Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
CAMTA1	23261	broad.mit.edu	37	1	7797314	7797314	+	Splice_Site	SNP	G	A	A			TCGA-76-4927-01	TCGA-76-4927-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:7797314G>A	uc001aoi.2	+	15	3550	c.3343_splice	c.e15-1	p.M1115_splice	CAMTA1_uc010nzv.1_Splice_Site_p.M202_splice|CAMTA1_uc001aok.3_Splice_Site_p.M158_splice|CAMTA1_uc001aoj.2_Splice_Site_p.M71_splice	NM_015215	NP_056030	Q9Y6Y1	CMTA1_HUMAN	calmodulin-binding transcription activator 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	calmodulin binding			ovary(5)|central_nervous_system(2)|breast(1)|pancreas(1)	9	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)		CTGTCTTCTAGATGTGGGCGT	0.557													22	325	---	---	---	---	capture	Splice_Site	SNP	7797314	7797314	CAMTA1	1	G	A	A	A	1	0	0	0	0	0	0	1	0	429	33	5	2	2589	267
GJA8	2703	broad.mit.edu	37	1	147380445	147380445	+	Silent	SNP	C	T	T			TCGA-76-4927-01	TCGA-76-4927-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:147380445C>T	uc001epu.1	+	2	426	c.363C>T	c.(361-363)AAC>AAT	p.N121N		NM_005267	NP_005258	P48165	CXA8_HUMAN	connexin 50	121	Cytoplasmic (Potential).				cell communication|visual perception	connexon complex|integral to plasma membrane	channel activity			ovary(2)|large_intestine(2)|breast(1)|skin(1)	6	all_hematologic(923;0.0276)					CGGGGACTAACGGCGGCCCGG	0.657													28	52	---	---	---	---	capture	Silent	SNP	147380445	147380445	GJA8	1	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	6342	267
UBAP2L	9898	broad.mit.edu	37	1	154207187	154207187	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4927-01	TCGA-76-4927-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:154207187C>T	uc001fep.3	+	5	567	c.400C>T	c.(400-402)CGT>TGT	p.R134C	UBAP2L_uc009wot.2_Missense_Mutation_p.R134C|UBAP2L_uc010pek.1_Missense_Mutation_p.R133C|UBAP2L_uc010pel.1_Missense_Mutation_p.R133C|UBAP2L_uc001fen.1_Missense_Mutation_p.R133C|UBAP2L_uc010pem.1_Missense_Mutation_p.R133C|UBAP2L_uc010pen.1_Missense_Mutation_p.R37C	NM_014847	NP_055662	Q14157	UBP2L_HUMAN	ubiquitin associated protein 2-like isoform a	134					binding of sperm to zona pellucida		protein binding			ovary(1)|central_nervous_system(1)	2	all_lung(78;1.09e-30)|Lung NSC(65;1.66e-28)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)			TAGTCGGCGACGTGGTGGGCC	0.552													11	29	---	---	---	---	capture	Missense_Mutation	SNP	154207187	154207187	UBAP2L	1	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	16720	267
CACNA1S	779	broad.mit.edu	37	1	201058474	201058474	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4927-01	TCGA-76-4927-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:201058474C>T	uc001gvv.2	-	6	1039	c.812G>A	c.(811-813)GGC>GAC	p.G271D		NM_000069	NP_000060	Q13698	CAC1S_HUMAN	calcium channel, voltage-dependent, L type,	271	Extracellular (Potential).|I.				axon guidance	I band|T-tubule|voltage-gated calcium channel complex	high voltage-gated calcium channel activity			ovary(3)|central_nervous_system(1)|skin(1)	5					Magnesium Sulfate(DB00653)|Verapamil(DB00661)	GTGGGTGATGCCATGGTTGGG	0.627													28	44	---	---	---	---	capture	Missense_Mutation	SNP	201058474	201058474	CACNA1S	1	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	2523	267
SPATA17	128153	broad.mit.edu	37	1	217824518	217824518	+	Missense_Mutation	SNP	C	A	A			TCGA-76-4927-01	TCGA-76-4927-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:217824518C>A	uc001hlh.1	+	3	264	c.238C>A	c.(238-240)CAG>AAG	p.Q80K	SPATA17_uc009xdr.1_RNA|SPATA17_uc001hli.2_Missense_Mutation_p.Q80K	NM_138796	NP_620151	Q96L03	SPT17_HUMAN	spermatogenesis associated 17	80	IQ 2.					cytoplasm	calmodulin binding			pancreas(1)	1				OV - Ovarian serous cystadenocarcinoma(81;0.0516)|all cancers(67;0.0891)|GBM - Glioblastoma multiforme(131;0.117)		ACTAACTGTGCAGGTAAATAT	0.289													45	132	---	---	---	---	capture	Missense_Mutation	SNP	217824518	217824518	SPATA17	1	C	A	A	A	1	0	0	0	0	1	0	0	0	325	25	4	4	14894	267
DISC1	27185	broad.mit.edu	37	1	232144583	232144583	+	Nonsense_Mutation	SNP	C	T	T			TCGA-76-4927-01	TCGA-76-4927-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:232144583C>T	uc001huz.2	+	11	2148	c.2095C>T	c.(2095-2097)CGA>TGA	p.R699*	TSNAX-DISC1_uc010pwl.1_RNA|DISC1_uc010pxd.1_Nonsense_Mutation_p.R344*|DISC1_uc010pxe.1_Nonsense_Mutation_p.R699*|DISC1_uc009xfr.2_Nonsense_Mutation_p.R654*|DISC1_uc010pxf.1_Silent_p.V678V|DISC1_uc010pxg.1_3'UTR|DISC1_uc010pxh.1_Nonsense_Mutation_p.R731*|DISC1_uc010pxi.1_RNA|DISC1_uc010pxj.1_Nonsense_Mutation_p.R344*|DISC1_uc010pxk.1_RNA|DISC1_uc010pxl.1_RNA|DISC1_uc010pxm.1_Nonsense_Mutation_p.R577*|DISC1_uc010pxn.1_Nonsense_Mutation_p.R344*|DISC1_uc001hva.2_Nonsense_Mutation_p.R699*	NM_018662	NP_061132	Q9NRI5	DISC1_HUMAN	disrupted in schizophrenia 1 isoform L	699	Necessary and sufficient for interaction with PCNT and localization at the centrosome.|Interaction with ATF4 and ATF5.				microtubule cytoskeleton organization|neuron migration|positive regulation of neuroblast proliferation|positive regulation of Wnt receptor signaling pathway|Wnt receptor signaling pathway	centrosome|microtubule	protein binding			skin(1)	1		all_cancers(173;0.0208)|Prostate(94;0.0975)				GGAAGCTTGTCGATTGCTTAT	0.493													30	102	---	---	---	---	capture	Nonsense_Mutation	SNP	232144583	232144583	DISC1	1	C	T	T	T	1	0	0	0	0	0	1	0	0	399	31	5	1	4496	267
MUC5B	727897	broad.mit.edu	37	11	1263896	1263896	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4927-01	TCGA-76-4927-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:1263896C>T	uc009ycr.1	+	47	7991	c.7865C>T	c.(7864-7866)ACC>ATC	p.T2622I	MUC5B_uc001ltb.2_Missense_Mutation_p.T1932I	NM_017511	NP_059981	Q9HC84	MUC5B_HUMAN	SubName: Full=Mucin 5AC, oligomeric mucus/gel-forming;	1929	7 X Cys-rich subdomain repeats.|11 X approximate tandem repeats, Ser/Thr- rich.|Thr-rich.				cell adhesion	extracellular region	extracellular matrix structural constituent|protein binding				0		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CCGACCTCCACCCTGAGAACA	0.637													53	121	---	---	---	---	capture	Missense_Mutation	SNP	1263896	1263896	MUC5B	11	C	T	T	T	1	0	0	0	0	1	0	0	0	234	18	2	2	9889	267
OR52N1	79473	broad.mit.edu	37	11	5809803	5809803	+	Missense_Mutation	SNP	T	C	C			TCGA-76-4927-01	TCGA-76-4927-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:5809803T>C	uc010qzo.1	-	1	244	c.244A>G	c.(244-246)AAC>GAC	p.N82D	TRIM5_uc001mbq.1_Intron|TRIM22_uc009yet.1_Intron	NM_001001913	NP_001001913	Q8NH53	O52N1_HUMAN	olfactory receptor, family 52, subfamily N,	82	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;3.05e-11)|LUSC - Lung squamous cell carcinoma(625;0.112)|BRCA - Breast invasive adenocarcinoma(625;0.135)|Lung(200;0.195)		AAGAGAGTGTTGGGAAGGGTG	0.473													40	141	---	---	---	---	capture	Missense_Mutation	SNP	5809803	5809803	OR52N1	11	T	C	C	C	1	0	0	0	0	1	0	0	0	819	63	3	3	11031	267
NPAS4	266743	broad.mit.edu	37	11	66189954	66189954	+	Silent	SNP	C	T	T			TCGA-76-4927-01	TCGA-76-4927-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:66189954C>T	uc001ohx.1	+	3	536	c.360C>T	c.(358-360)TAC>TAT	p.Y120Y	NPAS4_uc010rpc.1_Translation_Start_Site	NM_178864	NP_849195	Q8IUM7	NPAS4_HUMAN	neuronal PAS domain protein 4	120	PAS 1.				transcription, DNA-dependent		DNA binding|signal transducer activity				0						ACAGCATCTACGACATCATTG	0.557													84	221	---	---	---	---	capture	Silent	SNP	66189954	66189954	NPAS4	11	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	10472	267
PRCP	5547	broad.mit.edu	37	11	82549612	82549612	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4927-01	TCGA-76-4927-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:82549612C>T	uc001ozs.2	-	8	1204	c.1091G>A	c.(1090-1092)TGC>TAC	p.C364Y	PRCP_uc001ozr.2_Missense_Mutation_p.C385Y	NM_005040	NP_005031	P42785	PCP_HUMAN	prolylcarboxypeptidase isoform 1 preproprotein	364					blood coagulation, intrinsic pathway|proteolysis	lysosome|plasma membrane	protein binding|serine-type carboxypeptidase activity			skin(1)	1						TACTTCTGTGCAGGCCTAAGA	0.274													4	106	---	---	---	---	capture	Missense_Mutation	SNP	82549612	82549612	PRCP	11	C	T	T	T	1	0	0	0	0	1	0	0	0	325	25	2	2	12345	267
