Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
LOC649330	649330	broad.mit.edu	37	1	12908039	12908039	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6285-01	TCGA-76-6285-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:12908039G>A	uc009vno.2	-	1	199	c.104C>T	c.(103-105)GCG>GTG	p.A35V	HNRNPCL1_uc010obf.1_Missense_Mutation_p.A35V	NM_001146181	NP_001139653	B7ZW38	B7ZW38_HUMAN	heterogeneous nuclear ribonucleoprotein C-like	35							nucleic acid binding|nucleotide binding				0						GGAAAAGATCGCCTCCACATC	0.473													46	159	---	---	---	---	capture	Missense_Mutation	SNP	12908039	12908039	LOC649330	1	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	8802	280
CSMD2	114784	broad.mit.edu	37	1	34123559	34123559	+	Silent	SNP	C	T	T			TCGA-76-6285-01	TCGA-76-6285-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:34123559C>T	uc001bxn.1	-	27	4343	c.4314G>A	c.(4312-4314)CCG>CCA	p.P1438P	CSMD2_uc001bxm.1_Silent_p.P1478P|CSMD2_uc001bxo.1_Silent_p.P351P	NM_052896	NP_443128	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	1438	Extracellular (Potential).|Sushi 8.					integral to membrane|plasma membrane	protein binding			ovary(6)|skin(5)|pancreas(1)	12		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				TGCATGTTGGCGGGCTGGGCT	0.572													42	53	---	---	---	---	capture	Silent	SNP	34123559	34123559	CSMD2	1	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	3910	280
TIE1	7075	broad.mit.edu	37	1	43774798	43774798	+	Missense_Mutation	SNP	T	A	A			TCGA-76-6285-01	TCGA-76-6285-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:43774798T>A	uc001ciu.2	+	8	1263	c.1184T>A	c.(1183-1185)CTC>CAC	p.L395H	TIE1_uc010okd.1_Missense_Mutation_p.L395H|TIE1_uc010oke.1_Missense_Mutation_p.L350H|TIE1_uc009vwq.2_Missense_Mutation_p.L351H|TIE1_uc010okf.1_Missense_Mutation_p.L40H|TIE1_uc010okg.1_Missense_Mutation_p.L40H|TIE1_uc010okc.1_Intron	NM_005424	NP_005415	P35590	TIE1_HUMAN	tyrosine kinase with immunoglobulin-like and	395	Ig-like C2-type 2.|Extracellular (Potential).				mesoderm development	integral to plasma membrane	ATP binding|protein binding|transmembrane receptor protein tyrosine kinase activity			lung(3)|stomach(1)|salivary_gland(1)|ovary(1)|skin(1)	7	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				GGCACTGTGCTCCTGGTCAGC	0.617													8	28	---	---	---	---	capture	Missense_Mutation	SNP	43774798	43774798	TIE1	1	T	A	A	A	1	0	0	0	0	1	0	0	0	702	54	4	4	15778	280
C8A	731	broad.mit.edu	37	1	57341829	57341829	+	Silent	SNP	C	T	T			TCGA-76-6285-01	TCGA-76-6285-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:57341829C>T	uc001cyo.2	+	4	543	c.411C>T	c.(409-411)GAC>GAT	p.D137D		NM_000562	NP_000553	P07357	CO8A_HUMAN	complement component 8, alpha polypeptide	137	MACPF.				complement activation, alternative pathway|complement activation, classical pathway|cytolysis	extracellular space|membrane attack complex				ovary(1)|central_nervous_system(1)|skin(1)	3						GGGCCATTGACGAAGACTGCA	0.532													31	36	---	---	---	---	capture	Silent	SNP	57341829	57341829	C8A	1	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	2393	280
FLG	2312	broad.mit.edu	37	1	152275685	152275685	+	Nonsense_Mutation	SNP	C	A	A			TCGA-76-6285-01	TCGA-76-6285-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152275685C>A	uc001ezu.1	-	3	11713	c.11677G>T	c.(11677-11679)GAG>TAG	p.E3893*		NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	3893	Ser-rich.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CTTGACTGCTCCCGAGAAGAT	0.537									Ichthyosis				37	59	---	---	---	---	capture	Nonsense_Mutation	SNP	152275685	152275685	FLG	1	C	A	A	A	1	0	0	0	0	0	1	0	0	390	30	5	4	5867	280
CD1D	912	broad.mit.edu	37	1	158153826	158153826	+	Splice_Site	SNP	G	A	A			TCGA-76-6285-01	TCGA-76-6285-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:158153826G>A	uc001frr.2	+	6	1485	c.986_splice	c.e6+1	p.T329_splice	CD1D_uc009wss.2_Splice_Site_p.T236_splice	NM_001766	NP_001757	P15813	CD1D_HUMAN	CD1D antigen precursor						antigen processing and presentation, endogenous lipid antigen via MHC class Ib|detection of bacterium|innate immune response|interspecies interaction between organisms|positive regulation of innate immune response|T cell selection	endosome membrane|integral to plasma membrane|lysosomal membrane	beta-2-microglobulin binding|exogenous lipid antigen binding|histone binding			ovary(1)	1	all_hematologic(112;0.0378)					AGAGGCAAACGTAAGTCTCCC	0.512													75	123	---	---	---	---	capture	Splice_Site	SNP	158153826	158153826	CD1D	1	G	A	A	A	1	0	0	0	0	0	0	1	0	520	40	5	1	2948	280
SH3BP5L	80851	broad.mit.edu	37	1	249106332	249106332	+	Nonsense_Mutation	SNP	C	A	A			TCGA-76-6285-01	TCGA-76-6285-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:249106332C>A	uc001iew.1	-	7	1501	c.949G>T	c.(949-951)GAG>TAG	p.E317*	SH3BP5L_uc010pzp.1_Nonsense_Mutation_p.E210*|SH3BP5L_uc010pzq.1_Nonsense_Mutation_p.E285*|SH3BP5L_uc001iev.1_Nonsense_Mutation_p.E198*	NM_030645	NP_085148	Q7L8J4	3BP5L_HUMAN	SH3-binding domain protein 5-like	317											0	all_cancers(71;3.33e-06)|all_epithelial(71;2.41e-06)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.0458)|Lung NSC(105;0.0494)|Melanoma(84;0.199)	all_cancers(173;0.19)	OV - Ovarian serous cystadenocarcinoma(106;0.00805)			CTGCCCTCCTCCAGCCCCGCA	0.731													13	9	---	---	---	---	capture	Nonsense_Mutation	SNP	249106332	249106332	SH3BP5L	1	C	A	A	A	1	0	0	0	0	0	1	0	0	390	30	5	4	14141	280
AGAP7	653268	broad.mit.edu	37	10	51465417	51465417	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6285-01	TCGA-76-6285-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:51465417C>T	uc001jio.2	-	7	1165	c.1039G>A	c.(1039-1041)GGG>AGG	p.G347R	PARG_uc001jih.2_Intron|uc010qha.1_Intron|uc001jin.2_Intron|uc010qhb.1_Intron|uc010qhc.1_Intron	NM_001077685	NP_001071153	Q5VUJ5	AGAP7_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH	347	PH.				regulation of ARF GTPase activity		ARF GTPase activator activity|zinc ion binding				0						TCACCCAGCCCGGTGTCCATG	0.552													86	25	---	---	---	---	capture	Missense_Mutation	SNP	51465417	51465417	AGAP7	10	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	373	280
HPSE2	60495	broad.mit.edu	37	10	100249842	100249842	+	Silent	SNP	G	A	A			TCGA-76-6285-01	TCGA-76-6285-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:100249842G>A	uc001kpn.1	-	10	1492	c.1432C>T	c.(1432-1434)CTA>TTA	p.L478L	HPSE2_uc009xwc.1_Silent_p.L468L|HPSE2_uc001kpo.1_Silent_p.L410L|HPSE2_uc009xwd.1_Silent_p.L356L	NM_021828	NP_068600	Q8WWQ2	HPSE2_HUMAN	heparanase 2	478					carbohydrate metabolic process	intracellular|membrane	cation binding|heparanase activity			ovary(1)	1				Epithelial(162;1.8e-09)|all cancers(201;4.72e-07)		TAAATCCTTAGTTTGTCCCGG	0.577													12	90	---	---	---	---	capture	Silent	SNP	100249842	100249842	HPSE2	10	G	A	A	A	1	0	0	0	0	0	0	0	1	464	36	2	2	7270	280
MUC6	4588	broad.mit.edu	37	11	1025025	1025025	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6285-01	TCGA-76-6285-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:1025025G>A	uc001lsw.2	-	24	3095	c.3044C>T	c.(3043-3045)ACG>ATG	p.T1015M		NM_005961	NP_005952	Q6W4X9	MUC6_HUMAN	mucin 6, gastric	1015	VWFD 3.				maintenance of gastrointestinal epithelium	extracellular region	extracellular matrix structural constituent			ovary(1)	1		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		CCTGCTGCGCGTCTCGAAGTC	0.637													17	27	---	---	---	---	capture	Missense_Mutation	SNP	1025025	1025025	MUC6	11	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	9890	280
