Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
AADACL3	126767	broad.mit.edu	37	1	12785683	12785683	+	Missense_Mutation	SNP	T	C	C			TCGA-76-6282-01	TCGA-76-6282-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:12785683T>C	uc009vnn.1	+	4	1006	c.773T>C	c.(772-774)GTA>GCA	p.V258A	AADACL3_uc001aug.1_Missense_Mutation_p.V188A	NM_001103170	NP_001096640	Q5VUY0	ADCL3_HUMAN	arylacetamide deacetylase-like 3 isoform 1	258							hydrolase activity				0	Ovarian(185;0.249)	Lung NSC(185;8.27e-05)|all_lung(284;9.47e-05)|Renal(390;0.000147)|Colorectal(325;0.000583)|Breast(348;0.000596)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.13e-06)|COAD - Colon adenocarcinoma(227;0.000274)|BRCA - Breast invasive adenocarcinoma(304;0.000311)|Kidney(185;0.00217)|KIRC - Kidney renal clear cell carcinoma(229;0.00579)|STAD - Stomach adenocarcinoma(313;0.00743)|READ - Rectum adenocarcinoma(331;0.0649)		TACTTGGAAGTAAGTGTTGTC	0.502													34	70	---	---	---	---	capture	Missense_Mutation	SNP	12785683	12785683	AADACL3	1	T	C	C	C	1	0	0	0	0	1	0	0	0	741	57	3	3	12	278
C1orf129	80133	broad.mit.edu	37	1	170964598	170964598	+	Silent	SNP	C	T	T			TCGA-76-6282-01	TCGA-76-6282-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:170964598C>T	uc001ghg.2	+	13	1393	c.1263C>T	c.(1261-1263)CCC>CCT	p.P421P	C1orf129_uc009wvy.2_Silent_p.P228P|C1orf129_uc010plz.1_Silent_p.P421P	NM_025063	NP_079339	Q5TGP6	CA129_HUMAN	hypothetical protein LOC80133 isoform 2	421							binding			pancreas(1)	1	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					AGTATTTCCCCCAGCTCTTGA	0.473													29	63	---	---	---	---	capture	Silent	SNP	170964598	170964598	C1orf129	1	C	T	T	T	1	0	0	0	0	0	0	0	1	275	22	2	2	1978	278
OR52B4	143496	broad.mit.edu	37	11	4389252	4389252	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6282-01	TCGA-76-6282-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:4389252C>T	uc010qye.1	-	1	274	c.274G>A	c.(274-276)GGG>AGG	p.G92R		NM_001005161	NP_001005161	Q8NGK2	O52B4_HUMAN	olfactory receptor, family 52, subfamily B,	92	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0		Medulloblastoma(188;0.0075)|Breast(177;0.0249)|all_neural(188;0.0577)		Epithelial(150;1.57e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0826)|LUSC - Lung squamous cell carcinoma(625;0.19)		GAGATGTCCCCAGCACGGAAC	0.527													8	39	---	---	---	---	capture	Missense_Mutation	SNP	4389252	4389252	OR52B4	11	C	T	T	T	1	0	0	0	0	1	0	0	0	273	21	2	2	11016	278
ANO5	203859	broad.mit.edu	37	11	22296134	22296134	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6282-01	TCGA-76-6282-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:22296134C>T	uc001mqi.2	+	20	2572	c.2255C>T	c.(2254-2256)ACG>ATG	p.T752M	ANO5_uc001mqj.2_Missense_Mutation_p.T751M	NM_213599	NP_998764	Q75V66	ANO5_HUMAN	anoctamin 5 isoform a	752	Helical; (Potential).					chloride channel complex|endoplasmic reticulum membrane	chloride channel activity			central_nervous_system(3)|ovary(1)	4						GTTGCATTTACGTCAGACATC	0.363													21	89	---	---	---	---	capture	Missense_Mutation	SNP	22296134	22296134	ANO5	11	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	694	278
OR8K3	219473	broad.mit.edu	37	11	56085826	56085826	+	Missense_Mutation	SNP	C	T	T	rs149952066		TCGA-76-6282-01	TCGA-76-6282-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:56085826C>T	uc010rjf.1	+	1	44	c.44C>T	c.(43-45)ACG>ATG	p.T15M		NM_001005202	NP_001005202	Q8NH51	OR8K3_HUMAN	olfactory receptor, family 8, subfamily K,	15	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|large_intestine(1)|central_nervous_system(1)	4	Esophageal squamous(21;0.00448)					TTCATTCTTACGGGAATCACA	0.423													27	90	---	---	---	---	capture	Missense_Mutation	SNP	56085826	56085826	OR8K3	11	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	11148	278
MS4A12	54860	broad.mit.edu	37	11	60264794	60264794	+	Missense_Mutation	SNP	G	C	C			TCGA-76-6282-01	TCGA-76-6282-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:60264794G>C	uc001npr.2	+	2	60	c.3G>C	c.(1-3)ATG>ATC	p.M1I	MS4A12_uc009ynb.2_Missense_Mutation_p.M1I	NM_017716	NP_060186	Q9NXJ0	M4A12_HUMAN	membrane-spanning 4-domains, subfamily A, member	1	Cytoplasmic (Potential).					integral to membrane	receptor activity				0						AGGACATAATGATGTCATCCA	0.383													32	84	---	---	---	---	capture	Missense_Mutation	SNP	60264794	60264794	MS4A12	11	G	C	C	C	1	0	0	0	0	1	0	0	0	585	45	4	4	9766	278
PANX1	24145	broad.mit.edu	37	11	93911644	93911644	+	Missense_Mutation	SNP	A	T	T			TCGA-76-6282-01	TCGA-76-6282-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:93911644A>T	uc001per.2	+	3	816	c.431A>T	c.(430-432)GAA>GTA	p.E144V	PANX1_uc001peq.2_Missense_Mutation_p.E144V	NM_015368	NP_056183	Q96RD7	PANX1_HUMAN	pannexin 1	144	Cytoplasmic (Potential).				positive regulation of interleukin-1 beta secretion|protein hexamerization|synaptic transmission	bleb|endoplasmic reticulum membrane|gap junction|integral to membrane	calcium channel activity|gap junction hemi-channel activity|leak channel activity|receptor binding				0		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				TTTATCATGGAAGAACTTGAC	0.502													4	56	---	---	---	---	capture	Missense_Mutation	SNP	93911644	93911644	PANX1	11	A	T	T	T	1	0	0	0	0	1	0	0	0	117	9	4	4	11324	278
UBE4A	9354	broad.mit.edu	37	11	118255613	118255613	+	Missense_Mutation	SNP	A	T	T			TCGA-76-6282-01	TCGA-76-6282-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:118255613A>T	uc001psw.2	+	15	2494	c.2365A>T	c.(2365-2367)AAC>TAC	p.N789Y	UBE4A_uc001psv.2_Missense_Mutation_p.N796Y	NM_004788	NP_004779	Q14139	UBE4A_HUMAN	ubiquitination factor E4A	789					ubiquitin-dependent protein catabolic process	ubiquitin ligase complex	protein binding			ovary(2)|upper_aerodigestive_tract(1)|breast(1)|kidney(1)	5	all_hematologic(175;0.046)	Medulloblastoma(222;0.0425)|Breast(348;0.181)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.28e-05)		CCGCTTTCTTAACCTGCTAAT	0.373													30	104	---	---	---	---	capture	Missense_Mutation	SNP	118255613	118255613	UBE4A	11	A	T	T	T	1	0	0	0	0	1	0	0	0	169	13	4	4	16764	278