KITLG	4254	broad.mit.edu	37	12	88939597	88939597	+	Missense_Mutation	SNP	G	C	C			TCGA-76-4927-01	TCGA-76-4927-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:88939597G>C	uc001tav.2	-	2	244	c.61C>G	c.(61-63)CCT>GCT	p.P21A	KITLG_uc001taw.2_Missense_Mutation_p.P21A	NM_000899	NP_000890	P21583	SCF_HUMAN	KIT ligand isoform b precursor	21					cell adhesion|cell proliferation|hemopoiesis|male gonad development|positive regulation of DNA replication|signal transduction	cytoplasm|cytoskeleton|integral to membrane|plasma membrane	growth factor activity|identical protein binding|stem cell factor receptor binding			ovary(1)	1						TTGACGAGAGGATTAAATAGG	0.363									Testicular_Cancer_Familial_Clustering_of				33	83	---	---	---	---	capture	Missense_Mutation	SNP	88939597	88939597	KITLG	12	G	C	C	C	1	0	0	0	0	1	0	0	0	533	41	4	4	8251	267
TXNRD1	7296	broad.mit.edu	37	12	104721416	104721416	+	Silent	SNP	G	A	A			TCGA-76-4927-01	TCGA-76-4927-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:104721416G>A	uc010swk.1	+	13	1531	c.1509G>A	c.(1507-1509)CTG>CTA	p.L503L	TXNRD1_uc010swl.1_Silent_p.L353L|TXNRD1_uc010swm.1_Silent_p.L405L|TXNRD1_uc010swn.1_Silent_p.L353L|TXNRD1_uc010swo.1_Silent_p.L353L|TXNRD1_uc010swp.1_Silent_p.L315L|TXNRD1_uc010swq.1_Silent_p.L403L|TXNRD1_uc001tku.2_RNA|TXNRD1_uc009zun.2_Silent_p.L419L	NM_001093771	NP_001087240	Q16881	TRXR1_HUMAN	thioredoxin reductase 1 isoform 3	503					cell redox homeostasis|cellular lipid metabolic process|electron transport chain|nucleobase, nucleoside and nucleotide interconversion|signal transduction|transport	cytosol|nucleolus	electron carrier activity|flavin adenine dinucleotide binding|NADP binding|protein disulfide oxidoreductase activity|thioredoxin-disulfide reductase activity				0						GAAGATTGCTGGCTCAGAGGC	0.473													18	38	---	---	---	---	capture	Silent	SNP	104721416	104721416	TXNRD1	12	G	A	A	A	1	0	0	0	0	0	0	0	1	600	47	2	2	16689	267
SCFD1	23256	broad.mit.edu	37	14	31142541	31142541	+	Silent	SNP	T	C	C			TCGA-76-4927-01	TCGA-76-4927-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:31142541T>C	uc001wqm.1	+	12	1098	c.1074T>C	c.(1072-1074)CTT>CTC	p.L358L	SCFD1_uc001wqn.1_Silent_p.L291L|SCFD1_uc010tpg.1_Silent_p.L299L|SCFD1_uc010tph.1_Silent_p.L173L|SCFD1_uc010amf.1_Silent_p.L173L|SCFD1_uc010tpi.1_Silent_p.L266L|SCFD1_uc010amd.1_Silent_p.L190L|SCFD1_uc010ame.1_Silent_p.L291L	NM_016106	NP_057190	Q8WVM8	SCFD1_HUMAN	vesicle transport-related protein isoform a	358					post-Golgi vesicle-mediated transport|protein transport|regulation of ER to Golgi vesicle-mediated transport|response to toxin|retrograde vesicle-mediated transport, Golgi to ER|vesicle docking involved in exocytosis	cis-Golgi network|endoplasmic reticulum membrane|Golgi cisterna membrane|Golgi-associated vesicle|plasma membrane	syntaxin-5 binding				0	Hepatocellular(127;0.0877)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.0119)	GBM - Glioblastoma multiforme(265;0.0181)		TCAAACGACTTAAAAGCATTA	0.338													3	118	---	---	---	---	capture	Silent	SNP	31142541	31142541	SCFD1	14	T	C	C	C	1	0	0	0	0	0	0	0	1	782	61	3	3	13781	267
ESR2	2100	broad.mit.edu	37	14	64749369	64749369	+	Missense_Mutation	SNP	G	A	A	rs141516067		TCGA-76-4927-01	TCGA-76-4927-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:64749369G>A	uc001xha.1	-	2	803	c.335C>T	c.(334-336)TCG>TTG	p.S112L	ESR2_uc001xgu.2_Missense_Mutation_p.S112L|ESR2_uc001xgv.2_Missense_Mutation_p.S112L|ESR2_uc001xgw.2_RNA|ESR2_uc001xgx.2_Missense_Mutation_p.S112L|ESR2_uc001xgy.1_Missense_Mutation_p.S112L|ESR2_uc001xgz.1_Missense_Mutation_p.S112L|ESR2_uc010aqb.1_RNA|ESR2_uc010aqc.1_Missense_Mutation_p.S112L	NM_001437	NP_001428	Q92731	ESR2_HUMAN	estrogen receptor beta isoform 1	112	Modulating.				cell-cell signaling|negative regulation of cell growth|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	mitochondrion|nucleoplasm	enzyme binding|estrogen receptor activity|receptor antagonist activity|sequence-specific DNA binding transcription factor activity|steroid binding|transcription coactivator activity|zinc ion binding			central_nervous_system(2)|ovary(1)	3				all cancers(60;0.00916)|OV - Ovarian serous cystadenocarcinoma(108;0.0111)|BRCA - Breast invasive adenocarcinoma(234;0.0437)	Bicalutamide(DB01128)|Estradiol(DB00783)|Estramustine(DB01196)|Raloxifene(DB00481)|Tamoxifen(DB00675)|Trilostane(DB01108)	GTGTTCTAGCGATCTTGCTTC	0.448													82	162	---	---	---	---	capture	Missense_Mutation	SNP	64749369	64749369	ESR2	14	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	5212	267
PAPLN	89932	broad.mit.edu	37	14	73729314	73729314	+	Silent	SNP	C	T	T			TCGA-76-4927-01	TCGA-76-4927-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:73729314C>T	uc010ttx.1	+	18	2665	c.2502C>T	c.(2500-2502)GGC>GGT	p.G834G	PAPLN_uc001xnw.3_Silent_p.G807G|PAPLN_uc010arl.2_Intron|PAPLN_uc010ttw.1_RNA|PAPLN_uc010tty.1_Silent_p.G818G|PAPLN_uc010arm.2_Missense_Mutation_p.A26V|PAPLN_uc010arn.2_Silent_p.G34G	NM_173462	NP_775733	O95428	PPN_HUMAN	papilin	834						proteinaceous extracellular matrix	metalloendopeptidase activity|serine-type endopeptidase inhibitor activity|zinc ion binding			ovary(1)|central_nervous_system(1)|skin(1)	3				BRCA - Breast invasive adenocarcinoma(234;0.00394)|OV - Ovarian serous cystadenocarcinoma(108;0.0468)		GTCCTGCAGGCGAGCAGGAAC	0.682													4	7	---	---	---	---	capture	Silent	SNP	73729314	73729314	PAPLN	14	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	11332	267
GPR68	8111	broad.mit.edu	37	14	91700886	91700886	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4927-01	TCGA-76-4927-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:91700886C>T	uc001xzg.2	-	2	850	c.509G>A	c.(508-510)CGC>CAC	p.R170H	GPR68_uc001xzh.2_Missense_Mutation_p.R180H	NM_003485	NP_003476	Q15743	OGR1_HUMAN	G protein-coupled receptor 68	170	Extracellular (Potential).				inflammatory response	integral to plasma membrane	G-protein coupled receptor activity			kidney(1)	1		all_cancers(154;0.0555)		COAD - Colon adenocarcinoma(157;0.21)		AAAGCACACGCGGTGCTGGTT	0.627													17	53	---	---	---	---	capture	Missense_Mutation	SNP	91700886	91700886	GPR68	14	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	6640	267
BDKRB1	623	broad.mit.edu	37	14	96730468	96730468	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4927-01	TCGA-76-4927-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:96730468G>A	uc001yfh.2	+	3	657	c.449G>A	c.(448-450)CGG>CAG	p.R150Q	BDKRB1_uc010avn.2_Missense_Mutation_p.R150Q	NM_000710	NP_000701	P46663	BKRB1_HUMAN	bradykinin receptor B1	150	Cytoplasmic (Potential).				elevation of cytosolic calcium ion concentration	endoplasmic reticulum|integral to plasma membrane	bradykinin receptor activity			ovary(3)	3		all_cancers(154;0.0677)|Melanoma(154;0.155)|all_epithelial(191;0.179)		COAD - Colon adenocarcinoma(157;0.208)|Epithelial(152;0.226)		AGGCAGCAGCGGCGGAGGCAG	0.632													4	111	---	---	---	---	capture	Missense_Mutation	SNP	96730468	96730468	BDKRB1	14	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	1381	267
MKRN3	7681	broad.mit.edu	37	15	23811282	23811282	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4927-01	TCGA-76-4927-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:23811282C>T	uc001ywh.3	+	1	829	c.353C>T	c.(352-354)TCG>TTG	p.S118L	MKRN3_uc001ywi.2_Intron|MKRN3_uc010ayi.1_Missense_Mutation_p.S118L	NM_005664	NP_005655	Q13064	MKRN3_HUMAN	makorin ring finger protein 3	118	C3H1-type 1.					ribonucleoprotein complex	ligase activity|nucleic acid binding|zinc ion binding			lung(6)|large_intestine(2)|ovary(2)	10		all_cancers(20;8.44e-25)|all_epithelial(15;3.69e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000353)|Colorectal(260;0.14)		all cancers(64;3.02e-06)|Epithelial(43;1.94e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0012)		TGTCGCTATTCGCACGACCTT	0.597													6	223	---	---	---	---	capture	Missense_Mutation	SNP	23811282	23811282	MKRN3	15	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	9520	267