NAV2	89797	broad.mit.edu	37	11	19955730	19955730	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6285-01	TCGA-76-6285-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:19955730C>T	uc010rdm.1	+	8	2370	c.2009C>T	c.(2008-2010)ACC>ATC	p.T670I	NAV2_uc001mpp.2_Missense_Mutation_p.T583I|NAV2_uc001mpr.3_Missense_Mutation_p.T647I	NM_145117	NP_660093	Q8IVL1	NAV2_HUMAN	neuron navigator 2 isoform 2	670						nucleus	ATP binding|helicase activity			skin(4)|ovary(1)|pancreas(1)	6						ACCACCCAGACCACAGGAAGC	0.582													31	41	---	---	---	---	capture	Missense_Mutation	SNP	19955730	19955730	NAV2	11	C	T	T	T	1	0	0	0	0	1	0	0	0	234	18	2	2	10091	280
CHRDL2	25884	broad.mit.edu	37	11	74429781	74429781	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6285-01	TCGA-76-6285-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:74429781C>T	uc001ovi.2	-	2	432	c.179G>A	c.(178-180)CGC>CAC	p.R60H	CHRDL2_uc001ovg.2_5'UTR|CHRDL2_uc001ovh.2_Missense_Mutation_p.R60H|CHRDL2_uc001ovk.1_Missense_Mutation_p.R60H			Q6WN34	CRDL2_HUMAN	RecName: Full=Chordin-like protein 2; AltName: Full=Chordin-related protein 2; AltName: Full=Breast tumor novel factor 1;          Short=BNF-1; Flags: Precursor;	60	VWFC 1.				cartilage development|cell differentiation|ossification	extracellular region|mitochondrion					0	Hepatocellular(1;0.098)					GCAGGTACAGCGCAGGCAGTA	0.597													5	19	---	---	---	---	capture	Missense_Mutation	SNP	74429781	74429781	CHRDL2	11	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	3339	280
PIK3C2G	5288	broad.mit.edu	37	12	18658397	18658397	+	Splice_Site	SNP	T	C	C			TCGA-76-6285-01	TCGA-76-6285-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:18658397T>C	uc001rdt.2	+	23	3316	c.3200_splice	c.e23+2	p.R1067_splice	PIK3C2G_uc010sia.1_Splice_Site|PIK3C2G_uc010sib.1_Splice_Site_p.R1108_splice|PIK3C2G_uc010sic.1_Splice_Site_p.R886_splice	NM_004570	NP_004561	O75747	P3C2G_HUMAN	phosphoinositide-3-kinase, class 2 gamma						cell communication|phosphatidylinositol-mediated signaling	membrane|phosphatidylinositol 3-kinase complex	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol binding|phosphatidylinositol-4-phosphate 3-kinase activity			lung(8)|central_nervous_system(6)|breast(3)|stomach(2)|ovary(2)	21		Hepatocellular(102;0.194)				GATAAAAAGGTCAGTGCACAA	0.368													8	10	---	---	---	---	capture	Splice_Site	SNP	18658397	18658397	PIK3C2G	12	T	C	C	C	1	0	0	0	0	0	0	1	0	754	58	5	3	11814	280
KRT6B	3854	broad.mit.edu	37	12	52841112	52841112	+	Silent	SNP	A	G	G			TCGA-76-6285-01	TCGA-76-6285-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:52841112A>G	uc001sak.2	-	9	1605	c.1557T>C	c.(1555-1557)AGT>AGC	p.S519S		NM_005555	NP_005546	P04259	K2C6B_HUMAN	keratin 6B	519	Tail.				ectoderm development	keratin filament	structural constituent of cytoskeleton			ovary(2)	2				BRCA - Breast invasive adenocarcinoma(357;0.083)		CGCCAAGACCACTGCCATAGG	0.622													24	39	---	---	---	---	capture	Silent	SNP	52841112	52841112	KRT6B	12	A	G	G	G	1	0	0	0	0	0	0	0	1	76	6	3	3	8401	280
GPR182	11318	broad.mit.edu	37	12	57389618	57389618	+	Nonsense_Mutation	SNP	G	T	T			TCGA-76-6285-01	TCGA-76-6285-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:57389618G>T	uc001smk.2	+	2	719	c.625G>T	c.(625-627)GAA>TAA	p.E209*	RDH16_uc010sqx.1_Intron	NM_007264	NP_009195	O15218	GP182_HUMAN	G protein-coupled receptor 182	209	Extracellular (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			lung(1)	1						GGCACCTTTTGAAACGTACAG	0.617													15	24	---	---	---	---	capture	Nonsense_Mutation	SNP	57389618	57389618	GPR182	12	G	T	T	T	1	0	0	0	0	0	1	0	0	585	45	5	4	6611	280
NAB2	4665	broad.mit.edu	37	12	57485446	57485446	+	Missense_Mutation	SNP	T	C	C			TCGA-76-6285-01	TCGA-76-6285-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:57485446T>C	uc001smz.2	+	2	1000	c.622T>C	c.(622-624)TTC>CTC	p.F208L		NM_005967	NP_005958	Q15742	NAB2_HUMAN	NGFI-A binding protein 2	208					cell proliferation|negative regulation of transcription from RNA polymerase III promoter|transcription, DNA-dependent	nucleus	transcription corepressor activity			upper_aerodigestive_tract(1)|ovary(1)	2						CTCGCCCCCCTTCTCCCCCCC	0.716													6	25	---	---	---	---	capture	Missense_Mutation	SNP	57485446	57485446	NAB2	12	T	C	C	C	1	0	0	0	0	1	0	0	0	728	56	3	3	10042	280
RASSF9	9182	broad.mit.edu	37	12	86199112	86199112	+	Missense_Mutation	SNP	C	G	G			TCGA-76-6285-01	TCGA-76-6285-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:86199112C>G	uc001taf.1	-	2	1015	c.676G>C	c.(676-678)GAT>CAT	p.D226H		NM_005447	NP_005438	O75901	RASF9_HUMAN	Ras association (RalGDS/AF-6) domain family	226	Potential.				endosome transport|protein targeting|signal transduction	cytosol|endosome|trans-Golgi network transport vesicle membrane	protein binding|transporter activity			ovary(1)	1						TTTTCTCCATCATTTTCTACT	0.398													4	160	---	---	---	---	capture	Missense_Mutation	SNP	86199112	86199112	RASSF9	12	C	G	G	G	1	0	0	0	0	1	0	0	0	377	29	4	4	12988	280
NR2C1	7181	broad.mit.edu	37	12	95445680	95445680	+	Missense_Mutation	SNP	C	A	A			TCGA-76-6285-01	TCGA-76-6285-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:95445680C>A	uc001tdm.3	-	8	1079	c.823G>T	c.(823-825)GTG>TTG	p.V275L	NR2C1_uc010suu.1_Missense_Mutation_p.V275L|NR2C1_uc001tdo.3_Missense_Mutation_p.V275L|NR2C1_uc001tdn.3_Missense_Mutation_p.V275L	NM_003297	NP_003288	P13056	NR2C1_HUMAN	nuclear receptor subfamily 2, group C, member 1	275					regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	PML body	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)	1						GATGTAACCACATTGGCCAAT	0.303													25	30	---	---	---	---	capture	Missense_Mutation	SNP	95445680	95445680	NR2C1	12	C	A	A	A	1	0	0	0	0	1	0	0	0	221	17	4	4	10529	280
NOS1	4842	broad.mit.edu	37	12	117710328	117710328	+	Silent	SNP	G	A	A			TCGA-76-6285-01	TCGA-76-6285-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:117710328G>A	uc001twm.1	-	10	2387	c.1701C>T	c.(1699-1701)TAC>TAT	p.Y567Y		NM_000620	NP_000611	P29475	NOS1_HUMAN	nitric oxide synthase 1, neuronal	567					multicellular organismal response to stress|myoblast fusion|negative regulation of calcium ion transport into cytosol|neurotransmitter biosynthetic process|nitric oxide biosynthetic process|platelet activation|positive regulation of vasodilation|regulation of cardiac muscle contraction|response to heat|response to hypoxia	cytoskeleton|cytosol|dendritic spine|perinuclear region of cytoplasm|photoreceptor inner segment|sarcolemma|sarcoplasmic reticulum	arginine binding|cadmium ion binding|calmodulin binding|flavin adenine dinucleotide binding|FMN binding|heme binding|NADP binding|nitric-oxide synthase activity|tetrahydrobiopterin binding			ovary(3)|skin(3)|pancreas(1)	7	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0561)	L-Citrulline(DB00155)	CGGGGAGGCCGTACCACTTCA	0.612													21	21	---	---	---	---	capture	Silent	SNP	117710328	117710328	NOS1	12	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	10448	280
