Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
SERINC2	347735	broad.mit.edu	37	1	31897702	31897702	+	Missense_Mutation	SNP	G	A	A			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:31897702G>A	uc010ogh.1	+	3	587	c.386G>A	c.(385-387)CGG>CAG	p.R129Q	SERINC2_uc010ogg.1_Missense_Mutation_p.R126Q|SERINC2_uc009vtw.1_Missense_Mutation_p.R125Q|SERINC2_uc001bst.2_Missense_Mutation_p.R125Q|SERINC2_uc001bsu.2_Missense_Mutation_p.R70Q|SERINC2_uc001bsv.2_Missense_Mutation_p.R70Q	NM_178865	NP_849196	Q96SA4	SERC2_HUMAN	tumor differentially expressed 2-like	125						integral to membrane					0		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|all_neural(195;0.0629)|Breast(348;0.0707)|Medulloblastoma(700;0.123)		STAD - Stomach adenocarcinoma(196;0.0541)|READ - Rectum adenocarcinoma(331;0.151)		CGGGACCCCCGGGCTGCCATC	0.647													5	18	---	---	---	---	capture	Missense_Mutation	SNP	31897702	31897702	SERINC2	1	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	13973	261
WLS	79971	broad.mit.edu	37	1	68610274	68610274	+	Missense_Mutation	SNP	A	G	G			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:68610274A>G	uc001def.1	-	10	1611	c.1340T>C	c.(1339-1341)GTC>GCC	p.V447A	uc001deb.1_Intron|uc001dec.1_Intron|WLS_uc001dee.2_Missense_Mutation_p.V445A|WLS_uc001deg.1_Missense_Mutation_p.V356A|WLS_uc009wbf.1_Missense_Mutation_p.V402A	NM_024911	NP_079187	Q5T9L3	WLS_HUMAN	G protein-coupled receptor 177 isoform 1	447	Helical; Name=6; (Potential).				multicellular organismal development|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|Wnt receptor signaling pathway	cytoplasmic vesicle membrane|Golgi membrane|integral to membrane	signal transducer activity				0						GAAGAAGATGACAGTCATGGC	0.443													3	160	---	---	---	---	capture	Missense_Mutation	SNP	68610274	68610274	WLS	1	A	G	G	G	1	0	0	0	0	1	0	0	0	130	10	3	3	17257	261
SLC35A3	23443	broad.mit.edu	37	1	100464899	100464899	+	Silent	SNP	A	C	C			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:100464899A>C	uc001dsp.1	+	3	467	c.270A>C	c.(268-270)CCA>CCC	p.P90P	SLC35A3_uc001dsq.1_Silent_p.P90P|SLC35A3_uc009wdy.1_Silent_p.P90P|SLC35A3_uc001dsr.1_Silent_p.P132P|SLC35A3_uc001dss.1_Silent_p.P9P	NM_012243	NP_036375	Q9Y2D2	S35A3_HUMAN	solute carrier family 35 member 3A	90					UDP-N-acetylglucosamine metabolic process	Golgi membrane|integral to membrane	sugar:hydrogen symporter activity|UDP-N-acetylglucosamine transmembrane transporter activity				0		all_epithelial(167;0.000686)|all_lung(203;0.0154)|Lung NSC(277;0.0155)		Epithelial(280;0.124)|all cancers(265;0.198)|Lung(183;0.199)		TTGCTATTCCATCAGGGATCT	0.308													19	67	---	---	---	---	capture	Silent	SNP	100464899	100464899	SLC35A3	1	A	C	C	C	1	0	0	0	0	0	0	0	1	93	8	4	4	14464	261
THEM5	284486	broad.mit.edu	37	1	151820732	151820732	+	Silent	SNP	G	A	A			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:151820732G>A	uc009wnd.2	-	4	633	c.501C>T	c.(499-501)GAC>GAT	p.D167D		NM_182578	NP_872384	Q8N1Q8	THEM5_HUMAN	thioesterase superfamily member 5	167							hydrolase activity			ovary(1)|skin(1)	2	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		LUSC - Lung squamous cell carcinoma(543;0.181)			AAAAGGTCTCGTCCATCATGG	0.587													22	38	---	---	---	---	capture	Silent	SNP	151820732	151820732	THEM5	1	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	15744	261
CD1E	913	broad.mit.edu	37	1	158325309	158325309	+	Missense_Mutation	SNP	G	A	A			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:158325309G>A	uc001fse.2	+	3	814	c.575G>A	c.(574-576)CGA>CAA	p.R192Q	CD1E_uc010pid.1_Missense_Mutation_p.R190Q|CD1E_uc010pie.1_Missense_Mutation_p.R93Q|CD1E_uc010pif.1_Intron|CD1E_uc001fsd.2_Missense_Mutation_p.R192Q|CD1E_uc001fsk.2_Intron|CD1E_uc001fsj.2_Intron|CD1E_uc001fsc.2_Intron|CD1E_uc010pig.1_Intron|CD1E_uc001fsa.2_Intron|CD1E_uc001fsf.2_Missense_Mutation_p.R192Q|CD1E_uc001fry.2_Missense_Mutation_p.R192Q|CD1E_uc001fsg.2_Intron|CD1E_uc001fsh.2_Intron|CD1E_uc001fsi.2_Missense_Mutation_p.R192Q|CD1E_uc009wsv.2_Missense_Mutation_p.R93Q|CD1E_uc001frz.2_Intron|CD1E_uc009wsw.2_5'Flank	NM_030893	NP_112155	P15812	CD1E_HUMAN	CD1E antigen isoform a precursor	192	Ig-like.				antigen processing and presentation|immune response	early endosome|Golgi membrane|integral to plasma membrane|late endosome|lysosomal lumen				skin(3)	3	all_hematologic(112;0.0378)					ACCTGCCCTCGATTTCTAGCG	0.507													7	21	---	---	---	---	capture	Missense_Mutation	SNP	158325309	158325309	CD1E	1	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	2949	261
SPTA1	6708	broad.mit.edu	37	1	158621161	158621161	+	Missense_Mutation	SNP	C	T	T			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:158621161C>T	uc001fst.1	-	24	3672	c.3473G>A	c.(3472-3474)CGG>CAG	p.R1158Q		NM_003126	NP_003117	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	1158	Spectrin 11.				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8	all_hematologic(112;0.0378)					AGTTACCTGCCGGATTTGAGC	0.463													35	162	---	---	---	---	capture	Missense_Mutation	SNP	158621161	158621161	SPTA1	1	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	15008	261
SLAMF6	114836	broad.mit.edu	37	1	160461161	160461161	+	Missense_Mutation	SNP	G	T	T			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:160461161G>T	uc001fwe.1	-	3	460	c.400C>A	c.(400-402)CAA>AAA	p.Q134K	SLAMF6_uc001fwd.1_Missense_Mutation_p.Q134K|SLAMF6_uc010pjh.1_Missense_Mutation_p.Q85K|SLAMF6_uc010pji.1_Missense_Mutation_p.Q23K|SLAMF6_uc010pjj.1_Missense_Mutation_p.Q23K|SLAMF6_uc009wtm.1_Missense_Mutation_p.Q85K	NM_052931	NP_443163	Q96DU3	SLAF6_HUMAN	activating NK receptor precursor	134	Extracellular (Potential).|Ig-like.					integral to membrane|plasma membrane	receptor activity			ovary(1)|skin(1)	2	all_cancers(52;1.05e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.0923)			TTGGTAACTTGTATGTTCCTC	0.418													8	66	---	---	---	---	capture	Missense_Mutation	SNP	160461161	160461161	SLAMF6	1	G	T	T	T	1	0	0	0	0	1	0	0	0	624	48	4	4	14261	261
C1orf14	81626	broad.mit.edu	37	1	182898838	182898838	+	Nonsense_Mutation	SNP	T	A	A			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:182898838T>A	uc001gpu.2	-	6	1411	c.1126A>T	c.(1126-1128)AGA>TGA	p.R376*	C1orf14_uc001gpv.2_Nonsense_Mutation_p.R257*|C1orf14_uc010pnz.1_Nonsense_Mutation_p.R234*|C1orf14_uc001gpw.2_Nonsense_Mutation_p.R96*	NM_030933	NP_112195	Q9BZQ2	SHP1L_HUMAN	chromosome 1 open reading frame 14	448											0				Colorectal(1306;1.64e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00267)		CCAAATTCTCTTTTTCCTTTC	0.244													10	48	---	---	---	---	capture	Nonsense_Mutation	SNP	182898838	182898838	C1orf14	1	T	A	A	A	1	0	0	0	0	0	1	0	0	726	56	5	4	1982	261
NCF2	4688	broad.mit.edu	37	1	183532621	183532621	+	Missense_Mutation	SNP	G	A	A			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:183532621G>A	uc001gqj.3	-	12	1401	c.1126C>T	c.(1126-1128)CGG>TGG	p.R376W	NCF2_uc010pod.1_Missense_Mutation_p.R331W|NCF2_uc010poe.1_Missense_Mutation_p.R295W|NCF2_uc001gqk.3_Missense_Mutation_p.R376W	NM_000433	NP_000424	P19878	NCF2_HUMAN	neutrophil cytosolic factor 2	376	OPR.				cellular defense response|innate immune response|respiratory burst|superoxide anion generation	NADPH oxidase complex|nucleolus	electron carrier activity|protein C-terminus binding			ovary(3)	3						ACCATGTCCCGGACCTGGCTG	0.567													4	122	---	---	---	---	capture	Missense_Mutation	SNP	183532621	183532621	NCF2	1	G	A	A	A	1	0	0	0	0	1	0	0	0	506	39	1	1	10124	261
CFHR5	81494	broad.mit.edu	37	1	196977626	196977626	+	Missense_Mutation	SNP	T	C	C			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:196977626T>C	uc001gts.3	+	10	1651	c.1523T>C	c.(1522-1524)GTG>GCG	p.V508A		NM_030787	NP_110414	Q9BXR6	FHR5_HUMAN	complement factor H-related 5 precursor	508	Sushi 9.				complement activation, alternative pathway	extracellular region				breast(1)|skin(1)	2						GATCCATGTGTGGTATCTGAA	0.289													2	7	---	---	---	---	capture	Missense_Mutation	SNP	196977626	196977626	CFHR5	1	T	C	C	C	1	0	0	0	0	1	0	0	0	767	59	3	3	3254	261
USH2A	7399	broad.mit.edu	37	1	216498789	216498789	+	Missense_Mutation	SNP	C	T	T			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:216498789C>T	uc001hku.1	-	6	1388	c.1001G>A	c.(1000-1002)CGG>CAG	p.R334Q	USH2A_uc001hkv.2_Missense_Mutation_p.R334Q	NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	334	Laminin N-terminal.|Extracellular (Potential).		R -> Q (in USH2A).|R -> W (in USH2A).		maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		AGGATTCAACCGTGACACTCT	0.468										HNSCC(13;0.011)			20	70	---	---	---	---	capture	Missense_Mutation	SNP	216498789	216498789	USH2A	1	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	16918	261
OR14A16	284532	broad.mit.edu	37	1	247978682	247978682	+	Missense_Mutation	SNP	G	A	A			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:247978682G>A	uc001idm.1	-	1	350	c.350C>T	c.(349-351)TCC>TTC	p.S117F		NM_001001966	NP_001001966	Q8NHC5	O14AG_HUMAN	olfactory receptor, family 14, subfamily A,	117	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						GCGGTCAAAGGACATCACCGT	0.483													30	72	---	---	---	---	capture	Missense_Mutation	SNP	247978682	247978682	OR14A16	1	G	A	A	A	1	0	0	0	0	1	0	0	0	533	41	2	2	10849	261
OR2L13	284521	broad.mit.edu	37	1	248263535	248263535	+	Silent	SNP	C	A	A			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:248263535C>A	uc001ids.2	+	3	1195	c.858C>A	c.(856-858)CCC>CCA	p.P286P		NM_175911	NP_787107	Q8N349	OR2LD_HUMAN	olfactory receptor, family 2, subfamily L,	286	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity|protein binding			central_nervous_system(2)|ovary(1)|skin(1)	4	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0132)			TGCTCAATCCCATTATCTACA	0.493													16	67	---	---	---	---	capture	Silent	SNP	248263535	248263535	OR2L13	1	C	A	A	A	1	0	0	0	0	0	0	0	1	262	21	4	4	10910	261
C11orf35	256329	broad.mit.edu	37	11	556905	556905	+	Silent	SNP	C	T	T			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:556905C>T	uc001lpx.2	-	8	969	c.906G>A	c.(904-906)CCG>CCA	p.P302P	uc001lpy.2_5'Flank|uc001lpz.2_5'Flank	NM_173573	NP_775844	Q8IXW0	CK035_HUMAN	hypothetical protein LOC256329	302										pancreas(1)	1		all_cancers(49;2.16e-06)|all_epithelial(84;0.000256)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;7.18e-28)|Epithelial(43;6.93e-27)|OV - Ovarian serous cystadenocarcinoma(40;6.97e-21)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0375)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GGTCCCGGGGCGGGTGCCCTA	0.697													4	8	---	---	---	---	capture	Silent	SNP	556905	556905	C11orf35	11	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	1624	261
MUC5B	727897	broad.mit.edu	37	11	1156628	1156628	+	Silent	SNP	C	T	T			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:1156628C>T	uc009ycr.1	+	7	771	c.645C>T	c.(643-645)AAC>AAT	p.N215N		NM_017511	NP_059981	Q9HC84	MUC5B_HUMAN	SubName: Full=Mucin 5AC, oligomeric mucus/gel-forming;	211	VWFD 1.				cell adhesion	extracellular region	extracellular matrix structural constituent|protein binding				0		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		GGGACTTCAACGGGATGCCCG	0.617													26	90	---	---	---	---	capture	Silent	SNP	1156628	1156628	MUC5B	11	C	T	T	T	1	0	0	0	0	0	0	0	1	235	19	1	1	9889	261
C11orf2	738	broad.mit.edu	37	11	64876819	64876819	+	Missense_Mutation	SNP	C	T	T	rs140677028		TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:64876819C>T	uc001ocr.1	+	6	1551	c.1511C>T	c.(1510-1512)ACG>ATG	p.T504M	TM7SF2_uc001oct.2_5'Flank|TM7SF2_uc010rny.1_5'Flank|TM7SF2_uc001ocu.2_5'Flank|TM7SF2_uc001ocv.2_5'Flank|C11orf2_uc001ocs.1_Missense_Mutation_p.T380M	NM_013265	NP_037397	Q9UID3	FFR_HUMAN	chromosome 11 open reading frame 2	504					lipid transport|protein transport	Golgi apparatus|integral to membrane					0						ATGTGCCAGACGGCTCAGAGC	0.647													10	29	---	---	---	---	capture	Missense_Mutation	SNP	64876819	64876819	C11orf2	11	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	1620	261
DYNC2H1	79659	broad.mit.edu	37	11	102988581	102988581	+	Missense_Mutation	SNP	C	T	T			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:102988581C>T	uc001pho.2	+	6	1132	c.988C>T	c.(988-990)CGC>TGC	p.R330C	DYNC2H1_uc001phn.1_Missense_Mutation_p.R330C|DYNC2H1_uc009yxe.1_Missense_Mutation_p.R330C	NM_001080463	NP_001073932	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1	330	Stem (By similarity).				cell projection organization|Golgi organization|microtubule-based movement|multicellular organismal development	cilium axoneme|dynein complex|Golgi apparatus|microtubule|plasma membrane	ATP binding|ATPase activity|microtubule motor activity				0		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		ACTTGGCAAACGCCTTGAAGA	0.333													10	26	---	---	---	---	capture	Missense_Mutation	SNP	102988581	102988581	DYNC2H1	11	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	4801	261
TECTA	7007	broad.mit.edu	37	11	120998519	120998519	+	Silent	SNP	C	T	T			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:120998519C>T	uc010rzo.1	+	8	1833	c.1833C>T	c.(1831-1833)CCC>CCT	p.P611P		NM_005422	NP_005413	O75443	TECTA_HUMAN	tectorin alpha precursor	611	TIL 1.				cell-matrix adhesion|sensory perception of sound	anchored to membrane|plasma membrane|proteinaceous extracellular matrix				breast(6)|ovary(2)|skin(2)	10	all_hematologic(175;0.208)	Breast(109;0.000766)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;8.04e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.166)		GCAGCTGCCCCGACACATGCT	0.637													22	50	---	---	---	---	capture	Silent	SNP	120998519	120998519	TECTA	11	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	15632	261
