Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
CCDC27	148870	broad.mit.edu	37	1	3687985	3687985	+	Silent	SNP	C	T	T			TCGA-74-6584-01	TCGA-74-6584-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:3687985C>T	uc001akv.2	+	12	1950	c.1869C>T	c.(1867-1869)AGC>AGT	p.S623S	LOC388588_uc001akw.3_5'Flank	NM_152492	NP_689705	Q2M243	CCD27_HUMAN	coiled-coil domain containing 27	623										skin(1)	1	all_cancers(77;0.0385)|Ovarian(185;0.0634)|Lung NSC(156;0.21)|all_lung(157;0.218)	all_epithelial(116;5.52e-17)|all_lung(118;1.04e-06)|Lung NSC(185;0.000214)|Renal(390;0.00357)|Breast(487;0.00446)|Hepatocellular(190;0.0218)|Lung SC(97;0.0367)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.127)		Epithelial(90;1.11e-38)|OV - Ovarian serous cystadenocarcinoma(86;1.35e-22)|GBM - Glioblastoma multiforme(42;3.46e-16)|Colorectal(212;1.17e-05)|COAD - Colon adenocarcinoma(227;5.76e-05)|Kidney(185;0.00036)|BRCA - Breast invasive adenocarcinoma(365;0.000696)|KIRC - Kidney renal clear cell carcinoma(229;0.00558)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.203)		CAGAGAGAAGCGACTACTATA	0.547													35	90	---	---	---	---	capture	Silent	SNP	3687985	3687985	CCDC27	1	C	T	T	T	1	0	0	0	0	0	0	0	1	350	27	1	1	2775	264
TINAGL1	64129	broad.mit.edu	37	1	32049166	32049166	+	Missense_Mutation	SNP	A	C	C			TCGA-74-6584-01	TCGA-74-6584-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:32049166A>C	uc001bta.2	+	5	698	c.572A>C	c.(571-573)CAT>CCT	p.H191P	TINAGL1_uc001bsz.2_Missense_Mutation_p.H46P|TINAGL1_uc010ogj.1_Missense_Mutation_p.H160P|TINAGL1_uc010ogk.1_Missense_Mutation_p.H191P	NM_022164	NP_071447	Q9GZM7	TINAL_HUMAN	tubulointerstitial nephritis antigen-like 1	191					endosome transport|immune response|proteolysis	extracellular region	cysteine-type endopeptidase activity|extracellular matrix structural constituent|polysaccharide binding|scavenger receptor activity				0		Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		STAD - Stomach adenocarcinoma(196;0.0526)|READ - Rectum adenocarcinoma(331;0.145)		ATGAACATGCATGAAATTTAT	0.582													10	12	---	---	---	---	capture	Missense_Mutation	SNP	32049166	32049166	TINAGL1	1	A	C	C	C	1	0	0	0	0	1	0	0	0	104	8	4	4	15807	264
RORC	6097	broad.mit.edu	37	1	151789175	151789175	+	Missense_Mutation	SNP	A	G	G			TCGA-74-6584-01	TCGA-74-6584-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:151789175A>G	uc001ezh.2	-	4	371	c.263T>C	c.(262-264)CTG>CCG	p.L88P	RORC_uc001ezg.2_Missense_Mutation_p.L67P|RORC_uc010pdo.1_Missense_Mutation_p.L142P|RORC_uc010pdp.1_Missense_Mutation_p.L88P	NM_005060	NP_005051	P51449	RORG_HUMAN	RAR-related orphan receptor C isoform a	88	NR C4-type.|Nuclear receptor.				regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)|skin(1)	2	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		LUSC - Lung squamous cell carcinoma(543;0.181)			GCATTTCTGCAGGCGGCAGTG	0.662													3	19	---	---	---	---	capture	Missense_Mutation	SNP	151789175	151789175	RORC	1	A	G	G	G	1	0	0	0	0	1	0	0	0	91	7	3	3	13422	264
HRNR	388697	broad.mit.edu	37	1	152185788	152185788	+	Missense_Mutation	SNP	C	T	T			TCGA-74-6584-01	TCGA-74-6584-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152185788C>T	uc001ezt.1	-	3	8393	c.8317G>A	c.(8317-8319)GGC>AGC	p.G2773S		NM_001009931	NP_001009931	Q86YZ3	HORN_HUMAN	hornerin	2773	30.				keratinization		calcium ion binding|protein binding			skin(2)|ovary(1)	3	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CCGTGTCGGCCGTGGCTAAGA	0.602													64	32	---	---	---	---	capture	Missense_Mutation	SNP	152185788	152185788	HRNR	1	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	7284	264
CEP350	9857	broad.mit.edu	37	1	180062525	180062525	+	Missense_Mutation	SNP	T	A	A			TCGA-74-6584-01	TCGA-74-6584-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:180062525T>A	uc001gnt.2	+	34	7668	c.7285T>A	c.(7285-7287)TTT>ATT	p.F2429I	CEP350_uc009wxl.2_Missense_Mutation_p.F2428I|CEP350_uc001gnv.2_Missense_Mutation_p.F564I|CEP350_uc001gnw.1_Missense_Mutation_p.F186I|CEP350_uc001gnx.1_Missense_Mutation_p.F186I	NM_014810	NP_055625	Q5VT06	CE350_HUMAN	centrosome-associated protein 350	2429						centrosome|nucleus|spindle				ovary(4)	4						AGCCACTAGCTTTGGTAGTAA	0.453													10	15	---	---	---	---	capture	Missense_Mutation	SNP	180062525	180062525	CEP350	1	T	A	A	A	1	0	0	0	0	1	0	0	0	728	56	4	4	3222	264
C10orf79	80217	broad.mit.edu	37	10	105906078	105906078	+	Silent	SNP	A	G	G			TCGA-74-6584-01	TCGA-74-6584-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:105906078A>G	uc001kxw.2	-	30	3914	c.3798T>C	c.(3796-3798)TCT>TCC	p.S1266S	C10orf79_uc009xxq.2_Intron	NM_025145	NP_079421	Q8NDM7	WDR96_HUMAN	hypothetical protein LOC80217	1266											0		Colorectal(252;0.178)		Epithelial(162;4.83e-10)|all cancers(201;2.26e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0194)		GGTCTTCTCTAGATTTCCGAA	0.418													9	61	---	---	---	---	capture	Silent	SNP	105906078	105906078	C10orf79	10	A	G	G	G	1	0	0	0	0	0	0	0	1	184	15	3	3	1606	264