ANKS3	124401	broad.mit.edu	37	16	4764084	4764084	+	Missense_Mutation	SNP	G	A	A	rs146798732		TCGA-76-4927-01	TCGA-76-4927-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:4764084G>A	uc002cxj.1	-	7	972	c.677C>T	c.(676-678)CCC>CTC	p.P226L	ANKS3_uc002cxi.1_Missense_Mutation_p.P153L|ANKS3_uc002cxk.2_Missense_Mutation_p.P97L|ANKS3_uc002cxl.2_Missense_Mutation_p.P53L|ANKS3_uc010uxs.1_Missense_Mutation_p.P153L|ANKS3_uc002cxm.2_Missense_Mutation_p.P20L	NM_133450	NP_597707	Q6ZW76	ANKS3_HUMAN	ankyrin repeat and sterile alpha motif domain	226											0						GGGCAGAGAGGGCGAGTAAGT	0.617													40	78	---	---	---	---	capture	Missense_Mutation	SNP	4764084	4764084	ANKS3	16	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	684	267
HAS3	3038	broad.mit.edu	37	16	69148326	69148326	+	Silent	SNP	C	T	T			TCGA-76-4927-01	TCGA-76-4927-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:69148326C>T	uc010cfh.2	+	4	1043	c.819C>T	c.(817-819)TGC>TGT	p.C273C	HAS3_uc002ewk.2_Intron|HAS3_uc002ewl.2_Silent_p.C273C	NM_005329	NP_005320	O00219	HAS3_HUMAN	hyaluronan synthase 3 isoform a	273	Cytoplasmic (Potential).				carbohydrate metabolic process	integral to plasma membrane	hyaluronan synthase activity				0		Ovarian(137;0.101)		OV - Ovarian serous cystadenocarcinoma(108;0.0694)		AGCGGGCCTGCCAGTCCTACT	0.552													5	163	---	---	---	---	capture	Silent	SNP	69148326	69148326	HAS3	16	C	T	T	T	1	0	0	0	0	0	0	0	1	337	26	2	2	6890	267
KRTAP4-4	84616	broad.mit.edu	37	17	39316492	39316492	+	Missense_Mutation	SNP	C	G	G			TCGA-76-4927-01	TCGA-76-4927-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:39316492C>G	uc002hwc.2	-	1	492	c.452G>C	c.(451-453)TGT>TCT	p.C151S		NM_032524	NP_115913	Q9BYR3	KRA44_HUMAN	keratin associated protein 4.4	151	26.|26 X 5 AA repeats of C-C-[GRQVCH]-[SPT]- [VSTQR].					keratin filament					0		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000449)			CCTGGACACACAGCAGCTGGG	0.642													27	90	---	---	---	---	capture	Missense_Mutation	SNP	39316492	39316492	KRTAP4-4	17	C	G	G	G	1	0	0	0	0	1	0	0	0	221	17	4	4	8473	267
BRCA1	672	broad.mit.edu	37	17	41244612	41244612	+	Missense_Mutation	SNP	C	T	T	rs80356985		TCGA-76-4927-01	TCGA-76-4927-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:41244612C>T	uc002icq.2	-	10	3168	c.2936G>A	c.(2935-2937)CGT>CAT	p.R979H	BRCA1_uc010whp.1_Intron|BRCA1_uc010whl.1_Intron|BRCA1_uc010whm.1_Intron|BRCA1_uc002icp.3_Missense_Mutation_p.R908H|BRCA1_uc002icu.2_Intron|BRCA1_uc010cyx.2_Missense_Mutation_p.R932H|BRCA1_uc002ict.2_Missense_Mutation_p.R979H|BRCA1_uc010whn.1_Intron|BRCA1_uc010who.1_Intron|BRCA1_uc010whq.1_Intron|BRCA1_uc002idc.1_Intron|BRCA1_uc010whr.1_Intron|BRCA1_uc002idd.2_Missense_Mutation_p.R979H|BRCA1_uc002ide.1_Missense_Mutation_p.R810H|BRCA1_uc010cyy.1_Missense_Mutation_p.R979H|BRCA1_uc010whs.1_Missense_Mutation_p.R979H|BRCA1_uc010cyz.2_Missense_Mutation_p.R932H|BRCA1_uc010cza.2_Missense_Mutation_p.R953H|BRCA1_uc010wht.1_Missense_Mutation_p.R683H	NM_007294	NP_009225	P38398	BRCA1_HUMAN	breast cancer 1, early onset isoform 1	979					androgen receptor signaling pathway|apoptosis|cellular response to indole-3-methanol|chromosome segregation|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|DNA damage response, signal transduction resulting in induction of apoptosis|double-strand break repair via homologous recombination|fatty acid biosynthetic process|G2/M transition DNA damage checkpoint|negative regulation of centriole replication|negative regulation of fatty acid biosynthetic process|negative regulation of histone H3-K9 methylation|negative regulation of transcription, DNA-dependent|positive regulation of cell cycle arrest|positive regulation of DNA repair|positive regulation of histone acetylation|positive regulation of histone H3-K4 methylation|positive regulation of histone H4-K20 methylation|positive regulation of protein ubiquitination|positive regulation of transcription from RNA polymerase II promoter|postreplication repair|protein autoubiquitination|protein K6-linked ubiquitination|regulation of cell motility|regulation of cell proliferation|regulation of transcription from RNA polymerase III promoter|response to estrogen stimulus|response to ionizing radiation|substrate adhesion-dependent cell spreading	BRCA1-A complex|BRCA1-BARD1 complex|gamma-tubulin ring complex|nucleoplasm|plasma membrane|ribonucleoprotein complex|ruffle	androgen receptor binding|identical protein binding|protein binding|RNA binding|transcription coactivator activity|transcription regulatory region DNA binding|tubulin binding|ubiquitin protein ligase binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(24)|breast(21)|lung(4)|central_nervous_system(1)|endometrium(1)|urinary_tract(1)	52		Breast(137;0.000717)		BRCA - Breast invasive adenocarcinoma(366;0.126)		TGGTGGTATACGATATGGGTT	0.363			D|Mis|N|F|S		ovarian	breast|ovarian		Homologous_recombination	Hereditary_Breast-Ovarian_Cancer_BRCA1_type	TCGA Ovarian(2;0.000030)			121	230	---	---	---	---	capture	Missense_Mutation	SNP	41244612	41244612	BRCA1	17	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	1486	267
ITGA2B	3674	broad.mit.edu	37	17	42457990	42457990	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4927-01	TCGA-76-4927-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:42457990C>T	uc002igt.1	-	14	1449	c.1417G>A	c.(1417-1419)GCC>ACC	p.A473T	ITGA2B_uc002igu.1_5'UTR	NM_000419	NP_000410	P08514	ITA2B_HUMAN	integrin alpha 2b preproprotein	473	Extracellular (Potential).|FG-GAP 7.				axon guidance|integrin-mediated signaling pathway|platelet activation|platelet degranulation	integrin complex|platelet alpha granule membrane	identical protein binding|receptor activity			ovary(2)|lung(1)	3		Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.191)	Tirofiban(DB00775)	ACCTGGTTGGCCCCGTAAGCT	0.592													4	161	---	---	---	---	capture	Missense_Mutation	SNP	42457990	42457990	ITGA2B	17	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	7799	267
LRRC30	339291	broad.mit.edu	37	18	7231386	7231386	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4927-01	TCGA-76-4927-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:7231386C>T	uc010wzk.1	+	1	250	c.250C>T	c.(250-252)CGG>TGG	p.R84W		NM_001105581	NP_001099051	A6NM36	LRC30_HUMAN	leucine rich repeat containing 30	84	LRR 1.									ovary(1)|liver(1)	2						CAACCAGCTCCGGGTTCTCCC	0.587													52	90	---	---	---	---	capture	Missense_Mutation	SNP	7231386	7231386	LRRC30	18	C	T	T	T	1	0	0	0	0	1	0	0	0	295	23	1	1	8901	267
KHSRP	8570	broad.mit.edu	37	19	6420483	6420483	+	Splice_Site	SNP	C	T	T			TCGA-76-4927-01	TCGA-76-4927-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:6420483C>T	uc002mer.3	-	5	536	c.426_splice	c.e5-1	p.R142_splice		NM_003685	NP_003676	Q92945	FUBP2_HUMAN	KH-type splicing regulatory protein						mRNA processing|mRNA transport|regulation of transcription, DNA-dependent|RNA splicing, via transesterification reactions|transcription, DNA-dependent	cytosol|nucleus	DNA binding|protein binding|RNA binding			skin(1)	1						CATTGAAGTCCTGTAAAGAGA	0.567													21	70	---	---	---	---	capture	Splice_Site	SNP	6420483	6420483	KHSRP	19	C	T	T	T	1	0	0	0	0	0	0	1	0	312	24	5	2	8073	267
