Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
SLC45A1	50651	broad.mit.edu	37	1	8395553	8395553	+	Silent	SNP	C	T	T			TCGA-76-6193-01	TCGA-76-6193-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:8395553C>T	uc001apb.2	+	5	1500	c.1500C>T	c.(1498-1500)AGC>AGT	p.S500S	SLC45A1_uc001apc.2_Silent_p.S198S	NM_001080397	NP_001073866	Q9Y2W3	S45A1_HUMAN	DNB5	500					carbohydrate transport	integral to membrane	symporter activity			central_nervous_system(2)|pancreas(1)|skin(1)	4	Ovarian(185;0.0661)|all_lung(157;0.127)	all_epithelial(116;1.22e-15)|all_lung(118;0.000147)|Lung NSC(185;0.000251)|Renal(390;0.000469)|Colorectal(325;0.00578)|Breast(348;0.00686)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.11)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;3.95e-66)|GBM - Glioblastoma multiforme(8;5.93e-33)|Colorectal(212;2.86e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|Kidney(185;5.33e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000513)|KIRC - Kidney renal clear cell carcinoma(229;0.000979)|STAD - Stomach adenocarcinoma(132;0.00199)|READ - Rectum adenocarcinoma(331;0.0649)		CGGGCTCCAGCGAGCGCGCGG	0.647													13	49	---	---	---	---	capture	Silent	SNP	8395553	8395553	SLC45A1	1	C	T	T	T	1	0	0	0	0	0	0	0	1	350	27	1	1	14532	276
ST6GALNAC3	256435	broad.mit.edu	37	1	77094323	77094323	+	Missense_Mutation	SNP	A	T	T			TCGA-76-6193-01	TCGA-76-6193-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:77094323A>T	uc001dhh.2	+	5	913	c.750A>T	c.(748-750)AAA>AAT	p.K250N	ST6GALNAC3_uc010orh.1_Missense_Mutation_p.K149N	NM_152996	NP_694541	Q8NDV1	SIA7C_HUMAN	sialyltransferase 7C isoform 1	250	Lumenal (Potential).				protein glycosylation	integral to Golgi membrane	sialyltransferase activity			ovary(3)|skin(2)	5						GGTATAGAAAAGTCCCCTACC	0.328													10	55	---	---	---	---	capture	Missense_Mutation	SNP	77094323	77094323	ST6GALNAC3	1	A	T	T	T	1	0	0	0	0	1	0	0	0	37	3	4	4	15115	276
HCN3	57657	broad.mit.edu	37	1	155254428	155254428	+	Silent	SNP	C	G	G			TCGA-76-6193-01	TCGA-76-6193-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:155254428C>G	uc001fjz.1	+	4	977	c.969C>G	c.(967-969)CCC>CCG	p.P323P	RAG1AP1_uc010pey.1_Intron|HCN3_uc010pfz.1_Intron	NM_020897	NP_065948	Q9P1Z3	HCN3_HUMAN	hyperpolarization activated cyclic	323	Extracellular (Potential).					integral to membrane	cAMP binding|sodium channel activity|voltage-gated potassium channel activity			ovary(1)|breast(1)	2	all_lung(78;2.32e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			TAGGCATGCCCGACGTCTGGC	0.597													12	32	---	---	---	---	capture	Silent	SNP	155254428	155254428	HCN3	1	C	G	G	G	1	0	0	0	0	0	0	0	1	288	23	4	4	6924	276
CD1B	910	broad.mit.edu	37	1	158300836	158300836	+	Silent	SNP	G	A	A			TCGA-76-6193-01	TCGA-76-6193-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:158300836G>A	uc001frx.2	-	2	186	c.78C>T	c.(76-78)ACC>ACT	p.T26T	CD1B_uc001frw.2_5'UTR|CD1B_uc010pic.1_Silent_p.T26T	NM_001764	NP_001755	P29016	CD1B_HUMAN	CD1B antigen precursor	26	Extracellular (Potential).				antigen processing and presentation|immune response	endosome membrane|integral to membrane|lysosomal membrane|plasma membrane	protein binding			ovary(2)	2	all_hematologic(112;0.0378)					CATGAAAGGAGGTCGGCCCCT	0.458													66	205	---	---	---	---	capture	Silent	SNP	158300836	158300836	CD1B	1	G	A	A	A	1	0	0	0	0	0	0	0	1	444	35	2	2	2946	276
VSIG8	391123	broad.mit.edu	37	1	159827989	159827989	+	Nonsense_Mutation	SNP	G	C	C	rs138280068		TCGA-76-6193-01	TCGA-76-6193-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:159827989G>C	uc001fuh.2	-	3	457	c.321C>G	c.(319-321)TAC>TAG	p.Y107*	C1orf204_uc001fug.1_5'Flank	NM_001013661	NP_001013683	Q5VU13	VSIG8_HUMAN	V-set and immunoglobulin domain containing 8	107	Extracellular (Potential).|Ig-like V-type 1.					integral to membrane				central_nervous_system(1)	1	all_hematologic(112;0.0597)					TGGAGGCATCGTACTGGCTTG	0.542													7	54	---	---	---	---	capture	Nonsense_Mutation	SNP	159827989	159827989	VSIG8	1	G	C	C	C	1	0	0	0	0	0	1	0	0	516	40	5	4	17108	276
ITLN2	142683	broad.mit.edu	37	1	160920979	160920979	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6193-01	TCGA-76-6193-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:160920979C>T	uc001fxd.2	-	4	353	c.295G>A	c.(295-297)GAG>AAG	p.E99K	ITLN2_uc009wts.2_Missense_Mutation_p.E98K|ITLN2_uc010pju.1_Missense_Mutation_p.E16K	NM_080878	NP_543154	Q8WWU7	ITLN2_HUMAN	intelectin 2 precursor	99	Fibrinogen C-terminal.				signal transduction	extracellular region	receptor binding|sugar binding			ovary(1)	1	all_cancers(52;2.99e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00275)			ATGTCATTCTCGTGCACGCTG	0.582													6	46	---	---	---	---	capture	Missense_Mutation	SNP	160920979	160920979	ITLN2	1	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	7834	276
LAMC2	3918	broad.mit.edu	37	1	183207550	183207550	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6193-01	TCGA-76-6193-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:183207550C>T	uc001gqa.2	+	19	3177	c.2863C>T	c.(2863-2865)CTC>TTC	p.L955F	LAMC2_uc001gpz.3_Missense_Mutation_p.L955F|LAMC2_uc010poa.1_Missense_Mutation_p.L655F	NM_005562	NP_005553	Q13753	LAMC2_HUMAN	laminin, gamma 2 isoform a precursor	955	Potential.|Domain II and I.				cell adhesion|epidermis development|hemidesmosome assembly		heparin binding			skin(2)|ovary(1)	3						CCTTAAAAACCTCAGAGGTTA	0.413													16	47	---	---	---	---	capture	Missense_Mutation	SNP	183207550	183207550	LAMC2	1	C	T	T	T	1	0	0	0	0	1	0	0	0	312	24	2	2	8535	276
ITGA8	8516	broad.mit.edu	37	10	15590502	15590502	+	Silent	SNP	G	A	A			TCGA-76-6193-01	TCGA-76-6193-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:15590502G>A	uc001ioc.1	-	27	2832	c.2832C>T	c.(2830-2832)AGC>AGT	p.S944S	ITGA8_uc010qcb.1_Silent_p.S929S	NM_003638	NP_003629	P53708	ITA8_HUMAN	integrin, alpha 8 precursor	944	Extracellular (Potential).				cell differentiation|cell-cell adhesion|cell-matrix adhesion|integrin-mediated signaling pathway|nervous system development	integrin complex	receptor activity			ovary(3)|lung(3)	6						TCAGGACTGCGCTTTCTCCTC	0.483													13	33	---	---	---	---	capture	Silent	SNP	15590502	15590502	ITGA8	10	G	A	A	A	1	0	0	0	0	0	0	0	1	490	38	1	1	7805	276