SIGIRR	59307	broad.mit.edu	37	11	408155	408155	+	Silent	SNP	G	A	A	rs142561304		TCGA-74-6584-01	TCGA-74-6584-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:408155G>A	uc001lpd.2	-	4	588	c.258C>T	c.(256-258)AAC>AAT	p.N86N	SIGIRR_uc001lpf.2_Silent_p.N86N|SIGIRR_uc001lpe.1_Silent_p.N86N|SIGIRR_uc001lpg.2_Silent_p.N86N	NM_001135054	NP_001128526	Q6IA17	SIGIR_HUMAN	single Ig IL-1R-related molecule	86	Ig-like C2-type.|Extracellular (Potential).				acute-phase response|innate immune response|negative regulation of chemokine biosynthetic process|negative regulation of cytokine-mediated signaling pathway|negative regulation of lipopolysaccharide-mediated signaling pathway|negative regulation of sequence-specific DNA binding transcription factor activity	integral to membrane	protein binding|transmembrane receptor activity				0		all_cancers(49;1.59e-06)|all_epithelial(84;0.000256)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;1.56e-27)|Epithelial(43;9.31e-27)|OV - Ovarian serous cystadenocarcinoma(40;1.11e-20)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0182)|LUSC - Lung squamous cell carcinoma(625;0.0703)		TGCTGGTCACGTTGACCCCCA	0.577													11	77	---	---	---	---	capture	Silent	SNP	408155	408155	SIGIRR	11	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	14197	264
OR10AG1	282770	broad.mit.edu	37	11	55735664	55735664	+	Missense_Mutation	SNP	C	T	T			TCGA-74-6584-01	TCGA-74-6584-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:55735664C>T	uc010rit.1	-	1	276	c.276G>A	c.(274-276)ATG>ATA	p.M92I		NM_001005491	NP_001005491	Q8NH19	O10AG_HUMAN	olfactory receptor, family 10, subfamily AG,	92	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2	Esophageal squamous(21;0.0137)					GAAAAAAACACATTTGTGTAG	0.403													7	53	---	---	---	---	capture	Missense_Mutation	SNP	55735664	55735664	OR10AG1	11	C	T	T	T	1	0	0	0	0	1	0	0	0	221	17	2	2	10801	264
DDI1	414301	broad.mit.edu	37	11	103908618	103908618	+	Silent	SNP	G	A	A			TCGA-74-6584-01	TCGA-74-6584-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:103908618G>A	uc001phr.2	+	1	1311	c.1068G>A	c.(1066-1068)ACG>ACA	p.T356T	PDGFD_uc001php.2_Intron|PDGFD_uc001phq.2_Intron	NM_001001711	NP_001001711	Q8WTU0	DDI1_HUMAN	DDI1, DNA-damage inducible 1, homolog 1	356					proteolysis		aspartic-type endopeptidase activity			large_intestine(3)|upper_aerodigestive_tract(1)|pancreas(1)	5		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.00648)|Melanoma(852;0.055)|all_neural(303;0.164)		BRCA - Breast invasive adenocarcinoma(274;0.00128)|Epithelial(105;0.0631)|all cancers(92;0.169)		CCACTGGCACGCAGACTTATT	0.463													20	45	---	---	---	---	capture	Silent	SNP	103908618	103908618	DDI1	11	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	4287	264
MMP19	4327	broad.mit.edu	37	12	56230872	56230872	+	Missense_Mutation	SNP	C	T	T			TCGA-74-6584-01	TCGA-74-6584-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:56230872C>T	uc001sib.2	-	9	1596	c.1475G>A	c.(1474-1476)GGC>GAC	p.G492D	MMP19_uc001sia.2_Missense_Mutation_p.G206D|MMP19_uc001sid.2_RNA|MMP19_uc010spw.1_3'UTR	NM_002429	NP_002420	Q99542	MMP19_HUMAN	matrix metalloproteinase 19 isoform rasi-1	492					angiogenesis|cell differentiation|collagen catabolic process|proteolysis	proteinaceous extracellular matrix	calcium ion binding|metalloendopeptidase activity|zinc ion binding			ovary(1)	1						CAAGGTTATGCCCGTACCTGA	0.507													5	257	---	---	---	---	capture	Missense_Mutation	SNP	56230872	56230872	MMP19	12	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	9569	264
PLXNC1	10154	broad.mit.edu	37	12	94654582	94654582	+	Missense_Mutation	SNP	A	T	T			TCGA-74-6584-01	TCGA-74-6584-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:94654582A>T	uc001tdc.2	+	20	3665	c.3416A>T	c.(3415-3417)AAC>ATC	p.N1139I	PLXNC1_uc010sut.1_Missense_Mutation_p.N186I|PLXNC1_uc009zsv.2_5'Flank	NM_005761	NP_005752	O60486	PLXC1_HUMAN	plexin C1 precursor	1139	Cytoplasmic (Potential).				axon guidance|cell adhesion	integral to membrane|intracellular|plasma membrane	receptor activity|receptor binding			ovary(2)|central_nervous_system(1)	3						CTCCTCACAAACTGGATGTCC	0.498													17	19	---	---	---	---	capture	Missense_Mutation	SNP	94654582	94654582	PLXNC1	12	A	T	T	T	1	0	0	0	0	1	0	0	0	26	2	4	4	12029	264