GPR109B	8843	broad.mit.edu	37	12	123200222	123200222	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6285-01	TCGA-76-6285-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:123200222G>A	uc001ucy.3	-	1	1218	c.1063C>T	c.(1063-1065)CCC>TCC	p.P355S	GPR81_uc001ucw.1_Intron	NM_006018	NP_006009	P49019	HCAR3_HUMAN	G protein-coupled receptor 109B	355	Cytoplasmic (Potential).					integral to plasma membrane	purinergic nucleotide receptor activity, G-protein coupled			ovary(1)|skin(1)	2	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.12e-05)|Epithelial(86;3.19e-05)|BRCA - Breast invasive adenocarcinoma(302;0.196)	Mepenzolate(DB04843)|Niacin(DB00627)	AGATAAGAGGGGCTCCATGGC	0.537													57	79	---	---	---	---	capture	Missense_Mutation	SNP	123200222	123200222	GPR109B	12	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	6560	280
EML5	161436	broad.mit.edu	37	14	89130847	89130847	+	Nonsense_Mutation	SNP	C	T	T			TCGA-76-6285-01	TCGA-76-6285-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:89130847C>T	uc001xxg.2	-	24	3585	c.3399G>A	c.(3397-3399)TGG>TGA	p.W1133*	EML5_uc001xxf.2_5'UTR|EML5_uc001xxh.1_Nonsense_Mutation_p.W272*	NM_183387	NP_899243	Q05BV3	EMAL5_HUMAN	echinoderm microtubule associated protein like	1133						cytoplasm|microtubule				ovary(3)	3						CTCTAATATCCCAATCAATAT	0.308													34	9	---	---	---	---	capture	Nonsense_Mutation	SNP	89130847	89130847	EML5	14	C	T	T	T	1	0	0	0	0	0	1	0	0	286	22	5	2	5055	280
HS3ST4	9951	broad.mit.edu	37	16	26147153	26147153	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6285-01	TCGA-76-6285-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:26147153C>T	uc002dof.2	+	2	1347	c.955C>T	c.(955-957)CGG>TGG	p.R319W		NM_006040	NP_006031	Q9Y661	HS3S4_HUMAN	heparan sulfate D-glucosaminyl	319	Lumenal (Potential).				heparan sulfate proteoglycan metabolic process	extracellular region|Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity			large_intestine(1)|breast(1)	2				GBM - Glioblastoma multiforme(48;0.0988)		CTTCAAAAACCGGACCCTCGG	0.552													89	113	---	---	---	---	capture	Missense_Mutation	SNP	26147153	26147153	HS3ST4	16	C	T	T	T	1	0	0	0	0	1	0	0	0	295	23	1	1	7292	280
ZNF48	197407	broad.mit.edu	37	16	30409831	30409831	+	Silent	SNP	G	C	C			TCGA-76-6285-01	TCGA-76-6285-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:30409831G>C	uc002dya.1	+	2	1319	c.1260G>C	c.(1258-1260)TCG>TCC	p.S420S	ZNF48_uc002dxz.1_Silent_p.S297S	NM_152652	NP_689865	Q96MX3	ZNF48_HUMAN	zinc finger protein 48	420	Pro-rich.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						CCTCACACTCGGGTGAGCCTT	0.692													11	39	---	---	---	---	capture	Silent	SNP	30409831	30409831	ZNF48	16	G	C	C	C	1	0	0	0	0	0	0	0	1	496	39	4	4	17813	280
SHPK	23729	broad.mit.edu	37	17	3524530	3524530	+	Splice_Site	SNP	C	T	T			TCGA-76-6285-01	TCGA-76-6285-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:3524530C>T	uc002fvz.1	-	5	926	c.823_splice	c.e5+1	p.V275_splice		NM_013276	NP_037408	Q9UHJ6	SHPK_HUMAN	carbohydrate kinase-like						carbohydrate metabolic process	cytoplasm	ATP binding|sedoheptulokinase activity			ovary(1)	1				COAD - Colon adenocarcinoma(5;0.0828)		GAAAAACTTACCTGCATCTGT	0.522													8	6	---	---	---	---	capture	Splice_Site	SNP	3524530	3524530	SHPK	17	C	T	T	T	1	0	0	0	0	0	0	1	0	234	18	5	2	14183	280
ACACA	31	broad.mit.edu	37	17	35631152	35631152	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6285-01	TCGA-76-6285-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:35631152G>A	uc002hnm.2	-	9	1020	c.829C>T	c.(829-831)CGT>TGT	p.R277C	ACACA_uc002hnk.2_Missense_Mutation_p.R199C|ACACA_uc002hnl.2_Missense_Mutation_p.R219C|ACACA_uc002hnn.2_Missense_Mutation_p.R277C|ACACA_uc002hno.2_Missense_Mutation_p.R314C|ACACA_uc010cuz.2_Missense_Mutation_p.R277C|ACACA_uc002hnq.2_Missense_Mutation_p.R199C	NM_198836	NP_942133	Q13085	ACACA_HUMAN	acetyl-Coenzyme A carboxylase alpha isoform 2	277	Biotin carboxylation.|ATP-grasp.				acetyl-CoA metabolic process|energy reserve metabolic process|fatty acid biosynthetic process|long-chain fatty-acyl-CoA biosynthetic process|positive regulation of cellular metabolic process|protein homotetramerization|triglyceride biosynthetic process	cytosol	acetyl-CoA carboxylase activity|ATP binding|biotin carboxylase activity|metal ion binding|protein binding			large_intestine(1)|ovary(1)	2		Breast(25;0.00157)|Ovarian(249;0.15)			Biotin(DB00121)	TTTAAGATACGTTTTGAAAAA	0.408													48	17	---	---	---	---	capture	Missense_Mutation	SNP	35631152	35631152	ACACA	17	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	106	280
AOC2	314	broad.mit.edu	37	17	40997352	40997352	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6285-01	TCGA-76-6285-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:40997352G>A	uc002ibu.2	+	1	744	c.709G>A	c.(709-711)GTG>ATG	p.V237M	AOC2_uc002ibt.2_Missense_Mutation_p.V237M	NM_009590	NP_033720	O75106	AOC2_HUMAN	amine oxidase, copper containing 2 isoform b	237					catecholamine metabolic process|visual perception	cytoplasm|plasma membrane	aliphatic-amine oxidase activity|aminoacetone:oxygen oxidoreductase(deaminating) activity|copper ion binding|electron carrier activity|phenethylamine:oxygen oxidoreductase (deaminating) activity|primary amine oxidase activity|quinone binding|tryptamine:oxygen oxidoreductase (deaminating) activity			ovary(2)	2		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.156)		CCTTCACCCCGTGGGGCTGGA	0.612													48	10	---	---	---	---	capture	Missense_Mutation	SNP	40997352	40997352	AOC2	17	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	720	280
MYO5B	4645	broad.mit.edu	37	18	47463738	47463738	+	Silent	SNP	A	G	G			TCGA-76-6285-01	TCGA-76-6285-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:47463738A>G	uc002leb.2	-	15	2070	c.1782T>C	c.(1780-1782)GAT>GAC	p.D594D	MYO5B_uc002lec.1_Silent_p.D593D	NM_001080467	NP_001073936	Q9ULV0	MYO5B_HUMAN	myosin VB	594	Myosin head-like.				protein transport	myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			ovary(2)|skin(2)|central_nervous_system(1)	5				READ - Rectum adenocarcinoma(32;0.103)		GGTCCTTGTCATCATGAAACA	0.507													4	28	---	---	---	---	capture	Silent	SNP	47463738	47463738	MYO5B	18	A	G	G	G	1	0	0	0	0	0	0	0	1	102	8	3	3	9989	280
MIDN	90007	broad.mit.edu	37	19	1257154	1257154	+	Missense_Mutation	SNP	T	G	G			TCGA-76-6285-01	TCGA-76-6285-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:1257154T>G	uc002lrp.2	+	8	1805	c.1290T>G	c.(1288-1290)AGT>AGG	p.S430R		NM_177401	NP_796375	Q504T8	MIDN_HUMAN	midnolin	430						nucleolus					0		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCGACAGCAGTAGCAGCGGGG	0.682													25	28	---	---	---	---	capture	Missense_Mutation	SNP	1257154	1257154	MIDN	19	T	G	G	G	1	0	0	0	0	1	0	0	0	738	57	4	4	9491	280
ZNF492	57615	broad.mit.edu	37	19	22846866	22846866	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6285-01	TCGA-76-6285-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:22846866C>T	uc002nqw.3	+	4	639	c.395C>T	c.(394-396)ACG>ATG	p.T132M		NM_020855	NP_065906	Q9P255	ZN492_HUMAN	zinc finger protein 492	132					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_cancers(12;0.0266)|all_lung(12;0.00187)|Lung NSC(12;0.0019)|all_epithelial(12;0.00203)|Hepatocellular(1079;0.244)				AACAGACATACGATAAGACAT	0.308													9	14	---	---	---	---	capture	Missense_Mutation	SNP	22846866	22846866	ZNF492	19	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	17822	280