PLCE1	51196	broad.mit.edu	37	10	95791394	95791394	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6193-01	TCGA-76-6193-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:95791394G>A	uc001kjk.2	+	2	1225	c.591G>A	c.(589-591)ATG>ATA	p.M197I	PLCE1_uc010qnx.1_Missense_Mutation_p.M197I	NM_016341	NP_057425	Q9P212	PLCE1_HUMAN	phospholipase C, epsilon 1 isoform 1	197					activation of MAPK activity|activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|calcium-mediated signaling|cell proliferation|cytoskeleton organization|diacylglycerol biosynthetic process|elevation of cytosolic calcium ion concentration|epidermal growth factor receptor signaling pathway|glomerulus development|heart development|lipid catabolic process|Ras protein signal transduction|regulation of cell growth|regulation of G-protein coupled receptor protein signaling pathway|regulation of Ras protein signal transduction|regulation of smooth muscle contraction	cytosol|Golgi membrane|membrane fraction|plasma membrane	calcium ion binding|guanyl-nucleotide exchange factor activity|phosphatidylinositol phospholipase C activity|Ras GTPase binding|receptor signaling protein activity			ovary(2)|skin(1)	3		Colorectal(252;0.0458)				ACAGAAGAATGTCAGACACTT	0.408													25	68	---	---	---	---	capture	Missense_Mutation	SNP	95791394	95791394	PLCE1	10	G	A	A	A	1	0	0	0	0	1	0	0	0	624	48	2	2	11937	276
KIAA1598	57698	broad.mit.edu	37	10	118689505	118689505	+	Missense_Mutation	SNP	T	A	A	rs145640256		TCGA-76-6193-01	TCGA-76-6193-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:118689505T>A	uc009xyw.2	-	10	1365	c.867A>T	c.(865-867)GAA>GAT	p.E289D	KIAA1598_uc001lcz.3_Missense_Mutation_p.E289D|KIAA1598_uc010qso.1_Missense_Mutation_p.E229D|KIAA1598_uc010qsp.1_Missense_Mutation_p.E289D|KIAA1598_uc010qsq.1_Missense_Mutation_p.E229D|KIAA1598_uc001lcy.3_Missense_Mutation_p.E259D	NM_001127211	NP_001120683	A0MZ66	SHOT1_HUMAN	shootin1 isoform a	289	Potential.				axon guidance	axon					0				all cancers(201;0.00494)		GCTCTTCTAATTCTTTGACCT	0.308													17	55	---	---	---	---	capture	Missense_Mutation	SNP	118689505	118689505	KIAA1598	10	T	A	A	A	1	0	0	0	0	1	0	0	0	673	52	4	4	8168	276
OR5D16	390144	broad.mit.edu	37	11	55606593	55606593	+	Nonsense_Mutation	SNP	T	A	A			TCGA-76-6193-01	TCGA-76-6193-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:55606593T>A	uc010rio.1	+	1	366	c.366T>A	c.(364-366)TAT>TAA	p.Y122*		NM_001005496	NP_001005496	Q8NGK9	OR5DG_HUMAN	olfactory receptor, family 5, subfamily D,	122	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(4)|skin(1)	5		all_epithelial(135;0.208)				TGATGGCCTATGACCACTTTG	0.433													20	97	---	---	---	---	capture	Nonsense_Mutation	SNP	55606593	55606593	OR5D16	11	T	A	A	A	1	0	0	0	0	0	1	0	0	660	51	5	4	11060	276
LRRIQ1	84125	broad.mit.edu	37	12	85466877	85466877	+	Splice_Site	SNP	G	T	T			TCGA-76-6193-01	TCGA-76-6193-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:85466877G>T	uc001tac.2	+	11	2998	c.2887_splice	c.e11+1	p.C963_splice	LRRIQ1_uc001tab.1_Splice_Site_p.C963_splice	NM_001079910	NP_001073379	Q96JM4	LRIQ1_HUMAN	leucine-rich repeats and IQ motif containing 1											ovary(4)|central_nervous_system(1)|skin(1)	6				GBM - Glioblastoma multiforme(134;0.212)		TACTGGAATTGTAAGttgtgt	0.189													12	53	---	---	---	---	capture	Splice_Site	SNP	85466877	85466877	LRRIQ1	12	G	T	T	T	1	0	0	0	0	0	0	1	0	624	48	5	4	8944	276
NOS1	4842	broad.mit.edu	37	12	117723943	117723943	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6193-01	TCGA-76-6193-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:117723943C>T	uc001twm.1	-	6	1942	c.1256G>A	c.(1255-1257)CGC>CAC	p.R419H		NM_000620	NP_000611	P29475	NOS1_HUMAN	nitric oxide synthase 1, neuronal	419					multicellular organismal response to stress|myoblast fusion|negative regulation of calcium ion transport into cytosol|neurotransmitter biosynthetic process|nitric oxide biosynthetic process|platelet activation|positive regulation of vasodilation|regulation of cardiac muscle contraction|response to heat|response to hypoxia	cytoskeleton|cytosol|dendritic spine|perinuclear region of cytoplasm|photoreceptor inner segment|sarcolemma|sarcoplasmic reticulum	arginine binding|cadmium ion binding|calmodulin binding|flavin adenine dinucleotide binding|FMN binding|heme binding|NADP binding|nitric-oxide synthase activity|tetrahydrobiopterin binding			ovary(3)|skin(3)|pancreas(1)	7	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0561)	L-Citrulline(DB00155)	GCCCACACAGCGCGAGGCATT	0.557													13	57	---	---	---	---	capture	Missense_Mutation	SNP	117723943	117723943	NOS1	12	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	10448	276
ACADS	35	broad.mit.edu	37	12	121164991	121164991	+	Missense_Mutation	SNP	A	G	G			TCGA-76-6193-01	TCGA-76-6193-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:121164991A>G	uc001tza.3	+	2	327	c.209A>G	c.(208-210)CAG>CGG	p.Q70R	ACADS_uc010szl.1_Missense_Mutation_p.Q70R	NM_000017	NP_000008	P16219	ACADS_HUMAN	short-chain acyl-CoA dehydrogenase precursor	70						mitochondrial matrix	butyryl-CoA dehydrogenase activity			central_nervous_system(2)	2	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)	Lung NSC(355;0.163)			NADH(DB00157)	CCAGCGGCTCAGGTGAGAGTG	0.567													3	107	---	---	---	---	capture	Missense_Mutation	SNP	121164991	121164991	ACADS	12	A	G	G	G	1	0	0	0	0	1	0	0	0	91	7	3	3	114	276
RB1	5925	broad.mit.edu	37	13	49039379	49039379	+	Silent	SNP	C	T	T			TCGA-76-6193-01	TCGA-76-6193-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:49039379C>T	uc001vcb.2	+	23	2530	c.2364C>T	c.(2362-2364)AGC>AGT	p.S788S		NM_000321	NP_000312	P06400	RB_HUMAN	retinoblastoma 1	788	Interaction with LIMD1.|Domain C; mediates interaction with E4F1.				androgen receptor signaling pathway|cell cycle arrest|chromatin remodeling|G1 phase of mitotic cell cycle|interspecies interaction between organisms|maintenance of mitotic sister chromatid cohesion|mitotic cell cycle G1/S transition checkpoint|myoblast differentiation|negative regulation of cell growth|negative regulation of protein kinase activity|negative regulation of S phase of mitotic cell cycle|negative regulation of sequence-specific DNA binding transcription factor activity|positive regulation of mitotic metaphase/anaphase transition|protein localization to chromosome, centromeric region|Ras protein signal transduction|regulation of centromere complex assembly|regulation of cohesin localization to chromatin|regulation of lipid kinase activity|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle|sister chromatid biorientation	chromatin|PML body|Rb-E2F complex|SWI/SNF complex	androgen receptor binding|DNA binding|kinase binding|phosphoprotein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription factor binding|ubiquitin protein ligase binding	p.?(7)		lung(94)|eye(89)|central_nervous_system(47)|bone(22)|breast(21)|urinary_tract(17)|haematopoietic_and_lymphoid_tissue(14)|ovary(10)|prostate(9)|soft_tissue(8)|skin(7)|endometrium(5)|cervix(3)|liver(3)|salivary_gland(2)|stomach(2)|oesophagus(1)|adrenal_gland(1)|kidney(1)|gastrointestinal_tract_(site_indeterminate)(1)|pituitary(1)	358		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	TTCCTCGAAGCCCTTACAAGT	0.403		6	D|Mis|N|F|S		retinoblastoma|sarcoma|breast|small cell lung	retinoblastoma|sarcoma|breast|small cell lung			Hereditary_Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)			37	104	---	---	---	---	capture	Silent	SNP	49039379	49039379	RB1	13	C	T	T	T	1	0	0	0	0	0	0	0	1	337	26	2	2	12993	276
