Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
CHD5	26038	broad.mit.edu	37	1	6209438	6209438	+	Silent	SNP	C	T	T			TCGA-76-6657-01	TCGA-76-6657-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:6209438C>T	uc001amb.1	-	8	1129	c.1029G>A	c.(1027-1029)CAG>CAA	p.Q343Q	CHD5_uc001amc.1_5'Flank	NM_015557	NP_056372	Q8TDI0	CHD5_HUMAN	chromodomain helicase DNA binding protein 5	343	PHD-type 1.				chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ATP binding|ATP-dependent helicase activity|DNA binding|zinc ion binding			central_nervous_system(3)|breast(3)|ovary(2)|upper_aerodigestive_tract(1)|lung(1)|skin(1)|pancreas(1)	12	Ovarian(185;0.0634)	all_cancers(23;5.36e-32)|all_epithelial(116;2.32e-17)|all_neural(13;3.68e-06)|all_lung(118;3.94e-06)|all_hematologic(16;2.39e-05)|Lung NSC(185;5.33e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00373)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;3.08e-37)|GBM - Glioblastoma multiforme(13;1.36e-31)|OV - Ovarian serous cystadenocarcinoma(86;7.7e-19)|Colorectal(212;9.97e-08)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(185;6.16e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00109)|BRCA - Breast invasive adenocarcinoma(365;0.0012)|STAD - Stomach adenocarcinoma(132;0.00346)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.193)		CACAGTAATCCTGGTGGTCTG	0.577													18	14	---	---	---	---	capture	Silent	SNP	6209438	6209438	CHD5	1	C	T	T	T	1	0	0	0	0	0	0	0	1	311	24	2	2	3294	283
MACF1	23499	broad.mit.edu	37	1	39763324	39763324	+	Missense_Mutation	SNP	C	G	G			TCGA-76-6657-01	TCGA-76-6657-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:39763324C>G	uc010ois.1	+	22	2608	c.2403C>G	c.(2401-2403)TTC>TTG	p.F801L	MACF1_uc001cda.1_Missense_Mutation_p.F709L|MACF1_uc001cdc.1_5'Flank|MACF1_uc009vvq.1_5'Flank|MACF1_uc001cdb.1_5'Flank	NM_012090	NP_036222	Q9UPN3	MACF1_HUMAN	microfilament and actin filament cross-linker	801					cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding			ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			TGGAGTCATTCTTGAGGAACC	0.443													43	55	---	---	---	---	capture	Missense_Mutation	SNP	39763324	39763324	MACF1	1	C	G	G	G	1	0	0	0	0	1	0	0	0	415	32	4	4	9059	283
MPL	4352	broad.mit.edu	37	1	43812465	43812465	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6657-01	TCGA-76-6657-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:43812465C>T	uc001ciw.2	+	8	1213	c.1168C>T	c.(1168-1170)CGC>TGC	p.R390C	MPL_uc001civ.2_Missense_Mutation_p.R390C|MPL_uc009vwr.2_Missense_Mutation_p.R383C	NM_005373	NP_005364	P40238	TPOR_HUMAN	myeloproliferative leukemia virus oncogene	390	Extracellular (Potential).				cell proliferation|platelet activation	integral to plasma membrane	cytokine receptor activity			haematopoietic_and_lymphoid_tissue(361)|upper_aerodigestive_tract(1)|pancreas(1)	363	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				CCCTGTAGTGCGCCTCCCCAC	0.582			Mis		MPD	MPD	congenital amegakaryocytic thrombocytopenia						38	62	---	---	---	---	capture	Missense_Mutation	SNP	43812465	43812465	MPL	1	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	9642	283
EPS8L3	79574	broad.mit.edu	37	1	110293381	110293381	+	Silent	SNP	G	A	A			TCGA-76-6657-01	TCGA-76-6657-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:110293381G>A	uc001dyr.1	-	18	1816	c.1671C>T	c.(1669-1671)AGC>AGT	p.S557S	EPS8L3_uc001dys.1_Silent_p.S527S|EPS8L3_uc001dyq.1_Silent_p.S558S|EPS8L3_uc009wfm.1_Silent_p.S494S	NM_133181	NP_573444	Q8TE67	ES8L3_HUMAN	epidermal growth factor receptor pathway	557						cytoplasm	protein binding			ovary(2)|skin(1)	3		all_epithelial(167;1.95e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)		Lung(183;0.0245)|Colorectal(144;0.0365)|all cancers(265;0.103)|Epithelial(280;0.109)|LUSC - Lung squamous cell carcinoma(189;0.137)|COAD - Colon adenocarcinoma(174;0.141)		GAAGTAGCTGGCTCCCCGTCA	0.607													9	26	---	---	---	---	capture	Silent	SNP	110293381	110293381	EPS8L3	1	G	A	A	A	1	0	0	0	0	0	0	0	1	542	42	2	2	5152	283
IGSF3	3321	broad.mit.edu	37	1	117150591	117150591	+	Missense_Mutation	SNP	T	A	A			TCGA-76-6657-01	TCGA-76-6657-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:117150591T>A	uc001egr.1	-	5	1900	c.1195A>T	c.(1195-1197)AAC>TAC	p.N399Y	IGSF3_uc001egq.1_Missense_Mutation_p.N399Y|IGSF3_uc001egs.1_Missense_Mutation_p.N72Y	NM_001007237	NP_001007238	O75054	IGSF3_HUMAN	immunoglobulin superfamily, member 3 isoform 2	399	Extracellular (Potential).					integral to membrane				ovary(2)	2	Lung SC(450;0.225)	all_cancers(81;1.24e-06)|all_epithelial(167;4.85e-07)|all_lung(203;1.66e-06)|Lung NSC(69;1.11e-05)		Lung(183;0.0142)|Colorectal(144;0.0929)|LUSC - Lung squamous cell carcinoma(189;0.108)|COAD - Colon adenocarcinoma(174;0.139)|all cancers(265;0.159)|Epithelial(280;0.166)		ATGGGGATGTTCTTGGGACGC	0.517													8	151	---	---	---	---	capture	Missense_Mutation	SNP	117150591	117150591	IGSF3	1	T	A	A	A	1	0	0	0	0	1	0	0	0	806	62	4	4	7525	283
LCE1F	353137	broad.mit.edu	37	1	152749094	152749094	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6657-01	TCGA-76-6657-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152749094C>T	uc010pdv.1	+	1	247	c.247C>T	c.(247-249)CGT>TGT	p.R83C		NM_178354	NP_848131	Q5T754	LCE1F_HUMAN	late cornified envelope 1F	83	Poly-Arg.				keratinization						0	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			CCACAGACGGCGTAGGTCCCA	0.701													17	22	---	---	---	---	capture	Missense_Mutation	SNP	152749094	152749094	LCE1F	1	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	8584	283
OR10X1	128367	broad.mit.edu	37	1	158549258	158549258	+	Silent	SNP	G	A	A			TCGA-76-6657-01	TCGA-76-6657-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:158549258G>A	uc010pin.1	-	1	432	c.432C>T	c.(430-432)AAC>AAT	p.N144N		NM_001004477	NP_001004477	Q8NGY0	O10X1_HUMAN	olfactory receptor, family 10, subfamily X,	144	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1	all_hematologic(112;0.0378)					ATCTTAGAGGGTTACAGATGG	0.463													17	33	---	---	---	---	capture	Silent	SNP	158549258	158549258	OR10X1	1	G	A	A	A	1	0	0	0	0	0	0	0	1	568	44	2	2	10826	283
TNFSF18	8995	broad.mit.edu	37	1	173010834	173010834	+	Nonsense_Mutation	SNP	C	T	T			TCGA-76-6657-01	TCGA-76-6657-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:173010834C>T	uc001giu.2	-	3	274	c.273G>A	c.(271-273)TGG>TGA	p.W91*		NM_005092	NP_005083	Q9UNG2	TNF18_HUMAN	tumor necrosis factor (ligand) superfamily,	91	Extracellular (Potential).				anti-apoptosis|cell-cell signaling|immune response|signal transduction	extracellular space|integral to membrane	cytokine activity|tumor necrosis factor receptor binding			central_nervous_system(1)	1						ATGCCATTTGCCATTTTGAGG	0.353													4	148	---	---	---	---	capture	Nonsense_Mutation	SNP	173010834	173010834	TNFSF18	1	C	T	T	T	1	0	0	0	0	0	1	0	0	338	26	5	2	16192	283
RASAL2	9462	broad.mit.edu	37	1	178427055	178427055	+	Silent	SNP	A	T	T			TCGA-76-6657-01	TCGA-76-6657-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:178427055A>T	uc001glr.2	+	12	2330	c.2205A>T	c.(2203-2205)GGA>GGT	p.G735G	RASAL2_uc001glq.2_Silent_p.G876G|RASAL2_uc009wxc.2_Silent_p.G249G	NM_004841	NP_004832	Q9UJF2	NGAP_HUMAN	RAS protein activator like 2 isoform 1	735					negative regulation of Ras protein signal transduction|signal transduction	cytoplasm|intrinsic to internal side of plasma membrane	Ras GTPase activator activity			ovary(2)|breast(2)|large_intestine(1)	5						GCTTGACCGGAAGCCAGCTTT	0.572													27	37	---	---	---	---	capture	Silent	SNP	178427055	178427055	RASAL2	1	A	T	T	T	1	0	0	0	0	0	0	0	1	106	9	4	4	12959	283
OR2T3	343173	broad.mit.edu	37	1	248636975	248636975	+	Silent	SNP	C	T	T			TCGA-76-6657-01	TCGA-76-6657-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:248636975C>T	uc001iel.1	+	1	324	c.324C>T	c.(322-324)TTC>TTT	p.F108F		NM_001005495	NP_001005495	Q8NH03	OR2T3_HUMAN	olfactory receptor, family 2, subfamily T,	108	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			AGATGTTCTTCTACCTGACCC	0.537													31	86	---	---	---	---	capture	Silent	SNP	248636975	248636975	OR2T3	1	C	T	T	T	1	0	0	0	0	0	0	0	1	415	32	2	2	10927	283
