Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
KIAA0090	23065	broad.mit.edu	37	1	19557342	19557342	+	Missense_Mutation	SNP	C	T	T			TCGA-74-6577-01	TCGA-74-6577-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:19557342C>T	uc001bbo.2	-	17	2103	c.2060G>A	c.(2059-2061)CGA>CAA	p.R687Q	KIAA0090_uc001bbp.2_Missense_Mutation_p.R686Q|KIAA0090_uc001bbq.2_Missense_Mutation_p.R686Q|KIAA0090_uc001bbr.2_Missense_Mutation_p.R665Q	NM_015047	NP_055862	Q8N766	K0090_HUMAN	hypothetical protein LOC23065 precursor	687	Extracellular (Potential).					integral to membrane	protein binding			ovary(1)	1		Colorectal(325;0.000147)|Renal(390;0.000469)|Breast(348;0.00366)|all_lung(284;0.00519)|Lung NSC(340;0.00544)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0707)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00492)|BRCA - Breast invasive adenocarcinoma(304;3.84e-05)|Kidney(64;0.000191)|KIRC - Kidney renal clear cell carcinoma(64;0.00274)|GBM - Glioblastoma multiforme(114;0.005)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0656)		TCCTACCTTTCGAAGCCGATA	0.502													14	233	---	---	---	---	capture	Missense_Mutation	SNP	19557342	19557342	KIAA0090	1	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	8075	262
HRNR	388697	broad.mit.edu	37	1	152185734	152185734	+	Missense_Mutation	SNP	C	T	T			TCGA-74-6577-01	TCGA-74-6577-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152185734C>T	uc001ezt.1	-	3	8447	c.8371G>A	c.(8371-8373)GGC>AGC	p.G2791S		NM_001009931	NP_001009931	Q86YZ3	HORN_HUMAN	hornerin	2791	30.				keratinization		calcium ion binding|protein binding			skin(2)|ovary(1)	3	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TGTCCTGAGCCAGACCCATGT	0.557													62	50	---	---	---	---	capture	Missense_Mutation	SNP	152185734	152185734	HRNR	1	C	T	T	T	1	0	0	0	0	1	0	0	0	273	21	2	2	7284	262
SOX13	9580	broad.mit.edu	37	1	204092264	204092265	+	Missense_Mutation	DNP	CC	AA	AA			TCGA-74-6577-01	TCGA-74-6577-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:204092264_204092265CC>AA	uc001ham.2	+	11	1754_1755	c.1159_1160CC>AA	c.(1159-1161)CCA>AAA	p.P387K	SOX13_uc010pqp.1_Missense_Mutation_p.P386K|SOX13_uc010pqq.1_Missense_Mutation_p.P254K	NM_005686	NP_005677	Q9UN79	SOX13_HUMAN	SRY-box 13	387					anatomical structure morphogenesis	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			breast(1)|central_nervous_system(1)	2	all_cancers(21;0.0754)|Breast(84;0.116)|all_epithelial(62;0.189)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.109)			GGACTCATCCCCAGCCAAGGAG	0.634													12	760	---	---	---	---	capture	Missense_Mutation	DNP	204092264	204092265	SOX13	1	CC	AA	AA	AA	1	0	0	0	0	1	0	0	0	286	22	4	4	14836	262
REN	5972	broad.mit.edu	37	1	204125330	204125330	+	Missense_Mutation	SNP	C	A	A			TCGA-74-6577-01	TCGA-74-6577-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:204125330C>A	uc001haq.2	-	8	980	c.936G>T	c.(934-936)TTG>TTT	p.L312F		NM_000537	NP_000528	P00797	RENI_HUMAN	renin preproprotein	312					angiotensin maturation|regulation of MAPKKK cascade	extracellular space|membrane	aspartic-type endopeptidase activity			skin(3)|central_nervous_system(1)	4	all_cancers(21;0.00965)|Breast(84;0.116)|all_epithelial(62;0.157)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.109)		Aliskiren(DB01258)|Remikiren(DB00212)	TCTTGGCTCCCAAGGCCTCCA	0.567													11	900	---	---	---	---	capture	Missense_Mutation	SNP	204125330	204125330	REN	1	C	A	A	A	1	0	0	0	0	1	0	0	0	272	21	4	4	13119	262
USH1C	10083	broad.mit.edu	37	11	17519716	17519716	+	Missense_Mutation	SNP	T	C	C			TCGA-74-6577-01	TCGA-74-6577-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:17519716T>C	uc001mnf.2	-	19	1692	c.1583A>G	c.(1582-1584)CAG>CGG	p.Q528R	USH1C_uc001mne.2_Missense_Mutation_p.Q828R|USH1C_uc009yhb.2_Missense_Mutation_p.Q509R|USH1C_uc001mng.2_RNA|USH1C_uc001mnd.2_Missense_Mutation_p.Q492R	NM_005709	NP_005700	Q9Y6N9	USH1C_HUMAN	harmonin isoform a	528	PDZ 3.				equilibrioception|G2/M transition of mitotic cell cycle|photoreceptor cell maintenance|sensory perception of sound	apical part of cell|cytoplasm|stereocilium	protein binding			ovary(1)	1						TACCCCGCCCTGATTCCAGGC	0.577													3	107	---	---	---	---	capture	Missense_Mutation	SNP	17519716	17519716	USH1C	11	T	C	C	C	1	0	0	0	0	1	0	0	0	715	55	3	3	16916	262
PRG2	5553	broad.mit.edu	37	11	57155245	57155245	+	Missense_Mutation	SNP	C	T	T			TCGA-74-6577-01	TCGA-74-6577-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:57155245C>T	uc001njz.2	-	4	619	c.592G>A	c.(592-594)GTG>ATG	p.V198M	PRG2_uc001njw.1_RNA|PRG2_uc001njx.1_RNA|PRG2_uc001njy.1_RNA|PRG2_uc001nka.2_Missense_Mutation_p.V198M|PRG2_uc001nkb.2_Missense_Mutation_p.V198M|PRG2_uc001nkd.2_Missense_Mutation_p.V187M|PRG2_uc001nkc.2_Missense_Mutation_p.V198M|PRG2_uc001nke.2_Missense_Mutation_p.V478M	NM_002728	NP_002719	P13727	PRG2_HUMAN	proteoglycan 2 preproprotein	198	C-type lectin.				defense response to bacterium|immune response	extracellular region|transport vesicle	heparin binding|sugar binding			central_nervous_system(1)	1				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	Sargramostim(DB00020)	CACAGGGCCACGCAGTGACCA	0.617													6	10	---	---	---	---	capture	Missense_Mutation	SNP	57155245	57155245	PRG2	11	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	12375	262