COL4A2	1284	broad.mit.edu	37	13	111084708	111084708	+	Splice_Site	SNP	G	A	A			TCGA-74-6584-01	TCGA-74-6584-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:111084708G>A	uc001vqx.2	+	11	973	c.684_splice	c.e11+1	p.Q228_splice		NM_001846	NP_001837	P08572	CO4A2_HUMAN	alpha 2 type IV collagen preproprotein						angiogenesis|axon guidance|extracellular matrix organization|negative regulation of angiogenesis	collagen type IV	extracellular matrix structural constituent|protein binding			skin(3)|central_nervous_system(2)|ovary(1)	6	all_cancers(4;2.21e-12)|all_epithelial(4;2.63e-07)|all_lung(23;5.81e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00323)|all_neural(89;0.0565)|Lung SC(71;0.0753)|Medulloblastoma(90;0.0922)	Breast(118;0.212)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.151)			AGGACAGCAAGTAAGTTGGTT	0.438													11	33	---	---	---	---	capture	Splice_Site	SNP	111084708	111084708	COL4A2	13	G	A	A	A	1	0	0	0	0	0	0	1	0	468	36	5	2	3655	264
PTGR2	145482	broad.mit.edu	37	14	74346839	74346839	+	Missense_Mutation	SNP	C	G	G			TCGA-74-6584-01	TCGA-74-6584-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:74346839C>G	uc001xow.2	+	7	971	c.811C>G	c.(811-813)CCT>GCT	p.P271A	PTGR2_uc010tue.1_Missense_Mutation_p.P271A|PTGR2_uc001xox.2_Missense_Mutation_p.P271A|ZNF410_uc001xoy.1_RNA	NM_001146154	NP_001139626	Q8N8N7	PTGR2_HUMAN	prostaglandin reductase 2	271					prostaglandin metabolic process		15-oxoprostaglandin 13-oxidase activity|zinc ion binding				0						CCCGCTATCCCCTGCTATAGA	0.413													5	75	---	---	---	---	capture	Missense_Mutation	SNP	74346839	74346839	PTGR2	14	C	G	G	G	1	0	0	0	0	1	0	0	0	286	22	4	4	12649	264
MFAP1	4236	broad.mit.edu	37	15	44106722	44106722	+	Silent	SNP	G	T	T			TCGA-74-6584-01	TCGA-74-6584-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:44106722G>T	uc001zth.1	-	4	778	c.594C>A	c.(592-594)CGC>CGA	p.R198R		NM_005926	NP_005917	P55081	MFAP1_HUMAN	microfibrillar-associated protein 1	198						microfibril				skin(1)	1		all_cancers(109;7.57e-15)|all_epithelial(112;3.51e-12)|Lung NSC(122;4.72e-08)|all_lung(180;4.9e-07)|Melanoma(134;0.027)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;4.33e-07)		CTGGCTTAAGGCGAGGCTCCA	0.448													6	151	---	---	---	---	capture	Silent	SNP	44106722	44106722	MFAP1	15	G	T	T	T	1	0	0	0	0	0	0	0	1	535	42	4	4	9425	264
VWA3A	146177	broad.mit.edu	37	16	22149825	22149825	+	Missense_Mutation	SNP	G	A	A			TCGA-74-6584-01	TCGA-74-6584-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:22149825G>A	uc010vbq.1	+	22	2380	c.2284G>A	c.(2284-2286)GCC>ACC	p.A762T	VWA3A_uc010bxd.2_RNA|VWA3A_uc010bxc.2_Missense_Mutation_p.A770T	NM_173615	NP_775886	A6NCI4	VWA3A_HUMAN	von Willebrand factor A domain containing 3A	762						extracellular region				skin(1)	1				GBM - Glioblastoma multiforme(48;0.0439)		CCCCCTGGGGGCCAGAATGGT	0.537													13	27	---	---	---	---	capture	Missense_Mutation	SNP	22149825	22149825	VWA3A	16	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	17122	264
STX1B	112755	broad.mit.edu	37	16	31004532	31004532	+	Silent	SNP	G	A	A			TCGA-74-6584-01	TCGA-74-6584-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:31004532G>A	uc010cad.2	-	9	817	c.705C>T	c.(703-705)AAC>AAT	p.N235N	STX1B_uc010vfd.1_Silent_p.N235N	NM_052874	NP_443106	P61266	STX1B_HUMAN	syntaxin 1B	235	t-SNARE coiled-coil homology.|Cytoplasmic (Potential).				intracellular protein transport|neurotransmitter transport|synaptic transmission	integral to plasma membrane	extracellular-glutamate-gated ion channel activity|SNAP receptor activity				0						AATGTTCCACGTTGTACTCGA	0.602													5	175	---	---	---	---	capture	Silent	SNP	31004532	31004532	STX1B	16	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	15234	264
FAM92B	339145	broad.mit.edu	37	16	85132864	85132864	+	Missense_Mutation	SNP	A	C	C			TCGA-74-6584-01	TCGA-74-6584-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:85132864A>C	uc010vok.1	-	8	998	c.842T>G	c.(841-843)GTA>GGA	p.V281G		NM_198491	NP_940893	Q6ZTR7	FA92B_HUMAN	hypothetical protein LOC339145	281										central_nervous_system(1)	1						CCCCTTAACCACCCACTCACA	0.318													9	32	---	---	---	---	capture	Missense_Mutation	SNP	85132864	85132864	FAM92B	16	A	C	C	C	1	0	0	0	0	1	0	0	0	78	6	4	4	5599	264
FOXN1	8456	broad.mit.edu	37	17	26864216	26864216	+	Missense_Mutation	SNP	C	T	T			TCGA-74-6584-01	TCGA-74-6584-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:26864216C>T	uc010crm.2	+	9	1907	c.1709C>T	c.(1708-1710)TCG>TTG	p.S570L	FOXN1_uc002hbj.2_Missense_Mutation_p.S570L	NM_003593	NP_003584	O15353	FOXN1_HUMAN	forkhead box N1	570					defense response|embryo development|epithelial cell proliferation|keratinocyte differentiation|organ morphogenesis|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|regulation of transcription from RNA polymerase II promoter|thymus development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			skin(1)	1	Lung NSC(42;0.00431)					ACATCATCTTCGATGCCACCA	0.612													20	63	---	---	---	---	capture	Missense_Mutation	SNP	26864216	26864216	FOXN1	17	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	5963	264
