Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
TTC4	7268	broad.mit.edu	37	1	55207175	55207175	+	Missense_Mutation	SNP	C	G	G			TCGA-76-6286-01	TCGA-76-6286-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:55207175C>G	uc001cxx.3	+	10	1206	c.1153C>G	c.(1153-1155)CAG>GAG	p.Q385E	C1orf175_uc001cxq.2_RNA|TTC4_uc001cxw.3_Missense_Mutation_p.Q286E|TTC4_uc001cxv.2_Missense_Mutation_p.Q396E	NM_004623	NP_004614	O95801	TTC4_HUMAN	tetratricopeptide repeat domain 4	385							binding				0						AAAGGTGTACCAGATACGATG	0.517													62	72	---	---	---	---	capture	Missense_Mutation	SNP	55207175	55207175	TTC4	1	C	G	G	G	1	0	0	0	0	1	0	0	0	273	21	4	4	16592	281
RPE65	6121	broad.mit.edu	37	1	68905261	68905261	+	Missense_Mutation	SNP	C	A	A			TCGA-76-6286-01	TCGA-76-6286-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:68905261C>A	uc001dei.1	-	7	762	c.708G>T	c.(706-708)AAG>AAT	p.K236N		NM_000329	NP_000320	Q16518	RPE65_HUMAN	retinal pigment epithelium-specific protein	236					visual perception	cytoplasm|plasma membrane	all-trans-retinyl-palmitate hydrolase activity|metal ion binding|retinol isomerase activity			ovary(1)	1						CGTAAGATGGCTTGAATCGGT	0.403													33	46	---	---	---	---	capture	Missense_Mutation	SNP	68905261	68905261	RPE65	1	C	A	A	A	1	0	0	0	0	1	0	0	0	363	28	4	4	13437	281
NBPF10	100132406	broad.mit.edu	37	1	145367767	145367767	+	Missense_Mutation	SNP	G	A	A	rs77484671		TCGA-76-6286-01	TCGA-76-6286-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:145367767G>A	uc001end.3	+	85	10623	c.10588G>A	c.(10588-10590)GAA>AAA	p.E3530K	NBPF9_uc010oye.1_Intron|NBPF10_uc001emp.3_Intron|NBPF10_uc010oyi.1_Intron|NBPF10_uc010oyk.1_Intron|NBPF10_uc010oyl.1_Intron	NM_001039703	NP_001034792	A6NDV3	A6NDV3_HUMAN	hypothetical protein LOC100132406	3455											0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		atcaaagaaggaaagaagaag	0.254													5	55	---	---	---	---	capture	Missense_Mutation	SNP	145367767	145367767	NBPF10	1	G	A	A	A	1	0	0	0	0	1	0	0	0	533	41	2	2	10100	281
RPRD2	23248	broad.mit.edu	37	1	150437160	150437160	+	Silent	SNP	T	A	A			TCGA-76-6286-01	TCGA-76-6286-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:150437160T>A	uc009wlr.2	+	10	1770	c.1569T>A	c.(1567-1569)TCT>TCA	p.S523S	RPRD2_uc010pcc.1_Silent_p.S497S|RPRD2_uc001eup.3_Silent_p.S497S	NM_015203	NP_056018	Q5VT52	RPRD2_HUMAN	Regulation of nuclear pre-mRNA domain containing	523	Ser-rich.						protein binding			ovary(1)	1						GCATTCTGTCTGCACTTTCCA	0.502											OREG0013786	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	9	16	---	---	---	---	capture	Silent	SNP	150437160	150437160	RPRD2	1	T	A	A	A	1	0	0	0	0	0	0	0	1	704	55	4	4	13509	281
SLC9A11	284525	broad.mit.edu	37	1	173526582	173526582	+	Missense_Mutation	SNP	C	G	G			TCGA-76-6286-01	TCGA-76-6286-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:173526582C>G	uc001giz.2	-	10	1535	c.1112G>C	c.(1111-1113)TGG>TCG	p.W371S	SLC9A11_uc009wwe.2_5'UTR|SLC9A11_uc010pmq.1_RNA	NM_178527	NP_848622	Q5TAH2	S9A11_HUMAN	solute carrier family 9, member 11	371					sodium ion transport	integral to membrane	ion channel activity|solute:hydrogen antiporter activity			ovary(2)	2						TACAACTCCCCATCGCCAATT	0.368													74	143	---	---	---	---	capture	Missense_Mutation	SNP	173526582	173526582	SLC9A11	1	C	G	G	G	1	0	0	0	0	1	0	0	0	273	21	4	4	14603	281
RYR2	6262	broad.mit.edu	37	1	237791219	237791219	+	Silent	SNP	C	T	T			TCGA-76-6286-01	TCGA-76-6286-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:237791219C>T	uc001hyl.1	+	41	6399	c.6279C>T	c.(6277-6279)GAC>GAT	p.D2093D		NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	2093	Cytoplasmic (By similarity).|4 X approximate repeats.				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			GGCAGTATGACGGCATTGGGG	0.552													11	29	---	---	---	---	capture	Silent	SNP	237791219	237791219	RYR2	1	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	13661	281
KIAA0913	23053	broad.mit.edu	37	10	75556970	75556970	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6286-01	TCGA-76-6286-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:75556970G>A	uc009xrl.2	+	17	3391	c.3359G>A	c.(3358-3360)CGT>CAT	p.R1120H	KIAA0913_uc001jve.2_Missense_Mutation_p.R1125H|KIAA0913_uc001jvf.2_Missense_Mutation_p.R1120H|KIAA0913_uc001jvh.2_RNA|KIAA0913_uc001jvi.2_Missense_Mutation_p.R555H|KIAA0913_uc010qkr.1_Missense_Mutation_p.R543H|KIAA0913_uc001jvj.2_Missense_Mutation_p.R543H|KIAA0913_uc009xrn.1_5'Flank	NM_015037	NP_055852	A7E2V4	K0913_HUMAN	hypothetical protein LOC23053	1120							zinc ion binding			breast(1)	1	Prostate(51;0.0112)					CTTGGCAGTCGTGGAGGCTAT	0.577													26	4	---	---	---	---	capture	Missense_Mutation	SNP	75556970	75556970	KIAA0913	10	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	8122	281
PTEN	5728	broad.mit.edu	37	10	89720661	89720661	+	Missense_Mutation	SNP	T	C	C	rs142420551		TCGA-76-6286-01	TCGA-76-6286-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:89720661T>C	uc001kfb.2	+	9	1843	c.812T>C	c.(811-813)TTT>TCT	p.F271S		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog	271	C2 tensin-type.				activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.R55fs*1(4)|p.?(2)|p.N212fs*1(2)|p.Y27fs*1(2)|p.F271S(2)|p.D268_F279>VGQNVSLLGKYI(2)|p.F271fs*5(1)|p.G165_*404del(1)|p.F271L(1)|p.G165_K342del(1)		endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		GACAAAATGTTTCACTTTTGG	0.249		31	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			16	3	---	---	---	---	capture	Missense_Mutation	SNP	89720661	89720661	PTEN	10	T	C	C	C	1	0	0	0	0	1	0	0	0	832	64	3	3	12633	281
MUC5B	727897	broad.mit.edu	37	11	1273709	1273709	+	Silent	SNP	G	A	A			TCGA-76-6286-01	TCGA-76-6286-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:1273709G>A	uc009ycr.1	+	53	16092	c.15966G>A	c.(15964-15966)TCG>TCA	p.S5322S	MUC5B_uc001ltb.2_Silent_p.S5003S	NM_017511	NP_059981	Q9HC84	MUC5B_HUMAN	SubName: Full=Mucin 5AC, oligomeric mucus/gel-forming;	5000					cell adhesion	extracellular region	extracellular matrix structural constituent|protein binding				0		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CGCTGTCCTCGCCCTCCCCTG	0.682													4	19	---	---	---	---	capture	Silent	SNP	1273709	1273709	MUC5B	11	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	9889	281
OR5P2	120065	broad.mit.edu	37	11	7818411	7818411	+	Nonsense_Mutation	SNP	G	A	A			TCGA-76-6286-01	TCGA-76-6286-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:7818411G>A	uc001mfp.1	-	1	79	c.79C>T	c.(79-81)CGA>TGA	p.R27*		NM_153444	NP_703145	Q8WZ92	OR5P2_HUMAN	olfactory receptor, family 5, subfamily P,	27	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(2)|central_nervous_system(1)	5				Epithelial(150;8.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)		AGGATGACTCGAAGGATTGGA	0.428													28	32	---	---	---	---	capture	Nonsense_Mutation	SNP	7818411	7818411	OR5P2	11	G	A	A	A	1	0	0	0	0	0	1	0	0	480	37	5	1	11082	281
OR5W2	390148	broad.mit.edu	37	11	55681277	55681277	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6286-01	TCGA-76-6286-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:55681277C>T	uc010rir.1	-	1	782	c.782G>A	c.(781-783)CGG>CAG	p.R261Q		NM_001001960	NP_001001960	Q8NH69	OR5W2_HUMAN	olfactory receptor, family 5, subfamily W,	261	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	p.R261W(1)		ovary(1)|skin(1)	2						AGAACTTGGCCGGAAATACAT	0.443													37	50	---	---	---	---	capture	Missense_Mutation	SNP	55681277	55681277	OR5W2	11	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	11089	281
MAP3K11	4296	broad.mit.edu	37	11	65375157	65375157	+	Silent	SNP	C	T	T			TCGA-76-6286-01	TCGA-76-6286-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:65375157C>T	uc001oew.2	-	4	1693	c.1200G>A	c.(1198-1200)AAG>AAA	p.K400K	MAP3K11_uc001oev.2_5'Flank|MAP3K11_uc010rol.1_Silent_p.K143K|MAP3K11_uc001oex.1_5'UTR	NM_002419	NP_002410	Q16584	M3K11_HUMAN	mitogen-activated protein kinase kinase kinase	400					activation of JUN kinase activity|cell proliferation|G1 phase of mitotic cell cycle|microtubule-based process|positive regulation of JNK cascade|protein autophosphorylation	centrosome|microtubule	ATP binding|JUN kinase kinase kinase activity|mitogen-activated protein kinase kinase kinase binding|protein homodimerization activity			breast(3)|lung(1)|central_nervous_system(1)|skin(1)	6						GGATCTCGCGCTTCCAGCCTT	0.617													37	11	---	---	---	---	capture	Silent	SNP	65375157	65375157	MAP3K11	11	C	T	T	T	1	0	0	0	0	0	0	0	1	363	28	2	2	9159	281
HEPHL1	341208	broad.mit.edu	37	11	93808410	93808410	+	Silent	SNP	C	T	T	rs61746203		TCGA-76-6286-01	TCGA-76-6286-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:93808410C>T	uc001pep.2	+	9	1732	c.1575C>T	c.(1573-1575)AGC>AGT	p.S525S	uc001pen.1_Intron	NM_001098672	NP_001092142	Q6MZM0	HPHL1_HUMAN	hephaestin-like 1 precursor	525	Plastocyanin-like 3.|Extracellular (Potential).				copper ion transport	integral to membrane	copper ion binding|oxidoreductase activity			ovary(3)	3		Acute lymphoblastic leukemia(157;2.34e-05)|all_hematologic(158;0.00824)				TGCCTGAGAGCGTAAGCCCAA	0.468													15	26	---	---	---	---	capture	Silent	SNP	93808410	93808410	HEPHL1	11	C	T	T	T	1	0	0	0	0	0	0	0	1	350	27	1	1	6981	281
