Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
CYP4B1	1580	broad.mit.edu	37	1	47282802	47282802	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6280-01	TCGA-76-6280-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:47282802C>T	uc001cqm.3	+	9	1237	c.1153C>T	c.(1153-1155)CGC>TGC	p.R385C	CYP4B1_uc001cqn.3_Missense_Mutation_p.R386C|CYP4B1_uc009vym.2_Missense_Mutation_p.R371C|CYP4B1_uc010omk.1_Missense_Mutation_p.R222C	NM_000779	NP_000770	P13584	CP4B1_HUMAN	cytochrome P450, family 4, subfamily B,	385					xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding|oxygen binding			ovary(1)|skin(1)	2	Acute lymphoblastic leukemia(166;0.155)					CCAGGTGTACCGCCAGCTCAG	0.572													34	44	---	---	---	---	capture	Missense_Mutation	SNP	47282802	47282802	CYP4B1	1	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	4145	277
PLXNA2	5362	broad.mit.edu	37	1	208269395	208269395	+	Missense_Mutation	SNP	T	G	G			TCGA-76-6280-01	TCGA-76-6280-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:208269395T>G	uc001hgz.2	-	8	2719	c.1961A>C	c.(1960-1962)TAC>TCC	p.Y654S		NM_025179	NP_079455	O75051	PLXA2_HUMAN	plexin A2 precursor	654	Extracellular (Potential).				axon guidance	integral to membrane|intracellular|plasma membrane				ovary(2)|central_nervous_system(1)	3				OV - Ovarian serous cystadenocarcinoma(81;0.199)		ACTGCAGTTGTAAAACTTGAA	0.393													134	253	---	---	---	---	capture	Missense_Mutation	SNP	208269395	208269395	PLXNA2	1	T	G	G	G	1	0	0	0	0	1	0	0	0	741	57	4	4	12023	277
CACNB2	783	broad.mit.edu	37	10	18828173	18828173	+	Silent	SNP	T	C	C			TCGA-76-6280-01	TCGA-76-6280-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:18828173T>C	uc001ipr.2	+	14	1563	c.1503T>C	c.(1501-1503)GAT>GAC	p.D501D	CACNB2_uc009xjz.1_Silent_p.D251D|CACNB2_uc001ips.2_Silent_p.D477D|CACNB2_uc001ipt.2_Silent_p.D463D|CACNB2_uc001ipu.2_Silent_p.D473D|CACNB2_uc001ipv.2_Silent_p.D449D|CACNB2_uc009xka.1_Silent_p.D435D|CACNB2_uc001ipw.2_Silent_p.D408D|CACNB2_uc001ipx.2_Silent_p.D446D|CACNB2_uc001ipz.2_Silent_p.D423D|CACNB2_uc001ipy.2_Silent_p.D447D|CACNB2_uc010qco.1_Silent_p.D415D|CACNB2_uc001iqa.2_Silent_p.D453D|NSUN6_uc001iqb.2_RNA	NM_201596	NP_963890	Q08289	CACB2_HUMAN	calcium channel, voltage-dependent, beta 2	501				D -> H (in Ref. 3; AAD33729/AAD33730).	axon guidance|neuromuscular junction development	integral to plasma membrane|sarcolemma|voltage-gated calcium channel complex	protein binding|voltage-gated calcium channel activity			large_intestine(1)|central_nervous_system(1)|skin(1)	3					Magnesium Sulfate(DB00653)|Verapamil(DB00661)	CTCAAGGTGATCAGAGGACTG	0.527													38	27	---	---	---	---	capture	Silent	SNP	18828173	18828173	CACNB2	10	T	C	C	C	1	0	0	0	0	0	0	0	1	647	50	3	3	2529	277
ACTA2	59	broad.mit.edu	37	10	90707027	90707027	+	Silent	SNP	G	A	A			TCGA-76-6280-01	TCGA-76-6280-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:90707027G>A	uc001kfp.2	-	3	362	c.246C>T	c.(244-246)GAC>GAT	p.D82D	STAMBPL1_uc010qmx.1_Intron|ACTA2_uc010qmy.1_Silent_p.D37D|ACTA2_uc001kfq.2_Silent_p.D82D|ACTA2_uc010qmz.1_Silent_p.D82D	NM_001613	NP_001604	P62736	ACTA_HUMAN	alpha 2 actin	82					response to virus	cytosol	ATP binding				0		Colorectal(252;0.0161)		Colorectal(12;0.000123)|COAD - Colon adenocarcinoma(12;0.00018)		TTTCCATGTCGTCCCAGTTGG	0.502													54	24	---	---	---	---	capture	Silent	SNP	90707027	90707027	ACTA2	10	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	192	277
HTR7	3363	broad.mit.edu	37	10	92616992	92616992	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6280-01	TCGA-76-6280-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:92616992C>T	uc001kha.2	-	1	680	c.437G>A	c.(436-438)GGC>GAC	p.G146D	HTR7_uc001kgz.2_Missense_Mutation_p.G146D|HTR7_uc001khb.2_Missense_Mutation_p.G146D	NM_019859	NP_062873	P34969	5HT7R_HUMAN	5-hydroxytryptamine receptor 7 isoform d	146	Extracellular (By similarity).				blood circulation|circadian rhythm	integral to plasma membrane	protein binding|serotonin receptor activity			ovary(1)	1					Eletriptan(DB00216)|Methysergide(DB00247)|Ziprasidone(DB00246)	GATCCACTTGCCCCCGATGAG	0.592													3	31	---	---	---	---	capture	Missense_Mutation	SNP	92616992	92616992	HTR7	10	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	7377	277
OR52N1	79473	broad.mit.edu	37	11	5809262	5809262	+	Missense_Mutation	SNP	A	G	G			TCGA-76-6280-01	TCGA-76-6280-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:5809262A>G	uc010qzo.1	-	1	785	c.785T>C	c.(784-786)TTT>TCT	p.F262S	TRIM5_uc001mbq.1_Intron|TRIM22_uc009yet.1_Intron	NM_001001913	NP_001001913	Q8NH53	O52N1_HUMAN	olfactory receptor, family 52, subfamily N,	262	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;3.05e-11)|LUSC - Lung squamous cell carcinoma(625;0.112)|BRCA - Breast invasive adenocarcinoma(625;0.135)|Lung(200;0.195)		ATGGTGTGTAAAGAAGGTAAA	0.453													36	14	---	---	---	---	capture	Missense_Mutation	SNP	5809262	5809262	OR52N1	11	A	G	G	G	1	0	0	0	0	1	0	0	0	13	1	3	3	11031	277
NAV2	89797	broad.mit.edu	37	11	20065785	20065785	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6280-01	TCGA-76-6280-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:20065785G>A	uc010rdm.1	+	14	3596	c.3235G>A	c.(3235-3237)GCC>ACC	p.A1079T	NAV2_uc001mpp.2_Missense_Mutation_p.A992T|NAV2_uc001mpr.3_Missense_Mutation_p.A1056T|NAV2_uc001mpt.2_Missense_Mutation_p.A142T|NAV2_uc009yhx.2_Missense_Mutation_p.A142T|NAV2_uc009yhy.1_Missense_Mutation_p.A55T	NM_145117	NP_660093	Q8IVL1	NAV2_HUMAN	neuron navigator 2 isoform 2	1079						nucleus	ATP binding|helicase activity			skin(4)|ovary(1)|pancreas(1)	6						GAAGCCTTCAGCCCCGGCAGG	0.567													30	24	---	---	---	---	capture	Missense_Mutation	SNP	20065785	20065785	NAV2	11	G	A	A	A	1	0	0	0	0	1	0	0	0	442	34	2	2	10091	277
TM7SF2	7108	broad.mit.edu	37	11	64882420	64882420	+	Silent	SNP	C	T	T			TCGA-76-6280-01	TCGA-76-6280-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:64882420C>T	uc001oct.2	+	7	906	c.759C>T	c.(757-759)GAC>GAT	p.D253D	TM7SF2_uc010rny.1_Silent_p.D137D|TM7SF2_uc001ocu.2_Silent_p.D253D|TM7SF2_uc001ocv.2_Silent_p.D274D|uc009yqb.1_5'Flank	NM_003273	NP_003264	O76062	ERG24_HUMAN	transmembrane 7 superfamily member 2	253					cholesterol biosynthetic process	endoplasmic reticulum membrane|integral to plasma membrane	delta14-sterol reductase activity			ovary(1)	1						TCACACATGACGGGTTTGGCT	0.627													45	108	---	---	---	---	capture	Silent	SNP	64882420	64882420	TM7SF2	11	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	15859	277
KCNE3	10008	broad.mit.edu	37	11	74168386	74168386	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6280-01	TCGA-76-6280-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:74168386G>A	uc001ovc.2	-	3	570	c.223C>T	c.(223-225)CTC>TTC	p.L75F	KCNE3_uc001ovd.2_Missense_Mutation_p.L75F	NM_005472	NP_005463	Q9Y6H6	KCNE3_HUMAN	potassium voltage-gated channel, Isk-related	75	Helical; (Potential).					integral to membrane	voltage-gated potassium channel activity			ovary(1)	1	Breast(11;2.86e-06)					CCCAGGATGAGGCTGCCCACA	0.512													37	34	---	---	---	---	capture	Missense_Mutation	SNP	74168386	74168386	KCNE3	11	G	A	A	A	1	0	0	0	0	1	0	0	0	455	35	2	2	7946	277
HIP1R	9026	broad.mit.edu	37	12	123339938	123339938	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6280-01	TCGA-76-6280-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:123339938G>A	uc001udj.1	+	11	1038	c.979G>A	c.(979-981)GCG>ACG	p.A327T	HIP1R_uc001udg.1_Missense_Mutation_p.A315T|HIP1R_uc001udi.1_Missense_Mutation_p.A327T|HIP1R_uc001udk.1_5'Flank	NM_003959	NP_003950	O75146	HIP1R_HUMAN	huntingtin interacting protein-1-related	327					receptor-mediated endocytosis	clathrin coated vesicle membrane|coated pit|perinuclear region of cytoplasm	actin binding|phosphatidylinositol binding			ovary(1)	1	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;4.6e-05)|Epithelial(86;0.000119)|BRCA - Breast invasive adenocarcinoma(302;0.2)		AGGGCCCCCCGCGGGGGAGCC	0.677													6	2	---	---	---	---	capture	Missense_Mutation	SNP	123339938	123339938	HIP1R	12	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	7040	277
