Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
CDA	978	broad.mit.edu	37	1	20944980	20944980	+	Silent	SNP	G	A	A			TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:20944980G>A	uc001bdk.2	+	4	539	c.360G>A	c.(358-360)CCG>CCA	p.P120P	CDA_uc001bdl.2_RNA|CDA_uc009vpv.2_RNA	NM_001785	NP_001776	P32320	CDD_HUMAN	cytidine deaminase	120					cell surface receptor linked signaling pathway|cytosine metabolic process|negative regulation of cell growth|negative regulation of nucleotide metabolic process|protein homotetramerization|pyrimidine nucleoside salvage	cytosol|extracellular region	cytidine deaminase activity|nucleoside binding|protein homodimerization activity|zinc ion binding			ovary(1)	1		Lung NSC(340;1.75e-08)|all_lung(284;5.99e-08)|Colorectal(325;3.46e-05)|Renal(390;0.000147)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|GBM - Glioblastoma multiforme(114;1.06e-08)|COAD - Colon adenocarcinoma(152;1.22e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000148)|Kidney(64;0.000184)|KIRC - Kidney renal clear cell carcinoma(64;0.0027)|STAD - Stomach adenocarcinoma(196;0.00308)|READ - Rectum adenocarcinoma(331;0.0652)|Lung(427;0.199)	Azacitidine(DB00928)|Capecitabine(DB01101)|Cytarabine(DB00987)|Gemcitabine(DB00441)	TGACCAAGCCGGATGGTACGT	0.403													11	23	---	---	---	---	capture	Silent	SNP	20944980	20944980	CDA	1	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	3023	282
GRIK3	2899	broad.mit.edu	37	1	37356675	37356675	+	Silent	SNP	G	A	A	rs150456185		TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:37356675G>A	uc001caz.2	-	2	273	c.138C>T	c.(136-138)GAC>GAT	p.D46D	GRIK3_uc001cba.1_Silent_p.D46D	NM_000831	NP_000822	Q13003	GRIK3_HUMAN	glutamate receptor, ionotropic, kainate 3	46	Extracellular (Potential).				negative regulation of synaptic transmission, glutamatergic|regulation of membrane potential|synaptic transmission	cell junction|dendrite cytoplasm|integral to plasma membrane|perikaryon|postsynaptic membrane|terminal button	adenylate cyclase inhibiting metabotropic glutamate receptor activity|extracellular-glutamate-gated ion channel activity|G-protein-coupled receptor binding|kainate selective glutamate receptor activity			ovary(3)|skin(2)|large_intestine(1)|breast(1)	7		Myeloproliferative disorder(586;0.0258)|all_neural(195;0.169)			L-Glutamic Acid(DB00142)	CGTTGGGGCCGTCCGCATACT	0.507													86	116	---	---	---	---	capture	Silent	SNP	37356675	37356675	GRIK3	1	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	6708	282
PTPRF	5792	broad.mit.edu	37	1	44086251	44086251	+	Splice_Site	SNP	G	A	A			TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:44086251G>A	uc001cjr.2	+	31	5704	c.5364_splice	c.e31+1	p.R1788_splice	PTPRF_uc001cjs.2_Splice_Site_p.R1779_splice|PTPRF_uc001cju.2_Splice_Site_p.R1177_splice|PTPRF_uc009vwt.2_Splice_Site_p.R1348_splice|PTPRF_uc001cjv.2_Splice_Site_p.R1259_splice|PTPRF_uc001cjw.2_Splice_Site_p.R1014_splice	NM_002840	NP_002831	P10586	PTPRF_HUMAN	protein tyrosine phosphatase, receptor type, F						transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	transmembrane receptor protein tyrosine phosphatase activity			ovary(4)|skin(3)|lung(1)|kidney(1)|central_nervous_system(1)	10	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				GGATGCCCGGGTGAGTGAGTG	0.547													41	72	---	---	---	---	capture	Splice_Site	SNP	44086251	44086251	PTPRF	1	G	A	A	A	1	0	0	0	0	0	0	1	0	572	44	5	2	12696	282
NEGR1	257194	broad.mit.edu	37	1	72058647	72058647	+	Missense_Mutation	SNP	A	G	G			TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:72058647A>G	uc001dfw.2	-	6	893	c.793T>C	c.(793-795)TTC>CTC	p.F265L	NEGR1_uc001dfv.2_Missense_Mutation_p.F137L|NEGR1_uc010oqs.1_Missense_Mutation_p.F221L	NM_173808	NP_776169	Q7Z3B1	NEGR1_HUMAN	neuronal growth regulator 1 precursor	265	Ig-like C2-type 3.				cell adhesion	anchored to membrane|plasma membrane				ovary(1)	1		all_cancers(4;1.26e-06)|Renal(4;1.32e-08)|all_epithelial(4;5.39e-07)|Hepatocellular(141;0.117)		KIRC - Kidney renal clear cell carcinoma(4;0.00529)|Kidney(4;0.00609)|all cancers(265;0.022)|GBM - Glioblastoma multiforme(62;0.0382)|Epithelial(280;0.242)		TGGCCATTGAAGAGCCTAGAA	0.373													22	19	---	---	---	---	capture	Missense_Mutation	SNP	72058647	72058647	NEGR1	1	A	G	G	G	1	0	0	0	0	1	0	0	0	39	3	3	3	10224	282
HFM1	164045	broad.mit.edu	37	1	91740328	91740328	+	Silent	SNP	C	T	T			TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:91740328C>T	uc001doa.3	-	33	3727	c.3627G>A	c.(3625-3627)GAG>GAA	p.E1209E	HFM1_uc009wdb.2_RNA|HFM1_uc010osu.1_Silent_p.E888E|HFM1_uc001dob.3_Silent_p.E397E|HFM1_uc010osv.1_Silent_p.E893E	NM_001017975	NP_001017975	A2PYH4	HFM1_HUMAN	HFM1 protein	1209							ATP binding|ATP-dependent helicase activity|nucleic acid binding				0		all_lung(203;0.00961)|Lung NSC(277;0.0351)		all cancers(265;0.000481)|Epithelial(280;0.00863)|OV - Ovarian serous cystadenocarcinoma(397;0.126)|KIRC - Kidney renal clear cell carcinoma(1967;0.171)		TAAAACCAAACTCTTTAAGGT	0.299													20	34	---	---	---	---	capture	Silent	SNP	91740328	91740328	HFM1	1	C	T	T	T	1	0	0	0	0	0	0	0	1	259	20	2	2	7008	282
FAM102B	284611	broad.mit.edu	37	1	109167309	109167309	+	Silent	SNP	T	C	C			TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:109167309T>C	uc010ouy.1	+	6	575	c.495T>C	c.(493-495)TCT>TCC	p.S165S		NM_001010883	NP_001010883	Q5T8I3	F102B_HUMAN	hypothetical protein LOC284611	165										large_intestine(1)	1		all_epithelial(167;5.52e-05)|all_lung(203;0.00026)|Lung NSC(277;0.000508)		Colorectal(144;0.0217)|Lung(183;0.109)|COAD - Colon adenocarcinoma(174;0.141)|Epithelial(280;0.182)		CTGGTGAATCTGAATCTTTGC	0.403													3	132	---	---	---	---	capture	Silent	SNP	109167309	109167309	FAM102B	1	T	C	C	C	1	0	0	0	0	0	0	0	1	704	55	3	3	5337	282
NBPF10	100132406	broad.mit.edu	37	1	145296403	145296403	+	Silent	SNP	C	T	T	rs4996269	by1000genomes	TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:145296403C>T	uc001end.3	+	3	360	c.325C>T	c.(325-327)CTA>TTA	p.L109L	NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|NBPF10_uc001emp.3_Silent_p.L109L|NBPF10_uc001emq.1_Intron	NM_001039703	NP_001034792	A6NDV3	A6NDV3_HUMAN	hypothetical protein LOC100132406	109											0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		GCTGACCCAGCTAAGGGAGAA	0.517													4	185	---	---	---	---	capture	Silent	SNP	145296403	145296403	NBPF10	1	C	T	T	T	1	0	0	0	0	0	0	0	1	363	28	2	2	10100	282
FLG	2312	broad.mit.edu	37	1	152282565	152282565	+	Missense_Mutation	SNP	G	C	C			TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152282565G>C	uc001ezu.1	-	3	4833	c.4797C>G	c.(4795-4797)GAC>GAG	p.D1599E		NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	1599	Ser-rich.|Filaggrin 9.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GTCCCTCACTGTCCCTGTCCT	0.592									Ichthyosis				104	142	---	---	---	---	capture	Missense_Mutation	SNP	152282565	152282565	FLG	1	G	C	C	C	1	0	0	0	0	1	0	0	0	620	48	4	4	5867	282
HDGF	3068	broad.mit.edu	37	1	156713958	156713958	+	Silent	SNP	C	T	T			TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:156713958C>T	uc001fpy.3	-	4	808	c.486G>A	c.(484-486)CTG>CTA	p.L162L	HDGF_uc009wsd.2_Silent_p.L130L|HDGF_uc001fpz.3_Silent_p.L155L|HDGF_uc009wse.2_Silent_p.L178L|HDGF_uc010phr.1_Silent_p.L185L|HDGF_uc009wsf.2_Silent_p.L130L|HDGF_uc009wsg.2_Silent_p.L162L	NM_004494	NP_004485	P51858	HDGF_HUMAN	hepatoma-derived growth factor isoform a	162	Bipartite nuclear localization signal.|Glu-rich.				cell proliferation|regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	cytoplasm|extracellular space|nucleus	DNA binding|growth factor activity|heparin binding|nucleotide binding			lung(1)	1	all_hematologic(923;0.088)|Hepatocellular(266;0.158)	Breast(1374;0.198)		Colorectal(1306;0.018)		CAGTTACCTCCAGCAAGTCCC	0.612													78	91	---	---	---	---	capture	Silent	SNP	156713958	156713958	HDGF	1	C	T	T	T	1	0	0	0	0	0	0	0	1	262	21	2	2	6945	282
PTGS2	5743	broad.mit.edu	37	1	186645642	186645642	+	Nonsense_Mutation	SNP	C	T	T			TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:186645642C>T	uc001gsb.2	-	7	1064	c.927G>A	c.(925-927)TGG>TGA	p.W309*	PTGS2_uc009wyo.2_Nonsense_Mutation_p.W156*	NM_000963	NP_000954	P35354	PGH2_HUMAN	prostaglandin-endoperoxide synthase 2 precursor	309					cellular component movement|cyclooxygenase pathway|hormone biosynthetic process|positive regulation of brown fat cell differentiation|positive regulation of cell migration involved in sprouting angiogenesis|positive regulation of fever generation|positive regulation of fibroblast growth factor production|positive regulation of nitric oxide biosynthetic process|positive regulation of platelet-derived growth factor production|positive regulation of prostaglandin biosynthetic process|positive regulation of transforming growth factor-beta production|positive regulation vascular endothelial growth factor production|regulation of blood pressure|response to oxidative stress|xenobiotic metabolic process	endoplasmic reticulum lumen|endoplasmic reticulum membrane|microsome|neuron projection|nucleus	enzyme binding|heme binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|peroxidase activity|prostaglandin-endoperoxide synthase activity			ovary(1)|central_nervous_system(1)	2					Acetaminophen(DB00316)|Aspirin(DB00945)|Balsalazide(DB01014)|Bromfenac(DB00963)|Carprofen(DB00821)|Celecoxib(DB00482)|Ciclopirox(DB01188)|Diclofenac(DB00586)|Diflunisal(DB00861)|Epoprostenol(DB01240)|Etodolac(DB00749)|Etoricoxib(DB01628)|Fenoprofen(DB00573)|Flurbiprofen(DB00712)|gamma-Homolinolenic acid(DB00154)|Ginseng(DB01404)|Ibuprofen(DB01050)|Icosapent(DB00159)|Indomethacin(DB00328)|Ketoprofen(DB01009)|Ketorolac(DB00465)|Lenalidomide(DB00480)|Lumiracoxib(DB01283)|Meclofenamic acid(DB00939)|Mefenamic acid(DB00784)|Meloxicam(DB00814)|Mesalazine(DB00244)|Nabumetone(DB00461)|Naproxen(DB00788)|Oxaprozin(DB00991)|Phenylbutazone(DB00812)|Rofecoxib(DB00533)|Salicyclic acid(DB00936)|Salsalate(DB01399)|Sulindac(DB00605)|Suprofen(DB00870)|Tenoxicam(DB00469)|Thalidomide(DB01041)|Tiaprofenic acid(DB01600)|Tolmetin(DB00500)|Valdecoxib(DB00580)	GCTCATCACCCCATTCAGGAT	0.448													43	80	---	---	---	---	capture	Nonsense_Mutation	SNP	186645642	186645642	PTGS2	1	C	T	T	T	1	0	0	0	0	0	1	0	0	286	22	5	2	12651	282
OR6F1	343169	broad.mit.edu	37	1	247875393	247875393	+	Missense_Mutation	SNP	A	C	C			TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:247875393A>C	uc001idj.1	-	1	665	c.665T>G	c.(664-666)ATC>AGC	p.I222S		NM_001005286	NP_001005286	Q8NGZ6	OR6F1_HUMAN	olfactory receptor, family 6, subfamily F,	222	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.0168)			GATGGTGCTGATGATGTACAC	0.532													32	61	---	---	---	---	capture	Missense_Mutation	SNP	247875393	247875393	OR6F1	1	A	C	C	C	1	0	0	0	0	1	0	0	0	156	12	4	4	11105	282
TET1	80312	broad.mit.edu	37	10	70332622	70332622	+	Missense_Mutation	SNP	A	G	G			TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:70332622A>G	uc001jok.3	+	2	1032	c.527A>G	c.(526-528)CAA>CGA	p.Q176R		NM_030625	NP_085128	Q8NFU7	TET1_HUMAN	CXXC finger 6	176					DNA demethylation|inner cell mass cell differentiation|negative regulation of methylation-dependent chromatin silencing|stem cell maintenance		iron ion binding|methylcytosine dioxygenase activity|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|structure-specific DNA binding|zinc ion binding			ovary(5)|lung(2)|prostate(1)|breast(1)	9						ATTGGTGTACAAAATCCCTCT	0.433													23	9	---	---	---	---	capture	Missense_Mutation	SNP	70332622	70332622	TET1	10	A	G	G	G	1	0	0	0	0	1	0	0	0	65	5	3	3	15654	282