PAK4	10298	broad.mit.edu	37	19	39660357	39660357	+	Missense_Mutation	SNP	A	C	C	rs112229040		TCGA-76-6285-01	TCGA-76-6285-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:39660357A>C	uc002okj.1	+	4	625	c.164A>C	c.(163-165)GAC>GCC	p.D55A	PAK4_uc002okl.1_Missense_Mutation_p.D55A|PAK4_uc002okn.1_Missense_Mutation_p.D55A|PAK4_uc002okm.1_Missense_Mutation_p.D55A|PAK4_uc002oko.1_Missense_Mutation_p.D55A|PAK4_uc002okp.1_Missense_Mutation_p.D55A	NM_001014831	NP_001014831	O96013	PAK4_HUMAN	p21-activated kinase 4 isoform 1	55	Linker.				cellular component movement|signal transduction	Golgi apparatus	ATP binding|protein binding|protein serine/threonine kinase activity			lung(3)|ovary(1)	4	all_cancers(60;1.03e-07)|all_epithelial(25;9.66e-08)|all_lung(34;1.58e-07)|Lung NSC(34;1.88e-07)|Ovarian(47;0.0454)		Epithelial(26;4.82e-25)|all cancers(26;2.94e-22)|Lung(45;0.000797)|LUSC - Lung squamous cell carcinoma(53;0.00113)			CCCCTCGTCGACCCCGCCTGC	0.716													7	29	---	---	---	---	capture	Missense_Mutation	SNP	39660357	39660357	PAK4	19	A	C	C	C	1	0	0	0	0	1	0	0	0	130	10	4	4	11307	280
LTBP4	8425	broad.mit.edu	37	19	41129963	41129963	+	Missense_Mutation	SNP	G	C	C			TCGA-76-6285-01	TCGA-76-6285-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:41129963G>C	uc002ooh.1	+	30	4009	c.4009G>C	c.(4009-4011)GTC>CTC	p.V1337L	LTBP4_uc002oog.1_Missense_Mutation_p.V1300L|LTBP4_uc002ooi.1_Missense_Mutation_p.V1270L|LTBP4_uc002ooj.1_Missense_Mutation_p.V210L|LTBP4_uc002ook.1_Missense_Mutation_p.V471L|LTBP4_uc002ool.1_Missense_Mutation_p.V349L|LTBP4_uc010xvp.1_Missense_Mutation_p.V97L	NM_001042544	NP_001036009	Q8N2S1	LTBP4_HUMAN	latent transforming growth factor beta binding	1337	EGF-like 14; calcium-binding (Potential).				growth hormone secretion|multicellular organismal development|protein folding|regulation of cell differentiation|regulation of cell growth|regulation of proteolysis|regulation of transforming growth factor beta receptor signaling pathway	extracellular space|proteinaceous extracellular matrix	calcium ion binding|glycosaminoglycan binding|integrin binding|transforming growth factor beta binding|transforming growth factor beta receptor activity			central_nervous_system(1)	1			Lung(22;0.000158)|LUSC - Lung squamous cell carcinoma(20;0.000384)			GCGCCGCTGCGTCTCCAACGA	0.682													7	4	---	---	---	---	capture	Missense_Mutation	SNP	41129963	41129963	LTBP4	19	G	C	C	C	1	0	0	0	0	1	0	0	0	520	40	4	4	8991	280
SP3	6670	broad.mit.edu	37	2	174820235	174820235	+	Silent	SNP	A	G	G			TCGA-76-6285-01	TCGA-76-6285-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:174820235A>G	uc002uig.2	-	4	1169	c.1005T>C	c.(1003-1005)TCT>TCC	p.S335S	SP3_uc002uie.2_Silent_p.S267S|SP3_uc002uif.2_Silent_p.S282S|SP3_uc010zel.1_Silent_p.S332S	NM_003111	NP_003102	Q02447	SP3_HUMAN	Sp3 transcription factor isoform 1	335					negative regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	PML body	protein binding|zinc ion binding		EWSR1/SP3(3)	soft_tissue(3)|upper_aerodigestive_tract(1)|ovary(1)|skin(1)	6			OV - Ovarian serous cystadenocarcinoma(117;0.185)			ACTGTGATGAAGAGGATGTTG	0.378													68	106	---	---	---	---	capture	Silent	SNP	174820235	174820235	SP3	2	A	G	G	G	1	0	0	0	0	0	0	0	1	28	3	3	3	14857	280
GPR1	2825	broad.mit.edu	37	2	207041266	207041266	+	Nonsense_Mutation	SNP	G	A	A	rs34685097		TCGA-76-6285-01	TCGA-76-6285-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:207041266G>A	uc002vbl.3	-	3	1092	c.706C>T	c.(706-708)CGA>TGA	p.R236*	GPR1_uc010fue.2_Nonsense_Mutation_p.R236*|GPR1_uc010fuf.2_Nonsense_Mutation_p.R236*	NM_005279	NP_005270	P46091	GPR1_HUMAN	G protein-coupled receptor 1	236	Cytoplasmic (Potential).					integral to plasma membrane	G-protein coupled receptor activity				0		Lung NSC(271;7.93e-06)|Renal(323;0.000147)|Hepatocellular(293;0.000888)		UCEC - Uterine corpus endometrioid carcinoma (47;0.000241)|Epithelial(149;1.91e-37)|STAD - Stomach adenocarcinoma(1183;0.00178)|Lung(261;0.111)|LUSC - Lung squamous cell carcinoma(261;0.184)		AGGATGCTTCGCTTCTTCACC	0.438													37	51	---	---	---	---	capture	Nonsense_Mutation	SNP	207041266	207041266	GPR1	2	G	A	A	A	1	0	0	0	0	0	1	0	0	493	38	5	1	6555	280
COPS7B	64708	broad.mit.edu	37	2	232653347	232653347	+	Missense_Mutation	SNP	A	T	T			TCGA-76-6285-01	TCGA-76-6285-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:232653347A>T	uc002vsg.1	+	2	170	c.67A>T	c.(67-69)AGT>TGT	p.S23C	COPS7B_uc010fxy.1_Intron|COPS7B_uc002vsh.1_Missense_Mutation_p.S23C|COPS7B_uc002vsi.1_5'UTR|COPS7B_uc002vsj.1_5'Flank	NM_022730	NP_073567	Q9H9Q2	CSN7B_HUMAN	COP9 constitutive photomorphogenic homolog	23					cullin deneddylation	cytoplasm|signalosome				ovary(1)|liver(1)|skin(1)	3		all_hematologic(139;0.0123)|Acute lymphoblastic leukemia(138;0.0182)|Renal(207;0.025)		Epithelial(121;1.36e-12)|BRCA - Breast invasive adenocarcinoma(100;0.00136)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.0142)		CAAAGGTACCAGTGGCTCAGC	0.493													30	38	---	---	---	---	capture	Missense_Mutation	SNP	232653347	232653347	COPS7B	2	A	T	T	T	1	0	0	0	0	1	0	0	0	91	7	4	4	3704	280
TGM3	7053	broad.mit.edu	37	20	2298127	2298127	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6285-01	TCGA-76-6285-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:2298127G>A	uc002wfx.3	+	7	1076	c.979G>A	c.(979-981)GTA>ATA	p.V327I		NM_003245	NP_003236	Q08188	TGM3_HUMAN	transglutaminase 3 precursor	327					cell envelope organization|hair follicle morphogenesis|keratinization|peptide cross-linking|protein tetramerization	cytoplasm|extrinsic to internal side of plasma membrane	acyltransferase activity|calcium ion binding|GDP binding|GTP binding|GTPase activity|magnesium ion binding|protein-glutamine gamma-glutamyltransferase activity			large_intestine(4)|ovary(3)|breast(1)|skin(1)	9					L-Glutamine(DB00130)	TAGTGATAGCGTATGGTAAGT	0.507													71	91	---	---	---	---	capture	Missense_Mutation	SNP	2298127	2298127	TGM3	20	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	15716	280
CRNKL1	51340	broad.mit.edu	37	20	20033098	20033098	+	Silent	SNP	C	T	T			TCGA-76-6285-01	TCGA-76-6285-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:20033098C>T	uc002wrs.2	-	2	404	c.372G>A	c.(370-372)CCG>CCA	p.P124P	C20orf26_uc010gcw.1_5'Flank|C20orf26_uc010zse.1_5'Flank|C20orf26_uc002wru.2_5'Flank|CRNKL1_uc002wrt.1_Silent_p.P112P	NM_016652	NP_057736	Q9BZJ0	CRNL1_HUMAN	crooked neck-like 1 protein	124					spliceosome assembly	catalytic step 2 spliceosome|cytoplasm|nuclear speck	RNA binding			ovary(2)|large_intestine(1)	3						ATCTCGGAACCGGAAGCGGAA	0.592													24	29	---	---	---	---	capture	Silent	SNP	20033098	20033098	CRNKL1	20	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	3856	280
CD93	22918	broad.mit.edu	37	20	23065129	23065129	+	Silent	SNP	G	A	A			TCGA-76-6285-01	TCGA-76-6285-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:23065129G>A	uc002wsv.2	-	1	1849	c.1701C>T	c.(1699-1701)TCC>TCT	p.S567S		NM_012072	NP_036204	Q9NPY3	C1QR1_HUMAN	CD93 antigen precursor	567	Extracellular (Potential).				cell-cell adhesion|interspecies interaction between organisms|macrophage activation|phagocytosis	plasma membrane	calcium ion binding|complement component C1q binding|receptor activity|sugar binding			large_intestine(2)	2	Colorectal(13;0.0352)|Lung NSC(19;0.0542)|all_lung(19;0.118)					GTGTGGCCACGGAGGAGTCCC	0.637													42	64	---	---	---	---	capture	Silent	SNP	23065129	23065129	CD93	20	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	3018	280