CYP2C8	1558	broad.mit.edu	37	10	96827103	96827103	+	Missense_Mutation	SNP	T	G	G			TCGA-76-6657-01	TCGA-76-6657-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:96827103T>G	uc001kkb.2	-	3	438	c.343A>C	c.(343-345)AGC>CGC	p.S115R	CYP2C8_uc001kkc.2_RNA|CYP2C8_uc010qoa.1_Missense_Mutation_p.S45R|CYP2C8_uc010qob.1_Missense_Mutation_p.S29R|CYP2C8_uc010qoc.1_Missense_Mutation_p.S13R|CYP2C8_uc010qod.1_Missense_Mutation_p.S29R	NM_000770	NP_000761	P10632	CP2C8_HUMAN	cytochrome P450, family 2, subfamily C,	115					exogenous drug catabolic process|organic acid metabolic process|oxidative demethylation|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|caffeine oxidase activity|electron carrier activity|heme binding|oxygen binding				0		Colorectal(252;0.0397)		all cancers(201;6.21e-05)	Aminophenazone(DB01424)|Amiodarone(DB01118)|Amodiaquine(DB00613)|Benzphetamine(DB00865)|Carbamazepine(DB00564)|Cerivastatin(DB00439)|Diclofenac(DB00586)|Fluvastatin(DB01095)|Fosphenytoin(DB01320)|Gemfibrozil(DB01241)|Ketoconazole(DB01026)|Lapatinib(DB01259)|Lovastatin(DB00227)|Midazolam(DB00683)|Montelukast(DB00471)|Nicardipine(DB00622)|Paclitaxel(DB01229)|Phenytoin(DB00252)|Pioglitazone(DB01132)|Repaglinide(DB00912)|Rifampin(DB01045)|Rosiglitazone(DB00412)|Simvastatin(DB00641)|Sitagliptin(DB01261)|Tolbutamide(DB01124)|Torasemide(DB00214)|Tretinoin(DB00755)|Trimethoprim(DB00440)|Warfarin(DB00682)|Zafirlukast(DB00549)|Zopiclone(DB01198)	TTTCCATTGCTGGAAATGATT	0.483													33	22	---	---	---	---	capture	Missense_Mutation	SNP	96827103	96827103	CYP2C8	10	T	G	G	G	1	0	0	0	0	1	0	0	0	715	55	4	4	4127	283
DUSP5	1847	broad.mit.edu	37	10	112269798	112269798	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6657-01	TCGA-76-6657-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:112269798G>A	uc001kzd.2	+	4	1024	c.769G>A	c.(769-771)GGC>AGC	p.G257S		NM_004419	NP_004410	Q16690	DUS5_HUMAN	dual specificity phosphatase 5	257	Tyrosine-protein phosphatase.				endoderm formation|inactivation of MAPK activity	nucleoplasm	MAP kinase tyrosine/serine/threonine phosphatase activity|protein tyrosine phosphatase activity			upper_aerodigestive_tract(1)	1		Breast(234;0.0848)		Epithelial(162;0.000276)|all cancers(201;0.00465)|BRCA - Breast invasive adenocarcinoma(275;0.12)		GGAAAAGGGAGGCAAGGTCCT	0.512													19	10	---	---	---	---	capture	Missense_Mutation	SNP	112269798	112269798	DUSP5	10	G	A	A	A	1	0	0	0	0	1	0	0	0	455	35	2	2	4783	283
HABP2	3026	broad.mit.edu	37	10	115341658	115341658	+	Missense_Mutation	SNP	C	A	A			TCGA-76-6657-01	TCGA-76-6657-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:115341658C>A	uc001lai.3	+	9	965	c.862C>A	c.(862-864)CCC>ACC	p.P288T	HABP2_uc010qrz.1_Intron	NM_004132	NP_004123	Q14520	HABP2_HUMAN	hyaluronan binding protein 2 preproprotein	288					cell adhesion|proteolysis	extracellular space	glycosaminoglycan binding|serine-type endopeptidase activity			ovary(2)|skin(1)	3		Colorectal(252;0.0233)|Breast(234;0.0672)		Epithelial(162;0.00319)|all cancers(201;0.0112)		AGAGGAAAGCCCCACTGAGCC	0.507													46	23	---	---	---	---	capture	Missense_Mutation	SNP	115341658	115341658	HABP2	10	C	A	A	A	1	0	0	0	0	1	0	0	0	286	22	4	4	6865	283
OR5B3	441608	broad.mit.edu	37	11	58170350	58170350	+	Missense_Mutation	SNP	T	A	A			TCGA-76-6657-01	TCGA-76-6657-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:58170350T>A	uc010rkf.1	-	1	533	c.533A>T	c.(532-534)GAT>GTT	p.D178V		NM_001005469	NP_001005469	Q8NH48	OR5B3_HUMAN	olfactory receptor, family 5, subfamily B,	178	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	Esophageal squamous(5;0.0027)	Breast(21;0.0778)				TGCTGGAATATCACAGAAAAA	0.423													8	49	---	---	---	---	capture	Missense_Mutation	SNP	58170350	58170350	OR5B3	11	T	A	A	A	1	0	0	0	0	1	0	0	0	650	50	4	4	11056	283
CASP1	834	broad.mit.edu	37	11	104899923	104899923	+	Nonsense_Mutation	SNP	C	A	A			TCGA-76-6657-01	TCGA-76-6657-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:104899923C>A	uc010rve.1	-	7	951	c.934G>T	c.(934-936)GAG>TAG	p.E312*	CASP1_uc001pig.2_Nonsense_Mutation_p.E219*|CASP1_uc001pik.2_Nonsense_Mutation_p.E275*|CASP1_uc010rvf.1_Nonsense_Mutation_p.E219*|CASP1_uc010rvg.1_Nonsense_Mutation_p.E291*|CASP1_uc010rvh.1_Intron|CASP1_uc010rvi.1_Intron|CASP1_uc001pim.3_Nonsense_Mutation_p.E312*|CASP1_uc009yxi.2_Nonsense_Mutation_p.E291*|CASP1_uc010rvj.1_Nonsense_Mutation_p.E312*|CASP1_uc009yxj.2_Nonsense_Mutation_p.E157*|CASP1_uc010rvk.1_Nonsense_Mutation_p.E273*	NM_033292	NP_150634	P29466	CASP1_HUMAN	caspase 1 isoform alpha precursor	312					cellular response to mechanical stimulus|cellular response to organic substance|positive regulation of I-kappaB kinase/NF-kappaB cascade|proteolysis|signal transduction	cytosol	caspase activator activity|cysteine-type endopeptidase activity|protein binding			ovary(2)	2		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Melanoma(852;0.0047)		BRCA - Breast invasive adenocarcinoma(274;0.000525)|Epithelial(105;0.0128)|all cancers(92;0.0482)	Minocycline(DB01017)|Penicillamine(DB00859)	TCCTCAAACTCTTCTGTAGTT	0.408													16	30	---	---	---	---	capture	Nonsense_Mutation	SNP	104899923	104899923	CASP1	11	C	A	A	A	1	0	0	0	0	0	1	0	0	416	32	5	4	2644	283
OR8D1	283159	broad.mit.edu	37	11	124179842	124179842	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6657-01	TCGA-76-6657-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:124179842G>A	uc010sag.1	-	1	821	c.821C>T	c.(820-822)TCC>TTC	p.S274F		NM_001002917	NP_001002917	Q8WZ84	OR8D1_HUMAN	olfactory receptor, family 8, subfamily D,	274	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0528)		GAACACAGAGGACACCTTCTC	0.463													46	61	---	---	---	---	capture	Missense_Mutation	SNP	124179842	124179842	OR8D1	11	G	A	A	A	1	0	0	0	0	1	0	0	0	533	41	2	2	11135	283
DYRK4	8798	broad.mit.edu	37	12	4708241	4708241	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6657-01	TCGA-76-6657-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:4708241G>A	uc001qmx.2	+	7	768	c.608G>A	c.(607-609)AGT>AAT	p.S203N	DYRK4_uc009zeh.1_Missense_Mutation_p.S318N|DYRK4_uc001qmy.1_Missense_Mutation_p.S203N	NM_003845	NP_003836	Q9NR20	DYRK4_HUMAN	dual-specificity tyrosine-(Y)-phosphorylation	203	Protein kinase.					Golgi apparatus	ATP binding|metal ion binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			lung(2)|skin(1)	3			Colorectal(7;0.103)			CAAGGCTTCAGTCTGTCCATA	0.413													40	108	---	---	---	---	capture	Missense_Mutation	SNP	4708241	4708241	DYRK4	12	G	A	A	A	1	0	0	0	0	1	0	0	0	468	36	2	2	4813	283
PIK3C2G	5288	broad.mit.edu	37	12	18658296	18658296	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6657-01	TCGA-76-6657-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:18658296G>A	uc001rdt.2	+	23	3217	c.3101G>A	c.(3100-3102)CGT>CAT	p.R1034H	PIK3C2G_uc010sia.1_RNA|PIK3C2G_uc010sib.1_Missense_Mutation_p.R1075H|PIK3C2G_uc010sic.1_Missense_Mutation_p.R853H	NM_004570	NP_004561	O75747	P3C2G_HUMAN	phosphoinositide-3-kinase, class 2 gamma	1034	PI3K/PI4K.				cell communication|phosphatidylinositol-mediated signaling	membrane|phosphatidylinositol 3-kinase complex	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol binding|phosphatidylinositol-4-phosphate 3-kinase activity			lung(8)|central_nervous_system(6)|breast(3)|stomach(2)|ovary(2)	21		Hepatocellular(102;0.194)				GTATGTGACCGTCACAATGAT	0.398													7	16	---	---	---	---	capture	Missense_Mutation	SNP	18658296	18658296	PIK3C2G	12	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	11814	283