TNFRSF19	55504	broad.mit.edu	37	13	24233260	24233260	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6280-01	TCGA-76-6280-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:24233260G>A	uc001uov.1	+	6	581	c.517G>A	c.(517-519)GTT>ATT	p.V173I	TNFRSF19_uc001uot.2_Missense_Mutation_p.V173I|TNFRSF19_uc010tcu.1_Missense_Mutation_p.V41I|TNFRSF19_uc001uow.2_Missense_Mutation_p.V173I	NM_018647	NP_061117	Q9NS68	TNR19_HUMAN	tumor necrosis factor receptor superfamily,	173	Helical; (Potential).				apoptosis|induction of apoptosis|JNK cascade	integral to membrane|mitochondrion	tumor necrosis factor receptor activity			kidney(1)|skin(1)	2		all_cancers(29;3.4e-22)|all_epithelial(30;8.75e-19)|all_lung(29;5.09e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00193)|Epithelial(112;0.0137)|OV - Ovarian serous cystadenocarcinoma(117;0.0465)|GBM - Glioblastoma multiforme(144;0.184)|Lung(94;0.19)		GCTGGCTGCCGTTATCTGCAG	0.577													43	43	---	---	---	---	capture	Missense_Mutation	SNP	24233260	24233260	TNFRSF19	13	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	16175	277
COG6	57511	broad.mit.edu	37	13	40268775	40268775	+	Missense_Mutation	SNP	G	T	T			TCGA-76-6280-01	TCGA-76-6280-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:40268775G>T	uc001uxh.2	+	12	1179	c.1079G>T	c.(1078-1080)CGA>CTA	p.R360L	COG6_uc001uxi.2_Missense_Mutation_p.R308L|COG6_uc010acb.2_Missense_Mutation_p.R360L	NM_020751	NP_065802	Q9Y2V7	COG6_HUMAN	component of oligomeric golgi complex 6 isoform	360					protein transport	Golgi membrane|Golgi transport complex				kidney(1)|skin(1)	2		Lung NSC(96;0.000124)|Breast(139;0.0199)|Prostate(109;0.0233)|Lung SC(185;0.0367)		all cancers(112;6.03e-09)|Epithelial(112;7e-07)|OV - Ovarian serous cystadenocarcinoma(117;0.00015)|BRCA - Breast invasive adenocarcinoma(63;0.00438)|GBM - Glioblastoma multiforme(144;0.0168)		TAATAGGTTCGAATTGAGCAA	0.274													42	51	---	---	---	---	capture	Missense_Mutation	SNP	40268775	40268775	COG6	13	G	T	T	T	1	0	0	0	0	1	0	0	0	481	37	4	4	3627	277
DGKH	160851	broad.mit.edu	37	13	42761271	42761271	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6280-01	TCGA-76-6280-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:42761271C>T	uc001uyl.1	+	14	1646	c.1625C>T	c.(1624-1626)GCC>GTC	p.A542V	DGKH_uc010tfh.1_Missense_Mutation_p.A542V|DGKH_uc001uym.1_Missense_Mutation_p.A542V|DGKH_uc010tfi.1_Missense_Mutation_p.A297V|DGKH_uc010tfj.1_Missense_Mutation_p.A397V|DGKH_uc001uyn.1_RNA|DGKH_uc001uyo.1_Missense_Mutation_p.A397V|DGKH_uc001uyp.2_RNA	NM_178009	NP_821077	Q86XP1	DGKH_HUMAN	diacylglycerol kinase, eta isoform 2	542					activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation|protein oligomerization	endosome|plasma membrane	ATP binding|diacylglycerol kinase activity|metal ion binding			ovary(2)	2		Lung NSC(96;1.02e-05)|Prostate(109;0.0168)|Lung SC(185;0.0262)|Breast(139;0.0709)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;5.88e-05)|GBM - Glioblastoma multiforme(144;0.000935)|BRCA - Breast invasive adenocarcinoma(63;0.109)		GTAGCTGATGCCGTGGCCAGT	0.423													4	175	---	---	---	---	capture	Missense_Mutation	SNP	42761271	42761271	DGKH	13	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	4428	277
OR4K1	79544	broad.mit.edu	37	14	20404282	20404282	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6280-01	TCGA-76-6280-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:20404282G>A	uc001vwj.1	+	1	457	c.457G>A	c.(457-459)GTT>ATT	p.V153I		NM_001004063	NP_001004063	Q8NGD4	OR4K1_HUMAN	olfactory receptor, family 4, subfamily K,	153	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)	3	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00124)		GGCGGTGGGCGTTCTTCATTC	0.453													34	139	---	---	---	---	capture	Missense_Mutation	SNP	20404282	20404282	OR4K1	14	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	10971	277
NIN	51199	broad.mit.edu	37	14	51239180	51239180	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6280-01	TCGA-76-6280-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:51239180C>T	uc001wym.2	-	9	1011	c.820G>A	c.(820-822)GAT>AAT	p.D274N	NIN_uc001wyi.2_Missense_Mutation_p.D274N|NIN_uc001wyj.2_RNA|NIN_uc001wyk.2_Missense_Mutation_p.D274N|NIN_uc010tqp.1_Missense_Mutation_p.D280N|NIN_uc001wyo.2_Missense_Mutation_p.D274N|NIN_uc001wyp.1_Missense_Mutation_p.D236N	NM_182946	NP_891991	Q8N4C6	NIN_HUMAN	ninein isoform 5	274					centrosome localization	centrosome|microtubule	calcium ion binding|GTP binding|protein binding			skin(3)|ovary(1)|kidney(1)|central_nervous_system(1)	6	all_epithelial(31;0.00244)|Breast(41;0.127)					CCACTCTCATCGAAAGACTGG	0.502			T	PDGFRB	MPD								23	32	---	---	---	---	capture	Missense_Mutation	SNP	51239180	51239180	NIN	14	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	10324	277
SYT16	83851	broad.mit.edu	37	14	62567295	62567295	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6280-01	TCGA-76-6280-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:62567295G>A	uc001xfu.1	+	6	2005	c.1808G>A	c.(1807-1809)CGT>CAT	p.R603H	SYT16_uc010tse.1_Missense_Mutation_p.R161H	NM_031914	NP_114120	Q17RD7	SYT16_HUMAN	synaptotagmin XIV-like	603	C2 2.									central_nervous_system(1)	1				OV - Ovarian serous cystadenocarcinoma(108;0.0438)|BRCA - Breast invasive adenocarcinoma(234;0.118)		ACTATGAAGCGTAAAGAGATG	0.483													16	28	---	---	---	---	capture	Missense_Mutation	SNP	62567295	62567295	SYT16	14	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	15360	277
DCAF5	8816	broad.mit.edu	37	14	69520671	69520671	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6280-01	TCGA-76-6280-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:69520671C>T	uc001xkp.2	-	9	2951	c.2732G>A	c.(2731-2733)AGG>AAG	p.R911K	DCAF5_uc001xkq.2_Missense_Mutation_p.R910K	NM_003861	NP_003852	Q96JK2	DCAF5_HUMAN	WD repeat domain 22	911						CUL4 RING ubiquitin ligase complex				ovary(1)|central_nervous_system(1)	2						ATGAACAGCCCTGCTACTATC	0.473													34	47	---	---	---	---	capture	Missense_Mutation	SNP	69520671	69520671	DCAF5	14	C	T	T	T	1	0	0	0	0	1	0	0	0	312	24	2	2	4232	277
EIF2AK4	440275	broad.mit.edu	37	15	40280263	40280263	+	Missense_Mutation	SNP	T	C	C			TCGA-76-6280-01	TCGA-76-6280-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:40280263T>C	uc001zkm.1	+	15	2533	c.2483T>C	c.(2482-2484)CTT>CCT	p.L828P	EIF2AK4_uc010bbj.1_Missense_Mutation_p.L529P	NM_001013703	NP_001013725	Q9P2K8	E2AK4_HUMAN	eukaryotic translation initiation factor 2 alpha	828	Protein kinase 2.				translation	cytosolic ribosome	aminoacyl-tRNA ligase activity|ATP binding|eukaryotic translation initiation factor 2alpha kinase activity|protein homodimerization activity			lung(2)|stomach(1)|skin(1)	4		all_cancers(109;1.05e-19)|all_epithelial(112;4.38e-17)|Lung NSC(122;1.09e-12)|all_lung(180;3.56e-11)|Melanoma(134;0.0575)|Ovarian(310;0.0826)|Colorectal(260;0.119)		GBM - Glioblastoma multiforme(113;5.31e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0616)		CTCTGGAGGCTTTTTCGAGAG	0.393													3	86	---	---	---	---	capture	Missense_Mutation	SNP	40280263	40280263	EIF2AK4	15	T	C	C	C	1	0	0	0	0	1	0	0	0	728	56	3	3	4954	277
EHD4	30844	broad.mit.edu	37	15	42193062	42193062	+	Silent	SNP	G	A	A			TCGA-76-6280-01	TCGA-76-6280-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:42193062G>A	uc001zot.2	-	6	1470	c.1407C>T	c.(1405-1407)AAC>AAT	p.N469N		NM_139265	NP_644670	Q9H223	EHD4_HUMAN	EH-domain containing 4	469	EH.				endocytic recycling|protein homooligomerization	early endosome membrane|endoplasmic reticulum|nucleus|recycling endosome membrane	ATP binding|calcium ion binding|GTP binding|GTPase activity|nucleic acid binding|protein binding			ovary(2)	2		all_cancers(109;2.54e-12)|all_epithelial(112;6.59e-11)|Lung NSC(122;2.17e-07)|all_lung(180;8.79e-07)|Melanoma(134;0.091)		OV - Ovarian serous cystadenocarcinoma(18;1.6e-19)|GBM - Glioblastoma multiforme(94;3.77e-06)|COAD - Colon adenocarcinoma(120;0.0474)|Colorectal(105;0.0538)		CCTTCTTGGCGTTGACACCTG	0.592													33	45	---	---	---	---	capture	Silent	SNP	42193062	42193062	EHD4	15	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	4935	277