C13orf34	79866	broad.mit.edu	37	13	73321201	73321201	+	Silent	SNP	A	G	G			TCGA-76-6193-01	TCGA-76-6193-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:73321201A>G	uc001viv.1	+	10	1553	c.1434A>G	c.(1432-1434)TCA>TCG	p.S478S	C13orf34_uc010thq.1_Silent_p.S253S|C13orf34_uc010aen.1_Silent_p.S553S|C13orf34_uc010thr.1_Silent_p.S408S|C13orf34_uc001viw.1_Silent_p.S427S	NM_024808	NP_079084	Q6PGQ7	BORA_HUMAN	aurora borealis	478					cell division|mitosis|regulation of mitosis|regulation of mitotic spindle organization|regulation of protein localization		protein kinase binding				0		Breast(118;0.0735)		GBM - Glioblastoma multiforme(99;0.000227)		TGTGCATGTCACCTCTTGCTG	0.413													66	152	---	---	---	---	capture	Silent	SNP	73321201	73321201	C13orf34	13	A	G	G	G	1	0	0	0	0	0	0	0	1	67	6	3	3	1714	276
MAPK3	5595	broad.mit.edu	37	16	30128054	30128054	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6193-01	TCGA-76-6193-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:30128054G>A	uc002dws.2	-	8	1175	c.1075C>T	c.(1075-1077)CGG>TGG	p.R359W	uc002dtf.2_Intron|BOLA2_uc010bzb.1_Intron|MAPK3_uc002dwr.2_Missense_Mutation_p.R245W|MAPK3_uc002dwv.3_Missense_Mutation_p.R315W|MAPK3_uc002dwt.2_3'UTR|MAPK3_uc002dwu.2_RNA|MAPK3_uc010bzp.2_RNA	NM_002746	NP_002737	P27361	MK03_HUMAN	mitogen-activated protein kinase 3 isoform 1	359					activation of MAPK activity|activation of MAPKK activity|axon guidance|cell cycle|cellular response to mechanical stimulus|epidermal growth factor receptor signaling pathway|innate immune response|insulin receptor signaling pathway|interleukin-1-mediated signaling pathway|interspecies interaction between organisms|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of histone acetylation|positive regulation of histone phosphorylation|positive regulation of transcription from RNA polymerase II promoter|Ras protein signal transduction|regulation of sequence-specific DNA binding transcription factor activity|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway|transcription initiation from RNA polymerase I promoter	cytosol|nucleoplasm	ATP binding|MAP kinase activity|phosphatase binding	p.R359W(1)			0					Arsenic trioxide(DB01169)|Isoproterenol(DB01064)|Simvastatin(DB00641)|Sulindac(DB00605)	TCCTTCAGCCGCTCCTTAGGT	0.642													15	54	---	---	---	---	capture	Missense_Mutation	SNP	30128054	30128054	MAPK3	16	G	A	A	A	1	0	0	0	0	1	0	0	0	493	38	1	1	9192	276
SLC12A3	6559	broad.mit.edu	37	16	56913524	56913524	+	Missense_Mutation	SNP	C	T	T	rs139743444	byFrequency	TCGA-76-6193-01	TCGA-76-6193-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:56913524C>T	uc010ccm.2	+	11	1435	c.1406C>T	c.(1405-1407)GCC>GTC	p.A469V	SLC12A3_uc002ekd.3_Missense_Mutation_p.A469V|SLC12A3_uc010ccn.2_Missense_Mutation_p.A468V	NM_001126108	NP_001119580	P55017	S12A3_HUMAN	solute carrier family 12, member 3 isoform 3	469	Helical; (Potential).				sodium ion transmembrane transport	apical plasma membrane|integral to plasma membrane|membrane fraction	sodium:chloride symporter activity			ovary(2)|breast(1)	3					Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Chlorothiazide(DB00880)|Diazoxide(DB01119)|Hydrochlorothiazide(DB00999)|Metolazone(DB00524)|Polythiazide(DB01324)|Quinethazone(DB01325)	CTCTCCTCTGCCCTGGCCTGC	0.632													6	36	---	---	---	---	capture	Missense_Mutation	SNP	56913524	56913524	SLC12A3	16	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	14277	276
C17orf85	55421	broad.mit.edu	37	17	3721586	3721586	+	Silent	SNP	G	A	A			TCGA-76-6193-01	TCGA-76-6193-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:3721586G>A	uc010ckl.1	-	10	1304	c.1281C>T	c.(1279-1281)GAC>GAT	p.D427D	C17orf85_uc002fwr.2_Silent_p.D137D|C17orf85_uc002fwq.2_Silent_p.D147D	NM_001114118	NP_001107590	Q53F19	CQ085_HUMAN	ELG protein isoform a	427							nucleotide binding			skin(1)	1				UCEC - Uterine corpus endometrioid carcinoma (3;0.0725)		ATTCCACTTCGTCAGCATACA	0.328													4	111	---	---	---	---	capture	Silent	SNP	3721586	3721586	C17orf85	17	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	1873	276
TP53	7157	broad.mit.edu	37	17	7577551	7577551	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6193-01	TCGA-76-6193-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7577551C>T	uc002gim.2	-	7	924	c.730G>A	c.(730-732)GGC>AGC	p.G244S	TP53_uc002gig.1_Missense_Mutation_p.G244S|TP53_uc002gih.2_Missense_Mutation_p.G244S|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.G112S|TP53_uc010cng.1_Missense_Mutation_p.G112S|TP53_uc002gii.1_Missense_Mutation_p.G112S|TP53_uc010cnh.1_Missense_Mutation_p.G244S|TP53_uc010cni.1_Missense_Mutation_p.G244S|TP53_uc002gij.2_Missense_Mutation_p.G244S|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Missense_Mutation_p.G151S|TP53_uc002gio.2_Missense_Mutation_p.G112S	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	244	|Interaction with HIPK1 (By similarity).|Interacts with the 53BP2 SH3 domain.|Interaction with AXIN1 (By similarity).		G -> A (in sporadic cancers; somatic mutation).|G -> S (in sporadic cancers; somatic mutation).|G -> R (in sporadic cancers; somatic mutation).|MG -> IC (in a sporadic cancer; somatic mutation).|G -> E (in a sporadic cancer; somatic mutation).|G -> C (in sporadic cancers; somatic mutation).|MG -> IS (in a sporadic cancer; somatic mutation).|G -> V (in LFS; germline mutation and in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.G244C(36)|p.G244S(35)|p.G244D(32)|p.G244V(14)|p.G244G(13)|p.G244A(9)|p.0?(7)|p.G244fs*3(5)|p.G244R(3)|p.M243_G244>IC(1)|p.G244E(1)|p.G244fs*19(1)|p.G151C(1)|p.G244fs*17(1)|p.M243fs*18(1)|p.S241_G245delSCMGG(1)|p.C242fs*98(1)|p.C242_M246>L(1)|p.G244del(1)|p.C238_M246delCNSSCMGGM(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		TTCATGCCGCCCATGCAGGAA	0.582		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			11	34	---	---	---	---	capture	Missense_Mutation	SNP	7577551	7577551	TP53	17	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	16264	276