KRAS	3845	broad.mit.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	T	T	rs121913529		TCGA-74-6577-01	TCGA-74-6577-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:25398284C>T	uc001rgp.1	-	2	216	c.35G>A	c.(34-36)GGT>GAT	p.G12D	KRAS_uc001rgq.1_Missense_Mutation_p.G12D|KRAS_uc001rgr.2_RNA	NM_033360	NP_203524	P01116	RASK_HUMAN	c-K-ras2 protein isoform a precursor	12	GTP.		G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation).|G -> R (in lung cancer and bladder cancer; somatic mutation).|G -> S (in lung carcinoma and GASC; somatic mutation).|G -> A (in a colorectal cancer sample; somatic mutation).|G -> C (in lung carcinoma; somatic mutation).|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation).		activation of MAPKK activity|axon guidance|blood coagulation|epidermal growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|Ras protein signal transduction	plasma membrane	GTP binding|GTPase activity|protein binding	p.G12D(7175)|p.G12V(4780)|p.G12C(2482)|p.G12A(1180)|p.G12S(1119)|p.G12R(691)|p.G12?(50)|p.G12F(34)|p.G12N(6)|p.G12G(6)|p.G12L(5)|p.G12I(4)|p.G12_G13insG(4)|p.G12E(3)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12fs*3(1)		large_intestine(12391)|pancreas(3285)|lung(2847)|biliary_tract(521)|ovary(443)|endometrium(339)|haematopoietic_and_lymphoid_tissue(318)|stomach(203)|thyroid(149)|prostate(85)|soft_tissue(77)|small_intestine(62)|upper_aerodigestive_tract(59)|cervix(49)|urinary_tract(48)|skin(38)|liver(31)|breast(28)|testis(17)|oesophagus(15)|central_nervous_system(9)|peritoneum(6)|salivary_gland(6)|kidney(5)|gastrointestinal_tract_(site_indeterminate)(5)|thymus(5)|eye(4)|autonomic_ganglia(2)|bone(2)|genital_tract(1)|penis(1)|adrenal_gland(1)	21052	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12D(HPAC_PANCREAS)|G12V(SW403_LARGE_INTESTINE)|G12D(HPAFII_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12V(NCIH441_LUNG)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(PK1_PANCREAS)|G12V(KP3_PANCREAS)|G12D(PANC0813_PANCREAS)|G12A(SW1116_LARGE_INTESTINE)|G12D(LS180_LARGE_INTESTINE)|G12V(NCIH727_LUNG)|G12V(PATU8988S_PANCREAS)|G12V(CAPAN2_PANCREAS)|G12D(KP4_PANCREAS)|G12D(LS513_LARGE_INTESTINE)|G12D(SNUC2A_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(COLO668_LUNG)|G12D(COLO678_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12D(PANC0203_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(SW900_LUNG)|G12V(LCLC97TM1_LUNG)|G12V(SW620_LARGE_INTESTINE)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12V(SH10TC_STOMACH)|G12V(A498_KIDNEY)|G12D(PK59_PANCREAS)|G12D(HEC1A_ENDOMETRIUM)|G12D(PANC0504_PANCREAS)|G12V(SNGM_ENDOMETRIUM)|G12A(RERFLCAD1_LUNG)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12D(ASPC1_PANCREAS)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12V(RCM1_LARGE_INTESTINE)|G12V(CORL23_LUNG)|G12D(SW1990_PANCREAS)|G12D(HEYA8_OVARY)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12V(HUPT4_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(HEC50B_ENDOMETRIUM)|G12V(YAPC_PANCREAS)|G12V(NCIH2444_LUNG)|G12V(HCC56_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12V(DANG_PANCREAS)|G12V(SHP77_LUNG)|G12D(AGS_STOMACH)|G12D(SKLU1_LUNG)|G12V(QGP1_PANCREAS)|G12D(L33_PANCREAS)|G12V(PANC0327_PANCREAS)|G12D(PANC1_PANCREAS)|G12V(RKN_OVARY)|G12V(PATU8902_PANCREAS)	119	Mis		pancreatic|colorectal|lung|thyroid|AML|others				Cardiofaciocutaneous_syndrome|Noonan_syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)			9	25	---	---	---	---	capture	Missense_Mutation	SNP	25398284	25398284	KRAS	12	C	T	T	T	1	0	0	0	0	1	0	0	0	234	18	2	2	8358	262
AQP2	359	broad.mit.edu	37	12	50344911	50344911	+	Missense_Mutation	SNP	G	A	A			TCGA-74-6577-01	TCGA-74-6577-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:50344911G>A	uc001rvn.2	+	1	388	c.298G>A	c.(298-300)GGA>AGA	p.G100R		NM_000486	NP_000477	P41181	AQP2_HUMAN	aquaporin 2	100	Helical; (Potential).		G -> R (in ANDI).		cellular response to copper ion|cellular response to mercury ion|excretion	apical plasma membrane|integral to membrane|transport vesicle membrane	glycerol transmembrane transporter activity|water channel activity			ovary(2)	2						GGCTGTGGCCGGAGCCGCTCT	0.647													9	15	---	---	---	---	capture	Missense_Mutation	SNP	50344911	50344911	AQP2	12	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	819	262
NACA	4666	broad.mit.edu	37	12	57108166	57108166	+	Missense_Mutation	SNP	T	C	C			TCGA-74-6577-01	TCGA-74-6577-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:57108166T>C	uc001slz.2	-	4	563	c.214A>G	c.(214-216)AGT>GGT	p.S72G	NACA_uc001sly.2_Missense_Mutation_p.S72G|NACA_uc009zoy.1_Missense_Mutation_p.S1935G|NACA_uc001smc.2_Missense_Mutation_p.S72G|NACA_uc001sma.2_Missense_Mutation_p.S782G|NACA_uc001smb.2_Missense_Mutation_p.S72G|NACA_uc010squ.1_Intron	NM_001113201	NP_001106672	Q13765	NACA_HUMAN	nascent polypeptide-associated complex alpha	72	Required for DNA-binding (By similarity).|NAC-A/B.				interspecies interaction between organisms|protein transport|transcription, DNA-dependent|translation	nascent polypeptide-associated complex|nucleus	DNA binding			ovary(1)	1						TTCTTTTCACTCCGACTCTGT	0.358			T	BCL6	NHL								20	80	---	---	---	---	capture	Missense_Mutation	SNP	57108166	57108166	NACA	12	T	C	C	C	1	0	0	0	0	1	0	0	0	702	54	3	3	10043	262
OR4K2	390431	broad.mit.edu	37	14	20345324	20345324	+	Missense_Mutation	SNP	A	G	G			TCGA-74-6577-01	TCGA-74-6577-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:20345324A>G	uc001vwh.1	+	1	898	c.898A>G	c.(898-900)AAA>GAA	p.K300E		NM_001005501	NP_001005501	Q8NGD2	OR4K2_HUMAN	olfactory receptor, family 4, subfamily K,	300	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(2)	4	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		AGCCATGAGGAAACTGAAAAA	0.348													19	67	---	---	---	---	capture	Missense_Mutation	SNP	20345324	20345324	OR4K2	14	A	G	G	G	1	0	0	0	0	1	0	0	0	117	9	3	3	10976	262