PDZD3	79849	broad.mit.edu	37	11	119059542	119059542	+	Missense_Mutation	SNP	G	T	T			TCGA-76-6286-01	TCGA-76-6286-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:119059542G>T	uc001pwb.2	+	7	1975	c.1451G>T	c.(1450-1452)TGT>TTT	p.C484F	PDZD3_uc001pvy.2_Missense_Mutation_p.C404F|PDZD3_uc001pvz.2_Missense_Mutation_p.C418F|PDZD3_uc010rzd.1_Missense_Mutation_p.C405F|PDZD3_uc001pwa.2_Missense_Mutation_p.C114F			Q86UT5	NHRF4_HUMAN	RecName: Full=Na(+)/H(+) exchange regulatory cofactor NHE-RF4;          Short=NHERF-4; AltName: Full=PDZ domain-containing protein 3; AltName: Full=PDZ domain-containing protein 2; AltName: Full=Intestinal and kidney-enriched PDZ protein; AltName: Full=Sodium-hydrogen exchanger regulatory factor 4;	484	PDZ 4.				cGMP-mediated signaling|ion transport|negative regulation of cGMP biosynthetic process|response to toxin|water transport	apical part of cell|brush border|cytosol|membrane fraction|subapical complex	guanylate cyclase inhibitor activity|ion channel inhibitor activity|protein C-terminus binding			breast(1)	1	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0523)|Breast(348;0.174)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;7.52e-05)		CGACTCAGTTGTGTGGCCAGT	0.572													30	44	---	---	---	---	capture	Missense_Mutation	SNP	119059542	119059542	PDZD3	11	G	T	T	T	1	0	0	0	0	1	0	0	0	624	48	4	4	11605	281
CSDA	8531	broad.mit.edu	37	12	10854621	10854621	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6286-01	TCGA-76-6286-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:10854621G>A	uc001qyt.2	-	8	1234	c.991C>T	c.(991-993)CGT>TGT	p.R331C	CSDA_uc001qyu.2_Missense_Mutation_p.R262C	NM_003651	NP_003642	P16989	DBPA_HUMAN	cold shock domain protein A isoform a	331					negative regulation of transcription from RNA polymerase II promoter|response to cold	cytoplasm|nucleus	double-stranded DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity			ovary(2)|lung(1)|large_intestine(1)	4	Glioma(1;0.155)					TTGTAGGGACGCCGGTATCCA	0.567													98	105	---	---	---	---	capture	Missense_Mutation	SNP	10854621	10854621	CSDA	12	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	3892	281
KRT86	3892	broad.mit.edu	37	12	52699175	52699175	+	Nonsense_Mutation	SNP	G	A	A			TCGA-76-6286-01	TCGA-76-6286-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:52699175G>A	uc010snq.1	+	6	1020	c.887G>A	c.(886-888)TGG>TAG	p.W296*	KRT86_uc009zmg.2_Nonsense_Mutation_p.W296*|KRT81_uc001sac.2_Intron|KRT86_uc001sad.2_Nonsense_Mutation_p.W296*	NM_002284	NP_002275	O43790	KRT86_HUMAN	keratin 86	296	Rod.|Coil 2.				cytoskeleton organization	keratin filament	structural molecule activity			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(357;0.189)		GCCGAGTCCTGGTACCGCAGC	0.542													38	48	---	---	---	---	capture	Nonsense_Mutation	SNP	52699175	52699175	KRT86	12	G	A	A	A	1	0	0	0	0	0	1	0	0	611	47	5	2	8420	281
PTPRB	5787	broad.mit.edu	37	12	70990028	70990028	+	Silent	SNP	A	G	G			TCGA-76-6286-01	TCGA-76-6286-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:70990028A>G	uc001swb.3	-	3	435	c.405T>C	c.(403-405)TCT>TCC	p.S135S	PTPRB_uc010sto.1_Silent_p.S135S|PTPRB_uc010stp.1_Silent_p.S135S|PTPRB_uc001swc.3_Silent_p.S353S|PTPRB_uc001swa.3_Silent_p.S353S|PTPRB_uc001swd.3_Silent_p.S352S|PTPRB_uc009zrr.1_Silent_p.S232S|PTPRB_uc001swe.2_Silent_p.S353S	NM_002837	NP_002828	P23467	PTPRB_HUMAN	protein tyrosine phosphatase, receptor type, B	135	Fibronectin type-III 2.|Extracellular (Potential).				angiogenesis	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(2)|skin(1)	3	Renal(347;0.236)		GBM - Glioblastoma multiforme(2;2.17e-05)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00306)|STAD - Stomach adenocarcinoma(21;0.149)			CTTTTCCGGAAGAAGGAGTCC	0.408													4	59	---	---	---	---	capture	Silent	SNP	70990028	70990028	PTPRB	12	A	G	G	G	1	0	0	0	0	0	0	0	1	28	3	3	3	12691	281
RIMBP2	23504	broad.mit.edu	37	12	130907060	130907060	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6286-01	TCGA-76-6286-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:130907060C>T	uc001uil.2	-	13	2572	c.2408G>A	c.(2407-2409)CGG>CAG	p.R803Q		NM_015347	NP_056162	O15034	RIMB2_HUMAN	RIM-binding protein 2	803						cell junction|synapse				upper_aerodigestive_tract(3)|ovary(3)|large_intestine(2)|central_nervous_system(2)|pancreas(1)	11	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.213)		OV - Ovarian serous cystadenocarcinoma(86;4.29e-06)|all cancers(50;4.56e-05)|Epithelial(86;5.41e-05)		GGGAAACCTCCGGCCCATGTG	0.567													21	17	---	---	---	---	capture	Missense_Mutation	SNP	130907060	130907060	RIMBP2	12	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	13255	281
SACS	26278	broad.mit.edu	37	13	23913301	23913301	+	Missense_Mutation	SNP	T	C	C			TCGA-76-6286-01	TCGA-76-6286-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:23913301T>C	uc001uon.2	-	10	5303	c.4714A>G	c.(4714-4716)ATT>GTT	p.I1572V	SACS_uc001uoo.2_Missense_Mutation_p.I1425V|SACS_uc001uop.1_Intron|SACS_uc001uoq.1_Intron	NM_014363	NP_055178	Q9NZJ4	SACS_HUMAN	sacsin	1572					cell death|negative regulation of inclusion body assembly|protein folding	axon|cell body fiber|dendrite|mitochondrion|nucleus	ATP binding|chaperone binding|Hsp70 protein binding|proteasome binding			ovary(7)|skin(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	12		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		CGACTCATAATGATGGGAATG	0.338													4	29	---	---	---	---	capture	Missense_Mutation	SNP	23913301	23913301	SACS	13	T	C	C	C	1	0	0	0	0	1	0	0	0	663	51	3	3	13696	281
RB1	5925	broad.mit.edu	37	13	48941694	48941694	+	Nonsense_Mutation	SNP	T	G	G			TCGA-76-6286-01	TCGA-76-6286-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:48941694T>G	uc001vcb.2	+	10	1170	c.1004T>G	c.(1003-1005)TTA>TGA	p.L335*	RB1_uc010act.1_Nonsense_Mutation_p.L36*	NM_000321	NP_000312	P06400	RB_HUMAN	retinoblastoma 1	335					androgen receptor signaling pathway|cell cycle arrest|chromatin remodeling|G1 phase of mitotic cell cycle|interspecies interaction between organisms|maintenance of mitotic sister chromatid cohesion|mitotic cell cycle G1/S transition checkpoint|myoblast differentiation|negative regulation of cell growth|negative regulation of protein kinase activity|negative regulation of S phase of mitotic cell cycle|negative regulation of sequence-specific DNA binding transcription factor activity|positive regulation of mitotic metaphase/anaphase transition|protein localization to chromosome, centromeric region|Ras protein signal transduction|regulation of centromere complex assembly|regulation of cohesin localization to chromatin|regulation of lipid kinase activity|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle|sister chromatid biorientation	chromatin|PML body|Rb-E2F complex|SWI/SNF complex	androgen receptor binding|DNA binding|kinase binding|phosphoprotein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription factor binding|ubiquitin protein ligase binding	p.?(6)		lung(94)|eye(89)|central_nervous_system(47)|bone(22)|breast(21)|urinary_tract(17)|haematopoietic_and_lymphoid_tissue(14)|ovary(10)|prostate(9)|soft_tissue(8)|skin(7)|endometrium(5)|cervix(3)|liver(3)|salivary_gland(2)|stomach(2)|oesophagus(1)|adrenal_gland(1)|kidney(1)|gastrointestinal_tract_(site_indeterminate)(1)|pituitary(1)	358		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	GATGCAAGATTATTTTTGGAT	0.284		6	D|Mis|N|F|S		retinoblastoma|sarcoma|breast|small cell lung	retinoblastoma|sarcoma|breast|small cell lung			Hereditary_Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)			79	23	---	---	---	---	capture	Nonsense_Mutation	SNP	48941694	48941694	RB1	13	T	G	G	G	1	0	0	0	0	0	1	0	0	793	61	5	4	12993	281
FARP1	10160	broad.mit.edu	37	13	98865588	98865588	+	Missense_Mutation	SNP	C	T	T	rs113972742		TCGA-76-6286-01	TCGA-76-6286-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:98865588C>T	uc001vnj.2	+	2	428	c.92C>T	c.(91-93)CCG>CTG	p.P31L	FARP1_uc001vnh.2_Missense_Mutation_p.P31L|FARP1_uc001vni.2_Missense_Mutation_p.P31L	NM_005766	NP_005757	Q9Y4F1	FARP1_HUMAN	FERM, RhoGEF, and pleckstrin domain protein 1	31					regulation of Rho protein signal transduction	cytoplasm|cytoskeleton|extrinsic to membrane	cytoskeletal protein binding|Rho guanyl-nucleotide exchange factor activity			breast(2)	2	all_neural(89;0.0982)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		BRCA - Breast invasive adenocarcinoma(86;0.233)			GGACAGAAGCCGCCCCCAACA	0.537													6	136	---	---	---	---	capture	Missense_Mutation	SNP	98865588	98865588	FARP1	13	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	5622	281
OR11H12	440153	broad.mit.edu	37	14	19378054	19378054	+	Missense_Mutation	SNP	A	C	C			TCGA-76-6286-01	TCGA-76-6286-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:19378054A>C	uc010tkp.1	+	1	461	c.461A>C	c.(460-462)CAT>CCT	p.H154P		NM_001013354	NP_001013372	B2RN74	O11HC_HUMAN	olfactory receptor, family 11, subfamily H,	154	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		ATGACTGGGCATCTCTGTGCC	0.478													75	423	---	---	---	---	capture	Missense_Mutation	SNP	19378054	19378054	OR11H12	14	A	C	C	C	1	0	0	0	0	1	0	0	0	104	8	4	4	10831	281
