Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
TNFRSF4	7293	broad.mit.edu	37	1	1147004	1147004	+	Silent	SNP	C	T	T			TCGA-76-4929-01	TCGA-76-4929-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:1147004C>T	uc001ade.2	-	7	770	c.765G>A	c.(763-765)GGG>GGA	p.G255G	TNFRSF4_uc001adf.2_Silent_p.G285G	NM_003327	NP_003318	P43489	TNR4_HUMAN	tumor necrosis factor receptor superfamily,	255	Cytoplasmic (Potential).				immune response|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription, DNA-dependent|positive regulation of B cell proliferation|positive regulation of immunoglobulin secretion|T cell proliferation	integral to plasma membrane	tumor necrosis factor receptor activity				0	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;3.73e-36)|OV - Ovarian serous cystadenocarcinoma(86;1.01e-21)|Colorectal(212;3.94e-05)|COAD - Colon adenocarcinoma(227;4.22e-05)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.0025)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)		AACTGCCTCCCCCTGGGGAGG	0.677													11	33	---	---	---	---	capture	Silent	SNP	1147004	1147004	TNFRSF4	1	C	T	T	T	1	0	0	0	0	0	0	0	1	275	22	2	2	16180	269
PABPC4	8761	broad.mit.edu	37	1	40030160	40030160	+	Missense_Mutation	SNP	C	T	T	rs139185037		TCGA-76-4929-01	TCGA-76-4929-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:40030160C>T	uc010oiv.1	-	10	2286	c.1388G>A	c.(1387-1389)CGC>CAC	p.R463H	PABPC4_uc001cdl.2_Missense_Mutation_p.R463H|PABPC4_uc001cdm.2_Missense_Mutation_p.R463H	NM_003819	NP_003810	Q13310	PABP4_HUMAN	poly A binding protein, cytoplasmic 4 isoform 2	463					blood coagulation|RNA catabolic process|RNA processing|translation	cytoplasm|ribonucleoprotein complex	nucleotide binding|poly(A) RNA binding|poly(U) RNA binding|protein binding				0	Lung NSC(20;1.55e-06)|Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;2.89e-18)|Epithelial(16;6.17e-17)|all cancers(16;1.18e-15)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)			AGCCAGATGGCGAAGAGTTGG	0.542													54	93	---	---	---	---	capture	Missense_Mutation	SNP	40030160	40030160	PABPC4	1	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	11270	269
CASQ1	844	broad.mit.edu	37	1	160162639	160162639	+	Silent	SNP	A	T	T			TCGA-76-4929-01	TCGA-76-4929-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:160162639A>T	uc010pja.1	+	2	584	c.327A>T	c.(325-327)GTA>GTT	p.V109V		NM_001231	NP_001222	P31415	CASQ1_HUMAN	calsequestrin 1	109						mitochondrial matrix|sarcoplasmic reticulum lumen|smooth endoplasmic reticulum	calcium ion binding			central_nervous_system(1)	1	all_cancers(52;2.56e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			TCGGGCTGGTAGACTCTGAGA	0.522											OREG0013927	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	103	167	---	---	---	---	capture	Silent	SNP	160162639	160162639	CASQ1	1	A	T	T	T	1	0	0	0	0	0	0	0	1	184	15	4	4	2656	269
TNFSF18	8995	broad.mit.edu	37	1	173010533	173010533	+	Silent	SNP	G	A	A			TCGA-76-4929-01	TCGA-76-4929-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:173010533G>A	uc001giu.2	-	3	575	c.574C>T	c.(574-576)CTA>TTA	p.L192L		NM_005092	NP_005083	Q9UNG2	TNF18_HUMAN	tumor necrosis factor (ligand) superfamily,	192	Extracellular (Potential).				anti-apoptosis|cell-cell signaling|immune response|signal transduction	extracellular space|integral to membrane	cytokine activity|tumor necrosis factor receptor binding			central_nervous_system(1)	1						GGATTTGCTAGTAAAATGATA	0.418													52	75	---	---	---	---	capture	Silent	SNP	173010533	173010533	TNFSF18	1	G	A	A	A	1	0	0	0	0	0	0	0	1	464	36	2	2	16192	269
LHX9	56956	broad.mit.edu	37	1	197887088	197887088	+	Silent	SNP	C	T	T			TCGA-76-4929-01	TCGA-76-4929-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:197887088C>T	uc001guk.1	+	1	572	c.135C>T	c.(133-135)GCC>GCT	p.A45A	LHX9_uc009wzc.1_RNA|LHX9_uc001gui.1_Silent_p.A36A|LHX9_uc001guj.1_Silent_p.A51A	NM_020204	NP_064589	Q9NQ69	LHX9_HUMAN	LIM homeobox 9 isoform 1	45					motor axon guidance|negative regulation of transcription, DNA-dependent	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity|zinc ion binding			ovary(1)	1						AGACTGAGGCCCGTCTGGCCA	0.662													45	84	---	---	---	---	capture	Silent	SNP	197887088	197887088	LHX9	1	C	T	T	T	1	0	0	0	0	0	0	0	1	275	22	2	2	8697	269
NEBL	10529	broad.mit.edu	37	10	21112168	21112168	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4929-01	TCGA-76-4929-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:21112168C>T	uc001iqi.2	-	19	2328	c.1931G>A	c.(1930-1932)AGA>AAA	p.R644K	NEBL_uc001iqj.2_RNA|NEBL_uc001iqk.2_Intron|NEBL_uc001iql.1_RNA	NM_006393	NP_006384	O76041	NEBL_HUMAN	nebulette sarcomeric isoform	644	Nebulin 18.				regulation of actin filament length		actin binding|structural constituent of muscle			ovary(2)	2						TTCTTTAACTCTCTTTAGTTC	0.284													34	11	---	---	---	---	capture	Missense_Mutation	SNP	21112168	21112168	NEBL	10	C	T	T	T	1	0	0	0	0	1	0	0	0	416	32	2	2	10210	269
RBP3	5949	broad.mit.edu	37	10	48390589	48390589	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4929-01	TCGA-76-4929-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:48390589C>T	uc001jez.2	-	1	403	c.289G>A	c.(289-291)GAG>AAG	p.E97K		NM_002900	NP_002891	P10745	RET3_HUMAN	retinol-binding protein 3 precursor	97	4 X approximate tandem repeats.|1.				lipid metabolic process|proteolysis|transport|visual perception	interphotoreceptor matrix	retinal binding|serine-type peptidase activity			large_intestine(1)|central_nervous_system(1)	2					Vitamin A(DB00162)	GGGGGAGGCTCGGGGGTGCTG	0.627													69	20	---	---	---	---	capture	Missense_Mutation	SNP	48390589	48390589	RBP3	10	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	13052	269
ADO	84890	broad.mit.edu	37	10	64564912	64564912	+	Silent	SNP	C	T	T			TCGA-76-4929-01	TCGA-76-4929-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:64564912C>T	uc001jmg.2	+	1	397	c.93C>T	c.(91-93)TCC>TCT	p.S31S		NM_032804	NP_116193	Q96SZ5	AEDO_HUMAN	2-aminoethanethiol (cysteamine) dioxygenase	31							cysteamine dioxygenase activity|metal ion binding				0	Prostate(12;0.0297)|all_hematologic(501;0.228)					GCGGCGCTTCCGATCGCGACG	0.711													10	0	---	---	---	---	capture	Silent	SNP	64564912	64564912	ADO	10	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	325	269
NT5C2	22978	broad.mit.edu	37	10	104934623	104934623	+	Silent	SNP	G	A	A			TCGA-76-4929-01	TCGA-76-4929-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:104934623G>A	uc001kwo.2	-	3	279	c.93C>T	c.(91-93)GCC>GCT	p.A31A	NT5C2_uc001kwq.2_Silent_p.A31A|NT5C2_uc001kwp.2_Intron	NM_012229	NP_036361	P49902	5NTC_HUMAN	5'-nucleotidase, cytosolic II	31					purine base metabolic process|purine nucleotide catabolic process	cytosol	5'-nucleotidase activity|metal ion binding|nucleotide binding|protein binding				0		all_hematologic(284;0.176)|Colorectal(252;0.178)		Epithelial(162;1.33e-08)|all cancers(201;1.04e-07)|BRCA - Breast invasive adenocarcinoma(275;0.159)	Adenosine triphosphate(DB00171)|Ribavirin(DB00811)	ACCGATGATAGGCTTCTCGAC	0.254													9	168	---	---	---	---	capture	Silent	SNP	104934623	104934623	NT5C2	10	G	A	A	A	1	0	0	0	0	0	0	0	1	444	35	2	2	10594	269
SLC22A25	387601	broad.mit.edu	37	11	62931319	62931319	+	Missense_Mutation	SNP	G	C	C			TCGA-76-4929-01	TCGA-76-4929-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:62931319G>C	uc001nwr.1	-	9	1621	c.1621C>G	c.(1621-1623)CCT>GCT	p.P541A	SLC22A10_uc010rmo.1_Intron|SLC22A25_uc009yoq.1_RNA|SLC22A25_uc001nws.1_RNA	NM_199352	NP_955384	Q6T423	S22AP_HUMAN	putative UST1-like organic anion transporter	541	Cytoplasmic (Potential).				transmembrane transport	integral to membrane				ovary(3)|skin(1)	4						CTCCTCTGAGGGGCAGCTAGG	0.507													8	291	---	---	---	---	capture	Missense_Mutation	SNP	62931319	62931319	SLC22A25	11	G	C	C	C	1	0	0	0	0	1	0	0	0	559	43	4	4	14346	269
LRRC32	2615	broad.mit.edu	37	11	76371933	76371933	+	Missense_Mutation	SNP	G	A	A	rs147861179		TCGA-76-4929-01	TCGA-76-4929-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:76371933G>A	uc001oxq.3	-	3	947	c.704C>T	c.(703-705)ACG>ATG	p.T235M	LRRC32_uc001oxr.3_Missense_Mutation_p.T235M|LRRC32_uc010rsf.1_Missense_Mutation_p.T235M	NM_005512	NP_005503	Q14392	LRC32_HUMAN	leucine rich repeat containing 32 precursor	235	LRR 8.|Extracellular (Potential).					integral to plasma membrane					0						CTGGGAGGCCGTCTGAAAGGC	0.617													4	77	---	---	---	---	capture	Missense_Mutation	SNP	76371933	76371933	LRRC32	11	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	8903	269