ITPR2	3709	broad.mit.edu	37	12	26868282	26868282	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6282-01	TCGA-76-6282-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:26868282G>A	uc001rhg.2	-	8	1222	c.805C>T	c.(805-807)CGC>TGC	p.R269C		NM_002223	NP_002214	Q14571	ITPR2_HUMAN	inositol 1,4,5-triphosphate receptor, type 2	269	Cytoplasmic (Potential).|MIR 3.|Inositol-1,4,5-triphosphate binding (By similarity).				activation of phospholipase C activity|energy reserve metabolic process|nerve growth factor receptor signaling pathway|platelet activation|regulation of insulin secretion|response to hypoxia	integral to membrane|plasma membrane enriched fraction|platelet dense tubular network membrane|sarcoplasmic reticulum membrane	calcium ion transmembrane transporter activity|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity			kidney(6)|ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)	14	Colorectal(261;0.0847)					GCTGATTGGCGCAAGGTCGTA	0.363													48	94	---	---	---	---	capture	Missense_Mutation	SNP	26868282	26868282	ITPR2	12	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	7844	278
MTUS2	23281	broad.mit.edu	37	13	29600584	29600584	+	Silent	SNP	G	A	A			TCGA-76-6282-01	TCGA-76-6282-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:29600584G>A	uc001usl.3	+	1	1837	c.1779G>A	c.(1777-1779)ACG>ACA	p.T593T		NM_001033602	NP_001028774	Q5JR59	MTUS2_HUMAN	hypothetical protein LOC23281 isoform a	583						cytoplasm|microtubule	microtubule binding|protein homodimerization activity				0						TGTTGAACACGTCCCCCAAAG	0.552													20	58	---	---	---	---	capture	Silent	SNP	29600584	29600584	MTUS2	13	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	9876	278
OTX2	5015	broad.mit.edu	37	14	57269020	57269020	+	Missense_Mutation	SNP	C	A	A			TCGA-76-6282-01	TCGA-76-6282-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:57269020C>A	uc001xcp.2	-	3	474	c.303G>T	c.(301-303)CAG>CAT	p.Q101H	OTX2_uc010aou.2_Missense_Mutation_p.Q101H|OTX2_uc001xcq.2_Missense_Mutation_p.Q109H	NM_172337	NP_758840	P32243	OTX2_HUMAN	orthodenticle homeobox 2 isoform b	101	Poly-Gln.				axon guidance|forebrain development|midbrain development|positive regulation of embryonic development|positive regulation of gastrulation|primitive streak formation|protein complex assembly|regulation of fibroblast growth factor receptor signaling pathway|regulation of smoothened signaling pathway	growth cone|nucleus|protein complex	eukaryotic initiation factor 4E binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription|sequence-specific DNA binding			ovary(1)	1	Medulloblastoma(1;0.00184)|all_neural(1;0.00414)					GACCTCCATTCTGCTGTTGTT	0.448													41	78	---	---	---	---	capture	Missense_Mutation	SNP	57269020	57269020	OTX2	14	C	A	A	A	1	0	0	0	0	1	0	0	0	415	32	4	4	11225	278
VPS18	57617	broad.mit.edu	37	15	41193044	41193044	+	Silent	SNP	G	A	A			TCGA-76-6282-01	TCGA-76-6282-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:41193044G>A	uc001zne.2	+	4	2367	c.2028G>A	c.(2026-2028)CCG>CCA	p.P676P		NM_020857	NP_065908	Q9P253	VPS18_HUMAN	vacuolar protein sorting 18	676	Clathrin.				endosome organization|lysosome organization|protein transport	HOPS complex|late endosome membrane|lysosomal membrane	metal ion binding|protein binding			ovary(2)|large_intestine(1)	3		all_cancers(109;1.35e-17)|all_epithelial(112;3.78e-15)|Lung NSC(122;9.68e-11)|all_lung(180;2.25e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;1.07e-05)|COAD - Colon adenocarcinoma(120;0.15)|BRCA - Breast invasive adenocarcinoma(123;0.164)		GTGGCCGGCCGGACTCACTAC	0.647													18	49	---	---	---	---	capture	Silent	SNP	41193044	41193044	VPS18	15	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	17076	278
SLC27A2	11001	broad.mit.edu	37	15	50475097	50475097	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6282-01	TCGA-76-6282-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:50475097C>T	uc001zxw.2	+	1	705	c.473C>T	c.(472-474)TCG>TTG	p.S158L	SLC27A2_uc010bes.2_Missense_Mutation_p.S158L	NM_003645	NP_003636	O14975	S27A2_HUMAN	solute carrier family 27 (fatty acid	158	Lumenal (Potential).				bile acid biosynthetic process|fatty acid alpha-oxidation	endoplasmic reticulum membrane|integral to membrane|peroxisomal matrix|peroxisomal membrane	ATP binding|long-chain fatty acid-CoA ligase activity|phytanate-CoA ligase activity|pristanate-CoA ligase activity			ovary(1)|skin(1)	2		all_lung(180;0.00177)		all cancers(107;1.16e-06)|GBM - Glioblastoma multiforme(94;0.000113)		CTGCTGGTGTCGCCAGGTGAG	0.652													46	78	---	---	---	---	capture	Missense_Mutation	SNP	50475097	50475097	SLC27A2	15	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	14418	278
TARSL2	123283	broad.mit.edu	37	15	102242566	102242566	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6282-01	TCGA-76-6282-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:102242566C>T	uc002bxm.2	-	9	1152	c.1097G>A	c.(1096-1098)GGC>GAC	p.G366D	TARSL2_uc002bxl.2_5'UTR|TARSL2_uc010usi.1_RNA	NM_152334	NP_689547	A2RTX5	SYTC2_HUMAN	threonyl-tRNA synthetase-like 2	366					threonyl-tRNA aminoacylation	cytoplasm	ATP binding|threonine-tRNA ligase activity			ovary(2)	2	Lung NSC(78;0.000991)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.000268)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			TTCCGGATTGCCCTCCCAATA	0.353													3	73	---	---	---	---	capture	Missense_Mutation	SNP	102242566	102242566	TARSL2	15	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	15449	278
MSLNL	401827	broad.mit.edu	37	16	830269	830269	+	Silent	SNP	G	A	A			TCGA-76-6282-01	TCGA-76-6282-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:830269G>A	uc002cjz.1	-	3	732	c.732C>T	c.(730-732)TCC>TCT	p.S244S		NM_001025190	NP_001020361	Q96KJ4	MSLNL_HUMAN	mesothelin-like	Error:Variant_position_missing_in_Q96KJ4_after_alignment					cell adhesion	integral to membrane				breast(3)|ovary(1)	4						TGAGGCCAGAGGACATGGAGG	0.677													3	14	---	---	---	---	capture	Silent	SNP	830269	830269	MSLNL	16	G	A	A	A	1	0	0	0	0	0	0	0	1	444	35	2	2	9792	278
SRRM2	23524	broad.mit.edu	37	16	2812977	2812977	+	Silent	SNP	C	T	T			TCGA-76-6282-01	TCGA-76-6282-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:2812977C>T	uc002crk.2	+	11	2997	c.2448C>T	c.(2446-2448)CGC>CGT	p.R816R	SRRM2_uc002crj.1_Silent_p.R720R|SRRM2_uc002crl.1_Silent_p.R816R|SRRM2_uc010bsu.1_Silent_p.R720R	NM_016333	NP_057417	Q9UQ35	SRRM2_HUMAN	splicing coactivator subunit SRm300	816	Arg-rich.|Ser-rich.					Cajal body|catalytic step 2 spliceosome|nuclear speck	C2H2 zinc finger domain binding|protein N-terminus binding|RNA binding			ovary(1)|pancreas(1)|central_nervous_system(1)|skin(1)	4						GACGCAGTCGCTCCAGTTCTT	0.498													101	255	---	---	---	---	capture	Silent	SNP	2812977	2812977	SRRM2	16	C	T	T	T	1	0	0	0	0	0	0	0	1	353	28	2	2	15061	278