DYNC1H1	1778	broad.mit.edu	37	14	102467294	102467294	+	Nonsense_Mutation	SNP	C	T	T			TCGA-76-6286-01	TCGA-76-6286-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:102467294C>T	uc001yks.2	+	19	4242	c.4078C>T	c.(4078-4080)CGA>TGA	p.R1360*		NM_001376	NP_001367	Q14204	DYHC1_HUMAN	cytoplasmic dynein 1 heavy chain 1	1360	Stem (By similarity).|Potential.				cytoplasmic mRNA processing body assembly|G2/M transition of mitotic cell cycle|microtubule-based movement|mitotic spindle organization|stress granule assembly|transport	centrosome|cytoplasmic dynein complex|cytosol|Golgi apparatus|microtubule	ATP binding|ATPase activity, coupled|microtubule motor activity|protein binding			ovary(7)|central_nervous_system(2)|pancreas(1)	10						TCGACAGCTTCGACAAAATTT	0.373													59	73	---	---	---	---	capture	Nonsense_Mutation	SNP	102467294	102467294	DYNC1H1	14	C	T	T	T	1	0	0	0	0	0	1	0	0	399	31	5	1	4796	281
EHD4	30844	broad.mit.edu	37	15	42193062	42193062	+	Silent	SNP	G	A	A			TCGA-76-6286-01	TCGA-76-6286-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:42193062G>A	uc001zot.2	-	6	1470	c.1407C>T	c.(1405-1407)AAC>AAT	p.N469N		NM_139265	NP_644670	Q9H223	EHD4_HUMAN	EH-domain containing 4	469	EH.				endocytic recycling|protein homooligomerization	early endosome membrane|endoplasmic reticulum|nucleus|recycling endosome membrane	ATP binding|calcium ion binding|GTP binding|GTPase activity|nucleic acid binding|protein binding			ovary(2)	2		all_cancers(109;2.54e-12)|all_epithelial(112;6.59e-11)|Lung NSC(122;2.17e-07)|all_lung(180;8.79e-07)|Melanoma(134;0.091)		OV - Ovarian serous cystadenocarcinoma(18;1.6e-19)|GBM - Glioblastoma multiforme(94;3.77e-06)|COAD - Colon adenocarcinoma(120;0.0474)|Colorectal(105;0.0538)		CCTTCTTGGCGTTGACACCTG	0.592													4	35	---	---	---	---	capture	Silent	SNP	42193062	42193062	EHD4	15	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	4935	281
KIF7	374654	broad.mit.edu	37	15	90188330	90188330	+	Missense_Mutation	SNP	C	T	T	rs149078926	byFrequency	TCGA-76-6286-01	TCGA-76-6286-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:90188330C>T	uc002bof.2	-	10	2182	c.2105G>A	c.(2104-2106)CGG>CAG	p.R702Q	KIF7_uc010upw.1_Missense_Mutation_p.R188Q	NM_198525	NP_940927	Q2M1P5	KIF7_HUMAN	kinesin family member 7	702	Potential.				microtubule-based movement|negative regulation of smoothened signaling pathway|positive regulation of smoothened signaling pathway	cilium	ATP binding|microtubule motor activity|protein binding			ovary(2)|lung(1)	3	Lung NSC(78;0.0237)|all_lung(78;0.0478)		BRCA - Breast invasive adenocarcinoma(143;0.128)			CTGGGCCAGCCGCCACTCTGA	0.652													27	3	---	---	---	---	capture	Missense_Mutation	SNP	90188330	90188330	KIF7	15	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	8231	281
NXN	64359	broad.mit.edu	37	17	708351	708351	+	Silent	SNP	G	A	A			TCGA-76-6286-01	TCGA-76-6286-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:708351G>A	uc002fsa.2	-	6	1049	c.957C>T	c.(955-957)AAC>AAT	p.N319N	NXN_uc010vqd.1_Intron|NXN_uc002frz.2_Silent_p.N70N|NXN_uc010vqe.1_Silent_p.N211N	NM_022463	NP_071908	Q6DKJ4	NXN_HUMAN	nucleoredoxin	319	Thioredoxin.				cell differentiation|cell redox homeostasis|multicellular organismal development|Wnt receptor signaling pathway	cytosol|nucleus	protein-disulfide reductase activity			ovary(2)|breast(1)|pancreas(1)	4				UCEC - Uterine corpus endometrioid carcinoma (25;0.0237)		GCTGCGCGGCGTTGGAGTCGG	0.692													5	17	---	---	---	---	capture	Silent	SNP	708351	708351	NXN	17	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	10692	281
TP53	7157	broad.mit.edu	37	17	7572986	7572986	+	Missense_Mutation	SNP	G	T	T			TCGA-76-6286-01	TCGA-76-6286-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7572986G>T	uc002gim.2	-	11	1317	c.1123C>A	c.(1123-1125)CAG>AAG	p.Q375K	TP53_uc002gig.1_Intron|TP53_uc002gih.2_Intron|TP53_uc010cne.1_RNA|TP53_uc010cnf.1_3'UTR|TP53_uc010cng.1_3'UTR|TP53_uc002gii.1_Missense_Mutation_p.Q243K|TP53_uc010cnh.1_3'UTR|TP53_uc010cni.1_3'UTR|TP53_uc002gij.2_Missense_Mutation_p.Q375K	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	375	Basic (repression of DNA-binding).|Interaction with CARM1.				activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.0?(7)|p.?(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		GAGGTAGACTGACCCTTTTTG	0.527		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			40	68	---	---	---	---	capture	Missense_Mutation	SNP	7572986	7572986	TP53	17	G	T	T	T	1	0	0	0	0	1	0	0	0	585	45	4	4	16264	281
TP53	7157	broad.mit.edu	37	17	7577580	7577580	+	Missense_Mutation	SNP	T	C	C			TCGA-76-6286-01	TCGA-76-6286-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:7577580T>C	uc002gim.2	-	7	895	c.701A>G	c.(700-702)TAC>TGC	p.Y234C	TP53_uc002gig.1_Missense_Mutation_p.Y234C|TP53_uc002gih.2_Missense_Mutation_p.Y234C|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.Y102C|TP53_uc010cng.1_Missense_Mutation_p.Y102C|TP53_uc002gii.1_Missense_Mutation_p.Y102C|TP53_uc010cnh.1_Missense_Mutation_p.Y234C|TP53_uc010cni.1_Missense_Mutation_p.Y234C|TP53_uc002gij.2_Missense_Mutation_p.Y234C|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Missense_Mutation_p.Y141C|TP53_uc002gio.2_Missense_Mutation_p.Y102C	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	234	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		Y -> F (in a sporadic cancer; somatic mutation).|Y -> K (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|Y -> N (in sporadic cancers; somatic mutation).|Y -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation).|Y -> S (in sporadic cancers; somatic mutation).|Y -> H (in sporadic cancers; somatic mutation).|Y -> D (in sporadic cancers; somatic mutation).|Y -> Q (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.Y234C(70)|p.Y234H(13)|p.Y234N(11)|p.0?(7)|p.Y234S(6)|p.Y234*(4)|p.Y234D(3)|p.Y234del(3)|p.Y234fs*2(1)|p.V225fs*23(1)|p.Y234fs*6(1)|p.Y234fs*5(1)|p.Y234fs*4(1)|p.Y234R(1)|p.Y234Y(1)|p.H233_C242del10(1)|p.D228fs*12(1)|p.Y234F(1)|p.I232_Y236delIHYNY(1)|p.Y141S(1)|p.T230_Y234delTTIHY(1)|p.H233fs*6(1)|p.Y234_N235insX(1)|p.I232fs*5(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		CATGTAGTTGTAGTGGATGGT	0.572		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			38	53	---	---	---	---	capture	Missense_Mutation	SNP	7577580	7577580	TP53	17	T	C	C	C	1	0	0	0	0	1	0	0	0	741	57	3	3	16264	281
GRB7	2886	broad.mit.edu	37	17	37901165	37901165	+	Missense_Mutation	SNP	G	C	C			TCGA-76-6286-01	TCGA-76-6286-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:37901165G>C	uc002hsr.2	+	9	1189	c.939G>C	c.(937-939)AAG>AAC	p.K313N	GRB7_uc002hss.2_Missense_Mutation_p.K313N|GRB7_uc010cwc.2_Missense_Mutation_p.K313N|GRB7_uc002hst.2_Missense_Mutation_p.K313N	NM_005310	NP_005301	Q14451	GRB7_HUMAN	growth factor receptor-bound protein 7	313	PH.				blood coagulation|epidermal growth factor receptor signaling pathway|leukocyte migration|negative regulation of translation|positive regulation of cell migration|stress granule assembly	cytosol|focal adhesion|stress granule	phosphatidylinositol binding|protein kinase binding|SH3/SH2 adaptor activity			lung(2)|ovary(1)|breast(1)|skin(1)	5	all_cancers(6;1.06e-93)|all_epithelial(6;2.33e-113)|Breast(7;9.37e-100)|Lung NSC(9;9.76e-10)|all_lung(9;5.34e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)		UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Epithelial(3;6.86e-60)|all cancers(3;1.65e-53)|BRCA - Breast invasive adenocarcinoma(8;2.03e-43)|STAD - Stomach adenocarcinoma(3;1.43e-12)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|LUSC - Lung squamous cell carcinoma(15;0.171)			ATGGCCACAAGGGGCTTCGGA	0.582													10	33	---	---	---	---	capture	Missense_Mutation	SNP	37901165	37901165	GRB7	17	G	C	C	C	1	0	0	0	0	1	0	0	0	451	35	4	4	6692	281
KRT25	147183	broad.mit.edu	37	17	38910206	38910206	+	Missense_Mutation	SNP	A	G	G			TCGA-76-6286-01	TCGA-76-6286-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:38910206A>G	uc002hve.2	-	3	636	c.575T>C	c.(574-576)GTT>GCT	p.V192A		NM_181534	NP_853512	Q7Z3Z0	K1C25_HUMAN	keratin 25	192	Rod.|Coil 1B.					cytoplasm|intermediate filament	structural molecule activity			ovary(2)	2		Breast(137;0.00526)				TTCATCCAAAACTCTTCGTAA	0.403													50	68	---	---	---	---	capture	Missense_Mutation	SNP	38910206	38910206	KRT25	17	A	G	G	G	1	0	0	0	0	1	0	0	0	26	2	3	3	8382	281
INTS2	57508	broad.mit.edu	37	17	59946709	59946709	+	Silent	SNP	G	A	A			TCGA-76-6286-01	TCGA-76-6286-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:59946709G>A	uc002izn.2	-	22	3163	c.3087C>T	c.(3085-3087)GTC>GTT	p.V1029V	INTS2_uc002izm.2_Silent_p.V1021V	NM_020748	NP_065799	Q9H0H0	INT2_HUMAN	integrator complex subunit 2	1029					snRNA processing	integral to membrane|integrator complex|nuclear membrane	protein binding			ovary(1)|lung(1)|pancreas(1)	3						GAATACCTGCGACCGTCAGAG	0.333													9	11	---	---	---	---	capture	Silent	SNP	59946709	59946709	INTS2	17	G	A	A	A	1	0	0	0	0	0	0	0	1	470	37	1	1	7701	281