ATRNL1	26033	broad.mit.edu	37	10	117061383	117061383	+	Missense_Mutation	SNP	C	T	T	rs140372621		TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:117061383C>T	uc001lcg.2	+	17	3034	c.2648C>T	c.(2647-2649)GCG>GTG	p.A883V	ATRNL1_uc010qsm.1_Missense_Mutation_p.A58V|ATRNL1_uc010qsn.1_RNA	NM_207303	NP_997186	Q5VV63	ATRN1_HUMAN	attractin-like 1 precursor	883	Extracellular (Potential).					integral to membrane	sugar binding			ovary(5)|lung(1)|central_nervous_system(1)	7		all_lung(145;0.0686)|Breast(234;0.0969)|Lung NSC(174;0.17)|Colorectal(252;0.234)		Epithelial(162;0.00031)|all cancers(201;0.000753)|LUSC - Lung squamous cell carcinoma(1;0.0515)|Lung(30;0.0827)		AATCAAAATGCGAGGCCGTGC	0.378													17	3	---	---	---	---	capture	Missense_Mutation	SNP	117061383	117061383	ATRNL1	10	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	1198	282
HSPA12A	259217	broad.mit.edu	37	10	118434624	118434624	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:118434624C>T	uc001lct.2	-	12	1801	c.1696G>A	c.(1696-1698)GAC>AAC	p.D566N	HSPA12A_uc001lcu.2_Missense_Mutation_p.D483N	NM_025015	NP_079291	O43301	HS12A_HUMAN	heat shock 70kDa protein 12A	566							ATP binding			ovary(1)	1				all cancers(201;0.0158)		TCAAAGACGTCGGTGCACCAC	0.622													18	7	---	---	---	---	capture	Missense_Mutation	SNP	118434624	118434624	HSPA12A	10	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	7329	282
TRIM21	6737	broad.mit.edu	37	11	4410895	4410895	+	Missense_Mutation	SNP	C	A	A			TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:4410895C>A	uc001lyy.1	-	3	606	c.493G>T	c.(493-495)GCA>TCA	p.A165S		NM_003141	NP_003132	P19474	RO52_HUMAN	tripartite motif protein 21	165	Potential.				cell cycle|negative regulation of NF-kappaB transcription factor activity|negative regulation of protein deubiquitination|positive regulation of cell cycle|protein autoubiquitination|protein destabilization|protein monoubiquitination|protein polyubiquitination|protein trimerization	cytoplasmic mRNA processing body|nucleus	DNA binding|protein binding|RNA binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(3)|lung(1)	4		Medulloblastoma(188;0.0025)|Breast(177;0.0101)|all_neural(188;0.0227)		Epithelial(150;2.08e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0851)|LUSC - Lung squamous cell carcinoma(625;0.194)		TTCCAGTCTGCTCTCTTTATT	0.507													58	101	---	---	---	---	capture	Missense_Mutation	SNP	4410895	4410895	TRIM21	11	C	A	A	A	1	0	0	0	0	1	0	0	0	364	28	4	4	16378	282
OR51G1	79324	broad.mit.edu	37	11	4944754	4944754	+	Silent	SNP	G	A	A			TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:4944754G>A	uc010qyr.1	-	1	816	c.816C>T	c.(814-816)CGC>CGT	p.R272R		NM_001005237	NP_001005237	Q8NGK1	O51G1_HUMAN	olfactory receptor, family 51, subfamily G,	272	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;2.58e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0284)|LUSC - Lung squamous cell carcinoma(625;0.19)		GGTGTACAACGCGGGGCAGAT	0.498													48	68	---	---	---	---	capture	Silent	SNP	4944754	4944754	OR51G1	11	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	11002	282
C11orf41	25758	broad.mit.edu	37	11	33566719	33566719	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:33566719G>A	uc001mup.3	+	2	2431	c.2307G>A	c.(2305-2307)ATG>ATA	p.M769I	C11orf41_uc001mun.1_Missense_Mutation_p.M769I	NM_012194	NP_036326	Q6ZVL6	CK041_HUMAN	hypothetical protein LOC25758	763						integral to membrane				ovary(2)	2						ACCTGGAGATGCCCAGAGCAT	0.592													52	88	---	---	---	---	capture	Missense_Mutation	SNP	33566719	33566719	C11orf41	11	G	A	A	A	1	0	0	0	0	1	0	0	0	598	46	2	2	1626	282
LRRC4C	57689	broad.mit.edu	37	11	40136459	40136459	+	Missense_Mutation	SNP	T	C	C			TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:40136459T>C	uc001mxa.1	-	2	3348	c.1384A>G	c.(1384-1386)ATG>GTG	p.M462V	LRRC4C_uc001mxc.1_Missense_Mutation_p.M458V|LRRC4C_uc001mxd.1_Missense_Mutation_p.M458V|LRRC4C_uc001mxb.1_Missense_Mutation_p.M458V	NM_020929	NP_065980	Q9HCJ2	LRC4C_HUMAN	netrin-G1 ligand precursor	462					regulation of axonogenesis	integral to membrane	protein binding			ovary(4)|skin(3)|central_nervous_system(1)	8		all_lung(304;0.0575)|Lung NSC(402;0.138)				GACGGTTCCATAGTCTCTACT	0.507													38	63	---	---	---	---	capture	Missense_Mutation	SNP	40136459	40136459	LRRC4C	11	T	C	C	C	1	0	0	0	0	1	0	0	0	637	49	3	3	8923	282
INCENP	3619	broad.mit.edu	37	11	61895641	61895641	+	Missense_Mutation	SNP	C	T	T	rs61744797		TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:61895641C>T	uc001nsw.1	+	2	210	c.8C>T	c.(7-9)ACG>ATG	p.T3M	INCENP_uc009ynv.2_Missense_Mutation_p.T3M|INCENP_uc009ynw.1_Missense_Mutation_p.T3M|INCENP_uc001nsx.1_Missense_Mutation_p.T3M	NM_001040694	NP_001035784	Q9NQS7	INCE_HUMAN	inner centromere protein antigens 135/155kDa	3					chromosome segregation|cytokinesis|mitotic prometaphase	centromeric heterochromatin|condensed chromosome kinetochore|cytosol|microtubule|spindle	protein binding			lung(1)	1						ACCATGGGGACGACGGCCCCA	0.567													20	40	---	---	---	---	capture	Missense_Mutation	SNP	61895641	61895641	INCENP	11	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	7656	282
RSF1	51773	broad.mit.edu	37	11	77413468	77413468	+	Missense_Mutation	SNP	T	C	C			TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:77413468T>C	uc001oyn.2	-	6	926	c.806A>G	c.(805-807)AAT>AGT	p.N269S	RSF1_uc001oym.2_Missense_Mutation_p.N17S	NM_016578	NP_057662	Q96T23	RSF1_HUMAN	remodeling and spacing factor 1	269	Glu-rich.				CenH3-containing nucleosome assembly at centromere|negative regulation of DNA binding|negative regulation of transcription, DNA-dependent|nucleosome positioning|positive regulation of transcription, DNA-dependent|positive regulation of viral transcription|transcription initiation, DNA-dependent	RSF complex	histone binding|protein binding|zinc ion binding			ovary(2)|central_nervous_system(2)	4	all_cancers(14;1.54e-17)|all_epithelial(13;4.06e-20)|Ovarian(111;0.152)		Epithelial(5;3e-50)|all cancers(3;6.37e-47)|BRCA - Breast invasive adenocarcinoma(5;9.82e-31)			TTCTAGAACATTGGCTGTAGA	0.348													63	63	---	---	---	---	capture	Missense_Mutation	SNP	77413468	77413468	RSF1	11	T	C	C	C	1	0	0	0	0	1	0	0	0	676	52	3	3	13591	282
KCNJ5	3762	broad.mit.edu	37	11	128786516	128786516	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:128786516C>T	uc001qet.2	+	3	1464	c.1150C>T	c.(1150-1152)CCA>TCA	p.P384S	KCNJ5_uc009zck.2_Missense_Mutation_p.P384S|KCNJ5_uc001qew.2_Missense_Mutation_p.P384S	NM_000890	NP_000881	P48544	IRK5_HUMAN	potassium inwardly-rectifying channel J5	384	Cytoplasmic (By similarity).				synaptic transmission	voltage-gated potassium channel complex	G-protein activated inward rectifier potassium channel activity|protein binding			skin(1)	1	all_hematologic(175;0.0641)	Lung NSC(97;0.00038)|all_lung(97;0.000817)|Breast(109;0.00123)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0059)|LUSC - Lung squamous cell carcinoma(976;0.021)|Lung(977;0.0215)	Glibenclamide(DB01016)	CCCCAGCCCCCCACTGCTGGG	0.627													31	55	---	---	---	---	capture	Missense_Mutation	SNP	128786516	128786516	KCNJ5	11	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	7976	282
LGR5	8549	broad.mit.edu	37	12	71977624	71977624	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:71977624G>A	uc001swl.2	+	18	1882	c.1834G>A	c.(1834-1836)GTG>ATG	p.V612M	LGR5_uc001swm.2_Missense_Mutation_p.V588M|LGR5_uc001swn.1_RNA	NM_003667	NP_003658	O75473	LGR5_HUMAN	leucine-rich repeat-containing G protein-coupled	612	Helical; Name=2; (Potential).					integral to plasma membrane	protein-hormone receptor activity			lung(4)|skin(3)|ovary(1)|pancreas(1)	9						CTCCAGTGCCGTGCTGGCTGG	0.507													30	47	---	---	---	---	capture	Missense_Mutation	SNP	71977624	71977624	LGR5	12	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	8677	282
CCDC41	51134	broad.mit.edu	37	12	94761707	94761707	+	Missense_Mutation	SNP	C	G	G			TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:94761707C>G	uc001tdd.2	-	11	1792	c.1206G>C	c.(1204-1206)GAG>GAC	p.E402D	CCDC41_uc001tde.2_Missense_Mutation_p.E402D|CCDC41_uc009zsw.1_RNA	NM_016122	NP_057206	Q9Y592	CCD41_HUMAN	NY-REN-58 antigen	394	Potential.										0						CTAATCTGTTCTCGAGTTCTA	0.343													35	34	---	---	---	---	capture	Missense_Mutation	SNP	94761707	94761707	CCDC41	12	C	G	G	G	1	0	0	0	0	1	0	0	0	415	32	4	4	2787	282
RBM19	9904	broad.mit.edu	37	12	114282581	114282581	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:114282581C>T	uc009zwi.2	-	23	2821	c.2677G>A	c.(2677-2679)GCC>ACC	p.A893T	RBM19_uc001tvn.3_Missense_Mutation_p.A893T|RBM19_uc001tvm.2_Missense_Mutation_p.A893T	NM_001146699	NP_001140171	Q9Y4C8	RBM19_HUMAN	RNA binding motif protein 19	893	RRM 6.				multicellular organismal development|positive regulation of embryonic development	chromosome|cytoplasm|nucleolus|nucleoplasm	nucleotide binding|RNA binding			skin(3)|ovary(1)|liver(1)|central_nervous_system(1)	6	Medulloblastoma(191;0.163)|all_neural(191;0.178)					TGACACAGGGCGTTGAAGGCT	0.642													16	21	---	---	---	---	capture	Missense_Mutation	SNP	114282581	114282581	RBM19	12	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	13016	282
RNF17	56163	broad.mit.edu	37	13	25417989	25417989	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:25417989C>T	uc001upr.2	+	20	2752	c.2711C>T	c.(2710-2712)TCT>TTT	p.S904F	RNF17_uc010tdd.1_Missense_Mutation_p.S763F|RNF17_uc010aab.2_RNA|RNF17_uc010tde.1_Missense_Mutation_p.S904F|RNF17_uc001ups.2_Missense_Mutation_p.S843F|RNF17_uc010aac.2_Missense_Mutation_p.S102F|RNF17_uc010aad.2_5'UTR	NM_031277	NP_112567	Q9BXT8	RNF17_HUMAN	ring finger protein 17	904					multicellular organismal development	cytoplasm|nucleus	hydrolase activity, acting on ester bonds|nucleic acid binding|zinc ion binding			ovary(1)|skin(1)	2		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0114)|OV - Ovarian serous cystadenocarcinoma(117;0.0311)|Epithelial(112;0.0524)		TCTGCAAAATCTCTACCTAAT	0.323													25	24	---	---	---	---	capture	Missense_Mutation	SNP	25417989	25417989	RNF17	13	C	T	T	T	1	0	0	0	0	1	0	0	0	416	32	2	2	13353	282
SHISA2	387914	broad.mit.edu	37	13	26621160	26621160	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:26621160C>T	uc001uqm.1	-	2	464	c.379G>A	c.(379-381)GCC>ACC	p.A127T		NM_001007538	NP_001007539	Q6UWI4	SHSA2_HUMAN	shisa homolog 2 precursor	127	Helical; (Potential).				multicellular organismal development	endoplasmic reticulum membrane|integral to membrane				ovary(1)|central_nervous_system(1)	2						ATGATAAAGGCGACAAACACG	0.542													14	27	---	---	---	---	capture	Missense_Mutation	SNP	26621160	26621160	SHISA2	13	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	14173	282
C13orf18	80183	broad.mit.edu	37	13	46937309	46937309	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:46937309C>T	uc010acl.2	-	6	1471	c.866G>A	c.(865-867)CGT>CAT	p.R289H	C13orf18_uc001vbf.3_Missense_Mutation_p.R222H|C13orf18_uc001vbg.3_Missense_Mutation_p.R17H|C13orf18_uc010tfz.1_Missense_Mutation_p.R132H|C13orf18_uc010acm.2_Missense_Mutation_p.R154H|C13orf18_uc010acn.2_Missense_Mutation_p.R74H|C13orf18_uc001vbe.3_Missense_Mutation_p.R289H|C13orf18_uc001vbh.3_Missense_Mutation_p.R289H|C13orf18_uc001vbi.3_Missense_Mutation_p.R132H|C13orf18_uc010aco.1_Missense_Mutation_p.R289H	NM_025113	NP_079389	Q9H714	CM018_HUMAN	hypothetical protein LOC80183	289											0		Lung NSC(96;2.31e-05)|Breast(56;8.04e-05)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;2.19e-05)		ATGGTAAGTACGTGTTTCAGT	0.393													21	47	---	---	---	---	capture	Missense_Mutation	SNP	46937309	46937309	C13orf18	13	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	1706	282