PIK3C2G	5288	broad.mit.edu	37	12	18544153	18544153	+	Missense_Mutation	SNP	T	C	C			TCGA-76-4929-01	TCGA-76-4929-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:18544153T>C	uc001rdt.2	+	14	2086	c.1970T>C	c.(1969-1971)ATT>ACT	p.I657T	PIK3C2G_uc010sia.1_RNA|PIK3C2G_uc010sib.1_Missense_Mutation_p.I698T|PIK3C2G_uc010sic.1_Missense_Mutation_p.I476T	NM_004570	NP_004561	O75747	P3C2G_HUMAN	phosphoinositide-3-kinase, class 2 gamma	657					cell communication|phosphatidylinositol-mediated signaling	membrane|phosphatidylinositol 3-kinase complex	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol binding|phosphatidylinositol-4-phosphate 3-kinase activity			lung(8)|central_nervous_system(6)|breast(3)|stomach(2)|ovary(2)	21		Hepatocellular(102;0.194)				ATAAAACATATTGCCAGACTT	0.383													38	44	---	---	---	---	capture	Missense_Mutation	SNP	18544153	18544153	PIK3C2G	12	T	C	C	C	1	0	0	0	0	1	0	0	0	676	52	3	3	11814	269
KSR2	283455	broad.mit.edu	37	12	117962680	117962680	+	Silent	SNP	C	T	T	rs140960062	by1000genomes	TCGA-76-4929-01	TCGA-76-4929-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:117962680C>T	uc001two.2	-	14	2164	c.2109G>A	c.(2107-2109)CCG>CCA	p.P703P		NM_173598	NP_775869	Q6VAB6	KSR2_HUMAN	kinase suppressor of ras 2	732	Protein kinase.				intracellular signal transduction	cytoplasm|membrane	ATP binding|metal ion binding|protein serine/threonine kinase activity			lung(10)|central_nervous_system(2)|stomach(1)|large_intestine(1)|breast(1)	15	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					CCAGGTGAGGCGGGCTCATGC	0.473													23	38	---	---	---	---	capture	Silent	SNP	117962680	117962680	KSR2	12	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	8502	269
TMEM132D	121256	broad.mit.edu	37	12	130184667	130184667	+	Missense_Mutation	SNP	G	A	A	rs146143180		TCGA-76-4929-01	TCGA-76-4929-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:130184667G>A	uc009zyl.1	-	2	984	c.656C>T	c.(655-657)CCG>CTG	p.P219L		NM_133448	NP_597705	Q14C87	T132D_HUMAN	transmembrane protein 132D precursor	219	Extracellular (Potential).					integral to membrane		p.P219L(1)		ovary(10)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	14	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		GGTCCCCTCCGGCTGGTCCAC	0.682													38	70	---	---	---	---	capture	Missense_Mutation	SNP	130184667	130184667	TMEM132D	12	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	15931	269
SFRS8	6433	broad.mit.edu	37	12	132249171	132249171	+	Missense_Mutation	SNP	T	A	A			TCGA-76-4929-01	TCGA-76-4929-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:132249171T>A	uc001uja.1	+	12	2031	c.1891T>A	c.(1891-1893)TGT>AGT	p.C631S	SFRS8_uc010tbn.1_Missense_Mutation_p.C631S|SFRS8_uc001ujb.1_Missense_Mutation_p.C424S	NM_004592	NP_004583	Q12872	SFSWA_HUMAN	splicing factor, arginine/serine-rich 8	631					mRNA splice site selection|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein binding|RNA binding				0	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;3.44e-07)|Epithelial(86;2.94e-06)|all cancers(50;4.82e-05)		TGCCCCACCCTGTGTAGTTGT	0.423													3	69	---	---	---	---	capture	Missense_Mutation	SNP	132249171	132249171	SFRS8	12	T	A	A	A	1	0	0	0	0	1	0	0	0	715	55	4	4	14076	269
LRFN5	145581	broad.mit.edu	37	14	42356720	42356720	+	Missense_Mutation	SNP	G	T	T			TCGA-76-4929-01	TCGA-76-4929-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:42356720G>T	uc001wvm.2	+	3	2090	c.892G>T	c.(892-894)GTC>TTC	p.V298F	LRFN5_uc010ana.2_Missense_Mutation_p.V298F	NM_152447	NP_689660	Q96NI6	LRFN5_HUMAN	leucine rich repeat and fibronectin type III	298	Extracellular (Potential).|Ig-like.					integral to membrane				ovary(5)|pancreas(2)|central_nervous_system(1)	8			LUAD - Lung adenocarcinoma(50;0.0223)|Lung(238;0.0728)	GBM - Glioblastoma multiforme(112;0.00847)		TGAGATGAGAGTCCTGGAGGG	0.478										HNSCC(30;0.082)			82	30	---	---	---	---	capture	Missense_Mutation	SNP	42356720	42356720	LRFN5	14	G	T	T	T	1	0	0	0	0	1	0	0	0	468	36	4	4	8857	269
MOAP1	64112	broad.mit.edu	37	14	93650454	93650454	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4929-01	TCGA-76-4929-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:93650454G>A	uc001ybj.2	-	3	504	c.134C>T	c.(133-135)CCC>CTC	p.P45L	C14orf109_uc001ybk.3_5'Flank|C14orf109_uc010auo.2_5'Flank	NM_022151	NP_071434	Q96BY2	MOAP1_HUMAN	modulator of apoptosis 1	45					activation of caspase activity|apoptotic nuclear change	cytoplasm	protein homodimerization activity			skin(2)|ovary(1)	3		all_cancers(154;0.00528)|Acute lymphoblastic leukemia(33;0.0497)|all_epithelial(191;0.125)|all_neural(303;0.13)		Epithelial(152;0.178)|all cancers(159;0.2)|COAD - Colon adenocarcinoma(157;0.204)		ctcccccaagggagctaaacc	0.000													128	30	---	---	---	---	capture	Missense_Mutation	SNP	93650454	93650454	MOAP1	14	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	9592	269
IRX5	10265	broad.mit.edu	37	16	54967470	54967470	+	Silent	SNP	C	T	T			TCGA-76-4929-01	TCGA-76-4929-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:54967470C>T	uc002ehv.2	+	3	1137	c.1137C>T	c.(1135-1137)GCC>GCT	p.A379A	IRX5_uc002ehw.2_Silent_p.A313A	NM_005853	NP_005844	P78411	IRX5_HUMAN	iroquois homeobox protein 5	379					response to stimulus|visual perception	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|vitamin D binding				0						CGTCGCCGGCCCCGGCGCCGT	0.721													9	11	---	---	---	---	capture	Silent	SNP	54967470	54967470	IRX5	16	C	T	T	T	1	0	0	0	0	0	0	0	1	275	22	2	2	7770	269
CLEC3A	10143	broad.mit.edu	37	16	78064624	78064624	+	Silent	SNP	C	T	T			TCGA-76-4929-01	TCGA-76-4929-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:78064624C>T	uc002ffh.3	+	3	561	c.480C>T	c.(478-480)AAC>AAT	p.N160N		NM_005752	NP_005743	O75596	CLC3A_HUMAN	C-type lectin domain family 3 member A	160	C-type lectin.				skeletal system development	extracellular region	sugar binding				0						CACAGCCTAACGGTGGCAAGC	0.522													55	118	---	---	---	---	capture	Silent	SNP	78064624	78064624	CLEC3A	16	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	3475	269
ACAP1	9744	broad.mit.edu	37	17	7253543	7253543	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4929-01	TCGA-76-4929-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7253543G>A	uc002ggd.2	+	20	2265	c.2059G>A	c.(2059-2061)GAC>AAC	p.D687N	KCTD11_uc002gge.3_5'Flank	NM_014716	NP_055531	Q15027	ACAP1_HUMAN	centaurin beta1	687	Required for interaction with GULP1.|ANK 3.				intracellular signal transduction|lipid metabolic process|protein transport|regulation of ARF GTPase activity		ARF GTPase activator activity|phospholipase C activity|protein binding|zinc ion binding			breast(2)|large_intestine(1)	3						AGCCAACGCTGACATCGTCAC	0.682													64	76	---	---	---	---	capture	Missense_Mutation	SNP	7253543	7253543	ACAP1	17	G	A	A	A	1	0	0	0	0	1	0	0	0	585	45	2	2	118	269
TP53	7157	broad.mit.edu	37	17	7574003	7574003	+	Nonsense_Mutation	SNP	G	A	A			TCGA-76-4929-01	TCGA-76-4929-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7574003G>A	uc002gim.2	-	10	1218	c.1024C>T	c.(1024-1026)CGA>TGA	p.R342*	TP53_uc002gig.1_Intron|TP53_uc002gih.2_Intron|TP53_uc010cne.1_Intron|TP53_uc010cnf.1_3'UTR|TP53_uc010cng.1_3'UTR|TP53_uc002gii.1_Nonsense_Mutation_p.R210*|TP53_uc010cnh.1_3'UTR|TP53_uc010cni.1_3'UTR|TP53_uc002gij.2_Nonsense_Mutation_p.R342*	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	342	Oligomerization.|Interaction with HIPK1 (By similarity).|Interaction with CARM1.|Nuclear export signal.|Interaction with HIPK2.		R -> P (in sporadic cancers; somatic mutation).|R -> Q (in sporadic cancers; somatic mutation).|R -> L (in a sporadic cancer; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.R342*(49)|p.0?(7)|p.R342fs*3(5)|p.R342P(3)|p.R342Q(2)|p.?(1)|p.R342_N345delRELN(1)|p.I332fs*5(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		TTCAGCTCTCGGAACATCTCG	0.498		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			29	25	---	---	---	---	capture	Nonsense_Mutation	SNP	7574003	7574003	TP53	17	G	A	A	A	1	0	0	0	0	0	1	0	0	506	39	5	1	16264	269