SRRM2	23524	broad.mit.edu	37	16	2813966	2813966	+	Missense_Mutation	SNP	C	G	G			TCGA-76-6282-01	TCGA-76-6282-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:2813966C>G	uc002crk.2	+	11	3986	c.3437C>G	c.(3436-3438)CCT>CGT	p.P1146R	SRRM2_uc002crj.1_Missense_Mutation_p.P1050R|SRRM2_uc002crl.1_Missense_Mutation_p.P1146R|SRRM2_uc010bsu.1_Missense_Mutation_p.P1050R	NM_016333	NP_057417	Q9UQ35	SRRM2_HUMAN	splicing coactivator subunit SRm300	1146	Ser-rich.					Cajal body|catalytic step 2 spliceosome|nuclear speck	C2H2 zinc finger domain binding|protein N-terminus binding|RNA binding			ovary(1)|pancreas(1)|central_nervous_system(1)|skin(1)	4						TCTTCATATCCTACAGTGGAC	0.468													34	67	---	---	---	---	capture	Missense_Mutation	SNP	2813966	2813966	SRRM2	16	C	G	G	G	1	0	0	0	0	1	0	0	0	312	24	4	4	15061	278
GRIN2A	2903	broad.mit.edu	37	16	9857538	9857538	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6282-01	TCGA-76-6282-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:9857538C>T	uc002czo.3	-	13	4411	c.3863G>A	c.(3862-3864)CGT>CAT	p.R1288H	GRIN2A_uc010uym.1_Missense_Mutation_p.R1288H|GRIN2A_uc010uyn.1_Intron|GRIN2A_uc002czr.3_Intron	NM_001134407	NP_001127879	Q12879	NMDE1_HUMAN	N-methyl-D-aspartate receptor subunit 2A isoform	1288	Cytoplasmic (Potential).				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding			skin(32)|NS(5)|ovary(4)|large_intestine(1)|lung(1)|breast(1)|kidney(1)	45					Felbamate(DB00949)|Glycine(DB00145)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)	GGAATGCTGACGGCTAATCCT	0.537													22	75	---	---	---	---	capture	Missense_Mutation	SNP	9857538	9857538	GRIN2A	16	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	6712	278
MYH13	8735	broad.mit.edu	37	17	10233822	10233822	+	Missense_Mutation	SNP	G	T	T			TCGA-76-6282-01	TCGA-76-6282-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:10233822G>T	uc002gmk.1	-	21	2407	c.2317C>A	c.(2317-2319)CTC>ATC	p.L773I		NM_003802	NP_003793	Q9UKX3	MYH13_HUMAN	myosin, heavy polypeptide 13, skeletal muscle	773	Myosin head-like.|Actin-binding (By similarity).				muscle contraction	muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(4)|skin(2)	6						AGTCCCAGGAGCCCAGCTTTG	0.557													3	12	---	---	---	---	capture	Missense_Mutation	SNP	10233822	10233822	MYH13	17	G	T	T	T	1	0	0	0	0	1	0	0	0	442	34	4	4	9942	278
KRT33A	3883	broad.mit.edu	37	17	39506758	39506758	+	Missense_Mutation	SNP	T	G	G			TCGA-76-6282-01	TCGA-76-6282-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:39506758T>G	uc002hwk.1	-	1	299	c.262A>C	c.(262-264)ATC>CTC	p.I88L		NM_004138	NP_004129	O76009	KT33A_HUMAN	keratin 33A	88	Coil 1A.|Rod.					intermediate filament	protein binding|structural molecule activity				0		Breast(137;0.000496)				CGCTCCCGGATGAGGTTCTCC	0.612													14	48	---	---	---	---	capture	Missense_Mutation	SNP	39506758	39506758	KRT33A	17	T	G	G	G	1	0	0	0	0	1	0	0	0	663	51	4	4	8389	278
DSC1	1823	broad.mit.edu	37	18	28723628	28723628	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6282-01	TCGA-76-6282-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:28723628C>T	uc002kwn.2	-	8	1328	c.1066G>A	c.(1066-1068)GAA>AAA	p.E356K	DSC1_uc002kwm.2_Missense_Mutation_p.E356K	NM_024421	NP_077739	Q08554	DSC1_HUMAN	desmocollin 1 isoform Dsc1a preproprotein	356	Extracellular (Potential).|Cadherin 3.				homophilic cell adhesion	desmosome|gap junction|integral to membrane|membrane fraction	calcium ion binding			ovary(3)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(10;0.00778)			ACAGAAGTTTCTGTGAAAGAT	0.358													19	36	---	---	---	---	capture	Missense_Mutation	SNP	28723628	28723628	DSC1	18	C	T	T	T	1	0	0	0	0	1	0	0	0	416	32	2	2	4720	278
TNFSF9	8744	broad.mit.edu	37	19	6535006	6535006	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6282-01	TCGA-76-6282-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:6535006G>A	uc002mfh.2	+	3	732	c.694G>A	c.(694-696)GCC>ACC	p.A232T		NM_003811	NP_003802	P41273	TNFL9_HUMAN	tumor necrosis factor (ligand) superfamily,	232	Extracellular (Potential).				apoptosis|cell proliferation|cell-cell signaling|immune response|signal transduction	extracellular space|integral to membrane	cytokine activity|tumor necrosis factor receptor binding			central_nervous_system(1)	1						TACCCAGGGCGCCACAGTCTT	0.662													12	17	---	---	---	---	capture	Missense_Mutation	SNP	6535006	6535006	TNFSF9	19	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	16195	278
MUC16	94025	broad.mit.edu	37	19	9049297	9049297	+	Silent	SNP	C	T	T			TCGA-76-6282-01	TCGA-76-6282-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:9049297C>T	uc002mkp.2	-	5	32538	c.32334G>A	c.(32332-32334)TCG>TCA	p.S10778S		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	10780	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						TTGGAATGGCCGAACTTGTCT	0.468													36	85	---	---	---	---	capture	Silent	SNP	9049297	9049297	MUC16	19	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	9883	278
ZNF536	9745	broad.mit.edu	37	19	31039659	31039659	+	Missense_Mutation	SNP	G	T	T			TCGA-76-6282-01	TCGA-76-6282-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:31039659G>T	uc002nsu.1	+	4	3271	c.3133G>T	c.(3133-3135)GCC>TCC	p.A1045S	ZNF536_uc010edd.1_Missense_Mutation_p.A1045S	NM_014717	NP_055532	O15090	ZN536_HUMAN	zinc finger protein 536	1045					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(7)|large_intestine(2)|skin(2)	11	Esophageal squamous(110;0.0834)					CAAAGACCAAGCCCGGGAGGC	0.537													17	60	---	---	---	---	capture	Missense_Mutation	SNP	31039659	31039659	ZNF536	19	G	T	T	T	1	0	0	0	0	1	0	0	0	442	34	4	4	17853	278