ZNF136	7695	broad.mit.edu	37	19	12298584	12298584	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4927-01	TCGA-76-4927-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:12298584G>A	uc002mti.2	+	4	1491	c.1391G>A	c.(1390-1392)CGA>CAA	p.R464Q	ZNF136_uc010xmh.1_Missense_Mutation_p.R398Q	NM_003437	NP_003428	P52737	ZN136_HUMAN	zinc finger protein 136	464	C2H2-type 12.				negative regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	nucleus	DNA binding|protein binding|transcription corepressor activity|zinc ion binding			ovary(1)|pancreas(1)	2						AACTCCTTTCGAACACATGAA	0.393													32	101	---	---	---	---	capture	Missense_Mutation	SNP	12298584	12298584	ZNF136	19	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	17606	267
RASAL3	64926	broad.mit.edu	37	19	15574925	15574925	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4927-01	TCGA-76-4927-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:15574925C>T	uc002nbe.2	-	2	331	c.245G>A	c.(244-246)CGC>CAC	p.R82H		NM_022904	NP_075055	Q86YV0	RASL3_HUMAN	RAS protein activator like 3	82					negative regulation of Ras protein signal transduction|signal transduction	cytoplasm|intrinsic to internal side of plasma membrane	Ras GTPase activator activity				0						GAGTCGAAGGCGACTGGTCCG	0.672													20	73	---	---	---	---	capture	Missense_Mutation	SNP	15574925	15574925	RASAL3	19	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	12960	267
USHBP1	83878	broad.mit.edu	37	19	17375061	17375061	+	Silent	SNP	A	C	C			TCGA-76-4927-01	TCGA-76-4927-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:17375061A>C	uc002nfs.1	-	2	161	c.48T>G	c.(46-48)GCT>GCG	p.A16A	USHBP1_uc002nft.1_RNA|USHBP1_uc010xpk.1_Missense_Mutation_p.L2R|USHBP1_uc010eam.1_5'UTR	NM_031941	NP_114147	Q8N6Y0	USBP1_HUMAN	Usher syndrome 1C binding protein 1	16							PDZ domain binding			ovary(1)	1						TTACGGGTGGAGCATGCCTCC	0.647													16	70	---	---	---	---	capture	Silent	SNP	17375061	17375061	USHBP1	19	A	C	C	C	1	0	0	0	0	0	0	0	1	132	11	4	4	16919	267
MAG	4099	broad.mit.edu	37	19	35786738	35786738	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4927-01	TCGA-76-4927-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:35786738G>A	uc002nyy.1	+	4	418	c.269G>A	c.(268-270)CGC>CAC	p.R90H	MAG_uc002nyx.1_Missense_Mutation_p.R90H|MAG_uc010eds.1_Missense_Mutation_p.R65H|MAG_uc002nyz.1_Missense_Mutation_p.R90H	NM_002361	NP_002352	P20916	MAG_HUMAN	myelin associated glycoprotein isoform a	90	Ig-like V-type.|Extracellular (Potential).				blood coagulation|cell adhesion|leukocyte migration|negative regulation of axonogenesis|nerve growth factor receptor signaling pathway	integral to membrane|plasma membrane	sugar binding			breast(3)|lung(2)|central_nervous_system(1)|skin(1)	7	all_lung(56;2.37e-08)|Lung NSC(56;3.66e-08)|Esophageal squamous(110;0.162)	Renal(1328;0.242)	Epithelial(14;3.14e-19)|OV - Ovarian serous cystadenocarcinoma(14;1.5e-18)|all cancers(14;1.5e-16)|LUSC - Lung squamous cell carcinoma(66;0.0417)			GGCCGCAGCCGCCTCCTGGGG	0.652													144	408	---	---	---	---	capture	Missense_Mutation	SNP	35786738	35786738	MAG	19	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	9076	267
PLD3	23646	broad.mit.edu	37	19	40872766	40872766	+	Silent	SNP	C	T	T			TCGA-76-4927-01	TCGA-76-4927-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:40872766C>T	uc002onm.3	+	5	587	c.189C>T	c.(187-189)GGC>GGT	p.G63G	PLD3_uc002onj.3_Silent_p.G63G|PLD3_uc002onk.3_Silent_p.G63G|PLD3_uc002onl.3_Silent_p.G63G|PLD3_uc002onn.2_Silent_p.G63G|PLD3_uc002ono.2_Nonsense_Mutation_p.R93*	NM_001031696	NP_001026866	Q8IV08	PLD3_HUMAN	phospholipase D3	63	Lumenal (Potential).				lipid catabolic process	endoplasmic reticulum membrane|integral to membrane	NAPE-specific phospholipase D activity|phospholipase D activity|protein binding			skin(2)|ovary(1)	3			Lung(22;0.000636)|LUSC - Lung squamous cell carcinoma(20;0.00248)			GGGAATACGGCGACTTGCATC	0.627													8	349	---	---	---	---	capture	Silent	SNP	40872766	40872766	PLD3	19	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	11950	267
PSG1	5669	broad.mit.edu	37	19	43372476	43372476	+	Silent	SNP	T	A	A			TCGA-76-4927-01	TCGA-76-4927-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:43372476T>A	uc002ovb.2	-	5	1158	c.1020A>T	c.(1018-1020)TCA>TCT	p.S340S	PSG3_uc002ouf.2_Intron|PSG1_uc002oug.1_Intron|PSG11_uc002ouw.2_Intron|PSG7_uc002ous.1_Intron|PSG7_uc002out.1_Intron|PSG10_uc002ouv.1_Intron|PSG1_uc002oun.2_Intron|PSG1_uc002our.1_Silent_p.S340S|PSG1_uc010eio.1_Silent_p.S340S|PSG1_uc002oux.1_Silent_p.S269S|PSG1_uc002ouy.1_Silent_p.S247S|PSG1_uc002ouz.1_Silent_p.S340S|PSG1_uc002ova.1_Silent_p.S247S|PSG1_uc002ovc.2_Silent_p.S247S|PSG1_uc002ovd.1_Silent_p.S340S	NM_006905	NP_008836	P11464	PSG1_HUMAN	pregnancy specific beta-1-glycoprotein 1	340	Ig-like C2-type 3.				female pregnancy	extracellular region				ovary(2)	2		Prostate(69;0.00682)				AATAGGTGAATGAAGGGTAAA	0.468													60	124	---	---	---	---	capture	Silent	SNP	43372476	43372476	PSG1	19	T	A	A	A	1	0	0	0	0	0	0	0	1	652	51	4	4	12548	267
NLRP5	126206	broad.mit.edu	37	19	56538863	56538863	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4927-01	TCGA-76-4927-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:56538863G>A	uc002qmj.2	+	7	1264	c.1264G>A	c.(1264-1266)GTG>ATG	p.V422M	NLRP5_uc002qmi.2_Missense_Mutation_p.V403M	NM_153447	NP_703148	P59047	NALP5_HUMAN	NACHT, LRR and PYD containing protein 5	422	NACHT.					mitochondrion|nucleolus	ATP binding			ovary(3)|skin(2)|kidney(1)|central_nervous_system(1)	7		Colorectal(82;3.46e-05)|Ovarian(87;0.0481)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0326)		GTCAGAGGTCGTGTCTCCCCG	0.547													15	35	---	---	---	---	capture	Missense_Mutation	SNP	56538863	56538863	NLRP5	19	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	10387	267
ZNF470	388566	broad.mit.edu	37	19	57088760	57088760	+	Silent	SNP	C	T	T			TCGA-76-4927-01	TCGA-76-4927-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:57088760C>T	uc002qnl.3	+	6	1639	c.963C>T	c.(961-963)TTC>TTT	p.F321F	ZNF470_uc010etn.2_Intron	NM_001001668	NP_001001668	Q6ECI4	ZN470_HUMAN	zinc finger protein 470	321	C2H2-type 4.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|pancreas(1)	2		Colorectal(82;5.46e-05)|Ovarian(87;0.0822)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0294)		ATAAAGCATTCAGCCAGCTTG	0.448													44	101	---	---	---	---	capture	Silent	SNP	57088760	57088760	ZNF470	19	C	T	T	T	1	0	0	0	0	0	0	0	1	376	29	2	2	17808	267
LPIN1	23175	broad.mit.edu	37	2	11911528	11911528	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4927-01	TCGA-76-4927-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:11911528C>T	uc010yjn.1	+	5	593	c.319C>T	c.(319-321)CCC>TCC	p.P107S	LPIN1_uc010yjm.1_Missense_Mutation_p.P156S|LPIN1_uc002rbt.2_Missense_Mutation_p.P107S|LPIN1_uc002rbs.2_Missense_Mutation_p.P107S	NM_145693	NP_663731	Q14693	LPIN1_HUMAN	lipin 1	107	N-LIP.				fatty acid catabolic process|transcription, DNA-dependent|triglyceride biosynthetic process|triglyceride mobilization	cytosol|endoplasmic reticulum membrane	phosphatidate phosphatase activity			ovary(2)|large_intestine(1)|skin(1)	4	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.11)|OV - Ovarian serous cystadenocarcinoma(76;0.173)		GGCCACCTCCCCCATCCTGTC	0.517													34	93	---	---	---	---	capture	Missense_Mutation	SNP	11911528	11911528	LPIN1	2	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	8834	267
MFSD2B	388931	broad.mit.edu	37	2	24246495	24246495	+	Silent	SNP	C	T	T			TCGA-76-4927-01	TCGA-76-4927-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:24246495C>T	uc002reo.1	+	12	1226	c.1212C>T	c.(1210-1212)CAC>CAT	p.H404H		NM_001080473	NP_001073942	A6NFX1	MFS2B_HUMAN	major facilitator superfamily domain containing	404					transport	integral to membrane				ovary(2)	2						AGCTGCAGCACCGTCACGGGC	0.622													60	89	---	---	---	---	capture	Silent	SNP	24246495	24246495	MFSD2B	2	C	T	T	T	1	0	0	0	0	0	0	0	1	233	18	2	2	9443	267