TTC5	91875	broad.mit.edu	37	14	20760171	20760171	+	Missense_Mutation	SNP	G	A	A			TCGA-74-6577-01	TCGA-74-6577-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:20760171G>A	uc001vwt.2	-	9	1231	c.1174C>T	c.(1174-1176)CGG>TGG	p.R392W	TTC5_uc001vwu.2_Missense_Mutation_p.R249W	NM_138376	NP_612385	Q8N0Z6	TTC5_HUMAN	tetratricopeptide repeat domain 5	392					DNA repair	cytoplasm|nucleus	binding			ovary(1)	1	all_cancers(95;0.00092)		Epithelial(56;1.1e-06)|all cancers(55;8.07e-06)	GBM - Glioblastoma multiforme(265;0.0106)		CGGTGAAGCCGCAGGTTGGGC	0.453													10	31	---	---	---	---	capture	Missense_Mutation	SNP	20760171	20760171	TTC5	14	G	A	A	A	1	0	0	0	0	1	0	0	0	493	38	1	1	16593	262
LTB4R2	56413	broad.mit.edu	37	14	24779987	24779987	+	Silent	SNP	C	A	A			TCGA-74-6577-01	TCGA-74-6577-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:24779987C>A	uc001woq.1	+	1	1827	c.210C>A	c.(208-210)GGC>GGA	p.G70G	CIDEB_uc001won.2_5'Flank|CIDEB_uc001woo.2_5'UTR|CIDEB_uc001wop.2_5'UTR|LTB4R2_uc010alo.2_Silent_p.G39G|LTB4R2_uc001wor.2_Silent_p.G39G|LTB4R_uc001wos.2_5'Flank|LTB4R_uc010alp.2_5'Flank	NM_019839	NP_062813	Q9NPC1	LT4R2_HUMAN	leukotriene B4 receptor 2	70	Helical; Name=1; (Potential).				chemotaxis|negative regulation of adenylate cyclase activity	integral to plasma membrane					0				GBM - Glioblastoma multiforme(265;0.018)		CTGGCAACGGCTTCGTGGTGT	0.726													4	30	---	---	---	---	capture	Silent	SNP	24779987	24779987	LTB4R2	14	C	A	A	A	1	0	0	0	0	0	0	0	1	353	28	4	4	8987	262
BAZ1A	11177	broad.mit.edu	37	14	35331298	35331298	+	Missense_Mutation	SNP	C	T	T			TCGA-74-6577-01	TCGA-74-6577-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:35331298C>T	uc001wsk.2	-	3	912	c.344G>A	c.(343-345)CGA>CAA	p.R115Q	BAZ1A_uc001wsl.2_Missense_Mutation_p.R115Q|BAZ1A_uc001wsm.1_Missense_Mutation_p.R115Q	NM_013448	NP_038476	Q9NRL2	BAZ1A_HUMAN	bromodomain adjacent to zinc finger domain, 1A	115	WAC.|Required for association with the CHRAC1/POLE3 complex.|Required for interaction with NCOR1.				chromatin remodeling|regulation of transcription, DNA-dependent|transcription, DNA-dependent	ACF complex	zinc ion binding			lung(2)|central_nervous_system(2)|ovary(1)|breast(1)|skin(1)	7	Breast(36;0.0388)|Hepatocellular(127;0.158)		LUAD - Lung adenocarcinoma(48;7.23e-05)|Lung(238;0.00019)|Epithelial(34;0.0793)|all cancers(34;0.175)	GBM - Glioblastoma multiforme(112;0.0659)		GACAAAATATCGATCCTTGAC	0.358													38	93	---	---	---	---	capture	Missense_Mutation	SNP	35331298	35331298	BAZ1A	14	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	1318	262
GJD2	57369	broad.mit.edu	37	15	35045056	35045056	+	Missense_Mutation	SNP	G	A	A			TCGA-74-6577-01	TCGA-74-6577-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:35045056G>A	uc001zis.1	-	2	589	c.589C>T	c.(589-591)CGC>TGC	p.R197C	uc001zit.1_5'Flank	NM_020660	NP_065711	Q9UKL4	CXD2_HUMAN	gap junction protein, delta 2, 36kDa	197	Cytoplasmic (Potential).				synaptic transmission	connexon complex|integral to membrane	gap junction channel activity				0		all_lung(180;9.67e-07)		all cancers(64;2.75e-18)|GBM - Glioblastoma multiforme(113;1.9e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0156)		ATGTAGAAGCGGGAGATGCCT	0.483													38	62	---	---	---	---	capture	Missense_Mutation	SNP	35045056	35045056	GJD2	15	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	6354	262
BAHD1	22893	broad.mit.edu	37	15	40750942	40750942	+	Silent	SNP	G	A	A			TCGA-74-6577-01	TCGA-74-6577-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:40750942G>A	uc001zlu.2	+	2	350	c.279G>A	c.(277-279)CCG>CCA	p.P93P	BAHD1_uc001zlt.2_Silent_p.P93P|BAHD1_uc010bbp.1_Silent_p.P93P|BAHD1_uc001zlv.2_Silent_p.P93P	NM_014952	NP_055767	Q8TBE0	BAHD1_HUMAN	bromo adjacent homology domain containing 1	93					heterochromatin formation|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromatin silencing complex|chromosome	chromatin binding|DNA binding|protein binding				0		all_cancers(109;8.28e-19)|all_epithelial(112;2.64e-15)|Lung NSC(122;5.14e-11)|all_lung(180;1.27e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;3.46e-06)|BRCA - Breast invasive adenocarcinoma(123;0.08)		ATGAGCTACCGCCTGACCTGC	0.662													12	38	---	---	---	---	capture	Silent	SNP	40750942	40750942	BAHD1	15	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	1286	262
STRC	161497	broad.mit.edu	37	15	43893602	43893602	+	Missense_Mutation	SNP	T	C	C	rs141809944		TCGA-74-6577-01	TCGA-74-6577-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:43893602T>C	uc001zsf.2	-	24	4771	c.4693A>G	c.(4693-4695)ACC>GCC	p.T1565A	STRC_uc010bdl.2_Missense_Mutation_p.T792A|STRC_uc001zse.2_Missense_Mutation_p.T83A	NM_153700	NP_714544	Q7RTU9	STRC_HUMAN	stereocilin precursor	1565					sensory perception of sound	cell surface					0		all_cancers(109;3.26e-15)|all_epithelial(112;1.48e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.027)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.56e-07)		ACCTGAGTGGTGCTCCAGCCA	0.522													19	52	---	---	---	---	capture	Missense_Mutation	SNP	43893602	43893602	STRC	15	T	C	C	C	1	0	0	0	0	1	0	0	0	767	59	3	3	15218	262
SEC14L5	9717	broad.mit.edu	37	16	5058451	5058451	+	Silent	SNP	G	A	A			TCGA-74-6577-01	TCGA-74-6577-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:5058451G>A	uc002cye.2	+	14	1782	c.1602G>A	c.(1600-1602)TCG>TCA	p.S534S		NM_014692	NP_055507	O43304	S14L5_HUMAN	SEC14-like 5	534	GOLD.					integral to membrane|intracellular	transporter activity				0						AAGGAGAGTCGGTCATCACCT	0.642													8	13	---	---	---	---	capture	Silent	SNP	5058451	5058451	SEC14L5	16	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	13878	262