THOC1	9984	broad.mit.edu	37	18	225100	225100	+	Missense_Mutation	SNP	T	C	C			TCGA-74-6584-01	TCGA-74-6584-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:225100T>C	uc002kkj.3	-	14	1166	c.1126A>G	c.(1126-1128)AAG>GAG	p.K376E	THOC1_uc002kkk.3_RNA|THOC1_uc002kkl.2_3'UTR|THOC1_uc002kkh.3_5'UTR	NM_005131	NP_005122	Q96FV9	THOC1_HUMAN	THO complex 1	376					apoptosis|intronless viral mRNA export from host nucleus|mRNA processing|regulation of transcription elongation, DNA-dependent|RNA splicing|signal transduction|transcription, DNA-dependent	cytoplasm|nuclear matrix|nuclear speck|THO complex part of transcription export complex	DNA binding|protein binding|RNA binding			ovary(1)	1		all_cancers(4;0.0896)|Myeloproliferative disorder(11;0.0412)				TCTACCATCTTTGAAAATCTT	0.363													9	3	---	---	---	---	capture	Missense_Mutation	SNP	225100	225100	THOC1	18	T	C	C	C	1	0	0	0	0	1	0	0	0	832	64	3	3	15749	264
CEACAM7	1087	broad.mit.edu	37	19	42187745	42187745	+	Missense_Mutation	SNP	C	T	T			TCGA-74-6584-01	TCGA-74-6584-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:42187745C>T	uc002ori.1	-	3	679	c.677G>A	c.(676-678)CGC>CAC	p.R226H	CEACAM7_uc010ehx.2_Missense_Mutation_p.R226H|CEACAM7_uc010ehy.1_Intron	NM_006890	NP_008821	Q14002	CEAM7_HUMAN	carcinoembryonic antigen-related cell adhesion	226	Ig-like C2-type.					anchored to membrane|integral to membrane|plasma membrane				ovary(2)	2				OV - Ovarian serous cystadenocarcinoma(3;0.0027)|all cancers(3;0.00979)|Epithelial(262;0.0366)		TGGGTCACTGCGGCTGGCACC	0.547													57	123	---	---	---	---	capture	Missense_Mutation	SNP	42187745	42187745	CEACAM7	19	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	3166	264
NLRP12	91662	broad.mit.edu	37	19	54313743	54313743	+	Silent	SNP	G	A	A	rs146245368	byFrequency	TCGA-74-6584-01	TCGA-74-6584-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:54313743G>A	uc002qch.3	-	3	1390	c.1170C>T	c.(1168-1170)TAC>TAT	p.Y390Y	NLRP12_uc010eqw.2_5'Flank|NLRP12_uc002qci.3_Silent_p.Y390Y|NLRP12_uc002qcj.3_Silent_p.Y390Y|NLRP12_uc002qck.3_RNA|NLRP12_uc010eqx.2_Silent_p.Y390Y	NM_144687	NP_653288	P59046	NAL12_HUMAN	NLR family, pyrin domain containing 12 isoform	390	NACHT.				negative regulation of I-kappaB kinase/NF-kappaB cascade|negative regulation of interleukin-1 secretion|negative regulation of interleukin-6 biosynthetic process|negative regulation of protein autophosphorylation|negative regulation of Toll signaling pathway|positive regulation of inflammatory response|positive regulation of interleukin-1 beta secretion|regulation of interleukin-18 biosynthetic process|release of cytoplasmic sequestered NF-kappaB	cytoplasm	ATP binding|caspase activator activity|protein binding			ovary(4)|upper_aerodigestive_tract(2)|lung(1)	7	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.026)		TGTCCCTCACGTAATTGAAGA	0.567													73	144	---	---	---	---	capture	Silent	SNP	54313743	54313743	NLRP12	19	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	10381	264
ADCY3	109	broad.mit.edu	37	2	25044464	25044464	+	Missense_Mutation	SNP	C	T	T			TCGA-74-6584-01	TCGA-74-6584-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:25044464C>T	uc002rfs.3	-	19	3248	c.3049G>A	c.(3049-3051)GCC>ACC	p.A1017T	ADCY3_uc002rfr.3_Missense_Mutation_p.A604T|ADCY3_uc010ykm.1_Missense_Mutation_p.A1018T	NM_004036	NP_004027	O60266	ADCY3_HUMAN	adenylate cyclase 3	1017	Cytoplasmic (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|sensory perception of smell|synaptic transmission|transmembrane transport|water transport	cytoplasm|integral to plasma membrane	ATP binding|calmodulin binding|metal ion binding			breast(3)|ovary(1)	4	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.203)					GCGAAGTCGGCCAGGTCAGCC	0.607													4	243	---	---	---	---	capture	Missense_Mutation	SNP	25044464	25044464	ADCY3	2	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	295	264
C2orf55	343990	broad.mit.edu	37	2	99438371	99438371	+	Missense_Mutation	SNP	G	T	T			TCGA-74-6584-01	TCGA-74-6584-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:99438371G>T	uc002szf.1	-	7	2659	c.2365C>A	c.(2365-2367)CCC>ACC	p.P789T		NM_207362	NP_997245	Q6NV74	CB055_HUMAN	hypothetical protein LOC343990	789	Pro-rich.										0						TCCTTCCTGGGTTCCCGCTCT	0.736													14	8	---	---	---	---	capture	Missense_Mutation	SNP	99438371	99438371	C2orf55	2	G	T	T	T	1	0	0	0	0	1	0	0	0	572	44	4	4	2156	264