SCN1A	6323	broad.mit.edu	37	2	166897863	166897863	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4927-01	TCGA-76-4927-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:166897863C>T	uc010zcz.1	-	13	2278	c.2260G>A	c.(2260-2262)GTG>ATG	p.V754M	SCN1A_uc002udo.3_Missense_Mutation_p.V634M|SCN1A_uc010fpk.2_Missense_Mutation_p.V606M	NM_006920	NP_008851	P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha	765	Helical; Name=S1 of repeat II; (By similarity).|II.					voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(6)|skin(6)|large_intestine(1)	13					Lamotrigine(DB00555)|Levetiracetam(DB01202)|Phenacemide(DB01121)|Phenytoin(DB00252)|Topiramate(DB00273)|Zonisamide(DB00909)	GGGTCCATCACAACCAGGTTG	0.403													88	167	---	---	---	---	capture	Missense_Mutation	SNP	166897863	166897863	SCN1A	2	C	T	T	T	1	0	0	0	0	1	0	0	0	221	17	2	2	13807	267
PIKFYVE	200576	broad.mit.edu	37	2	209150648	209150648	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4927-01	TCGA-76-4927-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:209150648C>T	uc002vcz.2	+	6	970	c.812C>T	c.(811-813)GCC>GTC	p.A271V	PIKFYVE_uc010fun.1_5'UTR|PIKFYVE_uc002vcy.1_Missense_Mutation_p.A271V|PIKFYVE_uc002vcv.2_Missense_Mutation_p.A174V|PIKFYVE_uc002vcw.2_Missense_Mutation_p.A271V|PIKFYVE_uc002vcx.2_Missense_Mutation_p.A185V	NM_015040	NP_055855	Q9Y2I7	FYV1_HUMAN	phosphatidylinositol-3-phosphate 5-kinase type	271					cellular protein metabolic process|intracellular signal transduction|protein localization to nucleus|retrograde transport, endosome to Golgi	early endosome membrane|membrane raft	1-phosphatidylinositol-3-phosphate 5-kinase activity|1-phosphatidylinositol-4-phosphate 5-kinase activity|ATP binding|metal ion binding|protein binding			ovary(5)|kidney(2)|pancreas(1)|central_nervous_system(1)|skin(1)	10						GATGATTTGGCCTGGCAAAGG	0.403													5	179	---	---	---	---	capture	Missense_Mutation	SNP	209150648	209150648	PIKFYVE	2	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	11827	267
TNS1	7145	broad.mit.edu	37	2	218713141	218713141	+	Missense_Mutation	SNP	G	A	A	rs147452506		TCGA-76-4927-01	TCGA-76-4927-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:218713141G>A	uc002vgt.2	-	17	2122	c.1724C>T	c.(1723-1725)ACG>ATG	p.T575M	TNS1_uc002vgr.2_Missense_Mutation_p.T575M|TNS1_uc002vgs.2_Missense_Mutation_p.T575M|TNS1_uc010zjv.1_Missense_Mutation_p.T575M|TNS1_uc010fvj.1_Missense_Mutation_p.T643M|TNS1_uc010fvk.1_Missense_Mutation_p.T700M|TNS1_uc010fvi.1_Missense_Mutation_p.T262M	NM_022648	NP_072174	Q9HBL0	TENS1_HUMAN	tensin	575						cytoplasm|cytoskeleton|focal adhesion	actin binding			ovary(3)|breast(1)	4		Renal(207;0.0483)|Lung NSC(271;0.213)		Epithelial(149;4.43e-06)|all cancers(144;0.000653)|LUSC - Lung squamous cell carcinoma(224;0.0091)|Lung(261;0.013)		CATGGGGGCCGTGTGGCCAGC	0.667													4	114	---	---	---	---	capture	Missense_Mutation	SNP	218713141	218713141	TNS1	2	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	16226	267
COL6A3	1293	broad.mit.edu	37	2	238303590	238303590	+	Missense_Mutation	SNP	G	C	C			TCGA-76-4927-01	TCGA-76-4927-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:238303590G>C	uc002vwl.2	-	3	634	c.349C>G	c.(349-351)CAG>GAG	p.Q117E	COL6A3_uc002vwo.2_Intron|COL6A3_uc010znj.1_Intron|COL6A3_uc002vwq.2_Intron|COL6A3_uc002vwr.2_Intron|COL6A3_uc010znk.1_Missense_Mutation_p.Q117E	NM_004369	NP_004360	P12111	CO6A3_HUMAN	alpha 3 type VI collagen isoform 1 precursor	117	VWFA 1.|Nonhelical region.				axon guidance|cell adhesion|muscle organ development	collagen type VI|extracellular space	serine-type endopeptidase inhibitor activity			ovary(8)|central_nervous_system(6)|skin(2)|upper_aerodigestive_tract(1)|pancreas(1)	18		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		TTTCCAGTCTGATTGGTTCCC	0.453													105	187	---	---	---	---	capture	Missense_Mutation	SNP	238303590	238303590	COL6A3	2	G	C	C	C	1	0	0	0	0	1	0	0	0	585	45	4	4	3666	267
HDAC4	9759	broad.mit.edu	37	2	240061423	240061423	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4927-01	TCGA-76-4927-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:240061423G>A	uc002vyk.3	-	9	1727	c.935C>T	c.(934-936)GCG>GTG	p.A312V	HDAC4_uc010fyz.1_Missense_Mutation_p.A307V|HDAC4_uc010zoa.1_Missense_Mutation_p.A307V|HDAC4_uc010fza.2_Missense_Mutation_p.A312V|HDAC4_uc010fyy.2_Missense_Mutation_p.A264V|HDAC4_uc010znz.1_Missense_Mutation_p.A195V|HDAC4_uc010fzb.1_RNA	NM_006037	NP_006028	P56524	HDAC4_HUMAN	histone deacetylase 4	312	Interaction with MEF2A.				B cell differentiation|cardiac muscle hypertrophy in response to stress|chromatin remodeling|histone H3 deacetylation|histone H4 deacetylation|inflammatory response|negative regulation of glycolysis|negative regulation of myotube differentiation|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|nervous system development|peptidyl-lysine deacetylation|positive regulation of cell proliferation|positive regulation of protein sumoylation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|regulation of protein binding|response to denervation involved in regulation of muscle adaptation|response to interleukin-1|transcription, DNA-dependent	histone deacetylase complex|transcriptional repressor complex	activating transcription factor binding|histone deacetylase activity (H3-K16 specific)|histone deacetylase binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|potassium ion binding|repressing transcription factor binding|zinc ion binding			breast(3)|skin(2)|ovary(1)	6		all_epithelial(40;1.45e-17)|Breast(86;1.53e-05)|Renal(207;0.000355)|all_lung(227;0.0121)|Ovarian(221;0.0183)|Lung NSC(271;0.0413)|Melanoma(123;0.0749)|all_hematologic(139;0.159)		Epithelial(121;6.38e-25)|OV - Ovarian serous cystadenocarcinoma(60;2.48e-12)|Kidney(56;6.04e-08)|KIRC - Kidney renal clear cell carcinoma(57;1.18e-06)|BRCA - Breast invasive adenocarcinoma(100;3.99e-05)|Lung(119;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.04)		ACCGTTCTCCGCGCTGACGCT	0.662													10	262	---	---	---	---	capture	Missense_Mutation	SNP	240061423	240061423	HDAC4	2	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	6936	267
GGTLC1	92086	broad.mit.edu	37	20	23966561	23966561	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4927-01	TCGA-76-4927-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:23966561C>T	uc002wts.2	-	4	488	c.355G>A	c.(355-357)GGC>AGC	p.G119S	GGTLC1_uc002wtu.2_Missense_Mutation_p.G119S	NM_178312	NP_842564	Q9BX51	GGTL1_HUMAN	gamma-glutamyltransferase light chain 1	119							gamma-glutamyltransferase activity			ovary(1)	1						CGGACCTGGCCGTCCTGGCCC	0.662													72	142	---	---	---	---	capture	Missense_Mutation	SNP	23966561	23966561	GGTLC1	20	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	6304	267
CDH22	64405	broad.mit.edu	37	20	44841697	44841697	+	Silent	SNP	G	A	A			TCGA-76-4927-01	TCGA-76-4927-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:44841697G>A	uc002xrm.2	-	5	1370	c.969C>T	c.(967-969)GGC>GGT	p.G323G	CDH22_uc010ghk.1_Silent_p.G323G|CDH22_uc002xrn.1_Silent_p.G74G	NM_021248	NP_067071	Q9UJ99	CAD22_HUMAN	cadherin 22 precursor	323	Extracellular (Potential).|Cadherin 3.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|skin(1)	5		Myeloproliferative disorder(115;0.0122)				ACACATCGCCGCCGCTGCTGC	0.592													40	54	---	---	---	---	capture	Silent	SNP	44841697	44841697	CDH22	20	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	3078	267
FGD5	152273	broad.mit.edu	37	3	14862435	14862435	+	Silent	SNP	C	T	T			TCGA-76-4927-01	TCGA-76-4927-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:14862435C>T	uc003bzc.2	+	1	1967	c.1857C>T	c.(1855-1857)TTC>TTT	p.F619F	FGD5_uc011avk.1_Silent_p.F619F	NM_152536	NP_689749	Q6ZNL6	FGD5_HUMAN	FYVE, RhoGEF and PH domain containing 5	619					actin cytoskeleton organization|filopodium assembly|regulation of Cdc42 GTPase activity|regulation of cell shape	cytoskeleton|Golgi apparatus|lamellipodium|ruffle	metal ion binding|Rho guanyl-nucleotide exchange factor activity|small GTPase binding			ovary(3)|kidney(1)|pancreas(1)	5						CACCTCCTTTCGACCTGGCCT	0.557													63	78	---	---	---	---	capture	Silent	SNP	14862435	14862435	FGD5	3	C	T	T	T	1	0	0	0	0	0	0	0	1	402	31	1	1	5782	267
