Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
KIF1B	23095	broad.mit.edu	37	1	10425617	10425617	+	Missense_Mutation	SNP	G	C	C			TCGA-76-4931-01	TCGA-76-4931-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:10425617G>C	uc001aqx.3	+	43	4865	c.4663G>C	c.(4663-4665)GAA>CAA	p.E1555Q	KIF1B_uc001aqw.3_Missense_Mutation_p.E1509Q|KIF1B_uc001aqy.2_Missense_Mutation_p.E1529Q|KIF1B_uc001aqz.2_Missense_Mutation_p.E1555Q|KIF1B_uc001ara.2_Missense_Mutation_p.E1515Q|KIF1B_uc001arb.2_Missense_Mutation_p.E1541Q	NM_015074	NP_055889	O60333	KIF1B_HUMAN	kinesin family member 1B isoform b	1555					anterograde axon cargo transport|apoptosis|neuromuscular synaptic transmission|neuron-neuron synaptic transmission	cytoplasmic vesicle membrane|microtubule|microtubule associated complex|mitochondrion	ATP binding|ATPase activity|kinesin binding|microtubule motor activity|protein binding			ovary(2)|upper_aerodigestive_tract(1)	3	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.2e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0259)|Colorectal(212;9.79e-07)|COAD - Colon adenocarcinoma(227;0.000143)|BRCA - Breast invasive adenocarcinoma(304;0.000413)|Kidney(185;0.00134)|KIRC - Kidney renal clear cell carcinoma(229;0.0037)|STAD - Stomach adenocarcinoma(132;0.0113)|READ - Rectum adenocarcinoma(331;0.0642)		CACTACCTTTGAAAGCGCCAT	0.552													4	117	---	---	---	---	capture	Missense_Mutation	SNP	10425617	10425617	KIF1B	1	G	C	C	C	1	0	0	0	0	1	0	0	0	585	45	4	4	8206	270
CLCNKB	1188	broad.mit.edu	37	1	16374889	16374889	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4931-01	TCGA-76-4931-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:16374889C>T	uc001axw.3	+	6	630	c.550C>T	c.(550-552)CGC>TGC	p.R184C	FAM131C_uc010obz.1_Intron|CLCNKB_uc001axx.3_Missense_Mutation_p.R184C|CLCNKB_uc001axy.3_5'Flank	NM_000085	NP_000076	P51801	CLCKB_HUMAN	chloride channel Kb isoform 1	184					excretion	chloride channel complex|integral to plasma membrane	voltage-gated chloride channel activity			skin(1)	1		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Colorectal(212;8.04e-08)|COAD - Colon adenocarcinoma(227;5.46e-06)|BRCA - Breast invasive adenocarcinoma(304;9.02e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.00655)|READ - Rectum adenocarcinoma(331;0.0649)		GGGCCGTGTGCGCACCACGAC	0.662													23	57	---	---	---	---	capture	Missense_Mutation	SNP	16374889	16374889	CLCNKB	1	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	3435	270
CTH	1491	broad.mit.edu	37	1	70881655	70881655	+	Missense_Mutation	SNP	G	T	T			TCGA-76-4931-01	TCGA-76-4931-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:70881655G>T	uc001dfd.2	+	2	329	c.185G>T	c.(184-186)CGT>CTT	p.R62L	CTH_uc009wbl.1_RNA|CTH_uc001dfe.2_Missense_Mutation_p.R62L|CTH_uc010oqq.1_Missense_Mutation_p.R62L	NM_001902	NP_001893	P32929	CGL_HUMAN	cystathionase isoform 1	62		Substrate.			cysteine biosynthetic process|hydrogen sulfide biosynthetic process|protein homotetramerization|protein-pyridoxal-5-phosphate linkage via peptidyl-N6-pyridoxal phosphate-L-lysine	cytoplasm|nucleus	cystathionine gamma-lyase activity|L-cysteine desulfhydrase activity|pyridoxal phosphate binding			lung(1)	1					L-Cysteine(DB00151)|Pyridoxal Phosphate(DB00114)	GAATATAGCCGTTCTGGAAAT	0.378													3	99	---	---	---	---	capture	Missense_Mutation	SNP	70881655	70881655	CTH	1	G	T	T	T	1	0	0	0	0	1	0	0	0	520	40	4	4	3972	270
SPRR2B	6701	broad.mit.edu	37	1	153043127	153043127	+	Silent	SNP	G	A	A			TCGA-76-4931-01	TCGA-76-4931-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:153043127G>A	uc001fbg.2	-	2	252	c.189C>T	c.(187-189)TGC>TGT	p.C63C	SPRR2D_uc009wnz.2_Intron|SPRR2A_uc001fbf.2_Intron|SPRR2A_uc009woa.2_Intron	NM_001017418	NP_001017418	P35325	SPR2B_HUMAN	small proline-rich protein 2B	63					keratinization	cornified envelope|cytoplasm					0	Lung NSC(65;1.49e-28)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			ACTTTGGCTGGCAGGGTGGGG	0.557													5	232	---	---	---	---	capture	Silent	SNP	153043127	153043127	SPRR2B	1	G	A	A	A	1	0	0	0	0	0	0	0	1	542	42	2	2	14990	270
CHRNB2	1141	broad.mit.edu	37	1	154542048	154542048	+	Nonsense_Mutation	SNP	C	T	T			TCGA-76-4931-01	TCGA-76-4931-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:154542048C>T	uc001ffg.2	+	2	439	c.175C>T	c.(175-177)CAG>TAG	p.Q59*		NM_000748	NP_000739	P17787	ACHB2_HUMAN	neuronal nicotinic acetylcholine receptor beta 2	59	Extracellular (Potential).				B cell activation|behavioral response to nicotine|calcium ion transport|central nervous system projection neuron axonogenesis|lateral geniculate nucleus development|locomotory behavior|membrane depolarization|memory|negative regulation of action potential|optic nerve morphogenesis|positive regulation of B cell proliferation|positive regulation of dopamine secretion|regulation of circadian sleep/wake cycle, REM sleep|regulation of dendrite morphogenesis|regulation of dopamine metabolic process|regulation of synaptogenesis|response to cocaine|response to ethanol|response to hypoxia|sensory perception of pain|sensory perception of sound|smooth muscle contraction|social behavior|synaptic transmission involved in micturition|synaptic transmission, cholinergic|vestibulocochlear nerve development|visual learning|visual perception	cell junction|external side of plasma membrane|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	acetylcholine receptor activity|nicotinic acetylcholine-activated cation-selective channel activity				0	all_lung(78;2.22e-29)|Lung NSC(65;3.66e-27)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		LUSC - Lung squamous cell carcinoma(543;0.185)		Nicotine(DB00184)	GGTGACAGTACAGCTTATGGT	0.557													31	45	---	---	---	---	capture	Nonsense_Mutation	SNP	154542048	154542048	CHRNB2	1	C	T	T	T	1	0	0	0	0	0	1	0	0	221	17	5	2	3356	270
OBSCN	84033	broad.mit.edu	37	1	228564849	228564849	+	Silent	SNP	A	G	G			TCGA-76-4931-01	TCGA-76-4931-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:228564849A>G	uc009xez.1	+	101	23180	c.23136A>G	c.(23134-23136)GCA>GCG	p.A7712A	OBSCN_uc001hsr.1_Silent_p.A2341A	NM_001098623	NP_001092093	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and	7712	Protein kinase 2.				apoptosis|cell differentiation|induction of apoptosis by extracellular signals|multicellular organismal development|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|M band|Z disc	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity|Rho guanyl-nucleotide exchange factor activity|structural constituent of muscle|titin binding			stomach(8)|large_intestine(7)|breast(5)|ovary(4)|skin(2)|central_nervous_system(1)|pancreas(1)	28		Prostate(94;0.0405)				ACAAGACAGCAGTGCTGCGCG	0.692													2	7	---	---	---	---	capture	Silent	SNP	228564849	228564849	OBSCN	1	A	G	G	G	1	0	0	0	0	0	0	0	1	80	7	3	3	10717	270