MRPS7	51081	broad.mit.edu	37	17	73258939	73258939	+	Silent	SNP	C	T	T			TCGA-76-6286-01	TCGA-76-6286-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:73258939C>T	uc002jnm.3	+	3	563	c.330C>T	c.(328-330)CTC>CTT	p.L110L	GGA3_uc002jni.1_5'Flank|GGA3_uc002jnj.1_5'Flank|GGA3_uc010wrw.1_5'Flank|GGA3_uc002jnk.1_5'Flank|GGA3_uc010wrx.1_5'Flank|GGA3_uc010wry.1_5'Flank|GGA3_uc010wrz.1_5'Flank|MRPS7_uc002jnl.2_Silent_p.L110L|MRPS7_uc002jnn.3_Silent_p.L139L	NM_015971	NP_057055	Q9Y2R9	RT07_HUMAN	mitochondrial ribosomal protein S7 precursor	110					translation	cytosolic small ribosomal subunit|mitochondrion	protein binding|RNA binding|structural constituent of ribosome			central_nervous_system(1)	1	all_cancers(13;1.25e-07)|all_epithelial(9;2.63e-08)|Breast(9;1.06e-07)		all cancers(21;3.02e-07)|Epithelial(20;2.92e-06)			CCAGATCCCTCATGATTCAGG	0.448													17	31	---	---	---	---	capture	Silent	SNP	73258939	73258939	MRPS7	17	C	T	T	T	1	0	0	0	0	0	0	0	1	366	29	2	2	9758	281
GAMT	2593	broad.mit.edu	37	19	1397419	1397419	+	Missense_Mutation	SNP	G	A	A	rs139890971		TCGA-76-6286-01	TCGA-76-6286-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:1397419G>A	uc002lsj.2	-	6	727	c.650C>T	c.(649-651)CCG>CTG	p.P217L	uc002lsi.1_5'Flank	NM_000156	NP_000147	Q14353	GAMT_HUMAN	guanidinoacetate N-methyltransferase isoform a	217					creatine biosynthetic process|muscle contraction	cytosol	guanidinoacetate N-methyltransferase activity				0		Acute lymphoblastic leukemia(61;3.02e-13)|all_hematologic(61;4.32e-09)|Lung NSC(49;0.000195)|Breast(49;0.000231)|all_lung(49;0.000247)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	Creatine(DB00148)	GCAGTCGGCCGGTGGGACCAG	0.701													15	27	---	---	---	---	capture	Missense_Mutation	SNP	1397419	1397419	GAMT	19	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	6171	281
TJP3	27134	broad.mit.edu	37	19	3738562	3738562	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6286-01	TCGA-76-6286-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:3738562G>A	uc010xhv.1	+	11	1393	c.1393G>A	c.(1393-1395)GTG>ATG	p.V465M	TJP3_uc010xhs.1_Missense_Mutation_p.V432M|TJP3_uc010xht.1_Missense_Mutation_p.V396M|TJP3_uc010xhu.1_Missense_Mutation_p.V441M|TJP3_uc010xhw.1_Missense_Mutation_p.V451M	NM_014428	NP_055243	O95049	ZO3_HUMAN	tight junction protein 3	446	PDZ 3.					tight junction	protein binding			ovary(1)|central_nervous_system(1)|skin(1)	3				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0118)|STAD - Stomach adenocarcinoma(1328;0.18)		GGTGAATGACGTGCCATTCCA	0.577													66	79	---	---	---	---	capture	Missense_Mutation	SNP	3738562	3738562	TJP3	19	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	15816	281
PNPLA6	10908	broad.mit.edu	37	19	7607932	7607932	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6286-01	TCGA-76-6286-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:7607932G>A	uc010xjq.1	+	15	1792	c.1597G>A	c.(1597-1599)GCC>ACC	p.A533T	PNPLA6_uc002mgq.1_Missense_Mutation_p.A485T|PNPLA6_uc010xjp.1_Intron|PNPLA6_uc002mgr.1_Missense_Mutation_p.A485T|PNPLA6_uc002mgs.2_Missense_Mutation_p.A524T	NM_006702	NP_006693	Q8IY17	PLPL6_HUMAN	neuropathy target esterase isoform b	524	cNMP 2.|Cytoplasmic (Potential).				cell death|lipid catabolic process|phosphatidylcholine metabolic process	endoplasmic reticulum membrane|integral to membrane	lysophospholipase activity			ovary(3)	3						GCTGCACCACGCCAAAGCTGG	0.627													4	61	---	---	---	---	capture	Missense_Mutation	SNP	7607932	7607932	PNPLA6	19	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	12072	281
SLC1A6	6511	broad.mit.edu	37	19	15067342	15067342	+	Missense_Mutation	SNP	G	C	C			TCGA-76-6286-01	TCGA-76-6286-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:15067342G>C	uc002naa.1	-	6	1123	c.1115C>G	c.(1114-1116)CCC>CGC	p.P372R	SLC1A6_uc010dzu.1_Intron|SLC1A6_uc010xod.1_Missense_Mutation_p.P308R	NM_005071	NP_005062	P48664	EAA4_HUMAN	solute carrier family 1 (high affinity	372	Helical; (Potential).				synaptic transmission	integral to plasma membrane|membrane fraction	high-affinity glutamate transmembrane transporter activity|L-aspartate transmembrane transporter activity|sodium:dicarboxylate symporter activity			pancreas(3)|ovary(2)|skin(1)	6					L-Glutamic Acid(DB00142)	CCCAATGAAGGGGAAGGGGTT	0.592													14	14	---	---	---	---	capture	Missense_Mutation	SNP	15067342	15067342	SLC1A6	19	G	C	C	C	1	0	0	0	0	1	0	0	0	559	43	4	4	14329	281
RASAL3	64926	broad.mit.edu	37	19	15574925	15574925	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6286-01	TCGA-76-6286-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:15574925C>T	uc002nbe.2	-	2	331	c.245G>A	c.(244-246)CGC>CAC	p.R82H		NM_022904	NP_075055	Q86YV0	RASL3_HUMAN	RAS protein activator like 3	82					negative regulation of Ras protein signal transduction|signal transduction	cytoplasm|intrinsic to internal side of plasma membrane	Ras GTPase activator activity				0						GAGTCGAAGGCGACTGGTCCG	0.672													12	17	---	---	---	---	capture	Missense_Mutation	SNP	15574925	15574925	RASAL3	19	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	12960	281
F2RL3	9002	broad.mit.edu	37	19	17000842	17000842	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6286-01	TCGA-76-6286-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:17000842C>T	uc002nfa.2	+	2	743	c.568C>T	c.(568-570)CGG>TGG	p.R190W		NM_003950	NP_003941	Q96RI0	PAR4_HUMAN	coagulation factor II (thrombin) receptor-like 3	190	Cytoplasmic (Potential).				activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|platelet activation|positive regulation of release of sequestered calcium ion into cytosol	extracellular region|integral to plasma membrane	thrombin receptor activity				0						CCTGCGTGGCCGGCGCCTGGC	0.711													19	11	---	---	---	---	capture	Missense_Mutation	SNP	17000842	17000842	F2RL3	19	C	T	T	T	1	0	0	0	0	1	0	0	0	295	23	1	1	5300	281
RASGRP4	115727	broad.mit.edu	37	19	38909096	38909096	+	Missense_Mutation	SNP	C	G	G			TCGA-76-6286-01	TCGA-76-6286-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:38909096C>G	uc002oir.2	-	7	986	c.772G>C	c.(772-774)GTG>CTG	p.V258L	RASGRP4_uc010efz.1_RNA|RASGRP4_uc010ega.1_RNA|RASGRP4_uc010xua.1_Missense_Mutation_p.V258L|RASGRP4_uc010xub.1_Missense_Mutation_p.V224L|RASGRP4_uc010xuc.1_Missense_Mutation_p.V258L|RASGRP4_uc010xud.1_Intron|RASGRP4_uc010xue.1_Intron|RASGRP4_uc010egb.2_Missense_Mutation_p.V244L	NM_170604	NP_733749	Q8TDF6	GRP4_HUMAN	RAS guanyl releasing protein 4 isoform a	258	Ras-GEF.				activation of phospholipase C activity|cell growth|cell proliferation|myeloid cell differentiation|positive regulation of Ras protein signal transduction|regulation of G-protein coupled receptor protein signaling pathway|response to extracellular stimulus|small GTPase mediated signal transduction|transmembrane receptor protein tyrosine kinase signaling pathway	cytoplasm|membrane fraction|plasma membrane|soluble fraction	diacylglycerol binding|GTP-dependent protein binding|metal ion binding|Ras guanyl-nucleotide exchange factor activity			pancreas(1)|lung(1)|skin(1)	3	all_cancers(60;4.21e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			CGGCTCAGCACCATCACCTGC	0.662													6	5	---	---	---	---	capture	Missense_Mutation	SNP	38909096	38909096	RASGRP4	19	C	G	G	G	1	0	0	0	0	1	0	0	0	234	18	4	4	12972	281
SIGLEC10	89790	broad.mit.edu	37	19	51919569	51919569	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6286-01	TCGA-76-6286-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:51919569G>A	uc002pwo.2	-	4	1365	c.749C>T	c.(748-750)ACG>ATG	p.T250M	SIGLEC10_uc002pwp.2_Missense_Mutation_p.T192M|SIGLEC10_uc002pwq.2_Missense_Mutation_p.T192M|SIGLEC10_uc002pwr.2_Missense_Mutation_p.T250M|SIGLEC10_uc010ycy.1_Missense_Mutation_p.T250M|SIGLEC10_uc010ycz.1_Missense_Mutation_p.T202M|SIGLEC10_uc010eow.2_Missense_Mutation_p.R15C|SIGLEC10_uc002pws.1_Missense_Mutation_p.T176M	NM_033130	NP_149121	Q96LC7	SIG10_HUMAN	sialic acid binding Ig-like lectin 10 precursor	250	Extracellular (Potential).				cell adhesion	extracellular region|integral to membrane|plasma membrane	sugar binding			skin(1)	1		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000668)|OV - Ovarian serous cystadenocarcinoma(262;0.0101)		AGTACCTGGCGTGTTGTCACG	0.483													73	113	---	---	---	---	capture	Missense_Mutation	SNP	51919569	51919569	SIGLEC10	19	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	14199	281
ZSCAN1	284312	broad.mit.edu	37	19	58564824	58564824	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6286-01	TCGA-76-6286-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:58564824C>T	uc002qrc.1	+	6	879	c.632C>T	c.(631-633)CCG>CTG	p.P211L		NM_182572	NP_872378	Q8NBB4	ZSCA1_HUMAN	zinc finger and SCAN domain containing 1	211					viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)	2		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0152)		CCTCTGAAGCCGAGTATCTGG	0.652													42	47	---	---	---	---	capture	Missense_Mutation	SNP	58564824	58564824	ZSCAN1	19	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	18102	281