CYP19A1	1588	broad.mit.edu	37	15	51504611	51504611	+	Missense_Mutation	SNP	T	C	C			TCGA-76-6280-01	TCGA-76-6280-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:51504611T>C	uc001zyz.3	-	10	1420	c.1169A>G	c.(1168-1170)AAG>AGG	p.K390R	CYP19A1_uc001zza.3_Missense_Mutation_p.K390R|CYP19A1_uc001zzb.2_Missense_Mutation_p.K390R	NM_031226	NP_112503	P11511	CP19A_HUMAN	cytochrome P450, family 19	390					estrogen biosynthetic process|xenobiotic metabolic process	endoplasmic reticulum membrane|membrane fraction	aromatase activity|electron carrier activity|heme binding|oxygen binding|steroid hydroxylase activity			skin(3)	3				all cancers(107;0.000372)|GBM - Glioblastoma multiforme(94;0.0128)	Aminoglutethimide(DB00357)|Anastrozole(DB01217)|Conjugated Estrogens(DB00286)|Danazol(DB01406)|Diethylstilbestrol(DB00255)|Exemestane(DB00990)|Letrozole(DB01006)|Testolactone(DB00894)|Testosterone(DB00624)	GTTTGTCCCCTTTTTCACTGG	0.413													3	165	---	---	---	---	capture	Missense_Mutation	SNP	51504611	51504611	CYP19A1	15	T	C	C	C	1	0	0	0	0	1	0	0	0	728	56	3	3	4108	277
CYP1A2	1544	broad.mit.edu	37	15	75045612	75045612	+	Splice_Site	SNP	G	A	A	rs56107638	byFrequency	TCGA-76-6280-01	TCGA-76-6280-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:75045612G>A	uc002ayr.1	+	6	1317	c.1253_splice	c.e6+1	p.P418_splice		NM_000761	NP_000752	P05177	CP1A2_HUMAN	cytochrome P450, family 1, subfamily A,						alkaloid metabolic process|exogenous drug catabolic process|methylation|monocarboxylic acid metabolic process|monoterpenoid metabolic process|oxidative deethylation|oxidative demethylation|steroid catabolic process|toxin biosynthetic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|caffeine oxidase activity|demethylase activity|electron carrier activity|enzyme binding|heme binding|oxygen binding			ovary(3)|breast(1)	4					Acenocoumarol(DB01418)|Acetaminophen(DB00316)|Aciclovir(DB00787)|Alosetron(DB00969)|Aminophenazone(DB01424)|Amitriptyline(DB00321)|Anagrelide(DB00261)|Azelastine(DB00972)|Bortezomib(DB00188)|Caffeine(DB00201)|Carmustine(DB00262)|Chlordiazepoxide(DB00475)|Chlorpromazine(DB00477)|Chlorzoxazone(DB00356)|Cimetidine(DB00501)|Cinacalcet(DB01012)|Ciprofloxacin(DB00537)|Clomipramine(DB01242)|Clotrimazole(DB00257)|Clozapine(DB00363)|Conjugated Estrogens(DB00286)|Cyclobenzaprine(DB00924)|Dacarbazine(DB00851)|Desloratadine(DB00967)|Diazepam(DB00829)|Dibucaine(DB00527)|Diclofenac(DB00586)|Duloxetine(DB00476)|Enoxacin(DB00467)|Esomeprazole(DB00736)|Estradiol(DB00783)|Estrone(DB00655)|Fluorouracil(DB00544)|Flutamide(DB00499)|Fluvoxamine(DB00176)|Frovatriptan(DB00998)|Grepafloxacin(DB00365)|Haloperidol(DB00502)|Hesperetin(DB01094)|Imipramine(DB00458)|Ketoconazole(DB01026)|Leflunomide(DB01097)|Levobupivacaine(DB01002)|Levofloxacin(DB01137)|Lidocaine(DB00281)|Lomefloxacin(DB00978)|Melatonin(DB01065)|Mephenytoin(DB00532)|Mexiletine(DB00379)|Mirtazapine(DB00370)|Norfloxacin(DB01059)|Nortriptyline(DB00540)|Ofloxacin(DB01165)|Olanzapine(DB00334)|Ondansetron(DB00904)|Palonosetron(DB00377)|Pantoprazole(DB00213)|Pefloxacin(DB00487)|Pimozide(DB01100)|Propafenone(DB01182)|Propranolol(DB00571)|Quinidine(DB00908)|Ramelteon(DB00980)|Ranitidine(DB00863)|Rasagiline(DB01367)|Rifampin(DB01045)|Riluzole(DB00740)|Rofecoxib(DB00533)|Ropinirole(DB00268)|Ropivacaine(DB00296)|Tacrine(DB00382)|Telithromycin(DB00976)|Terfenadine(DB00342)|Theophylline(DB00277)|Thiabendazole(DB00730)|Tizanidine(DB00697)|Tolbutamide(DB01124)|Verapamil(DB00661)|Warfarin(DB00682)|Zileuton(DB00744)|Zolmitriptan(DB00315)	ACCATGACCCGTGAGTACATA	0.493													20	21	---	---	---	---	capture	Splice_Site	SNP	75045612	75045612	CYP1A2	15	G	A	A	A	1	0	0	0	0	0	0	1	0	520	40	5	1	4110	277
SV2B	9899	broad.mit.edu	37	15	91801746	91801746	+	Missense_Mutation	SNP	C	A	A			TCGA-76-6280-01	TCGA-76-6280-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:91801746C>A	uc002bqv.2	+	4	1271	c.880C>A	c.(880-882)CTG>ATG	p.L294M	SV2B_uc002bqt.2_Missense_Mutation_p.L294M|SV2B_uc010uqv.1_Missense_Mutation_p.L143M|SV2B_uc002bqu.3_RNA	NM_014848	NP_055663	Q7L1I2	SV2B_HUMAN	synaptic vesicle protein 2B homolog	294	Helical; (Potential).				neurotransmitter transport	acrosomal vesicle|cell junction|integral to membrane|synaptic vesicle membrane	transmembrane transporter activity			ovary(3)|central_nervous_system(2)|skin(2)|upper_aerodigestive_tract(1)	8	Lung NSC(78;0.0987)|all_lung(78;0.172)		BRCA - Breast invasive adenocarcinoma(143;0.0895)			CATGGTGGCCCTGAAGTTCAT	0.567													22	38	---	---	---	---	capture	Missense_Mutation	SNP	91801746	91801746	SV2B	15	C	A	A	A	1	0	0	0	0	1	0	0	0	311	24	4	4	15306	277
SV2B	9899	broad.mit.edu	37	15	91801750	91801750	+	Missense_Mutation	SNP	A	G	G			TCGA-76-6280-01	TCGA-76-6280-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:91801750A>G	uc002bqv.2	+	4	1275	c.884A>G	c.(883-885)AAG>AGG	p.K295R	SV2B_uc002bqt.2_Missense_Mutation_p.K295R|SV2B_uc010uqv.1_Missense_Mutation_p.K144R|SV2B_uc002bqu.3_RNA	NM_014848	NP_055663	Q7L1I2	SV2B_HUMAN	synaptic vesicle protein 2B homolog	295	Helical; (Potential).				neurotransmitter transport	acrosomal vesicle|cell junction|integral to membrane|synaptic vesicle membrane	transmembrane transporter activity			ovary(3)|central_nervous_system(2)|skin(2)|upper_aerodigestive_tract(1)	8	Lung NSC(78;0.0987)|all_lung(78;0.172)		BRCA - Breast invasive adenocarcinoma(143;0.0895)			GTGGCCCTGAAGTTCATGCCA	0.567													24	39	---	---	---	---	capture	Missense_Mutation	SNP	91801750	91801750	SV2B	15	A	G	G	G	1	0	0	0	0	1	0	0	0	39	3	3	3	15306	277
RNF40	9810	broad.mit.edu	37	16	30783282	30783282	+	Silent	SNP	C	A	A			TCGA-76-6280-01	TCGA-76-6280-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:30783282C>A	uc002dzq.2	+	18	2838	c.2715C>A	c.(2713-2715)CTC>CTA	p.L905L	RNF40_uc010caa.2_Silent_p.L905L|RNF40_uc010cab.2_Silent_p.L805L|RNF40_uc010vfa.1_Silent_p.L237L|RNF40_uc002dzr.2_Silent_p.L905L|RNF40_uc010vfb.1_Silent_p.L597L|RNF40_uc010vfc.1_Silent_p.L237L	NM_014771	NP_055586	O75150	BRE1B_HUMAN	ring finger protein 40	905	Potential.				histone H2B ubiquitination|histone monoubiquitination|ubiquitin-dependent protein catabolic process	nucleus|synaptosome|ubiquitin ligase complex	protein homodimerization activity|ubiquitin protein ligase binding|zinc ion binding			central_nervous_system(1)	1			Colorectal(24;0.198)			GCTTCAACCTCAAGAGGGCTC	0.647													15	20	---	---	---	---	capture	Silent	SNP	30783282	30783282	RNF40	16	C	A	A	A	1	0	0	0	0	0	0	0	1	366	29	4	4	13385	277
MMP15	4324	broad.mit.edu	37	16	58079116	58079116	+	Silent	SNP	C	T	T			TCGA-76-6280-01	TCGA-76-6280-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:58079116C>T	uc002ena.2	+	10	2749	c.1776C>T	c.(1774-1776)GGC>GGT	p.G592G		NM_002428	NP_002419	P51511	MMP15_HUMAN	matrix metalloproteinase 15 preproprotein	592	Extracellular (Potential).				protein modification process|proteolysis	extracellular matrix|integral to plasma membrane	calcium ion binding|enzyme activator activity|metalloendopeptidase activity|protein binding|zinc ion binding			central_nervous_system(2)|breast(1)	3						GCGCAGAGGGCGACGTGGGGG	0.736													7	10	---	---	---	---	capture	Silent	SNP	58079116	58079116	MMP15	16	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	9566	277
ATP2C2	9914	broad.mit.edu	37	16	84449185	84449185	+	Silent	SNP	C	A	A			TCGA-76-6280-01	TCGA-76-6280-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:84449185C>A	uc002fhx.2	+	7	701	c.612C>A	c.(610-612)ATC>ATA	p.I204I	ATP2C2_uc010chj.2_Silent_p.I204I|ATP2C2_uc002fhy.2_Silent_p.I221I|ATP2C2_uc002fhz.2_Silent_p.I53I	NM_014861	NP_055676	O75185	AT2C2_HUMAN	ATPase, Ca++ transporting, type 2C, member 2	204	Cytoplasmic (Potential).				ATP biosynthetic process	Golgi membrane|integral to membrane	ATP binding|calcium-transporting ATPase activity|metal ion binding|protein binding			breast(1)|central_nervous_system(1)	2						CTGCAGACATCCGACTCACTG	0.507													23	28	---	---	---	---	capture	Silent	SNP	84449185	84449185	ATP2C2	16	C	A	A	A	1	0	0	0	0	0	0	0	1	382	30	4	4	1135	277