TP53	7157	broad.mit.edu	37	17	7578464	7578464	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6193-01	TCGA-76-6193-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7578464G>A	uc002gim.2	-	5	660	c.466C>T	c.(466-468)CGC>TGC	p.R156C	TP53_uc002gig.1_Missense_Mutation_p.R156C|TP53_uc002gih.2_Missense_Mutation_p.R156C|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.R24C|TP53_uc010cng.1_Missense_Mutation_p.R24C|TP53_uc002gii.1_Missense_Mutation_p.R24C|TP53_uc010cnh.1_Missense_Mutation_p.R156C|TP53_uc010cni.1_Missense_Mutation_p.R156C|TP53_uc002gij.2_Missense_Mutation_p.R156C|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Missense_Mutation_p.R63C|TP53_uc002gio.2_Missense_Mutation_p.R24C|TP53_uc010vug.1_Missense_Mutation_p.R117C	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	156	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		R -> P (in sporadic cancers; somatic mutation).|R -> G (in sporadic cancers; somatic mutation).|R -> H (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation).|R -> C (in sporadic cancers; somatic mutation).|R -> S (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.R156P(24)|p.R156H(10)|p.R156fs*14(8)|p.0?(7)|p.R156S(3)|p.R156R(3)|p.R156fs*25(3)|p.P152fs*14(3)|p.R156G(3)|p.R156L(3)|p.G154fs*14(2)|p.R156_I162delRVRAMAI(2)|p.T155fs*23(2)|p.P153fs*22(2)|p.R156C(2)|p.T155_R156delTR(1)|p.R156_A161delRVRAMA(1)|p.P151_V173del23(1)|p.R156del(1)|p.R156_R158delRVR(1)|p.R156fs*12(1)|p.R156fs*18(1)|p.R156_A161del(1)|p.D148fs*23(1)|p.S149fs*72(1)|p.T155_A161delTRVRAMA(1)|p.G154fs*22(1)|p.G154_R156delGTR(1)|p.R156fs*20(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		GCGCGGACGCGGGTGCCGGGC	0.612		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			13	46	---	---	---	---	capture	Missense_Mutation	SNP	7578464	7578464	TP53	17	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	16264	276
TP53	7157	broad.mit.edu	37	17	7578466	7578466	+	Missense_Mutation	SNP	G	T	T			TCGA-76-6193-01	TCGA-76-6193-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7578466G>T	uc002gim.2	-	5	658	c.464C>A	c.(463-465)ACC>AAC	p.T155N	TP53_uc002gig.1_Missense_Mutation_p.T155N|TP53_uc002gih.2_Missense_Mutation_p.T155N|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.T23N|TP53_uc010cng.1_Missense_Mutation_p.T23N|TP53_uc002gii.1_Missense_Mutation_p.T23N|TP53_uc010cnh.1_Missense_Mutation_p.T155N|TP53_uc010cni.1_Missense_Mutation_p.T155N|TP53_uc002gij.2_Missense_Mutation_p.T155N|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Missense_Mutation_p.T62N|TP53_uc002gio.2_Missense_Mutation_p.T23N|TP53_uc010vug.1_Missense_Mutation_p.T116N	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	155	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		T -> N (in LFS; germline mutation and in sporadic cancers; somatic mutation).|T -> S (in sporadic cancers; somatic mutation).|T -> P (in sporadic cancers; somatic mutation).|T -> A (in sporadic cancers; somatic mutation).|T -> I (in sporadic cancers; somatic mutation).|T -> M (in a sporadic cancer; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.T155N(19)|p.T155P(14)|p.T155I(10)|p.0?(7)|p.T155A(7)|p.T155T(5)|p.P152fs*14(3)|p.G154fs*14(2)|p.T155fs*23(2)|p.P153fs*22(2)|p.T155S(2)|p.P151_V173del23(1)|p.G154_R156delGTR(1)|p.T155fs*26(1)|p.T155fs*25(1)|p.R156_A161del(1)|p.D148_T155delDSTPPPGT(1)|p.D148fs*23(1)|p.S149fs*72(1)|p.T155_A161delTRVRAMA(1)|p.G154fs*22(1)|p.T155fs*15(1)|p.R156fs*25(1)|p.T155_R156delTR(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		GCGGACGCGGGTGCCGGGCGG	0.612		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			13	45	---	---	---	---	capture	Missense_Mutation	SNP	7578466	7578466	TP53	17	G	T	T	T	1	0	0	0	0	1	0	0	0	572	44	4	4	16264	276
ALOX15B	247	broad.mit.edu	37	17	7942479	7942479	+	Silent	SNP	C	T	T			TCGA-76-6193-01	TCGA-76-6193-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7942479C>T	uc002gju.2	+	1	122	c.6C>T	c.(4-6)GCC>GCT	p.A2A	ALOX15B_uc002gjv.2_Silent_p.A2A|ALOX15B_uc002gjw.2_Silent_p.A2A|ALOX15B_uc010vun.1_Silent_p.A2A|ALOX15B_uc010cnp.2_5'UTR	NM_001141	NP_001132	O15296	LX15B_HUMAN	arachidonate 15-lipoxygenase, second type	2	PLAT.				induction of apoptosis|leukotriene biosynthetic process|negative regulation of cell cycle|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of growth|prostate gland development|regulation of epithelial cell differentiation	cytoplasm	arachidonate 15-lipoxygenase activity|iron ion binding|lipoxygenase activity			ovary(1)	1						GCAGCATGGCCGAGTTCAGGG	0.652													8	56	---	---	---	---	capture	Silent	SNP	7942479	7942479	ALOX15B	17	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	539	276
BPTF	2186	broad.mit.edu	37	17	65924656	65924656	+	Silent	SNP	A	G	G			TCGA-76-6193-01	TCGA-76-6193-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:65924656A>G	uc002jgf.2	+	16	5998	c.5937A>G	c.(5935-5937)CAA>CAG	p.Q1979Q	BPTF_uc002jge.2_Silent_p.Q2105Q	NM_182641	NP_872579	Q12830	BPTF_HUMAN	bromodomain PHD finger transcription factor	2105					brain development|chromatin remodeling|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|NURF complex	sequence-specific DNA binding|transcription factor binding|zinc ion binding			ovary(2)|skin(2)	4	all_cancers(12;6e-11)		BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|Colorectal(3;0.0984)|LUSC - Lung squamous cell carcinoma(166;0.24)			TAACATTCCAACAAAACAAGA	0.393													19	46	---	---	---	---	capture	Silent	SNP	65924656	65924656	BPTF	17	A	G	G	G	1	0	0	0	0	0	0	0	1	24	2	3	3	1483	276
TMEM146	257062	broad.mit.edu	37	19	5739352	5739352	+	Missense_Mutation	SNP	G	C	C			TCGA-76-6193-01	TCGA-76-6193-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:5739352G>C	uc002mda.2	+	7	536	c.475G>C	c.(475-477)GTT>CTT	p.V159L	TMEM146_uc010duj.1_5'UTR	NM_152784	NP_689997	Q86XM0	TM146_HUMAN	transmembrane protein 146 precursor	159	Extracellular (Potential).					integral to membrane				ovary(1)|central_nervous_system(1)|pancreas(1)	3						CAGTAATTTGGTTTTTGCATA	0.214													16	55	---	---	---	---	capture	Missense_Mutation	SNP	5739352	5739352	TMEM146	19	G	C	C	C	1	0	0	0	0	1	0	0	0	572	44	4	4	15944	276