TTC7A	57217	broad.mit.edu	37	2	47206005	47206005	+	Silent	SNP	A	G	G			TCGA-76-6286-01	TCGA-76-6286-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:47206005A>G	uc002rvo.2	+	5	1091	c.723A>G	c.(721-723)GAA>GAG	p.E241E	TTC7A_uc002rvm.2_Silent_p.E207E|TTC7A_uc002rvn.1_Silent_p.E122E|TTC7A_uc010fbb.2_Silent_p.E241E|TTC7A_uc010fbc.2_5'UTR|TTC7A_uc002rvp.2_Silent_p.E122E|TTC7A_uc002rvq.2_5'UTR	NM_020458	NP_065191	Q9ULT0	TTC7A_HUMAN	tetratricopeptide repeat domain 7A	241							binding			breast(1)|skin(1)	2		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.18)	Lung(47;0.0792)|LUSC - Lung squamous cell carcinoma(58;0.114)			ACTTCCTGGAAGCTGCCCTCC	0.537													7	62	---	---	---	---	capture	Silent	SNP	47206005	47206005	TTC7A	2	A	G	G	G	1	0	0	0	0	0	0	0	1	37	3	3	3	16594	281
STON1-GTF2A1L	286749	broad.mit.edu	37	2	48809567	48809567	+	Missense_Mutation	SNP	C	T	T	rs147440328		TCGA-76-6286-01	TCGA-76-6286-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:48809567C>T	uc010yol.1	+	1	1842	c.1795C>T	c.(1795-1797)CGC>TGC	p.R599C	STON1_uc002rwo.3_Missense_Mutation_p.R599C|STON1_uc010fbm.2_Missense_Mutation_p.R599C|STON1-GTF2A1L_uc002rwp.1_Missense_Mutation_p.R599C|STON1_uc002rwr.2_RNA|STON1_uc002rwq.2_Missense_Mutation_p.R599C	NM_006873	NP_006864	B7ZL16	B7ZL16_HUMAN	stonin 1	599					endocytosis|intracellular protein transport|transcription initiation from RNA polymerase II promoter	clathrin adaptor complex|transcription factor TFIIA complex				ovary(3)|pancreas(1)|skin(1)	5		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.176)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			TAAAATGAACCGCCGAGCATG	0.483													33	60	---	---	---	---	capture	Missense_Mutation	SNP	48809567	48809567	STON1-GTF2A1L	2	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	15207	281
EDAR	10913	broad.mit.edu	37	2	109522815	109522815	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6286-01	TCGA-76-6286-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:109522815G>A	uc002teq.3	-	11	1404	c.973C>T	c.(973-975)CGG>TGG	p.R325W	EDAR_uc010fjn.2_Missense_Mutation_p.R357W|EDAR_uc010yws.1_Missense_Mutation_p.R357W	NM_022336	NP_071731	Q9UNE0	EDAR_HUMAN	ectodysplasin A receptor precursor	325	Cytoplasmic (Potential).				apoptosis|cell differentiation	integral to membrane	protein binding|transmembrane receptor activity			skin(1)	1						TTTTTCCTCCGGCTTTGAATC	0.512													34	43	---	---	---	---	capture	Missense_Mutation	SNP	109522815	109522815	EDAR	2	G	A	A	A	1	0	0	0	0	1	0	0	0	506	39	1	1	4860	281
CNTNAP5	129684	broad.mit.edu	37	2	125504853	125504853	+	Missense_Mutation	SNP	C	A	A			TCGA-76-6286-01	TCGA-76-6286-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:125504853C>A	uc002tno.2	+	14	2486	c.2122C>A	c.(2122-2124)CCT>ACT	p.P708T	CNTNAP5_uc010flu.2_Missense_Mutation_p.P709T	NM_130773	NP_570129	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5 precursor	708	Extracellular (Potential).|Fibrinogen C-terminal.				cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(10)	10				BRCA - Breast invasive adenocarcinoma(221;0.248)		TGAAAGGCACCCTTACTGGGG	0.537													20	37	---	---	---	---	capture	Missense_Mutation	SNP	125504853	125504853	CNTNAP5	2	C	A	A	A	1	0	0	0	0	1	0	0	0	286	22	4	4	3615	281
POTEE	445582	broad.mit.edu	37	2	131984443	131984443	+	Silent	SNP	A	G	G			TCGA-76-6286-01	TCGA-76-6286-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:131984443A>G	uc002tsn.2	+	4	910	c.858A>G	c.(856-858)CAA>CAG	p.Q286Q	PLEKHB2_uc002tsh.2_Intron|POTEE_uc002tsk.2_5'UTR|POTEE_uc002tsl.2_5'UTR	NM_001083538	NP_001077007	Q6S8J3	POTEE_HUMAN	protein expressed in prostate, ovary, testis,	286	ANK 4.						ATP binding				0						AAAAACAGCAAGTCGTGAAAT	0.333													42	180	---	---	---	---	capture	Silent	SNP	131984443	131984443	POTEE	2	A	G	G	G	1	0	0	0	0	0	0	0	1	37	3	3	3	12165	281
ZNF804A	91752	broad.mit.edu	37	2	185731110	185731110	+	Missense_Mutation	SNP	G	C	C			TCGA-76-6286-01	TCGA-76-6286-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:185731110G>C	uc002uph.2	+	2	720	c.126G>C	c.(124-126)AAG>AAC	p.K42N		NM_194250	NP_919226	Q7Z570	Z804A_HUMAN	zinc finger protein 804A	42						intracellular	zinc ion binding			ovary(6)|skin(3)|large_intestine(1)|pancreas(1)	11						ATGCTGAGAAGGAAAATACCA	0.363													22	24	---	---	---	---	capture	Missense_Mutation	SNP	185731110	185731110	ZNF804A	2	G	C	C	C	1	0	0	0	0	1	0	0	0	451	35	4	4	18046	281
MPP4	58538	broad.mit.edu	37	2	202552079	202552079	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6286-01	TCGA-76-6286-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:202552079G>A	uc002uyk.3	-	5	503	c.295C>T	c.(295-297)CGT>TGT	p.R99C	MPP4_uc010ftj.2_Missense_Mutation_p.R99C|MPP4_uc010zhq.1_Missense_Mutation_p.R99C|MPP4_uc010zhr.1_Missense_Mutation_p.R99C|MPP4_uc010zhs.1_Missense_Mutation_p.R99C|MPP4_uc002uyj.3_Missense_Mutation_p.R99C|MPP4_uc010zht.1_Intron|MPP4_uc002uyl.3_RNA|MPP4_uc010ftk.2_Missense_Mutation_p.R99C|MPP4_uc002uym.1_Missense_Mutation_p.R112C|MPP4_uc002uyn.2_Missense_Mutation_p.R99C	NM_033066	NP_149055	Q96JB8	MPP4_HUMAN	membrane protein, palmitoylated 4	99	L27 2.					cytoplasm	protein binding				0						GGGGTTTCACGTAATAACTCC	0.408													6	5	---	---	---	---	capture	Missense_Mutation	SNP	202552079	202552079	MPP4	2	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	9648	281
ZNF831	128611	broad.mit.edu	37	20	57768855	57768855	+	Missense_Mutation	SNP	A	C	C			TCGA-76-6286-01	TCGA-76-6286-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:57768855A>C	uc002yan.2	+	1	2781	c.2781A>C	c.(2779-2781)AGA>AGC	p.R927S		NM_178457	NP_848552	Q5JPB2	ZN831_HUMAN	zinc finger protein 831	927						intracellular	nucleic acid binding|zinc ion binding			skin(13)|ovary(1)	14	all_lung(29;0.0085)					AGGCTCCTAGAGTGCTCTCTG	0.632													4	34	---	---	---	---	capture	Missense_Mutation	SNP	57768855	57768855	ZNF831	20	A	C	C	C	1	0	0	0	0	1	0	0	0	141	11	4	4	18061	281
CDH4	1002	broad.mit.edu	37	20	60503346	60503346	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6286-01	TCGA-76-6286-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:60503346G>A	uc002ybn.1	+	12	1884	c.1870G>A	c.(1870-1872)GAG>AAG	p.E624K	CDH4_uc002ybp.1_Missense_Mutation_p.E550K	NM_001794	NP_001785	P55283	CADH4_HUMAN	cadherin 4, type 1 preproprotein	624	Extracellular (Potential).|Cadherin 5.				adherens junction organization|cell junction assembly		calcium ion binding			lung(3)|ovary(2)|skin(1)	6			BRCA - Breast invasive adenocarcinoma(19;2.36e-08)			GCAGATCTGCGAGAAGCCCAA	0.642													12	104	---	---	---	---	capture	Missense_Mutation	SNP	60503346	60503346	CDH4	20	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	3083	281
HRH3	11255	broad.mit.edu	37	20	60793588	60793588	+	Missense_Mutation	SNP	C	T	T	rs142903103		TCGA-76-6286-01	TCGA-76-6286-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:60793588C>T	uc002ycf.2	-	2	673	c.376G>A	c.(376-378)GTG>ATG	p.V126M	HRH3_uc002ycg.2_Missense_Mutation_p.V126M|HRH3_uc002ych.2_Missense_Mutation_p.V126M|HRH3_uc002yci.2_Missense_Mutation_p.V126M	NM_007232	NP_009163	Q9Y5N1	HRH3_HUMAN	histamine receptor H3	126	Helical; Name=3; (Potential).				G-protein signaling, coupled to cyclic nucleotide second messenger|neurotransmitter secretion	integral to plasma membrane	histamine receptor activity				0	Breast(26;7.76e-09)		BRCA - Breast invasive adenocarcinoma(19;7.08e-07)		Histamine Phosphate(DB00667)	CTGATGAGCACGATGTTGAAG	0.647													14	1	---	---	---	---	capture	Missense_Mutation	SNP	60793588	60793588	HRH3	20	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	7282	281
KRTAP13-1	140258	broad.mit.edu	37	21	31768677	31768677	+	Silent	SNP	C	T	T			TCGA-76-6286-01	TCGA-76-6286-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:31768677C>T	uc002yoa.2	+	1	286	c.273C>T	c.(271-273)CCC>CCT	p.P91P		NM_181599	NP_853630	Q8IUC0	KR131_HUMAN	keratin associated protein 13-1	91	5 X 10 AA approximate repeats.					intermediate filament				ovary(1)	1						TCTGCAGTCCCTGCCAGACAA	0.612													30	36	---	---	---	---	capture	Silent	SNP	31768677	31768677	KRTAP13-1	21	C	T	T	T	1	0	0	0	0	0	0	0	1	301	24	2	2	8442	281
FAM3B	54097	broad.mit.edu	37	21	42720528	42720528	+	Silent	SNP	C	T	T			TCGA-76-6286-01	TCGA-76-6286-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:42720528C>T	uc002yzb.1	+	7	641	c.495C>T	c.(493-495)AAC>AAT	p.N165N	FAM3B_uc002yza.2_RNA|FAM3B_uc002yzc.1_Silent_p.N117N|FAM3B_uc002yzd.1_Silent_p.N188N	NM_058186	NP_478066	P58499	FAM3B_HUMAN	family with sequence similarity 3, member B	165					apoptosis|insulin secretion	extracellular space	cytokine activity				0		Prostate(19;1.57e-07)|all_epithelial(19;0.0404)				GACTGAATAACGATGCCAAGA	0.463													13	34	---	---	---	---	capture	Silent	SNP	42720528	42720528	FAM3B	21	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	5505	281
SHISA5	51246	broad.mit.edu	37	3	48520627	48520627	+	Silent	SNP	C	T	T			TCGA-76-6286-01	TCGA-76-6286-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:48520627C>T	uc003ctp.1	-	3	407	c.273G>A	c.(271-273)TCG>TCA	p.S91S	SHISA5_uc003cto.1_Silent_p.S60S|SHISA5_uc003ctq.1_Silent_p.S84S|SHISA5_uc003ctr.1_Silent_p.S60S|SHISA5_uc003cts.1_Silent_p.S60S|SHISA5_uc011bbl.1_5'UTR	NM_016479	NP_057563	Q8N114	SHSA5_HUMAN	scotin precursor	91	Extracellular (Potential).				apoptosis|positive regulation of I-kappaB kinase/NF-kappaB cascade	endoplasmic reticulum membrane|integral to membrane|nuclear membrane	signal transducer activity|WW domain binding				0						ACCTCAGCGCCGAGCCCAGCT	0.592													5	9	---	---	---	---	capture	Silent	SNP	48520627	48520627	SHISA5	3	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	14176	281