TECTA	7007	broad.mit.edu	37	11	121031074	121031074	+	Silent	SNP	G	A	A			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:121031074G>A	uc010rzo.1	+	14	4920	c.4920G>A	c.(4918-4920)CCG>CCA	p.P1640P		NM_005422	NP_005413	O75443	TECTA_HUMAN	tectorin alpha precursor	1640	VWFD 4.				cell-matrix adhesion|sensory perception of sound	anchored to membrane|plasma membrane|proteinaceous extracellular matrix				breast(6)|ovary(2)|skin(2)	10	all_hematologic(175;0.208)	Breast(109;0.000766)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;8.04e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.166)		GAGGGAAGCCGGTGGTAAGCA	0.542													61	128	---	---	---	---	capture	Silent	SNP	121031074	121031074	TECTA	11	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	15632	261
TAS2R10	50839	broad.mit.edu	37	12	10978396	10978396	+	Missense_Mutation	SNP	T	C	C			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:10978396T>C	uc001qyy.1	-	1	473	c.473A>G	c.(472-474)AAT>AGT	p.N158S		NM_023921	NP_076410	Q9NYW0	T2R10_HUMAN	taste receptor, type 2, member 10	158	Extracellular (Potential).				sensory perception of taste	integral to membrane	taste receptor activity				0						GACTGTGTCATTCTTCGTTTT	0.299													21	56	---	---	---	---	capture	Missense_Mutation	SNP	10978396	10978396	TAS2R10	12	T	C	C	C	1	0	0	0	0	1	0	0	0	676	52	3	3	15454	261
GRIN2B	2904	broad.mit.edu	37	12	13720091	13720091	+	Missense_Mutation	SNP	G	C	C			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:13720091G>C	uc001rbt.2	-	12	2645	c.2466C>G	c.(2464-2466)TTC>TTG	p.F822L		NM_000834	NP_000825	Q13224	NMDE2_HUMAN	N-methyl-D-aspartate receptor subunit 2B	822	Helical; (Potential).				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	glycine binding|N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding			central_nervous_system(4)|ovary(3)|skin(3)|lung(2)	12					Felbamate(DB00949)|Haloperidol(DB00502)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)	CCAACATGTAGAAGACCCCTG	0.507													7	94	---	---	---	---	capture	Missense_Mutation	SNP	13720091	13720091	GRIN2B	12	G	C	C	C	1	0	0	0	0	1	0	0	0	425	33	4	4	6713	261
PTPN11	5781	broad.mit.edu	37	12	112888189	112888189	+	Missense_Mutation	SNP	G	A	A			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:112888189G>A	uc001ttx.2	+	3	585	c.205G>A	c.(205-207)GAG>AAG	p.E69K	PTPN11_uc001ttw.1_Missense_Mutation_p.E69K	NM_002834	NP_002825	Q06124	PTN11_HUMAN	protein tyrosine phosphatase, non-receptor type	69	SH2 1.		E -> K (in JMML; also in myelodysplastic syndrome).|E -> Q (in NS1).		axon guidance|cell junction assembly|ephrin receptor signaling pathway|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|interferon-gamma-mediated signaling pathway|leukocyte migration|platelet activation|regulation of cell adhesion mediated by integrin|regulation of interferon-gamma-mediated signaling pathway|regulation of type I interferon-mediated signaling pathway|T cell costimulation|type I interferon-mediated signaling pathway	cytosol	non-membrane spanning protein tyrosine phosphatase activity|protein binding	p.E69K(15)|p.E69V(1)|p.E69G(1)		haematopoietic_and_lymphoid_tissue(375)|lung(6)|autonomic_ganglia(2)|soft_tissue(2)|central_nervous_system(2)|large_intestine(1)|skin(1)|ovary(1)|NS(1)|kidney(1)	392						GTATGGAGGGGAGAAATTTGC	0.428			Mis		JMML|AML|MDS		Noonan Syndrome		Noonan_syndrome				22	118	---	---	---	---	capture	Missense_Mutation	SNP	112888189	112888189	PTPN11	12	G	A	A	A	1	0	0	0	0	1	0	0	0	533	41	2	2	12675	261
KSR2	283455	broad.mit.edu	37	12	117993006	117993006	+	Missense_Mutation	SNP	G	C	C			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:117993006G>C	uc001two.2	-	9	1454	c.1399C>G	c.(1399-1401)CAG>GAG	p.Q467E		NM_173598	NP_775869	Q6VAB6	KSR2_HUMAN	kinase suppressor of ras 2	496					intracellular signal transduction	cytoplasm|membrane	ATP binding|metal ion binding|protein serine/threonine kinase activity			lung(10)|central_nervous_system(2)|stomach(1)|large_intestine(1)|breast(1)	15	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					GGGAGCGTCTGACTGATGTGC	0.577													4	41	---	---	---	---	capture	Missense_Mutation	SNP	117993006	117993006	KSR2	12	G	C	C	C	1	0	0	0	0	1	0	0	0	585	45	4	4	8502	261
GOLGA3	2802	broad.mit.edu	37	12	133373156	133373156	+	Missense_Mutation	SNP	G	A	A			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:133373156G>A	uc001ukz.1	-	10	2628	c.2069C>T	c.(2068-2070)TCG>TTG	p.S690L	GOLGA3_uc001ula.1_Missense_Mutation_p.S690L|GOLGA3_uc001ulb.2_Missense_Mutation_p.S690L	NM_005895	NP_005886	Q08378	GOGA3_HUMAN	Golgi autoantigen, golgin subfamily a, 3	690	Gln-rich.|Potential.				intra-Golgi vesicle-mediated transport	Golgi cisterna membrane|Golgi transport complex	protein binding|transporter activity			ovary(3)|central_nervous_system(2)|pancreas(1)	6	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0176)|Lung NSC(355;0.204)		OV - Ovarian serous cystadenocarcinoma(86;2.27e-08)|Epithelial(86;3.34e-07)|all cancers(50;9.4e-06)		GGATGCCGCCGAGTCCGCCAT	0.622													50	95	---	---	---	---	capture	Missense_Mutation	SNP	133373156	133373156	GOLGA3	12	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	6490	261
TUBA3C	7278	broad.mit.edu	37	13	19751438	19751438	+	Missense_Mutation	SNP	G	A	A			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:19751438G>A	uc009zzj.2	-	4	734	c.685C>T	c.(685-687)CGC>TGC	p.R229C		NM_006001	NP_005992	Q13748	TBA3C_HUMAN	tubulin, alpha 3c	229					'de novo' posttranslational protein folding|microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|protein binding|structural molecule activity			ovary(3)|skin(2)	5		all_cancers(29;1.31e-20)|all_epithelial(30;1.59e-20)|all_lung(29;6.91e-20)|Lung NSC(5;9.25e-17)|Hepatocellular(1;0.0207)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;6.78e-06)|Epithelial(112;3.79e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00172)|Lung(94;0.0186)|LUSC - Lung squamous cell carcinoma(192;0.108)		CCAATCAGGCGATTGAGGTTG	0.547													54	111	---	---	---	---	capture	Missense_Mutation	SNP	19751438	19751438	TUBA3C	13	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	16628	261
PAN3	255967	broad.mit.edu	37	13	28794483	28794483	+	Missense_Mutation	SNP	T	C	C			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:28794483T>C	uc001urz.2	+	5	538	c.530T>C	c.(529-531)ATG>ACG	p.M177T	PAN3_uc010tdo.1_Missense_Mutation_p.M323T|PAN3_uc001ury.2_5'UTR|PAN3_uc001urx.2_Missense_Mutation_p.M123T	NM_175854	NP_787050	Q58A45	PAN3_HUMAN	PABP1-dependent poly A-specific ribonuclease	323	Interaction with polyadenylate-binding protein.				nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|nuclear-transcribed mRNA poly(A) tail shortening	centrosome|cytosol	ATP binding|protein kinase activity			ovary(1)	1	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0262)	Colorectal(13;0.000334)	all cancers(112;0.0102)|Epithelial(112;0.0803)|GBM - Glioblastoma multiforme(144;0.121)|OV - Ovarian serous cystadenocarcinoma(117;0.13)|Lung(94;0.174)		CACCCATCCATGGGAAGCCCT	0.448													86	184	---	---	---	---	capture	Missense_Mutation	SNP	28794483	28794483	PAN3	13	T	C	C	C	1	0	0	0	0	1	0	0	0	663	51	3	3	11319	261
OR4M1	441670	broad.mit.edu	37	14	20248896	20248896	+	Missense_Mutation	SNP	C	T	T	rs148303756	byFrequency	TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:20248896C>T	uc010tku.1	+	1	415	c.415C>T	c.(415-417)CGT>TGT	p.R139C		NM_001005500	NP_001005500	Q8NGD0	OR4M1_HUMAN	olfactory receptor, family 4, subfamily M,	139	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		CATGAATCGACGTCTCTGCTG	0.517													79	170	---	---	---	---	capture	Missense_Mutation	SNP	20248896	20248896	OR4M1	14	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	10979	261
NRXN3	9369	broad.mit.edu	37	14	79432392	79432392	+	Missense_Mutation	SNP	G	A	A			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:79432392G>A	uc001xun.2	+	9	1792	c.1301G>A	c.(1300-1302)CGT>CAT	p.R434H	NRXN3_uc001xum.1_RNA|NRXN3_uc010asv.1_Missense_Mutation_p.R559H	NM_004796	NP_004787	Q9Y4C0	NRX3A_HUMAN	neurexin 3 isoform 1 precursor	807	Laminin G-like 4.|Extracellular (Potential).				axon guidance|cell adhesion	integral to plasma membrane	metal ion binding|receptor activity			ovary(3)|upper_aerodigestive_tract(2)|pancreas(2)|central_nervous_system(1)|breast(1)|skin(1)	10		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)		GACCATACCCGTTTGGAGTTC	0.428													22	58	---	---	---	---	capture	Missense_Mutation	SNP	79432392	79432392	NRXN3	14	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	10574	261
CCDC88C	440193	broad.mit.edu	37	14	91755541	91755541	+	Missense_Mutation	SNP	G	A	A			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:91755541G>A	uc010aty.2	-	25	4448	c.4349C>T	c.(4348-4350)CCG>CTG	p.P1450L		NM_001080414	NP_001073883	Q9P219	DAPLE_HUMAN	DVL-binding protein DAPLE	1450					microtubule cytoskeleton organization|protein destabilization|protein homooligomerization|regulation of protein phosphorylation|Wnt receptor signaling pathway	cytoplasm|insoluble fraction	microtubule binding|PDZ domain binding|protein self-association			ovary(3)	3		all_cancers(154;0.0468)				TGATCTGAGCGGCTGAGAGGC	0.652													9	107	---	---	---	---	capture	Missense_Mutation	SNP	91755541	91755541	CCDC88C	14	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	2838	261
ADAM10	102	broad.mit.edu	37	15	58957380	58957380	+	Silent	SNP	G	A	A			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:58957380G>A	uc002afd.1	-	5	945	c.501C>T	c.(499-501)TAC>TAT	p.Y167Y	ADAM10_uc010bgc.1_RNA|ADAM10_uc010ugz.1_Intron|ADAM10_uc002afe.1_Intron|ADAM10_uc002afg.2_Silent_p.Y167Y	NM_001110	NP_001101	O14672	ADA10_HUMAN	ADAM metallopeptidase domain 10 precursor	167	Extracellular (Potential).				cell-cell signaling|constitutive protein ectodomain proteolysis|epidermal growth factor receptor signaling pathway|in utero embryonic development|integrin-mediated signaling pathway|monocyte activation|negative regulation of cell adhesion|Notch receptor processing|Notch signaling pathway|PMA-inducible membrane protein ectodomain proteolysis|positive regulation of cell growth|positive regulation of cell proliferation|positive regulation of T cell chemotaxis|protein phosphorylation|response to tumor necrosis factor	cell surface|endomembrane system|Golgi-associated vesicle|integral to membrane|nucleus|plasma membrane	integrin binding|metalloendopeptidase activity|protein homodimerization activity|protein kinase binding|SH3 domain binding|zinc ion binding			skin(2)	2				GBM - Glioblastoma multiforme(80;0.202)		CCTGAGGACCGTATTTATGGG	0.348													4	142	---	---	---	---	capture	Silent	SNP	58957380	58957380	ADAM10	15	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	234	261
UACA	55075	broad.mit.edu	37	15	70959297	70959297	+	Missense_Mutation	SNP	G	C	C			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:70959297G>C	uc002asr.2	-	16	3830	c.3726C>G	c.(3724-3726)AGC>AGG	p.S1242R	UACA_uc010uke.1_Missense_Mutation_p.S1133R|UACA_uc002asq.2_Missense_Mutation_p.S1229R|UACA_uc010bin.1_Missense_Mutation_p.S1217R	NM_018003	NP_060473	Q9BZF9	UACA_HUMAN	uveal autoantigen with coiled-coil domains and	1242	Potential.					cytoskeleton|extracellular region				ovary(2)|pancreas(1)|skin(1)	4						TTTCATTTAAGCTAGAAATCT	0.323													20	149	---	---	---	---	capture	Missense_Mutation	SNP	70959297	70959297	UACA	15	G	C	C	C	1	0	0	0	0	1	0	0	0	438	34	4	4	16706	261
ALDH1A3	220	broad.mit.edu	37	15	101432805	101432805	+	Missense_Mutation	SNP	G	T	T			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:101432805G>T	uc002bwn.3	+	4	540	c.436G>T	c.(436-438)GGG>TGG	p.G146W	ALDH1A3_uc010bpb.2_Intron	NM_000693	NP_000684	P47895	AL1A3_HUMAN	aldehyde dehydrogenase 1A3	146					retinal metabolic process	cytoplasm	aldehyde dehydrogenase|protein homodimerization activity			central_nervous_system(2)|lung(1)|pancreas(1)	4	Lung NSC(78;0.00144)|all_lung(78;0.0018)|Melanoma(26;0.00852)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.0766)|Lung(145;0.103)		NADH(DB00157)|Vitamin A(DB00162)	ATACTTTGCAGGGTGGGCAGA	0.473													49	77	---	---	---	---	capture	Missense_Mutation	SNP	101432805	101432805	ALDH1A3	15	G	T	T	T	1	0	0	0	0	1	0	0	0	455	35	4	4	492	261
BTBD12	84464	broad.mit.edu	37	16	3658781	3658781	+	Missense_Mutation	SNP	A	G	G			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:3658781A>G	uc002cvp.2	-	2	812	c.185T>C	c.(184-186)GTG>GCG	p.V62A	BTBD12_uc002cvq.1_Missense_Mutation_p.V62A	NM_032444	NP_115820	Q8IY92	SLX4_HUMAN	BTB (POZ) domain containing 12	62	Interaction with C20orf94, ERCC4 and MSH2.				DNA double-strand break processing involved in repair via single-strand annealing|double-strand break repair via homologous recombination|nucleotide-excision repair	Slx1-Slx4 complex	enzyme activator activity|protein binding				0						ATGTTTTTTCACCCTTTGGAA	0.438								Direct_reversal_of_damage|Homologous_recombination	Fanconi_Anemia				3	144	---	---	---	---	capture	Missense_Mutation	SNP	3658781	3658781	BTBD12	16	A	G	G	G	1	0	0	0	0	1	0	0	0	78	6	3	3	1528	261
CORO7	79585	broad.mit.edu	37	16	4411454	4411454	+	Missense_Mutation	SNP	C	T	T			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:4411454C>T	uc002cwh.3	-	17	1715	c.1595G>A	c.(1594-1596)CGC>CAC	p.R532H	CORO7_uc002cwe.2_RNA|CORO7_uc002cwf.2_Missense_Mutation_p.R532H|CORO7_uc002cwg.3_Missense_Mutation_p.R312H|CORO7_uc010uxh.1_Missense_Mutation_p.R514H|CORO7_uc010uxi.1_Missense_Mutation_p.R447H|CORO7_uc002cwi.1_Missense_Mutation_p.R312H|CORO7_uc010uxj.1_RNA	NM_024535	NP_078811	P57737	CORO7_HUMAN	coronin 7	532						cytoplasmic membrane-bounded vesicle|cytosol|Golgi membrane|integral to membrane of membrane fraction|soluble fraction					0						GTCGGGCAGGCGGCCAGGCTT	0.667													7	46	---	---	---	---	capture	Missense_Mutation	SNP	4411454	4411454	CORO7	16	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	3724	261