ALX1	8092	broad.mit.edu	37	12	85695206	85695206	+	Nonsense_Mutation	SNP	C	T	T			TCGA-76-6657-01	TCGA-76-6657-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:85695206C>T	uc001tae.3	+	4	938	c.934C>T	c.(934-936)CGA>TGA	p.R312*		NM_006982	NP_008913	Q15699	ALX1_HUMAN	cartilage paired-class homeoprotein 1	312	OAR.				brain development|cartilage condensation|negative regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter		sequence-specific DNA binding transcription factor activity|transcription corepressor activity			ovary(1)|central_nervous_system(1)	2				GBM - Glioblastoma multiforme(134;0.134)		CGCAGTTCTTCGAATGAAAGC	0.378													27	50	---	---	---	---	capture	Nonsense_Mutation	SNP	85695206	85695206	ALX1	12	C	T	T	T	1	0	0	0	0	0	1	0	0	399	31	5	1	556	283
ACACB	32	broad.mit.edu	37	12	109687832	109687832	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6657-01	TCGA-76-6657-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:109687832G>A	uc001tob.2	+	41	5832	c.5713G>A	c.(5713-5715)GTG>ATG	p.V1905M	ACACB_uc001toc.2_Missense_Mutation_p.V1905M|ACACB_uc010sxl.1_RNA|ACACB_uc001tod.2_RNA|ACACB_uc010sxm.1_Missense_Mutation_p.V571M	NM_001093	NP_001084	O00763	ACACB_HUMAN	acetyl-Coenzyme A carboxylase beta	1905	Carboxyltransferase.				acetyl-CoA metabolic process|carnitine shuttle|energy reserve metabolic process|fatty acid biosynthetic process|positive regulation of cellular metabolic process|protein homotetramerization|regulation of fatty acid oxidation	cytosol|endomembrane system|Golgi apparatus|membrane	acetyl-CoA carboxylase activity|ATP binding|biotin carboxylase activity|metal ion binding|protein binding			ovary(5)|upper_aerodigestive_tract(1)|pancreas(1)|skin(1)	8					Biotin(DB00121)	TGGCTTGGGCGTGGAGAATCT	0.493													32	50	---	---	---	---	capture	Missense_Mutation	SNP	109687832	109687832	ACACB	12	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	107	283
GCN1L1	10985	broad.mit.edu	37	12	120582480	120582480	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6657-01	TCGA-76-6657-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:120582480G>A	uc001txo.2	-	41	5328	c.5315C>T	c.(5314-5316)ACT>ATT	p.T1772I		NM_006836	NP_006827	Q92616	GCN1L_HUMAN	GCN1 general control of amino-acid synthesis	1772					regulation of translation	ribosome	protein binding|translation factor activity, nucleic acid binding			ovary(4)	4	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					CACATAAGGAGTAAACTTGTC	0.512													50	75	---	---	---	---	capture	Missense_Mutation	SNP	120582480	120582480	GCN1L1	12	G	A	A	A	1	0	0	0	0	1	0	0	0	468	36	2	2	6239	283
ZC3H13	23091	broad.mit.edu	37	13	46549530	46549530	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6657-01	TCGA-76-6657-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:46549530G>A	uc010tfw.1	-	11	2362	c.2356C>T	c.(2356-2358)CGC>TGC	p.R786C	ZC3H13_uc001vas.1_Missense_Mutation_p.R786C|ZC3H13_uc001vat.1_Missense_Mutation_p.R786C	NM_015070	NP_055885	Q5T200	ZC3HD_HUMAN	zinc finger CCCH-type containing 13	786	Arg/Glu-rich.|Potential.						nucleic acid binding|zinc ion binding			ovary(1)|lung(1)	2		Lung NSC(96;7.26e-05)|Breast(56;0.000118)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;4.18e-05)		TCCCTTTGGCGTTCTCGTTCT	0.259													75	133	---	---	---	---	capture	Missense_Mutation	SNP	46549530	46549530	ZC3H13	13	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	17445	283
PCID2	55795	broad.mit.edu	37	13	113834511	113834511	+	Missense_Mutation	SNP	T	A	A			TCGA-76-6657-01	TCGA-76-6657-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:113834511T>A	uc010tju.1	-	11	902	c.821A>T	c.(820-822)TAT>TTT	p.Y274F	PCID2_uc001vtb.2_Missense_Mutation_p.Y107F|PCID2_uc010tjv.1_Missense_Mutation_p.Y274F|PCID2_uc010tjw.1_Missense_Mutation_p.Y274F|PCID2_uc001vte.2_Missense_Mutation_p.Y167F|PCID2_uc001vtd.2_Missense_Mutation_p.Y167F|PCID2_uc001vtf.2_Missense_Mutation_p.Y167F	NM_001127203	NP_001120675	Q5JVF3	PCID2_HUMAN	PCI domain containing 2	274					negative regulation of apoptosis|negative regulation of cysteine-type endopeptidase activity|positive regulation of mitotic cell cycle spindle assembly checkpoint|positive regulation of transcription, DNA-dependent|regulation of mRNA stability|spleen development		protein binding				0	Lung NSC(43;0.0161)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_lung(25;0.216)|all_epithelial(44;0.234)	all cancers(43;0.104)			CATCAGGTGATACTTTTTCAG	0.413													10	81	---	---	---	---	capture	Missense_Mutation	SNP	113834511	113834511	PCID2	13	T	A	A	A	1	0	0	0	0	1	0	0	0	637	49	4	4	11482	283
OR4E2	26686	broad.mit.edu	37	14	22134222	22134222	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6657-01	TCGA-76-6657-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:22134222C>T	uc010tmd.1	+	1	926	c.926C>T	c.(925-927)ACG>ATG	p.T309M		NM_001001912	NP_001001912	Q8NGC2	OR4E2_HUMAN	olfactory receptor, family 4, subfamily E,	309	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|pancreas(1)|skin(1)	4	all_cancers(95;0.00113)	Acute lymphoblastic leukemia(2;0.0279)		GBM - Glioblastoma multiforme(265;0.0137)		GTTTTTTTCACGAAATCATAT	0.393													4	20	---	---	---	---	capture	Missense_Mutation	SNP	22134222	22134222	OR4E2	14	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	10964	283
JAG2	3714	broad.mit.edu	37	14	105622280	105622280	+	Silent	SNP	C	T	T			TCGA-76-6657-01	TCGA-76-6657-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:105622280C>T	uc001yqg.2	-	4	926	c.522G>A	c.(520-522)CCG>CCA	p.P174P	JAG2_uc001yqh.2_Silent_p.P174P	NM_002226	NP_002217	Q9Y219	JAG2_HUMAN	jagged 2 isoform a precursor	174	Extracellular (Potential).				auditory receptor cell fate commitment|cell communication|cell cycle|Notch receptor processing|Notch signaling pathway|regulation of cell migration|regulation of cell proliferation|spermatogenesis|thymic T cell selection	integral to plasma membrane	calcium ion binding|growth factor activity|Notch binding			lung(3)|breast(2)	5		all_cancers(154;0.0336)|all_epithelial(191;0.0729)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.00989)|all cancers(16;0.0114)|Epithelial(46;0.0272)	Epithelial(152;0.047)|OV - Ovarian serous cystadenocarcinoma(161;0.148)|all cancers(159;0.208)		AGCGGTCCTCCGGGTTGATCA	0.652													11	19	---	---	---	---	capture	Silent	SNP	105622280	105622280	JAG2	14	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	7858	283
UNC13C	440279	broad.mit.edu	37	15	54786821	54786821	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6657-01	TCGA-76-6657-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:54786821G>A	uc002ack.2	+	18	4949	c.4949G>A	c.(4948-4950)CGG>CAG	p.R1650Q		NM_001080534	NP_001074003	Q8NB66	UN13C_HUMAN	unc-13 homolog C	1650	MHD1.				exocytosis|intracellular signal transduction	cell junction|cytoplasm|presynaptic membrane	metal ion binding			ovary(5)|pancreas(2)	7				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		GAAAATCAGCGGTTATGCAAG	0.308													12	30	---	---	---	---	capture	Missense_Mutation	SNP	54786821	54786821	UNC13C	15	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	16868	283
CSK	1445	broad.mit.edu	37	15	75092831	75092831	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6657-01	TCGA-76-6657-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:75092831G>A	uc010bkb.1	+	7	724	c.541G>A	c.(541-543)GAT>AAT	p.D181N	CSK_uc002ays.2_Missense_Mutation_p.D181N|CSK_uc010bkc.1_5'UTR	NM_001127190	NP_001120662	P41240	CSK_HUMAN	c-src tyrosine kinase	181					blood coagulation|epidermal growth factor receptor signaling pathway|T cell costimulation|T cell receptor signaling pathway	centrosome|cytosol|Golgi apparatus	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein C-terminus binding			lung(2)|central_nervous_system(1)	3						GGCGGCCCAGGATGAGTTCTA	0.632											OREG0023291	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	5	28	---	---	---	---	capture	Missense_Mutation	SNP	75092831	75092831	CSK	15	G	A	A	A	1	0	0	0	0	1	0	0	0	533	41	2	2	3908	283