BPIL1	80341	broad.mit.edu	37	20	31596448	31596448	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6285-01	TCGA-76-6285-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:31596448C>T	uc002wyj.2	+	2	262	c.68C>T	c.(67-69)CCA>CTA	p.P23L		NM_025227	NP_079503	Q8N4F0	BPIL1_HUMAN	bactericidal/permeability-increasing	23						extracellular region	lipid binding			skin(2)|large_intestine(1)|ovary(1)	4						GCCTCCACGCCAGGCACCGTG	0.622													4	11	---	---	---	---	capture	Missense_Mutation	SNP	31596448	31596448	BPIL1	20	C	T	T	T	1	0	0	0	0	1	0	0	0	273	21	2	2	1479	280
PREX1	57580	broad.mit.edu	37	20	47262489	47262489	+	Missense_Mutation	SNP	T	C	C			TCGA-76-6285-01	TCGA-76-6285-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:47262489T>C	uc002xtw.1	-	26	3435	c.3412A>G	c.(3412-3414)AGG>GGG	p.R1138G	PREX1_uc002xtv.1_Missense_Mutation_p.R435G	NM_020820	NP_065871	Q8TCU6	PREX1_HUMAN	phosphatidylinositol-3,4,	1138					actin filament polymerization|apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|neutrophil activation|small GTPase mediated signal transduction|superoxide metabolic process	cytosol|plasma membrane	enzyme binding|phospholipid binding|Rho GTPase activator activity|Rho guanyl-nucleotide exchange factor activity			lung(3)|ovary(2)|pancreas(1)	6			BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)			TGGTCACTCCTGTCCATCTCG	0.617													35	14	---	---	---	---	capture	Missense_Mutation	SNP	47262489	47262489	PREX1	20	T	C	C	C	1	0	0	0	0	1	0	0	0	713	55	3	3	12372	280
PRIC285	85441	broad.mit.edu	37	20	62197056	62197056	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6285-01	TCGA-76-6285-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:62197056G>A	uc002yfm.2	-	9	4011	c.3119C>T	c.(3118-3120)GCG>GTG	p.A1040V	PRIC285_uc002yfl.1_Missense_Mutation_p.A471V	NM_001037335	NP_001032412	Q9BYK8	PR285_HUMAN	PPAR-alpha interacting complex protein 285	1040	Ala-rich.				cellular lipid metabolic process|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleoplasm	ATP binding|DNA binding|helicase activity|ribonuclease activity|RNA binding|transcription coactivator activity|zinc ion binding			central_nervous_system(2)	2	all_cancers(38;2.51e-11)|all_epithelial(29;8.27e-13)		Epithelial(9;1.27e-08)|all cancers(9;7.32e-08)|BRCA - Breast invasive adenocarcinoma(10;5.15e-06)			CGCTCCTGCCGCACAGGCCCC	0.687													11	8	---	---	---	---	capture	Missense_Mutation	SNP	62197056	62197056	PRIC285	20	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	12381	280
IL17RA	23765	broad.mit.edu	37	22	17586805	17586805	+	Missense_Mutation	SNP	G	A	A	rs138404135		TCGA-76-6285-01	TCGA-76-6285-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:17586805G>A	uc002zly.2	+	11	1139	c.1006G>A	c.(1006-1008)GTC>ATC	p.V336I	IL17RA_uc010gqt.2_Intron	NM_014339	NP_055154	Q96F46	I17RA_HUMAN	interleukin 17A receptor precursor	336	Helical; (Potential).				fibroblast activation|positive regulation of interleukin-23 production	integral to plasma membrane	interleukin-17 receptor activity			skin(2)	2		all_epithelial(15;0.0181)|Lung NSC(13;0.109)|all_lung(157;0.132)		Colorectal(9;0.241)		GGTGGGCTCCGTCATCCTGCT	0.423													22	16	---	---	---	---	capture	Missense_Mutation	SNP	17586805	17586805	IL17RA	22	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	7562	280
MYO18B	84700	broad.mit.edu	37	22	26159232	26159232	+	Missense_Mutation	SNP	C	T	T	rs79294358	by1000genomes	TCGA-76-6285-01	TCGA-76-6285-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:26159232C>T	uc003abz.1	+	3	324	c.74C>T	c.(73-75)TCG>TTG	p.S25L	MYO18B_uc003aca.1_5'UTR|MYO18B_uc010guy.1_5'UTR|MYO18B_uc010guz.1_5'UTR|MYO18B_uc011aka.1_5'UTR	NM_032608	NP_115997	Q8IUG5	MY18B_HUMAN	myosin XVIIIB	25						nucleus|sarcomere|unconventional myosin complex	actin binding|ATP binding|motor activity			ovary(5)|central_nervous_system(3)|large_intestine(2)|breast(2)	12						CCACCATCCTCGCCCCCTCCT	0.542													15	21	---	---	---	---	capture	Missense_Mutation	SNP	26159232	26159232	MYO18B	22	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	9976	280
FAM109B	150368	broad.mit.edu	37	22	42473575	42473575	+	Missense_Mutation	SNP	C	G	G			TCGA-76-6285-01	TCGA-76-6285-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:42473575C>G	uc003bbz.2	+	3	465	c.278C>G	c.(277-279)GCC>GGC	p.A93G	C22orf32_uc003bca.2_5'Flank	NM_001002034	NP_001002034	Q6ICB4	SESQ2_HUMAN	hypothetical protein LOC150368	93	PH.				endosome organization|receptor recycling|retrograde transport, endosome to Golgi	clathrin-coated vesicle|early endosome|recycling endosome|trans-Golgi network	protein homodimerization activity				0						TGCTTTGATGCCCCTGGAGTG	0.682													43	21	---	---	---	---	capture	Missense_Mutation	SNP	42473575	42473575	FAM109B	22	C	G	G	G	1	0	0	0	0	1	0	0	0	338	26	4	4	5349	280
CNTN6	27255	broad.mit.edu	37	3	1339608	1339608	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6285-01	TCGA-76-6285-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:1339608C>T	uc003boz.2	+	7	961	c.694C>T	c.(694-696)CGT>TGT	p.R232C	CNTN6_uc010hbo.2_Missense_Mutation_p.R227C|CNTN6_uc011asj.1_Missense_Mutation_p.R160C|CNTN6_uc003bpa.2_Missense_Mutation_p.R232C	NM_014461	NP_055276	Q9UQ52	CNTN6_HUMAN	contactin 6 precursor	232	Ig-like C2-type 3.				axon guidance|cell adhesion|central nervous system development|Notch signaling pathway	anchored to membrane|plasma membrane				skin(3)|lung(2)|breast(2)|pancreas(1)	8		all_cancers(2;0.000164)|all_epithelial(2;0.107)		Epithelial(13;0.000233)|all cancers(10;0.0013)|OV - Ovarian serous cystadenocarcinoma(96;0.0139)		GATTGAAGTGCGTTTTCCTGA	0.338													45	118	---	---	---	---	capture	Missense_Mutation	SNP	1339608	1339608	CNTN6	3	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	3610	280
FBLN2	2199	broad.mit.edu	37	3	13613045	13613045	+	Missense_Mutation	SNP	C	A	A			TCGA-76-6285-01	TCGA-76-6285-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:13613045C>A	uc011avb.1	+	2	1315	c.1190C>A	c.(1189-1191)GCC>GAC	p.A397D	FBLN2_uc011auz.1_Missense_Mutation_p.A423D|FBLN2_uc011ava.1_Missense_Mutation_p.A397D|FBLN2_uc011avc.1_Missense_Mutation_p.A397D	NM_001998	NP_001989	P98095	FBLN2_HUMAN	fibulin 2 isoform b precursor	397	Subdomain NB (Cys-free).|N.					proteinaceous extracellular matrix	calcium ion binding|extracellular matrix structural constituent			ovary(1)	1			UCEC - Uterine corpus endometrioid carcinoma (1;0.00416)			CCTGATGCAGCCTGGATCCCA	0.622													7	21	---	---	---	---	capture	Missense_Mutation	SNP	13613045	13613045	FBLN2	3	C	A	A	A	1	0	0	0	0	1	0	0	0	338	26	4	4	5645	280
TRH	7200	broad.mit.edu	37	3	129696024	129696024	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6285-01	TCGA-76-6285-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:129696024C>T	uc003enc.2	+	3	1255	c.694C>T	c.(694-696)CGG>TGG	p.R232W		NM_007117	NP_009048	P20396	TRH_HUMAN	thyrotropin-releasing hormone	232					cell-cell signaling|hormone-mediated signaling pathway	extracellular region|soluble fraction	neuropeptide hormone activity|thyrotropin-releasing hormone activity			ovary(1)	1						CCCTGGTCGGCGGGCAGCCTG	0.622													21	23	---	---	---	---	capture	Missense_Mutation	SNP	129696024	129696024	TRH	3	C	T	T	T	1	0	0	0	0	1	0	0	0	347	27	1	1	16361	280