RAB11FIP4	84440	broad.mit.edu	37	17	29850999	29850999	+	Missense_Mutation	SNP	C	A	A			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:29850999C>A	uc002hgn.1	+	9	1347	c.1118C>A	c.(1117-1119)ACA>AAA	p.T373K	RAB11FIP4_uc002hgo.2_Missense_Mutation_p.T271K	NM_032932	NP_116321	Q86YS3	RFIP4_HUMAN	RAB11 family interacting protein 4 (class II)	373	Potential.|Necessary for interaction with RAB11A, subcellular location, homo- or heterooligomerization.				cytokinesis|interspecies interaction between organisms|protein transport	cleavage furrow|endocytic vesicle|midbody|recycling endosome membrane	ADP-ribosylation factor binding|calcium ion binding|protein homodimerization activity|Rab GTPase binding			skin(1)	1		all_cancers(10;3.62e-13)|all_epithelial(10;0.000387)|all_lung(9;0.0132)|Breast(31;0.014)|all_hematologic(16;0.015)|Myeloproliferative disorder(56;0.0255)|Acute lymphoblastic leukemia(14;0.0259)|Ovarian(249;0.0423)|Lung NSC(157;0.066)				CAAGAGAACACACAGCTGGTG	0.597													9	22	---	---	---	---	capture	Missense_Mutation	SNP	29850999	29850999	RAB11FIP4	17	C	A	A	A	1	0	0	0	0	1	0	0	0	221	17	4	4	12791	261
ABCA10	10349	broad.mit.edu	37	17	67211983	67211983	+	Silent	SNP	A	G	G			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:67211983A>G	uc010dfa.1	-	9	1710	c.831T>C	c.(829-831)CCT>CCC	p.P277P	ABCA10_uc010wqt.1_RNA|ABCA10_uc010dfb.1_5'Flank|ABCA10_uc010dfc.1_Silent_p.P169P	NM_080282	NP_525021	Q8WWZ4	ABCAA_HUMAN	ATP-binding cassette, sub-family A, member 10	277	Helical; (Potential).				transport	integral to membrane	ATP binding|ATPase activity			ovary(2)|central_nervous_system(1)|skin(1)	4	Breast(10;6.95e-12)					TGAAGGCAAAAGGGCTAAGAA	0.353													3	73	---	---	---	---	capture	Silent	SNP	67211983	67211983	ABCA10	17	A	G	G	G	1	0	0	0	0	0	0	0	1	28	3	3	3	29	261
POTEC	388468	broad.mit.edu	37	18	14513675	14513675	+	Missense_Mutation	SNP	T	C	C			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:14513675T>C	uc010dln.2	-	10	1973	c.1519A>G	c.(1519-1521)AAA>GAA	p.K507E	POTEC_uc010xaj.1_RNA	NM_001137671	NP_001131143	B2RU33	POTEC_HUMAN	ANKRD26-like family B, member 2	507	Potential.									skin(3)	3						GAATTCATTTTCTTTTCAGCC	0.284													3	96	---	---	---	---	capture	Missense_Mutation	SNP	14513675	14513675	POTEC	18	T	C	C	C	1	0	0	0	0	1	0	0	0	806	62	3	3	12164	261
CTAGE1	64693	broad.mit.edu	37	18	19996611	19996611	+	Silent	SNP	G	A	A			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:19996611G>A	uc002ktv.1	-	1	1268	c.1164C>T	c.(1162-1164)GAC>GAT	p.D388D		NM_172241	NP_758441	Q96RT6	CTGE2_HUMAN	cutaneous T-cell lymphoma-associated antigen 1	388	Potential.					integral to membrane				ovary(1)	1	all_cancers(21;0.000361)|all_epithelial(16;9.61e-06)|Colorectal(14;0.0533)|Lung NSC(20;0.0605)|Ovarian(2;0.116)|all_lung(20;0.135)					TGATCATTTCGTCTACTTTAG	0.343													30	125	---	---	---	---	capture	Silent	SNP	19996611	19996611	CTAGE1	18	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	3957	261
DSC2	1824	broad.mit.edu	37	18	28662997	28662997	+	Missense_Mutation	SNP	T	A	A			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:28662997T>A	uc002kwl.3	-	8	1426	c.972A>T	c.(970-972)AAA>AAT	p.K324N	DSC2_uc002kwk.3_Missense_Mutation_p.K324N	NM_024422	NP_077740	Q02487	DSC2_HUMAN	desmocollin 2 isoform Dsc2a preproprotein	324	Extracellular (Potential).|Cadherin 2.				homophilic cell adhesion	desmosome|integral to membrane	calcium ion binding			ovary(2)|skin(1)	3			OV - Ovarian serous cystadenocarcinoma(10;0.0241)			TGTCTTGTACTTTTATTTTCA	0.308													8	15	---	---	---	---	capture	Missense_Mutation	SNP	28662997	28662997	DSC2	18	T	A	A	A	1	0	0	0	0	1	0	0	0	725	56	4	4	4721	261
CELF4	56853	broad.mit.edu	37	18	34854357	34854357	+	Nonsense_Mutation	SNP	G	A	A			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:34854357G>A	uc002lae.2	-	6	1114	c.718C>T	c.(718-720)CGA>TGA	p.R240*	CELF4_uc010dnd.1_Nonsense_Mutation_p.R239*|CELF4_uc002lag.2_Nonsense_Mutation_p.R230*|CELF4_uc002laf.2_Nonsense_Mutation_p.R235*|CELF4_uc002lai.2_Nonsense_Mutation_p.R225*|CELF4_uc002lah.1_5'Flank|CELF4_uc002laj.1_Missense_Mutation_p.A75V	NM_020180	NP_064565	Q9BZC1	CELF4_HUMAN	bruno-like 4, RNA binding protein isoform 1	240	Sufficient for RNA-binding and MSE- dependent splicing activity.|Necessary for TNNT2 exon 5 inclusion.				embryo development|germ cell development|regulation of alternative nuclear mRNA splicing, via spliceosome	cytoplasm|nucleus	BRE binding|nucleotide binding|translation repressor activity, nucleic acid binding			ovary(2)	2						TGCTGCATTCGCCGCATCGTG	0.667													4	109	---	---	---	---	capture	Nonsense_Mutation	SNP	34854357	34854357	CELF4	18	G	A	A	A	1	0	0	0	0	0	1	0	0	493	38	5	1	3186	261
PPAP2C	8612	broad.mit.edu	37	19	288137	288137	+	Silent	SNP	G	A	A			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:288137G>A	uc002loi.2	-	2	186	c.87C>T	c.(85-87)AAC>AAT	p.N29N	PPAP2C_uc002loh.2_Silent_p.N50N|PPAP2C_uc002loj.2_Translation_Start_Site	NM_003712	NP_003703	O43688	LPP2_HUMAN	phosphatidic acid phosphatase type 2C isoform 1	29					sphingolipid metabolic process	integral to membrane|plasma membrane	phosphatidate phosphatase activity|phosphoprotein phosphatase activity|sphingosine-1-phosphate phosphatase activity			central_nervous_system(1)	1		all_cancers(10;1.13e-36)|all_epithelial(18;1.46e-23)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.1e-06)|all_lung(49;1.55e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TGTACGGGGCGTTCACCAGCG	0.617													28	61	---	---	---	---	capture	Silent	SNP	288137	288137	PPAP2C	19	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	12193	261
SLC39A3	29985	broad.mit.edu	37	19	2733313	2733313	+	Silent	SNP	C	T	T			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:2733313C>T	uc002lwg.2	-	3	635	c.381G>A	c.(379-381)GTG>GTA	p.V127V	SLC39A3_uc010xgy.1_Silent_p.V127V	NM_144564	NP_653165	Q9BRY0	S39A3_HUMAN	solute carrier family 39 (zinc transporter),	127	Cytoplasmic (Potential).					integral to membrane|plasma membrane	zinc ion transmembrane transporter activity				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		AGTCGCTGCCCACGTCCGATC	0.662													23	47	---	---	---	---	capture	Silent	SNP	2733313	2733313	SLC39A3	19	C	T	T	T	1	0	0	0	0	0	0	0	1	262	21	2	2	14511	261
VAV1	7409	broad.mit.edu	37	19	6854017	6854017	+	Nonsense_Mutation	SNP	C	T	T			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:6854017C>T	uc002mfu.1	+	26	2489	c.2392C>T	c.(2392-2394)CGA>TGA	p.R798*	VAV1_uc010xjh.1_Nonsense_Mutation_p.R766*|VAV1_uc010dva.1_Nonsense_Mutation_p.R776*|VAV1_uc002mfv.1_Nonsense_Mutation_p.R743*	NM_005428	NP_005419	P15498	VAV_HUMAN	vav 1 guanine nucleotide exchange factor	798	SH3 2.				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|platelet activation|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|T cell costimulation	cytosol|plasma membrane	metal ion binding|protein binding|sequence-specific DNA binding transcription factor activity			lung(4)|ovary(4)|breast(3)|central_nervous_system(2)|kidney(2)|skin(1)	16						CGCCCGAGACCGATCAGAGCT	0.552													24	67	---	---	---	---	capture	Nonsense_Mutation	SNP	6854017	6854017	VAV1	19	C	T	T	T	1	0	0	0	0	0	1	0	0	295	23	5	1	17013	261
AKAP8L	26993	broad.mit.edu	37	19	15510183	15510183	+	Missense_Mutation	SNP	G	A	A			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:15510183G>A	uc002naw.1	-	9	1186	c.1087C>T	c.(1087-1089)CGC>TGC	p.R363C	AKAP8L_uc002nax.1_RNA|AKAP8L_uc010xoh.1_Missense_Mutation_p.R302C	NM_014371	NP_055186	Q9ULX6	AKP8L_HUMAN	A kinase (PRKA) anchor protein 8-like	363	Nuclear localization signal (Potential).					cytoplasm|nuclear matrix	DEAD/H-box RNA helicase binding|DNA binding|zinc ion binding			ovary(1)	1						TGCAACTTGCGCTTGGTCTGG	0.602													28	67	---	---	---	---	capture	Missense_Mutation	SNP	15510183	15510183	AKAP8L	19	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	458	261
CPAMD8	27151	broad.mit.edu	37	19	17014389	17014389	+	Silent	SNP	G	A	A			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:17014389G>A	uc002nfb.2	-	34	4625	c.4593C>T	c.(4591-4593)GAC>GAT	p.D1531D	CPAMD8_uc002nfd.1_Translation_Start_Site	NM_015692	NP_056507	Q8IZJ3	CPMD8_HUMAN	C3 and PZP-like, alpha-2-macroglobulin domain	1484						extracellular space|plasma membrane	serine-type endopeptidase inhibitor activity			ovary(4)|breast(4)|large_intestine(3)|pancreas(1)|skin(1)	13						GGCAGCAGCCGTCCCCCTTGG	0.617													8	79	---	---	---	---	capture	Silent	SNP	17014389	17014389	CPAMD8	19	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	3760	261
SLC25A42	284439	broad.mit.edu	37	19	19206999	19206999	+	Silent	SNP	G	T	T			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:19206999G>T	uc002nlf.1	+	2	217	c.66G>T	c.(64-66)TCG>TCT	p.S22S	SLC25A42_uc010xqn.1_Silent_p.S74S	NM_178526	NP_848621	Q86VD7	S2542_HUMAN	solute carrier family 25, member 42	22					transmembrane transport	integral to membrane|mitochondrial inner membrane	binding				0			OV - Ovarian serous cystadenocarcinoma(5;5.4e-06)|Epithelial(12;0.000497)			TCCTGTCCTCGTCCGTCTCAT	0.647													23	28	---	---	---	---	capture	Silent	SNP	19206999	19206999	SLC25A42	19	G	T	T	T	1	0	0	0	0	0	0	0	1	509	40	4	4	14399	261
MEGF8	1954	broad.mit.edu	37	19	42841352	42841352	+	Missense_Mutation	SNP	C	T	T			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:42841352C>T	uc002otl.3	+	8	2142	c.1507C>T	c.(1507-1509)CCT>TCT	p.P503S	MEGF8_uc002otm.3_Missense_Mutation_p.P44S	NM_001410	NP_001401	Q7Z7M0	MEGF8_HUMAN	multiple EGF-like-domains 8	503	Extracellular (Potential).|Kelch 5.					integral to membrane	calcium ion binding|structural molecule activity			ovary(1)	1		Prostate(69;0.00682)				GCCAGGAACCCCTGAGGGTGA	0.572													3	67	---	---	---	---	capture	Missense_Mutation	SNP	42841352	42841352	MEGF8	19	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	9376	261
ETHE1	23474	broad.mit.edu	37	19	44015698	44015698	+	Silent	SNP	G	A	A			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:44015698G>A	uc002owp.2	-	4	463	c.396C>T	c.(394-396)AGC>AGT	p.S132S	ETHE1_uc010eiu.1_Silent_p.S132S	NM_014297	NP_055112	O95571	ETHE1_HUMAN	ETHE1 protein precursor	132						mitochondrial matrix|nucleus	hydrolase activity|metal ion binding				0		Prostate(69;0.0153)				TGTGGCCAGGGCTGGCCCTGG	0.602													12	59	---	---	---	---	capture	Silent	SNP	44015698	44015698	ETHE1	19	G	A	A	A	1	0	0	0	0	0	0	0	1	542	42	2	2	5227	261
GPR32	2854	broad.mit.edu	37	19	51274617	51274617	+	Missense_Mutation	SNP	C	T	T			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:51274617C>T	uc010ycf.1	+	1	760	c.760C>T	c.(760-762)CCC>TCC	p.P254S		NM_001506	NP_001497	O75388	GPR32_HUMAN	G protein-coupled receptor 32	254	Cytoplasmic (Potential).					integral to plasma membrane	N-formyl peptide receptor activity			upper_aerodigestive_tract(1)	1		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00641)|GBM - Glioblastoma multiforme(134;0.028)		TGCCAACCGGCCCAAGAGGCT	0.612													11	61	---	---	---	---	capture	Missense_Mutation	SNP	51274617	51274617	GPR32	19	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	6622	261
KLK8	11202	broad.mit.edu	37	19	51503469	51503469	+	Silent	SNP	A	G	G			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:51503469A>G	uc002pur.1	-	4	455	c.276T>C	c.(274-276)GAT>GAC	p.D92D	KLK8_uc002puq.1_Silent_p.D137D|KLK8_uc002pus.1_Intron|KLK8_uc002put.1_Intron|KLK8_uc002puu.1_Silent_p.D92D|KLK9_uc002puv.1_Intron	NM_007196	NP_009127	O60259	KLK8_HUMAN	kallikrein 8 isoform 1 preproprotein	92	Peptidase S1.				cell death|keratinocyte proliferation|memory|negative regulation of axon regeneration|negative regulation of myelination|neuron projection morphogenesis|proteolysis|regulation of synapse organization|response to wounding	cytoplasm|extracellular space	protein binding|serine-type endopeptidase activity			central_nervous_system(1)	1		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.0033)|GBM - Glioblastoma multiforme(134;0.00888)		GCTCTGGGCCATCTTTATTCT	0.483													42	159	---	---	---	---	capture	Silent	SNP	51503469	51503469	KLK8	19	A	G	G	G	1	0	0	0	0	0	0	0	1	102	8	3	3	8330	261
LILRA6	79168	broad.mit.edu	37	19	54744862	54744862	+	Missense_Mutation	SNP	C	T	T			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:54744862C>T	uc002qeu.1	-	5	924	c.800G>A	c.(799-801)CGC>CAC	p.R267H	LILRB3_uc002qeh.1_Intron|LILRB3_uc002qeg.1_Intron|LILRB3_uc002qei.1_Intron|LILRA6_uc002qek.1_Missense_Mutation_p.R267H|LILRB3_uc010erh.1_Intron|LILRB3_uc002qej.1_Intron|LILRA6_uc002qel.1_Missense_Mutation_p.R267H|LILRA6_uc002qem.1_RNA|LILRB3_uc002qen.1_RNA|LILRB3_uc002qeo.1_Missense_Mutation_p.R267H|LILRB3_uc002qep.1_Intron|LILRB3_uc002qeq.1_Missense_Mutation_p.R267H|LILRB3_uc002qer.1_RNA|LILRB3_uc002qes.1_Intron|LILRA6_uc010yep.1_Missense_Mutation_p.R267H|LILRA6_uc010yeq.1_Missense_Mutation_p.R267H|LILRA6_uc002qet.3_RNA|LILRA6_uc002qev.1_Missense_Mutation_p.R128H	NM_024318	NP_077294	Q6PI73	LIRA6_HUMAN	leukocyte immunoglobulin-like receptor,	267	Extracellular (Potential).|Ig-like C2-type 1.					integral to membrane	receptor activity			skin(2)	2	all_cancers(19;0.00723)|all_epithelial(19;0.00389)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		CTGGCCAGGGCGCTGGAGGAA	0.647													10	89	---	---	---	---	capture	Missense_Mutation	SNP	54744862	54744862	LILRA6	19	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	8709	261
KIR3DL1	3811	broad.mit.edu	37	19	55377847	55377847	+	Silent	SNP	G	A	A			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:55377847G>A	uc002qhl.3	+	8	1191	c.1128G>A	c.(1126-1128)GAG>GAA	p.E376E	KIR3DL2_uc010esh.2_Silent_p.E359E|KIR3DL2_uc002qho.3_Silent_p.E376E			P43629	KI3L1_HUMAN	SubName: Full=KIR3DS1;	376	Cytoplasmic (Potential).				immune response|regulation of immune response	integral to plasma membrane	HLA-B specific inhibitory MHC class I receptor activity			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|skin(1)	5				GBM - Glioblastoma multiforme(193;0.0192)		TGGACCAAGAGCCTGCGGGGG	0.542													4	138	---	---	---	---	capture	Silent	SNP	55377847	55377847	KIR3DL1	19	G	A	A	A	1	0	0	0	0	0	0	0	1	438	34	2	2	8242	261