ADAMTS7	11173	broad.mit.edu	37	15	79057006	79057006	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6657-01	TCGA-76-6657-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:79057006C>T	uc002bej.3	-	20	4521	c.4310G>A	c.(4309-4311)CGC>CAC	p.R1437H		NM_014272	NP_055087	Q9UKP4	ATS7_HUMAN	ADAM metallopeptidase with thrombospondin type 1	1437	TSP type-1 5.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding				0						GGAGCTACAGCGCACCGGCCT	0.726													9	11	---	---	---	---	capture	Missense_Mutation	SNP	79057006	79057006	ADAMTS7	15	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	271	283
ALPK3	57538	broad.mit.edu	37	15	85383056	85383056	+	Silent	SNP	C	T	T			TCGA-76-6657-01	TCGA-76-6657-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:85383056C>T	uc002ble.2	+	5	1319	c.1152C>T	c.(1150-1152)TTC>TTT	p.F384F		NM_020778	NP_065829	Q96L96	ALPK3_HUMAN	alpha-kinase 3	384					heart development	nucleus	ATP binding|protein serine/threonine kinase activity			stomach(3)|ovary(3)|lung(2)|skin(2)|central_nervous_system(1)|breast(1)	12			BRCA - Breast invasive adenocarcinoma(143;0.0587)			AGCGCTGGTTCGCCAAGTTGA	0.617													24	46	---	---	---	---	capture	Silent	SNP	85383056	85383056	ALPK3	15	C	T	T	T	1	0	0	0	0	0	0	0	1	402	31	1	1	546	283
BLM	641	broad.mit.edu	37	15	91341566	91341566	+	Silent	SNP	G	A	A			TCGA-76-6657-01	TCGA-76-6657-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:91341566G>A	uc002bpr.2	+	17	3454	c.3357G>A	c.(3355-3357)TTG>TTA	p.L1119L	BLM_uc010uqh.1_Silent_p.L1119L|BLM_uc010uqi.1_Silent_p.L744L|BLM_uc010bnx.2_Silent_p.L1119L|BLM_uc002bpt.2_Silent_p.L94L	NM_000057	NP_000048	P54132	BLM_HUMAN	Bloom syndrome protein	1119					double-strand break repair via homologous recombination|G2 phase of mitotic cell cycle|G2/M transition DNA damage checkpoint|negative regulation of cell division|positive regulation of transcription, DNA-dependent|protein oligomerization|regulation of cyclin-dependent protein kinase activity|replication fork processing|replication fork protection|response to X-ray	cytoplasm|lateral element|nuclear matrix|nucleolus|PML body	ATP binding|bubble DNA binding|DNA strand annealing activity|four-way junction helicase activity|G-quadruplex DNA binding|p53 binding			ovary(3)|skin(2)|breast(1)	6	Lung NSC(78;0.0875)|all_lung(78;0.109)		Lung(145;0.189)			ACATTTTCTTGGGTAAGTCAT	0.294			Mis|N|F			leukemia|lymphoma|skin squamous cell |other cancers		Genes_defective_in_diseases_associated_with_sensitivity_to_DNA_damaging_agents	Bloom_syndrome				30	68	---	---	---	---	capture	Silent	SNP	91341566	91341566	BLM	15	G	A	A	A	1	0	0	0	0	0	0	0	1	607	47	2	2	1433	283
MEF2A	4205	broad.mit.edu	37	15	100230604	100230604	+	Missense_Mutation	SNP	C	G	G			TCGA-76-6657-01	TCGA-76-6657-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:100230604C>G	uc010urw.1	+	7	1194	c.835C>G	c.(835-837)CCT>GCT	p.P279A	MEF2A_uc010urv.1_Missense_Mutation_p.P209A|MEF2A_uc010bos.2_Missense_Mutation_p.P277A|MEF2A_uc002bvf.2_Missense_Mutation_p.P279A|MEF2A_uc002bve.2_Missense_Mutation_p.P277A|MEF2A_uc002bvg.2_Missense_Mutation_p.P277A|MEF2A_uc002bvi.2_Missense_Mutation_p.P277A|MEF2A_uc010bot.2_Missense_Mutation_p.P209A	NM_005587	NP_005578	Q02078	MEF2A_HUMAN	myocyte enhancer factor 2A isoform 1	279	Required for interaction with MAPKs.		P -> L.		apoptosis|BMK cascade|cardiac conduction|cellular response to calcium ion|dendrite morphogenesis|innate immune response|mitochondrial genome maintenance|mitochondrion distribution|muscle organ development|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of transcription from RNA polymerase II promoter|nerve growth factor receptor signaling pathway|positive regulation of muscle cell differentiation|positive regulation of transcription from RNA polymerase II promoter|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway|ventricular cardiac myofibril development	nuclear chromatin|nucleoplasm	activating transcription factor binding|histone acetyltransferase binding|histone deacetylase binding|protein heterodimerization activity|RNA polymerase II regulatory region sequence-specific DNA binding|sequence-specific DNA binding RNA polymerase II transcription factor activity|SMAD binding			ovary(1)	1	Lung NSC(78;0.00335)|all_lung(78;0.00659)|Melanoma(26;0.00778)|Medulloblastoma(229;0.163)		OV - Ovarian serous cystadenocarcinoma(32;0.00085)			TGTCATCCCCCCTTCAAGCAA	0.428													11	17	---	---	---	---	capture	Missense_Mutation	SNP	100230604	100230604	MEF2A	15	C	G	G	G	1	0	0	0	0	1	0	0	0	286	22	4	4	9368	283
ACSM2A	123876	broad.mit.edu	37	16	20494409	20494409	+	Silent	SNP	G	A	A			TCGA-76-6657-01	TCGA-76-6657-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:20494409G>A	uc010bwe.2	+	14	1778	c.1539G>A	c.(1537-1539)TCG>TCA	p.S513S	ACSM2A_uc002dhf.3_Silent_p.S513S|ACSM2A_uc002dhg.3_Silent_p.S513S|ACSM2A_uc010vay.1_Silent_p.S434S|ACSM2A_uc002dhh.3_Silent_p.S143S	NM_001010845	NP_001010845	Q08AH3	ACS2A_HUMAN	acyl-CoA synthetase medium-chain family member	513					fatty acid metabolic process	mitochondrial matrix	ATP binding|butyrate-CoA ligase activity|metal ion binding			skin(2)|breast(1)	3						TCCTGGCCTCGCAGTTCCTGT	0.498													64	91	---	---	---	---	capture	Silent	SNP	20494409	20494409	ACSM2A	16	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	183	283
CDH5	1003	broad.mit.edu	37	16	66432371	66432371	+	Missense_Mutation	SNP	A	C	C			TCGA-76-6657-01	TCGA-76-6657-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:66432371A>C	uc002eom.3	+	10	1654	c.1498A>C	c.(1498-1500)ATC>CTC	p.I500L		NM_001795	NP_001786	P33151	CADH5_HUMAN	cadherin 5, type 2 preproprotein	500	Cadherin 5.|Extracellular (Potential).				adherens junction organization|cell junction assembly|homophilic cell adhesion|regulation of establishment of cell polarity	integral to membrane|membrane fraction	beta-catenin binding|calcium ion binding|ion channel binding|receptor binding			ovary(2)|lung(2)|central_nervous_system(1)|skin(1)	6		Ovarian(137;0.0955)		OV - Ovarian serous cystadenocarcinoma(108;0.107)		GGTCCTGCAGATCTCCGCAAT	0.493													5	26	---	---	---	---	capture	Missense_Mutation	SNP	66432371	66432371	CDH5	16	A	C	C	C	1	0	0	0	0	1	0	0	0	156	12	4	4	3084	283
NF1	4763	broad.mit.edu	37	17	29556484	29556484	+	Splice_Site	SNP	G	A	A			TCGA-76-6657-01	TCGA-76-6657-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:29556484G>A	uc002hgg.2	+	21	3183	c.2850_splice	c.e21+1	p.Q950_splice	NF1_uc002hgh.2_Splice_Site_p.Q950_splice|NF1_uc010csn.1_Splice_Site_p.Q810_splice|NF1_uc002hgi.1_5'UTR	NM_001042492	NP_001035957	P21359	NF1_HUMAN	neurofibromin isoform 1						actin cytoskeleton organization|adrenal gland development|artery morphogenesis|camera-type eye morphogenesis|cerebral cortex development|collagen fibril organization|forebrain astrocyte development|forebrain morphogenesis|heart development|liver development|MAPKKK cascade|metanephros development|myelination in peripheral nervous system|negative regulation of cell migration|negative regulation of endothelial cell proliferation|negative regulation of MAP kinase activity|negative regulation of MAPKKK cascade|negative regulation of neuroblast proliferation|negative regulation of oligodendrocyte differentiation|negative regulation of transcription factor import into nucleus|osteoblast differentiation|phosphatidylinositol 3-kinase cascade|pigmentation|positive regulation of adenylate cyclase activity|positive regulation of neuron apoptosis|Ras protein signal transduction|regulation of blood vessel endothelial cell migration|regulation of bone resorption|response to hypoxia|smooth muscle tissue development|spinal cord development|sympathetic nervous system development|visual learning|wound healing	axon|cytoplasm|dendrite|intrinsic to internal side of plasma membrane|nucleus	protein binding|Ras GTPase activator activity	p.?(2)		soft_tissue(159)|central_nervous_system(56)|lung(28)|large_intestine(27)|haematopoietic_and_lymphoid_tissue(18)|ovary(18)|autonomic_ganglia(12)|breast(3)|skin(3)|stomach(2)|thyroid(1)|prostate(1)|kidney(1)|pancreas(1)	330		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		CCAAGGACAGGTAAAGTGTTC	0.343			D|Mis|N|F|S|O		neurofibroma|glioma	neurofibroma|glioma			Neurofibromatosis_type_1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)			28	49	---	---	---	---	capture	Splice_Site	SNP	29556484	29556484	NF1	17	G	A	A	A	1	0	0	0	0	0	0	1	0	572	44	6	2	10263	283