TRPV2	51393	broad.mit.edu	37	17	16323552	16323552	+	Silent	SNP	G	A	A			TCGA-76-6280-01	TCGA-76-6280-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:16323552G>A	uc002gpy.2	+	3	691	c.324G>A	c.(322-324)TCG>TCA	p.S108S	TRPV2_uc002gpz.2_5'UTR	NM_016113	NP_057197	Q9Y5S1	TRPV2_HUMAN	transient receptor potential cation channel,	108	Cytoplasmic (Potential).|Required for interaction with SLC50A1 (By similarity).|ANK 1.				sensory perception	integral to plasma membrane|melanosome	calcium channel activity			ovary(1)	1				UCEC - Uterine corpus endometrioid carcinoma (92;0.0837)		TCACCGACTCGGAATACACAG	0.582													27	64	---	---	---	---	capture	Silent	SNP	16323552	16323552	TRPV2	17	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	16479	277
MAP2K3	5606	broad.mit.edu	37	17	21201792	21201792	+	Splice_Site	SNP	G	A	A			TCGA-76-6280-01	TCGA-76-6280-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:21201792G>A	uc002gys.2	+	2	381	c.116_splice	c.e2+1	p.T39_splice	MAP2K3_uc002gyt.2_Splice_Site_p.T10_splice|MAP2K3_uc002gyu.2_Splice_Site_p.T10_splice	NM_145109	NP_659731	P46734	MP2K3_HUMAN	mitogen-activated protein kinase kinase 3						activation of MAPK activity|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of transcription, DNA-dependent|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|MAP kinase kinase activity|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity				0				COAD - Colon adenocarcinoma(3;0.0131)|Colorectal(15;0.0553)		CCAACCCCACGTGAGTCTGCC	0.577													30	151	---	---	---	---	capture	Splice_Site	SNP	21201792	21201792	MAP2K3	17	G	A	A	A	1	0	0	0	0	0	0	1	0	520	40	5	1	9152	277
TMEM132E	124842	broad.mit.edu	37	17	32953325	32953325	+	Missense_Mutation	SNP	C	A	A			TCGA-76-6280-01	TCGA-76-6280-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:32953325C>A	uc002hif.2	+	2	575	c.247C>A	c.(247-249)CAG>AAG	p.Q83K		NM_207313	NP_997196	Q6IEE7	T132E_HUMAN	transmembrane protein 132E precursor	83	Extracellular (Potential).					integral to membrane				central_nervous_system(1)	1				BRCA - Breast invasive adenocarcinoma(366;0.231)		CGTGGTGTTCCAGACCAAGGA	0.697													10	14	---	---	---	---	capture	Missense_Mutation	SNP	32953325	32953325	TMEM132E	17	C	A	A	A	1	0	0	0	0	1	0	0	0	273	21	4	4	15932	277
MAPT	4137	broad.mit.edu	37	17	44067273	44067273	+	Silent	SNP	G	A	A			TCGA-76-6280-01	TCGA-76-6280-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:44067273G>A	uc002ijr.3	+	8	1532	c.1212G>A	c.(1210-1212)TTG>TTA	p.L404L	MAPT_uc010dau.2_Silent_p.L404L|MAPT_uc002ijs.3_Intron|MAPT_uc002ijx.3_Intron|MAPT_uc002ijt.3_Intron|MAPT_uc002iju.3_Intron|MAPT_uc002ijv.3_Intron	NM_016835	NP_058519	P10636	TAU_HUMAN	microtubule-associated protein tau isoform 1	404					cellular component disassembly involved in apoptosis|microtubule cytoskeleton organization|negative regulation of microtubule depolymerization|positive regulation of axon extension|positive regulation of microtubule polymerization|regulation of autophagy	axon|cytosol|growth cone|microtubule|microtubule associated complex|nuclear periphery|plasma membrane|tubulin complex	apolipoprotein E binding|enzyme binding|identical protein binding|lipoprotein particle binding|microtubule binding|protein binding|SH3 domain binding|structural constituent of cytoskeleton			pancreas(1)	1		Melanoma(429;0.216)				CTAAAACCTTGAAAAATAGGC	0.463													89	179	---	---	---	---	capture	Silent	SNP	44067273	44067273	MAPT	17	G	A	A	A	1	0	0	0	0	0	0	0	1	581	45	2	2	9210	277
KIF2B	84643	broad.mit.edu	37	17	51901778	51901778	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6280-01	TCGA-76-6280-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:51901778C>T	uc002iua.2	+	1	1540	c.1384C>T	c.(1384-1386)CGG>TGG	p.R462W	uc010wna.1_RNA	NM_032559	NP_115948	Q8N4N8	KIF2B_HUMAN	kinesin family member 2B	462	Kinesin-motor.				blood coagulation|cell division|microtubule depolymerization|microtubule-based movement|mitotic prometaphase|regulation of chromosome segregation	condensed chromosome kinetochore|cytosol|microtubule|microtubule organizing center|nucleolus|spindle	ATP binding|microtubule motor activity			ovary(5)|skin(3)	8						CAAGGCCAGCCGGAAAAGGCA	0.488													14	43	---	---	---	---	capture	Missense_Mutation	SNP	51901778	51901778	KIF2B	17	C	T	T	T	1	0	0	0	0	1	0	0	0	295	23	1	1	8220	277
CLTC	1213	broad.mit.edu	37	17	57738898	57738898	+	Missense_Mutation	SNP	T	C	C			TCGA-76-6280-01	TCGA-76-6280-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:57738898T>C	uc002ixq.1	+	8	1705	c.1262T>C	c.(1261-1263)CTT>CCT	p.L421P	CLTC_uc002ixp.2_Missense_Mutation_p.L421P|CLTC_uc002ixr.1_Missense_Mutation_p.L425P	NM_004859	NP_004850	Q00610	CLH1_HUMAN	clathrin heavy chain 1	421	Globular terminal domain.				axon guidance|epidermal growth factor receptor signaling pathway|intracellular protein transport|mitosis|negative regulation of epidermal growth factor receptor signaling pathway|nerve growth factor receptor signaling pathway|post-Golgi vesicle-mediated transport|receptor internalization|transferrin transport	clathrin coat of coated pit|clathrin coat of trans-Golgi network vesicle|cytosol|melanosome|spindle	protein binding|structural molecule activity		CLTC/ALK(44)|CLTC/TFE3(2)	haematopoietic_and_lymphoid_tissue(33)|soft_tissue(11)|kidney(2)|ovary(1)|breast(1)	48	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)					TTTGGTATCCTTTTGGACCAG	0.458			T	ALK|TFE3	ALCL|renal 								3	113	---	---	---	---	capture	Missense_Mutation	SNP	57738898	57738898	CLTC	17	T	C	C	C	1	0	0	0	0	1	0	0	0	728	56	3	3	3531	277
AANAT	15	broad.mit.edu	37	17	74465804	74465804	+	Missense_Mutation	SNP	G	A	A	rs72466447		TCGA-76-6280-01	TCGA-76-6280-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:74465804G>A	uc002jro.2	+	4	610	c.376G>A	c.(376-378)GTG>ATG	p.V126M	AANAT_uc010wte.1_RNA	NM_001088	NP_001079	Q16613	SNAT_HUMAN	arylalkylamine N-acetyltransferase	126	Acetyl-CoA binding (By similarity).|N-acetyltransferase.				circadian rhythm|melatonin biosynthetic process	cytosol	aralkylamine N-acetyltransferase activity				0						TGTGCTGGCCGTGCACCGCGC	0.692													6	8	---	---	---	---	capture	Missense_Mutation	SNP	74465804	74465804	AANAT	17	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	18	277
RAC3	5881	broad.mit.edu	37	17	79991354	79991354	+	Silent	SNP	C	T	T			TCGA-76-6280-01	TCGA-76-6280-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:79991354C>T	uc002kdf.2	+	5	433	c.327C>T	c.(325-327)CCC>CCT	p.P109P		NM_005052	NP_005043	P60763	RAC3_HUMAN	ras-related C3 botulinum toxin substrate 3 (rho	109					actin cytoskeleton organization|cell projection assembly|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|endomembrane system|filamentous actin|growth cone|lamellipodium|neuronal cell body|plasma membrane	GTP binding|GTPase activity|protein binding				0	all_neural(118;0.0878)|Ovarian(332;0.12)|all_lung(278;0.246)		BRCA - Breast invasive adenocarcinoma(99;0.0114)|OV - Ovarian serous cystadenocarcinoma(97;0.0191)			CCCACACGCCCATCCTCCTGG	0.672													15	28	---	---	---	---	capture	Silent	SNP	79991354	79991354	RAC3	17	C	T	T	T	1	0	0	0	0	0	0	0	1	262	21	2	2	12871	277
ADNP2	22850	broad.mit.edu	37	18	77893797	77893797	+	Nonsense_Mutation	SNP	C	G	G			TCGA-76-6280-01	TCGA-76-6280-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:77893797C>G	uc002lnw.2	+	4	956	c.501C>G	c.(499-501)TAC>TAG	p.Y167*		NM_014913	NP_055728	Q6IQ32	ADNP2_HUMAN	ADNP homeobox 2	167					cellular response to oxidative stress|cellular response to retinoic acid|negative regulation of cell death|neuron differentiation|positive regulation of cell growth	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(4)|breast(3)|central_nervous_system(1)	8		all_cancers(4;1.06e-15)|all_epithelial(4;2.36e-10)|all_lung(4;0.000302)|Lung NSC(4;0.000518)|Esophageal squamous(42;0.0212)|Ovarian(4;0.0256)|all_hematologic(56;0.15)|Melanoma(33;0.2)		Epithelial(2;1.1e-11)|OV - Ovarian serous cystadenocarcinoma(15;7.54e-09)|BRCA - Breast invasive adenocarcinoma(31;0.00247)|STAD - Stomach adenocarcinoma(84;0.164)		ACACTTTGTACTACAGCATGA	0.373													24	33	---	---	---	---	capture	Nonsense_Mutation	SNP	77893797	77893797	ADNP2	18	C	G	G	G	1	0	0	0	0	0	1	0	0	259	20	5	4	324	277