BOLL	66037	broad.mit.edu	37	2	198643759	198643759	+	Missense_Mutation	SNP	G	A	A			TCGA-74-6584-01	TCGA-74-6584-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:198643759G>A	uc002uus.2	-	3	471	c.161C>T	c.(160-162)TCC>TTC	p.S54F	BOLL_uc002uur.2_Missense_Mutation_p.S60F|BOLL_uc002uut.2_Missense_Mutation_p.S66F|BOLL_uc010zha.1_5'UTR|BOLL_uc002uuu.1_Missense_Mutation_p.S60F	NM_033030	NP_149019	Q8N9W6	BOLL_HUMAN	boule isoform 2	54	RRM.				cell differentiation|meiosis|multicellular organismal development|positive regulation of translational initiation|spermatogenesis	cytoplasm	nucleotide binding|protein binding|RNA binding|translation activator activity			ovary(2)	2						CCCATACTGGGAAAAAAATTT	0.318													17	29	---	---	---	---	capture	Missense_Mutation	SNP	198643759	198643759	BOLL	2	G	A	A	A	1	0	0	0	0	1	0	0	0	533	41	2	2	1475	264
FASTKD5	60493	broad.mit.edu	37	20	3128199	3128199	+	Silent	SNP	A	C	C			TCGA-74-6584-01	TCGA-74-6584-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:3128199A>C	uc002whz.2	-	2	1829	c.1518T>G	c.(1516-1518)ACT>ACG	p.T506T	uc002whv.1_Intron|UBOX5_uc002whw.2_Intron|UBOX5_uc002whx.2_Intron|UBOX5_uc002why.1_Intron	NM_021826	NP_068598	Q7L8L6	FAKD5_HUMAN	FAST kinase domains 5	506					apoptosis|cellular respiration	mitochondrion	ATP binding|protein kinase activity				0						GGTCAAACTTAGTTCTCTCCT	0.468													19	35	---	---	---	---	capture	Silent	SNP	3128199	3128199	FASTKD5	20	A	C	C	C	1	0	0	0	0	0	0	0	1	184	15	4	4	5634	264
OR5AC2	81050	broad.mit.edu	37	3	97806212	97806212	+	Missense_Mutation	SNP	G	A	A			TCGA-74-6584-01	TCGA-74-6584-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:97806212G>A	uc011bgs.1	+	1	196	c.196G>A	c.(196-198)GGT>AGT	p.G66S		NM_054106	NP_473447	Q9NZP5	O5AC2_HUMAN	olfactory receptor, family 5, subfamily AC,	66	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1						CTTATTCCTTGGTGGTTTAGC	0.438													63	153	---	---	---	---	capture	Missense_Mutation	SNP	97806212	97806212	OR5AC2	3	G	A	A	A	1	0	0	0	0	1	0	0	0	611	47	2	2	11045	264
SENP7	57337	broad.mit.edu	37	3	101046635	101046635	+	Missense_Mutation	SNP	T	C	C			TCGA-74-6584-01	TCGA-74-6584-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:101046635T>C	uc003dut.2	-	23	3001	c.2890A>G	c.(2890-2892)AAA>GAA	p.K964E	SENP7_uc003duu.2_Missense_Mutation_p.K899E|SENP7_uc003duv.2_Missense_Mutation_p.K931E|SENP7_uc003duw.2_Missense_Mutation_p.K898E|SENP7_uc003dux.2_Missense_Mutation_p.K800E|SENP7_uc003dus.2_Missense_Mutation_p.K152E	NM_020654	NP_065705	Q9BQF6	SENP7_HUMAN	sentrin/SUMO-specific protease 7 isoform 1	964	Protease.				proteolysis	nucleus	cysteine-type peptidase activity			ovary(3)|lung(2)	5						GTTTTTAGTTTAACTTCCCAC	0.338													12	22	---	---	---	---	capture	Missense_Mutation	SNP	101046635	101046635	SENP7	3	T	C	C	C	1	0	0	0	0	1	0	0	0	793	61	3	3	13944	264
AADAC	13	broad.mit.edu	37	3	151545690	151545690	+	Silent	SNP	A	G	G			TCGA-74-6584-01	TCGA-74-6584-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:151545690A>G	uc003eze.2	+	5	1020	c.930A>G	c.(928-930)AAA>AAG	p.K310K		NM_001086	NP_001077	P22760	AAAD_HUMAN	arylacetamide deacetylase	310	Lumenal (Potential).				positive regulation of triglyceride catabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	carboxylesterase activity|deacetylase activity|serine hydrolase activity|triglyceride lipase activity			skin(2)	2		Myeloproliferative disorder(1037;0.0255)|all_neural(597;0.112)	LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0813)			TGGCTAAAAAATATCCAGGGT	0.418													14	46	---	---	---	---	capture	Silent	SNP	151545690	151545690	AADAC	3	A	G	G	G	1	0	0	0	0	0	0	0	1	50	4	3	3	10	264
ATOH1	474	broad.mit.edu	37	4	94750754	94750754	+	Missense_Mutation	SNP	C	T	T			TCGA-74-6584-01	TCGA-74-6584-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:94750754C>T	uc003hta.1	+	1	677	c.677C>T	c.(676-678)CCG>CTG	p.P226L		NM_005172	NP_005163	Q92858	ATOH1_HUMAN	atonal homolog 1	226	Poly-Pro.				transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding transcription factor activity				0		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;3.57e-07)		CAGCCACCGCCGCCTCCAGCC	0.632													10	36	---	---	---	---	capture	Missense_Mutation	SNP	94750754	94750754	ATOH1	4	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	1103	264