MUC16	94025	broad.mit.edu	37	19	9049260	9049260	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6193-01	TCGA-76-6193-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:9049260G>A	uc002mkp.2	-	5	32575	c.32371C>T	c.(32371-32373)CGG>TGG	p.R10791W		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	10793	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						GTCACCAACCGTGATACAGCA	0.483													20	105	---	---	---	---	capture	Missense_Mutation	SNP	9049260	9049260	MUC16	19	G	A	A	A	1	0	0	0	0	1	0	0	0	519	40	1	1	9883	276
CASP14	23581	broad.mit.edu	37	19	15164396	15164396	+	Missense_Mutation	SNP	G	T	T			TCGA-76-6193-01	TCGA-76-6193-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:15164396G>T	uc010dzv.1	+	3	439	c.131G>T	c.(130-132)CGG>CTG	p.R44L	CASP14_uc002naf.2_Missense_Mutation_p.R44L	NM_012114	NP_036246	P31944	CASPE_HUMAN	caspase 14 precursor	44					apoptosis|cell differentiation|epidermis development|proteolysis	cytoplasm|nucleus	cysteine-type endopeptidase activity			skin(2)|ovary(1)|lung(1)	4						CACATGTTTCGGCAGCTGAGA	0.527													26	88	---	---	---	---	capture	Missense_Mutation	SNP	15164396	15164396	CASP14	19	G	T	T	T	1	0	0	0	0	1	0	0	0	507	39	4	4	2646	276
PPFIA3	8541	broad.mit.edu	37	19	49651354	49651354	+	Silent	SNP	C	T	T			TCGA-76-6193-01	TCGA-76-6193-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:49651354C>T	uc002pmr.2	+	24	3182	c.2850C>T	c.(2848-2850)GGC>GGT	p.G950G	PPFIA3_uc010yai.1_RNA|PPFIA3_uc002pms.2_Silent_p.G809G|PPFIA3_uc002pmt.2_Silent_p.G89G|PPFIA3_uc002pmu.1_5'UTR	NM_003660	NP_003651	O75145	LIPA3_HUMAN	PTPRF interacting protein alpha 3	950						cell surface|cytoplasm	protein binding			lung(1)	1		all_lung(116;3.16e-06)|Lung NSC(112;6.25e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		all cancers(93;2.36e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000203)|GBM - Glioblastoma multiforme(486;0.00307)|Epithelial(262;0.00677)		TGGCATATGGCGACATGAACC	0.617													13	37	---	---	---	---	capture	Silent	SNP	49651354	49651354	PPFIA3	19	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	12212	276
KLF11	8462	broad.mit.edu	37	2	10188462	10188462	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6193-01	TCGA-76-6193-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:10188462C>T	uc002raf.1	+	3	1160	c.998C>T	c.(997-999)GCT>GTT	p.A333V	KLF11_uc010yjc.1_Missense_Mutation_p.A316V	NM_003597	NP_003588	O14901	KLF11_HUMAN	Kruppel-like factor 11	333					apoptosis|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of apoptosis|regulation of transcription involved in S phase of mitotic cell cycle	nucleus	sequence-specific DNA binding RNA polymerase II transcription factor activity|transcription regulatory region DNA binding|zinc ion binding			ovary(2)	2	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.133)|OV - Ovarian serous cystadenocarcinoma(76;0.228)		GTGGGACCTGCTGTGCCTCAG	0.622											OREG0014425	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	64	---	---	---	---	capture	Missense_Mutation	SNP	10188462	10188462	KLF11	2	C	T	T	T	1	0	0	0	0	1	0	0	0	364	28	2	2	8260	276
ACTG2	72	broad.mit.edu	37	2	74140711	74140711	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6193-01	TCGA-76-6193-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:74140711G>A	uc002sjw.2	+	6	673	c.551G>A	c.(550-552)CGT>CAT	p.R184H	ACTG2_uc010fey.2_Missense_Mutation_p.R184H|ACTG2_uc010yrn.1_Missense_Mutation_p.R141H	NM_001615	NP_001606	P63267	ACTH_HUMAN	actin, gamma 2 propeptide	184					muscle contraction	cytoskeleton|cytosol	ATP binding				0						TTGGCTGGCCGTGACCTCACG	0.552													21	55	---	---	---	---	capture	Missense_Mutation	SNP	74140711	74140711	ACTG2	2	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	197	276
VIL1	7429	broad.mit.edu	37	2	219301877	219301877	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6193-01	TCGA-76-6193-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:219301877G>A	uc002via.2	+	17	2067	c.2002G>A	c.(2002-2004)GAG>AAG	p.E668K	VIL1_uc010zke.1_Missense_Mutation_p.E357K|VIL1_uc002vib.2_Missense_Mutation_p.E668K	NM_007127	NP_009058	P09327	VILI_HUMAN	villin 1	668	Gelsolin-like 6.|Core.				actin filament capping|actin filament depolymerization|actin filament polymerization|actin filament severing|apoptosis|cellular response to epidermal growth factor stimulus|cytoplasmic actin-based contraction involved in cell motility|epidermal growth factor receptor signaling pathway|positive regulation of actin filament bundle assembly|positive regulation of epithelial cell migration|regulation of actin nucleation|regulation of cell shape|regulation of lamellipodium morphogenesis|regulation of wound healing|response to bacterium	actin filament bundle|cytoplasm|filopodium tip|intracellular membrane-bounded organelle|lamellipodium|microvillus|ruffle	actin filament binding|calcium ion binding|caspase inhibitor activity|lysophosphatidic acid binding|phosphatidylinositol-4,5-bisphosphate binding|protein homodimerization activity			ovary(1)	1		Renal(207;0.0474)		Epithelial(149;6.88e-07)|all cancers(144;0.00013)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		ACATGCCAACGAGGAGGAGAA	0.577													19	79	---	---	---	---	capture	Missense_Mutation	SNP	219301877	219301877	VIL1	2	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	17046	276
PDYN	5173	broad.mit.edu	37	20	1961151	1961151	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6193-01	TCGA-76-6193-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:1961151C>T	uc010gaj.2	-	3	825	c.583G>A	c.(583-585)GGG>AGG	p.G195R	uc002wfu.1_Intron|PDYN_uc002wfv.2_Missense_Mutation_p.G195R|PDYN_uc010zpt.1_Missense_Mutation_p.G40R	NM_024411	NP_077722	P01213	PDYN_HUMAN	beta-neoendorphin-dynorphin preproprotein	195					cell death|neuropeptide signaling pathway|synaptic transmission	extracellular region|plasma membrane	opioid peptide activity			upper_aerodigestive_tract(1)|ovary(1)	2						ATGCTATCCCCGTCCCCCTCC	0.597													26	79	---	---	---	---	capture	Missense_Mutation	SNP	1961151	1961151	PDYN	20	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	11602	276
RALGAPA2	57186	broad.mit.edu	37	20	20493649	20493649	+	Missense_Mutation	SNP	G	C	C			TCGA-76-6193-01	TCGA-76-6193-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:20493649G>C	uc002wrz.2	-	32	4507	c.4364C>G	c.(4363-4365)TCT>TGT	p.S1455C	RALGAPA2_uc010gcx.2_Missense_Mutation_p.S1159C|RALGAPA2_uc010zsg.1_Missense_Mutation_p.S903C|RALGAPA2_uc002wsa.1_Missense_Mutation_p.S227C	NM_020343	NP_065076	Q2PPJ7	RGPA2_HUMAN	akt substrate AS250	1455					activation of Ral GTPase activity	cytosol|nucleus	protein heterodimerization activity|Ral GTPase activator activity			ovary(1)	1						ATCAGAGAGAGAGCCCACTGG	0.478													6	18	---	---	---	---	capture	Missense_Mutation	SNP	20493649	20493649	RALGAPA2	20	G	C	C	C	1	0	0	0	0	1	0	0	0	429	33	4	4	12909	276