SLC6A20	54716	broad.mit.edu	37	3	45812818	45812818	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4927-01	TCGA-76-4927-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:45812818C>T	uc011bai.1	-	6	950	c.826G>A	c.(826-828)GCC>ACC	p.A276T	SLC6A20_uc003cow.2_5'UTR|SLC6A20_uc011baj.1_Missense_Mutation_p.A239T	NM_020208	NP_064593	Q9NP91	S6A20_HUMAN	solute carrier family 6, member 20 isoform 1	276	Cytoplasmic (Potential).				cellular nitrogen compound metabolic process|glycine transport|proline transport	apical plasma membrane|integral to plasma membrane	amino acid transmembrane transporter activity|neurotransmitter:sodium symporter activity			ovary(2)	2				BRCA - Breast invasive adenocarcinoma(193;0.01)|KIRC - Kidney renal clear cell carcinoma(197;0.0225)|Kidney(197;0.0267)		ACGATGATGGCGTGCTTCTGG	0.517													36	90	---	---	---	---	capture	Missense_Mutation	SNP	45812818	45812818	SLC6A20	3	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	14576	267
PHLDB2	90102	broad.mit.edu	37	3	111603533	111603533	+	Silent	SNP	A	C	C			TCGA-76-4927-01	TCGA-76-4927-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:111603533A>C	uc010hqa.2	+	2	1020	c.609A>C	c.(607-609)TCA>TCC	p.S203S	PHLDB2_uc003dyc.2_Silent_p.S230S|PHLDB2_uc003dyd.2_Silent_p.S203S|PHLDB2_uc003dyg.2_Silent_p.S203S|PHLDB2_uc003dyh.2_Silent_p.S203S|PHLDB2_uc003dye.3_Silent_p.S203S|PHLDB2_uc003dyf.3_Silent_p.S203S	NM_001134438	NP_001127910	Q86SQ0	PHLB2_HUMAN	pleckstrin homology-like domain, family B,	203						cytoplasm|intermediate filament cytoskeleton|plasma membrane				ovary(4)|skin(2)	6						GCATGCCTTCAAGCCCAAAGC	0.532													20	83	---	---	---	---	capture	Silent	SNP	111603533	111603533	PHLDB2	3	A	C	C	C	1	0	0	0	0	0	0	0	1	54	5	4	4	11755	267
FIP1L1	81608	broad.mit.edu	37	4	54294195	54294195	+	Missense_Mutation	SNP	T	C	C			TCGA-76-4927-01	TCGA-76-4927-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:54294195T>C	uc003gzy.2	+	13	1205	c.1019T>C	c.(1018-1020)GTC>GCC	p.V340A	PDGFRA_uc003haa.2_Intron|FIP1L1_uc003gzx.3_Missense_Mutation_p.V325A|FIP1L1_uc011bzt.1_Missense_Mutation_p.V304A|FIP1L1_uc011bzu.1_Missense_Mutation_p.V325A|FIP1L1_uc003gzz.2_Missense_Mutation_p.V266A|FIP1L1_uc003hab.2_Missense_Mutation_p.V305A|FIP1L1_uc003hac.2_Missense_Mutation_p.V85A|FIP1L1_uc010ign.2_RNA|FIP1L1_uc003had.2_5'UTR|FIP1L1_uc003hae.2_5'UTR	NM_030917	NP_112179	Q6UN15	FIP1_HUMAN	FIP1 like 1 isoform 1	340	Necessary for stimulating PAPOLA activity.	Breakpoint for interstitial deletion to form the FIP1L1-PDGFRA fusion protein.			mRNA processing	nucleus	RNA binding			ovary(1)|skin(1)	2			GBM - Glioblastoma multiforme(3;3.31e-36)|LUSC - Lung squamous cell carcinoma(32;0.0134)			TAATTTTAGGTCCTTTCTGAA	0.264			T	PDGFRA	idiopathic hypereosinophilic syndrome								26	64	---	---	---	---	capture	Missense_Mutation	SNP	54294195	54294195	FIP1L1	4	T	C	C	C	1	0	0	0	0	1	0	0	0	754	58	3	3	5841	267
ANKRD56	345079	broad.mit.edu	37	4	77818025	77818025	+	Silent	SNP	G	A	A			TCGA-76-4927-01	TCGA-76-4927-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:77818025G>A	uc003hki.2	-	1	978	c.978C>T	c.(976-978)CGC>CGT	p.R326R		NM_001029870	NP_001025041	A6NEL2	ANR56_HUMAN	ankyrin repeat domain 56	326											0						CCGACCAGGCGCGGATAGGGC	0.657													36	83	---	---	---	---	capture	Silent	SNP	77818025	77818025	ANKRD56	4	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	677	267
TLR2	7097	broad.mit.edu	37	4	154625003	154625003	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4927-01	TCGA-76-4927-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:154625003G>A	uc003inq.2	+	3	1163	c.944G>A	c.(943-945)CGG>CAG	p.R315Q	TLR2_uc003inr.2_Missense_Mutation_p.R315Q|TLR2_uc003ins.2_Missense_Mutation_p.R315Q	NM_003264	NP_003255	O60603	TLR2_HUMAN	toll-like receptor 2 precursor	315	Extracellular (Potential).				cellular response to diacyl bacterial lipopeptide|cellular response to lipoteichoic acid|cellular response to triacyl bacterial lipopeptide|detection of diacyl bacterial lipopeptide|detection of triacyl bacterial lipopeptide|I-kappaB phosphorylation|induction of apoptosis|inflammatory response|innate immune response|MyD88-dependent toll-like receptor signaling pathway|positive regulation of chemokine production|positive regulation of interferon-beta production|positive regulation of interleukin-12 production|positive regulation of interleukin-18 production|positive regulation of interleukin-6 production|positive regulation of interleukin-8 production|positive regulation of NF-kappaB import into nucleus|positive regulation of NF-kappaB transcription factor activity|positive regulation of nitric-oxide synthase biosynthetic process|positive regulation of toll-like receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tumor necrosis factor production|positive regulation of Wnt receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	cytoplasm|integral to plasma membrane|Toll-like receptor 1-Toll-like receptor 2 protein complex	Gram-positive bacterial cell surface binding|lipopolysaccharide receptor activity|peptidoglycan binding|protein heterodimerization activity|transmembrane receptor activity|triacyl lipopeptide binding			ovary(1)|lung(1)|breast(1)	3	all_hematologic(180;0.093)	Renal(120;0.117)				TTAACAATCCGGAGGCTGCAT	0.338													8	212	---	---	---	---	capture	Missense_Mutation	SNP	154625003	154625003	TLR2	4	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	15836	267
PLEKHG4B	153478	broad.mit.edu	37	5	163559	163559	+	Silent	SNP	G	A	A	rs114260538	byFrequency;by1000genomes	TCGA-76-4927-01	TCGA-76-4927-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:163559G>A	uc003jak.2	+	11	2354	c.2304G>A	c.(2302-2304)CCG>CCA	p.P768P		NM_052909	NP_443141	Q96PX9	PKH4B_HUMAN	pleckstrin homology domain containing, family G	768					regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity			skin(2)	2			all cancers(22;0.0253)|Lung(60;0.113)	Kidney(1;0.119)		AGAAGCTCCCGCTGTGGCAGC	0.652													22	47	---	---	---	---	capture	Silent	SNP	163559	163559	PLEKHG4B	5	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	11975	267
PLEKHG4B	153478	broad.mit.edu	37	5	163619	163619	+	Silent	SNP	G	A	A	rs114939243	byFrequency;by1000genomes	TCGA-76-4927-01	TCGA-76-4927-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:163619G>A	uc003jak.2	+	11	2414	c.2364G>A	c.(2362-2364)TCG>TCA	p.S788S		NM_052909	NP_443141	Q96PX9	PKH4B_HUMAN	pleckstrin homology domain containing, family G	788					regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity			skin(2)	2			all cancers(22;0.0253)|Lung(60;0.113)	Kidney(1;0.119)		CCTCCCCCTCGGGGCTCCACC	0.647													13	39	---	---	---	---	capture	Silent	SNP	163619	163619	PLEKHG4B	5	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	11975	267
PCDHA5	56143	broad.mit.edu	37	5	140202723	140202723	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4927-01	TCGA-76-4927-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140202723G>A	uc003lhl.2	+	1	1363	c.1363G>A	c.(1363-1365)GCG>ACG	p.A455T	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Missense_Mutation_p.A455T|PCDHA5_uc003lhj.1_Missense_Mutation_p.A455T	NM_018908	NP_061731	Q9Y5H7	PCDA5_HUMAN	protocadherin alpha 5 isoform 1 precursor	455	Extracellular (Potential).|Cadherin 5.				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding			ovary(1)|breast(1)|skin(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCCGGCGTTCGCGCAGCCCCA	0.677													55	102	---	---	---	---	capture	Missense_Mutation	SNP	140202723	140202723	PCDHA5	5	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	11430	267