ANKRD30B	374860	broad.mit.edu	37	18	14779969	14779969	+	Missense_Mutation	SNP	C	G	G	rs9675365	by1000genomes	TCGA-76-6657-01	TCGA-76-6657-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:14779969C>G	uc010dlo.2	+	11	1611	c.1431C>G	c.(1429-1431)TTC>TTG	p.F477L	ANKRD30B_uc010xak.1_RNA	NM_001145029	NP_001138501	Q9BXX2	AN30B_HUMAN	ankyrin repeat domain 30B	477										ovary(1)|skin(1)	2						ATCAGATGTTCCCATCAGAAT	0.279													3	45	---	---	---	---	capture	Missense_Mutation	SNP	14779969	14779969	ANKRD30B	18	C	G	G	G	1	0	0	0	0	1	0	0	0	389	30	4	4	655	283
C19orf21	126353	broad.mit.edu	37	19	757476	757476	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6657-01	TCGA-76-6657-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:757476G>A	uc002lpo.2	+	2	613	c.530G>A	c.(529-531)CGG>CAG	p.R177Q		NM_173481	NP_775752	Q8IVT2	CS021_HUMAN	hypothetical protein LOC126353	177										upper_aerodigestive_tract(1)	1		Acute lymphoblastic leukemia(61;4.36e-14)|all_hematologic(61;4.84e-09)|Lung NSC(49;0.000145)|all_lung(49;0.000236)|Breast(49;0.0014)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGCCCACCTCGGTCCACGCCC	0.667													5	9	---	---	---	---	capture	Missense_Mutation	SNP	757476	757476	C19orf21	19	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	1896	283
REXO1	57455	broad.mit.edu	37	19	1827011	1827011	+	Missense_Mutation	SNP	C	G	G			TCGA-76-6657-01	TCGA-76-6657-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:1827011C>G	uc002lua.3	-	2	1872	c.1777G>C	c.(1777-1779)GCG>CCG	p.A593P	REXO1_uc010dsr.1_Missense_Mutation_p.A547P	NM_020695	NP_065746	Q8N1G1	REXO1_HUMAN	transcription elongation factor B polypeptide 3	593						nucleus	exonuclease activity|nucleic acid binding				0		Ovarian(11;1.78e-06)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TCCGCCCCCGCGCTggaggtg	0.473													2	4	---	---	---	---	capture	Missense_Mutation	SNP	1827011	1827011	REXO1	19	C	G	G	G	1	0	0	0	0	1	0	0	0	351	27	4	4	13136	283
FCER2	2208	broad.mit.edu	37	19	7763247	7763247	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6657-01	TCGA-76-6657-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:7763247C>T	uc002mhn.2	-	4	369	c.185G>A	c.(184-186)CGG>CAG	p.R62Q	FCER2_uc010xjs.1_5'UTR|FCER2_uc010xjt.1_5'UTR|FCER2_uc002mhm.2_Missense_Mutation_p.R62Q|FCER2_uc010dvo.2_Missense_Mutation_p.R62Q	NM_002002	NP_001993	P06734	FCER2_HUMAN	Fc fragment of IgE, low affinity II, receptor	62	Extracellular (Potential).				positive regulation of killing of cells of other organism|positive regulation of nitric-oxide synthase 2 biosynthetic process|positive regulation of nitric-oxide synthase activity	extracellular region|integral to plasma membrane	IgE binding|integrin binding|receptor activity|sugar binding				0						CATACCGTTCCGGGCAGCCCT	0.622													12	42	---	---	---	---	capture	Missense_Mutation	SNP	7763247	7763247	FCER2	19	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	5722	283
FBN3	84467	broad.mit.edu	37	19	8183822	8183822	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6657-01	TCGA-76-6657-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:8183822G>A	uc002mjf.2	-	25	3317	c.3296C>T	c.(3295-3297)CCC>CTC	p.P1099L		NM_032447	NP_115823	Q75N90	FBN3_HUMAN	fibrillin 3 precursor	1099	EGF-like 14; calcium-binding.					proteinaceous extracellular matrix	calcium ion binding|extracellular matrix structural constituent			ovary(6)|skin(3)|pancreas(1)|central_nervous_system(1)	11						ATGCCCAGGGGGACACTGGCA	0.592													16	33	---	---	---	---	capture	Missense_Mutation	SNP	8183822	8183822	FBN3	19	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	5650	283
SCN3A	6328	broad.mit.edu	37	2	165952115	165952115	+	Missense_Mutation	SNP	A	G	G			TCGA-76-6657-01	TCGA-76-6657-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:165952115A>G	uc002ucx.2	-	25	4829	c.4337T>C	c.(4336-4338)TTA>TCA	p.L1446S	SCN3A_uc010zcy.1_5'Flank|SCN3A_uc002ucy.2_Missense_Mutation_p.L1397S|SCN3A_uc002ucz.2_Missense_Mutation_p.L1397S	NM_006922	NP_008853	Q9NY46	SCN3A_HUMAN	sodium channel, voltage-gated, type III, alpha	1446	Helical; Name=S6 of repeat III; (Potential).					voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(4)|breast(3)|skin(2)|central_nervous_system(1)	10					Lamotrigine(DB00555)	GACAAAGTATAAATACATGTA	0.269													19	45	---	---	---	---	capture	Missense_Mutation	SNP	165952115	165952115	SCN3A	2	A	G	G	G	1	0	0	0	0	1	0	0	0	169	13	3	3	13811	283
METTL5	29081	broad.mit.edu	37	2	170677785	170677785	+	Splice_Site	SNP	T	C	C			TCGA-76-6657-01	TCGA-76-6657-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:170677785T>C	uc002ufn.2	-	3	471	c.225_splice	c.e3-1	p.G75_splice	METTL5_uc002ufo.2_Splice_Site_p.G75_splice|METTL5_uc002ufp.2_Splice_Site_p.G75_splice|METTL5_uc002ufq.1_Splice_Site_p.G75_splice	NM_014168	NP_054887	Q9NRN9	METL5_HUMAN	methyltransferase like 5								methyltransferase activity|nucleic acid binding			central_nervous_system(1)	1						ACACACAACCTATAAATACAA	0.303													3	53	---	---	---	---	capture	Splice_Site	SNP	170677785	170677785	METTL5	2	T	C	C	C	1	0	0	0	0	0	0	1	0	689	53	5	3	9415	283
CHRNG	1146	broad.mit.edu	37	2	233404776	233404776	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6657-01	TCGA-76-6657-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:233404776G>A	uc002vsx.1	+	2	151	c.130G>A	c.(130-132)GCG>ACG	p.A44T	CHRNG_uc010fyd.2_Missense_Mutation_p.A44T|CHRNG_uc010fye.1_Missense_Mutation_p.A44T	NM_005199	NP_005190	P07510	ACHG_HUMAN	cholinergic receptor, nicotinic, gamma	44	Extracellular (Potential).				muscle contraction	cell junction|postsynaptic membrane	acetylcholine receptor activity				0		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;6.39e-16)|BRCA - Breast invasive adenocarcinoma(100;0.00079)|LUSC - Lung squamous cell carcinoma(224;0.00757)|Lung(119;0.0086)		CCTGCGGCCCGCGGAACGAGA	0.632													13	19	---	---	---	---	capture	Missense_Mutation	SNP	233404776	233404776	CHRNG	2	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	3361	283
SALL4	57167	broad.mit.edu	37	20	50407510	50407510	+	Silent	SNP	G	A	A	rs138804604	byFrequency	TCGA-76-6657-01	TCGA-76-6657-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:50407510G>A	uc002xwh.3	-	2	1613	c.1512C>T	c.(1510-1512)CCC>CCT	p.P504P	SALL4_uc010gii.2_Intron|SALL4_uc002xwi.3_Intron	NM_020436	NP_065169	Q9UJQ4	SALL4_HUMAN	sal-like 4	504					transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2						GCAGGTCACCGGGCAAGGAGC	0.567													52	148	---	---	---	---	capture	Silent	SNP	50407510	50407510	SALL4	20	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	13705	283
LAMA5	3911	broad.mit.edu	37	20	60928193	60928193	+	Missense_Mutation	SNP	C	G	G			TCGA-76-6657-01	TCGA-76-6657-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:60928193C>G	uc002ycq.2	-	3	632	c.565G>C	c.(565-567)GCC>CCC	p.A189P		NM_005560	NP_005551	O15230	LAMA5_HUMAN	laminin alpha 5 precursor	189	Laminin N-terminal.				angiogenesis|cell proliferation|cell recognition|cytoskeleton organization|endothelial cell differentiation|focal adhesion assembly|integrin-mediated signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development|substrate adhesion-dependent cell spreading	extracellular space|laminin-1 complex|laminin-10 complex|laminin-11 complex	integrin binding			ovary(1)|pancreas(1)|skin(1)	3	Breast(26;1.57e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)		Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	GACTCACAGGCAAAGAACTGC	0.662													2	11	---	---	---	---	capture	Missense_Mutation	SNP	60928193	60928193	LAMA5	20	C	G	G	G	1	0	0	0	0	1	0	0	0	325	25	4	4	8529	283