APPBP2	10513	broad.mit.edu	37	17	58603208	58603208	+	Missense_Mutation	SNP	G	A	A			TCGA-74-6577-01	TCGA-74-6577-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:58603208G>A	uc002iys.1	-	1	373	c.85C>T	c.(85-87)CGC>TGC	p.R29C	APPBP2_uc010ddl.1_5'UTR	NM_006380	NP_006371	Q92624	APBP2_HUMAN	amyloid beta precursor protein-binding protein	29					intracellular protein transport	cytoplasmic vesicle membrane|microtubule|microtubule associated complex|nucleus	microtubule motor activity|protein binding				0	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;3.67e-13)|all cancers(12;1.44e-11)|Colorectal(3;0.01)			ATGTCTCGGCGGGAGCGGATG	0.562													21	49	---	---	---	---	capture	Missense_Mutation	SNP	58603208	58603208	APPBP2	17	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	809	262
CD300LD	100131439	broad.mit.edu	37	17	72576247	72576247	+	Missense_Mutation	SNP	G	A	A			TCGA-74-6577-01	TCGA-74-6577-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:72576247G>A	uc002jkz.2	-	4	508	c.479C>T	c.(478-480)CCG>CTG	p.P160L		NM_001115152	NP_001108624	Q6UXZ3	CLM4_HUMAN	CD300 molecule-like family member d precursor	160	Extracellular (Potential).					integral to membrane|plasma membrane	receptor activity				0						GCTCTTGAGCGGGGACCTGTG	0.572													6	10	---	---	---	---	capture	Missense_Mutation	SNP	72576247	72576247	CD300LD	17	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	2971	262
SERPINB7	8710	broad.mit.edu	37	18	61471645	61471645	+	Missense_Mutation	SNP	C	T	T			TCGA-74-6577-01	TCGA-74-6577-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:61471645C>T	uc002ljl.2	+	8	1015	c.919C>T	c.(919-921)CTC>TTC	p.L307F	SERPINB7_uc002ljm.2_Missense_Mutation_p.L307F|SERPINB7_uc010xet.1_Missense_Mutation_p.L290F|SERPINB7_uc010dqg.2_Missense_Mutation_p.L307F	NM_001040147	NP_001035237	O75635	SPB7_HUMAN	serine (or cysteine) proteinase inhibitor, clade	307					regulation of proteolysis	cytoplasm	serine-type endopeptidase inhibitor activity			lung(2)|central_nervous_system(1)	3		Esophageal squamous(42;0.129)				CAAAGCAGATCTCTCTGGGAT	0.433													12	28	---	---	---	---	capture	Missense_Mutation	SNP	61471645	61471645	SERPINB7	18	C	T	T	T	1	0	0	0	0	1	0	0	0	416	32	2	2	13999	262
ATP9B	374868	broad.mit.edu	37	18	77037059	77037059	+	Missense_Mutation	SNP	G	A	A	rs149013492		TCGA-74-6577-01	TCGA-74-6577-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:77037059G>A	uc002lmx.2	+	13	1288	c.1274G>A	c.(1273-1275)CGT>CAT	p.R425H	ATP9B_uc002lmv.1_RNA|ATP9B_uc002lmw.1_Missense_Mutation_p.R425H|ATP9B_uc002lmy.1_RNA|ATP9B_uc002lmz.1_Missense_Mutation_p.R119H	NM_198531	NP_940933	O43861	ATP9B_HUMAN	ATPase, class II, type 9B	425	Helical; (Potential).				ATP biosynthetic process	integral to membrane	aminophospholipid transporter activity|ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|cation-transporting ATPase activity|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(3)	3		Esophageal squamous(42;0.018)|Melanoma(33;0.0964)|Prostate(75;0.171)		OV - Ovarian serous cystadenocarcinoma(15;1.44e-07)|BRCA - Breast invasive adenocarcinoma(31;0.0405)		GGCAGTTTGCGTGTGAACTTG	0.493													80	156	---	---	---	---	capture	Missense_Mutation	SNP	77037059	77037059	ATP9B	18	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	1190	262
S1PR2	9294	broad.mit.edu	37	19	10335447	10335447	+	Silent	SNP	G	A	A			TCGA-74-6577-01	TCGA-74-6577-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:10335447G>A	uc002mnl.2	-	2	246	c.135C>T	c.(133-135)TGC>TGT	p.C45C		NM_004230	NP_004221	O95136	S1PR2_HUMAN	endothelial differentiation, sphingolipid	45	Helical; Name=1; (By similarity).				activation of MAPK activity|positive regulation of cell proliferation	integral to membrane|plasma membrane	lipid binding|lysosphingolipid and lysophosphatidic acid receptor activity			lung(1)|central_nervous_system(1)	2						CCACAATGGCGCAACAGAGGA	0.567													49	112	---	---	---	---	capture	Silent	SNP	10335447	10335447	S1PR2	19	G	A	A	A	1	0	0	0	0	0	0	0	1	490	38	1	1	13686	262
CILP2	148113	broad.mit.edu	37	19	19655680	19655680	+	Missense_Mutation	SNP	C	T	T			TCGA-74-6577-01	TCGA-74-6577-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:19655680C>T	uc002nmv.3	+	8	2411	c.2326C>T	c.(2326-2328)CGT>TGT	p.R776C	CILP2_uc002nmw.3_Missense_Mutation_p.R782C	NM_153221	NP_694953	Q8IUL8	CILP2_HUMAN	cartilage intermediate layer protein 2	776						proteinaceous extracellular matrix	carbohydrate binding|carboxypeptidase activity			ovary(1)	1						CGCCAACCCCCGTGCCTGGGG	0.711													5	10	---	---	---	---	capture	Missense_Mutation	SNP	19655680	19655680	CILP2	19	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	3395	262
LILRA3	11026	broad.mit.edu	37	19	54803127	54803127	+	Missense_Mutation	SNP	C	T	T			TCGA-74-6577-01	TCGA-74-6577-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:54803127C>T	uc002qfd.2	-	4	615	c.550G>A	c.(550-552)GTG>ATG	p.V184M	LILRA6_uc002qew.1_Intron|LILRA3_uc010erk.2_Intron	NM_006865	NP_006856	Q8N6C8	LIRA3_HUMAN	leukocyte immunoglobulin-like receptor,	184	Ig-like C2-type 2.				defense response	extracellular region|plasma membrane	antigen binding|receptor activity			ovary(1)	1	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		ACGGGGCCCACGGAGAAGATG	0.567													37	89	---	---	---	---	capture	Missense_Mutation	SNP	54803127	54803127	LILRA3	19	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	8706	262