GPR111	222611	broad.mit.edu	37	6	47647995	47647995	+	Missense_Mutation	SNP	C	A	A	rs141145040	by1000genomes	TCGA-76-4927-01	TCGA-76-4927-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:47647995C>A	uc010jzj.1	+	5	661	c.660C>A	c.(658-660)AAC>AAA	p.N220K	GPR111_uc010jzk.1_Missense_Mutation_p.N152K|GPR111_uc003oyy.2_RNA	NM_153839	NP_722581	Q8IZF7	GP111_HUMAN	G-protein coupled receptor 111	220	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			skin(1)	1						TCTTACACAACATATCAACAG	0.438													4	175	---	---	---	---	capture	Missense_Mutation	SNP	47647995	47647995	GPR111	6	C	A	A	A	1	0	0	0	0	1	0	0	0	220	17	4	4	6562	267
PACRG	135138	broad.mit.edu	37	6	163510341	163510341	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4927-01	TCGA-76-4927-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:163510341C>T	uc003qua.2	+	5	738	c.514C>T	c.(514-516)CTC>TTC	p.L172F	PACRG_uc003qub.2_Missense_Mutation_p.L172F|PACRG_uc003quc.2_Missense_Mutation_p.L172F	NM_152410	NP_689623	Q96M98	PACRG_HUMAN	parkin co-regulated gene protein isoform 1	172											0		Breast(66;2.41e-05)|Ovarian(120;0.0245)|Prostate(117;0.0273)|all_neural(5;0.0416)|Glioma(2;0.203)		OV - Ovarian serous cystadenocarcinoma(33;4.31e-19)|GBM - Glioblastoma multiforme(2;7.42e-11)|BRCA - Breast invasive adenocarcinoma(81;3.19e-05)|KIRC - Kidney renal clear cell carcinoma(3;0.205)|Kidney(3;0.242)		TCTCAAGGTCCTCCAGCATCT	0.448													78	174	---	---	---	---	capture	Missense_Mutation	SNP	163510341	163510341	PACRG	6	C	T	T	T	1	0	0	0	0	1	0	0	0	312	24	2	2	11274	267
INTS1	26173	broad.mit.edu	37	7	1522258	1522258	+	Silent	SNP	C	T	T			TCGA-76-4927-01	TCGA-76-4927-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:1522258C>T	uc003skn.2	-	27	3728	c.3627G>A	c.(3625-3627)TCG>TCA	p.S1209S	INTS1_uc003skp.1_3'UTR	NM_001080453	NP_001073922	Q8N201	INT1_HUMAN	integrator complex subunit 1	1209					snRNA processing	integral to membrane|integrator complex|nuclear membrane					0		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0181)|OV - Ovarian serous cystadenocarcinoma(56;6.99e-15)		GCGCCTCCTCCGATGTGTCCA	0.642													52	139	---	---	---	---	capture	Silent	SNP	1522258	1522258	INTS1	7	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	7698	267
TXNDC3	51314	broad.mit.edu	37	7	37890338	37890338	+	Splice_Site	SNP	G	A	A			TCGA-76-4927-01	TCGA-76-4927-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:37890338G>A	uc003tfn.2	+	5	570	c.198_splice	c.e5+1	p.V66_splice		NM_016616	NP_057700	Q8N427	TXND3_HUMAN	thioredoxin domain containing 3						cell differentiation|cell redox homeostasis|CTP biosynthetic process|GTP biosynthetic process|multicellular organismal development|spermatogenesis|UTP biosynthetic process	cytoplasm|microtubule cytoskeleton	ATP binding|nucleoside diphosphate kinase activity			ovary(1)|breast(1)|central_nervous_system(1)	3						TTTTGCTGTCGTAAGAATTTT	0.318									Kartagener_syndrome				62	207	---	---	---	---	capture	Splice_Site	SNP	37890338	37890338	TXNDC3	7	G	A	A	A	1	0	0	0	0	0	0	1	0	520	40	6	1	16680	267
PKD1L1	168507	broad.mit.edu	37	7	47854942	47854942	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4927-01	TCGA-76-4927-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:47854942G>A	uc003tny.1	-	47	7079	c.7079C>T	c.(7078-7080)CCG>CTG	p.P2360L	C7orf69_uc003tnz.3_Intron|C7orf69_uc003toa.1_Intron|PKD1L1_uc003tob.2_Missense_Mutation_p.P87L	NM_138295	NP_612152	Q8TDX9	PK1L1_HUMAN	polycystin-1L1	2360	Extracellular (Potential).				cell-cell adhesion	integral to membrane				ovary(8)|upper_aerodigestive_tract(2)|breast(1)	11						CTGAGCCCCCGGCACACGGGC	0.567													41	170	---	---	---	---	capture	Missense_Mutation	SNP	47854942	47854942	PKD1L1	7	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	11867	267
EGFR	1956	broad.mit.edu	37	7	55220274	55220274	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4927-01	TCGA-76-4927-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:55220274C>T	uc003tqk.2	+	6	910	c.664C>T	c.(664-666)CGC>TGC	p.R222C	EGFR_uc003tqh.2_Missense_Mutation_p.R222C|EGFR_uc003tqi.2_Missense_Mutation_p.R222C|EGFR_uc003tqj.2_Missense_Mutation_p.R222C|EGFR_uc010kzg.1_Missense_Mutation_p.R177C|EGFR_uc011kco.1_Missense_Mutation_p.R169C|EGFR_uc003tql.1_RNA	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	222	Approximate.|Extracellular (Potential).				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	p.V30_R297>G(5)|p.R222C(2)		lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	GTGCTCCGGGCGCTGCCGTGG	0.597		8	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			451	437	---	---	---	---	capture	Missense_Mutation	SNP	55220274	55220274	EGFR	7	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	4922	267
TAC1	6863	broad.mit.edu	37	7	97364145	97364145	+	Silent	SNP	C	T	T			TCGA-76-4927-01	TCGA-76-4927-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:97364145C>T	uc003uop.3	+	5	519	c.273C>T	c.(271-273)GGC>GGT	p.G91G	TAC1_uc003uoq.3_Silent_p.G91G|TAC1_uc003uor.3_Silent_p.G76G|TAC1_uc003uos.3_Silent_p.G76G	NM_003182	NP_003173	P20366	TKN1_HUMAN	tachykinin 1 isoform beta precursor	91					detection of abiotic stimulus|elevation of cytosolic calcium ion concentration|insemination|neuropeptide signaling pathway|synaptic transmission|tachykinin receptor signaling pathway	extracellular space					0	all_cancers(62;3.95e-09)|all_epithelial(64;1.1e-09)|Esophageal squamous(72;0.00448)|Lung NSC(181;0.0358)|all_lung(186;0.0384)				Bacitracin(DB00626)	TAGGACATGGCCAGATCTCTC	0.214													18	115	---	---	---	---	capture	Silent	SNP	97364145	97364145	TAC1	7	C	T	T	T	1	0	0	0	0	0	0	0	1	327	26	2	2	15386	267
FAM71F1	84691	broad.mit.edu	37	7	128369997	128369997	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4927-01	TCGA-76-4927-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:128369997G>A	uc003vno.1	+	6	948	c.895G>A	c.(895-897)GAC>AAC	p.D299N	FAM71F1_uc003vnm.1_RNA|FAM71F1_uc003vnn.1_Missense_Mutation_p.D198N|FAM71F1_uc003vnp.1_Missense_Mutation_p.D297N	NM_032599	NP_115988	Q96KD3	F71F1_HUMAN	testes development-related NYD-SP18	299								p.D299G(1)		skin(1)	1						TTGCACCTGTGACCTACGTTG	0.532													11	477	---	---	---	---	capture	Missense_Mutation	SNP	128369997	128369997	FAM71F1	7	G	A	A	A	1	0	0	0	0	1	0	0	0	585	45	2	2	5560	267
LMBR1	64327	broad.mit.edu	37	7	156556439	156556439	+	Silent	SNP	C	T	T			TCGA-76-4927-01	TCGA-76-4927-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:156556439C>T	uc003wmw.3	-	6	689	c.474G>A	c.(472-474)GCG>GCA	p.A158A	LMBR1_uc003wmv.3_Silent_p.A6A|LMBR1_uc003wmx.3_Silent_p.A6A|LMBR1_uc010lqn.2_Silent_p.A158A|LMBR1_uc011kvx.1_Silent_p.A137A	NM_022458	NP_071903	Q8WVP7	LMBR1_HUMAN	limb region 1 protein	158	Helical; (Potential).					integral to membrane	receptor activity				0	Ovarian(565;0.218)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.00231)	UCEC - Uterine corpus endometrioid carcinoma (81;0.208)		GAATGAGTAACGCAAGAAGAA	0.378													77	266	---	---	---	---	capture	Silent	SNP	156556439	156556439	LMBR1	7	C	T	T	T	1	0	0	0	0	0	0	0	1	236	19	1	1	8760	267
UBXN8	7993	broad.mit.edu	37	8	30609013	30609013	+	Missense_Mutation	SNP	A	C	C			TCGA-76-4927-01	TCGA-76-4927-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:30609013A>C	uc003xii.2	+	2	206	c.189A>C	c.(187-189)AAA>AAC	p.K63N	UBXN8_uc010lvi.2_Intron|UBXN8_uc011lbb.1_RNA|UBXN8_uc003xij.2_RNA	NM_005671	NP_005662	O00124	UBXN8_HUMAN	reproduction 8	63					single fertilization						0						ACTCATTTAAATCTCCCCAAG	0.338													17	44	---	---	---	---	capture	Missense_Mutation	SNP	30609013	30609013	UBXN8	8	A	C	C	C	1	0	0	0	0	1	0	0	0	50	4	4	4	16801	267
TG	7038	broad.mit.edu	37	8	134107432	134107432	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4927-01	TCGA-76-4927-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:134107432C>T	uc003ytw.2	+	42	7425	c.7384C>T	c.(7384-7386)CTC>TTC	p.L2462F	TG_uc010mdw.2_Missense_Mutation_p.L1221F|TG_uc011ljb.1_Missense_Mutation_p.L831F|TG_uc011ljc.1_Missense_Mutation_p.L595F|SLA_uc003ytz.2_Intron|SLA_uc011lje.1_Intron|SLA_uc011ljf.1_Intron|SLA_uc011ljg.1_Intron|SLA_uc010mea.2_Intron	NM_003235	NP_003226	P01266	THYG_HUMAN	thyroglobulin precursor	2462					hormone biosynthetic process|signal transduction|thyroid gland development|thyroid hormone generation	extracellular space	hormone activity			ovary(8)|breast(4)|pancreas(1)|central_nervous_system(1)|skin(1)	15	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		TGCCAATGTCCTCAATGATGC	0.448													52	178	---	---	---	---	capture	Missense_Mutation	SNP	134107432	134107432	TG	8	C	T	T	T	1	0	0	0	0	1	0	0	0	312	24	2	2	15698	267