TP53	7157	broad.mit.edu	37	17	7578476	7578476	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4929-01	TCGA-76-4929-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7578476G>A	uc002gim.2	-	5	648	c.454C>T	c.(454-456)CCG>TCG	p.P152S	TP53_uc002gig.1_Missense_Mutation_p.P152S|TP53_uc002gih.2_Missense_Mutation_p.P152S|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.P20S|TP53_uc010cng.1_Missense_Mutation_p.P20S|TP53_uc002gii.1_Missense_Mutation_p.P20S|TP53_uc010cnh.1_Missense_Mutation_p.P152S|TP53_uc010cni.1_Missense_Mutation_p.P152S|TP53_uc002gij.2_Missense_Mutation_p.P152S|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Missense_Mutation_p.P59S|TP53_uc002gio.2_Missense_Mutation_p.P20S|TP53_uc010vug.1_Missense_Mutation_p.P113S	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	152	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		P -> R (in sporadic cancers; somatic mutation).|P -> T (in sporadic cancers; somatic mutation).|P -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation).|P -> Q (in sporadic cancers; somatic mutation).|P -> S (in sporadic cancers; somatic mutation).|P -> A (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.P152L(57)|p.P152S(21)|p.P152fs*18(17)|p.P152T(7)|p.0?(7)|p.P152fs*29(5)|p.P152P(5)|p.P152Q(4)|p.P152fs*14(4)|p.P152fs*28(3)|p.P152R(3)|p.T150fs*16(3)|p.P152A(2)|p.P153fs*16(1)|p.P151_V173del23(1)|p.P152_P153del(1)|p.D148_T155delDSTPPPGT(1)|p.T150_P153delTPPP(1)|p.D148fs*23(1)|p.P152del(1)|p.S149fs*72(1)|p.S149fs*17(1)|p.Q144_G154del11(1)|p.P152_P153insXXX(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		GTGCCGGGCGGGGGTGTGGAA	0.607		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			37	50	---	---	---	---	capture	Missense_Mutation	SNP	7578476	7578476	TP53	17	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	16264	269
PFAS	5198	broad.mit.edu	37	17	8170745	8170745	+	Silent	SNP	G	A	A			TCGA-76-4929-01	TCGA-76-4929-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:8170745G>A	uc002gkr.2	+	25	3372	c.3231G>A	c.(3229-3231)CGG>CGA	p.R1077R	PFAS_uc010vuv.1_Silent_p.R653R|PFAS_uc002gks.2_Silent_p.R156R	NM_012393	NP_036525	O15067	PUR4_HUMAN	phosphoribosylformylglycinamidine synthase	1077	Glutamine amidotransferase type-1.				'de novo' IMP biosynthetic process|glutamine metabolic process|purine base metabolic process	cytosol	ATP binding|phosphoribosylformylglycinamidine synthase activity|protein binding			ovary(2)|central_nervous_system(2)|pancreas(1)	5					L-Glutamic Acid(DB00142)|L-Glutamine(DB00130)	ATGGAGACCGGGAGATGGCCG	0.612													80	108	---	---	---	---	capture	Silent	SNP	8170745	8170745	PFAS	17	G	A	A	A	1	0	0	0	0	0	0	0	1	548	43	2	2	11657	269
KRT13	3860	broad.mit.edu	37	17	39661389	39661389	+	Silent	SNP	G	A	A			TCGA-76-4929-01	TCGA-76-4929-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:39661389G>A	uc002hwu.1	-	1	477	c.414C>T	c.(412-414)GAC>GAT	p.D138D	KRT13_uc002hwv.1_Silent_p.D138D|KRT13_uc002hww.2_Silent_p.D31D|KRT13_uc010wfr.1_Silent_p.D31D|KRT13_uc010cxo.2_Silent_p.D138D|KRT13_uc002hwx.1_Silent_p.D126D	NM_153490	NP_705694	P13646	K1C13_HUMAN	keratin 13 isoform a	138	Coil 1A.|Rod.				epidermis development	intermediate filament	structural molecule activity			ovary(2)|skin(2)|pancreas(1)	5		Breast(137;0.000286)				TCAGGTGCCAGTCACGGATCT	0.602													79	119	---	---	---	---	capture	Silent	SNP	39661389	39661389	KRT13	17	G	A	A	A	1	0	0	0	0	0	0	0	1	464	36	2	2	8370	269
FMNL1	752	broad.mit.edu	37	17	43320637	43320637	+	Silent	SNP	C	T	T			TCGA-76-4929-01	TCGA-76-4929-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:43320637C>T	uc002iin.2	+	17	2363	c.2163C>T	c.(2161-2163)ACC>ACT	p.T721T	FMNL1_uc002iiq.2_Silent_p.T299T|FMNL1_uc010dag.2_RNA	NM_005892	NP_005883	O95466	FMNL_HUMAN	formin-like 1	721	FH2.				actin cytoskeleton organization		actin binding|Rho GTPase binding			pancreas(1)	1						TGGCCATCACCCTGCGGAAGG	0.642													32	65	---	---	---	---	capture	Silent	SNP	43320637	43320637	FMNL1	17	C	T	T	T	1	0	0	0	0	0	0	0	1	275	22	2	2	5895	269
RGS9	8787	broad.mit.edu	37	17	63193312	63193312	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4929-01	TCGA-76-4929-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:63193312C>T	uc002jfe.2	+	13	1039	c.929C>T	c.(928-930)CCC>CTC	p.P310L	RGS9_uc010dem.2_Missense_Mutation_p.P307L|RGS9_uc002jfd.2_Missense_Mutation_p.P307L|RGS9_uc002jff.2_RNA|RGS9_uc002jfg.2_Missense_Mutation_p.P81L	NM_003835	NP_003826	O75916	RGS9_HUMAN	regulator of G-protein signaling 9 isoform 1	310	RGS.				intracellular signal transduction|negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway|visual perception	cytoplasm|heterotrimeric G-protein complex	GTPase activator activity|signal transducer activity			ovary(2)|skin(2)	4						ATCCGAGACCCCAAAGGTCGA	0.423													4	52	---	---	---	---	capture	Missense_Mutation	SNP	63193312	63193312	RGS9	17	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	13205	269
ICAM5	7087	broad.mit.edu	37	19	10405102	10405102	+	Silent	SNP	C	A	A			TCGA-76-4929-01	TCGA-76-4929-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:10405102C>A	uc002mnu.3	+	9	2081	c.2016C>A	c.(2014-2016)ACC>ACA	p.T672T	ICAM5_uc002mnv.3_Silent_p.T547T	NM_003259	NP_003250	Q9UMF0	ICAM5_HUMAN	intercellular adhesion molecule 5 precursor	672	Extracellular (Potential).|Ig-like C2-type 8.				cell-cell adhesion	integral to plasma membrane				breast(3)	3			OV - Ovarian serous cystadenocarcinoma(20;2.64e-09)|Epithelial(33;4.31e-06)|all cancers(31;9.75e-06)			ATGAATCTACCTGCCCAAGTC	0.692													41	9	---	---	---	---	capture	Silent	SNP	10405102	10405102	ICAM5	19	C	A	A	A	1	0	0	0	0	0	0	0	1	301	24	4	4	7408	269
HADHA	3030	broad.mit.edu	37	2	26457099	26457099	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4929-01	TCGA-76-4929-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:26457099C>T	uc002rgy.2	-	5	569	c.439G>A	c.(439-441)GGA>AGA	p.G147R	HADHA_uc010yks.1_Missense_Mutation_p.G60R|HADHA_uc010ykt.1_Missense_Mutation_p.G60R	NM_000182	NP_000173	P40939	ECHA_HUMAN	mitochondrial trifunctional protein, alpha	147					fatty acid beta-oxidation	fatty acid beta-oxidation multienzyme complex|mitochondrial nucleoid|nucleolus	3-hydroxyacyl-CoA dehydrogenase activity|acetyl-CoA C-acetyltransferase activity|coenzyme binding|enoyl-CoA hydratase activity|long-chain-3-hydroxyacyl-CoA dehydrogenase activity|protein binding			ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				NADH(DB00157)	AGTCCTCCTCCCAGGCAGGAT	0.433													35	82	---	---	---	---	capture	Missense_Mutation	SNP	26457099	26457099	HADHA	2	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	6870	269
FAM123C	205147	broad.mit.edu	37	2	131520666	131520666	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4929-01	TCGA-76-4929-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:131520666C>T	uc002trw.2	+	2	1211	c.1021C>T	c.(1021-1023)CGG>TGG	p.R341W	FAM123C_uc010fmv.2_Missense_Mutation_p.R341W|FAM123C_uc010fms.1_Missense_Mutation_p.R341W|FAM123C_uc010fmt.1_Missense_Mutation_p.R341W|FAM123C_uc010fmu.1_Missense_Mutation_p.R341W	NM_152698	NP_689911	Q8N944	F123C_HUMAN	hypothetical protein LOC205147	341										pancreas(2)|ovary(1)	3	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.13)		GGACCAATCCCGGCTGGACAC	0.667													21	39	---	---	---	---	capture	Missense_Mutation	SNP	131520666	131520666	FAM123C	2	C	T	T	T	1	0	0	0	0	1	0	0	0	295	23	1	1	5378	269
PHOSPHO2	493911	broad.mit.edu	37	2	170558142	170558142	+	Missense_Mutation	SNP	T	C	C			TCGA-76-4929-01	TCGA-76-4929-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:170558142T>C	uc002ufg.2	+	4	1049	c.661T>C	c.(661-663)TCT>CCT	p.S221P	KLHL23_uc002ufh.1_Intron	NM_001008489	NP_001008489	Q8TCD6	PHOP2_HUMAN	phosphatase, orphan 2	221							metal ion binding|pyridoxal phosphatase activity			skin(1)	1						TATGGAATATTCTGTTGTAGT	0.308													74	80	---	---	---	---	capture	Missense_Mutation	SNP	170558142	170558142	PHOSPHO2	2	T	C	C	C	1	0	0	0	0	1	0	0	0	806	62	3	3	11760	269
MYO1B	4430	broad.mit.edu	37	2	192248067	192248067	+	Missense_Mutation	SNP	A	T	T			TCGA-76-4929-01	TCGA-76-4929-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:192248067A>T	uc010fsg.2	+	15	1607	c.1352A>T	c.(1351-1353)AAT>ATT	p.N451I	MYO1B_uc002usq.2_Missense_Mutation_p.N451I|MYO1B_uc002usr.2_Missense_Mutation_p.N451I|MYO1B_uc002ust.1_Missense_Mutation_p.N89I	NM_001130158	NP_001123630	O43795	MYO1B_HUMAN	myosin IB isoform 1	451	Myosin head-like.					myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			central_nervous_system(5)|large_intestine(2)|ovary(1)	8			OV - Ovarian serous cystadenocarcinoma(117;0.0112)|Epithelial(96;0.104)|all cancers(119;0.236)			CTAATAGAAAATGTGAGTACT	0.313													24	32	---	---	---	---	capture	Missense_Mutation	SNP	192248067	192248067	MYO1B	2	A	T	T	T	1	0	0	0	0	1	0	0	0	52	4	4	4	9979	269