ZNF827	152485	broad.mit.edu	37	4	146791485	146791485	+	Silent	SNP	G	A	A			TCGA-74-6584-01	TCGA-74-6584-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:146791485G>A	uc003ikn.2	-	5	1941	c.1893C>T	c.(1891-1893)GAC>GAT	p.D631D	ZNF827_uc003ikm.2_Silent_p.D631D|ZNF827_uc010iox.2_Silent_p.D281D	NM_178835	NP_849157	Q17R98	ZN827_HUMAN	zinc finger protein 827	631					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	all_hematologic(180;0.151)					GCTTTAGTGCGTCCTCAGAGA	0.537													21	59	---	---	---	---	capture	Silent	SNP	146791485	146791485	ZNF827	4	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	18056	264
IL31RA	133396	broad.mit.edu	37	5	55203287	55203287	+	Silent	SNP	C	T	T			TCGA-74-6584-01	TCGA-74-6584-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:55203287C>T	uc003jql.2	+	10	1418	c.1353C>T	c.(1351-1353)GGC>GGT	p.G451G	IL31RA_uc003jqk.2_Silent_p.G451G|IL31RA_uc011cqj.1_Silent_p.G309G|IL31RA_uc003jqm.2_Silent_p.G419G|IL31RA_uc003jqn.2_Silent_p.G451G|IL31RA_uc010iwa.1_Silent_p.G419G|IL31RA_uc003jqo.2_Silent_p.G309G	NM_139017	NP_620586	Q8NI17	IL31R_HUMAN	gp130-like monocyte receptor	419	Extracellular (Potential).				anti-apoptosis|defense response|homeostatic process|JAK-STAT cascade|macrophage differentiation|MAPKKK cascade|monocyte differentiation|negative regulation of macrophage activation|positive regulation of cell proliferation|positive regulation of transcription, DNA-dependent|positive regulation of tyrosine phosphorylation of Stat3 protein|positive regulation of tyrosine phosphorylation of Stat5 protein|transmembrane receptor protein tyrosine kinase signaling pathway	integral to membrane|plasma membrane	cytokine receptor activity|protein kinase binding|transcription coactivator activity			ovary(1)	1		Lung NSC(810;6.93e-05)|Prostate(74;0.00741)|Breast(144;0.0544)|Ovarian(174;0.223)				CCAAAGAAGGCGGTATGAATG	0.463													8	11	---	---	---	---	capture	Silent	SNP	55203287	55203287	IL31RA	5	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	7614	264
FBN2	2201	broad.mit.edu	37	5	127624839	127624839	+	Missense_Mutation	SNP	T	C	C			TCGA-74-6584-01	TCGA-74-6584-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:127624839T>C	uc003kuu.2	-	52	7056	c.6617A>G	c.(6616-6618)TAC>TGC	p.Y2206C		NM_001999	NP_001990	P35556	FBN2_HUMAN	fibrillin 2 precursor	2206	EGF-like 36; calcium-binding.				bone trabecula formation|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|positive regulation of bone mineralization|positive regulation of osteoblast differentiation	microfibril	calcium ion binding|extracellular matrix structural constituent			ovary(8)|large_intestine(4)|pancreas(1)|kidney(1)|skin(1)	15		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		TACTCCAGTGTAGTCAAGGTT	0.428													18	29	---	---	---	---	capture	Missense_Mutation	SNP	127624839	127624839	FBN2	5	T	C	C	C	1	0	0	0	0	1	0	0	0	741	57	3	3	5649	264
DSP	1832	broad.mit.edu	37	6	7581687	7581687	+	Missense_Mutation	SNP	A	T	T			TCGA-74-6584-01	TCGA-74-6584-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:7581687A>T	uc003mxp.1	+	23	5543	c.5264A>T	c.(5263-5265)CAG>CTG	p.Q1755L	DSP_uc003mxq.1_Intron	NM_004415	NP_004406	P15924	DESP_HUMAN	desmoplakin isoform I	1755	Central fibrous rod domain.|Potential.				cellular component disassembly involved in apoptosis|keratinocyte differentiation|peptide cross-linking	cornified envelope|cytoplasm|desmosome	protein binding, bridging|structural constituent of cytoskeleton			central_nervous_system(6)|ovary(2)|skin(1)	9	Ovarian(93;0.0584)	all_hematologic(90;0.236)		OV - Ovarian serous cystadenocarcinoma(45;0.000508)		CTAAGGAGCCAGCTGCAGATC	0.483													29	74	---	---	---	---	capture	Missense_Mutation	SNP	7581687	7581687	DSP	6	A	T	T	T	1	0	0	0	0	1	0	0	0	91	7	4	4	4736	264
ZNF184	7738	broad.mit.edu	37	6	27419109	27419109	+	Silent	SNP	T	C	C			TCGA-74-6584-01	TCGA-74-6584-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:27419109T>C	uc003njj.2	-	5	3040	c.2229A>G	c.(2227-2229)AAA>AAG	p.K743K	ZNF184_uc010jqv.2_Silent_p.K743K|ZNF184_uc003nji.2_Silent_p.K743K	NM_007149	NP_009080	Q99676	ZN184_HUMAN	zinc finger protein 184	743	C2H2-type 19.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						GTCTCTGATGTTTGTTGAGAG	0.378													13	128	---	---	---	---	capture	Silent	SNP	27419109	27419109	ZNF184	6	T	C	C	C	1	0	0	0	0	0	0	0	1	777	60	3	3	17631	264
PKHD1	5314	broad.mit.edu	37	6	51777281	51777281	+	Missense_Mutation	SNP	G	T	T			TCGA-74-6584-01	TCGA-74-6584-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:51777281G>T	uc003pah.1	-	38	6491	c.6215C>A	c.(6214-6216)CCT>CAT	p.P2072H	PKHD1_uc010jzn.1_Missense_Mutation_p.P97H|PKHD1_uc003pai.2_Missense_Mutation_p.P2072H	NM_138694	NP_619639	P08F94	PKHD1_HUMAN	fibrocystin isoform 1	2072	Extracellular (Potential).				cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity			lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44	Lung NSC(77;0.0605)					TTCATCCCCAGGGTTCCAGTC	0.478													7	125	---	---	---	---	capture	Missense_Mutation	SNP	51777281	51777281	PKHD1	6	G	T	T	T	1	0	0	0	0	1	0	0	0	455	35	4	4	11874	264
