Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
C1orf86	199990	broad.mit.edu	37	1	2125232	2125232	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6660-01	TCGA-76-6660-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:2125232C>T	uc001aiy.2	-	3	342	c.316G>A	c.(316-318)GGG>AGG	p.G106R	C1orf86_uc001aiv.1_RNA|C1orf86_uc001aiw.1_RNA|C1orf86_uc001aix.1_Silent_p.T101T	NM_182533	NP_872339	Q6NZ36	CA086_HUMAN	hypothetical protein LOC199990 isoform 2	106											0	all_cancers(77;0.000134)|all_epithelial(69;4.45e-05)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;1.14e-19)|all_lung(118;1.22e-08)|Lung NSC(185;1.24e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)		Epithelial(90;1.09e-37)|OV - Ovarian serous cystadenocarcinoma(86;1.5e-23)|GBM - Glioblastoma multiforme(42;1.61e-08)|Colorectal(212;3.98e-05)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00229)|BRCA - Breast invasive adenocarcinoma(365;0.00437)|STAD - Stomach adenocarcinoma(132;0.0134)|KIRC - Kidney renal clear cell carcinoma(229;0.034)|Lung(427;0.199)		CCTCCTGCCCCGTGAAGCAGC	0.692													10	11	---	---	---	---	capture	Missense_Mutation	SNP	2125232	2125232	C1orf86	1	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	2045	284
SPEN	23013	broad.mit.edu	37	1	16260992	16260992	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6660-01	TCGA-76-6660-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:16260992G>A	uc001axk.1	+	11	8461	c.8257G>A	c.(8257-8259)GTA>ATA	p.V2753I	SPEN_uc010obp.1_Missense_Mutation_p.V2712I	NM_015001	NP_055816	Q96T58	MINT_HUMAN	spen homolog, transcriptional regulator	2753	Interaction with RBPSUH (By similarity).				interspecies interaction between organisms|negative regulation of transcription, DNA-dependent|Notch signaling pathway	nucleus	nucleotide binding|protein binding|RNA binding			ovary(6)|breast(3)|lung(2)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	15		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		ATCTGGTGGTGTAACGGCCAC	0.577													27	30	---	---	---	---	capture	Missense_Mutation	SNP	16260992	16260992	SPEN	1	G	A	A	A	1	0	0	0	0	1	0	0	0	624	48	2	2	14930	284
OPRD1	4985	broad.mit.edu	37	1	29189500	29189500	+	Missense_Mutation	SNP	C	T	T	rs139895939		TCGA-76-6660-01	TCGA-76-6660-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:29189500C>T	uc001brf.1	+	3	1066	c.824C>T	c.(823-825)GCG>GTG	p.A275V		NM_000911	NP_000902	P41143	OPRD_HUMAN	opioid receptor, delta 1	275	Helical; Name=6; (Potential).				immune response|protein import into nucleus, translocation	integral to plasma membrane	delta-opioid receptor activity|protein binding			ovary(1)|central_nervous_system(1)	2		Colorectal(325;3.46e-05)|Lung NSC(340;0.000947)|all_lung(284;0.00131)|Renal(390;0.00758)|Breast(348;0.00765)|all_neural(195;0.0199)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;1.29e-07)|COAD - Colon adenocarcinoma(152;7.51e-06)|STAD - Stomach adenocarcinoma(196;0.00306)|BRCA - Breast invasive adenocarcinoma(304;0.0241)|READ - Rectum adenocarcinoma(331;0.0649)|KIRC - Kidney renal clear cell carcinoma(1967;0.147)	Butorphanol(DB00611)|Codeine(DB00318)|Fentanyl(DB00813)|Hydrocodone(DB00956)|Hydromorphone(DB00327)|Loperamide(DB00836)|Morphine(DB00295)|Nalbuphine(DB00844)|Naloxone(DB01183)|Naltrexone(DB00704)|Oxycodone(DB00497)|Pimozide(DB01100)|Propoxyphene(DB00647)	GTGTGTTGGGCGCCCATCCAC	0.672													10	4	---	---	---	---	capture	Missense_Mutation	SNP	29189500	29189500	OPRD1	1	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	10788	284