CD22	933	broad.mit.edu	37	19	35828889	35828889	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6282-01	TCGA-76-6282-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:35828889C>T	uc010edt.2	+	5	1027	c.950C>T	c.(949-951)CCG>CTG	p.P317L	CD22_uc010xst.1_Missense_Mutation_p.P145L|CD22_uc010edu.2_Missense_Mutation_p.P317L|CD22_uc010edv.2_Missense_Mutation_p.P317L|CD22_uc002nzb.3_Intron|CD22_uc010edx.2_RNA	NM_001771	NP_001762	P20273	CD22_HUMAN	CD22 molecule precursor	317	Extracellular (Potential).|Ig-like C2-type 2.				cell adhesion		protein binding|sugar binding			ovary(5)|lung(3)|breast(1)	9	all_lung(56;9.78e-09)|Lung NSC(56;1.46e-08)|Esophageal squamous(110;0.162)		Epithelial(14;5.83e-19)|OV - Ovarian serous cystadenocarcinoma(14;3.19e-18)|all cancers(14;3.41e-16)|LUSC - Lung squamous cell carcinoma(66;0.0417)		OspA lipoprotein(DB00045)	GACGTGGGCCCGGGAAGGTCG	0.602													6	23	---	---	---	---	capture	Missense_Mutation	SNP	35828889	35828889	CD22	19	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	2956	278
SHKBP1	92799	broad.mit.edu	37	19	41096902	41096902	+	Missense_Mutation	SNP	A	G	G			TCGA-76-6282-01	TCGA-76-6282-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:41096902A>G	uc002oob.2	+	18	1962	c.1913A>G	c.(1912-1914)AAC>AGC	p.N638S	SHKBP1_uc002ooc.2_Missense_Mutation_p.N613S|SHKBP1_uc002ood.2_Missense_Mutation_p.N546S|SHKBP1_uc002ooe.2_Missense_Mutation_p.N475S|SHKBP1_uc002oof.2_Missense_Mutation_p.N474S|SHKBP1_uc010xvm.1_Missense_Mutation_p.N418S|SHKBP1_uc010xvn.1_Missense_Mutation_p.N516S|LTBP4_uc002oog.1_5'Flank	NM_138392	NP_612401	Q8TBC3	SHKB1_HUMAN	SH3KBP1 binding protein 1	638						voltage-gated potassium channel complex	voltage-gated potassium channel activity			ovary(1)|pancreas(1)	2			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			GCCTCCAGCAACACCTCCTTG	0.662													10	21	---	---	---	---	capture	Missense_Mutation	SNP	41096902	41096902	SHKBP1	19	A	G	G	G	1	0	0	0	0	1	0	0	0	26	2	3	3	14177	278
MFSD9	84804	broad.mit.edu	37	2	103335367	103335367	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6282-01	TCGA-76-6282-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:103335367G>A	uc002tcb.2	-	6	1005	c.937C>T	c.(937-939)CGC>TGC	p.R313C	MFSD9_uc010fja.2_RNA	NM_032718	NP_116107	Q8NBP5	MFSD9_HUMAN	major facilitator superfamily domain containing	313					transmembrane transport	integral to membrane|plasma membrane	transporter activity			ovary(2)|breast(2)	4						ACCCCAAAGCGCTCCTCCAGG	0.587													10	27	---	---	---	---	capture	Missense_Mutation	SNP	103335367	103335367	MFSD9	2	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	9451	278
WNT10A	80326	broad.mit.edu	37	2	219746954	219746954	+	Missense_Mutation	SNP	T	C	C			TCGA-76-6282-01	TCGA-76-6282-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:219746954T>C	uc002vjd.1	+	2	648	c.185T>C	c.(184-186)CTA>CCA	p.L62P		NM_025216	NP_079492	Q9GZT5	WN10A_HUMAN	wingless-type MMTV integration site family,	62					anterior/posterior pattern formation|axis specification|canonical Wnt receptor signaling pathway|cellular response to transforming growth factor beta stimulus|female gonad development|hair follicle morphogenesis|odontogenesis|regulation of odontogenesis of dentine-containing tooth|sebaceous gland development|skin development|tongue development|Wnt receptor signaling pathway, calcium modulating pathway	extracellular space|plasma membrane|proteinaceous extracellular matrix	G-protein-coupled receptor binding|signal transducer activity			lung(1)|skin(1)	2		Renal(207;0.0474)		Epithelial(149;4.26e-07)|all cancers(144;8.8e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		ACAGTGTGCCTAACATTGCCA	0.612													3	47	---	---	---	---	capture	Missense_Mutation	SNP	219746954	219746954	WNT10A	2	T	C	C	C	1	0	0	0	0	1	0	0	0	689	53	3	3	17263	278
AGAP1	116987	broad.mit.edu	37	2	236659063	236659063	+	Silent	SNP	C	T	T			TCGA-76-6282-01	TCGA-76-6282-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:236659063C>T	uc002vvs.2	+	6	1199	c.604C>T	c.(604-606)CTG>TTG	p.L202L	AGAP1_uc002vvt.2_Silent_p.L202L	NM_001037131	NP_001032208	Q9UPQ3	AGAP1_HUMAN	centaurin, gamma 2 isoform 1	202	Small GTPase-like.				protein transport|regulation of ARF GTPase activity|small GTPase mediated signal transduction	cytoplasm	ARF GTPase activator activity|GTP binding|zinc ion binding			ovary(2)|skin(1)	3						CTCCAACGACCTGAAACGGTG	0.527													51	111	---	---	---	---	capture	Silent	SNP	236659063	236659063	AGAP1	2	C	T	T	T	1	0	0	0	0	0	0	0	1	311	24	2	2	366	278
PLCG1	5335	broad.mit.edu	37	20	39794468	39794468	+	Splice_Site	SNP	T	C	C			TCGA-76-6282-01	TCGA-76-6282-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:39794468T>C	uc002xjp.1	+	16	1920	c.1799_splice	c.e16+2	p.W600_splice	PLCG1_uc002xjo.1_Splice_Site_p.W600_splice|PLCG1_uc010zwe.1_Splice_Site_p.W226_splice|PLCG1_uc010ggf.2_5'Flank	NM_182811	NP_877963	P19174	PLCG1_HUMAN	phospholipase C, gamma 1 isoform b						activation of phospholipase C activity|axon guidance|blood coagulation|cellular response to epidermal growth factor stimulus|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|interspecies interaction between organisms|intracellular signal transduction|leukocyte migration|nerve growth factor receptor signaling pathway|phospholipid catabolic process|positive regulation of angiogenesis|positive regulation of blood vessel endothelial cell migration|positive regulation of epithelial cell migration|T cell receptor signaling pathway	cytosol|lamellipodium|plasma membrane|ruffle	calcium ion binding|phosphatidylinositol phospholipase C activity|protein binding|receptor signaling protein activity			lung(3)|breast(3)|skin(2)	8		Myeloproliferative disorder(115;0.00878)				CTCTTTCTGGTAACACTTCCC	0.522													3	47	---	---	---	---	capture	Splice_Site	SNP	39794468	39794468	PLCG1	20	T	C	C	C	1	0	0	0	0	0	0	1	0	741	57	5	3	11938	278
TPTE	7179	broad.mit.edu	37	21	10933879	10933879	+	Missense_Mutation	SNP	C	T	T	rs149228869		TCGA-76-6282-01	TCGA-76-6282-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:10933879C>T	uc002yip.1	-	17	1368	c.1000G>A	c.(1000-1002)GTA>ATA	p.V334I	TPTE_uc002yis.1_RNA|TPTE_uc002yiq.1_Missense_Mutation_p.V316I|TPTE_uc002yir.1_Missense_Mutation_p.V296I|TPTE_uc010gkv.1_Missense_Mutation_p.V196I	NM_199261	NP_954870	P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology	334	Phosphatase tensin-type.				signal transduction	integral to membrane	ion channel activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(2)|lung(1)|breast(1)|skin(1)	5			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		TGAATCGCTACGATGTTTTCA	0.313													37	261	---	---	---	---	capture	Missense_Mutation	SNP	10933879	10933879	TPTE	21	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	16313	278