ALS2	57679	broad.mit.edu	37	2	202609022	202609022	+	Missense_Mutation	SNP	C	G	G			TCGA-76-4929-01	TCGA-76-4929-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:202609022C>G	uc002uyo.2	-	10	2485	c.2129G>C	c.(2128-2130)AGT>ACT	p.S710T	ALS2_uc002uyp.3_Missense_Mutation_p.S710T|ALS2_uc002uyq.2_Missense_Mutation_p.S710T|ALS2_uc010ftl.2_RNA	NM_020919	NP_065970	Q96Q42	ALS2_HUMAN	alsin isoform 1	710	DH.				cell death|endosome organization|positive regulation of Rac GTPase activity|regulation of endosome size	centrosome|cytosol|early endosome|growth cone|lamellipodium|protein complex|ruffle	protein homodimerization activity|protein serine/threonine kinase activator activity|Rab GTPase binding|Rab guanyl-nucleotide exchange factor activity|Rac guanyl-nucleotide exchange factor activity|Ran guanyl-nucleotide exchange factor activity			skin(5)|lung(1)|breast(1)	7						TTTGATATCACTTAGTTTTGA	0.398													36	69	---	---	---	---	capture	Missense_Mutation	SNP	202609022	202609022	ALS2	2	C	G	G	G	1	0	0	0	0	1	0	0	0	260	20	4	4	550	269
SLC11A1	6556	broad.mit.edu	37	2	219254613	219254613	+	Silent	SNP	C	T	T			TCGA-76-4929-01	TCGA-76-4929-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:219254613C>T	uc002vhv.2	+	9	1156	c.816C>T	c.(814-816)GCC>GCT	p.A272A	SLC11A1_uc010fvp.1_Silent_p.A272A|SLC11A1_uc010fvq.1_Silent_p.A205A|SLC11A1_uc010zkc.1_Silent_p.A205A|SLC11A1_uc002vhu.1_Silent_p.A67A|SLC11A1_uc002vhw.2_Silent_p.A154A|SLC11A1_uc010fvr.2_Silent_p.A67A	NM_000578	NP_000569	P49279	NRAM1_HUMAN	natural resistance-associated macrophage protein	272	Cytoplasmic (Potential).				activation of protein kinase activity|antigen processing and presentation of peptide antigen|cadmium ion transmembrane transport|cellular cadmium ion homeostasis|cellular iron ion homeostasis|defense response to Gram-negative bacterium|defense response to protozoan|divalent metal ion export|inflammatory response|interleukin-2 production|interleukin-3 production|iron ion transport|L-arginine import|macrophage activation|MHC class II biosynthetic process|mRNA stabilization|multicellular organismal iron ion homeostasis|negative regulation of cytokine production|nitrite transport|phagocytosis|positive regulation of dendritic cell antigen processing and presentation|positive regulation of interferon-gamma production|positive regulation of phagocytosis|positive regulation of T-helper 1 type immune response|positive regulation of transcription from RNA polymerase II promoter|respiratory burst|response to interferon-gamma|response to lipopolysaccharide|T cell cytokine production|T cell proliferation involved in immune response|vacuolar acidification|wound healing	integral to plasma membrane|late endosome membrane|lysosome|phagocytic vesicle membrane|tertiary granule membrane	manganese ion transmembrane transporter activity|metal ion:hydrogen antiporter activity|protein homodimerization activity			ovary(3)|central_nervous_system(1)	4		Renal(207;0.0474)		Epithelial(149;1.16e-06)|all cancers(144;0.000195)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TAGACCGGGCCCGCCGAGCAG	0.537													26	24	---	---	---	---	capture	Silent	SNP	219254613	219254613	SLC11A1	2	C	T	T	T	1	0	0	0	0	0	0	0	1	275	22	2	2	14273	269
NANP	140838	broad.mit.edu	37	20	25597030	25597030	+	Missense_Mutation	SNP	G	C	C			TCGA-76-4929-01	TCGA-76-4929-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:25597030G>C	uc002wuy.2	-	2	342	c.278C>G	c.(277-279)GCT>GGT	p.A93G		NM_152667	NP_689880	Q8TBE9	NANP_HUMAN	N-acetylneuraminic acid phosphatase	93					N-acetylneuraminate biosynthetic process		N-acylneuraminate-9-phosphatase activity|phosphoglycolate phosphatase activity				0						ACATTCTTCAGCCAATTTTCT	0.403													36	72	---	---	---	---	capture	Missense_Mutation	SNP	25597030	25597030	NANP	20	G	C	C	C	1	0	0	0	0	1	0	0	0	442	34	4	4	10062	269
CDH4	1002	broad.mit.edu	37	20	60509217	60509217	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4929-01	TCGA-76-4929-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:60509217C>T	uc002ybn.1	+	15	2497	c.2483C>T	c.(2482-2484)CCC>CTC	p.P828L	CDH4_uc002ybp.1_Missense_Mutation_p.P754L	NM_001794	NP_001785	P55283	CADH4_HUMAN	cadherin 4, type 1 preproprotein	828	Cytoplasmic (Potential).				adherens junction organization|cell junction assembly		calcium ion binding			lung(3)|ovary(2)|skin(1)	6			BRCA - Breast invasive adenocarcinoma(19;2.36e-08)			GGCGCTGAGCCCCAGTACCCG	0.677													27	49	---	---	---	---	capture	Missense_Mutation	SNP	60509217	60509217	CDH4	20	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	3083	269
NTSR1	4923	broad.mit.edu	37	20	61341151	61341151	+	Missense_Mutation	SNP	C	A	A			TCGA-76-4929-01	TCGA-76-4929-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:61341151C>A	uc002ydf.2	+	1	963	c.592C>A	c.(592-594)CTG>ATG	p.L198M		NM_002531	NP_002522	P30989	NTR1_HUMAN	neurotensin receptor 1	198	Helical; Name=4; (Potential).					endoplasmic reticulum|Golgi apparatus|integral to plasma membrane	neurotensin receptor activity, G-protein coupled			skin(2)|lung(1)|central_nervous_system(1)	4	Breast(26;3.65e-08)		BRCA - Breast invasive adenocarcinoma(19;3.63e-06)			CGCCTCGGCCCTGCTGGCGGT	0.672													36	56	---	---	---	---	capture	Missense_Mutation	SNP	61341151	61341151	NTSR1	20	C	A	A	A	1	0	0	0	0	1	0	0	0	311	24	4	4	10617	269
GAB4	128954	broad.mit.edu	37	22	17450832	17450832	+	Splice_Site	SNP	C	T	T			TCGA-76-4929-01	TCGA-76-4929-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:17450832C>T	uc002zlw.2	-	4	1045	c.937_splice	c.e4+1	p.A313_splice	GAB4_uc010gqs.1_Intron	NM_001037814	NP_001032903	Q2WGN9	GAB4_HUMAN	GRB2-associated binding protein family, member											large_intestine(1)|ovary(1)	2		all_epithelial(15;0.112)|Lung NSC(13;0.248)				GGGGTACACACCCTCATTATC	0.597													102	28	---	---	---	---	capture	Splice_Site	SNP	17450832	17450832	GAB4	22	C	T	T	T	1	0	0	0	0	0	0	1	0	234	18	5	2	6093	269
DEPDC5	9681	broad.mit.edu	37	22	32234828	32234828	+	Nonsense_Mutation	SNP	C	T	T			TCGA-76-4929-01	TCGA-76-4929-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:32234828C>T	uc003als.2	+	27	2627	c.2485C>T	c.(2485-2487)CGA>TGA	p.R829*	DEPDC5_uc011als.1_Nonsense_Mutation_p.R760*|DEPDC5_uc011alu.1_Nonsense_Mutation_p.R838*|DEPDC5_uc011alv.1_RNA|DEPDC5_uc003alt.2_Nonsense_Mutation_p.R829*|DEPDC5_uc003alu.2_Nonsense_Mutation_p.R278*|DEPDC5_uc003alv.2_RNA|DEPDC5_uc011alw.1_Nonsense_Mutation_p.R159*|DEPDC5_uc003alw.2_Nonsense_Mutation_p.R127*|DEPDC5_uc011alx.1_Intron	NM_014662	NP_055477	O75140	DEPD5_HUMAN	DEP domain containing 5 isoform 1	829					intracellular signal transduction					ovary(4)|central_nervous_system(3)|pancreas(1)	8						ACTCTATAGCCGAGGTGAGTT	0.458													84	33	---	---	---	---	capture	Nonsense_Mutation	SNP	32234828	32234828	DEPDC5	22	C	T	T	T	1	0	0	0	0	0	1	0	0	295	23	5	1	4400	269
RNF123	63891	broad.mit.edu	37	3	49737157	49737157	+	Silent	SNP	C	T	T			TCGA-76-4929-01	TCGA-76-4929-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:49737157C>T	uc003cxh.2	+	12	1022	c.936C>T	c.(934-936)ACC>ACT	p.T312T	RNF123_uc010hky.1_5'UTR|RNF123_uc003cxi.2_RNA	NM_022064	NP_071347	Q5XPI4	RN123_HUMAN	ring finger protein 123	312						cytoplasm	ligase activity|protein binding|zinc ion binding			kidney(3)|ovary(1)|lung(1)|breast(1)|skin(1)	7				BRCA - Breast invasive adenocarcinoma(193;4.71e-05)|Kidney(197;0.00227)|KIRC - Kidney renal clear cell carcinoma(197;0.00255)		GCCAGCCCACCGTCCTCCTCA	0.647													44	39	---	---	---	---	capture	Silent	SNP	49737157	49737157	RNF123	3	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	13325	269
ALG3	10195	broad.mit.edu	37	3	183962404	183962404	+	Silent	SNP	G	A	A			TCGA-76-4929-01	TCGA-76-4929-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:183962404G>A	uc003fne.2	-	5	742	c.711C>T	c.(709-711)ATC>ATT	p.I237I	ALG3_uc011brc.1_Silent_p.I202I|ALG3_uc011brd.1_Silent_p.I181I|ALG3_uc011bre.1_Silent_p.I189I|ALG3_uc003fnf.1_Silent_p.I197I	NM_005787	NP_005778	Q92685	ALG3_HUMAN	alpha-1,3-mannosyltransferase ALG3 isoform a	237	Helical; (Potential).				dolichol-linked oligosaccharide biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine	endoplasmic reticulum membrane|integral to membrane	alpha-1,3-mannosyltransferase activity				0	all_cancers(143;1.39e-10)|Ovarian(172;0.0339)		Epithelial(37;8.28e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			GGCCAGCACAGATTCCCAGCT	0.537													3	13	---	---	---	---	capture	Silent	SNP	183962404	183962404	ALG3	3	G	A	A	A	1	0	0	0	0	0	0	0	1	421	33	2	2	520	269