ZP4	57829	broad.mit.edu	37	1	238050695	238050695	+	Silent	SNP	A	G	G			TCGA-76-4931-01	TCGA-76-4931-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:238050695A>G	uc001hym.2	-	5	720	c.720T>C	c.(718-720)ACT>ACC	p.T240T	LOC100130331_uc010pyc.1_Intron	NM_021186	NP_067009	Q12836	ZP4_HUMAN	zona pellucida glycoprotein 4 preproprotein	240	ZP.|Extracellular (Potential).				acrosomal vesicle exocytosis|negative regulation of binding of sperm to zona pellucida|positive regulation of acrosome reaction|positive regulation of humoral immune response|positive regulation of protein kinase activity|positive regulation of T cell proliferation|protein kinase A signaling cascade|protein kinase C signaling cascade	integral to membrane|intracellular|plasma membrane|proteinaceous extracellular matrix	acrosin binding|receptor activity			ovary(2)|skin(1)	3	Ovarian(103;0.103)	all_cancers(173;0.00175)|all_epithelial(177;0.162)|all_neural(198;0.164)|Melanoma(53;0.211)|Prostate(94;0.214)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)			TGCCACAGGAAGTAAATGGAA	0.502													75	115	---	---	---	---	capture	Silent	SNP	238050695	238050695	ZP4	1	A	G	G	G	1	0	0	0	0	0	0	0	1	28	3	3	3	18094	270
C1orf150	148823	broad.mit.edu	37	1	247712494	247712494	+	Missense_Mutation	SNP	A	G	G			TCGA-76-4931-01	TCGA-76-4931-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:247712494A>G	uc001idf.2	+	1	46	c.1A>G	c.(1-3)ATG>GTG	p.M1V	C1orf150_uc009xgw.2_Intron|C1orf150_uc001ida.3_RNA|C1orf150_uc001idb.3_RNA|C1orf150_uc009xgx.2_Intron	NM_145278	NP_660321	Q5JQS6	CA150_HUMAN	hypothetical protein LOC148823	1											0	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.0241)			CTGTGAAAAGATGGGAAATTA	0.488													28	59	---	---	---	---	capture	Missense_Mutation	SNP	247712494	247712494	C1orf150	1	A	G	G	G	1	0	0	0	0	1	0	0	0	156	12	3	3	1986	270
PTEN	5728	broad.mit.edu	37	10	89712007	89712007	+	Nonsense_Mutation	SNP	G	T	T			TCGA-76-4931-01	TCGA-76-4931-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:89712007G>T	uc001kfb.2	+	7	1656	c.625G>T	c.(625-627)GGA>TGA	p.G209*		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog	209	C2 tensin-type.				activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.R55fs*1(4)|p.?(3)|p.G165fs*9(3)|p.Y27fs*1(2)|p.Y27_N212>Y(2)|p.G165_K342del(1)|p.G165_*404del(1)		endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		GTTCAGTGGCGGAACTTGCAG	0.328		31	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			107	30	---	---	---	---	capture	Nonsense_Mutation	SNP	89712007	89712007	PTEN	10	G	T	T	T	1	0	0	0	0	0	1	0	0	507	39	5	4	12633	270
SMC3	9126	broad.mit.edu	37	10	112350788	112350788	+	Silent	SNP	G	A	A			TCGA-76-4931-01	TCGA-76-4931-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:112350788G>A	uc001kze.2	+	17	1836	c.1710G>A	c.(1708-1710)ACG>ACA	p.T570T		NM_005445	NP_005436	Q9UQE7	SMC3_HUMAN	structural maintenance of chromosomes 3	570	Flexible hinge.				cell division|DNA mediated transformation|DNA repair|meiosis|mitotic metaphase/anaphase transition|mitotic prometaphase|mitotic spindle organization|negative regulation of DNA endoreduplication|signal transduction|sister chromatid cohesion	basement membrane|chromatin|chromosome, centromeric region|cytoplasm|meiotic cohesin complex|nuclear matrix|nucleoplasm|spindle pole	ATP binding|dynein binding|microtubule motor activity|protein heterodimerization activity			ovary(1)|central_nervous_system(1)|skin(1)	3		Breast(234;0.0848)|Lung NSC(174;0.238)		Epithelial(162;0.00206)|all cancers(201;0.0227)|BRCA - Breast invasive adenocarcinoma(275;0.127)		AAGTCAGCACGAAGATTTTAA	0.363													41	8	---	---	---	---	capture	Silent	SNP	112350788	112350788	SMC3	10	G	A	A	A	1	0	0	0	0	0	0	0	1	470	37	1	1	14676	270
TRIM44	54765	broad.mit.edu	37	11	35747531	35747531	+	Silent	SNP	G	A	A			TCGA-76-4931-01	TCGA-76-4931-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:35747531G>A	uc001mwi.2	+	3	1114	c.807G>A	c.(805-807)GTG>GTA	p.V269V		NM_017583	NP_060053	Q96DX7	TRI44_HUMAN	DIPB protein	269						intracellular	protein binding|zinc ion binding			skin(1)	1	all_lung(20;0.0317)|Lung NSC(22;0.0661)|all_epithelial(35;0.115)	all_hematologic(20;0.107)				TTCAGAAAGTGATTGCTGATG	0.423													40	26	---	---	---	---	capture	Silent	SNP	35747531	35747531	TRIM44	11	G	A	A	A	1	0	0	0	0	0	0	0	1	574	45	2	2	16402	270
MS4A14	84689	broad.mit.edu	37	11	60183896	60183896	+	Silent	SNP	G	A	A			TCGA-76-4931-01	TCGA-76-4931-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:60183896G>A	uc001npj.2	+	5	2020	c.1455G>A	c.(1453-1455)CGG>CGA	p.R485R	MS4A14_uc001npi.2_Silent_p.R373R|MS4A14_uc001npn.2_Silent_p.R223R|MS4A14_uc001npk.2_Silent_p.R468R|MS4A14_uc001npl.2_Silent_p.R223R|MS4A14_uc001npm.2_Silent_p.R223R	NM_032597	NP_115986	Q96JA4	M4A14_HUMAN	membrane-spanning 4-domains, subfamily A, member	485	Gln-rich.					integral to membrane	receptor activity			breast(1)	1						CCTCAAGACGGCATTCCTTAA	0.393													4	117	---	---	---	---	capture	Silent	SNP	60183896	60183896	MS4A14	11	G	A	A	A	1	0	0	0	0	0	0	0	1	535	42	2	2	9768	270
PRPF19	27339	broad.mit.edu	37	11	60665709	60665709	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4931-01	TCGA-76-4931-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:60665709G>A	uc001nqf.2	-	14	1382	c.1175C>T	c.(1174-1176)TCG>TTG	p.S392L		NM_014502	NP_055317	Q9UMS4	PRP19_HUMAN	PRP19/PSO4 pre-mRNA processing factor 19	392	WD 5.				DNA repair|protein polyubiquitination|spliceosome assembly	catalytic step 2 spliceosome|nuclear speck|spindle|ubiquitin ligase complex	DNA binding|identical protein binding|ubiquitin-ubiquitin ligase activity			ovary(1)	1						GATGGGGCCCGAGTGGCCAGG	0.532													39	55	---	---	---	---	capture	Missense_Mutation	SNP	60665709	60665709	PRPF19	11	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	12460	270
HEPHL1	341208	broad.mit.edu	37	11	93778980	93778980	+	Silent	SNP	G	A	A			TCGA-76-4931-01	TCGA-76-4931-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:93778980G>A	uc001pep.2	+	2	469	c.312G>A	c.(310-312)TTG>TTA	p.L104L		NM_001098672	NP_001092142	Q6MZM0	HPHL1_HUMAN	hephaestin-like 1 precursor	104	Plastocyanin-like 1.|Extracellular (Potential).				copper ion transport	integral to membrane	copper ion binding|oxidoreductase activity			ovary(3)	3		Acute lymphoblastic leukemia(157;2.34e-05)|all_hematologic(158;0.00824)				GCCCCATCTTGAGGGCCGAAG	0.468													39	40	---	---	---	---	capture	Silent	SNP	93778980	93778980	HEPHL1	11	G	A	A	A	1	0	0	0	0	0	0	0	1	581	45	2	2	6981	270