RALGAPB	57148	broad.mit.edu	37	20	37182634	37182634	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6193-01	TCGA-76-6193-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:37182634G>A	uc002xiw.2	+	22	3544	c.3287G>A	c.(3286-3288)TGC>TAC	p.C1096Y	RALGAPB_uc002xix.2_Missense_Mutation_p.C1092Y|RALGAPB_uc002xiy.1_Intron|RALGAPB_uc002xiz.2_Missense_Mutation_p.C874Y	NM_020336	NP_065069	Q86X10	RLGPB_HUMAN	Ral GTPase activating protein, beta subunit	1096					activation of Ral GTPase activity	intracellular	protein heterodimerization activity|Ral GTPase activator activity			pancreas(1)|skin(1)	2						GTTACGGATTGCAAGCCCCCG	0.478													4	100	---	---	---	---	capture	Missense_Mutation	SNP	37182634	37182634	RALGAPB	20	G	A	A	A	1	0	0	0	0	1	0	0	0	598	46	2	2	12910	276
LAMA5	3911	broad.mit.edu	37	20	60911477	60911477	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6193-01	TCGA-76-6193-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:60911477C>T	uc002ycq.2	-	18	2309	c.2242G>A	c.(2242-2244)GCT>ACT	p.A748T		NM_005560	NP_005551	O15230	LAMA5_HUMAN	laminin alpha 5 precursor	748	Laminin EGF-like 9.				angiogenesis|cell proliferation|cell recognition|cytoskeleton organization|endothelial cell differentiation|focal adhesion assembly|integrin-mediated signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development|substrate adhesion-dependent cell spreading	extracellular space|laminin-1 complex|laminin-10 complex|laminin-11 complex	integrin binding			ovary(1)|pancreas(1)|skin(1)	3	Breast(26;1.57e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)		Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	TCCACGTGAGCCCGGCACATA	0.642													12	65	---	---	---	---	capture	Missense_Mutation	SNP	60911477	60911477	LAMA5	20	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	8529	276
APOBEC3F	200316	broad.mit.edu	37	22	39448100	39448100	+	Missense_Mutation	SNP	C	A	A			TCGA-76-6193-01	TCGA-76-6193-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:39448100C>A	uc003aww.2	+	6	1038	c.745C>A	c.(745-747)CAT>AAT	p.H249N		NM_145298	NP_660341	Q9HC16	ABC3G_HUMAN	apolipoprotein B mRNA editing enzyme, catalytic	257		Zinc (By similarity).		H->A: Decreases cytidine deaminase activity.	base conversion or substitution editing|DNA cytosine deamination|innate immune response|interspecies interaction between organisms|negative regulation of retroviral genome replication|negative regulation of transposition|positive regulation of defense response to virus by host|response to virus|viral reproduction	apolipoprotein B mRNA editing enzyme complex|cytosol|mitochondrion	cytidine deaminase activity|dCTP deaminase activity|protein homodimerization activity|RNA binding|zinc ion binding				0	Melanoma(58;0.04)					GACCCATTGTCATGCAGAAAG	0.572													37	146	---	---	---	---	capture	Missense_Mutation	SNP	39448100	39448100	APOBEC3F	22	C	A	A	A	1	0	0	0	0	1	0	0	0	377	29	4	4	786	276
RPL14	9045	broad.mit.edu	37	3	40499407	40499407	+	Silent	SNP	C	T	T			TCGA-76-6193-01	TCGA-76-6193-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:40499407C>T	uc003ckg.2	+	2	81	c.30C>T	c.(28-30)GGC>GGT	p.G10G	RPL14_uc003ckh.2_Silent_p.G10G|RPL14_uc003cki.2_5'UTR	NM_003973	NP_003964	P50914	RL14_HUMAN	ribosomal protein L14	10					endocrine pancreas development|ribosomal large subunit biogenesis|rRNA processing|translational elongation|translational termination|viral transcription	cytosolic large ribosomal subunit	protein binding|RNA binding|structural constituent of ribosome				0				KIRC - Kidney renal clear cell carcinoma(284;0.0517)|Kidney(284;0.065)		TGGAGGTTGGCCGGGTGGCCT	0.443													4	75	---	---	---	---	capture	Silent	SNP	40499407	40499407	RPL14	3	C	T	T	T	1	0	0	0	0	0	0	0	1	327	26	2	2	13453	276
CDCP1	64866	broad.mit.edu	37	3	45127459	45127459	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6193-01	TCGA-76-6193-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:45127459C>T	uc003com.2	-	9	2317	c.2182G>A	c.(2182-2184)GAC>AAC	p.D728N		NM_022842	NP_073753	Q9H5V8	CDCP1_HUMAN	CUB domain-containing protein 1 isoform 1	728	Cytoplasmic (Potential).					extracellular region|integral to membrane|plasma membrane				ovary(1)|central_nervous_system(1)|skin(1)	3				BRCA - Breast invasive adenocarcinoma(193;0.00928)|KIRC - Kidney renal clear cell carcinoma(197;0.0519)|Kidney(197;0.0651)		GAGTCATTGTCCTTTCGCCCT	0.502													13	272	---	---	---	---	capture	Missense_Mutation	SNP	45127459	45127459	CDCP1	3	C	T	T	T	1	0	0	0	0	1	0	0	0	390	30	2	2	3064	276
SLC15A2	6565	broad.mit.edu	37	3	121641692	121641692	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6193-01	TCGA-76-6193-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:121641692C>T	uc003eep.2	+	9	1004	c.851C>T	c.(850-852)GCG>GTG	p.A284V	SLC15A2_uc011bjn.1_Missense_Mutation_p.A253V	NM_021082	NP_066568	Q16348	S15A2_HUMAN	peptide transporter 2 isoform a	284					protein transport	integral to plasma membrane	peptide:hydrogen symporter activity|protein binding			skin(1)	1				GBM - Glioblastoma multiforme(114;0.0967)	Cefadroxil(DB01140)	CTAGACTGGGCGGCTGAGAAA	0.433													7	29	---	---	---	---	capture	Missense_Mutation	SNP	121641692	121641692	SLC15A2	3	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	14292	276
ILDR1	286676	broad.mit.edu	37	3	121712145	121712145	+	Missense_Mutation	SNP	T	G	G			TCGA-76-6193-01	TCGA-76-6193-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:121712145T>G	uc003ees.2	-	7	1557	c.1451A>C	c.(1450-1452)GAC>GCC	p.D484A	ILDR1_uc003eeq.2_Missense_Mutation_p.D452A|ILDR1_uc003eer.2_Missense_Mutation_p.D440A|ILDR1_uc010hrg.2_Missense_Mutation_p.D395A	NM_175924	NP_787120	Q86SU0	ILDR1_HUMAN	immunoglobulin-like domain containing receptor	484	Cytoplasmic (Potential).					cytosol|integral to membrane|plasma membrane	receptor activity			skin(1)	1				GBM - Glioblastoma multiforme(114;0.156)		CCTCTCCTTGTCCTCTTCAGA	0.677													5	23	---	---	---	---	capture	Missense_Mutation	SNP	121712145	121712145	ILDR1	3	T	G	G	G	1	0	0	0	0	1	0	0	0	754	58	4	4	7632	276