TJP3	27134	broad.mit.edu	37	19	3731941	3731941	+	Missense_Mutation	SNP	G	A	A	rs146857520		TCGA-76-6280-01	TCGA-76-6280-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:3731941G>A	uc010xhv.1	+	5	679	c.679G>A	c.(679-681)GTC>ATC	p.V227I	TJP3_uc010xhs.1_Missense_Mutation_p.V208I|TJP3_uc010xht.1_Missense_Mutation_p.V172I|TJP3_uc010xhu.1_Missense_Mutation_p.V217I|TJP3_uc010xhw.1_Missense_Mutation_p.V227I	NM_014428	NP_055243	O95049	ZO3_HUMAN	tight junction protein 3	208	PDZ 2.					tight junction	protein binding			ovary(1)|central_nervous_system(1)|skin(1)	3				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0118)|STAD - Stomach adenocarcinoma(1328;0.18)		AGAGTTTGGCGTCAAGCTGGG	0.592													8	31	---	---	---	---	capture	Missense_Mutation	SNP	3731941	3731941	TJP3	19	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	15816	277
C19orf62	29086	broad.mit.edu	37	19	17384818	17384818	+	Silent	SNP	C	T	T			TCGA-76-6280-01	TCGA-76-6280-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:17384818C>T	uc002nfu.2	+	4	568	c.450C>T	c.(448-450)AAC>AAT	p.N150N	C19orf62_uc010xpl.1_Intron|C19orf62_uc002nfv.2_Silent_p.N150N|C19orf62_uc010ean.2_RNA|C19orf62_uc002nfw.2_Silent_p.N150N	NM_014173	NP_054892	Q9NWV8	BABA1_HUMAN	mediator of Rap80 interactions and targeting 40	150	VWFA-like.				chromatin modification|double-strand break repair|G2/M transition DNA damage checkpoint|positive regulation of DNA repair|protein K63-linked deubiquitination|response to ionizing radiation	BRCA1-A complex|BRISC complex|cytoplasm	protein binding			ovary(1)|haematopoietic_and_lymphoid_tissue(1)	2						TGGTGGTGAACGATGACACGG	0.607													26	69	---	---	---	---	capture	Silent	SNP	17384818	17384818	C19orf62	19	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	1927	277
CILP2	148113	broad.mit.edu	37	19	19656132	19656132	+	Silent	SNP	C	G	G			TCGA-76-6280-01	TCGA-76-6280-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:19656132C>G	uc002nmv.3	+	8	2863	c.2778C>G	c.(2776-2778)CTC>CTG	p.L926L	CILP2_uc002nmw.3_Silent_p.L932L	NM_153221	NP_694953	Q8IUL8	CILP2_HUMAN	cartilage intermediate layer protein 2	926						proteinaceous extracellular matrix	carbohydrate binding|carboxypeptidase activity			ovary(1)	1						CTGGCGATCTCCTGGCCTGGT	0.647													20	23	---	---	---	---	capture	Silent	SNP	19656132	19656132	CILP2	19	C	G	G	G	1	0	0	0	0	0	0	0	1	379	30	4	4	3395	277
CD22	933	broad.mit.edu	37	19	35837131	35837131	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6280-01	TCGA-76-6280-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:35837131G>A	uc010edt.2	+	13	2482	c.2405G>A	c.(2404-2406)CGC>CAC	p.R802H	CD22_uc010xst.1_Missense_Mutation_p.R630H|CD22_uc010edu.2_Missense_Mutation_p.R714H|CD22_uc010edv.2_3'UTR|CD22_uc002nzb.3_Missense_Mutation_p.R625H|CD22_uc010edx.2_RNA	NM_001771	NP_001762	P20273	CD22_HUMAN	CD22 molecule precursor	802	Cytoplasmic (Potential).				cell adhesion		protein binding|sugar binding			ovary(5)|lung(3)|breast(1)	9	all_lung(56;9.78e-09)|Lung NSC(56;1.46e-08)|Esophageal squamous(110;0.162)		Epithelial(14;5.83e-19)|OV - Ovarian serous cystadenocarcinoma(14;3.19e-18)|all cancers(14;3.41e-16)|LUSC - Lung squamous cell carcinoma(66;0.0417)		OspA lipoprotein(DB00045)	TTGCACAAGCGCCAAGTGGTA	0.597													23	82	---	---	---	---	capture	Missense_Mutation	SNP	35837131	35837131	CD22	19	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	2956	277
ADCK4	79934	broad.mit.edu	37	19	41209757	41209757	+	Missense_Mutation	SNP	C	G	G			TCGA-76-6280-01	TCGA-76-6280-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:41209757C>G	uc002oor.2	-	8	882	c.580G>C	c.(580-582)GTT>CTT	p.V194L	ADCK4_uc002oop.1_5'Flank|ADCK4_uc002ooq.1_Missense_Mutation_p.V153L	NM_024876	NP_079152	Q96D53	ADCK4_HUMAN	aarF domain containing kinase 4 isoform a	194	Protein kinase.					integral to membrane	protein serine/threonine kinase activity				0			Lung(22;9.49e-05)|LUSC - Lung squamous cell carcinoma(20;0.000219)			tcttcaagaactctcTGCGGG	0.259													3	17	---	---	---	---	capture	Missense_Mutation	SNP	41209757	41209757	ADCK4	19	C	G	G	G	1	0	0	0	0	1	0	0	0	260	20	4	4	290	277
LILRA3	11026	broad.mit.edu	37	19	54800078	54800078	+	Nonsense_Mutation	SNP	G	A	A			TCGA-76-6280-01	TCGA-76-6280-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:54800078G>A	uc002qfd.2	-	7	1353	c.1288C>T	c.(1288-1290)CAA>TAA	p.Q430*	LILRA6_uc002qew.1_Intron|LILRA3_uc010erk.2_Nonsense_Mutation_p.Q366*	NM_006865	NP_006856	Q8N6C8	LIRA3_HUMAN	leukocyte immunoglobulin-like receptor,	430					defense response	extracellular region|plasma membrane	antigen binding|receptor activity			ovary(1)	1	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		GACTTGTTTTGTGGTGGGCTG	0.507													15	45	---	---	---	---	capture	Nonsense_Mutation	SNP	54800078	54800078	LILRA3	19	G	A	A	A	1	0	0	0	0	0	1	0	0	624	48	5	2	8706	277
SPAST	6683	broad.mit.edu	37	2	32366971	32366971	+	Splice_Site	SNP	A	T	T			TCGA-76-6280-01	TCGA-76-6280-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:32366971A>T	uc002roc.2	+	13	1715	c.1494_splice	c.e13-2	p.R498_splice	SPAST_uc002rod.2_Splice_Site_p.R466_splice	NM_014946	NP_055761	Q9UBP0	SPAST_HUMAN	spastin isoform 1						cell cycle|cell death|cell differentiation|cytokinesis, completion of separation|ER to Golgi vesicle-mediated transport|microtubule bundle formation|microtubule severing|nervous system development|protein hexamerization|protein homooligomerization	endoplasmic reticulum|endosome|integral to membrane|microtubule|microtubule organizing center|nucleus|perinuclear region of cytoplasm|spindle	alpha-tubulin binding|ATP binding|beta-tubulin binding|microtubule binding|microtubule-severing ATPase activity			breast(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.208)					TTTTTTTTTTAGGCGTTTCAT	0.279													3	32	---	---	---	---	capture	Splice_Site	SNP	32366971	32366971	SPAST	2	A	T	T	T	1	0	0	0	0	0	0	1	0	195	15	5	4	14889	277
POTEF	728378	broad.mit.edu	37	2	130878084	130878084	+	Missense_Mutation	SNP	A	C	C			TCGA-76-6280-01	TCGA-76-6280-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:130878084A>C	uc010fmh.2	-	3	405	c.5T>G	c.(4-6)GTG>GGG	p.V2G		NM_001099771	NP_001093241	A5A3E0	POTEF_HUMAN	prostate, ovary, testis expressed protein on	2						cell cortex	ATP binding			skin(3)|ovary(2)	5						AACCTCAACCACCATCTGCTT	0.532													8	100	---	---	---	---	capture	Missense_Mutation	SNP	130878084	130878084	POTEF	2	A	C	C	C	1	0	0	0	0	1	0	0	0	78	6	4	4	12166	277
PRPF40A	55660	broad.mit.edu	37	2	153514467	153514467	+	Missense_Mutation	SNP	T	C	C			TCGA-76-6280-01	TCGA-76-6280-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:153514467T>C	uc002tyh.3	-	25	2658	c.2636A>G	c.(2635-2637)GAC>GGC	p.D879G	PRPF40A_uc002tyg.3_Missense_Mutation_p.D335G|PRPF40A_uc010zcd.1_Missense_Mutation_p.D830G	NM_017892	NP_060362	O75400	PR40A_HUMAN	formin binding protein 3	906					mRNA processing|RNA splicing	nuclear matrix|nuclear speck	protein binding				0						TCTAGTTCTGTCTTTTTCACT	0.348													12	18	---	---	---	---	capture	Missense_Mutation	SNP	153514467	153514467	PRPF40A	2	T	C	C	C	1	0	0	0	0	1	0	0	0	754	58	3	3	12467	277
CASP10	843	broad.mit.edu	37	2	202074219	202074219	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6280-01	TCGA-76-6280-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:202074219G>A	uc002uxl.1	+	9	1767	c.1349G>A	c.(1348-1350)CGG>CAG	p.R450Q	CASP10_uc002uxj.1_Missense_Mutation_p.R450Q|CASP10_uc002uxk.1_Missense_Mutation_p.R407Q|CASP10_uc010fta.1_Missense_Mutation_p.R383Q|CASP10_uc002uxm.1_Missense_Mutation_p.R407Q|CASP10_uc010ftb.1_RNA	NM_032974	NP_116756	Q92851	CASPA_HUMAN	caspase 10 isoform b preproprotein	450					apoptosis|induction of apoptosis by extracellular signals|proteolysis	cytosol|plasma membrane	cysteine-type endopeptidase activity|identical protein binding|protein binding			skin(3)|ovary(1)|pancreas(1)|breast(1)	6						GTATCCTTTCGGCATGTGGAG	0.488													46	76	---	---	---	---	capture	Missense_Mutation	SNP	202074219	202074219	CASP10	2	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	2645	277