OR10G8	219869	broad.mit.edu	37	11	123900691	123900691	+	Missense_Mutation	SNP	G	A	A	rs116699538	byFrequency;by1000genomes	TCGA-76-4931-01	TCGA-76-4931-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:123900691G>A	uc001pzp.1	+	1	362	c.362G>A	c.(361-363)CGC>CAC	p.R121H		NM_001004464	NP_001004464	Q8NGN5	O10G8_HUMAN	olfactory receptor, family 10, subfamily G,	121	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0521)		TCCTGTGATCGCTACCTGGCC	0.567													108	149	---	---	---	---	capture	Missense_Mutation	SNP	123900691	123900691	OR10G8	11	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	10807	270
DENND5B	160518	broad.mit.edu	37	12	31545306	31545306	+	Silent	SNP	G	A	A			TCGA-76-4931-01	TCGA-76-4931-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:31545306G>A	uc001rki.1	-	19	3547	c.3361C>T	c.(3361-3363)CTG>TTG	p.L1121L	DENND5B_uc001rkh.1_Silent_p.L1156L|DENND5B_uc009zjq.1_Intron	NM_144973	NP_659410	Q6ZUT9	DEN5B_HUMAN	DENN/MADD domain containing 5B	1121	RUN 2.					integral to membrane				ovary(1)|central_nervous_system(1)	2						TCTCCACACAGCAACACGGTG	0.468													3	72	---	---	---	---	capture	Silent	SNP	31545306	31545306	DENND5B	12	G	A	A	A	1	0	0	0	0	0	0	0	1	438	34	2	2	4395	270
MLL2	8085	broad.mit.edu	37	12	49427983	49427983	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4931-01	TCGA-76-4931-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:49427983C>T	uc001rta.3	-	38	10607	c.10607G>A	c.(10606-10608)CGC>CAC	p.R3536H		NM_003482	NP_003473	O14686	MLL2_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 2	3536	Gln-rich.				chromatin silencing|histone H3-K4 methylation|oocyte growth|positive regulation of cell proliferation|positive regulation of estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|response to estrogen stimulus|transcription, DNA-dependent	histone methyltransferase complex	histone-lysine N-methyltransferase activity|protein binding|transcription regulatory region DNA binding|zinc ion binding			kidney(16)|central_nervous_system(12)|lung(4)|skin(4)|ovary(3)|pancreas(2)	41						CCGGGACTTGCGGTGTACACC	0.557			N|F|Mis		medulloblastoma|renal					HNSCC(34;0.089)			5	252	---	---	---	---	capture	Missense_Mutation	SNP	49427983	49427983	MLL2	12	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	9533	270
OR6C6	283365	broad.mit.edu	37	12	55688853	55688853	+	Missense_Mutation	SNP	G	A	A	rs77411445		TCGA-76-4931-01	TCGA-76-4931-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:55688853G>A	uc010sph.1	-	1	164	c.164C>T	c.(163-165)ACG>ATG	p.T55M		NM_001005493	NP_001005493	A6NF89	OR6C6_HUMAN	olfactory receptor, family 6, subfamily C,	55	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			large_intestine(1)|skin(1)	2						ATACATTGGCGTCTTGAGCCG	0.398													54	63	---	---	---	---	capture	Missense_Mutation	SNP	55688853	55688853	OR6C6	12	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	11098	270
AVPR1A	552	broad.mit.edu	37	12	63543656	63543656	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4931-01	TCGA-76-4931-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:63543656C>T	uc001sro.1	-	1	2935	c.961G>A	c.(961-963)GTC>ATC	p.V321I		NM_000706	NP_000697	P37288	V1AR_HUMAN	arginine vasopressin receptor 1A	321	Extracellular (Potential).				activation of phospholipase C activity|elevation of cytosolic calcium ion concentration|generation of precursor metabolites and energy	endosome|integral to plasma membrane	protein kinase C binding|vasopressin receptor activity				0			BRCA - Breast invasive adenocarcinoma(9;0.193)	GBM - Glioblastoma multiforme(28;0.0569)	Conivaptan(DB00872)|Desmopressin(DB00035)|Felypressin(DB00093)|Terlipressin(DB02638)|Vasopressin(DB00067)	CCGGTCCAGACGGACATGGGA	0.403													49	102	---	---	---	---	capture	Missense_Mutation	SNP	63543656	63543656	AVPR1A	12	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	1221	270
NOS1	4842	broad.mit.edu	37	12	117703242	117703242	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4931-01	TCGA-76-4931-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:117703242C>T	uc001twm.1	-	12	2701	c.2015G>A	c.(2014-2016)CGC>CAC	p.R672H		NM_000620	NP_000611	P29475	NOS1_HUMAN	nitric oxide synthase 1, neuronal	672					multicellular organismal response to stress|myoblast fusion|negative regulation of calcium ion transport into cytosol|neurotransmitter biosynthetic process|nitric oxide biosynthetic process|platelet activation|positive regulation of vasodilation|regulation of cardiac muscle contraction|response to heat|response to hypoxia	cytoskeleton|cytosol|dendritic spine|perinuclear region of cytoplasm|photoreceptor inner segment|sarcolemma|sarcoplasmic reticulum	arginine binding|cadmium ion binding|calmodulin binding|flavin adenine dinucleotide binding|FMN binding|heme binding|NADP binding|nitric-oxide synthase activity|tetrahydrobiopterin binding			ovary(3)|skin(3)|pancreas(1)	7	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0561)	L-Citrulline(DB00155)	CCCCCGGCAGCGGTACTCATT	0.602													5	11	---	---	---	---	capture	Missense_Mutation	SNP	117703242	117703242	NOS1	12	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	10448	270
GPR12	2835	broad.mit.edu	37	13	27332980	27332980	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4931-01	TCGA-76-4931-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:27332980G>A	uc010aal.2	-	2	1207	c.985C>T	c.(985-987)CGC>TGC	p.R329C	GPR12_uc010tdl.1_Missense_Mutation_p.R170C	NM_005288	NP_005279	P47775	GPR12_HUMAN	G protein-coupled receptor 12	329	Cytoplasmic (Potential).					integral to plasma membrane					0	Colorectal(5;5.77e-05)	Breast(139;0.198)		Epithelial(112;9.37e-07)|OV - Ovarian serous cystadenocarcinoma(117;1.16e-06)|all cancers(112;8.31e-06)|GBM - Glioblastoma multiforme(144;0.00121)|Lung(94;0.111)|LUSC - Lung squamous cell carcinoma(192;0.184)		CTGGGCGAGCGCGCTCTCTGG	0.537													30	30	---	---	---	---	capture	Missense_Mutation	SNP	27332980	27332980	GPR12	13	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	6569	270
