	0	0	1	0	0	0	311	24	4	4	8136	258
FRMD7	90167	broad.mit.edu	37	X	131219611	131219611	+	Missense_Mutation	SNP	G	A	A			TCGA-41-5651-01	TCGA-41-5651-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:131219611G>A	uc004ewn.2	-	7	821	c.643C>T	c.(643-645)CGG>TGG	p.R215W	FRMD7_uc011muy.1_Missense_Mutation_p.R200W	NM_194277	NP_919253	Q6ZUT3	FRMD7_HUMAN	FERM domain containing 7	215	FERM.				regulation of neuron projection development	cytoskeleton|growth cone|neuronal cell body	binding			skin(1)	1	Acute lymphoblastic leukemia(192;0.000127)					GATTTTACCCGTAACACCAGT	0.512													57	125	---	---	---	---	capture	Missense_Mutation	SNP	131219611	131219611	FRMD7	23	G	A	A	A	1	0	0	0	0	1	0	0	0	519	40	1	1	5998	258
ATP2B3	492	broad.mit.edu	37	X	152818620	152818620	+	Missense_Mutation	SNP	C	T	T			TCGA-41-5651-01	TCGA-41-5651-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:152818620C>T	uc004fht.1	+	11	2077	c.1951C>T	c.(1951-1953)CGG>TGG	p.R651W	ATP2B3_uc004fhs.1_Missense_Mutation_p.R651W	NM_001001344	NP_001001344	Q16720	AT2B3_HUMAN	plasma membrane calcium ATPase 3 isoform 3b	651	Cytoplasmic (Potential).				ATP biosynthetic process|platelet activation	integral to membrane|plasma membrane	ATP binding|calcium-transporting ATPase activity|calmodulin binding|metal ion binding			pancreas(1)	1	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					CATCGCCTACCGGGACTTCTC	0.632													24	63	---	---	---	---	capture	Missense_Mutation	SNP	152818620	152818620	ATP2B3	23	C	T	T	T	1	0	0	0	0	1	0	0	0	295	23	1	1	1132	258
LRIG3	121227	broad.mit.edu	37	12	59268350	59268351	+	Frame_Shift_Ins	INS	-	G	G			TCGA-41-5651-01	TCGA-41-5651-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:59268350_59268351insG	uc001sqr.2	-	17	2946_2947	c.2700_2701insC	c.(2698-2703)ACCTGCfs	p.T900fs	LRIG3_uc009zqh.2_Frame_Shift_Ins_p.T840fs|LRIG3_uc010ssh.1_RNA	NM_153377	NP_700356	Q6UXM1	LRIG3_HUMAN	leucine-rich repeats and immunoglobulin-like	900_901						integral to membrane				skin(3)|ovary(1)	4			GBM - Glioblastoma multiforme(1;1.17e-18)			TCAATATGGCAGGTCCCTTTGA	0.401													7	832	---	---	---	---	capture_indel	Frame_Shift_Ins	INS	59268350	59268351	LRIG3	12	-	G	G	G	1	0	1	1	0	0	0	0	0	91	7	5	5	8862	258
FAM83D	81610	broad.mit.edu	37	20	37555323	37555325	+	In_Frame_Del	DEL	GCG	-	-			TCGA-41-5651-01	TCGA-41-5651-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:37555323_37555325delGCG	uc002xjg.2	+	1	369_371	c.328_330delGCG	c.(328-330)GCGdel	p.A116del	FAM83D_uc002xjf.2_In_Frame_Del_p.A116del	NM_030919	NP_112181	Q9H4H8	FA83D_HUMAN	hypothetical protein LOC81610	86	Poly-Ala.				cell division|mitosis	cytoplasm|spindle pole				ovary(3)	3		Myeloproliferative disorder(115;0.00878)				AGAGGAGGGCgcggcggcggcgg	0.621													2	4	---	---	---	---	capture_indel	In_Frame_Del	DEL	37555323	37555325	FAM83D	20	GCG	-	-	-	1	0	1	0	1	0	0	0	0	494	38	5	5	5582	258