RRP1B	23076	broad.mit.edu	37	21	45107849	45107849	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6282-01	TCGA-76-6282-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:45107849G>A	uc002zdk.2	+	13	1708	c.1594G>A	c.(1594-1596)GTC>ATC	p.V532I	RRP1B_uc002zdl.2_Missense_Mutation_p.V65I	NM_015056	NP_055871	Q14684	RRP1B_HUMAN	ribosomal RNA processing 1 homolog B	532					rRNA processing	cytosol|nucleolus|preribosome, small subunit precursor	protein binding			skin(1)	1				STAD - Stomach adenocarcinoma(101;0.178)		AGTTGTGCCCGTCAATGGCAG	0.647													17	42	---	---	---	---	capture	Missense_Mutation	SNP	45107849	45107849	RRP1B	21	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	13580	278
RGL4	266747	broad.mit.edu	37	22	24034585	24034585	+	Silent	SNP	G	A	A	rs141395325	byFrequency	TCGA-76-6282-01	TCGA-76-6282-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:24034585G>A	uc002zxn.2	+	2	1413	c.243G>A	c.(241-243)CCG>CCA	p.P81P	LOC91316_uc002zxh.3_RNA|LOC91316_uc002zxi.3_RNA|LOC91316_uc002zxk.3_Intron|LOC91316_uc010gua.2_Intron|LOC91316_uc002zxl.3_Intron|LOC91316_uc011aiz.1_Intron|LOC91316_uc002zxm.3_Intron|RGL4_uc002zxo.2_Silent_p.P81P|RGL4_uc002zxp.1_5'UTR|RGL4_uc002zxq.2_5'UTR	NM_153615	NP_705843	Q8IZJ4	RGDSR_HUMAN	ral guanine nucleotide dissociation	81					small GTPase mediated signal transduction	cytoplasmic membrane-bounded vesicle	guanyl-nucleotide exchange factor activity			ovary(1)	1						ATCAGCCCCCGCAACGGTCAT	0.552													52	105	---	---	---	---	capture	Silent	SNP	24034585	24034585	RGL4	22	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	13174	278
MYO18B	84700	broad.mit.edu	37	22	26423542	26423542	+	Silent	SNP	G	A	A			TCGA-76-6282-01	TCGA-76-6282-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:26423542G>A	uc003abz.1	+	43	7852	c.7602G>A	c.(7600-7602)GCG>GCA	p.A2534A	MYO18B_uc003aca.1_Silent_p.A2415A|MYO18B_uc010guy.1_Silent_p.A2416A|MYO18B_uc010guz.1_Silent_p.A2414A|MYO18B_uc011aka.1_Silent_p.A1688A|MYO18B_uc011akb.1_Silent_p.A2047A|MYO18B_uc010gva.1_Silent_p.A517A|MYO18B_uc010gvb.1_RNA	NM_032608	NP_115997	Q8IUG5	MY18B_HUMAN	myosin XVIIIB	2534						nucleus|sarcomere|unconventional myosin complex	actin binding|ATP binding|motor activity			ovary(5)|central_nervous_system(3)|large_intestine(2)|breast(2)	12						CACGACTTGCGGGTGACGGTG	0.572													6	29	---	---	---	---	capture	Silent	SNP	26423542	26423542	MYO18B	22	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	9976	278
FGD5	152273	broad.mit.edu	37	3	14862054	14862054	+	Silent	SNP	T	C	C			TCGA-76-6282-01	TCGA-76-6282-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:14862054T>C	uc003bzc.2	+	1	1586	c.1476T>C	c.(1474-1476)TAT>TAC	p.Y492Y	FGD5_uc011avk.1_Silent_p.Y492Y	NM_152536	NP_689749	Q6ZNL6	FGD5_HUMAN	FYVE, RhoGEF and PH domain containing 5	492					actin cytoskeleton organization|filopodium assembly|regulation of Cdc42 GTPase activity|regulation of cell shape	cytoskeleton|Golgi apparatus|lamellipodium|ruffle	metal ion binding|Rho guanyl-nucleotide exchange factor activity|small GTPase binding			ovary(3)|kidney(1)|pancreas(1)	5						TGGCCGGCTATGTCCCAGAAA	0.612													23	36	---	---	---	---	capture	Silent	SNP	14862054	14862054	FGD5	3	T	C	C	C	1	0	0	0	0	0	0	0	1	660	51	3	3	5782	278
EFHB	151651	broad.mit.edu	37	3	19974766	19974766	+	Missense_Mutation	SNP	T	A	A			TCGA-76-6282-01	TCGA-76-6282-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:19974766T>A	uc003cbl.3	-	1	941	c.745A>T	c.(745-747)ATA>TTA	p.I249L	EFHB_uc003cbm.2_Missense_Mutation_p.I119L	NM_144715	NP_653316	Q8N7U6	EFHB_HUMAN	EF hand domain family, member B	249					signal transduction	proteinaceous extracellular matrix	calcium ion binding				0						CCAGAGTATATGGGTCTGATG	0.443													12	33	---	---	---	---	capture	Missense_Mutation	SNP	19974766	19974766	EFHB	3	T	A	A	A	1	0	0	0	0	1	0	0	0	663	51	4	4	4900	278
BOC	91653	broad.mit.edu	37	3	112997000	112997000	+	Missense_Mutation	SNP	G	A	A	rs149038528		TCGA-76-6282-01	TCGA-76-6282-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:112997000G>A	uc003dzx.2	+	10	2219	c.1598G>A	c.(1597-1599)CGC>CAC	p.R533H	BOC_uc003dzy.2_Missense_Mutation_p.R533H|BOC_uc003dzz.2_Missense_Mutation_p.R534H|BOC_uc003eab.2_Missense_Mutation_p.R234H|BOC_uc003eac.2_5'Flank	NM_033254	NP_150279	Q9BWV1	BOC_HUMAN	brother of CDO precursor	533	Fibronectin type-III 1.|Extracellular (Potential).				cell adhesion|muscle cell differentiation|positive regulation of myoblast differentiation	integral to membrane|plasma membrane	protein binding			ovary(3)|breast(1)|central_nervous_system(1)|pancreas(1)	6			Epithelial(53;0.227)			AACCAGCACCGCCTGACCCTC	0.567													47	142	---	---	---	---	capture	Missense_Mutation	SNP	112997000	112997000	BOC	3	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	1469	278
KDR	3791	broad.mit.edu	37	4	55956221	55956221	+	Nonsense_Mutation	SNP	G	A	A			TCGA-76-6282-01	TCGA-76-6282-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:55956221G>A	uc003has.2	-	23	3396	c.3094C>T	c.(3094-3096)CGA>TGA	p.R1032*	KDR_uc003hat.1_Nonsense_Mutation_p.R1032*	NM_002253	NP_002244	P35968	VGFR2_HUMAN	kinase insert domain receptor precursor	1032	Protein kinase.|Cytoplasmic (Potential).				angiogenesis|cell differentiation|interspecies interaction between organisms|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of focal adhesion assembly|positive regulation of positive chemotaxis|regulation of cell shape	integral to plasma membrane	ATP binding|growth factor binding|Hsp90 protein binding|integrin binding|receptor signaling protein tyrosine kinase activity|vascular endothelial growth factor receptor activity			lung(16)|soft_tissue(4)|central_nervous_system(4)|large_intestine(2)|stomach(2)|skin(2)|ovary(2)|kidney(1)	33	all_cancers(7;0.0255)|all_lung(4;0.00175)|Lung NSC(11;0.00384)|all_epithelial(27;0.034)|Glioma(25;0.08)|all_neural(26;0.101)		Epithelial(7;0.189)		Sorafenib(DB00398)|Sunitinib(DB01268)	AGGATATTTCGTGCCGCCAGG	0.448			Mis		NSCLC|angiosarcoma				Familial_Infantile_Hemangioma	TSP Lung(20;0.16)			25	68	---	---	---	---	capture	Nonsense_Mutation	SNP	55956221	55956221	KDR	4	G	A	A	A	1	0	0	0	0	0	1	0	0	519	40	5	1	8061	278