ADCY4	196883	broad.mit.edu	37	14	24795366	24795366	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4931-01	TCGA-76-4931-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:24795366C>T	uc001wov.2	-	12	1580	c.1574G>A	c.(1573-1575)CGT>CAT	p.R525H	ADCY4_uc001wow.2_Missense_Mutation_p.R525H|ADCY4_uc010toh.1_Missense_Mutation_p.R211H|ADCY4_uc001wox.2_Missense_Mutation_p.R525H|ADCY4_uc001woy.2_Missense_Mutation_p.R525H	NM_139247	NP_640340	Q8NFM4	ADCY4_HUMAN	adenylate cyclase 4	525	Cytoplasmic (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	cytoplasm|integral to membrane|plasma membrane	adenylate cyclase activity|ATP binding|metal ion binding|protein binding			ovary(1)|lung(1)|pancreas(1)	3				GBM - Glioblastoma multiforme(265;0.0192)		CCGGGGGGTACGGCTCCTGCA	0.592													17	53	---	---	---	---	capture	Missense_Mutation	SNP	24795366	24795366	ADCY4	14	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	296	270
GALC	2581	broad.mit.edu	37	14	88431916	88431916	+	Silent	SNP	G	A	A			TCGA-76-4931-01	TCGA-76-4931-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:88431916G>A	uc001xvt.2	-	9	1365	c.966C>T	c.(964-966)TGC>TGT	p.C322C	GALC_uc010tvw.1_RNA|GALC_uc010tvx.1_Silent_p.C296C|GALC_uc010tvy.1_Silent_p.C299C|GALC_uc010tvz.1_Silent_p.C266C|GALC_uc001xvu.1_Silent_p.C322C	NM_000153	NP_000144	P54803	GALC_HUMAN	galactosylceramidase isoform a precursor	322					carbohydrate metabolic process|galactosylceramide catabolic process	lysosome	cation binding|galactosylceramidase activity				0						TCATCAACCCGCATCTCCCAT	0.448													3	52	---	---	---	---	capture	Silent	SNP	88431916	88431916	GALC	14	G	A	A	A	1	0	0	0	0	0	0	0	1	490	38	1	1	6141	270
AHNAK2	113146	broad.mit.edu	37	14	105415138	105415138	+	Missense_Mutation	SNP	A	C	C			TCGA-76-4931-01	TCGA-76-4931-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:105415138A>C	uc010axc.1	-	7	6770	c.6650T>G	c.(6649-6651)GTG>GGG	p.V2217G	AHNAK2_uc001ypx.2_Missense_Mutation_p.V2117G	NM_138420	NP_612429	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	2217						nucleus				ovary(1)	1		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			TTTCACGTCCACCTGGCCAGC	0.627													115	116	---	---	---	---	capture	Missense_Mutation	SNP	105415138	105415138	AHNAK2	14	A	C	C	C	1	0	0	0	0	1	0	0	0	78	6	4	4	415	270
MKRN3	7681	broad.mit.edu	37	15	23810982	23810982	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4931-01	TCGA-76-4931-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:23810982C>T	uc001ywh.3	+	1	529	c.53C>T	c.(52-54)GCA>GTA	p.A18V	MKRN3_uc001ywi.2_Missense_Mutation_p.A18V|MKRN3_uc010ayi.1_Missense_Mutation_p.A18V	NM_005664	NP_005655	Q13064	MKRN3_HUMAN	makorin ring finger protein 3	18						ribonucleoprotein complex	ligase activity|nucleic acid binding|zinc ion binding			lung(6)|large_intestine(2)|ovary(2)	10		all_cancers(20;8.44e-25)|all_epithelial(15;3.69e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000353)|Colorectal(260;0.14)		all cancers(64;3.02e-06)|Epithelial(43;1.94e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0012)		GGGGCCCAGGCAGGTGCTGAG	0.637													11	25	---	---	---	---	capture	Missense_Mutation	SNP	23810982	23810982	MKRN3	15	C	T	T	T	1	0	0	0	0	1	0	0	0	325	25	2	2	9520	270
NEO1	4756	broad.mit.edu	37	15	73562540	73562540	+	Nonsense_Mutation	SNP	G	A	A			TCGA-76-4931-01	TCGA-76-4931-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:73562540G>A	uc002avm.3	+	17	2826	c.2684G>A	c.(2683-2685)TGG>TAG	p.W895*	NEO1_uc010ukx.1_Nonsense_Mutation_p.W895*|NEO1_uc010uky.1_Nonsense_Mutation_p.W895*|NEO1_uc010ukz.1_Nonsense_Mutation_p.W319*|NEO1_uc002avn.3_Nonsense_Mutation_p.W544*	NM_002499	NP_002490	Q92859	NEO1_HUMAN	neogenin homolog 1 precursor	895	Extracellular (Potential).|Fibronectin type-III 5.				axon guidance|cell adhesion|positive regulation of muscle cell differentiation	Golgi apparatus|integral to plasma membrane|nucleus				pancreas(1)	1						ACCGTCCGATGGAAAACCAAC	0.448													38	49	---	---	---	---	capture	Nonsense_Mutation	SNP	73562540	73562540	NEO1	15	G	A	A	A	1	0	0	0	0	0	1	0	0	611	47	5	2	10243	270
NOMO1	23420	broad.mit.edu	37	16	14968903	14968903	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4931-01	TCGA-76-4931-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:14968903G>A	uc002dcv.2	+	19	2131	c.2065G>A	c.(2065-2067)GAC>AAC	p.D689N		NM_014287	NP_055102	Q15155	NOMO1_HUMAN	nodal modulator 1 precursor	689	Extracellular (Potential).					integral to membrane	carbohydrate binding|carboxypeptidase activity|protein binding			ovary(1)	1						GTCTTCCATCGACAGTGAACC	0.562													74	75	---	---	---	---	capture	Missense_Mutation	SNP	14968903	14968903	NOMO1	16	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	10438	270
SCNN1B	6338	broad.mit.edu	37	16	23366788	23366788	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4931-01	TCGA-76-4931-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:23366788G>A	uc002dln.2	+	4	930	c.754G>A	c.(754-756)GGA>AGA	p.G252R		NM_000336	NP_000327	P51168	SCNNB_HUMAN	sodium channel, nonvoltage-gated 1, beta	252	Extracellular (By similarity).				excretion|sensory perception of taste	apical plasma membrane	ligand-gated sodium channel activity|WW domain binding			ovary(3)|breast(2)|large_intestine(1)|pancreas(1)	7				GBM - Glioblastoma multiforme(48;0.0465)	Amiloride(DB00594)|Triamterene(DB00384)	CTGCCTATTCGGAGCTGAGCC	0.488													17	56	---	---	---	---	capture	Missense_Mutation	SNP	23366788	23366788	SCNN1B	16	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	13821	270
ATP2A1	487	broad.mit.edu	37	16	28914740	28914740	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4931-01	TCGA-76-4931-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:28914740G>A	uc002dro.1	+	21	3143	c.2959G>A	c.(2959-2961)GTT>ATT	p.V987I	uc010vct.1_Intron|ATP2A1_uc002drn.1_Missense_Mutation_p.V987I|ATP2A1_uc002drp.1_Missense_Mutation_p.V862I	NM_173201	NP_775293	O14983	AT2A1_HUMAN	ATPase, Ca++ transporting, fast twitch 1 isoform	987	Cytoplasmic (By similarity).				apoptosis in response to endoplasmic reticulum stress|apoptotic mitochondrial changes|ATP biosynthetic process|calcium ion import|elevation of endoplasmic reticulum calcium ion concentration|elevation of mitochondrial calcium ion concentration|maintenance of mitochondrion location|negative regulation of striated muscle contraction|platelet activation|positive regulation of fast-twitch skeletal muscle fiber contraction|reduction of endoplasmic reticulum calcium ion concentration|relaxation of skeletal muscle|response to endoplasmic reticulum stress	endoplasmic reticulum membrane|ER-Golgi intermediate compartment|H zone|I band|microsome|perinuclear region of cytoplasm|platelet dense tubular network membrane|sarcoplasmic reticulum|sarcoplasmic reticulum membrane	ATP binding|ATP binding|calcium ion binding|calcium ion binding|calcium-transporting ATPase activity|protein homodimerization activity			ovary(2)|central_nervous_system(1)|pancreas(1)	4						CCTCAAGTTCGTTGCTCGGAA	0.522													16	40	---	---	---	---	capture	Missense_Mutation	SNP	28914740	28914740	ATP2A1	16	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	1127	270