HLTF	6596	broad.mit.edu	37	3	148768105	148768105	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6285-01	TCGA-76-6285-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:148768105C>T	uc003ewq.1	-	15	1749	c.1531G>A	c.(1531-1533)GGT>AGT	p.G511S	HLTF_uc003ewr.1_Missense_Mutation_p.G511S|HLTF_uc003ews.1_Missense_Mutation_p.G510S|HLTF_uc010hve.1_Missense_Mutation_p.G510S	NM_139048	NP_620636	Q14527	HLTF_HUMAN	helicase-like transcription factor	511	Helicase ATP-binding.				chromatin modification|transcription, DNA-dependent	nucleus	ATP binding|DNA binding|helicase activity|ligase activity|zinc ion binding			ovary(1)	1			LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)			CGATCAGGACCATAATAAACA	0.299													38	91	---	---	---	---	capture	Missense_Mutation	SNP	148768105	148768105	HLTF	3	C	T	T	T	1	0	0	0	0	1	0	0	0	273	21	2	2	7140	280
ACCN5	51802	broad.mit.edu	37	4	156764907	156764907	+	Missense_Mutation	SNP	C	A	A			TCGA-76-6285-01	TCGA-76-6285-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:156764907C>A	uc003ipe.1	-	5	834	c.787G>T	c.(787-789)GTG>TTG	p.V263L		NM_017419	NP_059115	Q9NY37	ACCN5_HUMAN	amiloride-sensitive cation channel 5,	263	Extracellular (Potential).					integral to membrane|plasma membrane				ovary(2)|skin(1)	3	all_hematologic(180;0.24)	Renal(120;0.0458)		KIRC - Kidney renal clear cell carcinoma(143;0.0464)|Kidney(143;0.058)|COAD - Colon adenocarcinoma(41;0.141)		AACTGTGGCACCTTCTTTGGT	0.453													30	13	---	---	---	---	capture	Missense_Mutation	SNP	156764907	156764907	ACCN5	4	C	A	A	A	1	0	0	0	0	1	0	0	0	234	18	4	4	132	280
TAS2R1	50834	broad.mit.edu	37	5	9629468	9629468	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6285-01	TCGA-76-6285-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:9629468G>A	uc003jem.1	-	1	996	c.677C>T	c.(676-678)GCG>GTG	p.A226V		NM_019599	NP_062545	Q9NYW7	TA2R1_HUMAN	taste receptor T2R1	226	Helical; Name=6; (Potential).				chemosensory behavior|sensory perception of taste	integral to membrane	taste receptor activity			ovary(3)	3						AGACAGCAACGCGCTGATGGG	0.498													27	41	---	---	---	---	capture	Missense_Mutation	SNP	9629468	9629468	TAS2R1	5	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	15453	280
ITGA2	3673	broad.mit.edu	37	5	52344242	52344242	+	Missense_Mutation	SNP	C	T	T	rs148042733		TCGA-76-6285-01	TCGA-76-6285-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:52344242C>T	uc003joy.2	+	5	580	c.437C>T	c.(436-438)ACG>ATG	p.T146M	ITGA2_uc011cqa.1_RNA|ITGA2_uc011cqb.1_RNA|ITGA2_uc011cqc.1_Missense_Mutation_p.T70M|ITGA2_uc011cqd.1_RNA|ITGA2_uc011cqe.1_RNA	NM_002203	NP_002194	P17301	ITA2_HUMAN	integrin alpha 2 precursor	146	Extracellular (Potential).|FG-GAP 2.				axon guidance|blood coagulation|cell-matrix adhesion|integrin-mediated signaling pathway|interspecies interaction between organisms|organ morphogenesis	integrin complex	collagen binding|identical protein binding|receptor activity			lung(1)	1		Lung NSC(810;3.11e-05)|Breast(144;0.014)|Prostate(461;0.0181)				TATTACACAACGGGTGTGTGT	0.438													26	50	---	---	---	---	capture	Missense_Mutation	SNP	52344242	52344242	ITGA2	5	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	7798	280
ACTBL2	345651	broad.mit.edu	37	5	56778423	56778423	+	Missense_Mutation	SNP	G	A	A	rs78342986	byFrequency;by1000genomes	TCGA-76-6285-01	TCGA-76-6285-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:56778423G>A	uc003jrm.2	-	1	214	c.112C>T	c.(112-114)CGT>TGT	p.R38C		NM_001017992	NP_001017992	Q562R1	ACTBL_HUMAN	actin, beta-like 2	38						cytoplasm|cytoskeleton	ATP binding			ovary(3)	3		Lung NSC(810;0.000135)|Prostate(74;0.055)|Breast(144;0.0707)|Ovarian(174;0.182)		OV - Ovarian serous cystadenocarcinoma(10;4.24e-37)		TGTCGAGGACGCCCTATCATG	0.592													15	23	---	---	---	---	capture	Missense_Mutation	SNP	56778423	56778423	ACTBL2	5	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	194	280
RGNEF	64283	broad.mit.edu	37	5	73148496	73148496	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6285-01	TCGA-76-6285-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:73148496C>T	uc011csq.1	+	13	1780	c.1769C>T	c.(1768-1770)TCG>TTG	p.S590L	RGNEF_uc003kcx.2_Missense_Mutation_p.S590L|RGNEF_uc003kcy.1_3'UTR|RGNEF_uc010izf.2_Missense_Mutation_p.S590L|RGNEF_uc011csr.1_Missense_Mutation_p.S277L	NM_001080479	NP_001073948	Q8N1W1	RGNEF_HUMAN	Rho-guanine nucleotide exchange factor	590					cell differentiation|intracellular signal transduction|regulation of Rho protein signal transduction	cytoplasm|plasma membrane	metal ion binding|Rho guanyl-nucleotide exchange factor activity|RNA binding				0		Lung NSC(167;0.0378)|all_lung(232;0.04)|Ovarian(174;0.0798)		OV - Ovarian serous cystadenocarcinoma(47;1.25e-51)		TACAGCTTATCGGAGCCACCA	0.378													9	194	---	---	---	---	capture	Missense_Mutation	SNP	73148496	73148496	RGNEF	5	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	13178	280
SLC27A6	28965	broad.mit.edu	37	5	128368954	128368954	+	Missense_Mutation	SNP	G	T	T			TCGA-76-6285-01	TCGA-76-6285-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:128368954G>T	uc003kuy.2	+	11	2235	c.1839G>T	c.(1837-1839)ATG>ATT	p.M613I	SLC27A6_uc003kuz.2_Missense_Mutation_p.M613I	NM_014031	NP_054750	Q9Y2P4	S27A6_HUMAN	solute carrier family 27 (fatty acid	613					long-chain fatty acid transport|transmembrane transport|very long-chain fatty acid metabolic process	integral to membrane|sarcolemma	fatty acid transporter activity|long-chain fatty acid-CoA ligase activity|nucleotide binding				0		all_cancers(142;0.0483)|Prostate(80;0.055)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Epithelial(69;0.171)|OV - Ovarian serous cystadenocarcinoma(64;0.186)		ATCAAATAATGTTAGGGGAAA	0.318													25	36	---	---	---	---	capture	Missense_Mutation	SNP	128368954	128368954	SLC27A6	5	G	T	T	T	1	0	0	0	0	1	0	0	0	624	48	4	4	14422	280
HLA-DOA	3111	broad.mit.edu	37	6	32975124	32975124	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6285-01	TCGA-76-6285-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:32975124G>A	uc003ocr.2	-	3	653	c.577C>T	c.(577-579)CAC>TAC	p.H193Y	HLA-DOA_uc010juj.2_Missense_Mutation_p.H163Y|HLA-DOA_uc010jui.2_Missense_Mutation_p.H193Y	NM_002119	NP_002110	P06340	DOA_HUMAN	major histocompatibility complex, class II, DO	193	Extracellular (Potential).|Alpha-2.|Ig-like C1-type.				antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|interferon-gamma-mediated signaling pathway|T cell costimulation|T cell receptor signaling pathway	endosome membrane|integral to membrane|lysosomal membrane|MHC class II protein complex	MHC class II receptor activity				0						AGGCCCCAGTGCTCCACCTGG	0.597													59	69	---	---	---	---	capture	Missense_Mutation	SNP	32975124	32975124	HLA-DOA	6	G	A	A	A	1	0	0	0	0	1	0	0	0	598	46	2	2	7125	280
VPS52	6293	broad.mit.edu	37	6	33238055	33238055	+	Silent	SNP	A	C	C			TCGA-76-6285-01	TCGA-76-6285-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:33238055A>C	uc003odm.1	-	2	306	c.96T>G	c.(94-96)GGT>GGG	p.G32G	VPS52_uc003odn.1_5'UTR|VPS52_uc003odo.1_5'UTR|VPS52_uc011dqy.1_5'UTR|VPS52_uc011dqz.1_5'UTR|RPS18_uc003odp.1_5'Flank|RPS18_uc010jum.1_5'Flank|RPS18_uc003odq.1_5'Flank	NM_022553	NP_072047	Q8N1B4	VPS52_HUMAN	vacuolar protein sorting 52	32					protein transport	endosome membrane|Golgi apparatus				ovary(4)|skin(1)	5						GCCCAGGACCACCCGCCTGGA	0.483													6	87	---	---	---	---	capture	Silent	SNP	33238055	33238055	VPS52	6	A	C	C	C	1	0	0	0	0	0	0	0	1	67	6	4	4	17096	280