CACNA2D2	9254	broad.mit.edu	37	3	50513588	50513588	+	Silent	SNP	G	A	A			TCGA-76-6286-01	TCGA-76-6286-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:50513588G>A	uc003daq.2	-	2	287	c.249C>T	c.(247-249)GGC>GGT	p.G83G	CACNA2D2_uc003dap.2_Silent_p.G83G	NM_006030	NP_006021	Q9NY47	CA2D2_HUMAN	calcium channel, voltage-dependent, alpha	83	Extracellular (Potential).				energy reserve metabolic process|regulation of insulin secretion	integral to membrane|plasma membrane	calcium channel activity|metal ion binding|voltage-gated ion channel activity			lung(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.000365)|KIRC - Kidney renal clear cell carcinoma(197;0.00862)|Kidney(197;0.01)	Gabapentin(DB00996)	TCCGCATCACGCCGTCGACCT	0.632													3	5	---	---	---	---	capture	Silent	SNP	50513588	50513588	CACNA2D2	3	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	2525	281
PIK3CA	5290	broad.mit.edu	37	3	178916726	178916726	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6286-01	TCGA-76-6286-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:178916726G>A	uc003fjk.2	+	2	270	c.113G>A	c.(112-114)CGT>CAT	p.R38H		NM_006218	NP_006209	P42336	PK3CA_HUMAN	phosphoinositide-3-kinase, catalytic, alpha	38	PI3K-ABD.		R -> H (in cancer; shows an increase in lipid kinase activity; may disrupt the interaction between the PI3K-ABD domain and the N-terminal lobe of PI3K/PI4K kinase domain possibly affecting the conformation of the kinase domain).		epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell costimulation|T cell receptor signaling pathway		1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity	p.R38H(4)|p.R38S(1)|p.R38G(1)|p.R38C(1)		breast(1564)|large_intestine(776)|endometrium(246)|urinary_tract(195)|ovary(141)|skin(112)|stomach(98)|thyroid(77)|central_nervous_system(69)|lung(65)|upper_aerodigestive_tract(58)|haematopoietic_and_lymphoid_tissue(27)|cervix(25)|biliary_tract(22)|liver(20)|oesophagus(17)|pancreas(11)|penis(8)|pituitary(8)|autonomic_ganglia(4)|prostate(3)|kidney(2)|meninges(1)|eye(1)|NS(1)|soft_tissue(1)|bone(1)	3553	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)			GAATGCCTCCGTGAGGCTACA	0.393		57	Mis		colorectal|gastric|gliobastoma|breast					HNSCC(19;0.045)|TSP Lung(28;0.18)			45	52	---	---	---	---	capture	Missense_Mutation	SNP	178916726	178916726	PIK3CA	3	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	11816	281
PF4V1	5197	broad.mit.edu	37	4	74719597	74719597	+	Silent	SNP	C	T	T	rs147144357		TCGA-76-6286-01	TCGA-76-6286-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:74719597C>T	uc003hhg.1	+	2	265	c.198C>T	c.(196-198)GCC>GCT	p.A66A		NM_002620	NP_002611	P10720	PF4V_HUMAN	platelet factor 4 variant 1	66					immune response	extracellular region	chemokine activity|heparin binding				0	Breast(15;0.00102)		all cancers(17;0.00176)|Lung(101;0.128)|LUSC - Lung squamous cell carcinoma(112;0.187)			TGATCAAGGCCGGACCCCACT	0.607													23	32	---	---	---	---	capture	Silent	SNP	74719597	74719597	PF4V1	4	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	11656	281
TACR3	6870	broad.mit.edu	37	4	104579420	104579420	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6286-01	TCGA-76-6286-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:104579420C>T	uc003hxe.1	-	2	832	c.689G>A	c.(688-690)CGT>CAT	p.R230H		NM_001059	NP_001050	P29371	NK3R_HUMAN	tachykinin receptor 3	230	Extracellular (Potential).					integral to plasma membrane	tachykinin receptor activity			ovary(3)|lung(2)|breast(1)|skin(1)	7		Hepatocellular(203;0.217)		UCEC - Uterine corpus endometrioid carcinoma (10;0.22)|OV - Ovarian serous cystadenocarcinoma(123;3.4e-08)		GCAGAGAGTACGGCCTGGCAT	0.393													47	32	---	---	---	---	capture	Missense_Mutation	SNP	104579420	104579420	TACR3	4	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	15395	281
ZNF827	152485	broad.mit.edu	37	4	146697085	146697085	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6286-01	TCGA-76-6286-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:146697085C>T	uc003ikn.2	-	10	2597	c.2549G>A	c.(2548-2550)TGC>TAC	p.C850Y	ZNF827_uc003ikm.2_Missense_Mutation_p.C850Y|ZNF827_uc010iox.2_Missense_Mutation_p.C500Y|ZNF827_uc003ikl.2_5'UTR	NM_178835	NP_849157	Q17R98	ZN827_HUMAN	zinc finger protein 827	850	C2H2-type 5.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	all_hematologic(180;0.151)					AGCATAGGGGCACAAGTGGCA	0.498													39	69	---	---	---	---	capture	Missense_Mutation	SNP	146697085	146697085	ZNF827	4	C	T	T	T	1	0	0	0	0	1	0	0	0	325	25	2	2	18056	281
ODZ3	55714	broad.mit.edu	37	4	183651467	183651467	+	Silent	SNP	C	T	T			TCGA-76-6286-01	TCGA-76-6286-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:183651467C>T	uc003ivd.1	+	14	2737	c.2700C>T	c.(2698-2700)GAC>GAT	p.D900D	ODZ3_uc003ive.1_Silent_p.D306D	NM_001080477	NP_001073946	Q9P273	TEN3_HUMAN	odz, odd Oz/ten-m homolog 3	900	Extracellular (Potential).				signal transduction	integral to membrane					0		all_lung(41;2.69e-14)|Lung NSC(41;1.92e-11)|Melanoma(52;1.74e-05)|Colorectal(36;0.0062)|Breast(14;0.00748)|all_hematologic(60;0.0162)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_neural(102;0.155)|Medulloblastoma(177;0.184)		all cancers(43;1.42e-24)|Epithelial(43;6.86e-23)|OV - Ovarian serous cystadenocarcinoma(60;2.16e-11)|Colorectal(24;9.75e-06)|STAD - Stomach adenocarcinoma(60;2.96e-05)|COAD - Colon adenocarcinoma(29;0.00103)|GBM - Glioblastoma multiforme(59;0.00462)|LUSC - Lung squamous cell carcinoma(40;0.0391)|READ - Rectum adenocarcinoma(43;0.0487)		CCCGCCAGGACGGAATGTGAG	0.398													34	47	---	---	---	---	capture	Silent	SNP	183651467	183651467	ODZ3	4	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	10741	281
FCHO2	115548	broad.mit.edu	37	5	72383422	72383422	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6286-01	TCGA-76-6286-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:72383422G>A	uc003kcl.2	+	25	2368	c.2252G>A	c.(2251-2253)GGG>GAG	p.G751E	FCHO2_uc011csl.1_Missense_Mutation_p.G718E|FCHO2_uc010izb.2_Missense_Mutation_p.G179E|FCHO2_uc011csn.1_Missense_Mutation_p.G179E	NM_138782	NP_620137	Q0JRZ9	FCHO2_HUMAN	FCH domain only 2 isoform a	751										ovary(1)	1		Lung NSC(167;0.0465)|Ovarian(174;0.0908)|Prostate(461;0.165)		OV - Ovarian serous cystadenocarcinoma(47;4.6e-53)		GTAGGTTCTGGGTCCCTCCGA	0.398													21	24	---	---	---	---	capture	Missense_Mutation	SNP	72383422	72383422	FCHO2	5	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	5734	281
GABRA6	2559	broad.mit.edu	37	5	161119060	161119060	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6286-01	TCGA-76-6286-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:161119060G>A	uc003lyu.2	+	8	1278	c.940G>A	c.(940-942)GTC>ATC	p.V314I	GABRA6_uc003lyv.2_Missense_Mutation_p.V85I	NM_000811	NP_000802	Q16445	GBRA6_HUMAN	gamma-aminobutyric acid A receptor, alpha 6	314	Helical; (Probable).				gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity	p.V314I(1)		ovary(7)|skin(3)|large_intestine(1)|central_nervous_system(1)	12	Renal(175;0.00259)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		Alprazolam(DB00404)|Ethchlorvynol(DB00189)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Lorazepam(DB00186)|Meprobamate(DB00371)|Midazolam(DB00683)	CTTTGCATTCGTCTTCTCTGC	0.478										TCGA Ovarian(5;0.080)			53	54	---	---	---	---	capture	Missense_Mutation	SNP	161119060	161119060	GABRA6	5	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	6107	281
LRRC16A	55604	broad.mit.edu	37	6	25450163	25450163	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6286-01	TCGA-76-6286-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:25450163C>T	uc011djw.1	+	6	785	c.409C>T	c.(409-411)CGC>TGC	p.R137C	LRRC16A_uc010jpx.2_Missense_Mutation_p.R137C|LRRC16A_uc010jpy.2_Missense_Mutation_p.R137C|LRRC16A_uc003nez.1_5'Flank	NM_017640	NP_060110	Q5VZK9	LR16A_HUMAN	leucine rich repeat containing 16A	137					actin filament organization|blood coagulation|cell migration|lamellipodium assembly|ruffle organization|urate metabolic process	cytosol|lamellipodium|nucleus				ovary(1)|breast(1)|central_nervous_system(1)|pancreas(1)	4						GCCATCTGAGCGCCTGGCTAG	0.468													21	25	---	---	---	---	capture	Missense_Mutation	SNP	25450163	25450163	LRRC16A	6	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	8887	281
ABCF1	23	broad.mit.edu	37	6	30548286	30548286	+	Missense_Mutation	SNP	A	G	G			TCGA-76-6286-01	TCGA-76-6286-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:30548286A>G	uc003nql.2	+	8	763	c.668A>G	c.(667-669)AAG>AGG	p.K223R	ABCF1_uc003nqk.2_Missense_Mutation_p.K224R|ABCF1_uc003nqm.2_Missense_Mutation_p.K223R|ABCF1_uc010jsb.2_Intron	NM_001025091	NP_001020262	Q8NE71	ABCF1_HUMAN	ATP-binding cassette, sub-family F, member 1	223	Glu-rich.				inflammatory response|translational initiation	nuclear envelope|nuclear envelope|nucleoplasm|nucleoplasm|polysomal ribosome	ATP binding|ATP binding|ATPase activity|protein binding|ribosome binding|translation activator activity|translation factor activity, nucleic acid binding			ovary(2)	2						AAGGCCAAGAAGGCAGAGCAG	0.453													5	13	---	---	---	---	capture	Missense_Mutation	SNP	30548286	30548286	ABCF1	6	A	G	G	G	1	0	0	0	0	1	0	0	0	39	3	3	3	65	281