PCDH17	27253	broad.mit.edu	37	13	58299189	58299189	+	Missense_Mutation	SNP	C	G	G			TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:58299189C>G	uc001vhq.1	+	4	4133	c.3241C>G	c.(3241-3243)CCT>GCT	p.P1081A	PCDH17_uc010aec.1_Missense_Mutation_p.P1080A|PCDH17_uc001vhr.1_Missense_Mutation_p.P170A	NM_001040429	NP_001035519	O14917	PCD17_HUMAN	protocadherin 17 precursor	1081	Cytoplasmic (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding|protein binding			ovary(3)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	7		Lung NSC(96;0.027)|Prostate(109;0.0453)|Breast(118;0.128)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;1.06e-05)		ATATCTGTCACCTAGTAAGCA	0.527													41	73	---	---	---	---	capture	Missense_Mutation	SNP	58299189	58299189	PCDH17	13	C	G	G	G	1	0	0	0	0	1	0	0	0	234	18	4	4	11415	282
DACH1	1602	broad.mit.edu	37	13	72147083	72147083	+	Silent	SNP	T	C	C			TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:72147083T>C	uc010thn.1	-	5	1611	c.1188A>G	c.(1186-1188)GCA>GCG	p.A396A	DACH1_uc010tho.1_Intron|DACH1_uc010thp.1_Intron	NM_080759	NP_542937	Q9UI36	DACH1_HUMAN	dachshund homolog 1 isoform a	448					multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleolus	DNA binding|nucleotide binding|protein binding			breast(1)	1		Acute lymphoblastic leukemia(28;0.0503)|Breast(118;0.198)		GBM - Glioblastoma multiforme(99;0.00032)		TGGTGACAGATGCTGGAGGTA	0.473													20	45	---	---	---	---	capture	Silent	SNP	72147083	72147083	DACH1	13	T	C	C	C	1	0	0	0	0	0	0	0	1	652	51	3	3	4180	282
ARID4A	5926	broad.mit.edu	37	14	58771705	58771705	+	Missense_Mutation	SNP	A	G	G			TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:58771705A>G	uc001xdp.2	+	4	415	c.161A>G	c.(160-162)GAC>GGC	p.D54G	ARID4A_uc010apf.1_RNA|ARID4A_uc001xdo.2_Missense_Mutation_p.D54G|ARID4A_uc001xdq.2_Missense_Mutation_p.D54G	NM_002892	NP_002883	P29374	ARI4A_HUMAN	retinoblastoma-binding protein 1 isoform I	54					negative regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	transcriptional repressor complex	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(3)|skin(2)|lung(1)	6						GTACAAGATGACCAAGTAAAG	0.279													3	81	---	---	---	---	capture	Missense_Mutation	SNP	58771705	58771705	ARID4A	14	A	G	G	G	1	0	0	0	0	1	0	0	0	130	10	3	3	912	282
SYNE2	23224	broad.mit.edu	37	14	64450574	64450574	+	Silent	SNP	A	G	G			TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:64450574A>G	uc001xgm.2	+	18	2351	c.2121A>G	c.(2119-2121)GAA>GAG	p.E707E	SYNE2_uc001xgl.2_Silent_p.E707E	NM_015180	NP_055995	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	707	Cytoplasmic (Potential).				centrosome localization|cytoskeletal anchoring at nuclear membrane|nuclear migration along microfilament|positive regulation of cell migration	cytoskeleton|filopodium membrane|focal adhesion|integral to membrane|lamellipodium membrane|mitochondrial part|nuclear outer membrane|nucleoplasm|sarcoplasmic reticulum membrane|SUN-KASH complex|Z disc	actin binding|protein binding			ovary(8)|breast(4)|central_nervous_system(1)|pancreas(1)	14				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		TGTCAGTAGAACTTCCTGAAA	0.259													3	9	---	---	---	---	capture	Silent	SNP	64450574	64450574	SYNE2	14	A	G	G	G	1	0	0	0	0	0	0	0	1	24	2	3	3	15334	282
ATP10A	57194	broad.mit.edu	37	15	26026298	26026298	+	Silent	SNP	G	A	A	rs145190957	byFrequency	TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:26026298G>A	uc010ayu.2	-	2	628	c.522C>T	c.(520-522)AAC>AAT	p.N174N		NM_024490	NP_077816	O60312	AT10A_HUMAN	ATPase, class V, type 10A	174	Cytoplasmic (Potential).				ATP biosynthetic process|regulation of cell shape	integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			pancreas(2)|ovary(1)|breast(1)|liver(1)	5		all_cancers(20;5.16e-25)|all_lung(180;1.51e-14)|Acute lymphoblastic leukemia(1;2.53e-05)|all_hematologic(1;0.000267)|Breast(32;0.00125)		all cancers(64;9.48e-07)|Epithelial(43;1.69e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0252)|Lung(196;0.244)		GGAAGATTTCGTTGCAGCGAA	0.488													16	41	---	---	---	---	capture	Silent	SNP	26026298	26026298	ATP10A	15	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	1107	282
SPINT1	6692	broad.mit.edu	37	15	41146113	41146113	+	Missense_Mutation	SNP	C	T	T	rs145193299		TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:41146113C>T	uc001zna.2	+	5	1151	c.947C>T	c.(946-948)GCG>GTG	p.A316V	SPINT1_uc001znb.2_Intron|SPINT1_uc001znc.2_Intron|SPINT1_uc010ucs.1_Missense_Mutation_p.A316V	NM_181642	NP_857593	O43278	SPIT1_HUMAN	serine peptidase inhibitor, Kunitz type 1	316						extracellular region|membrane fraction	protein binding|serine-type endopeptidase inhibitor activity			ovary(1)	1		all_cancers(109;1.35e-17)|all_epithelial(112;3.78e-15)|Lung NSC(122;9.68e-11)|all_lung(180;2.25e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;2.91e-05)|COAD - Colon adenocarcinoma(120;0.153)|BRCA - Breast invasive adenocarcinoma(123;0.166)		GGGGCTCAGGCGACTTTCCCC	0.592													49	73	---	---	---	---	capture	Missense_Mutation	SNP	41146113	41146113	SPINT1	15	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	14960	282
GABPB1	2553	broad.mit.edu	37	15	50593063	50593063	+	Missense_Mutation	SNP	G	T	T			TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:50593063G>T	uc001zyb.2	-	6	1080	c.656C>A	c.(655-657)TCT>TAT	p.S219Y	GABPB1_uc001zya.2_Missense_Mutation_p.S207Y|GABPB1_uc010ufg.1_Missense_Mutation_p.S143Y|GABPB1_uc001zyc.2_Missense_Mutation_p.S207Y|GABPB1_uc001zyd.2_Missense_Mutation_p.S207Y|GABPB1_uc001zye.2_Missense_Mutation_p.S219Y|GABPB1_uc001zyf.2_Missense_Mutation_p.S207Y	NM_005254	NP_005245	Q06547	GABP1_HUMAN	GA binding protein transcription factor, beta	219					positive regulation of transcription from RNA polymerase II promoter	nucleus	protein binding|protein heterodimerization activity|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding			large_intestine(1)	1						TGATGTAGAAGAGTTTCCAAA	0.363													29	24	---	---	---	---	capture	Missense_Mutation	SNP	50593063	50593063	GABPB1	15	G	T	T	T	1	0	0	0	0	1	0	0	0	429	33	4	4	6100	282
USP7	7874	broad.mit.edu	37	16	8998407	8998407	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:8998407G>A	uc002czl.2	-	15	1788	c.1589C>T	c.(1588-1590)GCG>GTG	p.A530V	USP7_uc010uyk.1_Missense_Mutation_p.A431V|USP7_uc002czj.2_RNA|USP7_uc010uyj.1_Missense_Mutation_p.A431V|USP7_uc002czk.2_Missense_Mutation_p.A514V|USP7_uc010uyl.1_Intron	NM_003470	NP_003461	Q93009	UBP7_HUMAN	ubiquitin specific peptidase 7	530					interspecies interaction between organisms|multicellular organismal development|protein deubiquitination|regulation of sequence-specific DNA binding transcription factor activity|ubiquitin-dependent protein catabolic process	cytoplasm|PML body	cysteine-type endopeptidase activity|p53 binding|protein C-terminus binding|transcription factor binding|ubiquitin protein ligase binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(3)	3						GTCGGTGACCGCCTGTAAAAC	0.502													38	52	---	---	---	---	capture	Missense_Mutation	SNP	8998407	8998407	USP7	16	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	16970	282
ERCC4	2072	broad.mit.edu	37	16	14029049	14029049	+	Silent	SNP	G	A	A			TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:14029049G>A	uc002dce.2	+	8	1269	c.1260G>A	c.(1258-1260)CTG>CTA	p.L420L	ERCC4_uc010uyz.1_5'UTR	NM_005236	NP_005227	Q92889	XPF_HUMAN	excision repair cross-complementing rodent	420					double-strand break repair via homologous recombination|meiotic mismatch repair|negative regulation of telomere maintenance|nucleotide-excision repair, DNA damage removal|nucleotide-excision repair, DNA incision, 3'-to lesion|nucleotide-excision repair, DNA incision, 5'-to lesion|resolution of meiotic recombination intermediates|telomere maintenance via telomere shortening|transcription-coupled nucleotide-excision repair	nuclear chromosome, telomeric region|nucleoplasm|nucleotide-excision repair factor 1 complex	damaged DNA binding|protein C-terminus binding|protein N-terminus binding|single-stranded DNA binding|single-stranded DNA specific endodeoxyribonuclease activity			lung(4)|ovary(3)|skin(2)|pancreas(1)	10						GTTCCCAGCTGAGAGACTATA	0.403			Mis|N|F			skin basal cell|skin squamous cell|melanoma		Direct_reversal_of_damage|NER	Xeroderma_Pigmentosum				43	56	---	---	---	---	capture	Silent	SNP	14029049	14029049	ERCC4	16	G	A	A	A	1	0	0	0	0	0	0	0	1	574	45	2	2	5170	282
CNOT1	23019	broad.mit.edu	37	16	58587731	58587731	+	Silent	SNP	C	T	T			TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:58587731C>T	uc002env.2	-	22	3218	c.2925G>A	c.(2923-2925)TTG>TTA	p.L975L	CNOT1_uc002enw.2_RNA|CNOT1_uc002enu.3_Silent_p.L970L|CNOT1_uc002enx.2_Silent_p.L975L|CNOT1_uc002enz.1_Silent_p.L404L|CNOT1_uc010vik.1_5'Flank	NM_016284	NP_057368	A5YKK6	CNOT1_HUMAN	CCR4-NOT transcription complex, subunit 1	975					nuclear-transcribed mRNA poly(A) tail shortening|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasmic mRNA processing body|cytosol				ovary(4)|central_nervous_system(2)	6				Kidney(780;0.0722)|OV - Ovarian serous cystadenocarcinoma(108;0.173)|Epithelial(162;0.239)		TGATAGAAGCCAAATGCTGAC	0.368													12	40	---	---	---	---	capture	Silent	SNP	58587731	58587731	CNOT1	16	C	T	T	T	1	0	0	0	0	0	0	0	1	272	21	2	2	3582	282
PIK3R5	23533	broad.mit.edu	37	17	8791674	8791674	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:8791674C>T	uc002glt.2	-	10	1497	c.1430G>A	c.(1429-1431)CGC>CAC	p.R477H	PIK3R5_uc010vuz.1_Missense_Mutation_p.R477H|PIK3R5_uc002glu.3_Missense_Mutation_p.R91H|PIK3R5_uc010coa.1_3'UTR|PIK3R5_uc010cob.1_Missense_Mutation_p.R91H	NM_014308	NP_055123	Q8WYR1	PI3R5_HUMAN	phosphoinositide-3-kinase, regulatory subunit 5	477					platelet activation	cytosol|membrane|nucleus				breast(2)|large_intestine(1)|central_nervous_system(1)|skin(1)	5						GGGCAGGGAGCGGGAGCGCTG	0.721													6	8	---	---	---	---	capture	Missense_Mutation	SNP	8791674	8791674	PIK3R5	17	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	11825	282
MYH13	8735	broad.mit.edu	37	17	10215249	10215249	+	Nonsense_Mutation	SNP	G	A	A			TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:10215249G>A	uc002gmk.1	-	32	4600	c.4510C>T	c.(4510-4512)CGA>TGA	p.R1504*		NM_003802	NP_003793	Q9UKX3	MYH13_HUMAN	myosin, heavy polypeptide 13, skeletal muscle	1504	Potential.				muscle contraction	muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(4)|skin(2)	6						TTGTTCTCTCGCCTCAGTGTC	0.542													26	47	---	---	---	---	capture	Nonsense_Mutation	SNP	10215249	10215249	MYH13	17	G	A	A	A	1	0	0	0	0	0	1	0	0	493	38	5	1	9942	282
KRT35	3886	broad.mit.edu	37	17	39637207	39637207	+	Missense_Mutation	SNP	C	A	A			TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:39637207C>A	uc002hws.2	-	1	186	c.143G>T	c.(142-144)AGT>ATT	p.S48I		NM_002280	NP_002271	Q92764	KRT35_HUMAN	keratin 35	48	Head.				anatomical structure morphogenesis	intermediate filament	protein binding|structural molecule activity			ovary(1)|skin(1)	2		Breast(137;0.000286)				GGCAGAGAAACTTCTGGCCAC	0.622													17	40	---	---	---	---	capture	Missense_Mutation	SNP	39637207	39637207	KRT35	17	C	A	A	A	1	0	0	0	0	1	0	0	0	260	20	4	4	8392	282
CYTH1	9267	broad.mit.edu	37	17	76705733	76705733	+	Missense_Mutation	SNP	T	C	C			TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:76705733T>C	uc002jvw.2	-	2	175	c.104A>G	c.(103-105)CAG>CGG	p.Q35R	CYTH1_uc010wtw.1_5'UTR|CYTH1_uc010wtx.1_5'UTR	NM_017456	NP_059430	Q15438	CYH1_HUMAN	cytohesin 1 isoform 2	35	Potential.				regulation of ARF protein signal transduction|regulation of cell adhesion|vesicle-mediated transport	cytoplasm|plasma membrane	ARF guanyl-nucleotide exchange factor activity|protein binding			ovary(1)	1						CTCTCCTACCTGAATGTCAGC	0.388													3	117	---	---	---	---	capture	Missense_Mutation	SNP	76705733	76705733	CYTH1	17	T	C	C	C	1	0	0	0	0	1	0	0	0	715	55	3	3	4162	282