KRTAP10-12	386685	broad.mit.edu	37	21	46117243	46117243	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6657-01	TCGA-76-6657-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:46117243G>A	uc002zfw.1	+	1	157	c.127G>A	c.(127-129)GCC>ACC	p.A43T	C21orf29_uc002zfe.1_Intron|C21orf29_uc010gpv.1_Intron	NM_198699	NP_941972	P60413	KR10C_HUMAN	keratin associated protein 10-12	43	2.|19 X 5 AA repeats of C-C-X(3).					keratin filament					0						CCCCTGCTGCGCCCCGGCCCC	0.677													66	65	---	---	---	---	capture	Missense_Mutation	SNP	46117243	46117243	KRTAP10-12	21	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	8428	283
POTEH	23784	broad.mit.edu	37	22	16287770	16287770	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6657-01	TCGA-76-6657-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:16287770C>T	uc010gqp.2	-	1	168	c.116G>A	c.(115-117)GGC>GAC	p.G39D	POTEH_uc002zlg.1_5'Flank|POTEH_uc002zlh.1_5'Flank|POTEH_uc002zlj.1_5'UTR	NM_001136213	NP_001129685	Q6S545	POTEH_HUMAN	ANKRD26-like family C, member 3	39										skin(1)	1						GTTGCTCTTGCCGCTCCCCCT	0.592													6	500	---	---	---	---	capture	Missense_Mutation	SNP	16287770	16287770	POTEH	22	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	12168	283
LZTR1	8216	broad.mit.edu	37	22	21342326	21342326	+	Missense_Mutation	SNP	A	C	C			TCGA-76-6657-01	TCGA-76-6657-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:21342326A>C	uc002zto.2	+	5	531	c.428A>C	c.(427-429)AAT>ACT	p.N143T	LZTR1_uc002ztn.2_Missense_Mutation_p.N102T|LZTR1_uc011ahy.1_Missense_Mutation_p.N124T|LZTR1_uc010gsr.1_Missense_Mutation_p.N14T	NM_006767	NP_006758	Q8N653	LZTR1_HUMAN	leucine-zipper-like transcription regulator 1	143	Kelch 2.				anatomical structure morphogenesis		sequence-specific DNA binding transcription factor activity			ovary(2)|lung(2)	4	all_cancers(11;1.83e-25)|all_epithelial(7;9.19e-23)|Lung NSC(8;3.06e-15)|all_lung(8;5.05e-14)|Melanoma(16;0.000465)|Ovarian(15;0.0028)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000204)|Lung(15;0.00494)|Epithelial(17;0.195)			ATTTATTCCAATTCTAACTTG	0.438													10	26	---	---	---	---	capture	Missense_Mutation	SNP	21342326	21342326	LZTR1	22	A	C	C	C	1	0	0	0	0	1	0	0	0	52	4	4	4	9052	283
C1QTNF6	114904	broad.mit.edu	37	22	37581479	37581479	+	Missense_Mutation	SNP	G	T	T			TCGA-76-6657-01	TCGA-76-6657-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:37581479G>T	uc003aqw.1	-	1	516	c.11C>A	c.(10-12)GCC>GAC	p.A4D	C1QTNF6_uc003aqx.1_Missense_Mutation_p.A23D|C1QTNF6_uc003aqy.1_Missense_Mutation_p.A23D|C1QTNF6_uc003aqz.1_RNA	NM_182486	NP_872292	Q9BXI9	C1QT6_HUMAN	C1q and tumor necrosis factor related protein 6	4						collagen					0						ACCCAGGGCGGCTGTCCCCAT	0.433													3	28	---	---	---	---	capture	Missense_Mutation	SNP	37581479	37581479	C1QTNF6	22	G	T	T	T	1	0	0	0	0	1	0	0	0	546	42	4	4	1949	283
UGT2A1	10941	broad.mit.edu	37	4	70455172	70455172	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6657-01	TCGA-76-6657-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:70455172G>A	uc003hem.3	-	6	1565	c.1502C>T	c.(1501-1503)ACG>ATG	p.T501M	UGT2A1_uc011caq.1_Missense_Mutation_p.T667M|UGT2A1_uc010ihu.2_Missense_Mutation_p.T501M|UGT2A1_uc010iht.2_Missense_Mutation_p.T457M|UGT2A1_uc010ihs.2_Missense_Mutation_p.T502M	NM_006798	NP_006789	Q9Y4X1	UD2A1_HUMAN	UDP glucuronosyltransferase 2 family,	501	Helical; (Potential).				detection of chemical stimulus|sensory perception of smell	integral to membrane	glucuronosyltransferase activity|glucuronosyltransferase activity			ovary(1)	1						AAATATAGCCGTTGTCACACA	0.413													46	86	---	---	---	---	capture	Missense_Mutation	SNP	70455172	70455172	UGT2A1	4	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	16835	283
FGA	2243	broad.mit.edu	37	4	155507683	155507683	+	Missense_Mutation	SNP	A	T	T			TCGA-76-6657-01	TCGA-76-6657-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:155507683A>T	uc003iod.1	-	5	956	c.898T>A	c.(898-900)TCT>ACT	p.S300T	FGA_uc003ioe.1_Missense_Mutation_p.S300T|FGA_uc003iof.1_Intron	NM_000508	NP_000499	P02671	FIBA_HUMAN	fibrinogen, alpha polypeptide isoform alpha-E	300	By similarity.				platelet activation|platelet degranulation|protein polymerization|response to calcium ion|signal transduction	external side of plasma membrane|fibrinogen complex|platelet alpha granule lumen	eukaryotic cell surface binding|protein binding, bridging|receptor binding			ovary(2)|breast(1)	3	all_hematologic(180;0.215)	Renal(120;0.0458)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Sucralfate(DB00364)|Tenecteplase(DB00031)	CCAGGTCCAGAGCTCCCAGAG	0.562													39	75	---	---	---	---	capture	Missense_Mutation	SNP	155507683	155507683	FGA	4	A	T	T	T	1	0	0	0	0	1	0	0	0	143	11	4	4	5776	283
STOX2	56977	broad.mit.edu	37	4	184938294	184938294	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6657-01	TCGA-76-6657-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:184938294C>T	uc003ivz.1	+	4	4073	c.2638C>T	c.(2638-2640)CGT>TGT	p.R880C	uc003iwb.1_5'Flank|STOX2_uc003iwa.1_3'UTR	NM_020225	NP_064610	Q9P2F5	STOX2_HUMAN	storkhead box 2	880					embryo development|maternal placenta development						0		all_lung(41;1.89e-12)|Lung NSC(41;3.48e-12)|Colorectal(36;0.00435)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|all_hematologic(60;0.027)|Prostate(90;0.0283)		all cancers(43;2.85e-26)|Epithelial(43;2.27e-22)|OV - Ovarian serous cystadenocarcinoma(60;3.4e-10)|Colorectal(24;8.23e-06)|GBM - Glioblastoma multiforme(59;1.64e-05)|STAD - Stomach adenocarcinoma(60;3.6e-05)|COAD - Colon adenocarcinoma(29;4.37e-05)|LUSC - Lung squamous cell carcinoma(40;0.008)|READ - Rectum adenocarcinoma(43;0.227)		AAGTAACCGTCGTCAGAACCC	0.502													3	36	---	---	---	---	capture	Missense_Mutation	SNP	184938294	184938294	STOX2	4	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	15210	283
DNAH5	1767	broad.mit.edu	37	5	13885213	13885213	+	Silent	SNP	G	A	A			TCGA-76-6657-01	TCGA-76-6657-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:13885213G>A	uc003jfd.2	-	19	2910	c.2868C>T	c.(2866-2868)CGC>CGT	p.R956R		NM_001369	NP_001360	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	956	Stem (By similarity).				microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31	Lung NSC(4;0.00476)					AGAGTAACTCGCGGGCTTCTT	0.443									Kartagener_syndrome				22	57	---	---	---	---	capture	Silent	SNP	13885213	13885213	DNAH5	5	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	4561	283
GPR98	84059	broad.mit.edu	37	5	89992775	89992775	+	Missense_Mutation	SNP	T	C	C			TCGA-76-6657-01	TCGA-76-6657-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:89992775T>C	uc003kju.2	+	34	8063	c.7967T>C	c.(7966-7968)ATT>ACT	p.I2656T	GPR98_uc003kjt.2_Missense_Mutation_p.I362T|GPR98_uc003kjv.2_Missense_Mutation_p.I256T	NM_032119	NP_115495	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98 precursor	2656	Calx-beta 18.|Extracellular (Potential).				cell communication|cell-cell adhesion|maintenance of organ identity|neuropeptide signaling pathway|photoreceptor cell maintenance	cell surface|cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(11)|central_nervous_system(3)|pancreas(2)	16		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		AAGACAGTCATTTTAACCATC	0.368													13	26	---	---	---	---	capture	Missense_Mutation	SNP	89992775	89992775	GPR98	5	T	C	C	C	1	0	0	0	0	1	0	0	0	676	52	3	3	6654	283
ARAP3	64411	broad.mit.edu	37	5	141049346	141049346	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6657-01	TCGA-76-6657-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:141049346C>T	uc003llm.2	-	16	2360	c.2282G>A	c.(2281-2283)GGG>GAG	p.G761E	ARAP3_uc011dbe.1_Missense_Mutation_p.G423E|ARAP3_uc003lln.2_Missense_Mutation_p.G663E	NM_022481	NP_071926	Q8WWN8	ARAP3_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH	761					cytoskeleton organization|negative regulation of cell migration|negative regulation of Rho protein signal transduction|regulation of ARF GTPase activity|regulation of cell shape|small GTPase mediated signal transduction|vesicle-mediated transport	cytoskeleton|cytosol|lamellipodium|plasma membrane|ruffle	ARF GTPase activator activity|phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3,4-bisphosphate binding|Rho GTPase activator activity|zinc ion binding			breast(5)|ovary(1)|large_intestine(1)	7						GATCCTCCCCCCAGCGAGGAT	0.587													29	42	---	---	---	---	capture	Missense_Mutation	SNP	141049346	141049346	ARAP3	5	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	833	283