NLRP4	147945	broad.mit.edu	37	19	56382302	56382302	+	Missense_Mutation	SNP	G	A	A	rs140263319	by1000genomes	TCGA-74-6577-01	TCGA-74-6577-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:56382302G>A	uc002qmd.3	+	7	2886	c.2464G>A	c.(2464-2466)GAA>AAA	p.E822K	NLRP4_uc002qmf.2_Missense_Mutation_p.E747K|NLRP4_uc010etf.2_Missense_Mutation_p.E597K	NM_134444	NP_604393	Q96MN2	NALP4_HUMAN	NLR family, pyrin domain containing 4	822	LRR 5.						ATP binding			ovary(5)|skin(4)|lung(3)|upper_aerodigestive_tract(1)|kidney(1)|pancreas(1)	15		Colorectal(82;0.0002)|Ovarian(87;0.221)		GBM - Glioblastoma multiforme(193;0.0606)		CCTGAAGGACGAAGGACTGAA	0.512													22	54	---	---	---	---	capture	Missense_Mutation	SNP	56382302	56382302	NLRP4	19	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	10386	262
GLI2	2736	broad.mit.edu	37	2	121748070	121748070	+	Missense_Mutation	SNP	G	T	T			TCGA-74-6577-01	TCGA-74-6577-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:121748070G>T	uc010flp.2	+	13	4610	c.4580G>T	c.(4579-4581)GGT>GTT	p.G1527V	GLI2_uc002tmq.1_Intron|GLI2_uc002tmr.1_Intron|GLI2_uc002tmt.3_Missense_Mutation_p.G1199V|GLI2_uc002tmu.3_Missense_Mutation_p.G1182V	NM_005270	NP_005261	P10070	GLI2_HUMAN	GLI-Kruppel family member GLI2	1527					axon guidance|branching morphogenesis of a tube|cell proliferation|cerebellar cortex morphogenesis|developmental growth|embryonic digestive tract development|epidermal cell differentiation|floor plate formation|heart development|hindgut morphogenesis|kidney development|lung development|negative regulation of transcription from RNA polymerase II promoter|odontogenesis of dentine-containing tooth|osteoblast development|osteoblast differentiation|pituitary gland development|positive regulation of DNA replication|positive regulation of T cell differentiation in thymus|positive regulation of transcription from RNA polymerase II promoter|proximal/distal pattern formation|skeletal system development|smoothened signaling pathway involved in ventral spinal cord interneuron specification|spinal cord ventral commissure morphogenesis	nucleus|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|lung(2)|breast(1)|central_nervous_system(1)|pancreas(1)	13	Renal(3;0.0496)	Prostate(154;0.0623)				TTGTTCTCGGGTGCTCTGAGC	0.622													42	112	---	---	---	---	capture	Missense_Mutation	SNP	121748070	121748070	GLI2	2	G	T	T	T	1	0	0	0	0	1	0	0	0	572	44	4	4	6374	262
RBCK1	10616	broad.mit.edu	37	20	390566	390566	+	Missense_Mutation	SNP	G	A	A			TCGA-74-6577-01	TCGA-74-6577-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:390566G>A	uc002wdp.3	+	2	757	c.64G>A	c.(64-66)GGG>AGG	p.G22R	RBCK1_uc010zpl.1_Missense_Mutation_p.G22R|RBCK1_uc010zpm.1_RNA|RBCK1_uc002wdq.3_Intron|RBCK1_uc010fzy.2_RNA|RBCK1_uc002wdr.3_Intron|RBCK1_uc002wdo.2_RNA	NM_031229	NP_112506	Q9BYM8	HOIL1_HUMAN	RanBP-type and C3HC4-type zinc finger containing	22	Interaction with IRF3.|Interaction with TAB2.				interspecies interaction between organisms|negative regulation of NF-kappaB transcription factor activity|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|proteasomal ubiquitin-dependent protein catabolic process|protein linear polyubiquitination|T cell receptor signaling pathway	LUBAC complex	protein binding|ubiquitin binding|ubiquitin-protein ligase activity|zinc ion binding				0		all_epithelial(17;0.172)|Lung NSC(37;0.191)|Breast(17;0.231)				AGTGGCGGGCGGGGATGAACA	0.582													46	112	---	---	---	---	capture	Missense_Mutation	SNP	390566	390566	RBCK1	20	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	13002	262
SEMA3G	56920	broad.mit.edu	37	3	52475334	52475334	+	Silent	SNP	C	T	T			TCGA-74-6577-01	TCGA-74-6577-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:52475334C>T	uc003dea.1	-	7	759	c.759G>A	c.(757-759)TCG>TCA	p.S253S		NM_020163	NP_064548	Q9NS98	SEM3G_HUMAN	semaphorin sem2 precursor	253	Sema.				multicellular organismal development	extracellular region|membrane	receptor activity			ovary(2)	2				BRCA - Breast invasive adenocarcinoma(193;1.69e-05)|Kidney(197;0.00173)|KIRC - Kidney renal clear cell carcinoma(197;0.00196)|OV - Ovarian serous cystadenocarcinoma(275;0.0333)		CACCATCGGGCGAGGGGACCG	0.617													11	37	---	---	---	---	capture	Silent	SNP	52475334	52475334	SEMA3G	3	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	13923	262
UGT2B4	7363	broad.mit.edu	37	4	70346533	70346533	+	Missense_Mutation	SNP	C	T	T			TCGA-74-6577-01	TCGA-74-6577-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:70346533C>T	uc003hek.3	-	6	1453	c.1406G>A	c.(1405-1407)CGC>CAC	p.R469H	UGT2B4_uc011cap.1_Missense_Mutation_p.R333H|UGT2B4_uc003hel.3_3'UTR	NM_021139	NP_066962	P06133	UD2B4_HUMAN	UDP glucuronosyltransferase 2B4 precursor	469					estrogen catabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity			skin(2)	2						TCCTTTATGGCGCATGACAAA	0.473													37	138	---	---	---	---	capture	Missense_Mutation	SNP	70346533	70346533	UGT2B4	4	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	16843	262
NPR3	4883	broad.mit.edu	37	5	32774858	32774858	+	Silent	SNP	C	T	T	rs140897654	by1000genomes	TCGA-74-6577-01	TCGA-74-6577-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:32774858C>T	uc003jhv.2	+	4	1322	c.1104C>T	c.(1102-1104)TAC>TAT	p.Y368Y	NPR3_uc010iuo.2_Silent_p.Y152Y|NPR3_uc011cnz.1_Silent_p.Y152Y|NPR3_uc003jhu.2_Silent_p.Y368Y	NM_000908	NP_000899	P17342	ANPRC_HUMAN	natriuretic peptide receptor C/guanylate cyclase	368	Extracellular (Potential).				osteoclast proliferation|positive regulation of urine volume|regulation of blood pressure|regulation of osteoblast proliferation|skeletal system development	integral to membrane	hormone binding|natriuretic peptide receptor activity			ovary(1)|central_nervous_system(1)	2					Nesiritide(DB04899)	TCCTCCTCTACGTCTTGGCTC	0.443													73	165	---	---	---	---	capture	Silent	SNP	32774858	32774858	NPR3	5	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	10503	262