ZDHHC4	55146	broad.mit.edu	37	7	6628405	6628405	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6286-01	TCGA-76-6286-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:6628405G>A	uc003sqi.2	+	9	1257	c.899G>A	c.(898-900)CGT>CAT	p.R300H	ZDHHC4_uc003sql.2_Missense_Mutation_p.R300H|ZDHHC4_uc003sqh.2_Missense_Mutation_p.R300H|ZDHHC4_uc003sqj.2_Missense_Mutation_p.R300H|ZDHHC4_uc003sqk.2_Missense_Mutation_p.R300H|ZDHHC4_uc003sqm.2_Missense_Mutation_p.R300H|uc011jwy.1_5'Flank|C7orf26_uc003sqo.1_5'Flank|C7orf26_uc003sqp.1_5'Flank|C7orf26_uc003sqq.1_5'Flank	NM_001134388	NP_001127860	Q9NPG8	ZDHC4_HUMAN	zinc finger, DHHC-type containing 4	300						integral to membrane	acyltransferase activity|zinc ion binding			breast(1)|pancreas(1)	2		Ovarian(82;0.232)		UCEC - Uterine corpus endometrioid carcinoma (126;0.1)		TGGTGCCAGCGTTGTCCCCTT	0.577													64	140	---	---	---	---	capture	Missense_Mutation	SNP	6628405	6628405	ZDHHC4	7	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	17497	281
PCLO	27445	broad.mit.edu	37	7	82583736	82583736	+	Missense_Mutation	SNP	G	T	T			TCGA-76-6286-01	TCGA-76-6286-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:82583736G>T	uc003uhx.2	-	5	6822	c.6533C>A	c.(6532-6534)CCC>CAC	p.P2178H	PCLO_uc003uhv.2_Missense_Mutation_p.P2178H|PCLO_uc010lec.2_5'Flank	NM_033026	NP_149015	Q9Y6V0	PCLO_HUMAN	piccolo isoform 1	2109					cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity			ovary(7)	7						TGTGTCAGAGGGTGGGACAGA	0.428													38	95	---	---	---	---	capture	Missense_Mutation	SNP	82583736	82583736	PCLO	7	G	T	T	T	1	0	0	0	0	1	0	0	0	559	43	4	4	11486	281
MUC17	140453	broad.mit.edu	37	7	100684314	100684314	+	Missense_Mutation	SNP	C	G	G			TCGA-76-6286-01	TCGA-76-6286-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:100684314C>G	uc003uxp.1	+	3	9670	c.9617C>G	c.(9616-9618)ACT>AGT	p.T3206S	MUC17_uc010lho.1_RNA	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN	mucin 17 precursor	3206	Extracellular (Potential).|Ser-rich.|59 X approximate tandem repeats.|52.					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity			ovary(14)|skin(8)|breast(3)|lung(2)	27	Lung NSC(181;0.136)|all_lung(186;0.182)					TCATCTACAACTGCTGAAGGT	0.502													42	706	---	---	---	---	capture	Missense_Mutation	SNP	100684314	100684314	MUC17	7	C	G	G	G	1	0	0	0	0	1	0	0	0	260	20	4	4	9884	281
EZH2	2146	broad.mit.edu	37	7	148529726	148529726	+	Missense_Mutation	SNP	C	G	G			TCGA-76-6286-01	TCGA-76-6286-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:148529726C>G	uc003wfd.1	-	4	529	c.363G>C	c.(361-363)ATG>ATC	p.M121I	EZH2_uc011kug.1_Missense_Mutation_p.M112I|EZH2_uc003wfb.1_Missense_Mutation_p.M121I|EZH2_uc003wfc.1_Intron|EZH2_uc011kuh.1_Missense_Mutation_p.M112I|EZH2_uc011kui.1_Missense_Mutation_p.M121I|EZH2_uc011kuj.1_RNA	NM_004456	NP_004447	Q15910	EZH2_HUMAN	enhancer of zeste 2 isoform a	121	Interaction with DNMT1, DNMT3A and DNMT3B.				negative regulation of retinoic acid receptor signaling pathway|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	ESC/E(Z) complex	DNA binding|histone-lysine N-methyltransferase activity|protein binding			haematopoietic_and_lymphoid_tissue(180)|skin(2)|large_intestine(1)	183	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00239)			ATTTACATACCATAAAATTCT	0.313			Mis		DLBCL								58	155	---	---	---	---	capture	Missense_Mutation	SNP	148529726	148529726	EZH2	7	C	G	G	G	1	0	0	0	0	1	0	0	0	273	21	4	4	5288	281
TNFRSF10C	8794	broad.mit.edu	37	8	22972207	22972207	+	Silent	SNP	G	A	A	rs74480765	byFrequency;by1000genomes	TCGA-76-6286-01	TCGA-76-6286-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:22972207G>A	uc003xcy.2	+	3	405	c.204G>A	c.(202-204)CCG>CCA	p.P68P	TNFRSF10C_uc011kzr.1_RNA	NM_003841	NP_003832	O14798	TR10C_HUMAN	tumor necrosis factor receptor superfamily,	68					apoptosis	anchored to membrane|integral to plasma membrane	TRAIL binding|transmembrane receptor activity				0		Prostate(55;0.0421)|Breast(100;0.067)		Colorectal(74;0.0147)|COAD - Colon adenocarcinoma(73;0.0612)		CCTGTAACCCGTGCACAGAGG	0.468													46	86	---	---	---	---	capture	Silent	SNP	22972207	22972207	TNFRSF10C	8	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	16165	281
SLCO5A1	81796	broad.mit.edu	37	8	70617355	70617355	+	Silent	SNP	A	G	G			TCGA-76-6286-01	TCGA-76-6286-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:70617355A>G	uc003xyl.2	-	6	2240	c.1533T>C	c.(1531-1533)AGT>AGC	p.S511S	SLCO5A1_uc010lzb.2_Silent_p.S456S|SLCO5A1_uc011lfa.1_Intron|SLCO5A1_uc003xyk.2_Silent_p.S511S|SLCO5A1_uc010lzc.2_Silent_p.S456S	NM_030958	NP_112220	Q9H2Y9	SO5A1_HUMAN	solute carrier organic anion transporter family,	511	Helical; Name=9; (Potential).					integral to membrane|plasma membrane	transporter activity			ovary(3)|upper_aerodigestive_tract(1)	4	Breast(64;0.0654)		Epithelial(68;0.0141)|OV - Ovarian serous cystadenocarcinoma(28;0.0315)|all cancers(69;0.0594)			AAGACACACCACTGCAGATCA	0.408													47	59	---	---	---	---	capture	Silent	SNP	70617355	70617355	SLCO5A1	8	A	G	G	G	1	0	0	0	0	0	0	0	1	76	6	3	3	14623	281
RIMS2	9699	broad.mit.edu	37	8	104897848	104897848	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6286-01	TCGA-76-6286-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:104897848C>T	uc003yls.2	+	2	596	c.355C>T	c.(355-357)CGT>TGT	p.R119C	RIMS2_uc003ylp.2_Missense_Mutation_p.R341C|RIMS2_uc003ylw.2_Missense_Mutation_p.R149C|RIMS2_uc003ylq.2_Missense_Mutation_p.R149C|RIMS2_uc003ylr.2_Missense_Mutation_p.R149C	NM_014677	NP_055492	Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	372					intracellular protein transport	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding			ovary(6)|lung(2)|breast(2)|skin(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	15			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			GAATTTGGCCCGTTATCCAGT	0.473										HNSCC(12;0.0054)			16	22	---	---	---	---	capture	Missense_Mutation	SNP	104897848	104897848	RIMS2	8	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	13260	281
CNTLN	54875	broad.mit.edu	37	9	17330744	17330744	+	Missense_Mutation	SNP	A	G	G			TCGA-76-6286-01	TCGA-76-6286-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:17330744A>G	uc003zmz.2	+	9	1482	c.1456A>G	c.(1456-1458)ATA>GTA	p.I486V	CNTLN_uc003zmy.2_Missense_Mutation_p.I486V|CNTLN_uc010mio.2_Missense_Mutation_p.I165V	NM_017738	NP_060208	Q9NXG0	CNTLN_HUMAN	centlein isoform 1	486						centriole|membrane	two-component sensor activity			pancreas(1)	1				GBM - Glioblastoma multiforme(50;6.14e-10)		GTCAGAAAACATATCTGCCAA	0.368													55	72	---	---	---	---	capture	Missense_Mutation	SNP	17330744	17330744	CNTLN	9	A	G	G	G	1	0	0	0	0	1	0	0	0	104	8	3	3	3604	281
FBXO10	26267	broad.mit.edu	37	9	37515999	37515999	+	Silent	SNP	G	T	T			TCGA-76-6286-01	TCGA-76-6286-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:37515999G>T	uc004aab.2	-	10	2647	c.2598C>A	c.(2596-2598)ATC>ATA	p.I866I	FBXO10_uc004aac.2_Silent_p.I882I|FBXO10_uc004aad.2_Silent_p.I416I	NM_012166	NP_036298	Q9UK96	FBX10_HUMAN	F-box protein 10	866						ubiquitin ligase complex	ubiquitin-protein ligase activity			lung(5)	5				GBM - Glioblastoma multiforme(29;0.0107)		CCTGGAAGATGATGTTTTCCT	0.522													61	69	---	---	---	---	capture	Silent	SNP	37515999	37515999	FBXO10	9	G	T	T	T	1	0	0	0	0	0	0	0	1	577	45	4	4	5672	281
TMC1	117531	broad.mit.edu	37	9	75435855	75435855	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6286-01	TCGA-76-6286-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:75435855G>A	uc004aiz.1	+	20	2401	c.1861G>A	c.(1861-1863)GTT>ATT	p.V621I	TMC1_uc010moz.1_Missense_Mutation_p.V579I|TMC1_uc004aja.1_RNA|TMC1_uc004ajb.1_RNA|TMC1_uc004ajc.1_Missense_Mutation_p.V475I|TMC1_uc010mpa.1_Missense_Mutation_p.V475I	NM_138691	NP_619636	Q8TDI8	TMC1_HUMAN	transmembrane channel-like 1	621	Cytoplasmic (Potential).				sensory perception of sound	integral to membrane				ovary(1)	1						GTGCTGCAATGTTCCTGAGGC	0.502													59	97	---	---	---	---	capture	Missense_Mutation	SNP	75435855	75435855	TMC1	9	G	A	A	A	1	0	0	0	0	1	0	0	0	624	48	2	2	15869	281
ASTN2	23245	broad.mit.edu	37	9	119770488	119770488	+	Silent	SNP	A	G	G			TCGA-76-6286-01	TCGA-76-6286-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:119770488A>G	uc004bjs.1	-	7	1575	c.1474T>C	c.(1474-1476)TTA>CTA	p.L492L	ASTN2_uc004bjr.1_Silent_p.L492L|ASTN2_uc004bjt.1_Silent_p.L441L	NM_198187	NP_937830	O75129	ASTN2_HUMAN	astrotactin 2 isoform c	492	Extracellular (Potential).					integral to membrane				skin(4)|ovary(3)|breast(1)|kidney(1)	9						GCCGGGTTTAACCAGTCGGAG	0.512													26	34	---	---	---	---	capture	Silent	SNP	119770488	119770488	ASTN2	9	A	G	G	G	1	0	0	0	0	0	0	0	1	24	2	3	3	1056	281