ZNF556	80032	broad.mit.edu	37	19	2878077	2878077	+	Missense_Mutation	SNP	C	T	T	rs139830711	byFrequency;by1000genomes	TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:2878077C>T	uc002lwp.1	+	4	1208	c.1121C>T	c.(1120-1122)ACG>ATG	p.T374M	ZNF556_uc002lwq.2_Missense_Mutation_p.T373M	NM_024967	NP_079243	Q9HAH1	ZN556_HUMAN	zinc finger protein 556	374	C2H2-type 8.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(3)	3				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		AAATGTGAAACGTGTGGGAAA	0.483													23	62	---	---	---	---	capture	Missense_Mutation	SNP	2878077	2878077	ZNF556	19	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	17866	282
C19orf28	126321	broad.mit.edu	37	19	3557226	3557226	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:3557226C>T	uc002lxz.2	-	1	346	c.176G>A	c.(175-177)GGG>GAG	p.G59E	C19orf28_uc002lxw.2_Missense_Mutation_p.G59E|C19orf28_uc002lxx.2_Missense_Mutation_p.G59E|C19orf28_uc002lxy.2_Missense_Mutation_p.G59E	NM_174983	NP_778148	Q6NUT3	CS028_HUMAN	hypothetical protein LOC126321 isoform c	59	Helical; (Potential).				transmembrane transport	integral to membrane				breast(1)|pancreas(1)	2		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00251)|STAD - Stomach adenocarcinoma(1328;0.18)		CAGCAGCAGCCCCGCGCCGCG	0.726													6	13	---	---	---	---	capture	Missense_Mutation	SNP	3557226	3557226	C19orf28	19	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	1900	282
ATCAY	85300	broad.mit.edu	37	19	3918804	3918804	+	Silent	SNP	C	T	T			TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:3918804C>T	uc002lyy.3	+	11	1432	c.1002C>T	c.(1000-1002)AGC>AGT	p.S334S	ATCAY_uc010xhz.1_Silent_p.S340S|ATCAY_uc010dts.2_Silent_p.S91S	NM_033064	NP_149053	Q86WG3	ATCAY_HUMAN	caytaxin	334					transport		protein binding			breast(1)	1		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00485)|STAD - Stomach adenocarcinoma(1328;0.183)		CTGTCCACAGCGCGAGGCCCC	0.612													22	62	---	---	---	---	capture	Silent	SNP	3918804	3918804	ATCAY	19	C	T	T	T	1	0	0	0	0	0	0	0	1	350	27	1	1	1068	282
FUT3	2525	broad.mit.edu	37	19	5844141	5844141	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:5844141G>A	uc002mdk.2	-	2	807	c.710C>T	c.(709-711)ACG>ATG	p.T237M	FUT3_uc002mdm.2_Missense_Mutation_p.T237M|FUT3_uc002mdj.2_Missense_Mutation_p.T237M|FUT3_uc002mdl.2_Missense_Mutation_p.T237M	NM_001097641	NP_001091110	P21217	FUT3_HUMAN	fucosyltransferase 3	237	Lumenal (Potential).				protein glycosylation	Golgi cisterna membrane|integral to membrane|membrane fraction	3-galactosyl-N-acetylglucosaminide 4-alpha-L-fucosyltransferase activity				0						CCGGGACAGCGTCTCCATCAT	0.622													70	162	---	---	---	---	capture	Missense_Mutation	SNP	5844141	5844141	FUT3	19	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	6047	282
TNFSF14	8740	broad.mit.edu	37	19	6669943	6669943	+	Silent	SNP	C	T	T	rs140577063		TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:6669943C>T	uc002mfk.1	-	2	520	c.138G>A	c.(136-138)CTG>CTA	p.L46L	TNFSF14_uc002mfj.1_Intron	NM_003807	NP_003798	O43557	TNF14_HUMAN	tumor necrosis factor ligand superfamily, member	46	Helical; Signal-anchor for type II membrane protein; (Potential).				cellular response to mechanical stimulus|immune response|induction of apoptosis|release of cytoplasmic sequestered NF-kappaB|T cell homeostasis|T cell proliferation	cytoplasm|extracellular space|integral to membrane|plasma membrane	caspase inhibitor activity|cytokine activity|tumor necrosis factor receptor binding			skin(1)	1						CGGCCCCCATCAGCAACAGCA	0.662													4	183	---	---	---	---	capture	Silent	SNP	6669943	6669943	TNFSF14	19	C	T	T	T	1	0	0	0	0	0	0	0	1	366	29	2	2	16190	282
MUC16	94025	broad.mit.edu	37	19	9047128	9047128	+	Missense_Mutation	SNP	C	G	G			TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:9047128C>G	uc002mkp.2	-	5	34707	c.34503G>C	c.(34501-34503)ATG>ATC	p.M11501I		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	11503	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						TCCTGGGAACCATTGTGTTGG	0.507													53	128	---	---	---	---	capture	Missense_Mutation	SNP	9047128	9047128	MUC16	19	C	G	G	G	1	0	0	0	0	1	0	0	0	273	21	4	4	9883	282
MUC16	94025	broad.mit.edu	37	19	9082859	9082859	+	Nonsense_Mutation	SNP	T	A	A			TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:9082859T>A	uc002mkp.2	-	1	9160	c.8956A>T	c.(8956-8958)AGA>TGA	p.R2986*		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	2987	Ser-rich.|Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						GAGGCATATCTAGGGTCCCCT	0.498													62	155	---	---	---	---	capture	Nonsense_Mutation	SNP	9082859	9082859	MUC16	19	T	A	A	A	1	0	0	0	0	0	1	0	0	687	53	5	4	9883	282
NOTCH3	4854	broad.mit.edu	37	19	15289676	15289676	+	Silent	SNP	C	T	T			TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:15289676C>T	uc002nan.2	-	23	3871	c.3795G>A	c.(3793-3795)CCG>CCA	p.P1265P	NOTCH3_uc002nao.1_Silent_p.P1213P	NM_000435	NP_000426	Q9UM47	NOTC3_HUMAN	Notch homolog 3 precursor	1265	Extracellular (Potential).|EGF-like 32.				Notch receptor processing|Notch signaling pathway|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to membrane|nucleoplasm|plasma membrane	calcium ion binding|protein binding|receptor activity			lung(8)|ovary(5)|skin(4)|prostate(2)|central_nervous_system(1)|breast(1)	21			OV - Ovarian serous cystadenocarcinoma(3;2.6e-20)|Epithelial(3;1.34e-16)|all cancers(3;5.13e-15)			CCCCAGGACCCGGGCTAGGAC	0.647													7	16	---	---	---	---	capture	Silent	SNP	15289676	15289676	NOTCH3	19	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	10457	282
IL12RB1	3594	broad.mit.edu	37	19	18180414	18180414	+	Silent	SNP	G	A	A			TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:18180414G>A	uc002nhw.1	-	10	1195	c.1131C>T	c.(1129-1131)GAC>GAT	p.D377D	IL12RB1_uc010xqb.1_Silent_p.D377D|IL12RB1_uc002nhx.1_Silent_p.D417D	NM_005535	NP_005526	P42701	I12R1_HUMAN	interleukin 12 receptor, beta 1 isoform 1	377	Extracellular (Potential).|Fibronectin type-III 4.				cellular response to interferon-gamma|interleukin-12-mediated signaling pathway|positive regulation of activated T cell proliferation|positive regulation of defense response to virus by host|positive regulation of interferon-gamma production|positive regulation of memory T cell differentiation|positive regulation of T cell mediated cytotoxicity|positive regulation of T-helper 1 type immune response|positive regulation of T-helper 17 cell lineage commitment|positive regulation of T-helper 17 type immune response	interleukin-12 receptor complex|interleukin-23 receptor complex	cytokine receptor activity			pancreas(1)	1						CAAGGCCCCCGTCCTGGCCCA	0.627													24	45	---	---	---	---	capture	Silent	SNP	18180414	18180414	IL12RB1	19	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	7549	282
GPATCH1	55094	broad.mit.edu	37	19	33604693	33604693	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:33604693C>T	uc002nug.1	+	14	2227	c.1913C>T	c.(1912-1914)CCA>CTA	p.P638L	GPATCH1_uc002nuh.1_Missense_Mutation_p.P15L	NM_018025	NP_060495	Q9BRR8	GPTC1_HUMAN	G patch domain containing 1	638						catalytic step 2 spliceosome	nucleic acid binding			skin(1)	1	Esophageal squamous(110;0.137)					GTTGGCTTACCAAGAGTGAAG	0.418													23	46	---	---	---	---	capture	Missense_Mutation	SNP	33604693	33604693	GPATCH1	19	C	T	T	T	1	0	0	0	0	1	0	0	0	273	21	2	2	6524	282
CYP2F1	1572	broad.mit.edu	37	19	41622139	41622139	+	Missense_Mutation	SNP	G	A	A	rs142026539		TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:41622139G>A	uc002opu.1	+	2	102	c.46G>A	c.(46-48)GTC>ATC	p.V16I	CYP2F1_uc010xvw.1_Intron|CYP2F1_uc010xvv.1_Missense_Mutation_p.V16I|CYP2F1_uc002opv.1_RNA	NM_000774	NP_000765	P24903	CP2F1_HUMAN	cytochrome P450, family 2, subfamily F,	16					naphthalene metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding|oxygen binding				0						CCTGGCTCTCGTCTGTCTGCT	0.577													85	162	---	---	---	---	capture	Missense_Mutation	SNP	41622139	41622139	CYP2F1	19	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	4131	282
NLRP8	126205	broad.mit.edu	37	19	56477731	56477731	+	Missense_Mutation	SNP	G	A	A	rs142437909	by1000genomes	TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:56477731G>A	uc002qmh.2	+	5	2437	c.2366G>A	c.(2365-2367)CGT>CAT	p.R789H	NLRP8_uc010etg.2_Missense_Mutation_p.R789H	NM_176811	NP_789781	Q86W28	NALP8_HUMAN	NLR family, pyrin domain containing 8	789						cytoplasm	ATP binding			ovary(4)|breast(3)|central_nervous_system(2)|skin(2)|large_intestine(1)|kidney(1)	13		Colorectal(82;0.000147)|Ovarian(87;0.17)		GBM - Glioblastoma multiforme(193;0.0695)		CCCCGGTGCCGTCTGCAGTGT	0.547													17	56	---	---	---	---	capture	Missense_Mutation	SNP	56477731	56477731	NLRP8	19	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	10390	282
C2orf89	129293	broad.mit.edu	37	2	85051303	85051303	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:85051303G>A	uc010ysl.1	-	6	1197	c.1108C>T	c.(1108-1110)CGG>TGG	p.R370W	C2orf89_uc002sou.3_Missense_Mutation_p.R321W	NM_001080824	NP_001074293	Q86V40	CB089_HUMAN	hypothetical protein LOC129293 precursor	370	Extracellular (Potential).					integral to membrane				ovary(1)	1						AGAGTGGGCCGTGTGGAGGTC	0.567													17	24	---	---	---	---	capture	Missense_Mutation	SNP	85051303	85051303	C2orf89	2	G	A	A	A	1	0	0	0	0	1	0	0	0	519	40	1	1	2183	282
MYO7B	4648	broad.mit.edu	37	2	128384614	128384614	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:128384614G>A	uc002top.2	+	31	4255	c.4202G>A	c.(4201-4203)CGC>CAC	p.R1401H	MYO7B_uc002toq.1_Missense_Mutation_p.R254H|MYO7B_uc002tor.1_Missense_Mutation_p.R254H	NM_001080527	NP_001073996	Q6PIF6	MYO7B_HUMAN	myosin VIIB	1401	FERM 1.					apical plasma membrane|myosin complex	actin binding|ATP binding|motor activity			ovary(1)|pancreas(1)	2	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0753)		GACGCCGCCCGCCTGCAGTGG	0.637													13	12	---	---	---	---	capture	Missense_Mutation	SNP	128384614	128384614	MYO7B	2	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	9993	282
YSK4	80122	broad.mit.edu	37	2	135738842	135738842	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:135738842G>A	uc002tue.1	-	9	3500	c.3469C>T	c.(3469-3471)CCA>TCA	p.P1157S	YSK4_uc002tuf.1_Missense_Mutation_p.P339S|YSK4_uc010fnc.1_Missense_Mutation_p.P291S|YSK4_uc010fnd.1_Missense_Mutation_p.P1044S|YSK4_uc010zbg.1_Missense_Mutation_p.P289S|YSK4_uc002tuh.3_Missense_Mutation_p.P885S|YSK4_uc002tui.3_3'UTR	NM_025052	NP_079328	Q56UN5	YSK4_HUMAN	Yeast Sps1/Ste20-related kinase 4 isoform 1	1157	Protein kinase.						ATP binding|protein serine/threonine kinase activity			stomach(2)|urinary_tract(1)|ovary(1)|breast(1)	5				BRCA - Breast invasive adenocarcinoma(221;0.112)		TCAGGCAATGGCCCAAAACGG	0.418													50	60	---	---	---	---	capture	Missense_Mutation	SNP	135738842	135738842	YSK4	2	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	17376	282
FMNL2	114793	broad.mit.edu	37	2	153463859	153463859	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:153463859G>A	uc002tye.2	+	10	1250	c.883G>A	c.(883-885)GGA>AGA	p.G295R		NM_052905	NP_443137	Q96PY5	FMNL2_HUMAN	formin-like 2	295	GBD/FH3.				actin cytoskeleton organization	cytoplasm	actin binding|Rho GTPase binding			central_nervous_system(2)|ovary(1)	3						TCAGGTTTGTGGAGAAAAACA	0.313													10	20	---	---	---	---	capture	Missense_Mutation	SNP	153463859	153463859	FMNL2	2	G	A	A	A	1	0	0	0	0	1	0	0	0	611	47	2	2	5896	282
LOC200726	200726	broad.mit.edu	37	2	207509344	207509344	+	Silent	SNP	G	A	A			TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:207509344G>A	uc010fuh.1	+	2	559	c.384G>A	c.(382-384)GCG>GCA	p.A128A		NM_001102659	NP_001096129			hypothetical protein LOC200726												0				LUSC - Lung squamous cell carcinoma(261;0.0703)|Epithelial(149;0.115)|Lung(261;0.133)		TCTCAGCAGCGCAGCCACAGC	0.488													12	13	---	---	---	---	capture	Silent	SNP	207509344	207509344	LOC200726	2	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	8791	282