TPX2	22974	broad.mit.edu	37	20	30347914	30347914	+	Missense_Mutation	SNP	T	C	C			TCGA-76-6280-01	TCGA-76-6280-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:30347914T>C	uc002wwp.1	+	4	859	c.161T>C	c.(160-162)CTT>CCT	p.L54P	TPX2_uc010gdv.1_Missense_Mutation_p.L54P	NM_012112	NP_036244	Q9ULW0	TPX2_HUMAN	TPX2, microtubule-associated protein homolog	54					activation of protein kinase activity|apoptosis|cell division|cell proliferation|mitosis|regulation of mitotic spindle organization	cytoplasm|microtubule|nucleus|spindle pole	ATP binding|GTP binding|protein kinase binding			large_intestine(1)|ovary(1)	2			Epithelial(4;0.000771)|Colorectal(19;0.00306)|all cancers(5;0.004)|COAD - Colon adenocarcinoma(19;0.0347)|OV - Ovarian serous cystadenocarcinoma(3;0.0656)			ACTGGAGGGCTTTTTCAGGGC	0.413													3	93	---	---	---	---	capture	Missense_Mutation	SNP	30347914	30347914	TPX2	20	T	C	C	C	1	0	0	0	0	1	0	0	0	728	56	3	3	16315	277
NFATC2	4773	broad.mit.edu	37	20	50139989	50139989	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6280-01	TCGA-76-6280-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:50139989G>A	uc002xwd.2	-	2	1011	c.791C>T	c.(790-792)CCG>CTG	p.P264L	NFATC2_uc002xwc.2_Missense_Mutation_p.P264L|NFATC2_uc010zyv.1_Missense_Mutation_p.P45L|NFATC2_uc010zyw.1_Missense_Mutation_p.P45L|NFATC2_uc010zyx.1_Missense_Mutation_p.P244L|NFATC2_uc010zyy.1_Missense_Mutation_p.P45L|NFATC2_uc010zyz.1_Missense_Mutation_p.P45L|NFATC2_uc002xwe.2_Missense_Mutation_p.P244L	NM_173091	NP_775114	Q13469	NFAC2_HUMAN	nuclear factor of activated T-cells,	264	3 X approximate SP repeats.				B cell receptor signaling pathway|positive regulation of B cell proliferation|response to DNA damage stimulus|response to drug	actin cytoskeleton|nucleus|plasma membrane	protein binding|sequence-specific DNA binding transcription factor activity			ovary(2)	2	Hepatocellular(150;0.248)					GGCTCCGGGCGGCAGGGCAAC	0.751													14	39	---	---	---	---	capture	Missense_Mutation	SNP	50139989	50139989	NFATC2	20	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	10269	277
RPS21	6227	broad.mit.edu	37	20	60963374	60963374	+	Missense_Mutation	SNP	G	C	C			TCGA-76-6280-01	TCGA-76-6280-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:60963374G>C	uc002ycr.2	+	5	286	c.196G>C	c.(196-198)GAT>CAT	p.D66H	RPS21_uc002ycs.2_Missense_Mutation_p.D66H|RPS21_uc002yct.2_3'UTR|RPS21_uc002ycu.2_Missense_Mutation_p.D66H	NM_001024	NP_001015	P63220	RS21_HUMAN	ribosomal protein S21	66					endocrine pancreas development|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage to generate mature 3'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|translational elongation|translational termination|viral transcription	cytosolic small ribosomal subunit	protein N-terminus binding|structural constituent of ribosome				0	Breast(26;2.05e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)			GGGTGAGTCAGATGATTCCAT	0.507													12	35	---	---	---	---	capture	Missense_Mutation	SNP	60963374	60963374	RPS21	20	G	C	C	C	1	0	0	0	0	1	0	0	0	429	33	4	4	13525	277
TRIM71	131405	broad.mit.edu	37	3	32859711	32859711	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6280-01	TCGA-76-6280-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:32859711G>A	uc003cff.2	+	1	202	c.139G>A	c.(139-141)GGG>AGG	p.G47R		NM_001039111	NP_001034200	Q2Q1W2	LIN41_HUMAN	tripartite motif-containing 71	47	RING-type.				multicellular organismal development	cytoplasm	zinc ion binding			ovary(2)|large_intestine(1)	3						gggcggcggcgggggccctgg	0.502													5	7	---	---	---	---	capture	Missense_Mutation	SNP	32859711	32859711	TRIM71	3	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	16427	277
C3orf67	200844	broad.mit.edu	37	3	58870322	58870322	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6280-01	TCGA-76-6280-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:58870322G>A	uc003dkt.1	-	7	698	c.289C>T	c.(289-291)CGC>TGC	p.R97C	uc003dku.1_Intron|C3orf67_uc003dkv.1_5'UTR|C3orf67_uc003dkw.2_Missense_Mutation_p.R5C	NM_198463	NP_940865	Q6ZVT6	CC067_HUMAN	hypothetical protein LOC200844	97											0		all_cancers(2;0.000156)|all_epithelial(2;0.000493)|Breast(2;0.00446)|all_lung(2;0.074)|Lung NSC(2;0.248)		BRCA - Breast invasive adenocarcinoma(55;5.93e-06)|Kidney(10;0.00155)|KIRC - Kidney renal clear cell carcinoma(10;0.00172)|OV - Ovarian serous cystadenocarcinoma(275;0.23)		TCAGTTTGGCGAAGTTTAGTC	0.353													49	102	---	---	---	---	capture	Missense_Mutation	SNP	58870322	58870322	C3orf67	3	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	2221	277
ROBO2	6092	broad.mit.edu	37	3	77629222	77629222	+	Missense_Mutation	SNP	C	A	A			TCGA-76-6280-01	TCGA-76-6280-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:77629222C>A	uc003dpy.3	+	16	3096	c.2453C>A	c.(2452-2454)ACC>AAC	p.T818N	ROBO2_uc003dpz.2_Missense_Mutation_p.T822N|ROBO2_uc011bgj.1_RNA|ROBO2_uc011bgk.1_Missense_Mutation_p.T822N	NM_002942	NP_002933	Q9HCK4	ROBO2_HUMAN	roundabout, axon guidance receptor, homolog 2	818	Fibronectin type-III 3.|Extracellular (Potential).				apoptosis involved in luteolysis|axon midline choice point recognition|cellular response to hormone stimulus|homophilic cell adhesion|metanephros development|negative regulation of negative chemotaxis|negative regulation of synaptogenesis|olfactory bulb interneuron development|positive regulation of axonogenesis|retinal ganglion cell axon guidance|ureteric bud development	axolemma|cell surface|integral to membrane	axon guidance receptor activity|identical protein binding			lung(5)|skin(3)|ovary(1)|large_intestine(1)|liver(1)	11				Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)		GCAGCTAGTACCAGTGCAGGG	0.453													33	52	---	---	---	---	capture	Missense_Mutation	SNP	77629222	77629222	ROBO2	3	C	A	A	A	1	0	0	0	0	1	0	0	0	234	18	4	4	13406	277
OR5K4	403278	broad.mit.edu	37	3	98073062	98073062	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6280-01	TCGA-76-6280-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:98073062G>A	uc011bgv.1	+	1	365	c.365G>A	c.(364-366)CGC>CAC	p.R122H		NM_001005517	NP_001005517	A6NMS3	OR5K4_HUMAN	olfactory receptor, family 5, subfamily K,	122	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1						GCCTATGACCGCTATGTGGCC	0.473													82	56	---	---	---	---	capture	Missense_Mutation	SNP	98073062	98073062	OR5K4	3	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	11073	277
CCDC80	151887	broad.mit.edu	37	3	112356885	112356885	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6280-01	TCGA-76-6280-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:112356885C>T	uc003dzf.2	-	2	2086	c.1868G>A	c.(1867-1869)CGA>CAA	p.R623Q	CCDC80_uc011bhv.1_Missense_Mutation_p.R623Q|CCDC80_uc003dzg.2_Missense_Mutation_p.R623Q|CCDC80_uc003dzh.1_Missense_Mutation_p.R623Q	NM_199512	NP_955806	Q76M96	CCD80_HUMAN	steroid-sensitive protein 1 precursor	623										ovary(2)	2						AAGGAGTCTTCGTTTGCCTTC	0.463													4	89	---	---	---	---	capture	Missense_Mutation	SNP	112356885	112356885	CCDC80	3	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	2828	277
PLXND1	23129	broad.mit.edu	37	3	129297231	129297231	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6280-01	TCGA-76-6280-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:129297231C>T	uc003emx.2	-	9	2387	c.2287G>A	c.(2287-2289)GTG>ATG	p.V763M		NM_015103	NP_055918	Q9Y4D7	PLXD1_HUMAN	plexin D1 precursor	763	Extracellular (Potential).				axon guidance	integral to membrane|intracellular|plasma membrane				large_intestine(1)	1						CCCGTAGGCACGGGTGCCAGG	0.632													9	11	---	---	---	---	capture	Missense_Mutation	SNP	129297231	129297231	PLXND1	3	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	12030	277