PDGFRA	5156	broad.mit.edu	37	4	55131090	55131090	+	Silent	SNP	A	G	G			TCGA-76-4929-01	TCGA-76-4929-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:55131090A>G	uc003han.3	+	5	964	c.633A>G	c.(631-633)ACA>ACG	p.T211T	PDGFRA_uc003haa.2_Intron|PDGFRA_uc003hal.2_3'UTR|PDGFRA_uc010igq.1_Silent_p.T105T|PDGFRA_uc003ham.2_RNA	NM_006206	NP_006197	P16234	PGFRA_HUMAN	platelet-derived growth factor receptor alpha	211	Ig-like C2-type 3.|Extracellular (Potential).				cardiac myofibril assembly|cell activation|luteinization|metanephric glomerular capillary formation|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of DNA replication|positive regulation of fibroblast proliferation|protein autophosphorylation|retina vasculature development in camera-type eye	cytoplasm|integral to plasma membrane|nucleus	ATP binding|platelet-derived growth factor alpha-receptor activity|platelet-derived growth factor binding|platelet-derived growth factor receptor binding|protein homodimerization activity|vascular endothelial growth factor receptor activity			soft_tissue(572)|small_intestine(40)|stomach(16)|lung(16)|central_nervous_system(13)|haematopoietic_and_lymphoid_tissue(7)|skin(3)|ovary(3)|gastrointestinal_tract_(site_indeterminate)(1)|autonomic_ganglia(1)|prostate(1)|bone(1)	674	all_cancers(7;0.000425)|all_lung(4;0.000343)|Lung NSC(11;0.000467)|all_epithelial(27;0.0131)|all_neural(26;0.0209)|Glioma(25;0.08)		GBM - Glioblastoma multiforme(1;4.18e-71)|all cancers(1;4.76e-45)|LUSC - Lung squamous cell carcinoma(32;0.00256)		Becaplermin(DB00102)|Imatinib(DB00619)|Sunitinib(DB01268)	TTATAGCAACATCAGAGCTGG	0.373			Mis|O|T	FIP1L1	GIST|idiopathic hypereosinophilic syndrome				Gastrointestinal_Stromal_Tumors_Sporadic_Multiple_Primary|Familial_Intestinal_Neurofibromatosis	TSP Lung(21;0.16)			9	222	---	---	---	---	capture	Silent	SNP	55131090	55131090	PDGFRA	4	A	G	G	G	1	0	0	0	0	0	0	0	1	93	8	3	3	11564	269
LPHN3	23284	broad.mit.edu	37	4	62363023	62363023	+	Silent	SNP	G	A	A			TCGA-76-4929-01	TCGA-76-4929-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:62363023G>A	uc010ihh.2	+	1	185	c.12G>A	c.(10-12)TCG>TCA	p.S4S	LPHN3_uc003hcq.3_Silent_p.S4S|LPHN3_uc010ihg.1_Silent_p.S4S	NM_015236	NP_056051	Q9HAR2	LPHN3_HUMAN	latrophilin 3 precursor	4					neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity|sugar binding			lung(15)|ovary(1)|central_nervous_system(1)|pancreas(1)	18						TGTGGCCATCGCAGCTACTAA	0.348													33	38	---	---	---	---	capture	Silent	SNP	62363023	62363023	LPHN3	4	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	8833	269
DCK	1633	broad.mit.edu	37	4	71888254	71888254	+	Missense_Mutation	SNP	T	G	G			TCGA-76-4929-01	TCGA-76-4929-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:71888254T>G	uc003hfx.2	+	3	666	c.378T>G	c.(376-378)TTT>TTG	p.F126L	DCK_uc011cbb.1_Missense_Mutation_p.F54L	NM_000788	NP_000779	P27707	DCK_HUMAN	deoxycytidine kinase	126					purine base metabolic process|purine-containing compound salvage|pyrimidine base metabolic process|pyrimidine nucleoside salvage|pyrimidine nucleotide metabolic process	cytosol|nucleus	ATP binding|deoxycytidine kinase activity|drug binding|phosphotransferase activity, alcohol group as acceptor|protein homodimerization activity			ovary(1)	1			Lung(101;0.235)		Cladribine(DB00242)|Clofarabine(DB00631)|Decitabine(DB01262)|Fludarabine(DB01073)|Gemcitabine(DB00441)|Pemetrexed(DB00642)|Zalcitabine(DB00943)	TATTATTTTTTGAACGATCTG	0.358													66	96	---	---	---	---	capture	Missense_Mutation	SNP	71888254	71888254	DCK	4	T	G	G	G	1	0	0	0	0	1	0	0	0	816	63	4	4	4249	269
ANXA3	306	broad.mit.edu	37	4	79507428	79507428	+	Silent	SNP	C	T	T	rs144437584		TCGA-76-4929-01	TCGA-76-4929-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:79507428C>T	uc003hld.2	+	6	637	c.327C>T	c.(325-327)AAC>AAT	p.N109N	ANXA3_uc003hle.2_Silent_p.N70N|ANXA3_uc010ijk.2_Silent_p.N70N	NM_005139	NP_005130	P12429	ANXA3_HUMAN	annexin A3	109	Annexin 2.				defense response to bacterium|neutrophil degranulation|phagocytosis|positive regulation of angiogenesis|positive regulation of endothelial cell migration|positive regulation of sequence-specific DNA binding transcription factor activity	phagocytic vesicle membrane|plasma membrane|specific granule	calcium ion binding|calcium-dependent phospholipid binding|phospholipase A2 inhibitor activity				0						CGGGAACAAACGAAGATGCCT	0.343													63	97	---	---	---	---	capture	Silent	SNP	79507428	79507428	ANXA3	4	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	713	269
FGG	2266	broad.mit.edu	37	4	155529787	155529787	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4929-01	TCGA-76-4929-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:155529787C>T	uc003ioj.2	-	7	823	c.682G>A	c.(682-684)GTA>ATA	p.V228I	FGG_uc003iog.2_Missense_Mutation_p.V228I|FGG_uc003ioh.2_Missense_Mutation_p.V236I|FGG_uc010ipx.2_Missense_Mutation_p.V56I|FGG_uc010ipy.2_5'UTR|FGG_uc003ioi.2_5'UTR|FGG_uc003iok.2_Missense_Mutation_p.V236I	NM_021870	NP_068656	P02679	FIBG_HUMAN	fibrinogen, gamma chain isoform gamma-B	228	Fibrinogen C-terminal.				platelet activation|platelet degranulation|protein polymerization|response to calcium ion|signal transduction	external side of plasma membrane|fibrinogen complex|platelet alpha granule lumen	eukaryotic cell surface binding|protein binding, bridging|receptor binding				0	all_hematologic(180;0.215)	Renal(120;0.0458)			Sucralfate(DB00364)	TTGAAATCTACACTGCCATCA	0.343													40	95	---	---	---	---	capture	Missense_Mutation	SNP	155529787	155529787	FGG	4	C	T	T	T	1	0	0	0	0	1	0	0	0	221	17	2	2	5816	269
PLEKHG4B	153478	broad.mit.edu	37	5	181778	181778	+	Missense_Mutation	SNP	G	A	A	rs114040866	by1000genomes	TCGA-76-4929-01	TCGA-76-4929-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:181778G>A	uc003jak.2	+	17	3534	c.3484G>A	c.(3484-3486)GTC>ATC	p.V1162I		NM_052909	NP_443141	Q96PX9	PKH4B_HUMAN	pleckstrin homology domain containing, family G	1162					regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity			skin(2)	2			all cancers(22;0.0253)|Lung(60;0.113)	Kidney(1;0.119)		CGACAGCATCGTCAAGGGCAC	0.637													20	103	---	---	---	---	capture	Missense_Mutation	SNP	181778	181778	PLEKHG4B	5	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	11975	269
BASP1	10409	broad.mit.edu	37	5	17275370	17275370	+	Silent	SNP	C	T	T			TCGA-76-4929-01	TCGA-76-4929-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:17275370C>T	uc003jfx.2	+	2	224	c.45C>T	c.(43-45)AAC>AAT	p.N15N		NM_006317	NP_006308	P80723	BASP1_HUMAN	brain abundant, membrane attached signal protein	15					glomerular visceral epithelial cell differentiation|negative regulation of transcription, DNA-dependent	cytoplasm|cytoskeleton|growth cone|nuclear speck|plasma membrane	protein domain specific binding|transcription corepressor activity|transcription regulatory region DNA binding				0						ACAATGTGAACGACGAGAAAG	0.567													16	24	---	---	---	---	capture	Silent	SNP	17275370	17275370	BASP1	5	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	1306	269
CDH18	1016	broad.mit.edu	37	5	19721516	19721516	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4929-01	TCGA-76-4929-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:19721516C>T	uc003jgc.2	-	4	960	c.583G>A	c.(583-585)GCT>ACT	p.A195T	CDH18_uc003jgd.2_Missense_Mutation_p.A195T|CDH18_uc011cnm.1_Missense_Mutation_p.A195T	NM_004934	NP_004925	Q13634	CAD18_HUMAN	cadherin 18, type 2 preproprotein	195	Extracellular (Potential).|Cadherin 2.				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	p.A195T(1)		ovary(5)|large_intestine(1)|skin(1)	7	Lung NSC(1;0.00734)|all_lung(1;0.0197)					ACCACCCGAGCGCTGTTTCCA	0.463													77	70	---	---	---	---	capture	Missense_Mutation	SNP	19721516	19721516	CDH18	5	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	3074	269
POU5F2	134187	broad.mit.edu	37	5	93077142	93077142	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4929-01	TCGA-76-4929-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:93077142C>T	uc003kkl.1	-	1	168	c.128G>A	c.(127-129)AGG>AAG	p.R43K	FAM172A_uc010jbd.2_Intron|FAM172A_uc011cuf.1_Intron|FAM172A_uc011cug.1_Intron|FAM172A_uc011cuh.1_Intron|FAM172A_uc011cui.1_Intron|FAM172A_uc011cuj.1_Intron	NM_153216	NP_694948	Q8N7G0	PO5F2_HUMAN	POU domain class 5, transcription factor 2	43						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0		all_cancers(142;3.87e-05)|all_epithelial(76;4.59e-07)|all_lung(232;0.0126)|Lung NSC(167;0.0155)|Ovarian(174;0.0218)|Prostate(281;0.173)|Colorectal(57;0.19)		UCEC - Uterine corpus endometrioid carcinoma (5;0.0415)|all cancers(79;2.03e-19)		GACCATCACCCTGCCAGGGGC	0.687													7	14	---	---	---	---	capture	Missense_Mutation	SNP	93077142	93077142	POU5F2	5	C	T	T	T	1	0	0	0	0	1	0	0	0	312	24	2	2	12184	269