NLRP11	204801	broad.mit.edu	37	19	56313012	56313012	+	Silent	SNP	C	G	G			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:56313012C>G	uc010ygf.1	-	7	2808	c.2097G>C	c.(2095-2097)ACG>ACC	p.T699T	NLRP11_uc002qlz.2_Silent_p.T546T|NLRP11_uc002qmb.2_Silent_p.T600T|NLRP11_uc002qmc.2_RNA|NLRP11_uc010ete.1_RNA	NM_145007	NP_659444	P59045	NAL11_HUMAN	NLR family, pyrin domain containing 11	699							ATP binding			ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	6		Colorectal(82;0.0002)		GBM - Glioblastoma multiforme(193;0.0325)		GGGAAATGGACGTACAGTTGA	0.468													4	91	---	---	---	---	capture	Silent	SNP	56313012	56313012	NLRP11	19	C	G	G	G	1	0	0	0	0	0	0	0	1	236	19	4	4	10380	261
NLRP13	126204	broad.mit.edu	37	19	56407321	56407321	+	Missense_Mutation	SNP	T	A	A			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:56407321T>A	uc010ygg.1	-	11	3147	c.3122A>T	c.(3121-3123)AAA>ATA	p.K1041I		NM_176810	NP_789780	Q86W25	NAL13_HUMAN	NACHT, leucine rich repeat and PYD containing	1041				KALKKSTCRLQKLG -> FKKTCTM (in Ref. 2; DAA01241).			ATP binding			skin(4)|ovary(3)|pancreas(1)|lung(1)	9		Colorectal(82;3.48e-05)|Ovarian(87;0.0481)|Renal(1328;0.218)		GBM - Glioblastoma multiforme(193;0.0642)		TTACCCGAGTTTCTGCAGCCT	0.458													21	207	---	---	---	---	capture	Missense_Mutation	SNP	56407321	56407321	NLRP13	19	T	A	A	A	1	0	0	0	0	1	0	0	0	832	64	4	4	10382	261
SOS1	6654	broad.mit.edu	37	2	39250170	39250170	+	Missense_Mutation	SNP	A	C	C			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:39250170A>C	uc002rrk.3	-	10	1440	c.1399T>G	c.(1399-1401)TTA>GTA	p.L467V	SOS1_uc010ynr.1_RNA|SOS1_uc002rrj.3_Missense_Mutation_p.L81V|SOS1_uc002rrl.2_Missense_Mutation_p.L199V	NM_005633	NP_005624	Q07889	SOS1_HUMAN	son of sevenless homolog 1	467	PH.				apoptosis|axon guidance|blood coagulation|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|induction of apoptosis by extracellular signals|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|Ras protein signal transduction	cytosol	DNA binding|protein binding|Rho GTPase activator activity|Rho guanyl-nucleotide exchange factor activity			ovary(4)|breast(3)|lung(2)|central_nervous_system(1)	10		all_hematologic(82;0.21)				CAAATCATTAAGCCATCAAAG	0.378									Noonan_syndrome				38	68	---	---	---	---	capture	Missense_Mutation	SNP	39250170	39250170	SOS1	2	A	C	C	C	1	0	0	0	0	1	0	0	0	37	3	4	4	14828	261
TGFA	7039	broad.mit.edu	37	2	70742023	70742023	+	Missense_Mutation	SNP	T	C	C			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:70742023T>C	uc002sgs.3	-	2	268	c.62A>G	c.(61-63)CAG>CGG	p.Q21R	TGFA_uc010fdq.2_Missense_Mutation_p.Q27R|TGFA_uc010fdr.2_Missense_Mutation_p.Q27R|TGFA_uc002sgt.3_Missense_Mutation_p.Q21R|TGFA_uc002sgu.2_Missense_Mutation_p.Q21R|TGFA_uc002sgv.2_Missense_Mutation_p.Q21R|TGFA_uc002sgw.2_Missense_Mutation_p.Q21R	NM_003236	NP_003227	P01135	TGFA_HUMAN	transforming growth factor, alpha isoform 1	21					activation of MAPK activity|cell proliferation|positive regulation of cell division|positive regulation of epidermal growth factor receptor activity|positive regulation of epithelial cell proliferation|positive regulation of mitosis	cell surface|extracellular space|integral to membrane|plasma membrane	epidermal growth factor receptor binding|growth factor activity|MAP kinase kinase activity|signal transducer activity			prostate(1)	1						CTCCAAGGCCTGGCACGCAGC	0.607													16	13	---	---	---	---	capture	Missense_Mutation	SNP	70742023	70742023	TGFA	2	T	C	C	C	1	0	0	0	0	1	0	0	0	715	55	3	3	15700	261
ZNF638	27332	broad.mit.edu	37	2	71576267	71576267	+	Silent	SNP	T	C	C			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:71576267T>C	uc002shx.2	+	2	502	c.183T>C	c.(181-183)TAT>TAC	p.Y61Y	ZNF638_uc010fec.2_Silent_p.Y167Y|ZNF638_uc010yqw.1_Intron|ZNF638_uc002shw.2_Silent_p.Y61Y|ZNF638_uc002shy.2_Silent_p.Y61Y|ZNF638_uc002shz.2_Silent_p.Y61Y|ZNF638_uc002sia.2_Silent_p.Y61Y|ZNF638_uc002sib.1_Silent_p.Y61Y	NM_014497	NP_055312	Q14966	ZN638_HUMAN	zinc finger protein 638	61					RNA splicing	cytoplasm|nuclear speck	double-stranded DNA binding|nucleotide binding|RNA binding|zinc ion binding			pancreas(2)|ovary(1)|skin(1)	4						ATGAATCTTATCAGAACATGG	0.448													31	108	---	---	---	---	capture	Silent	SNP	71576267	71576267	ZNF638	2	T	C	C	C	1	0	0	0	0	0	0	0	1	647	50	3	3	17933	261
TTC30A	92104	broad.mit.edu	37	2	178481798	178481798	+	Silent	SNP	G	A	A	rs150534803		TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:178481798G>A	uc002ulo.2	-	1	1897	c.1632C>T	c.(1630-1632)TGC>TGT	p.C544C		NM_152275	NP_689488	Q86WT1	TT30A_HUMAN	tetratricopeptide repeat domain 30A	544	TPR 8.				cell projection organization	cilium	binding				0			OV - Ovarian serous cystadenocarcinoma(117;0.000423)|Epithelial(96;0.00373)|all cancers(119;0.0169)			AATTCACAATGCAGAGATGGT	0.383													92	222	---	---	---	---	capture	Silent	SNP	178481798	178481798	TTC30A	2	G	A	A	A	1	0	0	0	0	0	0	0	1	594	46	2	2	16580	261
TTN	7273	broad.mit.edu	37	2	179417389	179417389	+	Missense_Mutation	SNP	C	T	T			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179417389C>T	uc010zfg.1	-	284	82758	c.82534G>A	c.(82534-82536)GCT>ACT	p.A27512T	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.A21207T|TTN_uc010zfi.1_Missense_Mutation_p.A21140T|TTN_uc010zfj.1_Missense_Mutation_p.A21015T	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	28439							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTTATGCCAGCGTGGGACCAC	0.453													30	60	---	---	---	---	capture	Missense_Mutation	SNP	179417389	179417389	TTN	2	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	16617	261
TTN	7273	broad.mit.edu	37	2	179448529	179448529	+	Missense_Mutation	SNP	C	T	T			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179448529C>T	uc010zfg.1	-	261	57900	c.57676G>A	c.(57676-57678)GTA>ATA	p.V19226I	uc002umo.2_RNA|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.V12921I|TTN_uc010zfi.1_Missense_Mutation_p.V12854I|TTN_uc010zfj.1_Missense_Mutation_p.V12729I	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	20153							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CAAGCTTCTACGAAATAGCCA	0.463													5	17	---	---	---	---	capture	Missense_Mutation	SNP	179448529	179448529	TTN	2	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	16617	261
TTN	7273	broad.mit.edu	37	2	179515501	179515501	+	Missense_Mutation	SNP	C	G	G			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179515501C>G	uc010zfg.1	-	163	32608	c.32384G>C	c.(32383-32385)AGA>ACA	p.R10795T	TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc010fre.1_Intron|TTN_uc002umw.1_RNA|TTN_uc002umx.1_5'UTR	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	11722							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AGACTCCGCTCTTTCTGGAAC	0.423													3	20	---	---	---	---	capture	Missense_Mutation	SNP	179515501	179515501	TTN	2	C	G	G	G	1	0	0	0	0	1	0	0	0	416	32	4	4	16617	261
KIAA1486	57624	broad.mit.edu	37	2	226446762	226446762	+	Missense_Mutation	SNP	C	T	T			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:226446762C>T	uc002voe.2	+	4	804	c.629C>T	c.(628-630)ACG>ATG	p.T210M	KIAA1486_uc010fxa.1_Intron|KIAA1486_uc002vof.1_Translation_Start_Site	NM_020864	NP_065915	Q9P242	K1486_HUMAN	hypothetical protein LOC57624	210										ovary(2)|central_nervous_system(1)	3		Renal(207;0.0112)|all_lung(227;0.0477)|Lung NSC(271;0.0644)|all_hematologic(139;0.101)|Esophageal squamous(248;0.129)		Epithelial(121;6.73e-10)|all cancers(144;4.32e-07)|Lung(261;0.0161)|LUSC - Lung squamous cell carcinoma(224;0.0223)		TTCGATGAAACGTACATCAAA	0.577													58	170	---	---	---	---	capture	Missense_Mutation	SNP	226446762	226446762	KIAA1486	2	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	8159	261
UGT1A4	54657	broad.mit.edu	37	2	234628246	234628246	+	Silent	SNP	C	T	T			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:234628246C>T	uc002vux.2	+	1	809	c.780C>T	c.(778-780)GAC>GAT	p.D260D	UGT1A8_uc010zmv.1_Intron|UGT1A8_uc002vup.2_Intron|UGT1A10_uc002vuq.3_Intron|UGT1A10_uc002vur.2_Intron|UGT1A9_uc010zmw.1_Intron|UGT1A9_uc002vus.2_Intron|UGT1A7_uc010zmx.1_Intron|UGT1A7_uc002vut.2_Intron|UGT1A6_uc002vuu.2_Intron|UGT1A6_uc010zmy.1_Intron|UGT1A6_uc002vuv.3_Intron|UGT1A5_uc010zmz.1_Intron|UGT1A5_uc002vuw.2_Intron|UGT1A4_uc010zna.1_Silent_p.D260D	NM_007120	NP_009051	P22310	UD14_HUMAN	UDP glycosyltransferase 1 family, polypeptide A4	260					xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	enzyme binding|glucuronosyltransferase activity|protein heterodimerization activity|protein homodimerization activity			skin(1)	1		Breast(86;0.000765)|all_lung(227;0.00266)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0327)|Lung NSC(271;0.0456)|Lung SC(224;0.128)		Epithelial(121;3.49e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000504)|Lung(119;0.0026)|LUSC - Lung squamous cell carcinoma(224;0.00624)	Imipramine(DB00458)|Lamotrigine(DB00555)|Paricalcitol(DB00910)|Trifluoperazine(DB00831)	TCCGAGGGGACTTTGTGATGG	0.527													88	214	---	---	---	---	capture	Silent	SNP	234628246	234628246	UGT1A4	2	C	T	T	T	1	0	0	0	0	0	0	0	1	259	20	2	2	16829	261
TATDN2	9797	broad.mit.edu	37	3	10302000	10302000	+	Silent	SNP	G	A	A			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:10302000G>A	uc003bvg.2	+	3	1175	c.594G>A	c.(592-594)TCG>TCA	p.S198S	TATDN2_uc003bvf.2_Silent_p.S198S|TATDN2_uc011atr.1_Silent_p.S198S|TATDN2_uc011ats.1_RNA|TATDN2_uc011att.1_RNA	NM_014760	NP_055575	Q93075	TATD2_HUMAN	TatD DNase domain containing 2	198						nucleus	endodeoxyribonuclease activity, producing 5'-phosphomonoesters|metal ion binding			pancreas(2)	2						TGGGGAAATCGATGCCAAAAA	0.557													13	59	---	---	---	---	capture	Silent	SNP	10302000	10302000	TATDN2	3	G	A	A	A	1	0	0	0	0	0	0	0	1	470	37	1	1	15480	261
BSN	8927	broad.mit.edu	37	3	49694511	49694511	+	Missense_Mutation	SNP	G	A	A			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:49694511G>A	uc003cxe.3	+	5	7636	c.7522G>A	c.(7522-7524)GCA>ACA	p.A2508T		NM_003458	NP_003449	Q9UPA5	BSN_HUMAN	bassoon protein	2508					synaptic transmission	cell junction|cytoplasm|cytoskeleton|nucleus|synaptosome	metal ion binding			ovary(5)|pancreas(1)|central_nervous_system(1)|skin(1)	8				BRCA - Breast invasive adenocarcinoma(193;6.66e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0032)|Kidney(197;0.00336)		CCTTACACATGCAGCCTTCAT	0.642													18	51	---	---	---	---	capture	Missense_Mutation	SNP	49694511	49694511	BSN	3	G	A	A	A	1	0	0	0	0	1	0	0	0	598	46	2	2	1518	261
RBM6	10180	broad.mit.edu	37	3	50099537	50099537	+	Missense_Mutation	SNP	C	T	T			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:50099537C>T	uc003cyc.2	+	15	2715	c.2582C>T	c.(2581-2583)ACG>ATG	p.T861M	RBM6_uc010hlc.1_Missense_Mutation_p.T380M|RBM6_uc003cyd.2_Missense_Mutation_p.T339M|RBM6_uc003cye.2_Missense_Mutation_p.T339M|RBM6_uc011bdi.1_Missense_Mutation_p.T203M|RBM6_uc010hld.1_RNA|RBM6_uc010hle.1_RNA|RBM6_uc010hlf.1_RNA	NM_005777	NP_005768	P78332	RBM6_HUMAN	RNA binding motif protein 6	861					RNA processing	nucleus	DNA binding|nucleotide binding|RNA binding|zinc ion binding			ovary(2)	2				BRCA - Breast invasive adenocarcinoma(193;6.81e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0084)|Kidney(197;0.00977)		AGAGGAGTGACGAGGGTAAGA	0.378													4	34	---	---	---	---	capture	Missense_Mutation	SNP	50099537	50099537	RBM6	3	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	13039	261
CADPS	8618	broad.mit.edu	37	3	62467450	62467450	+	Missense_Mutation	SNP	G	T	T			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:62467450G>T	uc003dll.2	-	22	3481	c.3121C>A	c.(3121-3123)CAA>AAA	p.Q1041K	CADPS_uc003dlj.1_5'UTR|CADPS_uc003dlk.1_Intron|CADPS_uc003dlm.2_Intron|CADPS_uc003dln.2_Intron	NM_003716	NP_003707	Q9ULU8	CAPS1_HUMAN	Ca2+-dependent secretion activator isoform 1	1041	MHD1.|Interaction with DRD2.				exocytosis|protein transport	cell junction|cytoplasmic vesicle membrane|cytosol|synapse	lipid binding|metal ion binding			central_nervous_system(2)|ovary(1)	3		Lung SC(41;0.0452)		BRCA - Breast invasive adenocarcinoma(55;5.98e-05)|KIRC - Kidney renal clear cell carcinoma(15;0.0246)|Kidney(15;0.0334)		GTAGGCATTTGTGGGATGCCT	0.423													49	115	---	---	---	---	capture	Missense_Mutation	SNP	62467450	62467450	CADPS	3	G	T	T	T	1	0	0	0	0	1	0	0	0	624	48	4	4	2546	261
ROBO2	6092	broad.mit.edu	37	3	77671470	77671470	+	Missense_Mutation	SNP	T	C	C			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:77671470T>C	uc003dpy.3	+	23	4290	c.3647T>C	c.(3646-3648)GTT>GCT	p.V1216A	ROBO2_uc003dpz.2_Missense_Mutation_p.V1220A|ROBO2_uc011bgj.1_RNA|ROBO2_uc011bgk.1_Missense_Mutation_p.V1220A	NM_002942	NP_002933	Q9HCK4	ROBO2_HUMAN	roundabout, axon guidance receptor, homolog 2	1216	Cytoplasmic (Potential).				apoptosis involved in luteolysis|axon midline choice point recognition|cellular response to hormone stimulus|homophilic cell adhesion|metanephros development|negative regulation of negative chemotaxis|negative regulation of synaptogenesis|olfactory bulb interneuron development|positive regulation of axonogenesis|retinal ganglion cell axon guidance|ureteric bud development	axolemma|cell surface|integral to membrane	axon guidance receptor activity|identical protein binding			lung(5)|skin(3)|ovary(1)|large_intestine(1)|liver(1)	11				Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)		GAAACGGATGTTGCAGATGAT	0.488													3	78	---	---	---	---	capture	Missense_Mutation	SNP	77671470	77671470	ROBO2	3	T	C	C	C	1	0	0	0	0	1	0	0	0	780	60	3	3	13406	261
MORC1	27136	broad.mit.edu	37	3	108724078	108724078	+	Missense_Mutation	SNP	G	A	A			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:108724078G>A	uc003dxl.2	-	19	1939	c.1852C>T	c.(1852-1854)CGT>TGT	p.R618C	MORC1_uc011bhn.1_Missense_Mutation_p.R597C	NM_014429	NP_055244	Q86VD1	MORC1_HUMAN	MORC family CW-type zinc finger 1	618					cell differentiation|multicellular organismal development|spermatogenesis	nucleus	ATP binding|zinc ion binding			ovary(3)|skin(3)|breast(2)	8						TGTCCTCTACGGCTCGCTGAA	0.363													20	47	---	---	---	---	capture	Missense_Mutation	SNP	108724078	108724078	MORC1	3	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	9613	261