R3HDML	140902	broad.mit.edu	37	20	42965819	42965819	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:42965819G>A	uc002xls.1	+	1	194	c.22G>A	c.(22-24)GTG>ATG	p.V8M		NM_178491	NP_848586	Q9H3Y0	CRSPL_HUMAN	R3H domain containing-like precursor	8						extracellular region	peptidase inhibitor activity				0		Myeloproliferative disorder(115;0.028)	COAD - Colon adenocarcinoma(18;0.00189)			GCCCAGCACCGTGGGCCTGGC	0.647													25	71	---	---	---	---	capture	Missense_Mutation	SNP	42965819	42965819	R3HDML	20	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	12784	282
SLC17A9	63910	broad.mit.edu	37	20	61595026	61595026	+	Silent	SNP	C	T	T			TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:61595026C>T	uc002yea.3	+	7	1000	c.816C>T	c.(814-816)GAC>GAT	p.D272D	SLC17A9_uc002ydz.3_Silent_p.D266D|SLC17A9_uc011aap.1_Silent_p.D292D	NM_022082	NP_071365	Q9BYT1	S17A9_HUMAN	vesicular nucleotide transporter SLC17A9	272					exocytosis|transmembrane transport	integral to membrane	transporter activity			ovary(1)|skin(1)	2						CCTTCCCCGACGCCAAGGTGA	0.667													4	11	---	---	---	---	capture	Silent	SNP	61595026	61595026	SLC17A9	20	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	14317	282
PWP2	5822	broad.mit.edu	37	21	45545899	45545899	+	Missense_Mutation	SNP	T	C	C			TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:45545899T>C	uc002zeb.2	+	16	2063	c.1973T>C	c.(1972-1974)TTG>TCG	p.L658S		NM_005049	NP_005040	Q15269	PWP2_HUMAN	PWP2 periodic tryptophan protein homolog	658						cytoplasm|nucleolus	signal transducer activity			pancreas(1)	1				STAD - Stomach adenocarcinoma(101;0.172)|Colorectal(79;0.2)		TAGGAATTTTTGAACCGAAGA	0.537													45	70	---	---	---	---	capture	Missense_Mutation	SNP	45545899	45545899	PWP2	21	T	C	C	C	1	0	0	0	0	1	0	0	0	819	63	3	3	12739	282
C21orf29	54084	broad.mit.edu	37	21	45919792	45919792	+	Silent	SNP	C	T	T			TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:45919792C>T	uc002zfe.1	-	12	1950	c.1884G>A	c.(1882-1884)GCG>GCA	p.A628A	C21orf29_uc010gpv.1_Silent_p.A560A	NM_144991	NP_659428	Q8WU66	TSEAR_HUMAN	chromosome 21 open reading frame 29 precursor	628	EAR 7.				cell adhesion	extracellular region	structural molecule activity				0						GGCTGTGCACCGCCACGAAGC	0.706													9	5	---	---	---	---	capture	Silent	SNP	45919792	45919792	C21orf29	21	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	2105	282
ZNF280B	140883	broad.mit.edu	37	22	22843649	22843649	+	Silent	SNP	G	A	A			TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:22843649G>A	uc002zwc.1	-	4	851	c.75C>T	c.(73-75)GAC>GAT	p.D25D	LOC96610_uc011aim.1_Intron	NM_080764	NP_542942	Q86YH2	Z280B_HUMAN	zinc finger protein 280B	25					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2	all_hematologic(9;0.0135)|Acute lymphoblastic leukemia(84;0.17)	all_hematologic(6;1.74e-30)|Acute lymphoblastic leukemia(6;7.75e-22)		READ - Rectum adenocarcinoma(21;0.145)		CAGCATCTTCGTCATCTACTT	0.378													54	41	---	---	---	---	capture	Silent	SNP	22843649	22843649	ZNF280B	22	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	17695	282
SCUBE1	80274	broad.mit.edu	37	22	43603579	43603579	+	Silent	SNP	C	T	T			TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:43603579C>T	uc003bdt.1	-	21	2863	c.2775G>A	c.(2773-2775)GGG>GGA	p.G925G		NM_173050	NP_766638	Q8IWY4	SCUB1_HUMAN	signal peptide, CUB domain, EGF-like 1	925					adult heart development|blood coagulation|endothelial cell differentiation|inflammatory response|post-embryonic development|protein homooligomerization	external side of plasma membrane|extracellular space|extrinsic to plasma membrane	calcium ion binding|identical protein binding|protein heterodimerization activity			central_nervous_system(2)|ovary(1)|lung(1)|skin(1)	5		all_neural(38;0.0414)|Ovarian(80;0.07)				CGTACAGGCGCCCATCGCGCA	0.597													21	35	---	---	---	---	capture	Silent	SNP	43603579	43603579	SCUBE1	22	C	T	T	T	1	0	0	0	0	0	0	0	1	327	26	2	2	13837	282
MOV10L1	54456	broad.mit.edu	37	22	50588117	50588117	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:50588117G>A	uc003bjj.2	+	20	2784	c.2701G>A	c.(2701-2703)GGG>AGG	p.G901R	MOV10L1_uc003bjk.3_Missense_Mutation_p.G901R|MOV10L1_uc011arp.1_Missense_Mutation_p.G881R|MOV10L1_uc003bjl.2_Missense_Mutation_p.G28R|MOV10L1_uc003bjm.1_5'UTR	NM_018995	NP_061868	Q9BXT6	M10L1_HUMAN	MOV10-like 1 isoform 1	901					germ cell development|multicellular organismal development|spermatogenesis		ATP binding|ATP-dependent RNA helicase activity|magnesium ion binding|RNA binding			ovary(2)|skin(1)	3		all_cancers(38;3.31e-11)|all_epithelial(38;5.69e-10)|all_lung(38;3.73e-05)|Breast(42;0.000525)|Lung NSC(38;0.000954)|Ovarian(80;0.0367)|Lung SC(80;0.114)		LUAD - Lung adenocarcinoma(64;0.0215)|BRCA - Breast invasive adenocarcinoma(115;0.24)		CATTCCTCTGGGGCTGATGTC	0.562											OREG0026674	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	20	21	---	---	---	---	capture	Missense_Mutation	SNP	50588117	50588117	MOV10L1	22	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	9631	282
SEMA5B	54437	broad.mit.edu	37	3	122632727	122632727	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:122632727C>T	uc003efz.1	-	15	2414	c.2110G>A	c.(2110-2112)GTG>ATG	p.V704M	SEMA5B_uc011bju.1_Missense_Mutation_p.V646M|SEMA5B_uc003ega.1_RNA|SEMA5B_uc003egb.1_Missense_Mutation_p.V704M|SEMA5B_uc010hro.1_Missense_Mutation_p.V646M|SEMA5B_uc003efy.1_5'Flank	NM_001031702	NP_001026872	Q9P283	SEM5B_HUMAN	semaphorin 5B isoform 1	704	Extracellular (Potential).|TSP type-1 1.				cell differentiation|nervous system development	integral to membrane	receptor activity			ovary(2)|breast(2)|pancreas(2)|central_nervous_system(1)	7				GBM - Glioblastoma multiforme(114;0.0367)		CTCTTGCCCACGCAGATGCGG	0.657													31	63	---	---	---	---	capture	Missense_Mutation	SNP	122632727	122632727	SEMA5B	3	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	13931	282
RTP1	132112	broad.mit.edu	37	3	186917605	186917605	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:186917605G>A	uc003frg.2	+	2	569	c.539G>A	c.(538-540)CGC>CAC	p.R180H		NM_153708	NP_714919	P59025	RTP1_HUMAN	receptor transporting protein 1	180	Cytoplasmic (Potential).				protein insertion into membrane	cell surface|integral to membrane|plasma membrane	olfactory receptor binding			ovary(2)|breast(1)	3	all_cancers(143;5.33e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;5.56e-18)	GBM - Glioblastoma multiforme(93;0.0269)		GTGGCCAGCCGCCAGGACAAC	0.682													12	13	---	---	---	---	capture	Missense_Mutation	SNP	186917605	186917605	RTP1	3	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	13625	282
CCDC149	91050	broad.mit.edu	37	4	24878210	24878210	+	Missense_Mutation	SNP	T	C	C			TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:24878210T>C	uc011bxr.1	-	3	317	c.173A>G	c.(172-174)AAT>AGT	p.N58S	CCDC149_uc003grc.2_Missense_Mutation_p.N58S|CCDC149_uc003grb.2_RNA|CCDC149_uc003grd.2_Missense_Mutation_p.N58S|CCDC149_uc003gre.2_Missense_Mutation_p.N3S	NM_173463	NP_775734	B4DZG3	B4DZG3_HUMAN	coiled-coil domain containing 149 isoform 1	58											0		Breast(46;0.173)				CCGGAGCTGATTGGCCATGAG	0.517													55	78	---	---	---	---	capture	Missense_Mutation	SNP	24878210	24878210	CCDC149	4	T	C	C	C	1	0	0	0	0	1	0	0	0	676	52	3	3	2757	282
EPHA5	2044	broad.mit.edu	37	4	66217156	66217156	+	Missense_Mutation	SNP	C	A	A			TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:66217156C>A	uc003hcy.2	-	14	2652	c.2459G>T	c.(2458-2460)GGA>GTA	p.G820V	EPHA5_uc003hcx.2_Missense_Mutation_p.G752V|EPHA5_uc003hcz.2_Missense_Mutation_p.G798V|EPHA5_uc011cah.1_Missense_Mutation_p.G821V|EPHA5_uc011cai.1_Missense_Mutation_p.G799V|EPHA5_uc003hda.2_Missense_Mutation_p.G821V	NM_004439	NP_004430	P54756	EPHA5_HUMAN	ephrin receptor EphA5 isoform a precursor	820	Cytoplasmic (Potential).|Protein kinase.			G -> E (in Ref. 3; CAD97914).	cAMP-mediated signaling|neuron development	dendrite|external side of plasma membrane|integral to plasma membrane|neuronal cell body|perinuclear region of cytoplasm|rough endoplasmic reticulum	ATP binding|transmembrane-ephrin receptor activity			lung(19)|stomach(2)|ovary(2)|central_nervous_system(1)	24						CCGGGAAAGTCCAAAGTCAGA	0.443										TSP Lung(17;0.13)			30	47	---	---	---	---	capture	Missense_Mutation	SNP	66217156	66217156	EPHA5	4	C	A	A	A	1	0	0	0	0	1	0	0	0	390	30	4	4	5125	282
GK2	2712	broad.mit.edu	37	4	80328891	80328891	+	Missense_Mutation	SNP	C	A	A	rs147498656	byFrequency	TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:80328891C>A	uc003hlu.2	-	1	482	c.464G>T	c.(463-465)CGT>CTT	p.R155L		NM_033214	NP_149991	Q14410	GLPK2_HUMAN	glycerol kinase 2	155					glycerol-3-phosphate metabolic process	mitochondrial outer membrane	ATP binding|glycerol kinase activity			ovary(2)|skin(2)	4						AAGCATCCAACGAAGTTTTAC	0.408													56	75	---	---	---	---	capture	Missense_Mutation	SNP	80328891	80328891	GK2	4	C	A	A	A	1	0	0	0	0	1	0	0	0	247	19	4	4	6357	282
SPARCL1	8404	broad.mit.edu	37	4	88414795	88414795	+	Missense_Mutation	SNP	T	C	C			TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:88414795T>C	uc010ikm.2	-	5	1729	c.1157A>G	c.(1156-1158)CAA>CGA	p.Q386R	SPARCL1_uc011cdc.1_Missense_Mutation_p.Q261R|SPARCL1_uc003hqs.3_Missense_Mutation_p.Q386R|SPARCL1_uc011cdd.1_Missense_Mutation_p.Q261R|SPARCL1_uc003hqt.2_Missense_Mutation_p.Q386R	NM_001128310	NP_001121782	Q14515	SPRL1_HUMAN	SPARC-like 1 precursor	386					signal transduction	extracellular space|proteinaceous extracellular matrix	calcium ion binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(123;0.00118)		TTTTTCTCTTTGCTCCTCAAT	0.443													27	40	---	---	---	---	capture	Missense_Mutation	SNP	88414795	88414795	SPARCL1	4	T	C	C	C	1	0	0	0	0	1	0	0	0	819	63	3	3	14888	282
FAM198B	51313	broad.mit.edu	37	4	159052126	159052126	+	Silent	SNP	T	C	C			TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:159052126T>C	uc003ipp.3	-	4	1616	c.1164A>G	c.(1162-1164)AGA>AGG	p.R388R	FAM198B_uc003ipq.3_Silent_p.R396R|FAM198B_uc003ipr.3_Silent_p.R388R	NM_016613	NP_057697	Q6UWH4	F198B_HUMAN	hypothetical protein LOC51313 isoform 2	388	Extracellular (Potential).					Golgi membrane|integral to membrane					0						CCTTGCGAGGTCTGAATCCAC	0.413													19	19	---	---	---	---	capture	Silent	SNP	159052126	159052126	FAM198B	4	T	C	C	C	1	0	0	0	0	0	0	0	1	751	58	3	3	5481	282
AHRR	57491	broad.mit.edu	37	5	428029	428029	+	Silent	SNP	C	T	T			TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:428029C>T	uc003jav.2	+	9	926	c.882C>T	c.(880-882)CCC>CCT	p.P294P	AHRR_uc003jaw.2_Silent_p.P272P|AHRR_uc010isy.2_Silent_p.P122P|AHRR_uc010isz.2_Silent_p.P272P|AHRR_uc003jax.2_Silent_p.P35P|AHRR_uc003jay.2_Silent_p.P132P	NM_020731	NP_065782	A9YTQ3	AHRR_HUMAN	arylhydrocarbon receptor repressor	276					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|signal transducer activity			breast(2)	2			Epithelial(17;0.0011)|OV - Ovarian serous cystadenocarcinoma(19;0.00353)|all cancers(22;0.00354)|Lung(60;0.0863)			TTGCGGCACCCGTTCTCCTCC	0.577													17	23	---	---	---	---	capture	Silent	SNP	428029	428029	AHRR	5	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	417	282