PKHD1	5314	broad.mit.edu	37	6	51947232	51947232	+	Missense_Mutation	SNP	A	G	G			TCGA-74-6584-01	TCGA-74-6584-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:51947232A>G	uc003pah.1	-	4	515	c.239T>C	c.(238-240)TTT>TCT	p.F80S	PKHD1_uc003pai.2_Missense_Mutation_p.F80S	NM_138694	NP_619639	P08F94	PKHD1_HUMAN	fibrocystin isoform 1	80	Extracellular (Potential).|IPT/TIG 1; atypical.				cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity			lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44	Lung NSC(77;0.0605)					GAAAACAGGAAAGACGTCACA	0.502													33	114	---	---	---	---	capture	Missense_Mutation	SNP	51947232	51947232	PKHD1	6	A	G	G	G	1	0	0	0	0	1	0	0	0	13	1	3	3	11874	264
COL10A1	1300	broad.mit.edu	37	6	116442879	116442879	+	Silent	SNP	G	A	A			TCGA-74-6584-01	TCGA-74-6584-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:116442879G>A	uc003pwm.2	-	3	496	c.400C>T	c.(400-402)CTA>TTA	p.L134L	NT5DC1_uc003pwj.2_Intron|NT5DC1_uc003pwk.2_Intron|NT5DC1_uc003pwl.2_Intron	NM_000493	NP_000484	Q03692	COAA1_HUMAN	type X collagen alpha 1 precursor	134	Triple-helical region.				skeletal system development	collagen	metal ion binding			central_nervous_system(1)	1		all_cancers(87;0.0176)|all_epithelial(87;0.0263)|Colorectal(196;0.234)		all cancers(137;0.0157)|OV - Ovarian serous cystadenocarcinoma(136;0.0325)|GBM - Glioblastoma multiforme(226;0.0446)|Epithelial(106;0.0711)		GGTCCTGGTAGGCCAGCTGGT	0.602													22	29	---	---	---	---	capture	Silent	SNP	116442879	116442879	COL10A1	6	G	A	A	A	1	0	0	0	0	0	0	0	1	451	35	2	2	3631	264
TMEM195	392636	broad.mit.edu	37	7	15599842	15599842	+	Missense_Mutation	SNP	G	T	T			TCGA-74-6584-01	TCGA-74-6584-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:15599842G>T	uc003stb.1	-	2	351	c.181C>A	c.(181-183)CTC>ATC	p.L61I		NM_001004320	NP_001004320	Q6ZNB7	ALKMO_HUMAN	transmembrane protein 195	61	Helical; (Potential).				ether lipid metabolic process|fatty acid biosynthetic process|membrane lipid metabolic process	endoplasmic reticulum membrane|integral to membrane	glyceryl-ether monooxygenase activity|iron ion binding				0						TTTCCTTTGAGAATCCAGCTG	0.438													28	95	---	---	---	---	capture	Missense_Mutation	SNP	15599842	15599842	TMEM195	7	G	T	T	T	1	0	0	0	0	1	0	0	0	429	33	4	4	16000	264
COBL	23242	broad.mit.edu	37	7	51287539	51287539	+	Missense_Mutation	SNP	C	A	A			TCGA-74-6584-01	TCGA-74-6584-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:51287539C>A	uc003tpr.3	-	2	329	c.144G>T	c.(142-144)CAG>CAT	p.Q48H	COBL_uc003tps.2_Missense_Mutation_p.Q48H|COBL_uc011kcl.1_Missense_Mutation_p.Q48H|COBL_uc010kzc.2_Missense_Mutation_p.Q48H|COBL_uc003tpt.2_Missense_Mutation_p.Q48H	NM_015198	NP_056013	O75128	COBL_HUMAN	cordon-bleu homolog	48										skin(3)|ovary(2)	5	Glioma(55;0.08)					CCAAGTTCTGCTGCGACCCGA	0.632													23	79	---	---	---	---	capture	Missense_Mutation	SNP	51287539	51287539	COBL	7	C	A	A	A	1	0	0	0	0	1	0	0	0	363	28	4	4	3618	264
PHF2	5253	broad.mit.edu	37	9	96421820	96421820	+	Missense_Mutation	SNP	C	T	T			TCGA-74-6584-01	TCGA-74-6584-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:96421820C>T	uc004aub.2	+	11	1414	c.1267C>T	c.(1267-1269)CCG>TCG	p.P423S	PHF2_uc011lug.1_Missense_Mutation_p.P306S	NM_005392	NP_005383	O75151	PHF2_HUMAN	PHD finger protein 2	423					liver development|negative regulation of chromatin silencing at rDNA|transcription, DNA-dependent	nucleolus	histone demethylase activity (H3-K9 specific)|iron ion binding|methylated histone residue binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding			ovary(1)	1		Myeloproliferative disorder(762;0.0255)		OV - Ovarian serous cystadenocarcinoma(323;9.11e-28)		GGACGAGCTCCCGGAGCACTT	0.612													10	23	---	---	---	---	capture	Missense_Mutation	SNP	96421820	96421820	PHF2	9	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	11733	264
LPAR1	1902	broad.mit.edu	37	9	113703965	113703965	+	Missense_Mutation	SNP	C	T	T			TCGA-74-6584-01	TCGA-74-6584-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:113703965C>T	uc004bfa.2	-	4	784	c.529G>A	c.(529-531)GTT>ATT	p.V177I	LPAR1_uc011lwm.1_Missense_Mutation_p.V178I|LPAR1_uc004bfb.2_Missense_Mutation_p.V177I|LPAR1_uc004bfc.2_Missense_Mutation_p.V177I|LPAR1_uc011lwn.1_Missense_Mutation_p.V159I|LPAR1_uc011lwo.1_Missense_Mutation_p.V178I|LPAR1_uc010mub.2_Missense_Mutation_p.V177I	NM_057159	NP_476500	Q92633	LPAR1_HUMAN	lysophosphatidic acid receptor 1	177	Helical; Name=4; (Potential).				positive regulation of I-kappaB kinase/NF-kappaB cascade	cell surface|integral to plasma membrane				ovary(2)	2						GCACCCATAACGATGGCCATA	0.498													23	60	---	---	---	---	capture	Missense_Mutation	SNP	113703965	113703965	LPAR1	9	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	8820	264