ECT2	1894	broad.mit.edu	37	3	172501613	172501613	+	Missense_Mutation	SNP	C	G	G			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:172501613C>G	uc003fii.2	+	15	1687	c.1549C>G	c.(1549-1551)CCT>GCT	p.P517A	ECT2_uc010hwv.1_Missense_Mutation_p.P548A|ECT2_uc003fih.2_Missense_Mutation_p.P516A|ECT2_uc003fij.1_Missense_Mutation_p.P517A|ECT2_uc003fik.1_Missense_Mutation_p.P517A|ECT2_uc003fil.1_Missense_Mutation_p.P548A	NM_018098	NP_060568	Q9H8V3	ECT2_HUMAN	epithelial cell transforming sequence 2 oncogene	517	DH.				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	Rho guanyl-nucleotide exchange factor activity|signal transducer activity			breast(2)|ovary(1)|skin(1)	4	Ovarian(172;0.00197)|Breast(254;0.158)		Lung(28;1.33e-14)|LUSC - Lung squamous cell carcinoma(14;1.48e-14)			AAAAACCTACCCTCCCTTTGT	0.308													11	92	---	---	---	---	capture	Missense_Mutation	SNP	172501613	172501613	ECT2	3	C	G	G	G	1	0	0	0	0	1	0	0	0	286	22	4	4	4856	261
TP63	8626	broad.mit.edu	37	3	189582022	189582022	+	Missense_Mutation	SNP	A	C	C			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:189582022A>C	uc003fry.2	+	5	670	c.581A>C	c.(580-582)TAT>TCT	p.Y194S	TP63_uc003frx.2_Missense_Mutation_p.Y194S|TP63_uc003frz.2_Missense_Mutation_p.Y194S|TP63_uc010hzc.1_Missense_Mutation_p.Y194S|TP63_uc003fsa.2_Missense_Mutation_p.Y100S|TP63_uc003fsb.2_Missense_Mutation_p.Y100S|TP63_uc003fsc.2_Missense_Mutation_p.Y100S|TP63_uc003fsd.2_Missense_Mutation_p.Y100S|TP63_uc010hzd.1_Missense_Mutation_p.Y15S|TP63_uc003fse.1_Missense_Mutation_p.Y75S	NM_003722	NP_003713	Q9H3D4	P63_HUMAN	tumor protein p63 isoform 1	194					anti-apoptosis|cellular response to UV|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|mitotic cell cycle G1/S transition DNA damage checkpoint|negative regulation of transcription from RNA polymerase II promoter|Notch signaling pathway|positive regulation of Notch signaling pathway|protein homotetramerization|regulation of neuron apoptosis|response to gamma radiation|response to X-ray	chromatin|cytosol|dendrite|Golgi apparatus|transcription factor complex	chromatin binding|damaged DNA binding|double-stranded DNA binding|identical protein binding|metal ion binding|p53 binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			skin(5)|lung(4)|ovary(2)|upper_aerodigestive_tract(1)	12	all_cancers(143;3.35e-10)|Ovarian(172;0.0925)		Lung(62;3.33e-05)	GBM - Glioblastoma multiforme(93;0.0227)		TCTAAGCAGTATTCCACTGAA	0.463									Hay-Wells_syndrome	HNSCC(45;0.13)			16	231	---	---	---	---	capture	Missense_Mutation	SNP	189582022	189582022	TP63	3	A	C	C	C	1	0	0	0	0	1	0	0	0	208	16	4	4	16275	261
CPN2	1370	broad.mit.edu	37	3	194062052	194062052	+	Silent	SNP	G	A	A			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:194062052G>A	uc003fts.2	-	2	1470	c.1380C>T	c.(1378-1380)GAC>GAT	p.D460D		NM_001080513	NP_001073982	P22792	CPN2_HUMAN	carboxypeptidase N, polypeptide 2	460					protein stabilization	extracellular region	enzyme regulator activity			ovary(5)	5	all_cancers(143;5.31e-09)|Ovarian(172;0.0634)		OV - Ovarian serous cystadenocarcinoma(49;2.2e-17)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;4.65e-05)		CCTTGCTTTCGTCCGGCCACG	0.657													42	81	---	---	---	---	capture	Silent	SNP	194062052	194062052	CPN2	3	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	3775	261
ATP13A3	79572	broad.mit.edu	37	3	194165469	194165469	+	Missense_Mutation	SNP	C	T	T			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:194165469C>T	uc003fty.3	-	14	1946	c.1544G>A	c.(1543-1545)CGA>CAA	p.R515Q	ATP13A3_uc003ftz.1_Missense_Mutation_p.R221Q	NM_024524	NP_078800	Q9H7F0	AT133_HUMAN	ATPase type 13A3	515					ATP biosynthetic process|cation transport	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|metal ion binding			ovary(1)	1	all_cancers(143;6.01e-09)|Ovarian(172;0.0634)	Melanoma(1037;0.211)	OV - Ovarian serous cystadenocarcinoma(49;3.83e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;5.98e-05)		ATTTTCCACTCGTTGAATCCC	0.308													9	141	---	---	---	---	capture	Missense_Mutation	SNP	194165469	194165469	ATP13A3	3	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	1116	261
FRAS1	80144	broad.mit.edu	37	4	79236806	79236806	+	Silent	SNP	T	G	G			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:79236806T>G	uc003hlb.2	+	16	2177	c.1737T>G	c.(1735-1737)ACT>ACG	p.T579T	FRAS1_uc003hkw.2_Silent_p.T579T|FRAS1_uc003hky.1_Silent_p.T283T|FRAS1_uc003hkz.2_Silent_p.T283T|FRAS1_uc003hla.1_Silent_p.T90T	NM_025074	NP_079350	Q86XX4	FRAS1_HUMAN	Fraser syndrome 1	579	FU 4.|Extracellular (Potential).				cell communication	integral to membrane|plasma membrane	metal ion binding			large_intestine(5)	5						TTACCTGTACTGAGAAGACAG	0.517													50	77	---	---	---	---	capture	Silent	SNP	79236806	79236806	FRAS1	4	T	G	G	G	1	0	0	0	0	0	0	0	1	704	55	4	4	5986	261
FRAS1	80144	broad.mit.edu	37	4	79400786	79400786	+	Missense_Mutation	SNP	C	T	T			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:79400786C>T	uc003hlb.2	+	56	8797	c.8357C>T	c.(8356-8358)GCG>GTG	p.A2786V		NM_025074	NP_079350	Q86XX4	FRAS1_HUMAN	Fraser syndrome 1	2781	Extracellular (Potential).				cell communication	integral to membrane|plasma membrane	metal ion binding			large_intestine(5)	5						GGAAGGGTGGCGACAGCCAAG	0.522													5	64	---	---	---	---	capture	Missense_Mutation	SNP	79400786	79400786	FRAS1	4	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	5986	261
FHDC1	85462	broad.mit.edu	37	4	153881743	153881743	+	Silent	SNP	C	T	T			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:153881743C>T	uc003inf.2	+	4	765	c.690C>T	c.(688-690)GGC>GGT	p.G230G		NM_033393	NP_203751	Q9C0D6	FHDC1_HUMAN	FH2 domain containing 1	230	FH2.				actin cytoskeleton organization		actin binding			large_intestine(1)|ovary(1)	2	all_hematologic(180;0.093)					CGTTTAGTGGCGACGTGTCGA	0.373													28	47	---	---	---	---	capture	Silent	SNP	153881743	153881743	FHDC1	4	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	5822	261
PRDM9	56979	broad.mit.edu	37	5	23526688	23526688	+	Missense_Mutation	SNP	G	C	C			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:23526688G>C	uc003jgo.2	+	11	1673	c.1491G>C	c.(1489-1491)GAG>GAC	p.E497D		NM_020227	NP_064612	Q9NQV7	PRDM9_HUMAN	PR domain containing 9	497					meiosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleoplasm	histone-lysine N-methyltransferase activity|nucleic acid binding|zinc ion binding			ovary(3)|large_intestine(2)|pancreas(1)	6						TGGAAGAAGAGTCCAGAACAG	0.453										HNSCC(3;0.000094)			4	29	---	---	---	---	capture	Missense_Mutation	SNP	23526688	23526688	PRDM9	5	G	C	C	C	1	0	0	0	0	1	0	0	0	464	36	4	4	12359	261
PRDM9	56979	broad.mit.edu	37	5	23526750	23526750	+	Missense_Mutation	SNP	T	A	A			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:23526750T>A	uc003jgo.2	+	11	1735	c.1553T>A	c.(1552-1554)ATC>AAC	p.I518N		NM_020227	NP_064612	Q9NQV7	PRDM9_HUMAN	PR domain containing 9	518					meiosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleoplasm	histone-lysine N-methyltransferase activity|nucleic acid binding|zinc ion binding			ovary(3)|large_intestine(2)|pancreas(1)	6						GGGGTAGGAATCTCAAGAATT	0.433										HNSCC(3;0.000094)			4	36	---	---	---	---	capture	Missense_Mutation	SNP	23526750	23526750	PRDM9	5	T	A	A	A	1	0	0	0	0	1	0	0	0	650	50	4	4	12359	261
SPEF2	79925	broad.mit.edu	37	5	35740247	35740247	+	Missense_Mutation	SNP	T	A	A			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:35740247T>A	uc003jjo.2	+	23	3319	c.3208T>A	c.(3208-3210)TTT>ATT	p.F1070I	SPEF2_uc003jjp.1_Missense_Mutation_p.F556I	NM_024867	NP_079143	Q9C093	SPEF2_HUMAN	KPL2 protein isoform 1	1070					nucleobase, nucleoside, nucleotide and nucleic acid metabolic process		ATP binding|nucleobase, nucleoside, nucleotide kinase activity|protein dimerization activity			skin(2)|ovary(1)|central_nervous_system(1)	4	all_lung(31;7.56e-05)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			TTTCCAGGAGTTTCTAAAGCG	0.388													6	67	---	---	---	---	capture	Missense_Mutation	SNP	35740247	35740247	SPEF2	5	T	A	A	A	1	0	0	0	0	1	0	0	0	780	60	4	4	14927	261
UGT3A1	133688	broad.mit.edu	37	5	35988627	35988627	+	Missense_Mutation	SNP	G	A	A	rs150814543	by1000genomes	TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:35988627G>A	uc003jjv.1	-	2	278	c.121C>T	c.(121-123)CGG>TGG	p.R41W	UGT3A1_uc003jjw.1_RNA|UGT3A1_uc011coq.1_Missense_Mutation_p.R41W|UGT3A1_uc011cor.1_Intron|UGT3A1_uc003jjy.1_5'UTR	NM_152404	NP_689617	Q6NUS8	UD3A1_HUMAN	UDP glycosyltransferase 3 family, polypeptide A1	41	Extracellular (Potential).					integral to membrane	glucuronosyltransferase activity			ovary(2)|central_nervous_system(1)	3	all_lung(31;0.000197)		Epithelial(62;0.107)|Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			TGAGACACCCGGTCCAACAGT	0.378													16	15	---	---	---	---	capture	Missense_Mutation	SNP	35988627	35988627	UGT3A1	5	G	A	A	A	1	0	0	0	0	1	0	0	0	506	39	1	1	16845	261
SLC1A3	6507	broad.mit.edu	37	5	36677194	36677194	+	Silent	SNP	G	C	C			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:36677194G>C	uc003jkj.3	+	6	1244	c.768G>C	c.(766-768)GTG>GTC	p.V256V	SLC1A3_uc011cox.1_Silent_p.V149V|SLC1A3_uc010iuy.2_Silent_p.V256V	NM_004172	NP_004163	P43003	EAA1_HUMAN	solute carrier family 1 (glial high affinity	256	Helical; (Potential).				D-aspartate import|L-glutamate import|neurotransmitter uptake	integral to membrane|membrane fraction	high-affinity glutamate transmembrane transporter activity|sodium:dicarboxylate symporter activity				0	all_lung(31;0.000245)		Epithelial(62;0.0444)|Lung(74;0.111)|all cancers(62;0.128)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)		L-Glutamic Acid(DB00142)	TCGGTTTTGTGATTGGAAACA	0.473													28	58	---	---	---	---	capture	Silent	SNP	36677194	36677194	SLC1A3	5	G	C	C	C	1	0	0	0	0	0	0	0	1	574	45	4	4	14326	261
MCTP1	79772	broad.mit.edu	37	5	94044306	94044306	+	Nonsense_Mutation	SNP	T	A	A			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:94044306T>A	uc003kkx.2	-	22	2839	c.2839A>T	c.(2839-2841)AAA>TAA	p.K947*	MCTP1_uc003kkv.2_Nonsense_Mutation_p.K726*|MCTP1_uc003kkw.2_Nonsense_Mutation_p.K640*|MCTP1_uc003kku.2_Nonsense_Mutation_p.K463*	NM_024717	NP_078993	Q6DN14	MCTP1_HUMAN	multiple C2 domains, transmembrane 1 isoform L	947					calcium-mediated signaling	integral to membrane|membrane fraction	calcium ion binding			ovary(2)	2		all_cancers(142;1.68e-05)|all_epithelial(76;1.51e-07)|all_lung(232;0.0167)|Lung NSC(167;0.0207)|Ovarian(225;0.0218)|Colorectal(57;0.207)		all cancers(79;9.1e-17)		TTTGTAAATTTATTGATGCCT	0.353													8	43	---	---	---	---	capture	Nonsense_Mutation	SNP	94044306	94044306	MCTP1	5	T	A	A	A	1	0	0	0	0	0	1	0	0	793	61	5	4	9313	261
CHD1	1105	broad.mit.edu	37	5	98192335	98192335	+	Missense_Mutation	SNP	G	A	A			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:98192335G>A	uc003knf.2	-	35	5030	c.4882C>T	c.(4882-4884)CAT>TAT	p.H1628Y	CHD1_uc010jbn.2_Missense_Mutation_p.H354Y	NM_001270	NP_001261	O14646	CHD1_HUMAN	chromodomain helicase DNA binding protein 1	1628	3 X 5 AA repeats of H-S-D-H-R.|1.				regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|nucleus	ATP binding|ATP-dependent DNA helicase activity|DNA binding|methylated histone residue binding			lung(2)|ovary(1)|breast(1)|pancreas(1)	5		all_cancers(142;5.36e-08)|all_epithelial(76;6.97e-11)|Lung NSC(167;0.000693)|Prostate(80;0.000986)|all_lung(232;0.00119)|Ovarian(225;0.024)|Colorectal(57;0.117)		COAD - Colon adenocarcinoma(37;0.0717)	Epirubicin(DB00445)	TGATCAGAATGAGATCTATCT	0.383													10	37	---	---	---	---	capture	Missense_Mutation	SNP	98192335	98192335	CHD1	5	G	A	A	A	1	0	0	0	0	1	0	0	0	585	45	2	2	3289	261
PCDHA10	56139	broad.mit.edu	37	5	140235776	140235776	+	Missense_Mutation	SNP	C	T	T			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140235776C>T	uc003lhx.2	+	1	143	c.143C>T	c.(142-144)GCG>GTG	p.A48V	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lhu.2_Intron|PCDHA10_uc003lhw.2_Missense_Mutation_p.A48V|PCDHA10_uc011dad.1_Missense_Mutation_p.A48V	NM_018901	NP_061724	Q9Y5I2	PCDAA_HUMAN	protocadherin alpha 10 isoform 1 precursor	48	Extracellular (Potential).|Cadherin 1.				homophilic cell adhesion|nervous system development	extracellular region|integral to plasma membrane	calcium ion binding|protein binding			ovary(2)|skin(2)|breast(1)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGCCGCATCGCGCAGGACCTG	0.652													7	122	---	---	---	---	capture	Missense_Mutation	SNP	140235776	140235776	PCDHA10	5	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	11423	261
PCDHAC1	56135	broad.mit.edu	37	5	140307515	140307515	+	Silent	SNP	G	A	A			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140307515G>A	uc003lih.2	+	1	1214	c.1038G>A	c.(1036-1038)TCG>TCA	p.S346S	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lhu.2_Intron|PCDHA10_uc003lhw.2_Intron|PCDHA10_uc003lhx.2_Intron|PCDHA11_uc003lia.2_Intron|PCDHA12_uc003lic.2_Intron|PCDHA13_uc003lie.1_Intron|PCDHA13_uc003lif.2_Intron|PCDHAC1_uc003lig.1_Silent_p.S346S	NM_018898	NP_061721	Q9H158	PCDC1_HUMAN	protocadherin alpha subfamily C, 1 isoform 1	346	Extracellular (Potential).				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding			skin(3)|ovary(2)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGACTCTTTCGAACCCAGTAC	0.517													12	137	---	---	---	---	capture	Silent	SNP	140307515	140307515	PCDHAC1	5	G	A	A	A	1	0	0	0	0	0	0	0	1	470	37	1	1	11435	261