SLC6A19	340024	broad.mit.edu	37	5	1216774	1216774	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:1216774C>T	uc003jbw.3	+	7	1045	c.989C>T	c.(988-990)ACA>ATA	p.T330I		NM_001003841	NP_001003841	Q695T7	S6A19_HUMAN	solute carrier family 6, member 19	330	Extracellular (Potential).				cellular nitrogen compound metabolic process	integral to plasma membrane	amino acid transmembrane transporter activity|neurotransmitter:sodium symporter activity				0	all_cancers(3;3.55e-15)|Lung NSC(6;2.89e-14)|all_lung(6;2.2e-13)|all_epithelial(6;3.75e-10)		Epithelial(17;0.000356)|all cancers(22;0.00137)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)			TTCCGCGCCACACAGCGCTAC	0.607													27	40	---	---	---	---	capture	Missense_Mutation	SNP	1216774	1216774	SLC6A19	5	C	T	T	T	1	0	0	0	0	1	0	0	0	221	17	2	2	14574	282
GZMK	3003	broad.mit.edu	37	5	54329635	54329635	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:54329635G>A	uc003jpl.1	+	5	720	c.676G>A	c.(676-678)GCT>ACT	p.A226T		NM_002104	NP_002095	P49863	GRAK_HUMAN	granzyme K precursor	226	Peptidase S1.				proteolysis	extracellular region	serine-type endopeptidase activity				0		Lung NSC(810;4.08e-05)|Breast(144;0.0433)|Prostate(74;0.183)				TGTCTTCCACGCTATAGTCTC	0.453													16	37	---	---	---	---	capture	Missense_Mutation	SNP	54329635	54329635	GZMK	5	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	6847	282
PIK3R1	5295	broad.mit.edu	37	5	67589138	67589138	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:67589138G>A	uc003jva.2	+	10	1686	c.1126G>A	c.(1126-1128)GGA>AGA	p.G376R	PIK3R1_uc003jvb.2_Missense_Mutation_p.G376R|PIK3R1_uc003jvc.2_Missense_Mutation_p.G76R|PIK3R1_uc003jvd.2_Missense_Mutation_p.G106R|PIK3R1_uc003jve.2_Missense_Mutation_p.G55R|PIK3R1_uc011crb.1_Missense_Mutation_p.G46R	NM_181523	NP_852664	P27986	P85A_HUMAN	phosphoinositide-3-kinase, regulatory subunit 1	376	SH2 1.				epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|growth hormone receptor signaling pathway|insulin receptor signaling pathway|insulin-like growth factor receptor signaling pathway|interspecies interaction between organisms|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol 3-kinase cascade|phosphatidylinositol phosphorylation|phosphatidylinositol-mediated signaling|platelet activation|positive regulation of establishment of protein localization in plasma membrane|positive regulation of glucose import|T cell costimulation|T cell receptor signaling pathway	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex	1-phosphatidylinositol binding|ErbB-3 class receptor binding|insulin binding|insulin receptor binding|insulin receptor substrate binding|insulin-like growth factor receptor binding|phosphatidylinositol 3-kinase regulator activity|protein phosphatase binding	p.G376R(3)|p.?(1)		endometrium(34)|central_nervous_system(27)|large_intestine(20)|breast(7)|ovary(5)|haematopoietic_and_lymphoid_tissue(3)|lung(2)|urinary_tract(1)|skin(1)|pancreas(1)	101		Lung NSC(167;1.99e-05)|Prostate(74;0.00308)|Ovarian(174;0.00473)|Colorectal(97;0.0176)		OV - Ovarian serous cystadenocarcinoma(47;3.76e-51)|Lung(70;0.0211)	Isoproterenol(DB01064)	CAGGAAAGGGGGAAATAACAA	0.308			Mis|F|O		gliobastoma|ovarian|colorectal					TCGA GBM(4;<1E-08)			10	28	---	---	---	---	capture	Missense_Mutation	SNP	67589138	67589138	PIK3R1	5	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	11821	282
SLCO4C1	353189	broad.mit.edu	37	5	101599411	101599411	+	Silent	SNP	G	A	A			TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:101599411G>A	uc003knm.2	-	4	1163	c.876C>T	c.(874-876)TAC>TAT	p.Y292Y		NM_180991	NP_851322	Q6ZQN7	SO4C1_HUMAN	solute carrier organic anion transporter family,	292	Helical; Name=5; (Potential).				cell differentiation|multicellular organismal development|sodium-independent organic anion transport|spermatogenesis	basolateral plasma membrane|integral to membrane	sodium-independent organic anion transmembrane transporter activity			upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)|pancreas(1)	4		all_cancers(142;1.86e-08)|all_epithelial(76;5.24e-12)|Prostate(80;0.00124)|Colorectal(57;0.00332)|Ovarian(225;0.024)|Lung NSC(167;0.0402)|all_lung(232;0.0486)		Epithelial(69;4.07e-14)|COAD - Colon adenocarcinoma(37;0.00986)		CAACATCAATGTATATGGTTA	0.358													39	83	---	---	---	---	capture	Silent	SNP	101599411	101599411	SLCO4C1	5	G	A	A	A	1	0	0	0	0	0	0	0	1	620	48	2	2	14622	282
PCDHB5	26167	broad.mit.edu	37	5	140516927	140516927	+	Missense_Mutation	SNP	C	G	G	rs138297526		TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140516927C>G	uc003liq.2	+	1	2128	c.1911C>G	c.(1909-1911)CAC>CAG	p.H637Q		NM_015669	NP_056484	Q9Y5E4	PCDB5_HUMAN	protocadherin beta 5 precursor	637	Cadherin 6.|Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding|protein binding			skin(3)|ovary(2)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CGGCCAAGCACAGGCTGGTGG	0.697													22	51	---	---	---	---	capture	Missense_Mutation	SNP	140516927	140516927	PCDHB5	5	C	G	G	G	1	0	0	0	0	1	0	0	0	220	17	4	4	11448	282
PCDHB7	56129	broad.mit.edu	37	5	140554075	140554075	+	Silent	SNP	C	T	T			TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140554075C>T	uc003lit.2	+	1	1833	c.1659C>T	c.(1657-1659)GAC>GAT	p.D553D		NM_018940	NP_061763	Q9Y5E2	PCDB7_HUMAN	protocadherin beta 7 precursor	553	Extracellular (Potential).|Cadherin 5.				calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|central_nervous_system(1)|skin(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TGGTGCTGGACGCCAACGACA	0.721													35	60	---	---	---	---	capture	Silent	SNP	140554075	140554075	PCDHB7	5	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	11450	282
PCDHGA2	56113	broad.mit.edu	37	5	140720777	140720777	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140720777C>T	uc003ljk.1	+	1	2424	c.2239C>T	c.(2239-2241)CGG>TGG	p.R747W	PCDHGA1_uc003lji.1_Intron|PCDHGA3_uc003ljm.1_5'Flank|PCDHGA3_uc010jfx.1_5'Flank|PCDHGA2_uc011dao.1_Missense_Mutation_p.R747W|PCDHGA3_uc011dap.1_5'Flank	NM_018915	NP_061738	Q9Y5H1	PCDG2_HUMAN	protocadherin gamma subfamily A, 2 isoform 1	747	Cytoplasmic (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			skin(2)|ovary(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGACGGGGTTCGGGCTTTCCT	0.627													54	62	---	---	---	---	capture	Missense_Mutation	SNP	140720777	140720777	PCDHGA2	5	C	T	T	T	1	0	0	0	0	1	0	0	0	399	31	1	1	11457	282
DNAH8	1769	broad.mit.edu	37	6	38850799	38850799	+	Missense_Mutation	SNP	T	G	G			TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:38850799T>G	uc003ooe.1	+	52	7921	c.7321T>G	c.(7321-7323)TTG>GTG	p.L2441V		NM_001371	NP_001362			dynein, axonemal, heavy polypeptide 8											skin(8)|ovary(7)|lung(2)|large_intestine(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	21						AACAAATTTTTTGATAGACAC	0.323													49	77	---	---	---	---	capture	Missense_Mutation	SNP	38850799	38850799	DNAH8	6	T	G	G	G	1	0	0	0	0	1	0	0	0	829	64	4	4	4563	282
GSTA5	221357	broad.mit.edu	37	6	52699018	52699018	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:52699018C>T	uc003pba.1	-	5	405	c.335G>A	c.(334-336)TGT>TAT	p.C112Y		NM_153699	NP_714543	Q7RTV2	GSTA5_HUMAN	glutathione S-transferase alpha 5	112	GST C-terminal.				glutathione metabolic process|xenobiotic metabolic process	cytosol	glutathione transferase activity			ovary(1)	1	Lung NSC(77;0.0912)				Glutathione(DB00143)	CTCTGGTTGACATATGAGCAG	0.373													86	92	---	---	---	---	capture	Missense_Mutation	SNP	52699018	52699018	GSTA5	6	C	T	T	T	1	0	0	0	0	1	0	0	0	221	17	2	2	6766	282
MYO6	4646	broad.mit.edu	37	6	76545638	76545638	+	Missense_Mutation	SNP	G	C	C			TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:76545638G>C	uc003pih.1	+	7	797	c.518G>C	c.(517-519)GGA>GCA	p.G173A	MYO6_uc003pig.1_Missense_Mutation_p.G173A|MYO6_uc003pii.1_Missense_Mutation_p.G173A	NM_004999	NP_004990	Q9UM54	MYO6_HUMAN	myosin VI	173	Myosin head-like.				actin filament-based movement|DNA damage response, signal transduction by p53 class mediator|endocytosis|intracellular protein transport|positive regulation of transcription from RNA polymerase II promoter|regulation of secretion|sensory perception of sound|synaptic transmission	cell cortex|clathrin coated vesicle membrane|coated pit|cytosol|DNA-directed RNA polymerase II, holoenzyme|filamentous actin|Golgi apparatus|nuclear membrane|perinuclear region of cytoplasm|ruffle membrane|unconventional myosin complex	actin filament binding|ADP binding|ATP binding|calmodulin binding|minus-end directed microfilament motor activity|protein binding			kidney(1)|pancreas(1)	2		all_hematologic(105;0.189)		BRCA - Breast invasive adenocarcinoma(397;0.223)		GAATCCTATGGAACAGGTCAA	0.274													16	38	---	---	---	---	capture	Missense_Mutation	SNP	76545638	76545638	MYO6	6	G	C	C	C	1	0	0	0	0	1	0	0	0	533	41	4	4	9991	282
SIM1	6492	broad.mit.edu	37	6	100896034	100896034	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:100896034C>T	uc003pqj.3	-	7	1045	c.838G>A	c.(838-840)GCG>ACG	p.A280T	SIM1_uc010kcu.2_Missense_Mutation_p.A280T	NM_005068	NP_005059	P81133	SIM1_HUMAN	single-minded homolog 1	280	PAS 2.				cell differentiation|nervous system development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|signal transducer activity			ovary(4)	4		all_cancers(76;9.88e-06)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0248)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0774)		AAATGGTGCGCGCAGCGCAGG	0.622													4	12	---	---	---	---	capture	Missense_Mutation	SNP	100896034	100896034	SIM1	6	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	14216	282
ASCC3	10973	broad.mit.edu	37	6	101073206	101073206	+	Silent	SNP	A	G	G			TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:101073206A>G	uc003pqk.2	-	30	4976	c.4647T>C	c.(4645-4647)ATT>ATC	p.I1549I		NM_006828	NP_006819	Q8N3C0	HELC1_HUMAN	activating signal cointegrator 1 complex subunit	1549	Helicase C-terminal 2.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|microtubule cytoskeleton	ATP binding|ATP-dependent helicase activity|nucleic acid binding			ovary(5)|skin(1)	6		all_cancers(76;1.45e-07)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(87;0.00149)|Hepatocellular(1;0.0893)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0539)|all cancers(137;0.103)|GBM - Glioblastoma multiforme(226;0.199)		AATGGCTTCTAATTGCTGTTG	0.368													29	33	---	---	---	---	capture	Silent	SNP	101073206	101073206	ASCC3	6	A	G	G	G	1	0	0	0	0	0	0	0	1	164	13	3	3	1024	282
SYNE1	23345	broad.mit.edu	37	6	152554981	152554981	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:152554981G>A	uc010kiw.2	-	112	21249	c.20647C>T	c.(20647-20649)CGC>TGC	p.R6883C	SYNE1_uc010kiv.2_Missense_Mutation_p.R1407C|SYNE1_uc003qos.3_Missense_Mutation_p.R1407C|SYNE1_uc003qot.3_Missense_Mutation_p.R6812C|SYNE1_uc003qou.3_Missense_Mutation_p.R6883C	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	6883	Spectrin 21.|Cytoplasmic (Potential).				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		CTATCAATGCGCGACAGCTCA	0.512										HNSCC(10;0.0054)			18	34	---	---	---	---	capture	Missense_Mutation	SNP	152554981	152554981	SYNE1	6	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	15333	282
PDE10A	10846	broad.mit.edu	37	6	165808689	165808689	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:165808689G>A	uc003qun.2	-	16	1697	c.1456C>T	c.(1456-1458)CGG>TGG	p.R486W	PDE10A_uc011egj.1_RNA|PDE10A_uc011egk.1_Missense_Mutation_p.R416W|PDE10A_uc003quo.2_Missense_Mutation_p.R496W	NM_006661	NP_006652	Q9Y233	PDE10_HUMAN	phosphodiesterase 10A isoform 2	486					platelet activation|signal transduction	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cAMP binding|cGMP binding|metal ion binding			ovary(3)|skin(2)	5		Breast(66;0.000425)|Prostate(117;0.104)|Ovarian(120;0.221)		OV - Ovarian serous cystadenocarcinoma(33;1.5e-17)|BRCA - Breast invasive adenocarcinoma(81;1.8e-06)|GBM - Glioblastoma multiforme(31;1.92e-05)	Dipyridamole(DB00975)	CCACAGGACCGATGAACCATG	0.383													14	21	---	---	---	---	capture	Missense_Mutation	SNP	165808689	165808689	PDE10A	6	G	A	A	A	1	0	0	0	0	1	0	0	0	480	37	1	1	11533	282