HTRA3	94031	broad.mit.edu	37	4	8307709	8307709	+	Missense_Mutation	SNP	A	G	G			TCGA-76-6193-01	TCGA-76-6193-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:8307709A>G	uc003gla.2	+	9	1412	c.1208A>G	c.(1207-1209)CAA>CGA	p.Q403R		NM_053044	NP_444272	P83110	HTRA3_HUMAN	HtrA serine peptidase 3 precursor	403	PDZ.				proteolysis|regulation of cell growth	extracellular region	insulin-like growth factor binding|serine-type endopeptidase activity			ovary(1)	1						GGCGGCATCCAAGATGGTGAC	0.647													4	89	---	---	---	---	capture	Missense_Mutation	SNP	8307709	8307709	HTRA3	4	A	G	G	G	1	0	0	0	0	1	0	0	0	65	5	3	3	7380	276
N4BP2	55728	broad.mit.edu	37	4	40127847	40127847	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6193-01	TCGA-76-6193-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:40127847C>T	uc003guy.3	+	12	4762	c.4424C>T	c.(4423-4425)TCT>TTT	p.S1475F	N4BP2_uc010ifq.2_Missense_Mutation_p.S1395F|N4BP2_uc010ifr.2_Missense_Mutation_p.S1395F	NM_018177	NP_060647	Q86UW6	N4BP2_HUMAN	Nedd4 binding protein 2	1475						cytoplasm	ATP binding|ATP-dependent polydeoxyribonucleotide 5'-hydroxyl-kinase activity|endonuclease activity|protein binding			lung(3)|breast(2)|kidney(2)|ovary(1)	8						TTAACAGCATCTGAAATGCTA	0.338													26	84	---	---	---	---	capture	Missense_Mutation	SNP	40127847	40127847	N4BP2	4	C	T	T	T	1	0	0	0	0	1	0	0	0	416	32	2	2	10020	276
NAA11	84779	broad.mit.edu	37	4	80246554	80246554	+	Nonsense_Mutation	SNP	G	A	A			TCGA-76-6193-01	TCGA-76-6193-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:80246554G>A	uc003hlt.3	-	1	618	c.478C>T	c.(478-480)CGA>TGA	p.R160*		NM_032693	NP_116082	Q9BSU3	NAA11_HUMAN	alpha-N-acetyltransferase 1B	160						cytoplasm|nucleus	peptide alpha-N-acetyltransferase activity|protein binding			ovary(1)|central_nervous_system(1)	2						TCCATTTGTCGTCTCAGCTCA	0.517													7	37	---	---	---	---	capture	Nonsense_Mutation	SNP	80246554	80246554	NAA11	4	G	A	A	A	1	0	0	0	0	0	1	0	0	519	40	5	1	10027	276
ANKRD50	57182	broad.mit.edu	37	4	125591834	125591834	+	Silent	SNP	A	G	G			TCGA-76-6193-01	TCGA-76-6193-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:125591834A>G	uc003ifg.3	-	3	2864	c.2598T>C	c.(2596-2598)CTT>CTC	p.L866L	ANKRD50_uc011cgo.1_Silent_p.L687L|ANKRD50_uc010inw.2_Silent_p.L866L	NM_020337	NP_065070	Q9ULJ7	ANR50_HUMAN	ankyrin repeat domain 50	866	ANK 12.									central_nervous_system(1)	1						CTTGTTCAATAAGTGCTTCAC	0.393													29	123	---	---	---	---	capture	Silent	SNP	125591834	125591834	ANKRD50	4	A	G	G	G	1	0	0	0	0	0	0	0	1	158	13	3	3	672	276
NEIL3	55247	broad.mit.edu	37	4	178274739	178274739	+	Missense_Mutation	SNP	T	G	G			TCGA-76-6193-01	TCGA-76-6193-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:178274739T>G	uc003iut.2	+	8	1434	c.1317T>G	c.(1315-1317)GAT>GAG	p.D439E	NEIL3_uc010irs.2_3'UTR	NM_018248	NP_060718	Q8TAT5	NEIL3_HUMAN	nei endonuclease VIII-like 3	439					base-excision repair|nucleotide-excision repair	nucleus	bubble DNA binding|damaged DNA binding|DNA N-glycosylase activity|DNA-(apurinic or apyrimidinic site) lyase activity|double-stranded DNA binding|single-stranded DNA binding|zinc ion binding			lung(2)|ovary(1)|central_nervous_system(1)	4		Breast(14;6.27e-05)|Melanoma(52;0.00102)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|all_neural(102;0.164)		all cancers(43;1.96e-23)|Epithelial(43;2.52e-20)|OV - Ovarian serous cystadenocarcinoma(60;1.89e-11)|GBM - Glioblastoma multiforme(59;9.49e-05)|Colorectal(24;0.00013)|COAD - Colon adenocarcinoma(29;0.000696)|STAD - Stomach adenocarcinoma(60;0.00308)|LUSC - Lung squamous cell carcinoma(193;0.0398)|READ - Rectum adenocarcinoma(43;0.191)		CAACAAACGATATAACTCAAC	0.373								BER_DNA_glycosylases					4	77	---	---	---	---	capture	Missense_Mutation	SNP	178274739	178274739	NEIL3	4	T	G	G	G	1	0	0	0	0	1	0	0	0	634	49	4	4	10227	276
ATG12	9140	broad.mit.edu	37	5	115177234	115177234	+	Nonsense_Mutation	SNP	G	A	A			TCGA-76-6193-01	TCGA-76-6193-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:115177234G>A	uc003krh.2	-	1	266	c.157C>T	c.(157-159)CAG>TAG	p.Q53*	AP3S1_uc003krl.2_5'Flank|AP3S1_uc003krk.2_5'Flank|AP3S1_uc003krm.2_5'Flank|ATG12_uc003kri.2_Nonsense_Mutation_p.Q53*|ATG12_uc003krj.2_RNA	NM_004707	NP_004698	O94817	ATG12_HUMAN	APG12 autophagy 12-like	6					autophagic vacuole assembly|negative regulation of type I interferon production	pre-autophagosomal structure membrane	protein binding				0		all_cancers(142;0.00377)|all_epithelial(76;0.000129)|Prostate(80;0.0132)|Ovarian(225;0.0776)|Lung NSC(810;0.245)		OV - Ovarian serous cystadenocarcinoma(64;7.59e-08)|Epithelial(69;7.05e-07)|all cancers(49;3.11e-05)		AACACAGACTGCGGCTCCTCC	0.607													16	88	---	---	---	---	capture	Nonsense_Mutation	SNP	115177234	115177234	ATG12	5	G	A	A	A	1	0	0	0	0	0	1	0	0	598	46	5	2	1081	276
PCDHB10	56126	broad.mit.edu	37	5	140573541	140573541	+	Silent	SNP	C	T	T	rs17844565	byFrequency	TCGA-76-6193-01	TCGA-76-6193-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140573541C>T	uc003lix.2	+	1	1590	c.1416C>T	c.(1414-1416)AGC>AGT	p.S472S		NM_018930	NP_061753	Q9UN67	PCDBA_HUMAN	protocadherin beta 10 precursor	472	Cadherin 5.|Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding			ovary(1)|skin(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			ACATCGGCAGCGTCAGCGCCA	0.662													5	70	---	---	---	---	capture	Silent	SNP	140573541	140573541	PCDHB10	5	C	T	T	T	1	0	0	0	0	0	0	0	1	350	27	1	1	11438	276
ZUFSP	221302	broad.mit.edu	37	6	116987896	116987896	+	Missense_Mutation	SNP	G	T	T			TCGA-76-6193-01	TCGA-76-6193-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:116987896G>T	uc003pxf.1	-	2	706	c.460C>A	c.(460-462)CCT>ACT	p.P154T	ZUFSP_uc010kef.1_Intron	NM_145062	NP_659499	Q96AP4	ZUFSP_HUMAN	zinc finger with UFM1-specific peptidase domain	154	C2H2-type 2.					intracellular	zinc ion binding			skin(1)	1				GBM - Glioblastoma multiforme(226;0.0258)|all cancers(137;0.0368)|OV - Ovarian serous cystadenocarcinoma(136;0.0464)|Epithelial(106;0.186)		GGACATTCAGGAGGACTGTAT	0.378													18	67	---	---	---	---	capture	Missense_Mutation	SNP	116987896	116987896	ZUFSP	6	G	T	T	T	1	0	0	0	0	1	0	0	0	533	41	4	4	18122	276
LAMA2	3908	broad.mit.edu	37	6	129573419	129573419	+	Missense_Mutation	SNP	T	C	C			TCGA-76-6193-01	TCGA-76-6193-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:129573419T>C	uc003qbn.2	+	14	2180	c.2075T>C	c.(2074-2076)TTT>TCT	p.F692S	LAMA2_uc003qbo.2_Missense_Mutation_p.F692S	NM_000426	NP_000417	P24043	LAMA2_HUMAN	laminin alpha 2 subunit isoform a precursor	692	Laminin IV type A 1.				cell adhesion|muscle organ development|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	receptor binding|structural molecule activity			ovary(8)|breast(1)|skin(1)	10				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)		ACATACAGCTTTGGGATGGAT	0.453													9	61	---	---	---	---	capture	Missense_Mutation	SNP	129573419	129573419	LAMA2	6	T	C	C	C	1	0	0	0	0	1	0	0	0	832	64	3	3	8526	276