C17orf87	388325	broad.mit.edu	37	17	5118261	5118261	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4931-01	TCGA-76-4931-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:5118261G>A	uc002gbh.2	-	4	275	c.242C>T	c.(241-243)CCG>CTG	p.P81L	uc002gbf.1_Intron|uc002gbg.1_Intron|C17orf87_uc010clb.1_Missense_Mutation_p.P74L|C17orf87_uc002gbi.2_Missense_Mutation_p.P74L	NM_207103	NP_996986	Q6UWF3	CQ087_HUMAN	hypothetical protein LOC388325	81						integral to membrane				ovary(1)	1						TGGCAGAGGCGGTAATTGAAC	0.433													4	77	---	---	---	---	capture	Missense_Mutation	SNP	5118261	5118261	C17orf87	17	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	1874	270
DNAH2	146754	broad.mit.edu	37	17	7722376	7722376	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4931-01	TCGA-76-4931-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7722376C>T	uc002giu.1	+	70	10824	c.10810C>T	c.(10810-10812)CGG>TGG	p.R3604W	DNAH2_uc010cnm.1_Missense_Mutation_p.R542W	NM_020877	NP_065928	Q9P225	DYH2_HUMAN	dynein heavy chain domain 3	3604					ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(6)|skin(6)|central_nervous_system(1)	13		all_cancers(10;4.66e-07)|Prostate(122;0.081)				TGACTTGGCGCGGGAGGTAAG	0.607													11	15	---	---	---	---	capture	Missense_Mutation	SNP	7722376	7722376	DNAH2	17	C	T	T	T	1	0	0	0	0	1	0	0	0	347	27	1	1	4559	270
KRT33A	3883	broad.mit.edu	37	17	39506774	39506774	+	Silent	SNP	C	T	T	rs61736449	byFrequency	TCGA-76-4931-01	TCGA-76-4931-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:39506774C>T	uc002hwk.1	-	1	283	c.246G>A	c.(244-246)GCG>GCA	p.A82A		NM_004138	NP_004129	O76009	KT33A_HUMAN	keratin 33A	82	Coil 1A.|Rod.			A -> T (in Ref. 3; BAG36784).		intermediate filament	protein binding|structural molecule activity				0		Breast(137;0.000496)				TCTCCAGCTCCGCGTTGTCCC	0.602													60	82	---	---	---	---	capture	Silent	SNP	39506774	39506774	KRT33A	17	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	8389	270
ZNF516	9658	broad.mit.edu	37	18	74153649	74153649	+	Silent	SNP	G	A	A			TCGA-76-4931-01	TCGA-76-4931-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:74153649G>A	uc010dqx.1	-	2	1597	c.1362C>T	c.(1360-1362)CGC>CGT	p.R454R	ZNF516_uc002lme.2_RNA	NM_014643	NP_055458	Q92618	ZN516_HUMAN	zinc finger protein 516	454					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Prostate(75;0.0869)|Esophageal squamous(42;0.129)		OV - Ovarian serous cystadenocarcinoma(15;7.64e-06)|BRCA - Breast invasive adenocarcinoma(31;0.238)		GGACGTACTCGCGCCTGTCCT	0.731													4	1	---	---	---	---	capture	Silent	SNP	74153649	74153649	ZNF516	18	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	17839	270
GRIN3B	116444	broad.mit.edu	37	19	1005285	1005285	+	Silent	SNP	C	T	T			TCGA-76-4931-01	TCGA-76-4931-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:1005285C>T	uc002lqo.1	+	3	1785	c.1785C>T	c.(1783-1785)TAC>TAT	p.Y595Y		NM_138690	NP_619635	O60391	NMD3B_HUMAN	glutamate receptor, ionotropic,	595	Cytoplasmic (Potential).				ionotropic glutamate receptor signaling pathway|protein insertion into membrane|regulation of calcium ion transport	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|neuronal cell body|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|glycine binding|ionotropic glutamate receptor activity|neurotransmitter receptor activity				0		Acute lymphoblastic leukemia(61;4.36e-14)|all_hematologic(61;4.84e-09)|Lung NSC(49;0.000226)|all_lung(49;0.000353)|Breast(49;0.00066)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	Glycine(DB00145)|L-Glutamic Acid(DB00142)|Orphenadrine(DB01173)	TCACCGTGTACGAGTGGCGTA	0.652													41	43	---	---	---	---	capture	Silent	SNP	1005285	1005285	GRIN3B	19	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	6717	270
DENND1C	79958	broad.mit.edu	37	19	6472910	6472910	+	Missense_Mutation	SNP	A	C	C			TCGA-76-4931-01	TCGA-76-4931-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:6472910A>C	uc002mfe.2	-	15	1240	c.1148T>G	c.(1147-1149)CTG>CGG	p.L383R	DENND1C_uc002mfb.2_5'UTR|DENND1C_uc002mfc.2_5'UTR|DENND1C_uc002mfd.2_5'UTR|DENND1C_uc010xje.1_Missense_Mutation_p.L339R	NM_024898	NP_079174	Q8IV53	DEN1C_HUMAN	DENN/MADD domain containing 1C	383	dDENN.					clathrin-coated vesicle|cytosol	guanyl-nucleotide exchange factor activity			large_intestine(1)	1						CTGTTTGAACAGCTGCAGGTG	0.627													5	2	---	---	---	---	capture	Missense_Mutation	SNP	6472910	6472910	DENND1C	19	A	C	C	C	1	0	0	0	0	1	0	0	0	91	7	4	4	4386	270
CD209	30835	broad.mit.edu	37	19	7809880	7809880	+	Missense_Mutation	SNP	C	T	T	rs139712001	byFrequency	TCGA-76-4931-01	TCGA-76-4931-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:7809880C>T	uc002mht.2	-	5	914	c.847G>A	c.(847-849)GCC>ACC	p.A283T	CD209_uc010xju.1_Missense_Mutation_p.A122T|CD209_uc010dvp.2_Missense_Mutation_p.A259T|CD209_uc002mhr.2_Missense_Mutation_p.A259T|CD209_uc002mhs.2_Missense_Mutation_p.A213T|CD209_uc002mhu.2_Missense_Mutation_p.A191T|CD209_uc010dvq.2_Missense_Mutation_p.A283T|CD209_uc002mhq.2_Missense_Mutation_p.A283T|CD209_uc002mhv.2_Missense_Mutation_p.A259T|CD209_uc002mhx.2_Missense_Mutation_p.A239T|CD209_uc002mhw.2_Missense_Mutation_p.A147T|CD209_uc010dvr.2_Intron	NM_021155	NP_066978	Q9NNX6	CD209_HUMAN	CD209 molecule isoform 1	283	Extracellular (Probable).|C-type lectin.				cell-cell recognition|endocytosis|heterophilic cell-cell adhesion|innate immune response|intracellular signal transduction|intracellular virion transport|leukocyte cell-cell adhesion|peptide antigen transport|viral genome replication|virion attachment to host cell surface receptor	cytoplasm|extracellular region|integral to membrane|plasma membrane	mannose binding|metal ion binding|peptide antigen binding|receptor activity|virion binding			skin(1)	1						TCTTTGCAGGCGGTGATGGAG	0.582													67	63	---	---	---	---	capture	Missense_Mutation	SNP	7809880	7809880	CD209	19	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	2955	270