SDK1	221935	broad.mit.edu	37	7	4050739	4050739	+	Missense_Mutation	SNP	C	A	A			TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:4050739C>A	uc003smx.2	+	15	2412	c.2273C>A	c.(2272-2274)ACA>AAA	p.T758K	SDK1_uc010kso.2_Missense_Mutation_p.T34K	NM_152744	NP_689957	Q7Z5N4	SDK1_HUMAN	sidekick 1 precursor	758	Fibronectin type-III 1.				cell adhesion	integral to membrane				large_intestine(3)|ovary(2)|skin(1)	6		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		AGCGCCGAGACAAGCAGGTGC	0.597													10	21	---	---	---	---	capture	Missense_Mutation	SNP	4050739	4050739	SDK1	7	C	A	A	A	1	0	0	0	0	1	0	0	0	221	17	4	4	13861	282
SDK1	221935	broad.mit.edu	37	7	4189057	4189057	+	Silent	SNP	G	A	A			TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:4189057G>A	uc003smx.2	+	30	4726	c.4587G>A	c.(4585-4587)TCG>TCA	p.S1529S	SDK1_uc010kso.2_Silent_p.S805S|SDK1_uc003smy.2_Silent_p.S16S	NM_152744	NP_689957	Q7Z5N4	SDK1_HUMAN	sidekick 1 precursor	1529	Fibronectin type-III 9.				cell adhesion	integral to membrane				large_intestine(3)|ovary(2)|skin(1)	6		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		CCTACTCCTCGTCCATCAGCC	0.682													9	10	---	---	---	---	capture	Silent	SNP	4189057	4189057	SDK1	7	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	13861	282
FAM188B	84182	broad.mit.edu	37	7	30830978	30830978	+	Silent	SNP	C	T	T			TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:30830978C>T	uc003tbt.2	+	5	938	c.861C>T	c.(859-861)GCC>GCT	p.A287A	FAM188B_uc010kwe.2_Silent_p.A258A	NM_032222	NP_115598	Q4G0A6	F188B_HUMAN	hypothetical protein LOC84182	287											0						AAACCACTGCCAGCAGCCCTC	0.637													18	32	---	---	---	---	capture	Silent	SNP	30830978	30830978	FAM188B	7	C	T	T	T	1	0	0	0	0	0	0	0	1	262	21	2	2	5467	282
EGFR	1956	broad.mit.edu	37	7	55220329	55220329	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:55220329G>A	uc003tqk.2	+	6	965	c.719G>A	c.(718-720)TGC>TAC	p.C240Y	EGFR_uc003tqh.2_Missense_Mutation_p.C240Y|EGFR_uc003tqi.2_Missense_Mutation_p.C240Y|EGFR_uc003tqj.2_Missense_Mutation_p.C240Y|EGFR_uc010kzg.1_Missense_Mutation_p.C195Y|EGFR_uc011kco.1_Missense_Mutation_p.C187Y|EGFR_uc003tql.1_RNA	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	240	Approximate.|Extracellular (Potential).				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	p.V30_R297>G(5)		lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	GCTGCAGGCTGCACAGGCCCC	0.647		8	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			157	759	---	---	---	---	capture	Missense_Mutation	SNP	55220329	55220329	EGFR	7	G	A	A	A	1	0	0	0	0	1	0	0	0	598	46	2	2	4922	282
PHKG1	5260	broad.mit.edu	37	7	56151084	56151084	+	Missense_Mutation	SNP	T	C	C			TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:56151084T>C	uc003trz.1	-	6	629	c.434A>G	c.(433-435)AAC>AGC	p.N145S	PSPH_uc003trj.2_Intron|PHKG1_uc003try.1_Missense_Mutation_p.N39S|PHKG1_uc011kdb.1_Missense_Mutation_p.N177S|PHKG1_uc011kdc.1_Missense_Mutation_p.N136S|PHKG1_uc011kdd.1_Missense_Mutation_p.N91S	NM_006213	NP_006204	Q16816	PHKG1_HUMAN	phosphorylase kinase gamma subunit 1	145	Protein kinase.				glucose metabolic process|glycogen biosynthetic process|glycogen catabolic process	cytosol	ATP binding|calmodulin binding|phosphorylase kinase activity			large_intestine(1)	1	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			GTGCACGATGTTGAGTTTGTG	0.527													30	66	---	---	---	---	capture	Missense_Mutation	SNP	56151084	56151084	PHKG1	7	T	C	C	C	1	0	0	0	0	1	0	0	0	780	60	3	3	11749	282
CALN1	83698	broad.mit.edu	37	7	71571179	71571179	+	Silent	SNP	G	A	A	rs139754746		TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:71571179G>A	uc003twa.3	-	3	746	c.219C>T	c.(217-219)AGC>AGT	p.S73S	CALN1_uc003twb.3_Silent_p.S115S|CALN1_uc003twc.3_Silent_p.S73S	NM_001017440	NP_001017440	Q9BXU9	CABP8_HUMAN	calneuron 1 isoform 2	73	EF-hand 2.|Cytoplasmic (Potential).					Golgi apparatus|integral to membrane|perinuclear region of cytoplasm|plasma membrane	calcium ion binding			skin(1)	1		all_cancers(73;0.069)|Lung NSC(55;0.0658)|all_lung(88;0.0912)|all_epithelial(88;0.161)				GCTCCACCTCGCTTGGCATGT	0.592													19	43	---	---	---	---	capture	Silent	SNP	71571179	71571179	CALN1	7	G	A	A	A	1	0	0	0	0	0	0	0	1	490	38	1	1	2567	282
KCND2	3751	broad.mit.edu	37	7	119915031	119915031	+	Silent	SNP	C	T	T			TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:119915031C>T	uc003vjj.1	+	1	1310	c.345C>T	c.(343-345)TAC>TAT	p.Y115Y		NM_012281	NP_036413	Q9NZV8	KCND2_HUMAN	potassium voltage-gated channel, Shal-related	115	Cytoplasmic (Potential).				regulation of action potential|synaptic transmission	cell surface|dendritic spine	metal ion binding			ovary(2)|central_nervous_system(2)|skin(1)	5	all_neural(327;0.117)					TCTCTGCTTACGATGAAGAAC	0.542													80	205	---	---	---	---	capture	Silent	SNP	119915031	119915031	KCND2	7	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	7941	282
CCDC136	64753	broad.mit.edu	37	7	128445464	128445464	+	Silent	SNP	G	A	A			TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:128445464G>A	uc003vnv.1	+	6	1201	c.834G>A	c.(832-834)ACG>ACA	p.T278T	CCDC136_uc003vnu.1_Silent_p.T316T|CCDC136_uc003vnw.1_Silent_p.T278T|CCDC136_uc003vnx.1_Silent_p.T94T|CCDC136_uc010llq.1_5'UTR|CCDC136_uc003vny.1_5'Flank	NM_022742	NP_073579	Q96JN2	CC136_HUMAN	coiled-coil domain containing 136	278	Glu-rich.					integral to membrane	protein binding			ovary(2)	2						TGAGTATGACGTCAGCAGAGT	0.502													44	91	---	---	---	---	capture	Silent	SNP	128445464	128445464	CCDC136	7	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	2744	282
TRPV6	55503	broad.mit.edu	37	7	142570125	142570125	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:142570125C>T	uc003wbx.1	-	14	2111	c.1895G>A	c.(1894-1896)CGG>CAG	p.R632Q	TRPV6_uc003wbw.1_Missense_Mutation_p.R418Q|TRPV6_uc010lou.1_Missense_Mutation_p.R503Q	NM_018646	NP_061116	Q9H1D0	TRPV6_HUMAN	transient receptor potential cation channel,	632	Cytoplasmic (Potential).				regulation of calcium ion-dependent exocytosis	integral to plasma membrane	calcium channel activity|calmodulin binding			ovary(2)	2	Melanoma(164;0.059)					TATCACTCACCGCAGGAACCA	0.662													12	38	---	---	---	---	capture	Missense_Mutation	SNP	142570125	142570125	TRPV6	7	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	16483	282
MSR1	4481	broad.mit.edu	37	8	16012638	16012638	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:16012638G>A	uc003wwz.2	-	6	1031	c.833C>T	c.(832-834)CCG>CTG	p.P278L	MSR1_uc010lsu.2_Missense_Mutation_p.P296L|MSR1_uc003wxa.2_Missense_Mutation_p.P278L|MSR1_uc003wxb.2_Missense_Mutation_p.P278L|MSR1_uc011kxz.1_Missense_Mutation_p.P52L	NM_138715	NP_619729	P21757	MSRE_HUMAN	macrophage scavenger receptor 1 isoform type 1	278	Collagen-like.|Extracellular (Potential).				cholesterol transport|plasma lipoprotein particle clearance|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis	collagen|integral to plasma membrane|low-density lipoprotein particle	low-density lipoprotein particle binding|protein binding|scavenger receptor activity			ovary(1)	1				Colorectal(111;0.00475)|COAD - Colon adenocarcinoma(73;0.0164)		TTTTTCACCCGGGGGTCCAGG	0.398													17	21	---	---	---	---	capture	Missense_Mutation	SNP	16012638	16012638	MSR1	8	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	9796	282
PRDM14	63978	broad.mit.edu	37	8	70964463	70964463	+	Missense_Mutation	SNP	C	A	A			TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:70964463C>A	uc003xym.2	-	8	1767	c.1565G>T	c.(1564-1566)TGT>TTT	p.C522F		NM_024504	NP_078780	Q9GZV8	PRD14_HUMAN	PR domain containing 14	522	C2H2-type 5.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(3)	3	Breast(64;0.193)		Epithelial(68;0.00508)|all cancers(69;0.0259)|OV - Ovarian serous cystadenocarcinoma(28;0.0405)			AGATTTACCACAGTACTTGCA	0.517													36	58	---	---	---	---	capture	Missense_Mutation	SNP	70964463	70964463	PRDM14	8	C	A	A	A	1	0	0	0	0	1	0	0	0	221	17	4	4	12351	282
MTDH	92140	broad.mit.edu	37	8	98731338	98731338	+	Missense_Mutation	SNP	G	A	A	rs143317071		TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:98731338G>A	uc003yhz.2	+	10	1770	c.1442G>A	c.(1441-1443)CGT>CAT	p.R481H	MTDH_uc010mbf.2_RNA	NM_178812	NP_848927	Q86UE4	LYRIC_HUMAN	metadherin	481	Cytoplasmic (Potential).				lipopolysaccharide-mediated signaling pathway|negative regulation of apoptosis|negative regulation of transcription from RNA polymerase II promoter|positive regulation of angiogenesis|positive regulation of autophagy|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|positive regulation of protein kinase B signaling cascade	apical plasma membrane|endoplasmic reticulum membrane|integral to membrane|intercellular canaliculus|nuclear body|nuclear membrane|nucleolus|perinuclear region of cytoplasm|tight junction	NF-kappaB binding|RNA polymerase II transcription factor binding|transcription coactivator activity			liver(1)|central_nervous_system(1)	2	Breast(36;2.56e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.178)			TCTAAAACCCGTCCAAAACAG	0.333													42	55	---	---	---	---	capture	Missense_Mutation	SNP	98731338	98731338	MTDH	8	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	9827	282
WISP1	8840	broad.mit.edu	37	8	134239690	134239690	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:134239690G>A	uc003yub.2	+	5	917	c.841G>A	c.(841-843)GCA>ACA	p.A281T	WISP1_uc003yuc.2_Missense_Mutation_p.A194T|WISP1_uc010meb.2_Missense_Mutation_p.A109T|WISP1_uc010mec.2_Missense_Mutation_p.G129D|WISP1_uc010med.2_Missense_Mutation_p.A36T|WISP1_uc003yud.2_RNA	NM_003882	NP_003873	O95388	WISP1_HUMAN	WNT1 inducible signaling pathway protein 1	281	CTCK.				cell adhesion|cell-cell signaling|regulation of cell growth|Wnt receptor signaling pathway	extracellular region|soluble fraction	insulin-like growth factor binding			central_nervous_system(1)|kidney(1)	2	all_epithelial(106;5.39e-23)|Lung NSC(106;7.26e-07)|all_lung(105;2.77e-06)|Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0107)			CCAGCCAGAGGCATCCATGAA	0.527													35	46	---	---	---	---	capture	Missense_Mutation	SNP	134239690	134239690	WISP1	8	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	17253	282
KIAA0020	9933	broad.mit.edu	37	9	2837296	2837296	+	Missense_Mutation	SNP	T	C	C			TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:2837296T>C	uc003zhp.1	-	3	284	c.188A>G	c.(187-189)AAG>AGG	p.K63R	KIAA0020_uc010mhc.1_Missense_Mutation_p.K62R|KIAA0020_uc003zhq.1_Missense_Mutation_p.K63R	NM_014878	NP_055693	Q15397	K0020_HUMAN	KIAA0020 protein	63						endoplasmic reticulum|nucleolus	RNA binding			ovary(1)	1				GBM - Glioblastoma multiforme(50;0.0319)		CTTTACACCCTTTTTCCCAAG	0.388													3	227	---	---	---	---	capture	Missense_Mutation	SNP	2837296	2837296	KIAA0020	9	T	C	C	C	1	0	0	0	0	1	0	0	0	728	56	3	3	8074	282
FAM75C1	441452	broad.mit.edu	37	9	90536630	90536630	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:90536630G>A	uc010mqi.2	+	4	1837	c.1808G>A	c.(1807-1809)CGT>CAT	p.R603H	FAM75C1_uc004apq.3_Missense_Mutation_p.R586H	NM_001145124	NP_001138596			family with sequence similarity 75, member C1												0						GTGAGTGTGCGTCGATCCTGG	0.512													76	130	---	---	---	---	capture	Missense_Mutation	SNP	90536630	90536630	FAM75C1	9	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	5569	282
BICD2	23299	broad.mit.edu	37	9	95481762	95481762	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:95481762G>A	uc004aso.1	-	5	1222	c.1165C>T	c.(1165-1167)CGC>TGC	p.R389C	BICD2_uc004asp.1_Missense_Mutation_p.R389C	NM_015250	NP_056065	Q8TD16	BICD2_HUMAN	bicaudal D homolog 2 isoform 2	389	Potential.				microtubule anchoring at microtubule organizing center|minus-end-directed organelle transport along microtubule	cytoplasmic vesicle|cytoskeleton|Golgi apparatus|plasma membrane	Rab GTPase binding			skin(1)	1						TCTGTGAGGCGGGTCACCTTC	0.647													10	18	---	---	---	---	capture	Missense_Mutation	SNP	95481762	95481762	BICD2	9	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	1417	282