FTMT	94033	broad.mit.edu	37	5	121187720	121187720	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4929-01	TCGA-76-4929-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:121187720C>T	uc003kss.2	+	1	71	c.62C>T	c.(61-63)CCG>CTG	p.P21L		NM_177478	NP_803431	Q8N4E7	FTMT_HUMAN	ferritin mitochondrial precursor	21					cellular iron ion homeostasis|iron ion transport|positive regulation of cell proliferation|positive regulation of lyase activity|positive regulation of oxidoreductase activity|positive regulation of transferase activity	mitochondrion	ferric iron binding|ferroxidase activity			ovary(1)	1		all_cancers(142;0.0124)|Prostate(80;0.0322)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	Epithelial(69;0.000171)|OV - Ovarian serous cystadenocarcinoma(64;0.000188)|all cancers(49;0.0027)		TCTCTGCGCCCGGTGCGCTGC	0.736													20	14	---	---	---	---	capture	Missense_Mutation	SNP	121187720	121187720	FTMT	5	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	6027	269
GABRB2	2561	broad.mit.edu	37	5	160721269	160721269	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4929-01	TCGA-76-4929-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:160721269C>T	uc003lys.1	-	11	1576	c.1358G>A	c.(1357-1359)CGA>CAA	p.R453Q	GABRB2_uc011deh.1_Missense_Mutation_p.R254Q|GABRB2_uc003lyr.1_Missense_Mutation_p.R415Q|GABRB2_uc003lyt.1_Missense_Mutation_p.R415Q|GABRB2_uc010jiu.1_Missense_Mutation_p.R352Q	NM_021911	NP_068711	P47870	GBRB2_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta	453	Cytoplasmic (Probable).				gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|GABA-A receptor activity				0	Renal(175;0.00259)	Medulloblastoma(196;0.021)|all_neural(177;0.0463)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		Ethchlorvynol(DB00189)|Flurazepam(DB00690)|Lorazepam(DB00186)|Midazolam(DB00683)	CAGAGCATTTCGGCCAAAACT	0.532													30	89	---	---	---	---	capture	Missense_Mutation	SNP	160721269	160721269	GABRB2	5	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	6109	269
FKBPL	63943	broad.mit.edu	37	6	32097113	32097113	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4929-01	TCGA-76-4929-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:32097113C>T	uc003nzr.2	-	2	715	c.445G>A	c.(445-447)GGG>AGG	p.G149R	ATF6B_uc003nzo.2_5'Flank|ATF6B_uc003nzn.2_5'Flank|ATF6B_uc011dpg.1_5'Flank|ATF6B_uc011dph.1_5'Flank	NM_022110	NP_071393	Q9UIM3	FKBPL_HUMAN	WAF-1/CIP1 stabilizing protein 39	149					response to radiation	membrane|nucleus	FK506 binding|peptidyl-prolyl cis-trans isomerase activity				0						CTCCATGGCCCTACGCCCATA	0.582													230	73	---	---	---	---	capture	Missense_Mutation	SNP	32097113	32097113	FKBPL	6	C	T	T	T	1	0	0	0	0	1	0	0	0	312	24	2	2	5861	269
PKHD1	5314	broad.mit.edu	37	6	51890856	51890856	+	Missense_Mutation	SNP	G	T	T			TCGA-76-4929-01	TCGA-76-4929-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:51890856G>T	uc003pah.1	-	32	4028	c.3752C>A	c.(3751-3753)ACC>AAC	p.T1251N	PKHD1_uc003pai.2_Missense_Mutation_p.T1251N	NM_138694	NP_619639	P08F94	PKHD1_HUMAN	fibrocystin isoform 1	1251	Extracellular (Potential).|IPT/TIG 7.				cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity			lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44	Lung NSC(77;0.0605)					GGCTGGCAGGGTTTCACACCA	0.597													33	60	---	---	---	---	capture	Missense_Mutation	SNP	51890856	51890856	PKHD1	6	G	T	T	T	1	0	0	0	0	1	0	0	0	572	44	4	4	11874	269
WBSCR17	64409	broad.mit.edu	37	7	70597844	70597844	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4929-01	TCGA-76-4929-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:70597844C>T	uc003tvy.2	+	1	56	c.56C>T	c.(55-57)GCC>GTC	p.A19V		NM_022479	NP_071924	Q6IS24	GLTL3_HUMAN	UDP-GalNAc:polypeptide	19	Helical; Signal-anchor for type II membrane protein; (Potential).					Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			skin(3)|upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)|central_nervous_system(1)	7		all_cancers(73;0.2)|Lung NSC(55;0.094)|all_lung(88;0.125)				ATCGCGGTAGCCGGCTTCGTG	0.677													3	46	---	---	---	---	capture	Missense_Mutation	SNP	70597844	70597844	WBSCR17	7	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	17145	269
CLIP2	7461	broad.mit.edu	37	7	73791076	73791076	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4929-01	TCGA-76-4929-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:73791076G>A	uc003uam.2	+	10	2672	c.2345G>A	c.(2344-2346)AGT>AAT	p.S782N	CLIP2_uc003uan.2_Missense_Mutation_p.S747N|CLIP2_uc003uao.2_Missense_Mutation_p.S176N	NM_003388	NP_003379	Q9UDT6	CLIP2_HUMAN	CAP-GLY domain containing linker protein 2	782	Potential.					microtubule associated complex				skin(3)	3						GAGGTCGAGAGTTTGCGGGAG	0.632													8	13	---	---	---	---	capture	Missense_Mutation	SNP	73791076	73791076	CLIP2	7	G	A	A	A	1	0	0	0	0	1	0	0	0	468	36	2	2	3498	269
JHDM1D	80853	broad.mit.edu	37	7	139824534	139824534	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4929-01	TCGA-76-4929-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:139824534C>T	uc003vvm.2	-	7	942	c.938G>A	c.(937-939)CGT>CAT	p.R313H		NM_030647	NP_085150	Q6ZMT4	KDM7_HUMAN	jumonji C domain containing histone demethylase	313	JmjC.				midbrain development|transcription, DNA-dependent	nucleolus	histone demethylase activity (H3-K27 specific)|histone demethylase activity (H3-K36 specific)|histone demethylase activity (H3-K9 specific)|histone demethylase activity (H4-K20 specific)|iron ion binding|methylated histone residue binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding			ovary(1)	1	Melanoma(164;0.0142)					AGATTCATAACGTGCCAAATT	0.358													29	71	---	---	---	---	capture	Missense_Mutation	SNP	139824534	139824534	JHDM1D	7	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	7871	269
MGAM	8972	broad.mit.edu	37	7	141765179	141765179	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4929-01	TCGA-76-4929-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:141765179G>A	uc003vwy.2	+	38	4583	c.4529G>A	c.(4528-4530)CGC>CAC	p.R1510H		NM_004668	NP_004659	O43451	MGA_HUMAN	maltase-glucoamylase	1510	Glucoamylase.|Lumenal (Potential).				polysaccharide digestion|starch catabolic process	apical plasma membrane|integral to membrane	carbohydrate binding|glucan 1,4-alpha-glucosidase activity|maltose alpha-glucosidase activity			ovary(2)	2	Melanoma(164;0.0272)				Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	GTCATCACCCGCTCCACATTT	0.597													16	9	---	---	---	---	capture	Missense_Mutation	SNP	141765179	141765179	MGAM	7	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	9453	269
KEL	3792	broad.mit.edu	37	7	142658027	142658027	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4929-01	TCGA-76-4929-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:142658027G>A	uc003wcb.2	-	4	598	c.388C>T	c.(388-390)CGG>TGG	p.R130W		NM_000420	NP_000411	P23276	KELL_HUMAN	Kell blood group, metallo-endopeptidase	130	Extracellular (Potential).				proteolysis|vasoconstriction	integral to membrane|plasma membrane	metal ion binding|metalloendopeptidase activity|protein binding			ovary(3)|central_nervous_system(1)	4	Melanoma(164;0.059)					AGTATTCTCCGAAGTCGGTTT	0.502													101	212	---	---	---	---	capture	Missense_Mutation	SNP	142658027	142658027	KEL	7	G	A	A	A	1	0	0	0	0	1	0	0	0	480	37	1	1	8064	269
NEFL	4747	broad.mit.edu	37	8	24813390	24813390	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4929-01	TCGA-76-4929-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:24813390C>T	uc003xee.2	-	1	742	c.640G>A	c.(640-642)GAC>AAC	p.D214N		NM_006158	NP_006149	P07196	NFL_HUMAN	neurofilament, light polypeptide 68kDa	214	Rod.|Coil 1B.				anterograde axon cargo transport|axon transport of mitochondrion|neurofilament bundle assembly|retrograde axon cargo transport|synaptic transmission	cytosol|neurofilament	identical protein binding|protein C-terminus binding|structural constituent of cytoskeleton			ovary(1)|central_nervous_system(1)	2		Ovarian(32;0.00965)|Prostate(55;0.157)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0197)|Epithelial(17;2.44e-10)|Colorectal(74;0.0108)|COAD - Colon adenocarcinoma(73;0.0375)		ATCAAGCTGTCGATGCGCTTC	0.632													27	38	---	---	---	---	capture	Missense_Mutation	SNP	24813390	24813390	NEFL	8	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	10222	269