ZNF761	388561	broad.mit.edu	37	19	53959098	53959098	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4931-01	TCGA-76-4931-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:53959098C>T	uc010eqp.2	+	7	1795	c.1337C>T	c.(1336-1338)ACC>ATC	p.T446I	ZNF761_uc010ydy.1_Missense_Mutation_p.T392I|ZNF761_uc002qbt.1_Missense_Mutation_p.T392I	NM_001008401	NP_001008401	Q86XN6	ZN761_HUMAN	zinc finger protein 761	446	C2H2-type 9.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1				GBM - Glioblastoma multiforme(134;0.00786)		TGTGGAAAGACCTTTAGCCGG	0.383													4	149	---	---	---	---	capture	Missense_Mutation	SNP	53959098	53959098	ZNF761	19	C	T	T	T	1	0	0	0	0	1	0	0	0	234	18	2	2	18013	270
XDH	7498	broad.mit.edu	37	2	31571198	31571198	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4931-01	TCGA-76-4931-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:31571198C>T	uc002rnv.1	-	28	3162	c.3083G>A	c.(3082-3084)GGC>GAC	p.G1028D		NM_000379	NP_000370	P47989	XDH_HUMAN	xanthine dehydrogenase	1028					purine nucleotide catabolic process|xanthine catabolic process	cytosol|extracellular region|peroxisome	2 iron, 2 sulfur cluster binding|electron carrier activity|flavin adenine dinucleotide binding|iron ion binding|molybdopterin cofactor binding|protein homodimerization activity|xanthine dehydrogenase activity|xanthine oxidase activity			skin(4)|breast(2)|ovary(1)|central_nervous_system(1)	8	Acute lymphoblastic leukemia(172;0.155)				Allopurinol(DB00437)|Carvedilol(DB01136)|Daunorubicin(DB00694)|Deferoxamine(DB00746)|Desflurane(DB01189)|Menadione(DB00170)|Mercaptopurine(DB01033)|Methotrexate(DB00563)|NADH(DB00157)|Nitrofurazone(DB00336)|Papaverine(DB01113)|Procarbazine(DB01168)|Pyrazinamide(DB00339)|Rasburicase(DB00049)|Spermine(DB00127)|Trifluoperazine(DB00831)|Vitamin E(DB00163)	CAGCACAGAGCCATCTGTGTA	0.517													24	45	---	---	---	---	capture	Missense_Mutation	SNP	31571198	31571198	XDH	2	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	17307	270
SERTAD2	9792	broad.mit.edu	37	2	64863694	64863694	+	Silent	SNP	C	T	T			TCGA-76-4931-01	TCGA-76-4931-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:64863694C>T	uc002sde.1	-	2	609	c.312G>A	c.(310-312)CCG>CCA	p.P104P		NM_014755	NP_055570	Q14140	SRTD2_HUMAN	SERTA domain containing 2	104					negative regulation of cell growth|transcription, DNA-dependent	cytoplasm|nucleus					0						TGAAGGCCGGCGGGGCCTCTC	0.697													31	26	---	---	---	---	capture	Silent	SNP	64863694	64863694	SERTAD2	2	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	14014	270
TTN	7273	broad.mit.edu	37	2	179474028	179474028	+	Nonsense_Mutation	SNP	G	A	A			TCGA-76-4931-01	TCGA-76-4931-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179474028G>A	uc010zfg.1	-	222	44529	c.44305C>T	c.(44305-44307)CGA>TGA	p.R14769*	uc002ump.1_Intron|TTN_uc010zfh.1_Nonsense_Mutation_p.R8464*|TTN_uc010zfi.1_Nonsense_Mutation_p.R8397*|TTN_uc010zfj.1_Nonsense_Mutation_p.R8272*	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	15696							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AGAGAATCTCGGACGCGTAGC	0.453													35	23	---	---	---	---	capture	Nonsense_Mutation	SNP	179474028	179474028	TTN	2	G	A	A	A	1	0	0	0	0	0	1	0	0	506	39	5	1	16617	270
CEP250	11190	broad.mit.edu	37	20	34092288	34092288	+	Missense_Mutation	SNP	C	G	G			TCGA-76-4931-01	TCGA-76-4931-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:34092288C>G	uc002xcm.2	+	31	6762	c.6091C>G	c.(6091-6093)CTC>GTC	p.L2031V	CEP250_uc010zve.1_Missense_Mutation_p.L1399V	NM_007186	NP_009117	Q9BV73	CP250_HUMAN	centrosomal protein 2	2031	Gln/Glu-rich.|Potential.				centriole-centriole cohesion|G2/M transition of mitotic cell cycle|protein localization|regulation of centriole-centriole cohesion	centriole|cilium|cytosol|microtubule basal body|perinuclear region of cytoplasm|protein complex	protein C-terminus binding|protein kinase binding			ovary(4)|central_nervous_system(1)	5	Lung NSC(9;0.00156)|all_lung(11;0.00243)		BRCA - Breast invasive adenocarcinoma(18;0.0106)			GGACCAGGATCTCCGATACCA	0.597													11	12	---	---	---	---	capture	Missense_Mutation	SNP	34092288	34092288	CEP250	20	C	G	G	G	1	0	0	0	0	1	0	0	0	416	32	4	4	3220	270
SUSD2	56241	broad.mit.edu	37	22	24579586	24579586	+	Silent	SNP	C	T	T			TCGA-76-4931-01	TCGA-76-4931-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:24579586C>T	uc002zzn.1	+	3	455	c.411C>T	c.(409-411)TCC>TCT	p.S137S		NM_019601	NP_062547	Q9UGT4	SUSD2_HUMAN	sushi domain containing 2 precursor	137	Extracellular (Potential).				immune response	integral to membrane	polysaccharide binding|protein binding|scavenger receptor activity			skin(1)	1						ACGGCCACTCCTTCCCTCGTG	0.642													15	29	---	---	---	---	capture	Silent	SNP	24579586	24579586	SUSD2	22	C	T	T	T	1	0	0	0	0	0	0	0	1	301	24	2	2	15296	270
CCDC157	550631	broad.mit.edu	37	22	30766543	30766543	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4931-01	TCGA-76-4931-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:30766543G>A	uc011aku.1	+	5	1309	c.649G>A	c.(649-651)GCC>ACC	p.A217T	CCDC157_uc011akv.1_Missense_Mutation_p.A217T	NM_001017437	NP_001017437	Q569K6	CC157_HUMAN	coiled-coil domain containing 157	217										central_nervous_system(1)	1						CATTGAGACGGCCCTGGTGCC	0.622													64	84	---	---	---	---	capture	Missense_Mutation	SNP	30766543	30766543	CCDC157	22	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	2763	270
GAL3ST1	9514	broad.mit.edu	37	22	30951178	30951178	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4931-01	TCGA-76-4931-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:30951178C>T	uc003aig.1	-	4	1174	c.1034G>A	c.(1033-1035)TGC>TAC	p.C345Y	GAL3ST1_uc003aih.1_Missense_Mutation_p.C345Y|GAL3ST1_uc003aii.1_Missense_Mutation_p.C345Y|GAL3ST1_uc010gvz.1_Missense_Mutation_p.C345Y	NM_004861	NP_004852	Q99999	G3ST1_HUMAN	galactose-3-O-sulfotransferase 1	345	Lumenal (Potential).				protein N-linked glycosylation	Golgi membrane|integral to plasma membrane|membrane fraction	galactosylceramide sulfotransferase activity				0						CCCGTCGATGCAGATGGTCCG	0.711													19	12	---	---	---	---	capture	Missense_Mutation	SNP	30951178	30951178	GAL3ST1	22	C	T	T	T	1	0	0	0	0	1	0	0	0	325	25	2	2	6137	270
MFNG	4242	broad.mit.edu	37	22	37882098	37882098	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4931-01	TCGA-76-4931-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:37882098C>T	uc003ass.1	-	1	288	c.118G>A	c.(118-120)GAG>AAG	p.E40K	MFNG_uc011ani.1_5'UTR|MFNG_uc011anj.1_Missense_Mutation_p.E40K|CARD10_uc003ast.1_Intron	NM_002405	NP_002396	O00587	MFNG_HUMAN	O-fucosylpeptide	40	Lumenal (Potential).				pattern specification process	extracellular space|integral to Golgi membrane	O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase activity			lung(1)	1	Melanoma(58;0.0574)					TGGCTCAGCTCGGGGGTCCCT	0.657													29	30	---	---	---	---	capture	Missense_Mutation	SNP	37882098	37882098	MFNG	22	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	9437	270