TBX18	9096	broad.mit.edu	37	6	85446874	85446874	+	Silent	SNP	C	T	T			TCGA-76-6285-01	TCGA-76-6285-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:85446874C>T	uc003pkl.1	-	8	1353	c.1353G>A	c.(1351-1353)CCG>CCA	p.P451P	TBX18_uc010kbq.1_Intron	NM_001080508	NP_001073977	O95935	TBX18_HUMAN	T-box 18	451					multicellular organismal development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(2)|pancreas(2)|lung(1)	5		all_cancers(76;0.000283)|Acute lymphoblastic leukemia(125;3.66e-08)|all_hematologic(105;8.61e-05)|all_epithelial(107;0.0858)		BRCA - Breast invasive adenocarcinoma(108;0.0267)		GAGTCCTGGGCGGGGCAAAGG	0.612													38	12	---	---	---	---	capture	Silent	SNP	85446874	85446874	TBX18	6	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	15540	280
TPD52L1	7164	broad.mit.edu	37	6	125541243	125541243	+	Silent	SNP	G	A	A			TCGA-76-6285-01	TCGA-76-6285-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:125541243G>A	uc003pzu.1	+	2	258	c.39G>A	c.(37-39)CCG>CCA	p.P13P	TPD52L1_uc003pzv.1_Silent_p.P13P|TPD52L1_uc003pzw.1_Silent_p.P13P|TPD52L1_uc003pzx.1_5'UTR|TPD52L1_uc003pzy.1_5'UTR|TPD52L1_uc003pzz.1_5'UTR	NM_003287	NP_003278	Q16890	TPD53_HUMAN	tumor protein D52-like 1 isoform 1	13					DNA fragmentation involved in apoptotic nuclear change|G2/M transition of mitotic cell cycle|induction of apoptosis|positive regulation of JNK cascade|positive regulation of MAP kinase activity	perinuclear region of cytoplasm	caspase activator activity|protein heterodimerization activity|protein homodimerization activity				0			LUSC - Lung squamous cell carcinoma(4;0.0263)|Lung(4;0.0828)	GBM - Glioblastoma multiforme(226;0.0265)		AGACTGAACCGTTGCAAGGAA	0.348													41	7	---	---	---	---	capture	Silent	SNP	125541243	125541243	TPD52L1	6	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	16281	280
SYNJ2	8871	broad.mit.edu	37	6	158454502	158454502	+	Silent	SNP	C	T	T			TCGA-76-6285-01	TCGA-76-6285-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:158454502C>T	uc003qqx.1	+	4	576	c.501C>T	c.(499-501)CAC>CAT	p.H167H	SYNJ2_uc011efm.1_RNA|SYNJ2_uc003qqw.1_Silent_p.H167H|SYNJ2_uc003qqy.1_Translation_Start_Site|SYNJ2_uc011efn.1_Silent_p.H116H|SYNJ2_uc010kjo.1_Silent_p.H116H	NM_003898	NP_003889	O15056	SYNJ2_HUMAN	synaptojanin 2	167	SAC.						nucleotide binding|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity|RNA binding			skin(1)	1				OV - Ovarian serous cystadenocarcinoma(65;4.42e-18)|BRCA - Breast invasive adenocarcinoma(81;4.23e-05)		AGCTGTTGCACGTGCCCTTGA	0.572													18	5	---	---	---	---	capture	Silent	SNP	158454502	158454502	SYNJ2	6	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	15341	280
SYNJ2	8871	broad.mit.edu	37	6	158483049	158483049	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6285-01	TCGA-76-6285-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:158483049C>T	uc003qqx.1	+	8	1055	c.980C>T	c.(979-981)GCG>GTG	p.A327V	SYNJ2_uc011efm.1_Intron|SYNJ2_uc003qqw.1_Missense_Mutation_p.A327V|SYNJ2_uc003qqy.1_Missense_Mutation_p.A40V|SYNJ2_uc011efn.1_Intron|SYNJ2_uc010kjo.1_Missense_Mutation_p.A276V|SYNJ2_uc003qqz.1_5'UTR	NM_003898	NP_003889	O15056	SYNJ2_HUMAN	synaptojanin 2	327	SAC.						nucleotide binding|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity|RNA binding			skin(1)	1				OV - Ovarian serous cystadenocarcinoma(65;4.42e-18)|BRCA - Breast invasive adenocarcinoma(81;4.23e-05)		TCTTGCCACGCGGGCGACACG	0.383													102	36	---	---	---	---	capture	Missense_Mutation	SNP	158483049	158483049	SYNJ2	6	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	15341	280
AGPAT4	56895	broad.mit.edu	37	6	161587289	161587289	+	Silent	SNP	C	T	T			TCGA-76-6285-01	TCGA-76-6285-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:161587289C>T	uc003qtr.1	-	3	566	c.339G>A	c.(337-339)GGG>GGA	p.G113G	AGPAT4_uc003qts.1_Intron|AGPAT4_uc011egb.1_Intron|AGPAT4_uc003qtt.1_RNA|AGPAT4_uc011egc.1_Silent_p.G113G|AGPAT4_uc011egd.1_Silent_p.G51G|AGPAT4_uc011ege.1_Intron	NM_020133	NP_064518	Q9NRZ5	PLCD_HUMAN	1-acylglycerol-3-phosphate O-acyltransferase 4	113					phospholipid biosynthetic process	integral to membrane	1-acylglycerol-3-phosphate O-acyltransferase activity|protein binding				0		Breast(66;0.000289)|Ovarian(120;0.0266)|Prostate(117;0.0285)		OV - Ovarian serous cystadenocarcinoma(65;2.23e-17)|BRCA - Breast invasive adenocarcinoma(81;3.58e-05)		CCCCTAACAGCCCAAAGCGTT	0.507													10	3	---	---	---	---	capture	Silent	SNP	161587289	161587289	AGPAT4	6	C	T	T	T	1	0	0	0	0	0	0	0	1	327	26	2	2	389	280
TYW1	55253	broad.mit.edu	37	7	66532361	66532361	+	Silent	SNP	G	A	A			TCGA-76-6285-01	TCGA-76-6285-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:66532361G>A	uc003tvn.2	+	10	1394	c.1245G>A	c.(1243-1245)GCG>GCA	p.A415A	TYW1_uc010lai.2_RNA|TYW1_uc011kef.1_Silent_p.A29A	NM_018264	NP_060734	Q9NV66	TYW1_HUMAN	radical S-adenosyl methionine and flavodoxin	415					tRNA processing		4 iron, 4 sulfur cluster binding|FMN binding|iron ion binding|oxidoreductase activity			skin(1)	1		Lung NSC(55;0.0846)|all_lung(88;0.183)				CGAGCTTGGCGTGTGCTAATA	0.458													62	104	---	---	---	---	capture	Silent	SNP	66532361	66532361	TYW1	7	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	16700	280
C7orf51	222950	broad.mit.edu	37	7	100086489	100086489	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6285-01	TCGA-76-6285-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:100086489C>T	uc003uvd.1	+	4	1304	c.1145C>T	c.(1144-1146)ACG>ATG	p.T382M	C7orf51_uc003uve.1_Missense_Mutation_p.T164M	NM_173564	NP_775835	Q6ZVC0	CG051_HUMAN	hypothetical protein FLJ37538	382	Pro-rich.									skin(1)	1	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					GAGCGGGAGACGCCTCCCCCA	0.706													11	32	---	---	---	---	capture	Missense_Mutation	SNP	100086489	100086489	C7orf51	7	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	2377	280
RELN	5649	broad.mit.edu	37	7	103341383	103341383	+	Silent	SNP	C	T	T			TCGA-76-6285-01	TCGA-76-6285-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:103341383C>T	uc003vca.2	-	9	1036	c.876G>A	c.(874-876)GCG>GCA	p.A292A	RELN_uc010liz.2_Silent_p.A292A	NM_005045	NP_005036	P78509	RELN_HUMAN	reelin isoform a	292					axon guidance|cell adhesion|cerebral cortex tangential migration|glial cell differentiation|neuron migration|peptidyl-tyrosine phosphorylation|positive regulation of protein kinase activity|positive regulation of small GTPase mediated signal transduction|response to pain|spinal cord patterning	cytoplasm|dendrite|extracellular space|proteinaceous extracellular matrix	metal ion binding|protein serine/threonine/tyrosine kinase activity|serine-type peptidase activity			ovary(8)|upper_aerodigestive_tract(5)|large_intestine(2)|central_nervous_system(2)|skin(1)|pancreas(1)	19				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		GAATCCAGTCCGCAGAGTTAT	0.358													48	147	---	---	---	---	capture	Silent	SNP	103341383	103341383	RELN	7	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	13115	280
SPAM1	6677	broad.mit.edu	37	7	123595133	123595133	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6285-01	TCGA-76-6285-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:123595133G>A	uc003vld.2	+	5	1439	c.1037G>A	c.(1036-1038)CGA>CAA	p.R346Q	SPAM1_uc003vle.2_Missense_Mutation_p.R346Q|SPAM1_uc011koa.1_Missense_Mutation_p.R2Q|SPAM1_uc003vlf.3_Missense_Mutation_p.R346Q|SPAM1_uc010lku.2_Missense_Mutation_p.R346Q	NM_153189	NP_694859	P38567	HYALP_HUMAN	sperm adhesion molecule 1 isoform 2	346					binding of sperm to zona pellucida|carbohydrate metabolic process|cell adhesion|fusion of sperm to egg plasma membrane	anchored to membrane|plasma membrane	hyalurononglucosaminidase activity			ovary(3)|kidney(1)	4					Hyaluronidase(DB00070)	AGTATAATGCGAAGTATGGTA	0.294													63	213	---	---	---	---	capture	Missense_Mutation	SNP	123595133	123595133	SPAM1	7	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	14878	280