PCDHGB5	56101	broad.mit.edu	37	5	140778096	140778096	+	Silent	SNP	G	A	A			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140778096G>A	uc003lkf.1	+	1	402	c.402G>A	c.(400-402)ACG>ACA	p.T134T	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc011daw.1_Silent_p.T134T	NM_018925	NP_061748	Q9Y5G0	PCDGH_HUMAN	protocadherin gamma subfamily B, 5 isoform 1	134	Extracellular (Potential).|Cadherin 2.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CAAAATTCACGCAAAATTCCT	0.423													14	38	---	---	---	---	capture	Silent	SNP	140778096	140778096	PCDHGB5	5	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	11469	261
GABRA6	2559	broad.mit.edu	37	5	161128666	161128666	+	Missense_Mutation	SNP	A	G	G			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:161128666A>G	uc003lyu.2	+	9	1587	c.1249A>G	c.(1249-1251)ATA>GTA	p.I417V	GABRA6_uc003lyv.2_Missense_Mutation_p.I188V	NM_000811	NP_000802	Q16445	GBRA6_HUMAN	gamma-aminobutyric acid A receptor, alpha 6	417	Cytoplasmic (Probable).				gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity			ovary(7)|skin(3)|large_intestine(1)|central_nervous_system(1)	12	Renal(175;0.00259)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		Alprazolam(DB00404)|Ethchlorvynol(DB00189)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Lorazepam(DB00186)|Meprobamate(DB00371)|Midazolam(DB00683)	CACCAGTAAAATAGACCAGTA	0.468										TCGA Ovarian(5;0.080)			20	36	---	---	---	---	capture	Missense_Mutation	SNP	161128666	161128666	GABRA6	5	A	G	G	G	1	0	0	0	0	1	0	0	0	52	4	3	3	6107	261
DSP	1832	broad.mit.edu	37	6	7584328	7584328	+	Missense_Mutation	SNP	T	C	C			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:7584328T>C	uc003mxp.1	+	24	7112	c.6833T>C	c.(6832-6834)ATG>ACG	p.M2278T	DSP_uc003mxq.1_Missense_Mutation_p.M1679T	NM_004415	NP_004406	P15924	DESP_HUMAN	desmoplakin isoform I	2278	Plectin 7.|Globular 2.				cellular component disassembly involved in apoptosis|keratinocyte differentiation|peptide cross-linking	cornified envelope|cytoplasm|desmosome	protein binding, bridging|structural constituent of cytoskeleton			central_nervous_system(6)|ovary(2)|skin(1)	9	Ovarian(93;0.0584)	all_hematologic(90;0.236)		OV - Ovarian serous cystadenocarcinoma(45;0.000508)		TATGAGGCCATGAAAATTGGC	0.473													3	110	---	---	---	---	capture	Missense_Mutation	SNP	7584328	7584328	DSP	6	T	C	C	C	1	0	0	0	0	1	0	0	0	663	51	3	3	4736	261
DNAH11	8701	broad.mit.edu	37	7	21609750	21609750	+	Missense_Mutation	SNP	G	T	T			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:21609750G>T	uc003svc.2	+	7	1289	c.1258G>T	c.(1258-1260)GTG>TTG	p.V420L		NM_003777	NP_003768	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	420	Stem (By similarity).				microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(8)|large_intestine(3)|pancreas(3)|central_nervous_system(1)	15						ACTGGAAAAGGTGCAGGTGGC	0.383									Kartagener_syndrome				9	43	---	---	---	---	capture	Missense_Mutation	SNP	21609750	21609750	DNAH11	7	G	T	T	T	1	0	0	0	0	1	0	0	0	572	44	4	4	4557	261
NPC1L1	29881	broad.mit.edu	37	7	44578753	44578753	+	Missense_Mutation	SNP	G	T	T			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:44578753G>T	uc003tlb.2	-	2	1299	c.1243C>A	c.(1243-1245)CCT>ACT	p.P415T	NPC1L1_uc003tlc.2_Missense_Mutation_p.P415T|NPC1L1_uc011kbw.1_Missense_Mutation_p.P415T|NPC1L1_uc003tld.2_Missense_Mutation_p.P415T	NM_013389	NP_037521	Q9UHC9	NPCL1_HUMAN	Niemann-Pick C1-like protein 1 isoform 1	415	Extracellular (Potential).				cholesterol biosynthetic process|intestinal cholesterol absorption|lipoprotein metabolic process	apical plasma membrane|cytoplasmic vesicle membrane|integral to membrane	hedgehog receptor activity|protein binding			ovary(3)|central_nervous_system(1)|skin(1)	5					Ezetimibe(DB00973)	GACCGGTTAGGAGCCGTCAGG	0.592													42	96	---	---	---	---	capture	Missense_Mutation	SNP	44578753	44578753	NPC1L1	7	G	T	T	T	1	0	0	0	0	1	0	0	0	533	41	4	4	10478	261
LANCL2	55915	broad.mit.edu	37	7	55467774	55467774	+	Missense_Mutation	SNP	G	A	A			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:55467774G>A	uc003tqp.2	+	4	1233	c.655G>A	c.(655-657)GTG>ATG	p.V219M		NM_018697	NP_061167	Q9NS86	LANC2_HUMAN	LanC lantibiotic synthetase component C-like 2	219					negative regulation of transcription, DNA-dependent|positive regulation of abscisic acid mediated signaling pathway	cortical actin cytoskeleton|cytosol|nucleus|plasma membrane	ATP binding|catalytic activity|GTP binding|phosphatidylinositol-3-phosphate binding|phosphatidylinositol-4-phosphate binding|phosphatidylinositol-5-phosphate binding			ovary(1)|skin(1)	2	Breast(14;0.0379)		Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00128)|Epithelial(13;0.0706)			TCCAGGCACCGTGTGTGAGTC	0.458													50	157	---	---	---	---	capture	Missense_Mutation	SNP	55467774	55467774	LANCL2	7	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	8541	261
SEMA3C	10512	broad.mit.edu	37	7	80374224	80374224	+	Silent	SNP	A	G	G			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:80374224A>G	uc003uhj.2	-	18	2804	c.2242T>C	c.(2242-2244)TTG>CTG	p.L748L	SEMA3C_uc011kgw.1_Silent_p.L766L	NM_006379	NP_006370	Q99985	SEM3C_HUMAN	semaphorin 3C precursor	748					immune response|response to drug	membrane	receptor activity			ovary(1)	1						GACTCTGGCAACTGATTCCTC	0.393													5	150	---	---	---	---	capture	Silent	SNP	80374224	80374224	SEMA3C	7	A	G	G	G	1	0	0	0	0	0	0	0	1	24	2	3	3	13919	261
KIAA1324L	222223	broad.mit.edu	37	7	86521207	86521207	+	Splice_Site	SNP	T	A	A			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:86521207T>A	uc011kha.1	-	21	3050	c.2865_splice	c.e21-1	p.K955_splice	KIAA1324L_uc003uif.1_Splice_Site_p.K715_splice|KIAA1324L_uc011kgz.1_Splice_Site_p.K841_splice|KIAA1324L_uc003uie.2_Splice_Site_p.K788_splice	NM_001142749	NP_001136221	A8MWY0	K132L_HUMAN	hypothetical protein LOC222223 isoform 1							integral to membrane				ovary(6)|skin(1)	7	Esophageal squamous(14;0.0058)					TATTCCAGTCTAAATAGTGAT	0.303													10	20	---	---	---	---	capture	Splice_Site	SNP	86521207	86521207	KIAA1324L	7	T	A	A	A	1	0	0	0	0	0	0	1	0	689	53	5	4	8146	261
COL1A2	1278	broad.mit.edu	37	7	94042435	94042435	+	Missense_Mutation	SNP	T	A	A			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:94042435T>A	uc003ung.1	+	26	2015	c.1544T>A	c.(1543-1545)CTT>CAT	p.L515H	COL1A2_uc011kib.1_Intron	NM_000089	NP_000080	P08123	CO1A2_HUMAN	alpha 2 type I collagen precursor	515					axon guidance|blood vessel development|collagen fibril organization|leukocyte migration|odontogenesis|platelet activation|regulation of blood pressure|Rho protein signal transduction|skeletal system development|skin morphogenesis|transforming growth factor beta receptor signaling pathway	collagen type I|extracellular space|plasma membrane	extracellular matrix structural constituent|identical protein binding|platelet-derived growth factor binding|protein binding, bridging		COL1A2/PLAG1(3)	soft_tissue(3)|central_nervous_system(3)|ovary(2)|skin(1)	9	all_cancers(62;2.46e-09)|all_epithelial(64;2.7e-08)		STAD - Stomach adenocarcinoma(171;0.0031)		Collagenase(DB00048)	CATGCTGGTCTTGCTGGTGCT	0.368										HNSCC(75;0.22)			28	235	---	---	---	---	capture	Missense_Mutation	SNP	94042435	94042435	COL1A2	7	T	A	A	A	1	0	0	0	0	1	0	0	0	728	56	4	4	3643	261
WNT2	7472	broad.mit.edu	37	7	116955387	116955387	+	Missense_Mutation	SNP	G	T	T			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:116955387G>T	uc003viz.2	-	3	626	c.326C>A	c.(325-327)GCC>GAC	p.A109D	WNT2_uc003vja.2_Intron	NM_003391	NP_003382	P09544	WNT2_HUMAN	wingless-type MMTV integration site family	109					atrial cardiac muscle tissue morphogenesis|canonical Wnt receptor signaling pathway|cardiac epithelial to mesenchymal transition|cellular response to retinoic acid|cellular response to transforming growth factor beta stimulus|dorsal/ventral axis specification|iris morphogenesis|labyrinthine layer blood vessel development|lens development in camera-type eye|lung induction|mammary gland epithelium development|neuron differentiation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cardiac muscle cell proliferation|positive regulation of epithelial cell proliferation involved in lung morphogenesis|positive regulation of fibroblast proliferation|positive regulation of mesenchymal cell proliferation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|Wnt receptor signaling pathway, calcium modulating pathway	cytoplasm|extracellular space|proteinaceous extracellular matrix	cytokine activity|frizzled binding|frizzled-2 binding|signal transducer activity			breast(2)|central_nervous_system(2)|ovary(1)|lung(1)|skin(1)	7	all_epithelial(6;2.24e-06)|Lung NSC(10;0.000936)|all_lung(10;0.00109)		STAD - Stomach adenocarcinoma(10;0.000512)	LUSC - Lung squamous cell carcinoma(290;0.133)		ATAAACAAAGGCAGATTCCCG	0.403													14	48	---	---	---	---	capture	Missense_Mutation	SNP	116955387	116955387	WNT2	7	G	T	T	T	1	0	0	0	0	1	0	0	0	546	42	4	4	17267	261
HYAL4	23553	broad.mit.edu	37	7	123508674	123508674	+	Missense_Mutation	SNP	T	C	C			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:123508674T>C	uc003vlc.2	+	3	985	c.347T>C	c.(346-348)ATA>ACA	p.I116T	HYAL4_uc011knz.1_Missense_Mutation_p.I116T	NM_012269	NP_036401	Q2M3T9	HYAL4_HUMAN	hyaluronoglucosaminidase 4	116	Extracellular (Potential).				fusion of sperm to egg plasma membrane|glycosaminoglycan catabolic process	integral to membrane	hyalurononglucosaminidase activity			skin(1)	1						CCACAGAACATAAGTTTACAA	0.393													33	102	---	---	---	---	capture	Missense_Mutation	SNP	123508674	123508674	HYAL4	7	T	C	C	C	1	0	0	0	0	1	0	0	0	637	49	3	3	7391	261
PLXNA4	91584	broad.mit.edu	37	7	131865369	131865369	+	Silent	SNP	G	A	A			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:131865369G>A	uc003vra.3	-	19	3844	c.3615C>T	c.(3613-3615)AAC>AAT	p.N1205N		NM_020911	NP_065962	Q9HCM2	PLXA4_HUMAN	plexin A4 isoform 1	1205	IPT/TIG 4.|Extracellular (Potential).					integral to membrane|intracellular|plasma membrane				ovary(1)	1						TGCCGATGAGGTTGGGGGACT	0.602													13	38	---	---	---	---	capture	Silent	SNP	131865369	131865369	PLXNA4	7	G	A	A	A	1	0	0	0	0	0	0	0	1	568	44	2	2	12025	261
PLAT	5327	broad.mit.edu	37	8	42036566	42036566	+	Missense_Mutation	SNP	G	A	A			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:42036566G>A	uc003xos.2	-	13	1588	c.1379C>T	c.(1378-1380)TCG>TTG	p.S460L	PLAT_uc010lxf.1_Missense_Mutation_p.S377L|PLAT_uc010lxg.1_Missense_Mutation_p.S285L|PLAT_uc003xot.2_Missense_Mutation_p.S414L|PLAT_uc011lcm.1_Missense_Mutation_p.S371L|PLAT_uc011lcn.1_Missense_Mutation_p.S334L	NM_000930	NP_000921	P00750	TPA_HUMAN	plasminogen activator, tissue isoform 1	460	Peptidase S1.				blood coagulation|fibrinolysis|negative regulation of proteolysis|protein modification process|proteolysis	cell surface|cytoplasm|extracellular space	protein binding|serine-type endopeptidase activity			breast(1)|skin(1)	2	all_cancers(6;3.84e-26)|all_epithelial(6;9.61e-28)|all_lung(13;7.2e-13)|Lung NSC(13;1.18e-11)|Ovarian(28;0.00438)|Prostate(17;0.0119)|Colorectal(14;0.0468)|Lung SC(25;0.211)	all_lung(54;0.000378)|Lung NSC(58;0.00145)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.0954)	BRCA - Breast invasive adenocarcinoma(8;5.23e-10)|OV - Ovarian serous cystadenocarcinoma(14;0.00135)|Colorectal(10;0.00165)|Lung(22;0.00467)|COAD - Colon adenocarcinoma(11;0.0171)|LUSC - Lung squamous cell carcinoma(45;0.024)		Alteplase(DB00009)|Aminocaproic Acid(DB00513)|Anistreplase(DB00029)|Iloprost(DB01088)|Reteplase(DB00015)|Tenecteplase(DB00031)|Tranexamic Acid(DB00302)|Urokinase(DB00013)	CAGCCGCTCCGAATAGAAAGG	0.423													10	61	---	---	---	---	capture	Missense_Mutation	SNP	42036566	42036566	PLAT	8	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	11924	261
RP1	6101	broad.mit.edu	37	8	55533600	55533600	+	Missense_Mutation	SNP	G	A	A			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:55533600G>A	uc003xsd.1	+	2	222	c.74G>A	c.(73-75)CGC>CAC	p.R25H	RP1_uc011ldy.1_Missense_Mutation_p.R25H	NM_006269	NP_006260	P56715	RP1_HUMAN	retinitis pigmentosa RP1 protein	25					axoneme assembly|intracellular signal transduction|photoreceptor cell maintenance|photoreceptor cell outer segment organization|phototransduction, visible light|retinal cone cell development|retinal rod cell development	cilium axoneme|cytoplasm|microtubule|microtubule associated complex|photoreceptor connecting cilium|photoreceptor inner segment|photoreceptor outer segment	microtubule binding			skin(7)|ovary(4)|pancreas(1)	12		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			CCACCCCCTCGCCATTTGAGC	0.517													39	72	---	---	---	---	capture	Missense_Mutation	SNP	55533600	55533600	RP1	8	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	13424	261
NCOA2	10499	broad.mit.edu	37	8	71057034	71057034	+	Missense_Mutation	SNP	C	G	G			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:71057034C>G	uc003xyn.1	-	13	2817	c.2655G>C	c.(2653-2655)CAG>CAC	p.Q885H	NCOA2_uc011lfb.1_Intron	NM_006540	NP_006531	Q15596	NCOA2_HUMAN	nuclear receptor coactivator 2	885					cellular lipid metabolic process|transcription, DNA-dependent	nucleoplasm	histone acetyltransferase activity|ligand-dependent nuclear receptor binding|nuclear hormone receptor binding|signal transducer activity		PAX3/NCOA2(4)	lung(6)|soft_tissue(4)|breast(2)|skin(2)|ovary(1)|pancreas(1)	16	Breast(64;0.201)		Epithelial(68;0.0147)|OV - Ovarian serous cystadenocarcinoma(28;0.0455)|all cancers(69;0.0606)			GTGGTAAATTCTGGTTTGGCA	0.423			T	RUNXBP2	AML								10	120	---	---	---	---	capture	Missense_Mutation	SNP	71057034	71057034	NCOA2	8	C	G	G	G	1	0	0	0	0	1	0	0	0	415	32	4	4	10136	261
TTC39B	158219	broad.mit.edu	37	9	15214139	15214139	+	Silent	SNP	G	C	C			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:15214139G>C	uc003zlr.1	-	4	403	c.282C>G	c.(280-282)CCC>CCG	p.P94P	TTC39B_uc003zlq.1_Silent_p.P63P|TTC39B_uc011lmp.1_5'UTR|TTC39B_uc010mie.1_Silent_p.P94P|TTC39B_uc011lmq.1_Silent_p.P94P|TTC39B_uc011lmr.1_Intron|TTC39B_uc010mif.1_Silent_p.P94P|TTC39B_uc003zls.1_5'UTR|TTC39B_uc010mig.1_Silent_p.P63P|TTC39B_uc011lms.1_RNA	NM_152574	NP_689787	Q5VTQ0	TT39B_HUMAN	tetratricopeptide repeat domain 39B	94							binding			ovary(1)	1						TAAATTACCAGGGGCGAAGCA	0.373													8	35	---	---	---	---	capture	Silent	SNP	15214139	15214139	TTC39B	9	G	C	C	C	1	0	0	0	0	0	0	0	1	444	35	4	4	16590	261