UGT2B10	7365	broad.mit.edu	37	4	69870669	69870669	+	Missense_Mutation	SNP	C	A	A			TCGA-76-6282-01	TCGA-76-6282-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:69870669C>A	uc011cao.1	-	9	1517	c.1381G>T	c.(1381-1383)GCT>TCT	p.A461S	UGT2B10_uc011can.1_Missense_Mutation_p.A377S			P36537	UDB10_HUMAN	RecName: Full=UDP-glucuronosyltransferase 2B28;          Short=UDPGT 2B28;          EC=2.4.1.17; Flags: Precursor;	498	Helical; (Potential).				lipid metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity			skin(3)|ovary(2)	5						GCCACACAGGCCAGCAGGAAC	0.448													8	90	---	---	---	---	capture	Missense_Mutation	SNP	69870669	69870669	UGT2B10	4	C	A	A	A	1	0	0	0	0	1	0	0	0	338	26	4	4	16838	278
PROL1	58503	broad.mit.edu	37	4	71275177	71275177	+	Missense_Mutation	SNP	G	T	T			TCGA-76-6282-01	TCGA-76-6282-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:71275177G>T	uc003hfi.2	+	3	306	c.132G>T	c.(130-132)TGG>TGT	p.W44C		NM_021225	NP_067048	Q99935	PROL1_HUMAN	proline rich, lacrimal 1	44	Pro-rich.				regulation of sensory perception of pain	extracellular region	endopeptidase inhibitor activity			large_intestine(1)	1		all_hematologic(202;0.196)				GGCCAAGATGGGTTCCACCAA	0.502													32	99	---	---	---	---	capture	Missense_Mutation	SNP	71275177	71275177	PROL1	4	G	T	T	T	1	0	0	0	0	1	0	0	0	559	43	4	4	12450	278
HSD17B13	345275	broad.mit.edu	37	4	88239495	88239495	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6282-01	TCGA-76-6282-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:88239495G>A	uc003hqo.2	-	2	367	c.304C>T	c.(304-306)CGC>TGC	p.R102C	HSD17B13_uc010ikk.2_Intron	NM_178135	NP_835236	Q7Z5P4	DHB13_HUMAN	hydroxysteroid (17-beta) dehydrogenase 13	102						extracellular region	binding|oxidoreductase activity				0		Acute lymphoblastic leukemia(40;0.244)|all_hematologic(202;0.248)		OV - Ovarian serous cystadenocarcinoma(123;0.000308)		TTTAGAGAGCGATAGATCTCT	0.468													23	60	---	---	---	---	capture	Missense_Mutation	SNP	88239495	88239495	HSD17B13	4	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	7307	278
PTCD2	79810	broad.mit.edu	37	5	71616252	71616252	+	Missense_Mutation	SNP	C	G	G			TCGA-76-6282-01	TCGA-76-6282-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:71616252C>G	uc003kcb.2	+	1	53	c.43C>G	c.(43-45)CGA>GGA	p.R15G	MRPS27_uc003kca.3_5'Flank|MRPS27_uc003kbz.3_5'Flank|MRPS27_uc011cse.1_5'Flank|MRPS27_uc010iza.2_5'Flank|PTCD2_uc011csf.1_Translation_Start_Site|PTCD2_uc003kcc.2_Translation_Start_Site|PTCD2_uc011csg.1_Translation_Start_Site|PTCD2_uc011csh.1_Missense_Mutation_p.R15G|PTCD2_uc003kcd.2_RNA	NM_024754	NP_079030	Q8WV60	PTCD2_HUMAN	pentatricopeptide repeat domain 2	15											0		Lung NSC(167;0.00237)|Ovarian(174;0.0175)|Prostate(461;0.141)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;1.73e-53)		GCCCTCGAATCGAGTTCTCCT	0.627													11	30	---	---	---	---	capture	Missense_Mutation	SNP	71616252	71616252	PTCD2	5	C	G	G	G	1	0	0	0	0	1	0	0	0	399	31	4	4	12623	278
DDX41	51428	broad.mit.edu	37	5	176942773	176942773	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6282-01	TCGA-76-6282-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:176942773G>A	uc003mho.2	-	6	505	c.484C>T	c.(484-486)CGC>TGC	p.R162C	DDX41_uc003mhm.2_5'UTR|DDX41_uc003mhn.2_Missense_Mutation_p.R31C|DDX41_uc003mhp.2_Missense_Mutation_p.R31C|DDX41_uc003mhq.1_5'UTR	NM_016222	NP_057306	Q9UJV9	DDX41_HUMAN	DEAD-box protein abstrakt	162					apoptosis|multicellular organismal development	catalytic step 2 spliceosome	ATP binding|ATP-dependent helicase activity|protein binding|RNA binding|zinc ion binding				0	all_cancers(89;0.00033)|Renal(175;0.000269)|Lung NSC(126;0.00161)|all_lung(126;0.00286)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.191)			ttccgcacgcgctcatgtcgc	0.129													4	98	---	---	---	---	capture	Missense_Mutation	SNP	176942773	176942773	DDX41	5	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	4319	278
MYLIP	29116	broad.mit.edu	37	6	16130808	16130808	+	Missense_Mutation	SNP	C	G	G			TCGA-76-6282-01	TCGA-76-6282-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:16130808C>G	uc003nbq.2	+	2	345	c.108C>G	c.(106-108)ATC>ATG	p.I36M	MYLIP_uc003nbr.2_Intron	NM_013262	NP_037394	Q8WY64	MYLIP_HUMAN	myosin regulatory light chain interacting	36	FERM.				cellular component movement|nervous system development	cytoplasm|cytoskeleton|extrinsic to membrane	cytoskeletal protein binding|ubiquitin-protein ligase activity|zinc ion binding			pancreas(1)	1	Breast(50;0.0799)|Ovarian(93;0.103)	all_hematologic(90;0.0895)	Epithelial(50;0.241)			GACTGGGAATCATAGAAGTTG	0.468													26	61	---	---	---	---	capture	Missense_Mutation	SNP	16130808	16130808	MYLIP	6	C	G	G	G	1	0	0	0	0	1	0	0	0	369	29	4	4	9965	278
MYLIP	29116	broad.mit.edu	37	6	16130886	16130886	+	Silent	SNP	C	T	T			TCGA-76-6282-01	TCGA-76-6282-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:16130886C>T	uc003nbq.2	+	2	423	c.186C>T	c.(184-186)ATC>ATT	p.I62I	MYLIP_uc003nbr.2_Intron	NM_013262	NP_037394	Q8WY64	MYLIP_HUMAN	myosin regulatory light chain interacting	62	FERM.				cellular component movement|nervous system development	cytoplasm|cytoskeleton|extrinsic to membrane	cytoskeletal protein binding|ubiquitin-protein ligase activity|zinc ion binding			pancreas(1)	1	Breast(50;0.0799)|Ovarian(93;0.103)	all_hematologic(90;0.0895)	Epithelial(50;0.241)			GAAACCGGATCTCCCAGCAGA	0.473													24	52	---	---	---	---	capture	Silent	SNP	16130886	16130886	MYLIP	6	C	T	T	T	1	0	0	0	0	0	0	0	1	408	32	2	2	9965	278
TNXB	7148	broad.mit.edu	37	6	32012858	32012858	+	Missense_Mutation	SNP	T	C	C			TCGA-76-6282-01	TCGA-76-6282-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:32012858T>C	uc003nzl.2	-	32	11048	c.10846A>G	c.(10846-10848)ACC>GCC	p.T3616A	TNXB_uc003nzg.1_Missense_Mutation_p.T47A|TNXB_uc003nzh.1_Missense_Mutation_p.T85A	NM_019105	NP_061978	P22105	TENX_HUMAN	tenascin XB isoform 1 precursor	3663	Fibronectin type-III 28.				actin cytoskeleton organization|cell adhesion|collagen metabolic process|elastic fiber assembly|signal transduction	extracellular space|intracellular|proteinaceous extracellular matrix	heparin binding|integrin binding				0						CTGTAGGGGGTGCTGGGCTCC	0.642													4	19	---	---	---	---	capture	Missense_Mutation	SNP	32012858	32012858	TNXB	6	T	C	C	C	1	0	0	0	0	1	0	0	0	767	59	3	3	16229	278