CHRM2	1129	broad.mit.edu	37	7	136700700	136700700	+	Missense_Mutation	SNP	G	A	A	rs147228075		TCGA-76-6285-01	TCGA-76-6285-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:136700700G>A	uc003vtf.1	+	4	1711	c.1088G>A	c.(1087-1089)CGC>CAC	p.R363H	CHRM2_uc003vtg.1_Missense_Mutation_p.R363H|CHRM2_uc003vtj.1_Missense_Mutation_p.R363H|CHRM2_uc003vtk.1_Missense_Mutation_p.R363H|CHRM2_uc003vtl.1_Missense_Mutation_p.R363H|CHRM2_uc003vtm.1_Missense_Mutation_p.R363H|CHRM2_uc003vti.1_Missense_Mutation_p.R363H|CHRM2_uc003vto.1_Missense_Mutation_p.R363H|CHRM2_uc003vtn.1_Missense_Mutation_p.R363H|uc003vtp.1_Intron	NM_001006630	NP_001006631	P08172	ACM2_HUMAN	cholinergic receptor, muscarinic 2	363	Cytoplasmic (By similarity).				activation of phospholipase C activity by muscarinic acetylcholine receptor signaling pathway|G-protein signaling, coupled to cAMP nucleotide second messenger|nervous system development|regulation of heart contraction|response to virus	cell junction|integral to plasma membrane|postsynaptic membrane	muscarinic acetylcholine receptor activity|protein binding			ovary(4)|central_nervous_system(1)	5					Anisotropine Methylbromide(DB00517)|Atropine(DB00572)|Benzquinamide(DB00767)|Carbachol(DB00411)|Cryptenamine(DB00785)|Cyclizine(DB01176)|Desipramine(DB01151)|Diphenidol(DB01231)|Doxacurium(DB01334)|Doxacurium chloride(DB01135)|Flavoxate(DB01148)|Gallamine Triethiodide(DB00483)|Homatropine Methylbromide(DB00725)|Hyoscyamine(DB00424)|Ipratropium(DB00332)|Methotrimeprazine(DB01403)|Metixene(DB00340)|Metocurine(DB01336)|Mivacurium(DB01226)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Pilocarpine(DB01085)|Procyclidine(DB00387)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Rocuronium(DB00728)|Thiethylperazine(DB00372)|Tolterodine(DB01036)|Tridihexethyl(DB00505)|Triflupromazine(DB00508)	ATTGTAGCCCGCAAGATTGTG	0.468													26	79	---	---	---	---	capture	Missense_Mutation	SNP	136700700	136700700	CHRM2	7	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	3342	280
EIF3E	3646	broad.mit.edu	37	8	109240547	109240547	+	Missense_Mutation	SNP	T	C	C			TCGA-76-6285-01	TCGA-76-6285-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:109240547T>C	uc003ymu.2	-	7	699	c.671A>G	c.(670-672)AAT>AGT	p.N224S	EIF3E_uc003ymt.2_Missense_Mutation_p.N175S|EIF3E_uc003ymv.2_Missense_Mutation_p.N131S|EIF3E_uc010mci.1_Missense_Mutation_p.N224S	NM_001568	NP_001559	P60228	EIF3E_HUMAN	eukaryotic translation initiation factor 3,	224					negative regulation of translational initiation|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay	cytosol|eukaryotic translation initiation factor 3 complex|PML body	protein N-terminus binding			ovary(2)|kidney(1)	3			OV - Ovarian serous cystadenocarcinoma(57;6.84e-10)			TTTGGGGTGATTGAAGAAAAC	0.343													51	65	---	---	---	---	capture	Missense_Mutation	SNP	109240547	109240547	EIF3E	8	T	C	C	C	1	0	0	0	0	1	0	0	0	676	52	3	3	4970	280
BAI1	575	broad.mit.edu	37	8	143558906	143558906	+	Silent	SNP	C	T	T			TCGA-76-6285-01	TCGA-76-6285-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:143558906C>T	uc003ywm.2	+	5	1566	c.1383C>T	c.(1381-1383)TGC>TGT	p.C461C		NM_001702	NP_001693	O14514	BAI1_HUMAN	brain-specific angiogenesis inhibitor 1	461	Extracellular (Potential).|TSP type-1 3.				axonogenesis|cell adhesion|negative regulation of angiogenesis|negative regulation of cell proliferation|neuropeptide signaling pathway|peripheral nervous system development	cell-cell junction|integral to plasma membrane	G-protein coupled receptor activity|protein binding			lung(3)|ovary(2)|breast(1)|central_nervous_system(1)|pancreas(1)	8	all_cancers(97;2.84e-12)|all_epithelial(106;5.91e-09)|Lung NSC(106;0.000322)|all_lung(105;0.000616)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)					TTGCCCTGTGCCCTGGTAGGT	0.657													3	49	---	---	---	---	capture	Silent	SNP	143558906	143558906	BAI1	8	C	T	T	T	1	0	0	0	0	0	0	0	1	337	26	2	2	1287	280
METTL11A	28989	broad.mit.edu	37	9	132394975	132394975	+	Translation_Start_Site	SNP	G	A	A			TCGA-76-6285-01	TCGA-76-6285-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:132394975G>A	uc004byd.1	+	2	187	c.-7G>A	c.(-9--5)TGGTG>TGATG		METTL11A_uc010myw.1_RNA|METTL11A_uc011mbs.1_Translation_Start_Site	NM_014064	NP_054783	Q9BV86	NTM1A_HUMAN	methyltransferase like 11A						chromosome segregation|N-terminal peptidyl-proline dimethylation|N-terminal peptidyl-serine dimethylation|N-terminal peptidyl-serine trimethylation|spindle organization	nucleus	protein binding|protein methyltransferase activity				0						GCCGTGGTTGGTGACAGCATG	0.577													14	24	---	---	---	---	capture	Translation_Start_Site	SNP	132394975	132394975	METTL11A	9	G	A	A	A	1	0	0	0	0	0	0	0	0	560	44	2	2	9407	280
USP51	158880	broad.mit.edu	37	X	55514642	55514642	+	Missense_Mutation	SNP	T	C	C			TCGA-76-6285-01	TCGA-76-6285-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:55514642T>C	uc004dun.1	-	2	810	c.731A>G	c.(730-732)AAC>AGC	p.N244S	USP51_uc011moo.1_Intron	NM_201286	NP_958443	Q70EK9	UBP51_HUMAN	ubiquitin specific protease 51	244	UBP-type.				ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|ubiquitin thiolesterase activity|zinc ion binding			ovary(1)|lung(1)|breast(1)	3						GTGGAGTCTGTTCATATGGGT	0.448													39	5	---	---	---	---	capture	Missense_Mutation	SNP	55514642	55514642	USP51	23	T	C	C	C	1	0	0	0	0	1	0	0	0	780	60	3	3	16965	280
POF1B	79983	broad.mit.edu	37	X	84562214	84562214	+	Silent	SNP	G	A	A			TCGA-76-6285-01	TCGA-76-6285-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:84562214G>A	uc004eer.2	-	11	1265	c.1119C>T	c.(1117-1119)TAC>TAT	p.Y373Y	POF1B_uc004ees.2_Silent_p.Y373Y	NM_024921	NP_079197	Q8WVV4	POF1B_HUMAN	premature ovarian failure, 1B	373	Potential.						actin binding				0						AGAGTTCTTCGTACTCTTTTA	0.333													22	6	---	---	---	---	capture	Silent	SNP	84562214	84562214	POF1B	23	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	12085	280
AP2A2	161	broad.mit.edu	37	11	926039	926039	+	Frame_Shift_Del	DEL	G	-	-			TCGA-76-6285-01	TCGA-76-6285-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:926039delG	uc001lss.2	+	1	199	c.18delG	c.(16-18)AAGfs	p.K6fs	AP2A2_uc001lst.1_Frame_Shift_Del_p.K6fs|AP2A2_uc009yco.1_RNA	NM_012305	NP_036437	O94973	AP2A2_HUMAN	adaptor-related protein complex 2, alpha 2	6	Lipid-binding.				axon guidance|endocytosis|epidermal growth factor receptor signaling pathway|intracellular protein transport|negative regulation of epidermal growth factor receptor signaling pathway|nerve growth factor receptor signaling pathway|regulation of defense response to virus by virus|synaptic transmission|viral reproduction	AP-2 adaptor complex|cytosol	lipid binding|protein transporter activity				0		all_cancers(49;9.46e-06)|Breast(177;0.00257)|all_epithelial(84;0.0027)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;1.75e-24)|BRCA - Breast invasive adenocarcinoma(625;5.73e-05)|Lung(200;0.0696)|LUSC - Lung squamous cell carcinoma(625;0.082)		CCGTGTCCAAGGGGGACGGGA	0.572													2	4	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	926039	926039	AP2A2	11	G	-	-	-	1	0	1	0	1	0	0	0	0	451	35	5	5	733	280