FAT2	2196	broad.mit.edu	37	5	150920247	150920247	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6657-01	TCGA-76-6657-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:150920247G>A	uc003lue.3	-	10	8933	c.8920C>T	c.(8920-8922)CGC>TGC	p.R2974C	GM2A_uc011dcs.1_Intron	NM_001447	NP_001438	Q9NYQ8	FAT2_HUMAN	FAT tumor suppressor 2 precursor	2974	Extracellular (Potential).|Cadherin 26.				epithelial cell migration|homophilic cell adhesion	cell-cell adherens junction|integral to membrane|nucleus	calcium ion binding			ovary(4)|upper_aerodigestive_tract(1)|skin(1)	6		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GTATGCTCGCGGTCCAGGGTC	0.527													3	42	---	---	---	---	capture	Missense_Mutation	SNP	150920247	150920247	FAT2	5	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	5636	283
C6orf221	154288	broad.mit.edu	37	6	74073351	74073351	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6657-01	TCGA-76-6657-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:74073351G>A	uc003pgt.3	+	3	475	c.422G>A	c.(421-423)CGG>CAG	p.R141Q		NM_001017361	NP_001017361	Q587J8	ECAT1_HUMAN	hypothetical protein LOC154288	141										skin(2)	2						ATAGAAGTCCGGGAGGCCGGG	0.657													23	49	---	---	---	---	capture	Missense_Mutation	SNP	74073351	74073351	C6orf221	6	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	2332	283
FYN	2534	broad.mit.edu	37	6	112015863	112015863	+	Missense_Mutation	SNP	T	C	C			TCGA-76-6657-01	TCGA-76-6657-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:112015863T>C	uc003pvj.2	-	10	1427	c.1087A>G	c.(1087-1089)AAA>GAA	p.K363E	FYN_uc003pvi.2_Missense_Mutation_p.K308E|FYN_uc003pvk.2_Missense_Mutation_p.K363E|FYN_uc003pvh.2_Missense_Mutation_p.K360E|FYN_uc010kdy.1_Missense_Mutation_p.K54E	NM_002037	NP_002028	P06241	FYN_HUMAN	protein-tyrosine kinase fyn isoform a	363	Protein kinase.				axon guidance|calcium ion transport|feeding behavior|interspecies interaction between organisms|intracellular protein kinase cascade|learning|leukocyte migration|platelet activation|regulation of defense response to virus by virus|T cell costimulation|T cell receptor signaling pathway|viral reproduction	cytosol|endosome|plasma membrane	ATP binding|glycoprotein binding|identical protein binding|metal ion binding|non-membrane spanning protein tyrosine kinase activity			lung(5)|central_nervous_system(1)|skin(1)	7		all_cancers(87;1.37e-05)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|all_epithelial(87;0.00125)|Colorectal(196;0.0211)		all cancers(137;0.0451)|OV - Ovarian serous cystadenocarcinoma(136;0.0476)|Epithelial(106;0.102)	Dasatinib(DB01254)	TTTGGTAATTTCAGAGCTCTT	0.383													61	101	---	---	---	---	capture	Missense_Mutation	SNP	112015863	112015863	FYN	6	T	C	C	C	1	0	0	0	0	1	0	0	0	806	62	3	3	6068	283
CNKSR3	154043	broad.mit.edu	37	6	154831213	154831213	+	Silent	SNP	C	T	T			TCGA-76-6657-01	TCGA-76-6657-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:154831213C>T	uc003qpy.2	-	1	541	c.36G>A	c.(34-36)GTG>GTA	p.V12V		NM_173515	NP_775786	Q6P9H4	CNKR3_HUMAN	CNKSR family member 3	12	SAM.				negative regulation of ERK1 and ERK2 cascade|negative regulation of peptidyl-serine phosphorylation|positive regulation of sodium ion transport	cytoplasm|membrane				ovary(2)|breast(1)|skin(1)	4		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;5.03e-11)|BRCA - Breast invasive adenocarcinoma(81;0.00627)		TCCAGTCCACCACTTGTTTGG	0.652													36	65	---	---	---	---	capture	Silent	SNP	154831213	154831213	CNKSR3	6	C	T	T	T	1	0	0	0	0	0	0	0	1	262	21	2	2	3573	283
SUMF2	25870	broad.mit.edu	37	7	56144570	56144570	+	Silent	SNP	C	T	T			TCGA-76-6657-01	TCGA-76-6657-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:56144570C>T	uc003trv.2	+	6	667	c.636C>T	c.(634-636)ACC>ACT	p.T212T	PSPH_uc003trj.2_Intron|SUMF2_uc011kcv.1_RNA|SUMF2_uc011kcw.1_Silent_p.T212T|SUMF2_uc011kcx.1_Intron|SUMF2_uc003trt.2_Silent_p.T105T|SUMF2_uc011kcy.1_Silent_p.T197T|SUMF2_uc011kcz.1_Intron|SUMF2_uc003tru.2_RNA|SUMF2_uc011kda.1_5'UTR|SUMF2_uc003trx.2_RNA	NM_001130069	NP_001123541	Q8NBJ7	SUMF2_HUMAN	sulfatase modifying factor 2 isoform e	193						endoplasmic reticulum lumen	metal ion binding			ovary(1)|skin(1)	2	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			CAAACCGCACCAACCTGTGGC	0.418													23	71	---	---	---	---	capture	Silent	SNP	56144570	56144570	SUMF2	7	C	T	T	T	1	0	0	0	0	0	0	0	1	262	21	2	2	15274	283
CACNA2D1	781	broad.mit.edu	37	7	81611940	81611940	+	Missense_Mutation	SNP	G	A	A	rs149510838		TCGA-76-6657-01	TCGA-76-6657-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:81611940G>A	uc003uhr.1	-	24	2154	c.1898C>T	c.(1897-1899)TCG>TTG	p.S633L		NM_000722	NP_000713	P54289	CA2D1_HUMAN	calcium channel, voltage-dependent, alpha	645	Extracellular (Potential).					voltage-gated calcium channel complex	metal ion binding			ovary(5)|pancreas(1)	6					Felodipine(DB01023)|Gabapentin(DB00996)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nifedipine(DB01115)	CAGGGTTTCCGAATCTGCAAA	0.333													41	125	---	---	---	---	capture	Missense_Mutation	SNP	81611940	81611940	CACNA2D1	7	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	2524	283
CTHRC1	115908	broad.mit.edu	37	8	104388028	104388028	+	Silent	SNP	C	T	T			TCGA-76-6657-01	TCGA-76-6657-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:104388028C>T	uc003ylk.2	+	2	312	c.213C>T	c.(211-213)GCC>GCT	p.A71A	CTHRC1_uc011lhq.1_Silent_p.A71A	NM_138455	NP_612464	Q96CG8	CTHR1_HUMAN	collagen triple helix repeat containing 1	71	Collagen-like.					collagen				ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(57;2.79e-06)|STAD - Stomach adenocarcinoma(118;0.197)			GCCCTGGGGCCAATGGCATTC	0.522													43	106	---	---	---	---	capture	Silent	SNP	104388028	104388028	CTHRC1	8	C	T	T	T	1	0	0	0	0	0	0	0	1	262	21	2	2	3973	283
EPPK1	83481	broad.mit.edu	37	8	144940918	144940918	+	Missense_Mutation	SNP	G	T	T			TCGA-76-6657-01	TCGA-76-6657-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:144940918G>T	uc003zaa.1	-	1	6517	c.6504C>A	c.(6502-6504)AGC>AGA	p.S2168R		NM_031308	NP_112598	P58107	EPIPL_HUMAN	epiplakin 1	2168						cytoplasm|cytoskeleton	protein binding|structural molecule activity			pancreas(1)|skin(1)	2	all_cancers(97;1.42e-10)|all_epithelial(106;1.99e-09)|Lung NSC(106;0.000126)|all_lung(105;0.000354)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;2.88e-40)|all cancers(56;1.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			GGTGTTTGTTGCTGGTTTCCT	0.507													94	161	---	---	---	---	capture	Missense_Mutation	SNP	144940918	144940918	EPPK1	8	G	T	T	T	1	0	0	0	0	1	0	0	0	594	46	4	4	5145	283
PTEN	5728	broad.mit.edu	37	10	89692852	89692856	+	Frame_Shift_Del	DEL	AAGTG	-	-			TCGA-76-6657-01	TCGA-76-6657-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:89692852_89692856delAAGTG	uc001kfb.2	+	6	1367_1371	c.336_340delAAGTG	c.(334-342)CTAAGTGAAfs	p.L112fs		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog	112_114	Phosphatase tensin-type.				activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.L112V(4)|p.R55fs*1(4)|p.?(2)|p.L112P(2)|p.Y27fs*1(2)|p.Y27_N212>Y(2)|p.L112fs*3(1)|p.L112R(1)|p.E114*(1)|p.S113fs*9(1)|p.S113R(1)|p.S113fs*20(1)|p.F56fs*2(1)|p.L112Q(1)		endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		ACCAATGGCTAAGTGAAGATGACAA	0.376		31	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			34	32	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	89692852	89692856	PTEN	10	AAGTG	-	-	-	1	0	1	0	1	0	0	0	0	158	13	5	5	12633	283