STK32A	202374	broad.mit.edu	37	5	146750222	146750222	+	Silent	SNP	G	A	A			TCGA-74-6577-01	TCGA-74-6577-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:146750222G>A	uc010jgn.1	+	9	946	c.666G>A	c.(664-666)CCG>CCA	p.P222P	STK32A_uc003lom.2_Silent_p.P222P|STK32A_uc011dbw.1_Silent_p.P222P	NM_001112724	NP_001106195	Q8WU08	ST32A_HUMAN	serine/threonine kinase 32A isoform 1	222	Protein kinase.						ATP binding|metal ion binding|protein serine/threonine kinase activity			lung(2)|skin(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTAAGAGACCGTATCATATTC	0.378													42	100	---	---	---	---	capture	Silent	SNP	146750222	146750222	STK32A	5	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	15187	262
ABLIM3	22885	broad.mit.edu	37	5	148619445	148619445	+	Missense_Mutation	SNP	C	T	T			TCGA-74-6577-01	TCGA-74-6577-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:148619445C>T	uc003lpy.2	+	13	1449	c.1198C>T	c.(1198-1200)CGC>TGC	p.R400C	ABLIM3_uc003lpz.1_Missense_Mutation_p.R400C|ABLIM3_uc003lqa.1_Missense_Mutation_p.R346C|ABLIM3_uc003lqb.2_Missense_Mutation_p.R338C|ABLIM3_uc003lqc.1_Missense_Mutation_p.R400C|ABLIM3_uc003lqd.1_Missense_Mutation_p.R338C|ABLIM3_uc003lqf.2_Missense_Mutation_p.R338C|ABLIM3_uc003lqe.1_Missense_Mutation_p.R338C	NM_014945	NP_055760	O94929	ABLM3_HUMAN	actin binding LIM protein family, member 3	400					axon guidance|cytoskeleton organization	cytoplasm	actin binding|zinc ion binding			ovary(2)|skin(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCACTACTACCGCTCTGGTAA	0.647													15	45	---	---	---	---	capture	Missense_Mutation	SNP	148619445	148619445	ABLIM3	5	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	96	262
PKD1L1	168507	broad.mit.edu	37	7	47869692	47869692	+	Silent	SNP	C	T	T			TCGA-74-6577-01	TCGA-74-6577-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:47869692C>T	uc003tny.1	-	43	6504	c.6504G>A	c.(6502-6504)CTG>CTA	p.L2168L	C7orf69_uc003toa.1_Intron|PKD1L1_uc003tob.2_5'Flank	NM_138295	NP_612152	Q8TDX9	PK1L1_HUMAN	polycystin-1L1	2168	Extracellular (Potential).				cell-cell adhesion	integral to membrane				ovary(8)|upper_aerodigestive_tract(2)|breast(1)	11						ACAGCAGGTGCAGCCACTGCA	0.577													17	102	---	---	---	---	capture	Silent	SNP	47869692	47869692	PKD1L1	7	C	T	T	T	1	0	0	0	0	0	0	0	1	314	25	2	2	11867	262
ZP3	7784	broad.mit.edu	37	7	76054396	76054396	+	Missense_Mutation	SNP	G	A	A			TCGA-74-6577-01	TCGA-74-6577-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:76054396G>A	uc003ufd.3	+	1	125	c.115G>A	c.(115-117)GTA>ATA	p.V39I	ZP3_uc003ufc.3_5'UTR	NM_001110354	NP_001103824	P21754	ZP3_HUMAN	zona pellucida glycoprotein 3 isoform 1	39	Extracellular (Potential).				binding of sperm to zona pellucida|blastocyst formation|egg coat formation|humoral immune response mediated by circulating immunoglobulin|intracellular protein transport|negative regulation of binding of sperm to zona pellucida|negative regulation of transcription, DNA-dependent|oocyte development|phosphatidylinositol-mediated signaling|positive regulation of acrosomal vesicle exocytosis|positive regulation of acrosome reaction|positive regulation of antral ovarian follicle growth|positive regulation of calcium ion import|positive regulation of calcium ion transport via store-operated calcium channel activity|positive regulation of humoral immune response|positive regulation of interferon-gamma production|positive regulation of interleukin-4 production|positive regulation of leukocyte migration|positive regulation of ovarian follicle development|positive regulation of phosphatidylinositol biosynthetic process|positive regulation of protein kinase activity|positive regulation of protein kinase B signaling cascade|positive regulation of T cell proliferation|positive regulation of transcription, DNA-dependent|positive regulation of type IV hypersensitivity|protein kinase C signaling cascade	endoplasmic reticulum|extracellular space|Golgi apparatus|integral to membrane|multivesicular body|outer acrosomal membrane|perinuclear region of cytoplasm|plasma membrane|proteinaceous extracellular matrix	acrosin binding|manganese ion transmembrane transporter activity|receptor activity|sugar binding				0						TGAGACGTCCGTACAGCCCGT	0.592													10	39	---	---	---	---	capture	Missense_Mutation	SNP	76054396	76054396	ZP3	7	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	18093	262
RBM28	55131	broad.mit.edu	37	7	127954955	127954956	+	Missense_Mutation	DNP	GG	TT	TT			TCGA-74-6577-01	TCGA-74-6577-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:127954955_127954956GG>TT	uc003vmp.2	-	17	2021_2022	c.1906_1907CC>AA	c.(1906-1908)CCA>AAA	p.P636K	RBM28_uc003vmo.2_Missense_Mutation_p.P178K|RBM28_uc011koj.1_Missense_Mutation_p.P495K	NM_018077	NP_060547	Q9NW13	RBM28_HUMAN	RNA binding motif protein 28	636					mRNA processing|RNA splicing	Golgi apparatus|nucleolus|spliceosomal complex	nucleotide binding|RNA binding			ovary(2)	2						CTTCTGCTCTGGGGGCACCTTG	0.564													8	416	---	---	---	---	capture	Missense_Mutation	DNP	127954955	127954956	RBM28	7	GG	TT	TT	TT	1	0	0	0	0	1	0	0	0	611	47	4	4	13023	262