PTPN3	5774	broad.mit.edu	37	9	112200417	112200417	+	Silent	SNP	G	A	A	rs148263399		TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:112200417G>A	uc004bed.2	-	8	676	c.564C>T	c.(562-564)GTC>GTT	p.V188V	PTPN3_uc004beb.2_Silent_p.V57V|PTPN3_uc004bec.2_Silent_p.V57V|PTPN3_uc010mtu.2_RNA|PTPN3_uc011lwg.1_Silent_p.V188V|PTPN3_uc011lwh.1_Silent_p.V79V	NM_002829	NP_002820	P26045	PTN3_HUMAN	protein tyrosine phosphatase, non-receptor type	188	FERM.				negative regulation of membrane protein ectodomain proteolysis|negative regulation of mitotic cell cycle	cytoplasm|cytoskeleton|internal side of plasma membrane	ATPase binding|cytoskeletal protein binding|phosphotyrosine binding|protein tyrosine phosphatase activity			ovary(3)	3						GCAGAGATTCGACTTTTGTTA	0.438													39	72	---	---	---	---	capture	Silent	SNP	112200417	112200417	PTPN3	9	G	A	A	A	1	0	0	0	0	0	0	0	1	470	37	1	1	12684	261
CRAT	1384	broad.mit.edu	37	9	131864744	131864744	+	Missense_Mutation	SNP	T	C	C			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:131864744T>C	uc004bxh.2	-	5	847	c.565A>G	c.(565-567)ACA>GCA	p.T189A	CRAT_uc004bxg.2_Missense_Mutation_p.T168A|CRAT_uc004bxk.3_Missense_Mutation_p.T168A	NM_000755	NP_000746	P43155	CACP_HUMAN	carnitine acetyltransferase precursor	189					energy derivation by oxidation of organic compounds|fatty acid beta-oxidation using acyl-CoA oxidase|transport	endoplasmic reticulum|mitochondrial inner membrane|peroxisomal matrix	carnitine O-acetyltransferase activity			central_nervous_system(1)	1				UCEC - Uterine corpus endometrioid carcinoma (4;0.0178)	L-Carnitine(DB00583)	TTGCTGACTGTGTCCTGCTTG	0.617													92	203	---	---	---	---	capture	Missense_Mutation	SNP	131864744	131864744	CRAT	9	T	C	C	C	1	0	0	0	0	1	0	0	0	767	59	3	3	3812	261
POMT1	10585	broad.mit.edu	37	9	134394274	134394274	+	Silent	SNP	C	T	T	rs139687326	byFrequency;by1000genomes	TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:134394274C>T	uc004cav.2	+	15	1684	c.1482C>T	c.(1480-1482)GTC>GTT	p.V494V	POMT1_uc004cax.2_Silent_p.V472V|POMT1_uc011mcj.1_Silent_p.V250V|POMT1_uc004cau.2_Silent_p.V472V|POMT1_uc004caw.2_Silent_p.V418V|POMT1_uc011mck.1_Silent_p.V355V|POMT1_uc011mcl.1_Silent_p.V320V|POMT1_uc011mcm.1_Silent_p.V442V|POMT1_uc011mcn.1_3'UTR	NM_007171	NP_009102	Q9Y6A1	POMT1_HUMAN	protein-O-mannosyltransferase 1 isoform a	494	MIR 3.				multicellular organismal development|protein O-linked glycosylation	endoplasmic reticulum membrane|integral to membrane	dolichyl-phosphate-mannose-protein mannosyltransferase activity|metal ion binding			upper_aerodigestive_tract(1)	1		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;2.65e-05)|Epithelial(140;0.000259)		TGGAGATCGTCGGGGAGAAGC	0.677													8	41	---	---	---	---	capture	Silent	SNP	134394274	134394274	POMT1	9	C	T	T	T	1	0	0	0	0	0	0	0	1	392	31	1	1	12147	261
COL5A1	1289	broad.mit.edu	37	9	137704532	137704532	+	Missense_Mutation	SNP	G	A	A			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:137704532G>A	uc004cfe.2	+	48	4208	c.3826G>A	c.(3826-3828)GGA>AGA	p.G1276R		NM_000093	NP_000084	P20908	CO5A1_HUMAN	alpha 1 type V collagen preproprotein	1276	Triple-helical region.				axon guidance|cell adhesion|collagen biosynthetic process|collagen fibril organization|eye morphogenesis|fibril organization|integrin biosynthetic process|skin development|wound healing, spreading of epidermal cells	collagen type V	heparin binding|integrin binding|platelet-derived growth factor binding|proteoglycan binding			skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|kidney(1)	11		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)		AGGTGGAATAGGAAACCCTGG	0.557													2	5	---	---	---	---	capture	Missense_Mutation	SNP	137704532	137704532	COL5A1	9	G	A	A	A	1	0	0	0	0	1	0	0	0	455	35	2	2	3661	261
LCN6	158062	broad.mit.edu	37	9	139639655	139639655	+	Missense_Mutation	SNP	C	T	T			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:139639655C>T	uc004ciy.2	-	4	424	c.379G>A	c.(379-381)GGG>AGG	p.G127R	LCN10_uc004civ.2_5'Flank|LCN10_uc011med.1_5'Flank|LCN10_uc010nbq.2_5'Flank|LCN10_uc011mee.1_5'Flank|LCN10_uc011mef.1_5'Flank|LCN10_uc004ciw.2_RNA|uc004ciz.1_5'Flank	NM_198946	NP_945184	P62502	LCN6_HUMAN	lipocalin 6 precursor	127					single fertilization	extracellular region	binding				0	all_cancers(76;0.0882)|all_epithelial(76;0.228)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.32e-06)|Epithelial(140;7.83e-05)		GGCTCGTCCCCGAACTCCAGC	0.607													18	42	---	---	---	---	capture	Missense_Mutation	SNP	139639655	139639655	LCN6	9	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	8605	261
CSF2RA	1438	broad.mit.edu	37	X	1407534	1407534	+	Silent	SNP	A	G	G			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:1407534A>G	uc010nct.2	+	6	664	c.342A>G	c.(340-342)TCA>TCG	p.S114S	CSF2RA_uc011mhb.1_Silent_p.S114S|CSF2RA_uc004cpq.2_Silent_p.S114S|CSF2RA_uc004cpn.2_Silent_p.S114S|CSF2RA_uc004cpo.2_Silent_p.S114S|CSF2RA_uc010ncu.2_RNA|CSF2RA_uc011mhc.1_5'UTR|CSF2RA_uc004cpp.2_Silent_p.S114S|CSF2RA_uc010ncv.2_Silent_p.S114S|CSF2RA_uc004cpr.2_Silent_p.S114S	NM_001161529	NP_001155001	P15509	CSF2R_HUMAN	colony stimulating factor 2 receptor alpha chain	114	Extracellular (Potential).					extracellular region|integral to plasma membrane	cytokine receptor activity			ovary(2)	2		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			Sargramostim(DB00020)	ATCCAAATTCAGGTAAGCAAG	0.443													11	275	---	---	---	---	capture	Silent	SNP	1407534	1407534	CSF2RA	23	A	G	G	G	1	0	0	0	0	0	0	0	1	80	7	3	3	3899	261
TLR7	51284	broad.mit.edu	37	X	12906437	12906437	+	Missense_Mutation	SNP	A	T	T			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:12906437A>T	uc004cvc.2	+	3	2949	c.2810A>T	c.(2809-2811)CAG>CTG	p.Q937L		NM_016562	NP_057646	Q9NYK1	TLR7_HUMAN	toll-like receptor 7 precursor	937	TIR.|Cytoplasmic (Potential).				cellular response to mechanical stimulus|defense response to virus|I-kappaB phosphorylation|inflammatory response|innate immune response|positive regulation of chemokine production|positive regulation of interferon-alpha biosynthetic process|positive regulation of interferon-beta biosynthetic process|positive regulation of interferon-gamma biosynthetic process|positive regulation of interleukin-8 biosynthetic process|positive regulation of interleukin-8 production|positive regulation of NF-kappaB import into nucleus	early phagosome|endoplasmic reticulum membrane|endosome membrane|integral to membrane|lysosome|plasma membrane	double-stranded RNA binding|single-stranded RNA binding|siRNA binding|transmembrane receptor activity			ovary(2)|lung(2)|breast(1)	5					Imiquimod(DB00724)	TTACCAGGGCAGCCAGTTCTG	0.443													62	155	---	---	---	---	capture	Missense_Mutation	SNP	12906437	12906437	TLR7	23	A	T	T	T	1	0	0	0	0	1	0	0	0	91	7	4	4	15841	261
BMX	660	broad.mit.edu	37	X	15526512	15526512	+	Silent	SNP	C	G	G			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:15526512C>G	uc004cww.2	+	2	224	c.36C>G	c.(34-36)CTC>CTG	p.L12L	BMX_uc004cwx.3_Silent_p.L12L|BMX_uc004cwy.3_Silent_p.L12L	NM_203281	NP_975010	P51813	BMX_HUMAN	BMX non-receptor tyrosine kinase	12	PH.				cellular component disassembly involved in apoptosis|intracellular signal transduction|mesoderm development	cytosol	ATP binding|metal ion binding|non-membrane spanning protein tyrosine kinase activity|protein binding|signal transducer activity			lung(3)|ovary(2)	5	Hepatocellular(33;0.183)					AACTTCTTCTCAAAAGATCAC	0.284													8	97	---	---	---	---	capture	Silent	SNP	15526512	15526512	BMX	23	C	G	G	G	1	0	0	0	0	0	0	0	1	366	29	4	4	1461	261
CDKL5	6792	broad.mit.edu	37	X	18664128	18664128	+	Silent	SNP	C	T	T			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:18664128C>T	uc004cym.2	+	19	2968	c.2715C>T	c.(2713-2715)GAC>GAT	p.D905D	CDKL5_uc004cyn.2_Silent_p.D905D|RS1_uc004cyo.2_Intron	NM_003159	NP_003150	O76039	CDKL5_HUMAN	cyclin-dependent kinase-like 5	905					neuron migration|positive regulation of axon extension|positive regulation of dendrite morphogenesis|positive regulation of Rac GTPase activity|protein autophosphorylation	dendrite cytoplasm|dendritic growth cone|nucleus	ATP binding|cyclin-dependent protein kinase activity|Rac GTPase binding	p.D905D(1)		ovary(2)|large_intestine(1)|stomach(1)|central_nervous_system(1)|skin(1)	6	Hepatocellular(33;0.183)					actaactagacggtggatgtg	0.000													14	94	---	---	---	---	capture	Silent	SNP	18664128	18664128	CDKL5	23	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	3127	261
UBQLN2	29978	broad.mit.edu	37	X	56590893	56590893	+	Missense_Mutation	SNP	C	T	T			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:56590893C>T	uc004dus.2	+	1	822	c.587C>T	c.(586-588)TCG>TTG	p.S196L	UBQLN2_uc011moq.1_Missense_Mutation_p.S196L	NM_013444	NP_038472	Q9UHD9	UBQL2_HUMAN	ubiquilin 2	196						cytoplasm|nucleus|plasma membrane	binding			ovary(1)|skin(1)	2						AGCATGCTTTCGAATCCCGAT	0.473													9	110	---	---	---	---	capture	Missense_Mutation	SNP	56590893	56590893	UBQLN2	23	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	16779	261
ATRX	546	broad.mit.edu	37	X	76918879	76918879	+	Missense_Mutation	SNP	C	G	G			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:76918879C>G	uc004ecp.3	-	12	4344	c.4112G>C	c.(4111-4113)AGA>ACA	p.R1371T	ATRX_uc004ecq.3_Missense_Mutation_p.R1333T|ATRX_uc004eco.3_Missense_Mutation_p.R1156T|ATRX_uc004ecr.2_Missense_Mutation_p.R1303T	NM_000489	NP_000480	P46100	ATRX_HUMAN	transcriptional regulator ATRX isoform 1	1371					DNA methylation|DNA recombination|DNA repair|regulation of transcription, DNA-dependent	nuclear heterochromatin	ATP binding|chromo shadow domain binding|DNA binding|DNA helicase activity|zinc ion binding			haematopoietic_and_lymphoid_tissue(14)|pancreas(12)|lung(1)|breast(1)|skin(1)|kidney(1)	30					Phosphatidylserine(DB00144)	ACCCTTTCTTCTGTTTCTGCC	0.289			Mis|F|N		Pancreatic neuroendocrine tumors		ATR-X (alpha thalassemia/mental retardation) syndrome						38	107	---	---	---	---	capture	Missense_Mutation	SNP	76918879	76918879	ATRX	23	C	G	G	G	1	0	0	0	0	1	0	0	0	416	32	4	4	1199	261
POU3F4	5456	broad.mit.edu	37	X	82763915	82763915	+	Missense_Mutation	SNP	G	C	C			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:82763915G>C	uc004eeg.2	+	1	647	c.583G>C	c.(583-585)GAA>CAA	p.E195Q		NM_000307	NP_000298	P49335	PO3F4_HUMAN	POU domain, class 3, transcription factor 4	195	POU-specific.				sensory perception of sound	nucleus	sequence-specific DNA binding transcription factor activity			ovary(1)	1						TGATGAGTTGGAACAGTTCGC	0.582													5	32	---	---	---	---	capture	Missense_Mutation	SNP	82763915	82763915	POU3F4	23	G	C	C	C	1	0	0	0	0	1	0	0	0	533	41	4	4	12178	261
TAF7L	54457	broad.mit.edu	37	X	100538449	100538449	+	Missense_Mutation	SNP	C	G	G			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:100538449C>G	uc004ehb.2	-	4	538	c.526G>C	c.(526-528)GAC>CAC	p.D176H	TAF7L_uc004eha.2_Missense_Mutation_p.D90H|TAF7L_uc004ehc.1_Missense_Mutation_p.D90H	NM_024885	NP_079161	Q5H9L4	TAF7L_HUMAN	TATA box binding protein-associated factor, RNA	176					cell differentiation|multicellular organismal development|regulation of transcription, DNA-dependent|spermatogenesis|transcription initiation from RNA polymerase II promoter	cytoplasm|transcription factor TFIID complex	binding			breast(1)	1						TGAGAAATGTCTGCTGTTTTA	0.378													11	221	---	---	---	---	capture	Missense_Mutation	SNP	100538449	100538449	TAF7L	23	C	G	G	G	1	0	0	0	0	1	0	0	0	416	32	4	4	15421	261
TAF7L	54457	broad.mit.edu	37	X	100538507	100538507	+	Missense_Mutation	SNP	C	G	G			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:100538507C>G	uc004ehb.2	-	4	480	c.468G>C	c.(466-468)TTG>TTC	p.L156F	TAF7L_uc004eha.2_Missense_Mutation_p.L70F|TAF7L_uc004ehc.1_Missense_Mutation_p.L70F	NM_024885	NP_079161	Q5H9L4	TAF7L_HUMAN	TATA box binding protein-associated factor, RNA	156					cell differentiation|multicellular organismal development|regulation of transcription, DNA-dependent|spermatogenesis|transcription initiation from RNA polymerase II promoter	cytoplasm|transcription factor TFIID complex	binding			breast(1)	1						TAACACAAGGCAAGTCAACCA	0.403													20	320	---	---	---	---	capture	Missense_Mutation	SNP	100538507	100538507	TAF7L	23	C	G	G	G	1	0	0	0	0	1	0	0	0	324	25	4	4	15421	261
KCNE1L	23630	broad.mit.edu	37	X	108868079	108868079	+	Silent	SNP	G	A	A			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:108868079G>A	uc004eoh.2	-	1	315	c.171C>T	c.(169-171)GAC>GAT	p.D57D		NM_012282	NP_036414	Q9UJ90	KCE1L_HUMAN	potassium voltage-gated channel, Isk-related	57					regulation of heart contraction	voltage-gated potassium channel complex					0						GATAGGCGTCGTCGCCCTTGG	0.652													18	43	---	---	---	---	capture	Silent	SNP	108868079	108868079	KCNE1L	23	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	7944	261
XPNPEP2	7512	broad.mit.edu	37	X	128890500	128890500	+	Missense_Mutation	SNP	A	C	C			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:128890500A>C	uc004eut.1	+	14	1580	c.1336A>C	c.(1336-1338)ATG>CTG	p.M446L		NM_003399	NP_003390	O43895	XPP2_HUMAN	X-prolyl aminopeptidase 2, membrane-bound	446					cellular process|proteolysis	anchored to membrane|plasma membrane	aminopeptidase activity|metal ion binding|metalloexopeptidase activity				0						CTCAGATGAGATGTACCTGCT	0.592													4	97	---	---	---	---	capture	Missense_Mutation	SNP	128890500	128890500	XPNPEP2	23	A	C	C	C	1	0	0	0	0	1	0	0	0	156	12	4	4	17324	261