OR8B4	283162	broad.mit.edu	37	11	124294437	124294439	+	In_Frame_Del	DEL	ACT	-	-			TCGA-76-6657-01	TCGA-76-6657-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:124294437_124294439delACT	uc010sak.1	-	1	329_331	c.329_331delAGT	c.(328-333)GAGTGC>GGC	p.110_111EC>G		NM_001005196	NP_001005196	Q96RC9	OR8B4_HUMAN	olfactory receptor, family 8, subfamily B,	110_111	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0279)		AACACATAGCACTCAGAATTGAC	0.433													24	54	---	---	---	---	capture_indel	In_Frame_Del	DEL	124294437	124294439	OR8B4	11	ACT	-	-	-	1	0	1	0	1	0	0	0	0	78	6	5	5	11133	283
RAB11FIP4	84440	broad.mit.edu	37	17	29850996	29850997	+	Frame_Shift_Del	DEL	AC	-	-			TCGA-76-6657-01	TCGA-76-6657-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:29850996_29850997delAC	uc002hgn.1	+	9	1344_1345	c.1115_1116delAC	c.(1114-1116)AACfs	p.N372fs	RAB11FIP4_uc002hgo.2_Frame_Shift_Del_p.N270fs	NM_032932	NP_116321	Q86YS3	RFIP4_HUMAN	RAB11 family interacting protein 4 (class II)	372	Potential.|Necessary for interaction with RAB11A, subcellular location, homo- or heterooligomerization.				cytokinesis|interspecies interaction between organisms|protein transport	cleavage furrow|endocytic vesicle|midbody|recycling endosome membrane	ADP-ribosylation factor binding|calcium ion binding|protein homodimerization activity|Rab GTPase binding			skin(1)	1		all_cancers(10;3.62e-13)|all_epithelial(10;0.000387)|all_lung(9;0.0132)|Breast(31;0.014)|all_hematologic(16;0.015)|Myeloproliferative disorder(56;0.0255)|Acute lymphoblastic leukemia(14;0.0259)|Ovarian(249;0.0423)|Lung NSC(157;0.066)				AAGCAAGAGAACACACAGCTGG	0.599													8	19	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	29850996	29850997	RAB11FIP4	17	AC	-	-	-	1	0	1	0	1	0	0	0	0	26	2	5	5	12791	283
MSH6	2956	broad.mit.edu	37	2	48023188	48023190	+	In_Frame_Del	DEL	GAA	-	-			TCGA-76-6657-01	TCGA-76-6657-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:48023188_48023190delGAA	uc002rwd.3	+	3	765_767	c.613_615delGAA	c.(613-615)GAAdel	p.E207del	MSH6_uc002rwc.2_In_Frame_Del_p.E207del|MSH6_uc010fbj.2_Intron|MSH6_uc010yoi.1_Intron|MSH6_uc010yoj.1_5'UTR	NM_000179	NP_000170	P52701	MSH6_HUMAN	mutS homolog 6	207	Poly-Glu.				determination of adult lifespan|DNA damage response, signal transduction resulting in induction of apoptosis|isotype switching|meiotic mismatch repair|negative regulation of DNA recombination|positive regulation of helicase activity|reciprocal meiotic recombination|response to UV|somatic hypermutation of immunoglobulin genes	MutSalpha complex	ATP binding|DNA-dependent ATPase activity|protein binding			large_intestine(53)|central_nervous_system(28)|endometrium(28)|stomach(22)|haematopoietic_and_lymphoid_tissue(9)|lung(7)|skin(6)|urinary_tract(5)|breast(5)|ovary(3)|thyroid(1)|upper_aerodigestive_tract(1)	168		Acute lymphoblastic leukemia(82;0.0299)|all_hematologic(82;0.0358)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			GCCAGAAGAGGAAGAAGAGATGG	0.438			Mis|N|F|S		colorectal	colorectal|endometrial|ovarian		MMR	Lynch_syndrome|Muir-Torre_syndrome|Turcot_syndrome|Constitutional_Mismatch_Repair_Deficiency_Syndrome				11	29	---	---	---	---	capture_indel	In_Frame_Del	DEL	48023188	48023190	MSH6	2	GAA	-	-	-	1	0	1	0	1	0	0	0	0	533	41	5	5	9784	283
NAP1L5	266812	broad.mit.edu	37	4	89618484	89618486	+	In_Frame_Del	DEL	TCC	-	-			TCGA-76-6657-01	TCGA-76-6657-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:89618484_89618486delTCC	uc003hrx.2	-	1	538_540	c.420_422delGGA	c.(418-423)GAGGAA>GAA	p.140_141EE>E	HERC3_uc003hrw.1_Intron|HERC3_uc011cdn.1_Intron|HERC3_uc011cdo.1_Intron	NM_153757	NP_715638	Q96NT1	NP1L5_HUMAN	nucleosome assembly protein 1-like 5	140_141	Glu-rich.				nucleosome assembly	nucleus	protein binding			skin(1)	1				OV - Ovarian serous cystadenocarcinoma(123;0.000181)		gtactcctcttcctcctcctcct	0.369													7	76	---	---	---	---	capture_indel	In_Frame_Del	DEL	89618484	89618486	NAP1L5	4	TCC	-	-	-	1	0	1	0	1	0	0	0	0	806	62	5	5	10068	283
PIK3R1	5295	broad.mit.edu	37	5	67522740	67522741	+	Frame_Shift_Ins	INS	-	A	A			TCGA-76-6657-01	TCGA-76-6657-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:67522740_67522741insA	uc003jva.2	+	2	797_798	c.237_238insA	c.(235-240)AGGAAAfs	p.R79fs	PIK3R1_uc003jvb.2_Frame_Shift_Ins_p.R79fs	NM_181523	NP_852664	P27986	P85A_HUMAN	phosphoinositide-3-kinase, regulatory subunit 1	79_80					epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|growth hormone receptor signaling pathway|insulin receptor signaling pathway|insulin-like growth factor receptor signaling pathway|interspecies interaction between organisms|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol 3-kinase cascade|phosphatidylinositol phosphorylation|phosphatidylinositol-mediated signaling|platelet activation|positive regulation of establishment of protein localization in plasma membrane|positive regulation of glucose import|T cell costimulation|T cell receptor signaling pathway	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex	1-phosphatidylinositol binding|ErbB-3 class receptor binding|insulin binding|insulin receptor binding|insulin receptor substrate binding|insulin-like growth factor receptor binding|phosphatidylinositol 3-kinase regulator activity|protein phosphatase binding			endometrium(34)|central_nervous_system(27)|large_intestine(20)|breast(7)|ovary(5)|haematopoietic_and_lymphoid_tissue(3)|lung(2)|urinary_tract(1)|skin(1)|pancreas(1)	101		Lung NSC(167;1.99e-05)|Prostate(74;0.00308)|Ovarian(174;0.00473)|Colorectal(97;0.0176)		OV - Ovarian serous cystadenocarcinoma(47;3.76e-51)|Lung(70;0.0211)	Isoproterenol(DB01064)	ATATTGGAAGGAAAAAAATCTC	0.490			Mis|F|O		gliobastoma|ovarian|colorectal					TCGA GBM(4;<1E-08)			19	55	---	---	---	---	capture_indel	Frame_Shift_Ins	INS	67522740	67522741	PIK3R1	5	-	A	A	A	1	0	1	1	0	0	0	0	0	529	41	5	5	11821	283
GRM1	2911	broad.mit.edu	37	6	146350671	146350672	+	Frame_Shift_Ins	INS	-	T	T			TCGA-76-6657-01	TCGA-76-6657-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:146350671_146350672insT	uc010khw.1	+	2	488_489	c.18_19insT	c.(16-21)TTGTTTfs	p.L6fs	GRM1_uc010khu.1_Frame_Shift_Ins_p.L6fs|GRM1_uc010khv.1_Frame_Shift_Ins_p.L6fs|GRM1_uc003qll.2_Frame_Shift_Ins_p.L6fs|GRM1_uc011edz.1_Frame_Shift_Ins_p.L6fs|GRM1_uc011eea.1_Frame_Shift_Ins_p.L6fs	NM_000838	NP_000829	Q13255	GRM1_HUMAN	glutamate receptor, metabotropic 1 isoform alpha	6_7					synaptic transmission	integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity			lung(8)|ovary(4)|central_nervous_system(3)|large_intestine(2)|breast(2)	19		Ovarian(120;0.0387)		OV - Ovarian serous cystadenocarcinoma(155;5.35e-08)|GBM - Glioblastoma multiforme(68;0.00762)	Acamprosate(DB00659)|L-Glutamic Acid(DB00142)	GGCTCCTTTTGTTTTTTTTCCC	0.644													7	273	---	---	---	---	capture_indel	Frame_Shift_Ins	INS	146350671	146350672	GRM1	6	-	T	T	T	1	0	1	1	0	0	0	0	0	620	48	5	5	6729	283
UBR5	51366	broad.mit.edu	37	8	103340098	103340099	+	Frame_Shift_Ins	INS	-	A	A			TCGA-76-6657-01	TCGA-76-6657-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:103340098_103340099insA	uc003ykr.1	-	12	1385_1386	c.1352_1353insT	c.(1351-1353)TTAfs	p.L451fs	UBR5_uc003yks.1_Frame_Shift_Ins_p.L451fs	NM_015902	NP_056986	O95071	UBR5_HUMAN	ubiquitin protein ligase E3 component n-recognin	451					cell proliferation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of catenin import into nucleus|positive regulation of protein import into nucleus, translocation|progesterone receptor signaling pathway|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|response to DNA damage stimulus	nucleus|soluble fraction	protein binding|RNA binding|ubiquitin-ubiquitin ligase activity|zinc ion binding			lung(16)|ovary(4)|large_intestine(3)|breast(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|kidney(1)	28	all_cancers(14;8e-07)|all_epithelial(15;2.18e-08)|Lung NSC(17;2.55e-05)|all_lung(17;8.85e-05)		OV - Ovarian serous cystadenocarcinoma(57;0.000442)			CCACAGAACTTAAAGTTTCATC	0.376													19	50	---	---	---	---	capture_indel	Frame_Shift_Ins	INS	103340098	103340099	UBR5	8	-	A	A	A	1	0	1	1	0	0	0	0	0	790	61	5	5	16787	283