DCHS2	54798	broad.mit.edu	37	4	155243612	155243612	+	Silent	SNP	G	A	A	rs142864637	byFrequency;by1000genomes	TCGA-76-4931-01	TCGA-76-4931-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:155243612G>A	uc003inw.2	-	13	2682	c.2682C>T	c.(2680-2682)GAC>GAT	p.D894D		NM_017639	NP_060109	Q6V1P9	PCD23_HUMAN	dachsous 2 isoform 1	894	Cadherin 7.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(3)|pancreas(1)	4	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		CATTGTTGGCGTCAATCTTAA	0.358													14	35	---	---	---	---	capture	Silent	SNP	155243612	155243612	DCHS2	4	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	4247	270
ZFP42	132625	broad.mit.edu	37	4	188924640	188924640	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4931-01	TCGA-76-4931-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:188924640G>A	uc003izg.1	+	3	924	c.679G>A	c.(679-681)GTT>ATT	p.V227I	ZFP42_uc003izh.1_Missense_Mutation_p.V227I|ZFP42_uc003izi.1_Missense_Mutation_p.V227I	NM_174900	NP_777560	Q96MM3	ZFP42_HUMAN	zinc finger protein 42	227	C2H2-type 2.				female gonad development|male gonad development|meiosis	cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|skin(1)	2		all_cancers(14;6.2e-52)|all_epithelial(14;7.36e-37)|all_lung(41;2.29e-15)|Lung NSC(41;6.7e-15)|Breast(6;1.53e-05)|Melanoma(20;3.01e-05)|Hepatocellular(41;0.00335)|all_hematologic(60;0.014)|Renal(120;0.0183)|Prostate(90;0.0421)|Colorectal(36;0.227)		OV - Ovarian serous cystadenocarcinoma(60;1.54e-11)|BRCA - Breast invasive adenocarcinoma(30;4.21e-06)|GBM - Glioblastoma multiforme(59;8.93e-05)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.157)		GAAAGCGTTCGTTGAGAGCTC	0.502													65	85	---	---	---	---	capture	Missense_Mutation	SNP	188924640	188924640	ZFP42	4	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	17530	270
PCDHB12	56124	broad.mit.edu	37	5	140590123	140590123	+	Silent	SNP	C	T	T	rs147374257		TCGA-76-4931-01	TCGA-76-4931-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140590123C>T	uc003liz.2	+	1	1833	c.1644C>T	c.(1642-1644)CGC>CGT	p.R548R	PCDHB12_uc011dak.1_Silent_p.R211R	NM_018932	NP_061755	Q9Y5F1	PCDBC_HUMAN	protocadherin beta 12 precursor	548	Extracellular (Potential).|Cadherin 5.				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding			skin(2)|ovary(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CGCTGGTGCGCGTGCTGGTGC	0.711													29	57	---	---	---	---	capture	Silent	SNP	140590123	140590123	PCDHB12	5	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	11440	270
GABRA6	2559	broad.mit.edu	37	5	161113339	161113339	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4931-01	TCGA-76-4931-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:161113339C>T	uc003lyu.2	+	2	480	c.142C>T	c.(142-144)CGG>TGG	p.R48W		NM_000811	NP_000802	Q16445	GBRA6_HUMAN	gamma-aminobutyric acid A receptor, alpha 6	48	Extracellular (Probable).				gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity			ovary(7)|skin(3)|large_intestine(1)|central_nervous_system(1)	12	Renal(175;0.00259)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		Alprazolam(DB00404)|Ethchlorvynol(DB00189)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Lorazepam(DB00186)|Meprobamate(DB00371)|Midazolam(DB00683)	CAATCGGCTGCGGCCGGGATT	0.483										TCGA Ovarian(5;0.080)			55	80	---	---	---	---	capture	Missense_Mutation	SNP	161113339	161113339	GABRA6	5	C	T	T	T	1	0	0	0	0	1	0	0	0	347	27	1	1	6107	270
MICALL2	79778	broad.mit.edu	37	7	1485031	1485031	+	Silent	SNP	C	T	T			TCGA-76-4931-01	TCGA-76-4931-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:1485031C>T	uc003skj.3	-	6	822	c.675G>A	c.(673-675)GGG>GGA	p.G225G	MICALL2_uc003ski.3_5'Flank	NM_182924	NP_891554	Q8IY33	MILK2_HUMAN	MICAL-like 2 isoform 1	225	LIM zinc-binding.					cytoplasm|cytoskeleton	zinc ion binding			central_nervous_system(1)	1		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0178)|OV - Ovarian serous cystadenocarcinoma(56;6.01e-15)		CCTTGTAGGCCCCCGAGTGCA	0.692													4	10	---	---	---	---	capture	Silent	SNP	1485031	1485031	MICALL2	7	C	T	T	T	1	0	0	0	0	0	0	0	1	275	22	2	2	9486	270
CARD11	84433	broad.mit.edu	37	7	2984147	2984147	+	Missense_Mutation	SNP	G	C	C			TCGA-76-4931-01	TCGA-76-4931-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:2984147G>C	uc003smv.2	-	5	787	c.383C>G	c.(382-384)ACG>AGG	p.T128R		NM_032415	NP_115791	Q9BXL7	CAR11_HUMAN	caspase recruitment domain family, member 11	128					positive regulation of cytokine production|positive regulation of NF-kappaB transcription factor activity|regulation of apoptosis|T cell costimulation|T cell receptor signaling pathway	cytosol|membrane raft|plasma membrane	CARD domain binding|guanylate kinase activity	p.T121M(2)		haematopoietic_and_lymphoid_tissue(43)|ovary(2)|kidney(2)|skin(2)|central_nervous_system(1)	50		Ovarian(82;0.0115)		OV - Ovarian serous cystadenocarcinoma(56;8.44e-14)		CAGGAAGTGCGTGAGGCCCTC	0.622			Mis		DLBCL								48	138	---	---	---	---	capture	Missense_Mutation	SNP	2984147	2984147	CARD11	7	G	C	C	C	1	0	0	0	0	1	0	0	0	520	40	4	4	2621	270
EGFR	1956	broad.mit.edu	37	7	55233043	55233043	+	Missense_Mutation	SNP	G	T	T	rs139236063		TCGA-76-4931-01	TCGA-76-4931-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:55233043G>T	uc003tqk.2	+	15	2039	c.1793G>T	c.(1792-1794)GGA>GTA	p.G598V	EGFR_uc003tqi.2_Missense_Mutation_p.G598V|EGFR_uc003tqj.2_Missense_Mutation_p.G598V|EGFR_uc010kzg.1_Missense_Mutation_p.G553V|EGFR_uc011kco.1_Missense_Mutation_p.G545V|EGFR_uc011kcp.1_Intron|EGFR_uc011kcq.1_RNA|EGFR_uc003tqn.2_RNA	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	598	Approximate.|Extracellular (Potential).				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	p.G598V(16)		lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	TGCCCGGCAGGAGTCATGGGA	0.567		8	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			895	58	---	---	---	---	capture	Missense_Mutation	SNP	55233043	55233043	EGFR	7	G	T	T	T	1	0	0	0	0	1	0	0	0	533	41	4	4	4922	270