MLL3	58508	broad.mit.edu	37	7	151945253	151945253	+	Missense_Mutation	SNP	C	T	T			TCGA-74-6577-01	TCGA-74-6577-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:151945253C>T	uc003wla.2	-	14	2485	c.2266G>A	c.(2266-2268)GGA>AGA	p.G756R		NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3	756					intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)		GATTTGCCTCCTTGGTATGAA	0.393			N		medulloblastoma								36	207	---	---	---	---	capture	Missense_Mutation	SNP	151945253	151945253	MLL3	7	C	T	T	T	1	0	0	0	0	1	0	0	0	312	24	2	2	9534	262
PTPRN2	5799	broad.mit.edu	37	7	157985120	157985120	+	Missense_Mutation	SNP	C	T	T			TCGA-74-6577-01	TCGA-74-6577-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:157985120C>T	uc003wno.2	-	5	569	c.448G>A	c.(448-450)GCC>ACC	p.A150T	PTPRN2_uc003wnp.2_Missense_Mutation_p.A133T|PTPRN2_uc003wnq.2_Missense_Mutation_p.A150T|PTPRN2_uc003wnr.2_Missense_Mutation_p.A112T|PTPRN2_uc011kwa.1_Missense_Mutation_p.A173T	NM_002847	NP_002838	Q92932	PTPR2_HUMAN	protein tyrosine phosphatase, receptor type, N	150	Extracellular (Potential).					integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(4)|large_intestine(1)|pleura(1)|skin(1)	7	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)		CGTCGGAGGGCGTTGGCCAGG	0.652													26	82	---	---	---	---	capture	Missense_Mutation	SNP	157985120	157985120	PTPRN2	7	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	12703	262
VPS13B	157680	broad.mit.edu	37	8	100821739	100821739	+	Missense_Mutation	SNP	T	C	C			TCGA-74-6577-01	TCGA-74-6577-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:100821739T>C	uc003yiv.2	+	44	8264	c.8153T>C	c.(8152-8154)CTC>CCC	p.L2718P	VPS13B_uc003yiw.2_Missense_Mutation_p.L2693P	NM_017890	NP_060360	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13B isoform 5	2718					protein transport					ovary(7)|skin(4)|lung(3)|central_nervous_system(2)|pancreas(2)|breast(1)|kidney(1)	20	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			GTTCAGCAACTCAATGGAGTA	0.383													3	58	---	---	---	---	capture	Missense_Mutation	SNP	100821739	100821739	VPS13B	8	T	C	C	C	1	0	0	0	0	1	0	0	0	702	54	3	3	17072	262
PRUNE2	158471	broad.mit.edu	37	9	79324782	79324782	+	Missense_Mutation	SNP	A	T	T			TCGA-74-6577-01	TCGA-74-6577-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:79324782A>T	uc010mpk.2	-	8	2532	c.2408T>A	c.(2407-2409)TTT>TAT	p.F803Y		NM_015225	NP_056040	Q8WUY3	PRUN2_HUMAN	prune homolog 2	803					apoptosis|G1 phase|induction of apoptosis	cytoplasm	metal ion binding|pyrophosphatase activity				0						TTCTTTACCAAATGCACTCCA	0.517													10	21	---	---	---	---	capture	Missense_Mutation	SNP	79324782	79324782	PRUNE2	9	A	T	T	T	1	0	0	0	0	1	0	0	0	13	1	4	4	12536	262
SVEP1	79987	broad.mit.edu	37	9	113171158	113171158	+	Missense_Mutation	SNP	G	A	A			TCGA-74-6577-01	TCGA-74-6577-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:113171158G>A	uc010mtz.2	-	38	7059	c.6722C>T	c.(6721-6723)CCT>CTT	p.P2241L	SVEP1_uc010mty.2_Missense_Mutation_p.P167L	NM_153366	NP_699197	Q4LDE5	SVEP1_HUMAN	polydom	2241	Sushi 14.				cell adhesion	cytoplasm|extracellular region|membrane	calcium ion binding			ovary(7)	7						GACAAATACAGGACTTCCGAC	0.507													47	142	---	---	---	---	capture	Missense_Mutation	SNP	113171158	113171158	SVEP1	9	G	A	A	A	1	0	0	0	0	1	0	0	0	455	35	2	2	15308	262
C9orf84	158401	broad.mit.edu	37	9	114475419	114475419	+	Missense_Mutation	SNP	C	G	G			TCGA-74-6577-01	TCGA-74-6577-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:114475419C>G	uc004bfr.2	-	16	2392	c.2257G>C	c.(2257-2259)GAA>CAA	p.E753Q	C9orf84_uc011lwt.1_RNA|C9orf84_uc004bfq.2_Missense_Mutation_p.E714Q|C9orf84_uc010mug.2_Missense_Mutation_p.E664Q	NM_173521	NP_775792	Q5VXU9	CI084_HUMAN	hypothetical protein LOC158401 isoform 1	753										ovary(2)	2						AAATGTTTTTCACCGTCTGAG	0.259													12	18	---	---	---	---	capture	Missense_Mutation	SNP	114475419	114475419	C9orf84	9	C	G	G	G	1	0	0	0	0	1	0	0	0	377	29	4	4	2476	262
PAPPA	5069	broad.mit.edu	37	9	118982397	118982397	+	Silent	SNP	T	C	C			TCGA-74-6577-01	TCGA-74-6577-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:118982397T>C	uc004bjn.2	+	5	2481	c.2100T>C	c.(2098-2100)CAT>CAC	p.H700H	PAPPA_uc011lxp.1_Silent_p.H395H|PAPPA_uc011lxq.1_Intron	NM_002581	NP_002572	Q13219	PAPP1_HUMAN	pregnancy-associated plasma protein A	700					cell differentiation|female pregnancy	cytoplasm|extracellular region|membrane	metalloendopeptidase activity|zinc ion binding			ovary(4)|skin(4)|pancreas(1)	9						TAGATGGCCATTTCTTTGAAA	0.547													31	86	---	---	---	---	capture	Silent	SNP	118982397	118982397	PAPPA	9	T	C	C	C	1	0	0	0	0	0	0	0	1	673	52	3	3	11336	262
FAM47C	442444	broad.mit.edu	37	X	37027712	37027712	+	Missense_Mutation	SNP	G	A	A			TCGA-74-6577-01	TCGA-74-6577-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:37027712G>A	uc004ddl.1	+	1	1243	c.1229G>A	c.(1228-1230)CGC>CAC	p.R410H		NM_001013736	NP_001013758	Q5HY64	FA47C_HUMAN	hypothetical protein LOC442444	410										ovary(3)	3						CCCAAGACTCGCATATCTAAT	0.607													35	17	---	---	---	---	capture	Missense_Mutation	SNP	37027712	37027712	FAM47C	23	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	5519	262