INSL6	11172	broad.mit.edu	37	9	5185459	5185459	+	Silent	SNP	G	A	A			TCGA-76-4929-01	TCGA-76-4929-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:5185459G>A	uc003zix.2	-	1	160	c.144C>T	c.(142-144)GCC>GCT	p.A48A		NM_007179	NP_009110	Q9Y581	INSL6_HUMAN	insulin-like 6 precursor	48						extracellular region	hormone activity				0	all_hematologic(13;0.137)	Breast(48;0.147)|Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.0128)|Lung(218;0.145)		GGCTCCAGTTGGCATGGCCGC	0.532													61	27	---	---	---	---	capture	Silent	SNP	5185459	5185459	INSL6	9	G	A	A	A	1	0	0	0	0	0	0	0	1	600	47	2	2	7693	269
NUDT2	318	broad.mit.edu	37	9	34343182	34343182	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4929-01	TCGA-76-4929-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:34343182C>T	uc003zub.2	+	5	546	c.188C>T	c.(187-189)GCA>GTA	p.A63V	NUDT2_uc003zuc.2_Missense_Mutation_p.A63V|NUDT2_uc003zud.2_Missense_Mutation_p.A63V	NM_001161	NP_001152	P50583	AP4A_HUMAN	nudix-type motif 2	63	Nudix box.|Nudix hydrolase.				induction of apoptosis|nucleobase, nucleoside, nucleotide and nucleic acid metabolic process		bis(5'-nucleosyl)-tetraphosphatase (asymmetrical) activity|bis(5'-nucleosyl)-tetraphosphatase (symmetrical) activity|GTP binding				0			LUSC - Lung squamous cell carcinoma(29;0.0107)	GBM - Glioblastoma multiforme(74;0.126)		CAAGAGGAAGCAGGCATAGAA	0.493													125	211	---	---	---	---	capture	Missense_Mutation	SNP	34343182	34343182	NUDT2	9	C	T	T	T	1	0	0	0	0	1	0	0	0	325	25	2	2	10644	269
NAA35	60560	broad.mit.edu	37	9	88633637	88633637	+	Silent	SNP	T	C	C			TCGA-76-4929-01	TCGA-76-4929-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:88633637T>C	uc004aoi.3	+	21	2075	c.1938T>C	c.(1936-1938)TAT>TAC	p.Y646Y	NAA35_uc004aoj.3_Silent_p.Y646Y	NM_024635	NP_078911	Q5VZE5	NAA35_HUMAN	corneal wound healing-related protein	646					smooth muscle cell proliferation	cytoplasm|nucleus|plasma membrane				skin(2)|central_nervous_system(1)	3						TCAATAAATATAGCCCTCCTC	0.363													126	155	---	---	---	---	capture	Silent	SNP	88633637	88633637	NAA35	9	T	C	C	C	1	0	0	0	0	0	0	0	1	634	49	3	3	10033	269
PTPN3	5774	broad.mit.edu	37	9	112189356	112189356	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4929-01	TCGA-76-4929-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:112189356C>T	uc004bed.2	-	12	987	c.875G>A	c.(874-876)CGA>CAA	p.R292Q	PTPN3_uc004beb.2_Missense_Mutation_p.R161Q|PTPN3_uc004bec.2_Missense_Mutation_p.R161Q|PTPN3_uc010mtu.2_RNA|PTPN3_uc011lwg.1_Missense_Mutation_p.R292Q|PTPN3_uc011lwh.1_Missense_Mutation_p.R183Q|PTPN3_uc011lwe.1_Missense_Mutation_p.R5Q|PTPN3_uc011lwf.1_Missense_Mutation_p.R5Q	NM_002829	NP_002820	P26045	PTN3_HUMAN	protein tyrosine phosphatase, non-receptor type	292	FERM.				negative regulation of membrane protein ectodomain proteolysis|negative regulation of mitotic cell cycle	cytoplasm|cytoskeleton|internal side of plasma membrane	ATPase binding|cytoskeletal protein binding|phosphotyrosine binding|protein tyrosine phosphatase activity			ovary(3)	3						TTTGCAAGATCGGTAATTCAG	0.448													56	100	---	---	---	---	capture	Missense_Mutation	SNP	112189356	112189356	PTPN3	9	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	12684	269
RGS3	5998	broad.mit.edu	37	9	116268773	116268773	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4929-01	TCGA-76-4929-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:116268773G>A	uc004bhq.2	+	13	1294	c.1085G>A	c.(1084-1086)CGG>CAG	p.R362Q	RGS3_uc004bhr.2_Missense_Mutation_p.R250Q|RGS3_uc004bhs.2_Missense_Mutation_p.R252Q|RGS3_uc004bht.2_Missense_Mutation_p.R81Q|RGS3_uc010muy.2_Missense_Mutation_p.R81Q|RGS3_uc004bhu.2_5'UTR	NM_144488	NP_652759	P49796	RGS3_HUMAN	regulator of G-protein signalling 3 isoform 6	362	PDZ.				inactivation of MAPK activity|regulation of G-protein coupled receptor protein signaling pathway	cytosol|nucleus|plasma membrane	GTPase activator activity|signal transducer activity			ovary(1)|lung(1)|skin(1)	3						CACGAGATCCGGTGACAGGGG	0.677													5	10	---	---	---	---	capture	Missense_Mutation	SNP	116268773	116268773	RGS3	9	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	13198	269
GYG2	8908	broad.mit.edu	37	X	2799206	2799206	+	Silent	SNP	G	A	A			TCGA-76-4929-01	TCGA-76-4929-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:2799206G>A	uc004cqs.1	+	12	1740	c.1458G>A	c.(1456-1458)AAG>AAA	p.K486K	GYG2_uc004cqt.1_Silent_p.K455K|GYG2_uc004cqu.1_Silent_p.K454K|GYG2_uc004cqv.1_Silent_p.K229K|GYG2_uc004cqw.1_Silent_p.K446K|GYG2_uc004cqx.1_Silent_p.K384K|GYG2_uc010ndc.1_Silent_p.K264K	NM_003918	NP_003909	O15488	GLYG2_HUMAN	glycogenin 2 isoform b	486					glucose metabolic process|glycogen biosynthetic process|glycogen catabolic process	cytosol|soluble fraction	glycogenin glucosyltransferase activity			ovary(1)|kidney(1)	2		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				ACATGGGGAAGGACGCGTTTG	0.552													12	33	---	---	---	---	capture	Silent	SNP	2799206	2799206	GYG2	23	G	A	A	A	1	0	0	0	0	0	0	0	1	451	35	2	2	6835	269
MXRA5	25878	broad.mit.edu	37	X	3229254	3229254	+	Silent	SNP	G	A	A			TCGA-76-4929-01	TCGA-76-4929-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:3229254G>A	uc004crg.3	-	7	7147	c.6990C>T	c.(6988-6990)GTC>GTT	p.V2330V		NM_015419	NP_056234	Q9NR99	MXRA5_HUMAN	adlican precursor	2330	Ig-like C2-type 7.					extracellular region				ovary(5)|lung(1)|central_nervous_system(1)|skin(1)	8		all_lung(23;0.00031)|Lung NSC(23;0.000946)				CGTCCTTCCCGACCTGATTTT	0.542													114	298	---	---	---	---	capture	Silent	SNP	3229254	3229254	MXRA5	23	G	A	A	A	1	0	0	0	0	0	0	0	1	470	37	1	1	9913	269
ARHGAP6	395	broad.mit.edu	37	X	11272748	11272748	+	Missense_Mutation	SNP	T	C	C			TCGA-76-4929-01	TCGA-76-4929-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:11272748T>C	uc004cup.1	-	2	1541	c.668A>G	c.(667-669)GAG>GGG	p.E223G	ARHGAP6_uc004cuo.1_RNA|ARHGAP6_uc004cur.1_Missense_Mutation_p.E223G|ARHGAP6_uc004cum.1_Missense_Mutation_p.E20G|ARHGAP6_uc004cun.1_Missense_Mutation_p.E43G|ARHGAP6_uc010neb.1_Missense_Mutation_p.E45G|ARHGAP6_uc011mif.1_Missense_Mutation_p.E20G	NM_013427	NP_038286	O43182	RHG06_HUMAN	Rho GTPase activating protein 6 isoform 1	223					actin filament polymerization|activation of phospholipase C activity|negative regulation of focal adhesion assembly|negative regulation of stress fiber assembly|Rho protein signal transduction	actin filament|cytosol	phospholipase activator activity|phospholipase binding|Rho GTPase activator activity|SH3 domain binding|SH3/SH2 adaptor activity			urinary_tract(1)|lung(1)	2						CCGGGCCCTCTCCAGCTCTGA	0.522													9	227	---	---	---	---	capture	Missense_Mutation	SNP	11272748	11272748	ARHGAP6	23	T	C	C	C	1	0	0	0	0	1	0	0	0	702	54	3	3	880	269
CDKL5	6792	broad.mit.edu	37	X	18627018	18627018	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4929-01	TCGA-76-4929-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:18627018C>T	uc004cym.2	+	13	2285	c.2032C>T	c.(2032-2034)CGC>TGC	p.R678C	CDKL5_uc004cyn.2_Missense_Mutation_p.R678C	NM_003159	NP_003150	O76039	CDKL5_HUMAN	cyclin-dependent kinase-like 5	678					neuron migration|positive regulation of axon extension|positive regulation of dendrite morphogenesis|positive regulation of Rac GTPase activity|protein autophosphorylation	dendrite cytoplasm|dendritic growth cone|nucleus	ATP binding|cyclin-dependent protein kinase activity|Rac GTPase binding			ovary(2)|large_intestine(1)|stomach(1)|central_nervous_system(1)|skin(1)	6	Hepatocellular(33;0.183)					CTTCCATACACGCCAGAAGTC	0.433													42	117	---	---	---	---	capture	Missense_Mutation	SNP	18627018	18627018	CDKL5	23	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	3127	269
IL1RAPL1	11141	broad.mit.edu	37	X	29972739	29972739	+	Silent	SNP	A	G	G			TCGA-76-4929-01	TCGA-76-4929-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:29972739A>G	uc004dby.2	+	10	1810	c.1302A>G	c.(1300-1302)CTA>CTG	p.L434L		NM_014271	NP_055086	Q9NZN1	IRPL1_HUMAN	interleukin 1 receptor accessory protein-like 1	434	Cytoplasmic (Potential).|TIR.				innate immune response|negative regulation of calcium ion transport via voltage-gated calcium channel activity|negative regulation of exocytosis|regulation of neuron projection development	cytoplasm|integral to membrane|plasma membrane	protein binding|transmembrane receptor activity			ovary(3)|lung(1)|pancreas(1)	5						TTGAAATCCTACCTGATATGC	0.363													60	179	---	---	---	---	capture	Silent	SNP	29972739	29972739	IL1RAPL1	23	A	G	G	G	1	0	0	0	0	0	0	0	1	171	14	3	3	7584	269