SH2D3C	10044	broad.mit.edu	37	9	130507103	130507103	+	Missense_Mutation	SNP	A	G	G			TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:130507103A>G	uc004bsc.2	-	7	1682	c.1540T>C	c.(1540-1542)TCC>CCC	p.S514P	SH2D3C_uc010mxo.2_Missense_Mutation_p.S354P|SH2D3C_uc004bry.2_Missense_Mutation_p.S356P|SH2D3C_uc004brz.3_Missense_Mutation_p.S160P|SH2D3C_uc011mak.1_Missense_Mutation_p.S160P|SH2D3C_uc004bsa.2_Missense_Mutation_p.S357P|SH2D3C_uc004bsb.2_Missense_Mutation_p.S446P	NM_170600	NP_733745	Q8N5H7	SH2D3_HUMAN	SH2 domain containing 3C isoform a	514					JNK cascade|small GTPase mediated signal transduction	cytoplasm|membrane	guanyl-nucleotide exchange factor activity|SH3/SH2 adaptor activity			ovary(1)	1						TGCTGGCTGGAGGTCTCAGTC	0.622													4	200	---	---	---	---	capture	Missense_Mutation	SNP	130507103	130507103	SH2D3C	9	A	G	G	G	1	0	0	0	0	1	0	0	0	143	11	3	3	14127	282
NTNG2	84628	broad.mit.edu	37	9	135042315	135042315	+	Missense_Mutation	SNP	A	C	C			TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:135042315A>C	uc004cbh.2	+	2	873	c.97A>C	c.(97-99)ACC>CCC	p.T33P		NM_032536	NP_115925	Q96CW9	NTNG2_HUMAN	netrin G2 precursor	33					axonogenesis	anchored to plasma membrane					0				OV - Ovarian serous cystadenocarcinoma(145;1.23e-05)|Epithelial(140;0.000173)		TGAGGGCCCCACCTGGGAGTT	0.607													4	93	---	---	---	---	capture	Missense_Mutation	SNP	135042315	135042315	NTNG2	9	A	C	C	C	1	0	0	0	0	1	0	0	0	78	6	4	4	10612	282
COL5A1	1289	broad.mit.edu	37	9	137716532	137716532	+	Silent	SNP	C	T	T	rs149981025		TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:137716532C>T	uc004cfe.2	+	62	5167	c.4785C>T	c.(4783-4785)GAC>GAT	p.D1595D	uc004cff.2_Intron	NM_000093	NP_000084	P20908	CO5A1_HUMAN	alpha 1 type V collagen preproprotein	1595	Nonhelical region.				axon guidance|cell adhesion|collagen biosynthetic process|collagen fibril organization|eye morphogenesis|fibril organization|integrin biosynthetic process|skin development|wound healing, spreading of epidermal cells	collagen type V	heparin binding|integrin binding|platelet-derived growth factor binding|proteoglycan binding			skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|kidney(1)	11		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)		TGCTGGACGACGGGAATGGCG	0.627													26	52	---	---	---	---	capture	Silent	SNP	137716532	137716532	COL5A1	9	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	3661	282
KDM6A	7403	broad.mit.edu	37	X	44929255	44929255	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:44929255G>A	uc004dge.3	+	17	2730	c.2355G>A	c.(2353-2355)ATG>ATA	p.M785I	KDM6A_uc010nhk.2_Missense_Mutation_p.M751I|KDM6A_uc011mkz.1_Missense_Mutation_p.M837I|KDM6A_uc011mla.1_Missense_Mutation_p.M740I|KDM6A_uc011mlb.1_Missense_Mutation_p.M792I|KDM6A_uc011mlc.1_Missense_Mutation_p.M489I|KDM6A_uc011mld.1_Missense_Mutation_p.M424I	NM_021140	NP_066963	O15550	KDM6A_HUMAN	ubiquitously transcribed tetratricopeptide	785					histone H3-K4 methylation		metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			kidney(24)|haematopoietic_and_lymphoid_tissue(23)|oesophagus(11)|large_intestine(7)|lung(5)|breast(4)|central_nervous_system(3)|urinary_tract(3)|endometrium(2)|pancreas(2)	84						CCTTGTTGATGGGAAAAGCCA	0.448			D|N|F|S		renal|oesophageal SCC|MM								24	7	---	---	---	---	capture	Missense_Mutation	SNP	44929255	44929255	KDM6A	23	G	A	A	A	1	0	0	0	0	1	0	0	0	611	47	2	2	8059	282
IL1RAPL2	26280	broad.mit.edu	37	X	105011554	105011554	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:105011554C>T	uc004elz.1	+	11	2717	c.1961C>T	c.(1960-1962)CCC>CTC	p.P654L		NM_017416	NP_059112	Q9NP60	IRPL2_HUMAN	interleukin 1 receptor accessory protein-like 2	654	Cytoplasmic (Potential).				central nervous system development|innate immune response	integral to membrane	interleukin-1, Type II, blocking receptor activity			breast(2)|ovary(1)	3						GGACAGCTACCCCTTAATAAC	0.448													60	9	---	---	---	---	capture	Missense_Mutation	SNP	105011554	105011554	IL1RAPL2	23	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	7585	282
MAGEC2	51438	broad.mit.edu	37	X	141290669	141290669	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:141290669C>T	uc004fbu.1	-	3	1453	c.1105G>A	c.(1105-1107)GTC>ATC	p.V369I		NM_016249	NP_057333	Q9UBF1	MAGC2_HUMAN	melanoma antigen family C, 2	369						cytoplasm|nucleus				breast(2)	2	Acute lymphoblastic leukemia(192;6.56e-05)					GAAAAGGAGACGTTGCTGGAC	0.502										HNSCC(46;0.14)			58	11	---	---	---	---	capture	Missense_Mutation	SNP	141290669	141290669	MAGEC2	23	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	9095	282
COL24A1	255631	broad.mit.edu	37	1	86282552	86282552	+	Frame_Shift_Del	DEL	T	-	-			TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:86282552delT	uc001dlj.2	-	47	3912	c.3870delA	c.(3868-3870)AAAfs	p.K1290fs	COL24A1_uc001dli.2_Frame_Shift_Del_p.K426fs|COL24A1_uc010osd.1_Frame_Shift_Del_p.K590fs|COL24A1_uc001dlk.2_RNA|COL24A1_uc010ose.1_RNA|COL24A1_uc010osf.1_RNA	NM_152890	NP_690850	Q17RW2	COOA1_HUMAN	collagen, type XXIV, alpha 1 precursor	1290	Collagen-like 14.				cell adhesion	collagen	extracellular matrix structural constituent			ovary(3)|central_nervous_system(1)|skin(1)	5				all cancers(265;0.0627)|Epithelial(280;0.0689)		CTTGTATGCCTTTTGGCCCAA	0.388													7	173	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	86282552	86282552	COL24A1	1	T	-	-	-	1	0	1	0	1	0	0	0	0	725	56	5	5	3648	282
RBMXL1	494115	broad.mit.edu	37	1	89448604	89448605	+	Frame_Shift_Ins	INS	-	GG	GG			TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:89448604_89448605insGG	uc009wcx.2	-	3	1621_1622	c.905_906insCC	c.(904-906)CCAfs	p.P302fs	CCBL2_uc001dmp.2_Intron|CCBL2_uc001dmq.2_Intron|CCBL2_uc001dmr.2_Intron|RBMXL1_uc001dms.2_Frame_Shift_Ins_p.P302fs	NM_001162536	NP_001156008	Q96E39	RBMXL_HUMAN	RNA binding motif protein, X-linked-like 1	302	Ser-rich.						nucleotide binding|RNA binding				0						CACCATAAGATGGCGGGGGCCC	0.475													7	262	---	---	---	---	capture_indel	Frame_Shift_Ins	INS	89448604	89448605	RBMXL1	1	-	GG	GG	GG	1	0	1	1	0	0	0	0	0	652	51	5	5	13048	282
RPTN	126638	broad.mit.edu	37	1	152128277	152128280	+	Frame_Shift_Del	DEL	TGTC	-	-			TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152128277_152128280delTGTC	uc001ezs.1	-	3	1360_1363	c.1295_1298delGACA	c.(1294-1299)AGACAAfs	p.R432fs		NM_001122965	NP_001116437	Q6XPR3	RPTN_HUMAN	repetin	432_433	Gln-rich.					proteinaceous extracellular matrix	calcium ion binding				0						ACTCTGGCCTTGTCTGTCTGTCTG	0.525													9	1141	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	152128277	152128280	RPTN	1	TGTC	-	-	-	1	0	1	0	1	0	0	0	0	819	63	5	5	13556	282
PTPN14	5784	broad.mit.edu	37	1	214557049	214557051	+	In_Frame_Del	DEL	CCT	-	-			TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:214557049_214557051delCCT	uc001hkk.1	-	13	2418_2420	c.2147_2149delAGG	c.(2146-2151)GAGGCT>GCT	p.E716del	PTPN14_uc010pty.1_In_Frame_Del_p.E617del	NM_005401	NP_005392	Q15678	PTN14_HUMAN	protein tyrosine phosphatase, non-receptor type	716	Poly-Glu.				lymphangiogenesis	cytoplasm|cytoskeleton	protein tyrosine phosphatase activity|receptor tyrosine kinase binding			breast(2)|ovary(1)|kidney(1)|skin(1)	5				OV - Ovarian serous cystadenocarcinoma(81;0.00181)|all cancers(67;0.00194)|Epithelial(68;0.0157)|GBM - Glioblastoma multiforme(131;0.155)		GATTCTGGAGCCTCCTCCTCCTC	0.626													7	78	---	---	---	---	capture_indel	In_Frame_Del	DEL	214557049	214557051	PTPN14	1	CCT	-	-	-	1	0	1	0	1	0	0	0	0	338	26	5	5	12678	282
ZNF563	147837	broad.mit.edu	37	19	12430217	12430217	+	Frame_Shift_Del	DEL	A	-	-			TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:12430217delA	uc002mtp.2	-	4	860	c.622delT	c.(622-624)TGGfs	p.W208fs	ZNF563_uc002mtq.2_Intron	NM_145276	NP_660319	Q8TA94	ZN563_HUMAN	zinc finger protein 563	208	C2H2-type 3.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						AAACTGGGCCAAAAAAAAGCT	0.393													8	290	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	12430217	12430217	ZNF563	19	A	-	-	-	1	0	1	0	1	0	0	0	0	65	5	5	5	17873	282
ZNF91	7644	broad.mit.edu	37	19	23544856	23544856	+	Frame_Shift_Del	DEL	G	-	-			TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:23544856delG	uc002nre.2	-	4	1038	c.925delC	c.(925-927)CTTfs	p.L309fs	ZNF91_uc010xrj.1_Frame_Shift_Del_p.L277fs	NM_003430	NP_003421	Q05481	ZNF91_HUMAN	zinc finger protein 91	309	C2H2-type 6.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		all_lung(12;0.0349)|Lung NSC(12;0.0538)|all_epithelial(12;0.0611)				TGTTTAGCAAGGGTTGAAGAA	0.403													52	127	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	23544856	23544856	ZNF91	19	G	-	-	-	1	0	1	0	1	0	0	0	0	455	35	5	5	18076	282
WDR88	126248	broad.mit.edu	37	19	33666419	33666421	+	In_Frame_Del	DEL	TCA	-	-			TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:33666419_33666421delTCA	uc002nui.2	+	11	1438_1440	c.1360_1362delTCA	c.(1360-1362)TCAdel	p.S458del		NM_173479	NP_775750	Q6ZMY6	WDR88_HUMAN	PQQ repeat and WD repeat domain containing	458	Poly-Ser.									ovary(1)|breast(1)|central_nervous_system(1)	3	Esophageal squamous(110;0.137)					TACTTCATCGTCATCATCATCAT	0.527													7	229	---	---	---	---	capture_indel	In_Frame_Del	DEL	33666419	33666421	WDR88	19	TCA	-	-	-	1	0	1	0	1	0	0	0	0	754	58	5	5	17216	282
TMEM131	23505	broad.mit.edu	37	2	98427639	98427639	+	Frame_Shift_Del	DEL	T	-	-			TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:98427639delT	uc002syh.3	-	18	2149	c.1920delA	c.(1918-1920)AAAfs	p.K640fs		NM_015348	NP_056163	Q92545	TM131_HUMAN	RW1 protein	640						integral to membrane				ovary(4)|central_nervous_system(2)	6						TCCCCTCTAATTTTTTTGCAG	0.393													9	409	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	98427639	98427639	TMEM131	2	T	-	-	-	1	0	1	0	1	0	0	0	0	673	52	5	5	15928	282
MORC1	27136	broad.mit.edu	37	3	108682419	108682419	+	Frame_Shift_Del	DEL	T	-	-			TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:108682419delT	uc003dxl.2	-	27	2728	c.2641delA	c.(2641-2643)ATAfs	p.I881fs	MORC1_uc011bhn.1_Frame_Shift_Del_p.I860fs	NM_014429	NP_055244	Q86VD1	MORC1_HUMAN	MORC family CW-type zinc finger 1	881					cell differentiation|multicellular organismal development|spermatogenesis	nucleus	ATP binding|zinc ion binding			ovary(3)|skin(3)|breast(2)	8						TTCCTCTTTATTTTTTTTTCA	0.284													7	73	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	108682419	108682419	MORC1	3	T	-	-	-	1	0	1	0	1	0	0	0	0	676	52	5	5	9613	282
SLC35B2	347734	broad.mit.edu	37	6	44222858	44222858	+	Frame_Shift_Del	DEL	T	-	-			TCGA-76-6656-01	TCGA-76-6656-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:44222858delT	uc003oxd.2	-	4	1020	c.884delA	c.(883-885)TATfs	p.Y295fs	SLC35B2_uc011dvt.1_Frame_Shift_Del_p.Y198fs|SLC35B2_uc011dvu.1_Frame_Shift_Del_p.Y162fs	NM_178148	NP_835361	Q8TB61	S35B2_HUMAN	solute carrier family 35, member B2	295					positive regulation of I-kappaB kinase/NF-kappaB cascade	Golgi membrane|integral to membrane	3'-phosphoadenosine 5'-phosphosulfate transmembrane transporter activity|signal transducer activity			ovary(1)|central_nervous_system(1)	2	all_cancers(18;2e-05)|all_lung(25;0.00747)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			TGACATCTTATAGGCAAACAG	0.532													32	43	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	44222858	44222858	SLC35B2	6	T	-	-	-	1	0	1	0	1	0	0	0	0	637	49	5	5	14468	282