UGT2B10	7365	broad.mit.edu	37	4	69874575	69874575	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6280-01	TCGA-76-6280-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:69874575G>A	uc011cao.1	-	8	1332	c.1196C>T	c.(1195-1197)TCA>TTA	p.S399L	UGT2B10_uc011can.1_Missense_Mutation_p.S315L			P36537	UDB10_HUMAN	RecName: Full=UDP-glucuronosyltransferase 2B28;          Short=UDPGT 2B28;          EC=2.4.1.17; Flags: Precursor;	436					lipid metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity			skin(3)|ovary(2)	5						TTCTACTCACGAAGGATCATT	0.368													42	78	---	---	---	---	capture	Missense_Mutation	SNP	69874575	69874575	UGT2B10	4	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	16838	277
NDST4	64579	broad.mit.edu	37	4	115891587	115891587	+	Missense_Mutation	SNP	A	G	G			TCGA-76-6280-01	TCGA-76-6280-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:115891587A>G	uc003ibu.2	-	4	1899	c.1220T>C	c.(1219-1221)CTG>CCG	p.L407P	NDST4_uc010imw.2_RNA	NM_022569	NP_072091	Q9H3R1	NDST4_HUMAN	heparan sulfate N-deacetylase/N-sulfotransferase	407	Lumenal (Potential).|Heparan sulfate N-deacetylase 4.					Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine N-sulfotransferase activity|hydrolase activity			skin(3)|ovary(1)	4		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000562)		TGTGCTCACCAGTGCAAATTC	0.383													8	13	---	---	---	---	capture	Missense_Mutation	SNP	115891587	115891587	NDST4	4	A	G	G	G	1	0	0	0	0	1	0	0	0	91	7	3	3	10165	277
HEATR7B2	133558	broad.mit.edu	37	5	41058293	41058293	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6280-01	TCGA-76-6280-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:41058293C>T	uc003jmj.3	-	7	1118	c.628G>A	c.(628-630)GTT>ATT	p.V210I	HEATR7B2_uc003jmi.3_5'UTR	NM_173489	NP_775760	Q7Z745	HTRB2_HUMAN	HEAT repeat family member 7B2	210							binding			ovary(6)|central_nervous_system(2)	8						TGGGCCTTAACGATGCTCAAA	0.512													7	19	---	---	---	---	capture	Missense_Mutation	SNP	41058293	41058293	HEATR7B2	5	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	6961	277
PKHD1	5314	broad.mit.edu	37	6	51491840	51491840	+	Nonsense_Mutation	SNP	G	A	A			TCGA-76-6280-01	TCGA-76-6280-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:51491840G>A	uc003pah.1	-	66	12016	c.11740C>T	c.(11740-11742)CGA>TGA	p.R3914*		NM_138694	NP_619639	P08F94	PKHD1_HUMAN	fibrocystin isoform 1	3914	Cytoplasmic (Potential).				cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity			lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44	Lung NSC(77;0.0605)					TGTGATTCTCGGCGTTTGGAT	0.438													72	79	---	---	---	---	capture	Nonsense_Mutation	SNP	51491840	51491840	PKHD1	6	G	A	A	A	1	0	0	0	0	0	1	0	0	506	39	5	1	11874	277
PKHD1	5314	broad.mit.edu	37	6	51918008	51918008	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6280-01	TCGA-76-6280-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:51918008C>T	uc003pah.1	-	21	2282	c.2006G>A	c.(2005-2007)CGT>CAT	p.R669H	PKHD1_uc003pai.2_Missense_Mutation_p.R669H	NM_138694	NP_619639	P08F94	PKHD1_HUMAN	fibrocystin isoform 1	669	Extracellular (Potential).				cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity			lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44	Lung NSC(77;0.0605)					CCCGAAGCAACGCACACAAGT	0.582													14	43	---	---	---	---	capture	Missense_Mutation	SNP	51918008	51918008	PKHD1	6	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	11874	277
PKHD1	5314	broad.mit.edu	37	6	51941107	51941107	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6280-01	TCGA-76-6280-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:51941107C>T	uc003pah.1	-	6	691	c.415G>A	c.(415-417)GTT>ATT	p.V139I	PKHD1_uc003pai.2_Missense_Mutation_p.V139I	NM_138694	NP_619639	P08F94	PKHD1_HUMAN	fibrocystin isoform 1	139	IPT/TIG 2.|Extracellular (Potential).				cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity			lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44	Lung NSC(77;0.0605)					ACTTGGTGAACGATGGGTGTC	0.393													12	21	---	---	---	---	capture	Missense_Mutation	SNP	51941107	51941107	PKHD1	6	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	11874	277
VGLL2	245806	broad.mit.edu	37	6	117589651	117589651	+	Nonsense_Mutation	SNP	C	T	T			TCGA-76-6280-01	TCGA-76-6280-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:117589651C>T	uc003pxn.2	+	2	578	c.388C>T	c.(388-390)CGA>TGA	p.R130*	VGLL2_uc003pxo.2_Nonsense_Mutation_p.R130*	NM_182645	NP_872586	Q8N8G2	VGLL2_HUMAN	vestigial-like 2 isoform 1	130					transcription, DNA-dependent	nucleus				central_nervous_system(1)	1				GBM - Glioblastoma multiforme(226;0.0254)|all cancers(137;0.0676)|OV - Ovarian serous cystadenocarcinoma(136;0.0757)		TGGGCCCTGGCGAGGTGAGTA	0.567													7	5	---	---	---	---	capture	Nonsense_Mutation	SNP	117589651	117589651	VGLL2	6	C	T	T	T	1	0	0	0	0	0	1	0	0	347	27	5	1	17041	277
IGF2R	3482	broad.mit.edu	37	6	160506085	160506085	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6280-01	TCGA-76-6280-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:160506085G>A	uc003qta.2	+	41	6275	c.6127G>A	c.(6127-6129)GCC>ACC	p.A2043T		NM_000876	NP_000867	P11717	MPRI_HUMAN	insulin-like growth factor 2 receptor precursor	2043	14.|Lumenal (Potential).				receptor-mediated endocytosis	cell surface|endocytic vesicle|endosome|integral to plasma membrane|lysosomal membrane|trans-Golgi network transport vesicle	glycoprotein binding|insulin-like growth factor receptor activity|phosphoprotein binding|transporter activity			ovary(3)	3		Breast(66;0.000777)|Ovarian(120;0.0305)		OV - Ovarian serous cystadenocarcinoma(65;2.45e-17)|BRCA - Breast invasive adenocarcinoma(81;1.09e-05)		CTCTGAAAGGGCCAGCATTTG	0.517													14	32	---	---	---	---	capture	Missense_Mutation	SNP	160506085	160506085	IGF2R	6	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	7501	277
ZPBP	11055	broad.mit.edu	37	7	50097612	50097612	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6280-01	TCGA-76-6280-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:50097612G>A	uc003tou.2	-	4	530	c.460C>T	c.(460-462)CGT>TGT	p.R154C	ZPBP_uc011kci.1_Missense_Mutation_p.R80C|ZPBP_uc010kyw.2_Missense_Mutation_p.R153C	NM_007009	NP_008940	Q9BS86	ZPBP1_HUMAN	zona pellucida binding protein isoform 1	154					binding of sperm to zona pellucida	extracellular region					0	Glioma(55;0.08)|all_neural(89;0.245)					AGTTGAAGACGTTTAACAATT	0.294													15	59	---	---	---	---	capture	Missense_Mutation	SNP	50097612	50097612	ZPBP	7	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	18095	277
NRCAM	4897	broad.mit.edu	37	7	107880546	107880546	+	Translation_Start_Site	SNP	C	A	A			TCGA-76-6280-01	TCGA-76-6280-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:107880546C>A	uc003vfb.2	-	4	434	c.-37G>T	c.(-39--35)AAGGA>AATGA		NRCAM_uc003vfc.2_Translation_Start_Site|NRCAM_uc011kmk.1_Translation_Start_Site|NRCAM_uc003vfd.2_Translation_Start_Site|NRCAM_uc003vfe.2_Translation_Start_Site	NM_001037132	NP_001032209	Q92823	NRCAM_HUMAN	neuronal cell adhesion molecule isoform A						angiogenesis|axon guidance|axonal fasciculation|cell-cell adhesion|central nervous system development|clustering of voltage-gated sodium channels|neuron migration|positive regulation of neuron differentiation|regulation of axon extension|synapse assembly	external side of plasma membrane|integral to plasma membrane	ankyrin binding			ovary(3)|breast(2)	5						ACTGAATTTCCTTTTCTTCTT	0.383													4	103	---	---	---	---	capture	Translation_Start_Site	SNP	107880546	107880546	NRCAM	7	C	A	A	A	1	0	0	0	0	0	0	0	0	300	24	4	4	10551	277
GRM8	2918	broad.mit.edu	37	7	126173900	126173900	+	Silent	SNP	C	T	T			TCGA-76-6280-01	TCGA-76-6280-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:126173900C>T	uc003vlr.2	-	8	1847	c.1536G>A	c.(1534-1536)CCG>CCA	p.P512P	GRM8_uc003vls.2_RNA|GRM8_uc011kof.1_RNA|GRM8_uc003vlt.2_Silent_p.P512P|GRM8_uc010lkz.1_RNA	NM_000845	NP_000836	O00222	GRM8_HUMAN	glutamate receptor, metabotropic 8 isoform a	512	Extracellular (Potential).				negative regulation of cAMP biosynthetic process|sensory perception of smell|visual perception	integral to plasma membrane				lung(15)|ovary(5)|pancreas(1)|breast(1)|skin(1)	23		Prostate(267;0.186)			L-Glutamic Acid(DB00142)	AGACAGACGCCGGGTGAGTAT	0.488										HNSCC(24;0.065)			30	86	---	---	---	---	capture	Silent	SNP	126173900	126173900	GRM8	7	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	6736	277