GRIPAP1	56850	broad.mit.edu	37	X	48831638	48831638	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4929-01	TCGA-76-4929-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:48831638G>A	uc004dly.1	-	25	2397	c.2362C>T	c.(2362-2364)CTT>TTT	p.L788F		NM_020137	NP_064522	Q4V328	GRAP1_HUMAN	GRIP1 associated protein 1 isoform 1	788	Potential.					early endosome				breast(2)|kidney(1)	3						ATCTCCCGAAGGTTCTCGTCG	0.592													23	65	---	---	---	---	capture	Missense_Mutation	SNP	48831638	48831638	GRIPAP1	23	G	A	A	A	1	0	0	0	0	1	0	0	0	455	35	2	2	6722	269
NOX1	27035	broad.mit.edu	37	X	100117739	100117739	+	Silent	SNP	G	A	A			TCGA-76-4929-01	TCGA-76-4929-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:100117739G>A	uc004egj.2	-	5	614	c.408C>T	c.(406-408)TCC>TCT	p.S136S	uc010nnf.2_Intron|NOX1_uc004egl.3_Silent_p.S136S|NOX1_uc010nne.2_Silent_p.S99S	NM_007052	NP_008983	Q9Y5S8	NOX1_HUMAN	NADPH oxidase 1 isoform long	136	Extracellular (Potential).|Ferric oxidoreductase.				angiogenesis|cell migration|electron transport chain|FADH2 metabolic process|hydrogen peroxide metabolic process|inflammatory response|intracellular pH elevation|positive regulation of integrin biosynthetic process|positive regulation of smooth muscle cell proliferation|positive regulation vascular endothelial growth factor production|respiratory burst|response to pH|signal transduction|superoxide anion generation	cell junction|early endosome|invadopodium membrane|NADPH oxidase complex	electron carrier activity|flavin adenine dinucleotide binding|iron ion binding|Rac GTPase binding|superoxide-generating NADPH oxidase activity|voltage-gated proton channel activity			ovary(1)	1						TGGAGGCAAGGGAGCCATCTG	0.453													165	430	---	---	---	---	capture	Silent	SNP	100117739	100117739	NOX1	23	G	A	A	A	1	0	0	0	0	0	0	0	1	548	43	2	2	10463	269
BHLHB9	80823	broad.mit.edu	37	X	102004877	102004877	+	Silent	SNP	C	T	T			TCGA-76-4929-01	TCGA-76-4929-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:102004877C>T	uc010nog.2	+	4	1525	c.954C>T	c.(952-954)TGC>TGT	p.C318C	BHLHB9_uc011mrq.1_Silent_p.C318C|BHLHB9_uc011mrr.1_Silent_p.C318C|BHLHB9_uc011mrs.1_Silent_p.C318C|BHLHB9_uc011mrt.1_Silent_p.C318C|BHLHB9_uc004ejo.2_Silent_p.C318C|BHLHB9_uc011mru.1_Silent_p.C318C|BHLHB9_uc011mrv.1_Silent_p.C318C	NM_001142526	NP_001135998	Q6PI77	BHLH9_HUMAN	basic helix-loop-helix domain containing, class	318						cytoplasm|nucleus	binding			ovary(2)	2						AAATGGAATGCTATATGGATT	0.398													149	125	---	---	---	---	capture	Silent	SNP	102004877	102004877	BHLHB9	23	C	T	T	T	1	0	0	0	0	0	0	0	1	363	28	2	2	1408	269
MAGEA4	4103	broad.mit.edu	37	X	151093031	151093031	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4929-01	TCGA-76-4929-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:151093031C>T	uc004fez.2	+	3	1051	c.895C>T	c.(895-897)CGC>TGC	p.R299C	MAGEA4_uc004ffa.2_Missense_Mutation_p.R299C|MAGEA4_uc004ffb.2_Missense_Mutation_p.R299C|MAGEA4_uc004ffc.2_Missense_Mutation_p.R299C|MAGEA4_uc004ffd.2_Missense_Mutation_p.R299C	NM_002362	NP_002353	P43358	MAGA4_HUMAN	melanoma antigen family A, 4	299	MAGE.						protein binding			ovary(1)|breast(1)|central_nervous_system(1)	3	Acute lymphoblastic leukemia(192;6.56e-05)					TGCAAGAGTTCGCATTGCCTA	0.567													128	343	---	---	---	---	capture	Missense_Mutation	SNP	151093031	151093031	MAGEA4	23	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	9082	269
RBBP6	5930	broad.mit.edu	37	16	24581488	24581489	+	Frame_Shift_Del	DEL	TT	-	-			TCGA-76-4929-01	TCGA-76-4929-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:24581488_24581489delTT	uc002dmh.2	+	17	4517_4518	c.3477_3478delTT	c.(3475-3480)GATTTTfs	p.D1159fs	RBBP6_uc010vcb.1_Frame_Shift_Del_p.D1026fs|RBBP6_uc002dmi.2_Frame_Shift_Del_p.D1125fs|RBBP6_uc010bxr.2_Intron|RBBP6_uc002dmk.2_Frame_Shift_Del_p.D992fs	NM_006910	NP_008841	Q7Z6E9	RBBP6_HUMAN	retinoblastoma-binding protein 6 isoform 1	1159_1160					protein ubiquitination involved in ubiquitin-dependent protein catabolic process	chromosome|nucleolus|ubiquitin ligase complex	nucleic acid binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(3)|pancreas(1)	4				GBM - Glioblastoma multiforme(48;0.0518)		TAGATAAAGATTTTGAGTCTTC	0.342													51	67	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	24581488	24581489	RBBP6	16	TT	-	-	-	1	0	1	0	1	0	0	0	0	673	52	5	5	12998	269
PIK3R1	5295	broad.mit.edu	37	5	67575468	67575468	+	Frame_Shift_Del	DEL	G	-	-	rs143572224		TCGA-76-4929-01	TCGA-76-4929-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:67575468delG	uc003jva.2	+	5	1101	c.541delG	c.(541-543)GTTfs	p.V181fs	PIK3R1_uc003jvb.2_Frame_Shift_Del_p.V181fs	NM_181523	NP_852664	P27986	P85A_HUMAN	phosphoinositide-3-kinase, regulatory subunit 1	181	Rho-GAP.				epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|growth hormone receptor signaling pathway|insulin receptor signaling pathway|insulin-like growth factor receptor signaling pathway|interspecies interaction between organisms|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol 3-kinase cascade|phosphatidylinositol phosphorylation|phosphatidylinositol-mediated signaling|platelet activation|positive regulation of establishment of protein localization in plasma membrane|positive regulation of glucose import|T cell costimulation|T cell receptor signaling pathway	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex	1-phosphatidylinositol binding|ErbB-3 class receptor binding|insulin binding|insulin receptor binding|insulin receptor substrate binding|insulin-like growth factor receptor binding|phosphatidylinositol 3-kinase regulator activity|protein phosphatase binding	p.?(1)		endometrium(34)|central_nervous_system(27)|large_intestine(20)|breast(7)|ovary(5)|haematopoietic_and_lymphoid_tissue(3)|lung(2)|urinary_tract(1)|skin(1)|pancreas(1)	101		Lung NSC(167;1.99e-05)|Prostate(74;0.00308)|Ovarian(174;0.00473)|Colorectal(97;0.0176)		OV - Ovarian serous cystadenocarcinoma(47;3.76e-51)|Lung(70;0.0211)	Isoproterenol(DB01064)	CGATGTGCACGTTTTGGCTGA	0.393			Mis|F|O		gliobastoma|ovarian|colorectal					TCGA GBM(4;<1E-08)			53	31	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	67575468	67575468	PIK3R1	5	G	-	-	-	1	0	1	0	1	0	0	0	0	520	40	5	5	11821	269
SLU7	10569	broad.mit.edu	37	5	159842130	159842130	+	Splice_Site	DEL	A	-	-			TCGA-76-4929-01	TCGA-76-4929-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:159842130delA	uc003lyg.2	-	2	325	c.170_splice	c.e2+1	p.K57_splice	SLU7_uc003lyh.1_Splice_Site_p.K57_splice|SLU7_uc003lyi.1_Splice_Site_p.K57_splice	NM_006425	NP_006416	O95391	SLU7_HUMAN	step II splicing factor SLU7						alternative nuclear mRNA splicing, via spliceosome|nuclear mRNA 3'-splice site recognition	catalytic step 2 spliceosome|cytoplasm|nuclear speck|small nuclear ribonucleoprotein complex	pre-mRNA 3'-splice site binding|second spliceosomal transesterification activity|zinc ion binding			ovary(1)	1	Renal(175;0.00196)	Medulloblastoma(196;0.0354)|all_neural(177;0.116)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TTAAGTACTTACTTTCCTTCT	0.358													41	109	---	---	---	---	capture_indel	Splice_Site	DEL	159842130	159842130	SLU7	5	A	-	-	-	1	0	1	0	1	0	0	1	0	182	14	5	5	14647	269
AKAP9	10142	broad.mit.edu	37	7	91711915	91711915	+	Frame_Shift_Del	DEL	C	-	-			TCGA-76-4929-01	TCGA-76-4929-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:91711915delC	uc003ulg.2	+	32	8324	c.8099delC	c.(8098-8100)GCTfs	p.A2700fs	AKAP9_uc003ulf.2_Frame_Shift_Del_p.A2692fs|AKAP9_uc003uli.2_Frame_Shift_Del_p.A2323fs|AKAP9_uc003ulj.2_Frame_Shift_Del_p.A470fs|AKAP9_uc003ulk.2_5'Flank	NM_005751	NP_005742	Q99996	AKAP9_HUMAN	A-kinase anchor protein 9 isoform 2	2712	Potential.|Glu-rich.				G2/M transition of mitotic cell cycle|signal transduction|synaptic transmission|transport	centrosome|cytosol|Golgi apparatus	receptor binding			breast(7)|ovary(6)|lung(5)|skin(3)|large_intestine(2)|prostate(2)|central_nervous_system(1)	26	all_cancers(62;2.46e-09)|all_epithelial(64;4.42e-08)|Breast(17;0.00206)|all_lung(186;0.185)|all_hematologic(106;0.215)|Lung NSC(181;0.249)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			GAATCAGTGGCTACCAAAGCA	0.373			T	BRAF	papillary thyroid								41	187	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	91711915	91711915	AKAP9	7	C	-	-	-	1	0	1	0	1	0	0	0	0	364	28	5	5	459	269