PTPN22	26191	broad.mit.edu	37	1	114380721	114380721	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6660-01	TCGA-76-6660-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:114380721G>A	uc001eds.2	-	13	1431	c.1301C>T	c.(1300-1302)GCA>GTA	p.A434V	PTPN22_uc009wgq.2_Missense_Mutation_p.A379V|PTPN22_uc010owo.1_Missense_Mutation_p.A190V|PTPN22_uc001edt.2_Intron|PTPN22_uc009wgr.2_Missense_Mutation_p.A434V|PTPN22_uc009wgs.2_Missense_Mutation_p.A307V|PTPN22_uc001edu.2_Missense_Mutation_p.A434V	NM_015967	NP_057051	Q9Y2R2	PTN22_HUMAN	protein tyrosine phosphatase, non-receptor type	434					negative regulation of T cell activation|negative regulation of T cell receptor signaling pathway|phosphoanandamide dephosphorylation|regulation of B cell receptor signaling pathway|regulation of natural killer cell proliferation|T cell differentiation	internal side of plasma membrane|nucleus|perinuclear region of cytoplasm	kinase binding|protein tyrosine phosphatase activity|SH3 domain binding			kidney(2)|lung(1)|skin(1)	4	Lung SC(450;0.184)	all_cancers(81;1.93e-08)|all_epithelial(167;4.37e-08)|all_lung(203;5.22e-06)|Lung NSC(69;8.94e-06)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		ATATCTTCCTGCTGCATTTAC	0.408													5	75	---	---	---	---	capture	Missense_Mutation	SNP	114380721	114380721	PTPN22	1	G	A	A	A	1	0	0	0	0	1	0	0	0	598	46	2	2	12682	284
IGSF3	3321	broad.mit.edu	37	1	117142794	117142794	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6660-01	TCGA-76-6660-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:117142794G>A	uc001egr.1	-	7	2503	c.1798C>T	c.(1798-1800)CGG>TGG	p.R600W	IGSF3_uc001egq.1_Missense_Mutation_p.R620W|IGSF3_uc001egs.1_Missense_Mutation_p.R273W	NM_001007237	NP_001007238	O75054	IGSF3_HUMAN	immunoglobulin superfamily, member 3 isoform 2	600	Ig-like C2-type 5.|Extracellular (Potential).					integral to membrane				ovary(2)	2	Lung SC(450;0.225)	all_cancers(81;1.24e-06)|all_epithelial(167;4.85e-07)|all_lung(203;1.66e-06)|Lung NSC(69;1.11e-05)		Lung(183;0.0142)|Colorectal(144;0.0929)|LUSC - Lung squamous cell carcinoma(189;0.108)|COAD - Colon adenocarcinoma(174;0.139)|all cancers(265;0.159)|Epithelial(280;0.166)		CCTCCGTCCCGGGTGAAGGTC	0.622													11	28	---	---	---	---	capture	Missense_Mutation	SNP	117142794	117142794	IGSF3	1	G	A	A	A	1	0	0	0	0	1	0	0	0	506	39	1	1	7525	284
VTCN1	79679	broad.mit.edu	37	1	117690323	117690323	+	Missense_Mutation	SNP	C	A	A			TCGA-76-6660-01	TCGA-76-6660-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:117690323C>A	uc001ehb.2	-	5	878	c.806G>T	c.(805-807)AGC>ATC	p.S269I	VTCN1_uc001ehc.2_Missense_Mutation_p.S174I|VTCN1_uc009whf.1_Missense_Mutation_p.S153I	NM_024626	NP_078902	Q7Z7D3	VTCN1_HUMAN	V-set domain containing T cell activation	269	Helical; (Potential).					integral to membrane|plasma membrane					0	Lung SC(450;0.225)	all_cancers(81;6.05e-06)|all_epithelial(167;5.59e-07)|all_lung(203;2.85e-06)|Lung NSC(69;2e-05)		Lung(183;0.0664)|LUSC - Lung squamous cell carcinoma(189;0.214)|Colorectal(144;0.23)		AAGTGCCCAGCTGATGGCAAA	0.448													12	74	---	---	---	---	capture	Missense_Mutation	SNP	117690323	117690323	VTCN1	1	C	A	A	A	1	0	0	0	0	1	0	0	0	364	28	4	4	17116	284
C1orf110	339512	broad.mit.edu	37	1	162829260	162829260	+	Missense_Mutation	SNP	C	A	A			TCGA-76-6660-01	TCGA-76-6660-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:162829260C>A	uc001gck.2	-	2	352	c.177G>T	c.(175-177)AGG>AGT	p.R59S	C1orf110_uc009wux.1_Missense_Mutation_p.R59S	NM_178550	NP_848645	Q86UF4	CA110_HUMAN	hypothetical protein LOC339512	59	Potential.										0						CTTGCTGCAACCTCTGCAGTT	0.547													9	22	---	---	---	---	capture	Missense_Mutation	SNP	162829260	162829260	C1orf110	1	C	A	A	A	1	0	0	0	0	1	0	0	0	233	18	4	4	1965	284