INSL6	11172	broad.mit.edu	37	9	5185468	5185468	+	Silent	SNP	G	A	A	rs141353328	byFrequency	TCGA-76-4927-01	TCGA-76-4927-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:5185468G>A	uc003zix.2	-	1	151	c.135C>T	c.(133-135)TGC>TGT	p.C45C		NM_007179	NP_009110	Q9Y581	INSL6_HUMAN	insulin-like 6 precursor	45						extracellular region	hormone activity				0	all_hematologic(13;0.137)	Breast(48;0.147)|Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.0128)|Lung(218;0.145)		TGGCATGGCCGCAGAGTTTTT	0.542													73	124	---	---	---	---	capture	Silent	SNP	5185468	5185468	INSL6	9	G	A	A	A	1	0	0	0	0	0	0	0	1	490	38	1	1	7693	267
CTSL2	1515	broad.mit.edu	37	9	99800218	99800218	+	Missense_Mutation	SNP	G	C	C			TCGA-76-4927-01	TCGA-76-4927-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:99800218G>C	uc004awt.2	-	2	305	c.108C>G	c.(106-108)CAC>CAG	p.H36Q	CTSL2_uc010msi.2_Missense_Mutation_p.H36Q|CTSL2_uc004awu.2_5'UTR|CTSL2_uc010msj.1_5'UTR|CTSL2_uc010msk.2_5'UTR	NM_001333	NP_001324	O60911	CATL2_HUMAN	cathepsin L2 preproprotein	36						lysosome	cysteine-type endopeptidase activity				0		Acute lymphoblastic leukemia(62;0.0559)				ATAATCTTCTGTGTGTTGCCT	0.483													62	141	---	---	---	---	capture	Missense_Mutation	SNP	99800218	99800218	CTSL2	9	G	C	C	C	1	0	0	0	0	1	0	0	0	620	48	4	4	4000	267
FAM102A	399665	broad.mit.edu	37	9	130710496	130710496	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4927-01	TCGA-76-4927-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:130710496G>A	uc004bsx.1	-	6	549	c.470C>T	c.(469-471)TCG>TTG	p.S157L	FAM102A_uc004bsw.1_Missense_Mutation_p.S15L|FAM102A_uc004bsy.1_5'UTR	NM_001035254	NP_001030331	Q5T9C2	F102A_HUMAN	early estrogen-induced gene 1 protein isoform a	157	Ser-rich.									ovary(1)	1						CTTGGCAGTCGATGGTGGCCT	0.602													8	158	---	---	---	---	capture	Missense_Mutation	SNP	130710496	130710496	FAM102A	9	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	5336	267
PHKA1	5255	broad.mit.edu	37	X	71895990	71895990	+	Missense_Mutation	SNP	A	G	G			TCGA-76-4927-01	TCGA-76-4927-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:71895990A>G	uc004eax.3	-	6	849	c.548T>C	c.(547-549)ATA>ACA	p.I183T	PHKA1_uc004eay.3_Missense_Mutation_p.I183T|PHKA1_uc011mqi.1_Missense_Mutation_p.I183T	NM_002637	NP_002628	P46020	KPB1_HUMAN	phosphorylase kinase, alpha 1 (muscle) isoform	183					glucose metabolic process|glycogen catabolic process	cytosol|plasma membrane	calmodulin binding|glucan 1,4-alpha-glucosidase activity|phosphorylase kinase activity			ovary(3)|skin(1)	4	Renal(35;0.156)					ACGTTCCCATATCCCGAAGTC	0.388													47	36	---	---	---	---	capture	Missense_Mutation	SNP	71895990	71895990	PHKA1	23	A	G	G	G	1	0	0	0	0	1	0	0	0	208	16	3	3	11746	267
PHF6	84295	broad.mit.edu	37	X	133551307	133551307	+	Missense_Mutation	SNP	G	C	C			TCGA-76-4927-01	TCGA-76-4927-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:133551307G>C	uc004exj.2	+	9	1145	c.943G>C	c.(943-945)GAA>CAA	p.E315Q	PHF6_uc004exk.2_Missense_Mutation_p.E315Q|PHF6_uc011mvk.1_Missense_Mutation_p.E281Q|PHF6_uc004exi.2_Missense_Mutation_p.E316Q	NM_001015877	NP_001015877	Q8IWS0	PHF6_HUMAN	PHD finger protein 6 isoform 1	315	PHD-type 2; degenerate.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleolus	zinc ion binding			ovary(1)	1	Acute lymphoblastic leukemia(192;0.000127)					TAAATACATTGAAAATATGTC	0.353													3	103	---	---	---	---	capture	Missense_Mutation	SNP	133551307	133551307	PHF6	23	G	C	C	C	1	0	0	0	0	1	0	0	0	585	45	4	4	11741	267
SLITRK4	139065	broad.mit.edu	37	X	142717983	142717983	+	Silent	SNP	T	A	A			TCGA-76-4927-01	TCGA-76-4927-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:142717983T>A	uc004fbx.2	-	2	1318	c.942A>T	c.(940-942)GGA>GGT	p.G314G	SLITRK4_uc004fby.2_Silent_p.G314G	NM_173078	NP_775101	Q8IW52	SLIK4_HUMAN	slit and trk like 4 protein precursor	314	Extracellular (Potential).					integral to membrane				upper_aerodigestive_tract(1)|large_intestine(1)	2	Acute lymphoblastic leukemia(192;6.56e-05)					CTGCAACGATTCCAGAGATCT	0.463													11	189	---	---	---	---	capture	Silent	SNP	142717983	142717983	SLITRK4	23	T	A	A	A	1	0	0	0	0	0	0	0	1	795	62	4	4	14637	267
PTEN	5728	broad.mit.edu	37	10	89692905	89692905	+	Frame_Shift_Del	DEL	G	-	-	rs121913292		TCGA-76-4927-01	TCGA-76-4927-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:89692905delG	uc001kfb.2	+	6	1420	c.389delG	c.(388-390)CGAfs	p.R130fs		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog	130	Phosphatase tensin-type.		R -> L (in CD and endometrial hyperplasia; loss of phosphatase activity towards Ins(1,3,4,5)P4; retains ability to bind phospholipid membranes).|R -> Q (in CD; loss of phosphatase activity towards Ins(1,3,4,5)P4; retains ability to bind phospholipid membranes).|R -> G (loss of phosphatase activity towards Ins(1,3,4,5)P4 and PtdIns(3,4,5)P3).	R->M: Does not affect the ability to inhibit AKT/PKB activation.	activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.R130G(65)|p.R130*(61)|p.R130Q(43)|p.R130fs*4(12)|p.R130L(7)|p.R55fs*1(4)|p.R130P(4)|p.K128_R130del(3)|p.Y27_N212>Y(2)|p.?(2)|p.Y27fs*1(2)|p.R130R(1)|p.K128fs*47(1)|p.A121_F145del(1)|p.R130fs*2(1)|p.T131fs*50(1)|p.F56fs*2(1)		endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		GGAAAGGGACGAACTGGTGTA	0.403	R130Q(MDAPCA2B_PROSTATE)|R130Q(MFE296_ENDOMETRIUM)|R130fs*4(AN3CA_ENDOMETRIUM)|R130Q(JHUEM1_ENDOMETRIUM)	31	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			13	169	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	89692905	89692905	PTEN	10	G	-	-	-	1	0	1	0	1	0	0	0	0	481	37	5	5	12633	267
PIK3R1	5295	broad.mit.edu	37	5	67575431	67575432	+	Frame_Shift_Ins	INS	-	A	A			TCGA-76-4927-01	TCGA-76-4927-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:67575431_67575432insA	uc003jva.2	+	5	1064_1065	c.504_505insA	c.(502-507)GATACAfs	p.D168fs	PIK3R1_uc003jvb.2_Frame_Shift_Ins_p.D168fs	NM_181523	NP_852664	P27986	P85A_HUMAN	phosphoinositide-3-kinase, regulatory subunit 1	168_169	Rho-GAP.				epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|growth hormone receptor signaling pathway|insulin receptor signaling pathway|insulin-like growth factor receptor signaling pathway|interspecies interaction between organisms|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol 3-kinase cascade|phosphatidylinositol phosphorylation|phosphatidylinositol-mediated signaling|platelet activation|positive regulation of establishment of protein localization in plasma membrane|positive regulation of glucose import|T cell costimulation|T cell receptor signaling pathway	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex	1-phosphatidylinositol binding|ErbB-3 class receptor binding|insulin binding|insulin receptor binding|insulin receptor substrate binding|insulin-like growth factor receptor binding|phosphatidylinositol 3-kinase regulator activity|protein phosphatase binding	p.?(1)		endometrium(34)|central_nervous_system(27)|large_intestine(20)|breast(7)|ovary(5)|haematopoietic_and_lymphoid_tissue(3)|lung(2)|urinary_tract(1)|skin(1)|pancreas(1)	101		Lung NSC(167;1.99e-05)|Prostate(74;0.00308)|Ovarian(174;0.00473)|Colorectal(97;0.0176)		OV - Ovarian serous cystadenocarcinoma(47;3.76e-51)|Lung(70;0.0211)	Isoproterenol(DB01064)	GTTTCCTAGATACACCCTCCGT	0.381			Mis|F|O		gliobastoma|ovarian|colorectal					TCGA GBM(4;<1E-08)			14	207	---	---	---	---	capture_indel	Frame_Shift_Ins	INS	67575431	67575432	PIK3R1	5	-	A	A	A	1	0	1	1	0	0	0	0	0	634	49	5	5	11821	267