MAGEC1	9947	broad.mit.edu	37	X	140994261	140994261	+	Silent	SNP	T	C	C	rs58302943	byFrequency	TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:140994261T>C	uc004fbt.2	+	4	1357	c.1071T>C	c.(1069-1071)TCT>TCC	p.S357S	MAGEC1_uc010nsl.1_Intron	NM_005462	NP_005453	O60732	MAGC1_HUMAN	melanoma antigen family C, 1	357							protein binding			ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4	Acute lymphoblastic leukemia(192;6.56e-05)					TCCAGAGTTCTCCTGAGAGTG	0.468										HNSCC(15;0.026)			5	284	---	---	---	---	capture	Silent	SNP	140994261	140994261	MAGEC1	23	T	C	C	C	1	0	0	0	0	0	0	0	1	691	54	3	3	9094	261
FLNA	2316	broad.mit.edu	37	X	153592699	153592699	+	Silent	SNP	G	A	A			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:153592699G>A	uc004fkk.2	-	14	2313	c.2064C>T	c.(2062-2064)GCC>GCT	p.A688A	FLNA_uc010nuu.1_Silent_p.A688A	NM_001110556	NP_001104026	P21333	FLNA_HUMAN	filamin A, alpha isoform 2	688	Filamin 5.				actin crosslink formation|actin cytoskeleton reorganization|cell junction assembly|cytoplasmic sequestering of protein|establishment of protein localization|inhibition of adenylate cyclase activity by dopamine receptor signaling pathway|negative regulation of protein catabolic process|negative regulation of sequence-specific DNA binding transcription factor activity|platelet activation|platelet degranulation|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of transcription factor import into nucleus|protein localization at cell surface|protein stabilization|receptor clustering	cell cortex|cytosol|extracellular region|nucleus|plasma membrane	actin filament binding|Fc-gamma receptor I complex binding|glycoprotein binding|GTP-Ral binding|protein homodimerization activity|Rac GTPase binding|signal transducer activity|transcription factor binding			breast(6)	6	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					GCTTGTTGACGGCCACACCTG	0.637													47	100	---	---	---	---	capture	Silent	SNP	153592699	153592699	FLNA	23	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	5877	261
SERPING1	710	broad.mit.edu	37	11	57365774	57365776	+	In_Frame_Del	DEL	CTG	-	-			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:57365774_57365776delCTG	uc001nkp.1	+	2	222_224	c.31_33delCTG	c.(31-33)CTGdel	p.L15del	SERPING1_uc001nkq.1_In_Frame_Del_p.L15del|SERPING1_uc010rju.1_Intron|SERPING1_uc010rjv.1_In_Frame_Del_p.L15del|SERPING1_uc001nkr.1_In_Frame_Del_p.L15del|SERPING1_uc009ymi.1_In_Frame_Del_p.L15del|SERPING1_uc009ymj.1_In_Frame_Del_p.L15del|SERPING1_uc001nks.1_5'UTR	NM_000062	NP_000053	P05155	IC1_HUMAN	serpin peptidase inhibitor, clade G, member 1	15					blood circulation|blood coagulation, intrinsic pathway|complement activation, classical pathway|innate immune response|negative regulation of complement activation, lectin pathway|platelet activation|platelet degranulation	extracellular space|platelet alpha granule lumen	protein binding|serine-type endopeptidase inhibitor activity			central_nervous_system(1)	1						GCTGACCCTCCTGCTGCTGCTGC	0.709									Hereditary_Angioedema				2	4	---	---	---	---	capture_indel	In_Frame_Del	DEL	57365774	57365776	SERPING1	11	CTG	-	-	-	1	0	1	0	1	0	0	0	0	311	24	5	5	14009	261
MTERFD3	80298	broad.mit.edu	37	12	107371558	107371559	+	Frame_Shift_Ins	INS	-	AT	AT			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:107371558_107371559insAT	uc001tme.1	-	2	2753_2754	c.934_935insAT	c.(934-936)TCCfs	p.S312fs	MTERFD3_uc001tmf.1_Frame_Shift_Ins_p.S312fs|MTERFD3_uc001tmg.1_Frame_Shift_Ins_p.S312fs|MTERFD3_uc001tmh.1_Frame_Shift_Ins_p.S312fs	NM_025198	NP_079474	Q49AM1	MTER3_HUMAN	transcription termination factor-like protein	312					regulation of transcription, DNA-dependent|transcription, DNA-dependent	mitochondrial nucleoid	transcription regulatory region DNA binding				0						CTGAGCTATGGAAATTCCTTCT	0.371													25	182	---	---	---	---	capture_indel	Frame_Shift_Ins	INS	107371558	107371559	MTERFD3	12	-	AT	AT	AT	1	0	1	1	0	0	0	0	0	533	41	5	5	9831	261
NF1	4763	broad.mit.edu	37	17	29654677	29654678	+	Frame_Shift_Ins	INS	-	C	C			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:29654677_29654678insC	uc002hgg.2	+	38	5762_5763	c.5429_5430insC	c.(5428-5430)CTCfs	p.L1810fs	NF1_uc002hgh.2_Frame_Shift_Ins_p.L1789fs|NF1_uc002hgi.1_Frame_Shift_Ins_p.L822fs|NF1_uc010cso.2_5'UTR	NM_001042492	NP_001035957	P21359	NF1_HUMAN	neurofibromin isoform 1	1810					actin cytoskeleton organization|adrenal gland development|artery morphogenesis|camera-type eye morphogenesis|cerebral cortex development|collagen fibril organization|forebrain astrocyte development|forebrain morphogenesis|heart development|liver development|MAPKKK cascade|metanephros development|myelination in peripheral nervous system|negative regulation of cell migration|negative regulation of endothelial cell proliferation|negative regulation of MAP kinase activity|negative regulation of MAPKKK cascade|negative regulation of neuroblast proliferation|negative regulation of oligodendrocyte differentiation|negative regulation of transcription factor import into nucleus|osteoblast differentiation|phosphatidylinositol 3-kinase cascade|pigmentation|positive regulation of adenylate cyclase activity|positive regulation of neuron apoptosis|Ras protein signal transduction|regulation of blood vessel endothelial cell migration|regulation of bone resorption|response to hypoxia|smooth muscle tissue development|spinal cord development|sympathetic nervous system development|visual learning|wound healing	axon|cytoplasm|dendrite|intrinsic to internal side of plasma membrane|nucleus	protein binding|Ras GTPase activator activity			soft_tissue(159)|central_nervous_system(56)|lung(28)|large_intestine(27)|haematopoietic_and_lymphoid_tissue(18)|ovary(18)|autonomic_ganglia(12)|breast(3)|skin(3)|stomach(2)|thyroid(1)|prostate(1)|kidney(1)|pancreas(1)	330		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		GGCACGCCGCTCACCTTCATGC	0.480			D|Mis|N|F|S|O		neurofibroma|glioma	neurofibroma|glioma			Neurofibromatosis_type_1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)			58	108	---	---	---	---	capture_indel	Frame_Shift_Ins	INS	29654677	29654678	NF1	17	-	C	C	C	1	0	1	1	0	0	0	0	0	702	54	5	5	10263	261
ZSCAN22	342945	broad.mit.edu	37	19	58850663	58850663	+	Frame_Shift_Del	DEL	T	-	-			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:58850663delT	uc002qsc.2	+	3	1594	c.1447delT	c.(1447-1449)TTGfs	p.L483fs	ZSCAN22_uc010yhz.1_3'UTR	NM_181846	NP_862829	P10073	ZSC22_HUMAN	zinc finger and SCAN domain containing 22	483	C2H2-type 8.				viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			pancreas(1)	1		all_cancers(17;3.11e-12)|all_epithelial(17;9.43e-09)|Colorectal(82;0.000256)|Lung NSC(17;0.000607)|all_lung(17;0.0024)|all_neural(62;0.0412)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0289)		GATGGTTCACTTGCGGATCCA	0.577													14	48	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	58850663	58850663	ZSCAN22	19	T	-	-	-	1	0	1	0	1	0	0	0	0	725	56	5	5	18110	261
RBM15B	29890	broad.mit.edu	37	3	51429849	51429850	+	Frame_Shift_Ins	INS	-	A	A			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:51429849_51429850insA	uc003dbd.2	+	1	1119_1120	c.1019_1020insA	c.(1018-1020)TTCfs	p.F340fs		NM_013286	NP_037418	Q8NDT2	RB15B_HUMAN	RNA binding motif protein 15B	340	RRM 2.				interspecies interaction between organisms|mRNA processing|regulation of alternative nuclear mRNA splicing, via spliceosome|regulation of transcription, DNA-dependent|RNA splicing|transcription, DNA-dependent	nucleoplasm	nucleotide binding|protein binding|RNA binding				0				BRCA - Breast invasive adenocarcinoma(193;0.000224)|Kidney(197;0.000539)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		CGCAACCTCTTCATTGGTAACC	0.609													26	73	---	---	---	---	capture_indel	Frame_Shift_Ins	INS	51429849	51429850	RBM15B	3	-	A	A	A	1	0	1	1	0	0	0	0	0	806	62	5	5	13012	261
TLR3	7098	broad.mit.edu	37	4	187003807	187003807	+	Frame_Shift_Del	DEL	A	-	-			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:187003807delA	uc003iyq.2	+	4	1068	c.967delA	c.(967-969)AATfs	p.N323fs	TLR3_uc011ckz.1_Frame_Shift_Del_p.N46fs|TLR3_uc003iyr.2_Frame_Shift_Del_p.N46fs	NM_003265	NP_003256	O15455	TLR3_HUMAN	toll-like receptor 3 precursor	323	Lumenal (Potential).|LRR 12.				activation of NF-kappaB-inducing kinase activity|cellular response to mechanical stimulus|defense response to bacterium|defense response to virus|detection of virus|hyperosmotic response|I-kappaB phosphorylation|inflammatory response|innate immune response|MyD88-independent toll-like receptor signaling pathway|negative regulation of osteoclast differentiation|positive regulation of chemokine production|positive regulation of interferon-alpha biosynthetic process|positive regulation of interferon-beta biosynthetic process|positive regulation of interferon-beta production|positive regulation of interferon-gamma biosynthetic process|positive regulation of interleukin-12 production|positive regulation of interleukin-6 production|positive regulation of interleukin-8 production|positive regulation of NF-kappaB import into nucleus|positive regulation of toll-like receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tumor necrosis factor production|toll-like receptor 3 signaling pathway	endoplasmic reticulum membrane|endosome membrane|integral to plasma membrane	double-stranded RNA binding|transmembrane receptor activity			ovary(2)|prostate(1)|lung(1)|breast(1)	5		all_cancers(14;4.27e-52)|all_epithelial(14;7.69e-39)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.0066)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|all_neural(102;0.243)		OV - Ovarian serous cystadenocarcinoma(60;1.47e-11)|BRCA - Breast invasive adenocarcinoma(30;1.14e-05)|GBM - Glioblastoma multiforme(59;0.000107)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.16)		CGGGCTTTTCAATGTGAGGTA	0.368													31	47	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	187003807	187003807	TLR3	4	A	-	-	-	1	0	1	0	1	0	0	0	0	65	5	5	5	15837	261
PIK3R1	5295	broad.mit.edu	37	5	67591259	67591261	+	In_Frame_Del	DEL	AAA	-	-			TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:67591259_67591261delAAA	uc003jva.2	+	14	2317_2319	c.1757_1759delAAA	c.(1756-1761)CAAAAA>CAA	p.K587del	PIK3R1_uc003jvb.2_In_Frame_Del_p.K587del|PIK3R1_uc003jvc.2_In_Frame_Del_p.K287del|PIK3R1_uc003jvd.2_In_Frame_Del_p.K317del|PIK3R1_uc003jve.2_In_Frame_Del_p.K266del|PIK3R1_uc011crb.1_In_Frame_Del_p.K257del	NM_181523	NP_852664	P27986	P85A_HUMAN	phosphoinositide-3-kinase, regulatory subunit 1	587					epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|growth hormone receptor signaling pathway|insulin receptor signaling pathway|insulin-like growth factor receptor signaling pathway|interspecies interaction between organisms|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol 3-kinase cascade|phosphatidylinositol phosphorylation|phosphatidylinositol-mediated signaling|platelet activation|positive regulation of establishment of protein localization in plasma membrane|positive regulation of glucose import|T cell costimulation|T cell receptor signaling pathway	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex	1-phosphatidylinositol binding|ErbB-3 class receptor binding|insulin binding|insulin receptor binding|insulin receptor substrate binding|insulin-like growth factor receptor binding|phosphatidylinositol 3-kinase regulator activity|protein phosphatase binding	p.M582_D605>I(4)|p.Y580fs*1(1)|p.?(1)		endometrium(34)|central_nervous_system(27)|large_intestine(20)|breast(7)|ovary(5)|haematopoietic_and_lymphoid_tissue(3)|lung(2)|urinary_tract(1)|skin(1)|pancreas(1)	101		Lung NSC(167;1.99e-05)|Prostate(74;0.00308)|Ovarian(174;0.00473)|Colorectal(97;0.0176)		OV - Ovarian serous cystadenocarcinoma(47;3.76e-51)|Lung(70;0.0211)	Isoproterenol(DB01064)	TGGTTGACTCAAAAAGGTGTTCG	0.355			Mis|F|O		gliobastoma|ovarian|colorectal					TCGA GBM(4;<1E-08)			14	43	---	---	---	---	capture_indel	In_Frame_Del	DEL	67591259	67591261	PIK3R1	5	AAA	-	-	-	1	0	1	0	1	0	0	0	0	65	5	5	5	11821	261
PIK3R1	5295	broad.mit.edu	37	5	67593227	67593245	+	Splice_Site	DEL	CTCTCCTCTCTAGGGTGGA	-	-	rs143771559	by1000genomes	TCGA-74-6575-01	TCGA-74-6575-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:67593227_67593245delCTCTCCTCTCTAGGGTGGA	uc003jva.2	+	16	2546	c.1986_splice	c.e16-1	p.V662_splice	PIK3R1_uc003jvb.2_Splice_Site_p.V662_splice|PIK3R1_uc003jvc.2_Splice_Site_p.V362_splice|PIK3R1_uc003jvd.2_Splice_Site_p.V392_splice|PIK3R1_uc003jve.2_Splice_Site_p.V341_splice	NM_181523	NP_852664	P27986	P85A_HUMAN	phosphoinositide-3-kinase, regulatory subunit 1						epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|growth hormone receptor signaling pathway|insulin receptor signaling pathway|insulin-like growth factor receptor signaling pathway|interspecies interaction between organisms|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol 3-kinase cascade|phosphatidylinositol phosphorylation|phosphatidylinositol-mediated signaling|platelet activation|positive regulation of establishment of protein localization in plasma membrane|positive regulation of glucose import|T cell costimulation|T cell receptor signaling pathway	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex	1-phosphatidylinositol binding|ErbB-3 class receptor binding|insulin binding|insulin receptor binding|insulin receptor substrate binding|insulin-like growth factor receptor binding|phosphatidylinositol 3-kinase regulator activity|protein phosphatase binding	p.?(1)		endometrium(34)|central_nervous_system(27)|large_intestine(20)|breast(7)|ovary(5)|haematopoietic_and_lymphoid_tissue(3)|lung(2)|urinary_tract(1)|skin(1)|pancreas(1)	101		Lung NSC(167;1.99e-05)|Prostate(74;0.00308)|Ovarian(174;0.00473)|Colorectal(97;0.0176)		OV - Ovarian serous cystadenocarcinoma(47;3.76e-51)|Lung(70;0.0211)	Isoproterenol(DB01064)	AGTTTTTCTTCTCTCCTCTCTAGGGTGGACGGCGAAGTA	0.356			Mis|F|O		gliobastoma|ovarian|colorectal					TCGA GBM(4;<1E-08)			19	89	---	---	---	---	capture_indel	Splice_Site	DEL	67593227	67593245	PIK3R1	5	CTCTCCTCTCTAGGGTGGA	-	-	-	1	0	1	0	1	0	0	1	0	404	32	5	5	11821	261