GPSM1	26086	broad.mit.edu	37	9	139250804	139250804	+	Silent	SNP	G	A	A	rs79557901	byFrequency	TCGA-76-6286-01	TCGA-76-6286-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:139250804G>A	uc004chd.2	+	13	1843	c.1623G>A	c.(1621-1623)TCG>TCA	p.S541S	GPSM1_uc011mdu.1_Silent_p.S32S|GPSM1_uc004che.2_Silent_p.S32S	NM_001145638	NP_001139110	Q86YR5	GPSM1_HUMAN	G-protein signaling modulator 1 (AGS3-like, C.	541					cell differentiation|nervous system development|signal transduction	cytosol|endoplasmic reticulum membrane|Golgi membrane|plasma membrane	binding|GTPase activator activity				0		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;2.39e-06)|Epithelial(140;3.24e-06)		CCCAGCCCTCGATGACGGCCT	0.716													3	25	---	---	---	---	capture	Silent	SNP	139250804	139250804	GPSM1	9	G	A	A	A	1	0	0	0	0	0	0	0	1	470	37	1	1	6667	281
KCND1	3750	broad.mit.edu	37	X	48819889	48819889	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6286-01	TCGA-76-6286-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:48819889C>T	uc004dlx.1	-	6	3470	c.1897G>A	c.(1897-1899)GGT>AGT	p.G633S	KCND1_uc004dlw.1_Missense_Mutation_p.G256S	NM_004979	NP_004970	Q9NSA2	KCND1_HUMAN	potassium voltage-gated channel, Shal-related	633	Cytoplasmic (Potential).					voltage-gated potassium channel complex	metal ion binding|voltage-gated potassium channel activity			ovary(2)|lung(1)	3						CAAGGGGTACCCAGGCTGGAG	0.612													13	4	---	---	---	---	capture	Missense_Mutation	SNP	48819889	48819889	KCND1	23	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	7940	281
VSIG4	11326	broad.mit.edu	37	X	65242302	65242302	+	Missense_Mutation	SNP	T	C	C			TCGA-76-6286-01	TCGA-76-6286-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:65242302T>C	uc004dwh.2	-	8	1130	c.1003A>G	c.(1003-1005)AGG>GGG	p.R335G	VSIG4_uc004dwi.2_Missense_Mutation_p.R241G|VSIG4_uc010nkq.1_3'UTR|VSIG4_uc004dwj.2_3'UTR|VSIG4_uc011moy.1_3'UTR|VSIG4_uc004dwk.2_Intron|VSIG4_uc004dwl.2_Intron	NM_007268	NP_009199	Q9Y279	VSIG4_HUMAN	V-set and immunoglobulin domain containing 4	335	Cytoplasmic (Potential).				complement activation, alternative pathway	integral to membrane	protein binding				0						ATGGCCACCCTCATGGTTTCT	0.567													15	1	---	---	---	---	capture	Missense_Mutation	SNP	65242302	65242302	VSIG4	23	T	C	C	C	1	0	0	0	0	1	0	0	0	700	54	3	3	17107	281
USP26	83844	broad.mit.edu	37	X	132161219	132161219	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6286-01	TCGA-76-6286-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:132161219G>A	uc010nrm.1	-	6	1500	c.1030C>T	c.(1030-1032)CGG>TGG	p.R344W	USP26_uc011mvf.1_Missense_Mutation_p.R344W	NM_031907	NP_114113	Q9BXU7	UBP26_HUMAN	ubiquitin-specific protease 26	344					protein deubiquitination|ubiquitin-dependent protein catabolic process	nucleus	cysteine-type peptidase activity|protein binding|ubiquitin thiolesterase activity			lung(3)|central_nervous_system(3)|kidney(1)|liver(1)	8	Acute lymphoblastic leukemia(192;0.000127)					AAAAGTAGCCGTGCCAAGCAC	0.378													35	2	---	---	---	---	capture	Missense_Mutation	SNP	132161219	132161219	USP26	23	G	A	A	A	1	0	0	0	0	1	0	0	0	519	40	1	1	16939	281
AFF2	2334	broad.mit.edu	37	X	147924922	147924922	+	Silent	SNP	C	A	A			TCGA-76-6286-01	TCGA-76-6286-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:147924922C>A	uc004fcp.2	+	7	1706	c.1227C>A	c.(1225-1227)ACC>ACA	p.T409T	AFF2_uc004fco.2_Silent_p.T376T|AFF2_uc004fcq.2_Silent_p.T405T|AFF2_uc004fcr.2_Silent_p.T376T|AFF2_uc011mxb.1_Silent_p.T380T|AFF2_uc004fcs.2_Silent_p.T376T|AFF2_uc011mxc.1_Silent_p.T50T	NM_002025	NP_002016	P51816	AFF2_HUMAN	fragile X mental retardation 2	409					brain development|mRNA processing|regulation of RNA splicing|RNA splicing	nuclear speck	G-quadruplex RNA binding|protein binding			ovary(3)|pancreas(2)	5	Acute lymphoblastic leukemia(192;6.56e-05)					ATGACCCAACCACCAGAGCTT	0.378													40	6	---	---	---	---	capture	Silent	SNP	147924922	147924922	AFF2	23	C	A	A	A	1	0	0	0	0	0	0	0	1	262	21	4	4	357	281
FLNA	2316	broad.mit.edu	37	X	153588445	153588445	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6286-01	TCGA-76-6286-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:153588445C>T	uc004fkk.2	-	22	3967	c.3718G>A	c.(3718-3720)GTG>ATG	p.V1240M	FLNA_uc011mzn.1_5'Flank|FLNA_uc010nuu.1_Missense_Mutation_p.V1240M	NM_001110556	NP_001104026	P21333	FLNA_HUMAN	filamin A, alpha isoform 2	1240	Filamin 10.				actin crosslink formation|actin cytoskeleton reorganization|cell junction assembly|cytoplasmic sequestering of protein|establishment of protein localization|inhibition of adenylate cyclase activity by dopamine receptor signaling pathway|negative regulation of protein catabolic process|negative regulation of sequence-specific DNA binding transcription factor activity|platelet activation|platelet degranulation|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of transcription factor import into nucleus|protein localization at cell surface|protein stabilization|receptor clustering	cell cortex|cytosol|extracellular region|nucleus|plasma membrane	actin filament binding|Fc-gamma receptor I complex binding|glycoprotein binding|GTP-Ral binding|protein homodimerization activity|Rac GTPase binding|signal transducer activity|transcription factor binding			breast(6)	6	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					AAGTTGGGCACGGGCTGGCCG	0.627													30	6	---	---	---	---	capture	Missense_Mutation	SNP	153588445	153588445	FLNA	23	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	5877	281
FAM98C	147965	broad.mit.edu	37	19	38899502	38899504	+	In_Frame_Del	DEL	AAG	-	-			TCGA-76-6286-01	TCGA-76-6286-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:38899502_38899504delAAG	uc002oin.1	+	8	1049_1051	c.1030_1032delAAG	c.(1030-1032)AAGdel	p.K349del	FAM98C_uc002oio.1_In_Frame_Del_p.K267del|FAM98C_uc010xtz.1_3'UTR	NM_174905	NP_777565	Q17RN3	FA98C_HUMAN	hypothetical protein LOC147965	349										skin(1)	1	all_cancers(60;3.95e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			TTGGGGTCGCAAGAAGAAGAAGA	0.606													8	116	---	---	---	---	capture_indel	In_Frame_Del	DEL	38899502	38899504	FAM98C	19	AAG	-	-	-	1	0	1	0	1	0	0	0	0	65	5	5	5	5604	281
CLOCK	9575	broad.mit.edu	37	4	56336954	56336954	+	Frame_Shift_Del	DEL	A	-	-			TCGA-76-6286-01	TCGA-76-6286-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:56336954delA	uc003haz.1	-	9	1294	c.368delT	c.(367-369)TTAfs	p.L123fs	CLOCK_uc003hba.1_Frame_Shift_Del_p.L123fs	NM_004898	NP_004889	O15516	CLOCK_HUMAN	clock	123	PAS 1.				circadian rhythm|photoperiodism|positive regulation of transcription from RNA polymerase II promoter	cytoplasm|transcription factor complex	DNA binding|histone acetyltransferase activity|sequence-specific DNA binding transcription factor activity|signal transducer activity			central_nervous_system(2)|ovary(1)	3	Lung NSC(11;0.00335)|Glioma(25;0.08)|all_epithelial(27;0.0992)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(4;1.62e-07)|Lung(4;1.34e-06)|Epithelial(7;0.0107)			CATGATTGCTAAAAAAAAACC	0.289													7	147	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	56336954	56336954	CLOCK	4	A	-	-	-	1	0	1	0	1	0	0	0	0	169	13	5	5	3514	281
CYP21A2	1589	broad.mit.edu	37	6	31973481	31973483	+	In_Frame_Del	DEL	CTG	-	-			TCGA-76-6286-01	TCGA-76-6286-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:31973481_31973483delCTG	uc010jtp.2	+	1	134_136	c.16_18delCTG	c.(16-18)CTGdel	p.L10del	CYP21A2_uc011dpb.1_In_Frame_Del_p.L10del			P08686	CP21A_HUMAN	SubName: Full=Cytochrome P450, family 21, subfamily A, polypeptide 2; SubName: Full=Cytochrome P450 21-hydroxylase; SubName: Full=Cytochrome P450, family 21, subfamily A, polypeptide 2, isoform CRA_b; SubName: Full=DJ34F7.3 (Cytochrome P450, subfamily XXIA (Steroid 21-hydroxylase, congenital adrenal hyperplasia), polypeptide 2 (CYP21, P450c21B)); SubName: Full=cDNA, FLJ95495, Homo sapiens cytochrome P450, family 21, subfamily A, polypeptide 2(CYP21A2), mRNA;	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					glucocorticoid biosynthetic process|mineralocorticoid biosynthetic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	electron carrier activity|heme binding|steroid 21-monooxygenase activity|steroid binding				0						gctcctgggcctgctgctgctgc	0.527													3	6	---	---	---	---	capture_indel	In_Frame_Del	DEL	31973481	31973483	CYP21A2	6	CTG	-	-	-	1	0	1	0	1	0	0	0	0	311	24	5	5	4113	281
MSL3	10943	broad.mit.edu	37	X	11790368	11790371	+	Frame_Shift_Del	DEL	TTGT	-	-			TCGA-76-6286-01	TCGA-76-6286-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:11790368_11790371delTTGT	uc004cuw.2	+	11	1480_1483	c.1375_1378delTTGT	c.(1375-1380)TTGTTTfs	p.L459fs	MSL3_uc004cux.2_Frame_Shift_Del_p.L400fs|MSL3_uc011mig.1_Frame_Shift_Del_p.L310fs|MSL3_uc011mih.1_Frame_Shift_Del_p.L447fs|MSL3_uc004cuy.2_Frame_Shift_Del_p.L293fs	NM_078629	NP_523353	Q8N5Y2	MS3L1_HUMAN	male-specific lethal 3-like 1 isoform a	459_460					histone H4-K16 acetylation|multicellular organismal development|transcription from RNA polymerase II promoter	MSL complex	DNA binding|methylated histone residue binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1						TTTGCTGCGATTGTTTGGTAAGAA	0.451													54	10	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	11790368	11790371	MSL3	23	TTGT	-	-	-	1	0	1	0	1	0	0	0	0	673	52	5	5	9789	281