PIK3CG	5294	broad.mit.edu	37	7	106508432	106508432	+	Silent	SNP	G	A	A			TCGA-76-4931-01	TCGA-76-4931-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:106508432G>A	uc003vdv.3	+	2	511	c.426G>A	c.(424-426)CCG>CCA	p.P142P	PIK3CG_uc003vdu.2_Silent_p.P142P|PIK3CG_uc003vdw.2_Silent_p.P142P	NM_002649	NP_002640	P48736	PK3CG_HUMAN	phosphoinositide-3-kinase, catalytic, gamma	142					G-protein coupled receptor protein signaling pathway|phosphatidylinositol-mediated signaling|platelet activation	phosphatidylinositol 3-kinase complex	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity|protein binding			lung(16)|central_nervous_system(8)|breast(5)|pancreas(3)|stomach(2)|ovary(2)|upper_aerodigestive_tract(1)|skin(1)	38						AGCGGCACCCGCCCTCCGAGG	0.637													23	29	---	---	---	---	capture	Silent	SNP	106508432	106508432	PIK3CG	7	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	11819	270
ADAM2	2515	broad.mit.edu	37	8	39613418	39613418	+	Silent	SNP	G	A	A			TCGA-76-4931-01	TCGA-76-4931-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:39613418G>A	uc003xnj.2	-	16	1701	c.1626C>T	c.(1624-1626)TGC>TGT	p.C542C	ADAM2_uc003xnk.2_Silent_p.C523C|ADAM2_uc011lck.1_Intron|ADAM2_uc003xnl.2_Intron	NM_001464	NP_001455	Q99965	ADAM2_HUMAN	ADAM metallopeptidase domain 2 proprotein	542	Extracellular (Potential).|Cys-rich.				cell adhesion|fusion of sperm to egg plasma membrane|proteolysis	integral to plasma membrane	integrin binding|metalloendopeptidase activity|zinc ion binding			ovary(1)|lung(1)	2		all_cancers(7;2.38e-28)|all_epithelial(6;8.85e-21)|all_lung(54;1.24e-07)|Lung NSC(58;1.94e-07)|Hepatocellular(245;0.00745)|Breast(189;0.00908)|Renal(179;0.0183)|Colorectal(162;0.246)	LUSC - Lung squamous cell carcinoma(45;0.000149)	READ - Rectum adenocarcinoma(644;0.0689)|Kidney(114;0.162)		TTAATTTTCCGCACTGCAGAT	0.249													60	89	---	---	---	---	capture	Silent	SNP	39613418	39613418	ADAM2	8	G	A	A	A	1	0	0	0	0	0	0	0	1	490	38	1	1	241	270
LMX1B	4010	broad.mit.edu	37	9	129453336	129453336	+	Missense_Mutation	SNP	A	G	G			TCGA-76-4931-01	TCGA-76-4931-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:129453336A>G	uc004bqj.2	+	3	529	c.479A>G	c.(478-480)GAG>GGG	p.E160G	LMX1B_uc004bqi.2_Missense_Mutation_p.E160G|LMX1B_uc011maa.1_Missense_Mutation_p.E160G	NM_002316	NP_002307	O60663	LMX1B_HUMAN	LIM homeobox transcription factor 1, beta	160					dorsal/ventral pattern formation|in utero embryonic development	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0						AGCCCCGACGAGTCCGACTCC	0.667									Nail-Patella_Syndrome				6	15	---	---	---	---	capture	Missense_Mutation	SNP	129453336	129453336	LMX1B	9	A	G	G	G	1	0	0	0	0	1	0	0	0	143	11	3	3	8782	270
GYG2	8908	broad.mit.edu	37	X	2799104	2799104	+	Silent	SNP	C	T	T			TCGA-76-4931-01	TCGA-76-4931-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:2799104C>T	uc004cqs.1	+	12	1638	c.1356C>T	c.(1354-1356)GCC>GCT	p.A452A	GYG2_uc004cqt.1_Silent_p.A421A|GYG2_uc004cqu.1_Silent_p.A420A|GYG2_uc004cqv.1_Silent_p.A195A|GYG2_uc004cqw.1_Silent_p.A412A|GYG2_uc004cqx.1_Silent_p.A350A|GYG2_uc010ndc.1_Silent_p.A230A	NM_003918	NP_003909	O15488	GLYG2_HUMAN	glycogenin 2 isoform b	452					glucose metabolic process|glycogen biosynthetic process|glycogen catabolic process	cytosol|soluble fraction	glycogenin glucosyltransferase activity			ovary(1)|kidney(1)	2		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				TCGACCTGGCCGTCTCTGTTT	0.542													18	10	---	---	---	---	capture	Silent	SNP	2799104	2799104	GYG2	23	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	6835	270
ASB9	140462	broad.mit.edu	37	X	15266989	15266989	+	Nonsense_Mutation	SNP	C	A	A			TCGA-76-4931-01	TCGA-76-4931-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:15266989C>A	uc004cwl.2	-	6	884	c.637G>T	c.(637-639)GAG>TAG	p.E213*	ASB9_uc004cwk.2_Nonsense_Mutation_p.E213*|ASB9_uc004cwm.2_Nonsense_Mutation_p.E203*|ASB9_uc010ner.2_Nonsense_Mutation_p.E213*|ASB9_uc004cwn.2_Nonsense_Mutation_p.E184*	NM_001031739	NP_001026909	Q96DX5	ASB9_HUMAN	ankyrin repeat and SOCS box-containing 9 isoform	213	ANK 6.				intracellular signal transduction						0	Hepatocellular(33;0.183)					CAGGCCAGCTCTTCACTGGCT	0.567													53	88	---	---	---	---	capture	Nonsense_Mutation	SNP	15266989	15266989	ASB9	23	C	A	A	A	1	0	0	0	0	0	1	0	0	416	32	5	4	1021	270
APEX2	27301	broad.mit.edu	37	X	55032975	55032975	+	Missense_Mutation	SNP	C	T	T			TCGA-76-4931-01	TCGA-76-4931-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:55032975C>T	uc004dtz.2	+	6	740	c.664C>T	c.(664-666)CGC>TGC	p.R222C	APEX2_uc011mom.1_Missense_Mutation_p.R51C	NM_014481	NP_055296	Q9UBZ4	APEX2_HUMAN	apurinic/apyrimidinic endonuclease 2	222					cell cycle|DNA recombination|DNA repair	nucleus	DNA binding|DNA-(apurinic or apyrimidinic site) lyase activity|endonuclease activity|exonuclease activity|zinc ion binding			breast(1)	1						GGACCCAGGGCGCAAGTGGAT	0.473								Other_BER_factors					14	30	---	---	---	---	capture	Missense_Mutation	SNP	55032975	55032975	APEX2	23	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	763	270
ACRC	93953	broad.mit.edu	37	X	70830605	70830605	+	Missense_Mutation	SNP	G	A	A			TCGA-76-4931-01	TCGA-76-4931-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:70830605G>A	uc004eae.2	+	11	2187	c.1686G>A	c.(1684-1686)ATG>ATA	p.M562I	BCYRN1_uc011mpt.1_Intron	NM_052957	NP_443189	Q96QF7	ACRC_HUMAN	ACRC protein	562						nucleus				ovary(3)	3	Renal(35;0.156)					CTGGTGAGATGTGGTACCCAA	0.502													21	16	---	---	---	---	capture	Missense_Mutation	SNP	70830605	70830605	ACRC	23	G	A	A	A	1	0	0	0	0	1	0	0	0	624	48	2	2	171	270
HCFC1	3054	broad.mit.edu	37	X	153236126	153236126	+	Missense_Mutation	SNP	C	G	G			TCGA-76-4931-01	TCGA-76-4931-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:153236126C>G	uc004fjp.2	-	1	694	c.166G>C	c.(166-168)GTG>CTG	p.V56L	TMEM187_uc004fjq.2_5'Flank	NM_005334	NP_005325	P51610	HCFC1_HUMAN	host cell factor 1	56	Kelch 1.				cell cycle|interspecies interaction between organisms|positive regulation of cell cycle|positive regulation of gene expression|protein stabilization|reactivation of latent virus|regulation of protein complex assembly|transcription from RNA polymerase II promoter	mitochondrion|MLL1 complex|MLL5-L complex|Set1C/COMPASS complex	chromatin binding|identical protein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity			ovary(2)	2	all_cancers(53;6.23e-16)|all_epithelial(53;5.61e-10)|all_lung(58;3.99e-07)|Lung NSC(58;5.02e-07)|all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					AGTTCGTCCACTATTCCCTCG	0.532													24	46	---	---	---	---	capture	Missense_Mutation	SNP	153236126	153236126	HCFC1	23	C	G	G	G	1	0	0	0	0	1	0	0	0	260	20	4	4	6917	270