STAG2	10735	broad.mit.edu	37	X	123197784	123197784	+	Nonsense_Mutation	SNP	C	G	G			TCGA-74-6577-01	TCGA-74-6577-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:123197784C>G	uc004etz.3	+	19	2247	c.1908C>G	c.(1906-1908)TAC>TAG	p.Y636*	STAG2_uc004eua.2_Nonsense_Mutation_p.Y636*|STAG2_uc004eub.2_Nonsense_Mutation_p.Y636*|STAG2_uc004euc.2_Nonsense_Mutation_p.Y636*|STAG2_uc004eud.2_Nonsense_Mutation_p.Y636*|STAG2_uc004eue.2_Nonsense_Mutation_p.Y636*	NM_006603	NP_006594	Q8N3U4	STAG2_HUMAN	stromal antigen 2 isoform b	636					cell division|meiosis|mitotic metaphase/anaphase transition|mitotic prometaphase|negative regulation of DNA endoreduplication|sister chromatid cohesion	chromatin|chromosome, centromeric region|nucleoplasm	protein binding			ovary(4)|skin(1)	5						CTAAAACTTACCATGCACTCT	0.363													23	18	---	---	---	---	capture	Nonsense_Mutation	SNP	123197784	123197784	STAG2	23	C	G	G	G	1	0	0	0	0	0	1	0	0	233	18	5	4	15133	262
FRMD7	90167	broad.mit.edu	37	X	131216403	131216403	+	Missense_Mutation	SNP	C	A	A			TCGA-74-6577-01	TCGA-74-6577-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:131216403C>A	uc004ewn.2	-	9	1071	c.893G>T	c.(892-894)AGT>ATT	p.S298I	FRMD7_uc011muy.1_Missense_Mutation_p.S283I	NM_194277	NP_919253	Q6ZUT3	FRMD7_HUMAN	FERM domain containing 7	298					regulation of neuron projection development	cytoskeleton|growth cone|neuronal cell body	binding			skin(1)	1	Acute lymphoblastic leukemia(192;0.000127)					ATAGCGGAAACTGGAACCCTT	0.448													36	250	---	---	---	---	capture	Missense_Mutation	SNP	131216403	131216403	FRMD7	23	C	A	A	A	1	0	0	0	0	1	0	0	0	260	20	4	4	5998	262
PTEN	5728	broad.mit.edu	37	10	89720855	89720856	+	Frame_Shift_Ins	INS	-	A	A			TCGA-74-6577-01	TCGA-74-6577-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:89720855_89720856insA	uc001kfb.2	+	9	2037_2038	c.1006_1007insA	c.(1006-1008)TACfs	p.Y336fs		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog	336	C2 tensin-type.			Y->F: Significantly lower phosphatase activity, reduced protein stability and decreased growth-inhibitory effect.	activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.R55fs*1(4)|p.Y336*(3)|p.?(2)|p.N212fs*1(2)|p.Y27fs*1(2)|p.R335fs*8(1)|p.G165_*404del(1)|p.G165_K342del(1)|p.R335fs*4(1)|p.R335fs*7(1)|p.W274_F341del(1)|p.Y336F(1)|p.D326_K342del(1)		endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		AGCCAACCGATACTTTTCTCCA	0.337		31	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			37	52	---	---	---	---	capture_indel	Frame_Shift_Ins	INS	89720855	89720856	PTEN	10	-	A	A	A	1	0	1	1	0	0	0	0	0	637	49	5	5	12633	262
COL18A1	80781	broad.mit.edu	37	21	46897864	46897864	+	Frame_Shift_Del	DEL	A	-	-			TCGA-74-6577-01	TCGA-74-6577-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:46897864delA	uc011afs.1	+	7	2472	c.2451delA	c.(2449-2451)GGAfs	p.G817fs	COL18A1_uc002zhg.2_Frame_Shift_Del_p.G402fs|COL18A1_uc002zhi.2_Frame_Shift_Del_p.G582fs	NM_130444	NP_569711	P39060	COIA1_HUMAN	alpha 1 type XVIII collagen isoform 3 precursor	817	Triple-helical region 2 (COL2).				cell adhesion|negative regulation of cell proliferation|organ morphogenesis|visual perception	collagen|extracellular space	extracellular matrix structural constituent|metal ion binding|protein binding			central_nervous_system(1)	1				Colorectal(79;0.0157)|READ - Rectum adenocarcinoma(84;0.0929)		GCACCCCTGGAAGGGACGGCG	0.726													2	4	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	46897864	46897864	COL18A1	21	A	-	-	-	1	0	1	0	1	0	0	0	0	106	9	5	5	3640	262
MYO6	4646	broad.mit.edu	37	6	76566831	76566834	+	Frame_Shift_Del	DEL	AGCA	-	-			TCGA-74-6577-01	TCGA-74-6577-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:76566831_76566834delAGCA	uc003pih.1	+	13	1520_1523	c.1241_1244delAGCA	c.(1240-1245)GAGCAAfs	p.E414fs	MYO6_uc003pig.1_Frame_Shift_Del_p.E414fs|MYO6_uc003pii.1_Frame_Shift_Del_p.E414fs	NM_004999	NP_004990	Q9UM54	MYO6_HUMAN	myosin VI	414_415	Myosin head-like.				actin filament-based movement|DNA damage response, signal transduction by p53 class mediator|endocytosis|intracellular protein transport|positive regulation of transcription from RNA polymerase II promoter|regulation of secretion|sensory perception of sound|synaptic transmission	cell cortex|clathrin coated vesicle membrane|coated pit|cytosol|DNA-directed RNA polymerase II, holoenzyme|filamentous actin|Golgi apparatus|nuclear membrane|perinuclear region of cytoplasm|ruffle membrane|unconventional myosin complex	actin filament binding|ADP binding|ATP binding|calmodulin binding|minus-end directed microfilament motor activity|protein binding			kidney(1)|pancreas(1)	2		all_hematologic(105;0.189)		BRCA - Breast invasive adenocarcinoma(397;0.223)		CTGAAAGTGGAGCAAGCAAACAAT	0.377													25	57	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	76566831	76566834	MYO6	6	AGCA	-	-	-	1	0	1	0	1	0	0	0	0	143	11	5	5	9991	262
DDX3X	1654	broad.mit.edu	37	X	41206682	41206683	+	In_Frame_Ins	INS	-	AGC	AGC			TCGA-74-6577-01	TCGA-74-6577-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:41206682_41206683insAGC	uc004dfe.2	+	16	2742_2743	c.1887_1888insAGC	c.(1885-1890)insAGC	p.631_632insS	DDX3X_uc004dff.2_In_Frame_Ins_p.630_631insS|DDX3X_uc011mkq.1_In_Frame_Ins_p.615_616insS|DDX3X_uc011mkr.1_In_Frame_Ins_p.501_502insS|DDX3X_uc011mks.1_Intron|DDX3X_uc004dfg.2_RNA	NM_001356	NP_001347	O00571	DDX3X_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 3	631_632	Gly/Ser-rich.				interspecies interaction between organisms	cytoplasm|nuclear speck	ATP binding|ATP-dependent RNA helicase activity|DNA binding|protein binding|RNA binding			ovary(2)|breast(2)|central_nervous_system(1)|skin(1)	6						gtggccacggtagcagcagAGG	0.228										HNSCC(61;0.18)			18	19	---	---	---	---	capture_indel	In_Frame_Ins	INS	41206682	41206683	DDX3X	23	-	AGC	AGC	AGC	1	0	1	1	0	0	0	0	0	730	57	5	5	4316	262