MLN	4295	broad.mit.edu	37	6	33768891	33768891	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6282-01	TCGA-76-6282-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:33768891G>A	uc003off.1	-	2	121	c.50C>T	c.(49-51)GCC>GTC	p.A17V	MLN_uc003ofg.1_Missense_Mutation_p.A17V|MLN_uc011drn.1_Missense_Mutation_p.A17V	NM_002418	NP_002409	P12872	MOTI_HUMAN	motilin isoform 1 preproprotein	17					cell-cell signaling|G-protein coupled receptor protein signaling pathway	extracellular region|soluble fraction	hormone activity				0						GGCCAGCATGGCAGCTACATG	0.537													35	87	---	---	---	---	capture	Missense_Mutation	SNP	33768891	33768891	MLN	6	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	9543	278
SRPK1	6732	broad.mit.edu	37	6	35838178	35838178	+	Missense_Mutation	SNP	C	G	G			TCGA-76-6282-01	TCGA-76-6282-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:35838178C>G	uc003olj.2	-	10	994	c.871G>C	c.(871-873)GAA>CAA	p.E291Q	SRPK1_uc011dtg.1_Missense_Mutation_p.E275Q|SRPK1_uc003olh.2_Missense_Mutation_p.E184Q|SRPK1_uc003oli.2_Missense_Mutation_p.E184Q	NM_003137	NP_003128	Q96SB4	SRPK1_HUMAN	SFRS protein kinase 1	291	Protein kinase.				cell differentiation|chromosome segregation|interspecies interaction between organisms|intracellular protein kinase cascade|mRNA processing|negative regulation of viral genome replication|positive regulation of viral genome replication|regulation of mRNA processing|RNA splicing	cytoplasm|nucleus	ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity			ovary(1)	1						TTCTCCATTTCCTCAATTTCC	0.383													2	11	---	---	---	---	capture	Missense_Mutation	SNP	35838178	35838178	SRPK1	6	C	G	G	G	1	0	0	0	0	1	0	0	0	390	30	4	4	15051	278
VPS41	27072	broad.mit.edu	37	7	38798055	38798055	+	Missense_Mutation	SNP	C	A	A			TCGA-76-6282-01	TCGA-76-6282-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:38798055C>A	uc003tgy.2	-	18	1475	c.1449G>T	c.(1447-1449)TGG>TGT	p.W483C	VPS41_uc003tgz.2_Missense_Mutation_p.W458C|VPS41_uc010kxn.2_Missense_Mutation_p.W394C	NM_014396	NP_055211	P49754	VPS41_HUMAN	vacuolar protein sorting 41 isoform 1	483					Golgi vesicle transport|intracellular protein transport|vesicle-mediated transport	cytosol|Golgi-associated vesicle|HOPS complex|membrane fraction	zinc ion binding			skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	4						GATCTCCAGGCCATTCTCGGA	0.328													5	55	---	---	---	---	capture	Missense_Mutation	SNP	38798055	38798055	VPS41	7	C	A	A	A	1	0	0	0	0	1	0	0	0	338	26	4	4	17092	278
EGFR	1956	broad.mit.edu	37	7	55231506	55231506	+	Missense_Mutation	SNP	G	C	C			TCGA-76-6282-01	TCGA-76-6282-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:55231506G>C	uc003tqk.2	+	14	1958	c.1712G>C	c.(1711-1713)TGC>TCC	p.C571S	EGFR_uc003tqi.2_Missense_Mutation_p.C571S|EGFR_uc003tqj.2_Missense_Mutation_p.C571S|EGFR_uc010kzg.1_Missense_Mutation_p.C526S|EGFR_uc011kco.1_Missense_Mutation_p.C518S|EGFR_uc011kcp.1_Intron|EGFR_uc011kcq.1_Intron|EGFR_uc003tqn.2_5'Flank	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	571	Approximate.|Extracellular (Potential).				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity			lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	AACATCACCTGCACAGGACGG	0.557		8	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			685	231	---	---	---	---	capture	Missense_Mutation	SNP	55231506	55231506	EGFR	7	G	C	C	C	1	0	0	0	0	1	0	0	0	598	46	4	4	4922	278
ASNS	440	broad.mit.edu	37	7	97483890	97483890	+	Splice_Site	SNP	A	G	G			TCGA-76-6282-01	TCGA-76-6282-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:97483890A>G	uc003uot.3	-	10	1744	c.1238_splice	c.e10+1	p.G413_splice	ASNS_uc011kin.1_Splice_Site_p.G330_splice|ASNS_uc003uou.3_Splice_Site_p.G413_splice|ASNS_uc003uov.3_Splice_Site_p.G413_splice|ASNS_uc011kio.1_Splice_Site_p.G392_splice|ASNS_uc003uow.3_Splice_Site_p.G392_splice|ASNS_uc003uox.3_Splice_Site_p.G330_splice	NM_133436	NP_597680	P08243	ASNS_HUMAN	asparagine synthetase						cellular response to glucose starvation|glutamine metabolic process|negative regulation of apoptosis|positive regulation of mitotic cell cycle	cytosol|soluble fraction	asparagine synthase (glutamine-hydrolyzing) activity|ATP binding			ovary(1)	1	all_cancers(62;6.64e-09)|all_epithelial(64;1.58e-09)|Esophageal squamous(72;0.00448)|Lung NSC(181;0.0342)|all_lung(186;0.0369)				Adenosine triphosphate(DB00171)|L-Asparagine(DB00174)|L-Aspartic Acid(DB00128)|L-Glutamic Acid(DB00142)|L-Glutamine(DB00130)	TAAAAATATTACCCATGGGCA	0.343													3	92	---	---	---	---	capture	Splice_Site	SNP	97483890	97483890	ASNS	7	A	G	G	G	1	0	0	0	0	0	0	1	0	182	14	5	3	1039	278
OR2A25	392138	broad.mit.edu	37	7	143771890	143771890	+	Missense_Mutation	SNP	T	C	C			TCGA-76-6282-01	TCGA-76-6282-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:143771890T>C	uc011ktx.1	+	1	578	c.578T>C	c.(577-579)ATT>ACT	p.I193T		NM_001004488	NP_001004488	A4D2G3	O2A25_HUMAN	olfactory receptor, family 2, subfamily A,	193	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	Melanoma(164;0.0783)					GATACCCACATTAATGAGGTA	0.433													32	144	---	---	---	---	capture	Missense_Mutation	SNP	143771890	143771890	OR2A25	7	T	C	C	C	1	0	0	0	0	1	0	0	0	676	52	3	3	10882	278
IKBKB	3551	broad.mit.edu	37	8	42163910	42163910	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6282-01	TCGA-76-6282-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:42163910G>A	uc003xow.1	+	7	704	c.527G>A	c.(526-528)GGC>GAC	p.G176D	IKBKB_uc003xov.2_Missense_Mutation_p.G176D|IKBKB_uc010lxh.1_Missense_Mutation_p.G71D|IKBKB_uc011lco.1_RNA|IKBKB_uc010lxj.1_Intron|IKBKB_uc003xox.1_5'UTR|IKBKB_uc011lcp.1_RNA|IKBKB_uc011lcq.1_Missense_Mutation_p.G174D|IKBKB_uc010lxi.1_RNA|IKBKB_uc011lcr.1_Missense_Mutation_p.G117D	NM_001556	NP_001547	O14920	IKKB_HUMAN	inhibitor of nuclear factor kappa B kinase beta	176	Protein kinase.				anti-apoptosis|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|positive regulation of transcription, DNA-dependent|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	CD40 receptor complex|cytosol|internal side of plasma membrane|membrane raft	ATP binding|identical protein binding|IkappaB kinase activity			breast(3)|ovary(2)|lung(1)|skin(1)	7	all_cancers(6;1.42e-24)|all_epithelial(6;1.02e-25)|all_lung(13;6.21e-12)|Lung NSC(13;1.04e-10)|Ovarian(28;0.00769)|Prostate(17;0.0119)|Colorectal(14;0.0468)|Lung SC(25;0.211)	all_lung(54;0.000434)|Lung NSC(58;0.00161)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.0954)	BRCA - Breast invasive adenocarcinoma(8;1.37e-10)|Colorectal(10;0.00102)|OV - Ovarian serous cystadenocarcinoma(14;0.00168)|Lung(22;0.00467)|LUSC - Lung squamous cell carcinoma(45;0.024)|COAD - Colon adenocarcinoma(11;0.0264)		Arsenic trioxide(DB01169)|Auranofin(DB00995)	CTGGATCAGGGCAGTCTTTGC	0.478													3	43	---	---	---	---	capture	Missense_Mutation	SNP	42163910	42163910	IKBKB	8	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	7535	278