CNTNAP2	26047	broad.mit.edu	37	7	147183114	147183114	+	Missense_Mutation	SNP	T	G	G			TCGA-76-6280-01	TCGA-76-6280-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:147183114T>G	uc003weu.1	+	11	2274	c.1758T>G	c.(1756-1758)AGT>AGG	p.S586R		NM_014141	NP_054860	Q9UHC6	CNTP2_HUMAN	cell recognition molecule Caspr2 precursor	586	EGF-like 1.|Extracellular (Potential).				behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding			ovary(9)|central_nervous_system(1)|pancreas(1)	11	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			CAGGATACAGTGGGGCCACCT	0.468										HNSCC(39;0.1)			9	81	---	---	---	---	capture	Missense_Mutation	SNP	147183114	147183114	CNTNAP2	7	T	G	G	G	1	0	0	0	0	1	0	0	0	764	59	4	4	3612	277
SPTAN1	6709	broad.mit.edu	37	9	131381157	131381157	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6280-01	TCGA-76-6280-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:131381157C>T	uc004bvl.3	+	43	5706	c.5593C>T	c.(5593-5595)CGG>TGG	p.R1865W	SPTAN1_uc004bvm.3_Missense_Mutation_p.R1870W|SPTAN1_uc004bvn.3_Missense_Mutation_p.R1845W	NM_003127	NP_003118	Q13813	SPTA2_HUMAN	spectrin, alpha, non-erythrocytic 1	1865	Spectrin 19.				actin filament capping|axon guidance|cellular component disassembly involved in apoptosis	cytosol|intracellular membrane-bounded organelle|membrane fraction|microtubule cytoskeleton|spectrin	actin binding|calcium ion binding|calmodulin binding|structural constituent of cytoskeleton			breast(5)|ovary(4)|pancreas(1)	10						TAGGGGTCAGCGGCTGGAAGA	0.423													55	91	---	---	---	---	capture	Missense_Mutation	SNP	131381157	131381157	SPTAN1	9	C	T	T	T	1	0	0	0	0	1	0	0	0	347	27	1	1	15009	277
CACNA1B	774	broad.mit.edu	37	9	140777224	140777224	+	Missense_Mutation	SNP	T	C	C			TCGA-76-6280-01	TCGA-76-6280-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:140777224T>C	uc004cog.2	+	3	564	c.419T>C	c.(418-420)ATC>ACC	p.I140T	uc004cof.1_Intron	NM_000718	NP_000709	Q00975	CAC1B_HUMAN	calcium channel, voltage-dependent, N type,	140	I.|Helical; Name=S2 of repeat I; (Potential).				membrane depolarization|synaptic transmission	voltage-gated calcium channel complex	ATP binding|protein C-terminus binding|voltage-gated calcium channel activity			breast(3)|large_intestine(2)|ovary(1)	6	all_cancers(76;0.166)			OV - Ovarian serous cystadenocarcinoma(145;1.16e-05)|Epithelial(140;0.000476)	Amlodipine(DB00381)|Gabapentin(DB00996)	TTCATCGGGATCTTTTGCTTC	0.572													34	119	---	---	---	---	capture	Missense_Mutation	SNP	140777224	140777224	CACNA1B	9	T	C	C	C	1	0	0	0	0	1	0	0	0	650	50	3	3	2515	277
PRB2	653247	broad.mit.edu	37	12	11546506	11546508	+	In_Frame_Del	DEL	TTG	-	-			TCGA-76-6280-01	TCGA-76-6280-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:11546506_11546508delTTG	uc010shk.1	-	3	539_541	c.504_506delCAA	c.(502-507)AACAAG>AAG	p.N168del		NM_006248	NP_006239			proline-rich protein BstNI subfamily 2												0		all_cancers(2;0.00558)|Acute lymphoblastic leukemia(2;3.94e-11)|all_hematologic(2;3.6e-09)	OV - Ovarian serous cystadenocarcinoma(49;0.185)			ACTTCGGGACTTGTTGTCTCCTT	0.596													7	619	---	---	---	---	capture_indel	In_Frame_Del	DEL	11546506	11546508	PRB2	12	TTG	-	-	-	1	0	1	0	1	0	0	0	0	728	56	5	5	12339	277
SACS	26278	broad.mit.edu	37	13	23914687	23914687	+	Frame_Shift_Del	DEL	T	-	-			TCGA-76-6280-01	TCGA-76-6280-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:23914687delT	uc001uon.2	-	10	3917	c.3328delA	c.(3328-3330)ATTfs	p.I1110fs	SACS_uc001uoo.2_Frame_Shift_Del_p.I963fs|SACS_uc001uop.1_Intron|SACS_uc001uoq.1_Intron	NM_014363	NP_055178	Q9NZJ4	SACS_HUMAN	sacsin	1110					cell death|negative regulation of inclusion body assembly|protein folding	axon|cell body fiber|dendrite|mitochondrion|nucleus	ATP binding|chaperone binding|Hsp70 protein binding|proteasome binding			ovary(7)|skin(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	12		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		AAGGCTTCAATTTTTTTTGCC	0.383													8	290	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	23914687	23914687	SACS	13	T	-	-	-	1	0	1	0	1	0	0	0	0	676	52	5	5	13696	277
ZNF700	90592	broad.mit.edu	37	19	12059987	12059988	+	Frame_Shift_Del	DEL	CT	-	-			TCGA-76-6280-01	TCGA-76-6280-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:12059987_12059988delCT	uc002msu.2	+	4	1274_1275	c.1148_1149delCT	c.(1147-1149)ACTfs	p.T383fs	ZNF700_uc010xme.1_Frame_Shift_Del_p.T401fs|ZNF763_uc010xmf.1_Intron	NM_144566	NP_653167	Q9H0M5	ZN700_HUMAN	zinc finger protein 700	383	C2H2-type 6.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						CATGAAAAAACTCACACTGGAG	0.371													22	74	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	12059987	12059988	ZNF700	19	CT	-	-	-	1	0	1	0	1	0	0	0	0	260	20	5	5	17982	277
VPS8	23355	broad.mit.edu	37	3	184552450	184552450	+	Frame_Shift_Del	DEL	C	-	-			TCGA-76-6280-01	TCGA-76-6280-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:184552450delC	uc003fpb.1	+	5	538	c.367delC	c.(367-369)CCTfs	p.P123fs	VPS8_uc010hyd.1_Frame_Shift_Del_p.P123fs|VPS8_uc003fpc.1_Frame_Shift_Del_p.P123fs	NM_015303	NP_056118	Q8N3P4	VPS8_HUMAN	vacuolar protein sorting 8 homolog isoform b	123							zinc ion binding			ovary(1)	1	all_cancers(143;2.51e-11)|Ovarian(172;0.0339)|Breast(254;0.247)		Epithelial(37;1.02e-33)|OV - Ovarian serous cystadenocarcinoma(80;4.81e-22)			GAAGAAATTACCTGATTCTTT	0.343													2	4	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	184552450	184552450	VPS8	3	C	-	-	-	1	0	1	0	1	0	0	0	0	234	18	5	5	17100	277
PIK3R1	5295	broad.mit.edu	37	5	67589634	67589635	+	In_Frame_Ins	INS	-	ATATGAAGA	ATATGAAGA			TCGA-76-6280-01	TCGA-76-6280-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:67589634_67589635insATATGAAGA	uc003jva.2	+	11	1957_1958	c.1397_1398insATATGAAGA	c.(1396-1398)TTA>TTATATGAAGAA	p.469_470insYEE	PIK3R1_uc003jvb.2_In_Frame_Ins_p.469_470insYEE|PIK3R1_uc003jvc.2_In_Frame_Ins_p.169_170insYEE|PIK3R1_uc003jvd.2_In_Frame_Ins_p.199_200insYEE|PIK3R1_uc003jve.2_In_Frame_Ins_p.148_149insYEE|PIK3R1_uc011crb.1_In_Frame_Ins_p.139_140insYEE	NM_181523	NP_852664	P27986	P85A_HUMAN	phosphoinositide-3-kinase, regulatory subunit 1	469_470					epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|growth hormone receptor signaling pathway|insulin receptor signaling pathway|insulin-like growth factor receptor signaling pathway|interspecies interaction between organisms|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol 3-kinase cascade|phosphatidylinositol phosphorylation|phosphatidylinositol-mediated signaling|platelet activation|positive regulation of establishment of protein localization in plasma membrane|positive regulation of glucose import|T cell costimulation|T cell receptor signaling pathway	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex	1-phosphatidylinositol binding|ErbB-3 class receptor binding|insulin binding|insulin receptor binding|insulin receptor substrate binding|insulin-like growth factor receptor binding|phosphatidylinositol 3-kinase regulator activity|protein phosphatase binding	p.D434_Q475del(2)|p.Y463_L466del(1)|p.?(1)		endometrium(34)|central_nervous_system(27)|large_intestine(20)|breast(7)|ovary(5)|haematopoietic_and_lymphoid_tissue(3)|lung(2)|urinary_tract(1)|skin(1)|pancreas(1)	101		Lung NSC(167;1.99e-05)|Prostate(74;0.00308)|Ovarian(174;0.00473)|Colorectal(97;0.0176)		OV - Ovarian serous cystadenocarcinoma(47;3.76e-51)|Lung(70;0.0211)	Isoproterenol(DB01064)	TATGATAGATTATATGAAGAAT	0.287			Mis|F|O		gliobastoma|ovarian|colorectal					TCGA GBM(4;<1E-08)			10	38	---	---	---	---	capture_indel	In_Frame_Ins	INS	67589634	67589635	PIK3R1	5	-	ATATGAAGA	ATATGAAGA	ATATGAAGA	1	0	1	1	0	0	0	0	0	793	61	5	5	11821	277