PLXNA4	91584	broad.mit.edu	37	7	131982916	131982916	+	Silent	SNP	G	T	T			TCGA-76-6193-01	TCGA-76-6193-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:131982916G>T	uc003vra.3	-	4	1666	c.1437C>A	c.(1435-1437)GGC>GGA	p.G479G		NM_020911	NP_065962	Q9HCM2	PLXA4_HUMAN	plexin A4 isoform 1	479	Extracellular (Potential).|Sema.					integral to membrane|intracellular|plasma membrane				ovary(1)	1						GGAGGACTGGGCCGGGGTCCA	0.582													14	56	---	---	---	---	capture	Silent	SNP	131982916	131982916	PLXNA4	7	G	T	T	T	1	0	0	0	0	0	0	0	1	535	42	4	4	12025	276
DLGAP2	9228	broad.mit.edu	37	8	1574988	1574988	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6193-01	TCGA-76-6193-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:1574988C>T	uc003wpl.2	+	4	1382	c.1285C>T	c.(1285-1287)CGC>TGC	p.R429C	DLGAP2_uc003wpm.2_Missense_Mutation_p.R429C	NM_004745	NP_004736	Q9P1A6	DLGP2_HUMAN	discs large-associated protein 2	508					neuron-neuron synaptic transmission	cell junction|neurofilament|postsynaptic density|postsynaptic membrane	protein binding				0		Ovarian(12;0.0271)|Hepatocellular(245;0.0838)|Colorectal(14;0.0846)		BRCA - Breast invasive adenocarcinoma(11;0.000169)|READ - Rectum adenocarcinoma(644;0.171)		CCCGAAATTCCGCTCCCGGAA	0.617													3	13	---	---	---	---	capture	Missense_Mutation	SNP	1574988	1574988	DLGAP2	8	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	4518	276
MPDZ	8777	broad.mit.edu	37	9	13162794	13162794	+	Silent	SNP	T	C	C			TCGA-76-6193-01	TCGA-76-6193-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:13162794T>C	uc010mia.1	-	22	3312	c.3255A>G	c.(3253-3255)AAA>AAG	p.K1085K	MPDZ_uc010mhx.2_5'UTR|MPDZ_uc011lmm.1_5'UTR|MPDZ_uc003zkz.3_Intron|MPDZ_uc010mhy.2_Silent_p.K1085K|MPDZ_uc010mhz.2_Silent_p.K1085K|MPDZ_uc011lmn.1_Silent_p.K1085K|MPDZ_uc003zlb.3_Silent_p.K1085K	NM_003829	NP_003820	O75970	MPDZ_HUMAN	multiple PDZ domain protein	1085	PDZ 6.				interspecies interaction between organisms	apical plasma membrane|dendrite|postsynaptic density|postsynaptic membrane|synaptosome|tight junction	protein C-terminus binding			ovary(5)|central_nervous_system(1)	6				GBM - Glioblastoma multiforme(50;2.03e-06)		CATAAGTAATTCTGGAACAAA	0.348													13	37	---	---	---	---	capture	Silent	SNP	13162794	13162794	MPDZ	9	T	C	C	C	1	0	0	0	0	0	0	0	1	803	62	3	3	9634	276
DCAF12L1	139170	broad.mit.edu	37	X	125685588	125685588	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6193-01	TCGA-76-6193-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:125685588C>T	uc004eul.2	-	1	1255	c.1004G>A	c.(1003-1005)CGC>CAC	p.R335H		NM_178470	NP_848565	Q5VU92	DC121_HUMAN	DDB1 and CUL4 associated factor 12-like 1	335										skin(3)|ovary(1)	4						CTGGTCCTGGCGCAGATCCAG	0.597													28	21	---	---	---	---	capture	Missense_Mutation	SNP	125685588	125685588	DCAF12L1	23	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	4223	276
VAMP7	6845	broad.mit.edu	37	X	155169439	155169439	+	Missense_Mutation	SNP	C	G	G			TCGA-76-6193-01	TCGA-76-6193-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:155169439C>G	uc004fnr.2	+	7	750	c.576C>G	c.(574-576)ATC>ATG	p.I192M	VAMP7_uc004fnt.2_Missense_Mutation_p.I151M|VAMP7_uc011naa.1_Missense_Mutation_p.I153M|VAMP7_uc011nab.1_Missense_Mutation_p.I91M|VAMP7_uc004fns.2_Missense_Mutation_p.H170D|VAMP7_uc011nac.1_Missense_Mutation_p.I125M	NM_005638	NP_005629	P51809	VAMP7_HUMAN	vesicle-associated membrane protein 7 isoform 1	192	Helical; Anchor for type IV membrane protein; (Potential).				calcium ion-dependent exocytosis|endosome to lysosome transport|eosinophil degranulation|ER to Golgi vesicle-mediated transport|neutrophil degranulation|phagocytosis, engulfment|post-Golgi vesicle-mediated transport|protein transport|vesicle fusion	endoplasmic reticulum membrane|Golgi apparatus|integral to membrane|late endosome membrane|lysosomal membrane|phagocytic vesicle membrane|plasma membrane|SNARE complex|transport vesicle membrane	protein binding				0	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					TCACTATTATCATCATCATCG	0.333													35	165	---	---	---	---	capture	Missense_Mutation	SNP	155169439	155169439	VAMP7	23	C	G	G	G	1	0	0	0	0	1	0	0	0	377	29	4	4	16999	276
PYGO1	26108	broad.mit.edu	37	15	55838924	55838927	+	Frame_Shift_Del	DEL	TGAC	-	-			TCGA-76-6193-01	TCGA-76-6193-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:55838924_55838927delTGAC	uc010bfl.1	-	3	610_613	c.554_557delGTCA	c.(553-558)AGTCAAfs	p.S185fs	PYGO1_uc002adf.1_Frame_Shift_Del_p.S185fs	NM_015617	NP_056432	Q9Y3Y4	PYGO1_HUMAN	pygopus homolog 1	185_186	Asn-rich.				Wnt receptor signaling pathway	nucleus	zinc ion binding			ovary(1)|skin(1)	2				all cancers(107;0.0131)|GBM - Glioblastoma multiforme(80;0.18)		TGGAGGAATTTGACTGAAATTTTC	0.333													28	89	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	55838924	55838927	PYGO1	15	TGAC	-	-	-	1	0	1	0	1	0	0	0	0	819	63	5	5	12758	276
PIK3CA	5290	broad.mit.edu	37	3	178938803	178938803	+	Frame_Shift_Del	DEL	A	-	-			TCGA-76-6193-01	TCGA-76-6193-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:178938803delA	uc003fjk.2	+	14	2202	c.2045delA	c.(2044-2046)CAGfs	p.Q682fs		NM_006218	NP_006209	P42336	PK3CA_HUMAN	phosphoinositide-3-kinase, catalytic, alpha	682	PI3K helical.				epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell costimulation|T cell receptor signaling pathway		1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity			breast(1564)|large_intestine(776)|endometrium(246)|urinary_tract(195)|ovary(141)|skin(112)|stomach(98)|thyroid(77)|central_nervous_system(69)|lung(65)|upper_aerodigestive_tract(58)|haematopoietic_and_lymphoid_tissue(27)|cervix(25)|biliary_tract(22)|liver(20)|oesophagus(17)|pancreas(11)|penis(8)|pituitary(8)|autonomic_ganglia(4)|prostate(3)|kidney(2)|meninges(1)|eye(1)|NS(1)|soft_tissue(1)|bone(1)	3553	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)			ACAGTTAGCCAGAGGTTTGGC	0.348		57	Mis		colorectal|gastric|gliobastoma|breast					HNSCC(19;0.045)|TSP Lung(28;0.18)			9	41	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	178938803	178938803	PIK3CA	3	A	-	-	-	1	0	1	0	1	0	0	0	0	91	7	5	5	11816	276