DCAF4L2	138009	broad.mit.edu	37	8	88886131	88886131	+	Silent	SNP	G	C	C			TCGA-76-6282-01	TCGA-76-6282-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:88886131G>C	uc003ydz.2	-	1	166	c.69C>G	c.(67-69)CTC>CTG	p.L23L		NM_152418	NP_689631	Q8NA75	DC4L2_HUMAN	WD repeat domain 21C	23										ovary(1)	1						AAGGTGCATTGAGTCCCACTC	0.532													5	72	---	---	---	---	capture	Silent	SNP	88886131	88886131	DCAF4L2	8	G	C	C	C	1	0	0	0	0	0	0	0	1	574	45	4	4	4231	278
RIMS2	9699	broad.mit.edu	37	8	105001597	105001597	+	Nonsense_Mutation	SNP	C	T	T			TCGA-76-6282-01	TCGA-76-6282-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:105001597C>T	uc003yls.2	+	15	2567	c.2326C>T	c.(2326-2328)CGA>TGA	p.R776*	RIMS2_uc003ylp.2_Nonsense_Mutation_p.R998*|RIMS2_uc003ylw.2_Nonsense_Mutation_p.R790*|RIMS2_uc003ylq.2_Nonsense_Mutation_p.R790*|RIMS2_uc003ylr.2_Nonsense_Mutation_p.R837*	NM_014677	NP_055492	Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	1060					intracellular protein transport	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding			ovary(6)|lung(2)|breast(2)|skin(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	15			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			TACAATTAGCCGAATGGACAG	0.368										HNSCC(12;0.0054)			24	82	---	---	---	---	capture	Nonsense_Mutation	SNP	105001597	105001597	RIMS2	8	C	T	T	T	1	0	0	0	0	0	1	0	0	295	23	5	1	13260	278
COLEC10	10584	broad.mit.edu	37	8	120101985	120101985	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6282-01	TCGA-76-6282-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:120101985C>T	uc003yoo.2	+	2	312	c.215C>T	c.(214-216)CCG>CTG	p.P72L		NM_006438	NP_006429	Q9Y6Z7	COL10_HUMAN	collectin sub-family member 10 precursor	72	Collagen-like.					collagen|cytoplasm	mannose binding			ovary(2)|skin(1)	3	all_cancers(13;4.13e-26)|Lung NSC(37;1.36e-07)|Ovarian(258;0.018)|Hepatocellular(40;0.234)		STAD - Stomach adenocarcinoma(47;0.00113)			CGCATGGGGCCGAAAGGTAAC	0.413													8	34	---	---	---	---	capture	Missense_Mutation	SNP	120101985	120101985	COLEC10	8	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	3675	278
SHB	6461	broad.mit.edu	37	9	37919970	37919970	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6282-01	TCGA-76-6282-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:37919970C>T	uc004aax.2	-	6	1946	c.1378G>A	c.(1378-1380)GCC>ACC	p.A460T		NM_003028	NP_003019	Q15464	SHB_HUMAN	Src homology 2 domain containing adaptor protein	460	SH2.				angiogenesis|apoptosis|cell differentiation|signal transduction	cytoplasm|plasma membrane	SH3/SH2 adaptor activity			central_nervous_system(2)|skin(1)	3		all_epithelial(88;0.122)		GBM - Glioblastoma multiforme(29;3.27e-05)|Lung(182;0.0658)		TTGGTTTTGGCCAGTTTCATG	0.502													3	50	---	---	---	---	capture	Missense_Mutation	SNP	37919970	37919970	SHB	9	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	14161	278
FAM75A3	727830	broad.mit.edu	37	9	40702866	40702866	+	Missense_Mutation	SNP	A	T	T			TCGA-76-6282-01	TCGA-76-6282-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:40702866A>T	uc010mmj.2	+	4	552	c.523A>T	c.(523-525)ACC>TCC	p.T175S		NM_001083124	NP_001076593	Q5VYP0	F75A3_HUMAN	hypothetical protein LOC727830	175	Pro-rich.					integral to membrane				ovary(2)|skin(1)	3				GBM - Glioblastoma multiforme(29;0.02)|Lung(182;0.0681)		AGGCCCAATGACCACCTCAGT	0.592													11	141	---	---	---	---	capture	Missense_Mutation	SNP	40702866	40702866	FAM75A3	9	A	T	T	T	1	0	0	0	0	1	0	0	0	130	10	4	4	5567	278
ITGA11	22801	broad.mit.edu	37	15	68641185	68641185	+	Frame_Shift_Del	DEL	A	-	-			TCGA-76-6282-01	TCGA-76-6282-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:68641185delA	uc002ari.2	-	10	1201	c.1114delT	c.(1114-1116)TCCfs	p.S372fs	ITGA11_uc010bib.2_Frame_Shift_Del_p.S372fs	NM_001004439	NP_001004439	Q9UKX5	ITA11_HUMAN	integrin, alpha 11 precursor	372	FG-GAP 3.|Extracellular (Potential).				cell-matrix adhesion|integrin-mediated signaling pathway|muscle organ development	integrin complex	collagen binding|receptor activity			kidney(2)|pancreas(1)	3					Tirofiban(DB00775)	ACGTGCGAGGAAAAGCCCGTC	0.562													2	4	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	68641185	68641185	ITGA11	15	A	-	-	-	1	0	1	0	1	0	0	0	0	117	9	5	5	7797	278
OTOP2	92736	broad.mit.edu	37	17	72923832	72923832	+	Frame_Shift_Del	DEL	C	-	-			TCGA-76-6282-01	TCGA-76-6282-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:72923832delC	uc010wrp.1	+	6	671	c.582delC	c.(580-582)CACfs	p.H194fs	OTOP2_uc002jmf.1_3'UTR	NM_178160	NP_835454	Q7RTS6	OTOP2_HUMAN	otopetrin 2	194						integral to membrane				ovary(3)|large_intestine(1)	4	all_lung(278;0.172)|Lung NSC(278;0.207)					AATCTGTGCACCAATCCCACT	0.582													10	24	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	72923832	72923832	OTOP2	17	C	-	-	-	1	0	1	0	1	0	0	0	0	233	18	5	5	11210	278
SLC5A7	60482	broad.mit.edu	37	2	108626710	108626710	+	Frame_Shift_Del	DEL	G	-	-			TCGA-76-6282-01	TCGA-76-6282-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:108626710delG	uc002tdv.2	+	9	1412	c.1136delG	c.(1135-1137)TGGfs	p.W379fs	SLC5A7_uc010ywm.1_Frame_Shift_Del_p.W132fs|SLC5A7_uc010fjj.2_Frame_Shift_Del_p.W379fs|SLC5A7_uc010ywn.1_Frame_Shift_Del_p.W266fs	NM_021815	NP_068587	Q9GZV3	SC5A7_HUMAN	solute carrier family 5 (choline transporter),	379	Helical; (Potential).				acetylcholine biosynthetic process|neurotransmitter secretion	integral to membrane|plasma membrane	choline:sodium symporter activity			ovary(2)|central_nervous_system(1)|skin(1)	4					Choline(DB00122)	GAAATCGTTTGGGTTATGCGA	0.443													21	53	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	108626710	108626710	SLC5A7	2	G	-	-	-	1	0	1	0	1	0	0	0	0	611	47	5	5	14562	278