CEP110	11064	broad.mit.edu	37	9	123930543	123930543	+	Missense_Mutation	SNP	C	G	G			TCGA-74-6584-01	TCGA-74-6584-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:123930543C>G	uc004bkx.1	+	36	6045	c.6014C>G	c.(6013-6015)ACT>AGT	p.T2005S	CEP110_uc004blb.1_Missense_Mutation_p.T674S|CEP110_uc010mvp.1_5'UTR	NM_007018	NP_008949	Q7Z7A1	CNTRL_HUMAN	centrosomal protein 110kDa	2005	Required for centrosome localization.|Sufficient for interaction with HOOK2.|Potential.				cell division|G2/M transition of mitotic cell cycle	centrosome|cytosol	protein binding				0						CGTGTTAGGACTCTGCAGGAA	0.498													6	73	---	---	---	---	capture	Missense_Mutation	SNP	123930543	123930543	CEP110	9	C	G	G	G	1	0	0	0	0	1	0	0	0	260	20	4	4	3213	264
DCAF8L1	139425	broad.mit.edu	37	X	27999269	27999269	+	Silent	SNP	G	A	A			TCGA-74-6584-01	TCGA-74-6584-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:27999269G>A	uc004dbx.1	-	1	298	c.183C>T	c.(181-183)AAC>AAT	p.N61N		NM_001017930	NP_001017930	A6NGE4	DC8L1_HUMAN	DDB1 and CUL4 associated factor 8-like 1	61										ovary(3)|skin(1)	4						TGCTGGCATCGTTCAGGAAAC	0.507													35	62	---	---	---	---	capture	Silent	SNP	27999269	27999269	DCAF8L1	23	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	4236	264
SSX5	6758	broad.mit.edu	37	X	48053576	48053576	+	Missense_Mutation	SNP	C	T	T			TCGA-74-6584-01	TCGA-74-6584-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:48053576C>T	uc004dja.1	-	4	322	c.269G>A	c.(268-270)CGT>CAT	p.R90H	SSX5_uc004diz.1_Missense_Mutation_p.R131H	NM_175723	NP_783729	O60225	SSX5_HUMAN	synovial sarcoma, X breakpoint 5 isoform b	90					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding				0						CTGATTCCCACGGTTAGGGTC	0.498													59	99	---	---	---	---	capture	Missense_Mutation	SNP	48053576	48053576	SSX5	23	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	15098	264
MUM1L1	139221	broad.mit.edu	37	X	105450536	105450536	+	Missense_Mutation	SNP	G	A	A			TCGA-74-6584-01	TCGA-74-6584-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:105450536G>A	uc004emf.1	+	4	1760	c.1111G>A	c.(1111-1113)GAT>AAT	p.D371N	MUM1L1_uc004emg.1_Missense_Mutation_p.D371N	NM_152423	NP_689636	Q5H9M0	MUML1_HUMAN	melanoma associated antigen (mutated) 1-like 1	371										ovary(2)|pancreas(1)|skin(1)	4						TCTATTAGATGATGATGAGGA	0.368													14	30	---	---	---	---	capture	Missense_Mutation	SNP	105450536	105450536	MUM1L1	23	G	A	A	A	1	0	0	0	0	1	0	0	0	585	45	2	2	9896	264
LAMP2	3920	broad.mit.edu	37	X	119589247	119589247	+	Missense_Mutation	SNP	C	A	A			TCGA-74-6584-01	TCGA-74-6584-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:119589247C>A	uc004est.3	-	3	542	c.362G>T	c.(361-363)GGT>GTT	p.G121V	LAMP2_uc004ess.3_Missense_Mutation_p.G121V|LAMP2_uc011mtz.1_Intron|LAMP2_uc011mua.1_Missense_Mutation_p.G74V|LAMP2_uc010nqp.1_Missense_Mutation_p.G121V	NM_002294	NP_002285	P13473	LAMP2_HUMAN	lysosomal-associated membrane protein 2 isoform	121	Lumenal (Potential).|First lumenal domain.				platelet activation|platelet degranulation	endosome membrane|integral to membrane|late endosome|lysosomal membrane|membrane fraction|plasma membrane|platelet dense granule membrane				ovary(1)	1						TGTGTTATCACCAGTGTTGTA	0.363													21	67	---	---	---	---	capture	Missense_Mutation	SNP	119589247	119589247	LAMP2	23	C	A	A	A	1	0	0	0	0	1	0	0	0	234	18	4	4	8538	264
SUFU	51684	broad.mit.edu	37	10	104353785	104353785	+	Frame_Shift_Del	DEL	G	-	-			TCGA-74-6584-01	TCGA-74-6584-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:104353785delG	uc001kvy.1	+	6	865	c.719delG	c.(718-720)AGGfs	p.R240fs	SUFU_uc001kvw.1_Frame_Shift_Del_p.R240fs|SUFU_uc001kvx.2_Frame_Shift_Del_p.R240fs|SUFU_uc009xxe.1_5'Flank|SUFU_uc009xxf.1_5'Flank	NM_016169	NP_057253	Q9UMX1	SUFU_HUMAN	suppressor of fused	240					negative regulation of transcription from RNA polymerase II promoter|proteolysis|skeletal system development	cytoplasm|nucleus	identical protein binding|protein binding|signal transducer activity|transcription corepressor activity|transcription factor binding			central_nervous_system(4)|skin(2)|breast(1)	7		Colorectal(252;0.207)		Epithelial(162;1.36e-08)|all cancers(201;3.81e-07)|BRCA - Breast invasive adenocarcinoma(275;0.242)		GACATGCGGAGGGGAGAGACC	0.532			D|F|S		medulloblastoma	medulloblastoma			Medulloblastoma_associated_with_Germline_SUFU_Mutation				40	43	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	104353785	104353785	SUFU	10	G	-	-	-	1	0	1	0	1	0	0	0	0	455	35	5	5	15258	264