CYB5R1	51706	broad.mit.edu	37	1	202932844	202932844	+	Missense_Mutation	SNP	T	C	C			TCGA-76-6660-01	TCGA-76-6660-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:202932844T>C	uc001gyt.2	-	7	642	c.571A>G	c.(571-573)ATG>GTG	p.M191V	CYB5R1_uc010pqe.1_RNA	NM_016243	NP_057327	Q9UHQ9	NB5R1_HUMAN	cytochrome b5 reductase 1	191	FAD (By similarity).				sterol biosynthetic process	integral to membrane	cytochrome-b5 reductase activity			ovary(1)	1			BRCA - Breast invasive adenocarcinoma(75;0.141)			AGCTGTAGCATTGGGGTGATT	0.512													5	8	---	---	---	---	capture	Missense_Mutation	SNP	202932844	202932844	CYB5R1	1	T	C	C	C	1	0	0	0	0	1	0	0	0	676	52	3	3	4086	284
SMYD3	64754	broad.mit.edu	37	1	246078867	246078867	+	Nonsense_Mutation	SNP	C	A	A			TCGA-76-6660-01	TCGA-76-6660-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:246078867C>A	uc001ibl.2	-	8	873	c.778G>T	c.(778-780)GAA>TAA	p.E260*	SMYD3_uc001ibk.2_Nonsense_Mutation_p.E201*|SMYD3_uc001ibi.2_Nonsense_Mutation_p.E71*|SMYD3_uc001ibj.2_Nonsense_Mutation_p.E71*	NM_022743	NP_073580	Q9H7B4	SMYD3_HUMAN	SET and MYND domain containing 3	260						cytoplasm|nucleus	histone-lysine N-methyltransferase activity|protein binding|zinc ion binding				0	all_cancers(71;0.000291)|all_epithelial(71;0.000174)|Ovarian(71;0.0377)|all_lung(81;0.0568)|Lung NSC(105;0.0804)|Breast(184;0.173)|Melanoma(84;0.242)	all_cancers(173;0.0496)|Acute lymphoblastic leukemia(190;0.164)	OV - Ovarian serous cystadenocarcinoma(106;0.0129)	all cancers(4;0.028)|GBM - Glioblastoma multiforme(49;0.0537)		CAGTCACATTCAAAGCAGTAC	0.512													48	40	---	---	---	---	capture	Nonsense_Mutation	SNP	246078867	246078867	SMYD3	1	C	A	A	A	1	0	0	0	0	0	1	0	0	377	29	5	4	14715	284
OPTN	10133	broad.mit.edu	37	10	13174131	13174131	+	Missense_Mutation	SNP	A	G	G			TCGA-76-6660-01	TCGA-76-6660-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:13174131A>G	uc001ilu.1	+	14	1904	c.1466A>G	c.(1465-1467)AAG>AGG	p.K489R	OPTN_uc001ilv.1_Missense_Mutation_p.K489R|OPTN_uc001ilw.1_Missense_Mutation_p.K489R|OPTN_uc001ilx.1_Missense_Mutation_p.K489R|OPTN_uc001ily.1_Missense_Mutation_p.K483R|OPTN_uc010qbr.1_Missense_Mutation_p.K432R|OPTN_uc001ilz.1_Missense_Mutation_p.K483R	NM_001008213	NP_001008214	Q96CV9	OPTN_HUMAN	optineurin	489	Potential.|Interaction with MYO6.|Interaction with HD.				cell death|Golgi ribbon formation|Golgi to plasma membrane protein transport|protein targeting to Golgi|signal transduction	perinuclear region of cytoplasm|trans-Golgi network	protein C-terminus binding			ovary(2)	2						CATGAGGAAAAGGAGCAACTG	0.443													3	79	---	---	---	---	capture	Missense_Mutation	SNP	13174131	13174131	OPTN	10	A	G	G	G	1	0	0	0	0	1	0	0	0	39	3	3	3	10793	284
CCDC7	221016	broad.mit.edu	37	10	32780862	32780862	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6660-01	TCGA-76-6660-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:32780862C>T	uc001iwj.2	+	10	1379	c.809C>T	c.(808-810)TCA>TTA	p.S270L	CCDC7_uc009xlu.1_Intron|CCDC7_uc001iwk.2_Missense_Mutation_p.S270L|CCDC7_uc009xlv.2_Intron|CCDC7_uc009xlw.1_RNA|CCDC7_uc009xlx.1_Intron|CCDC7_uc009xly.1_Intron	NM_145023	NP_659460	Q96M83	CCDC7_HUMAN	coiled-coil domain containing 7	270											0		Breast(68;0.000207)|Prostate(175;0.0107)				ACTGCTCATTCAATGACTAAT	0.259													5	131	---	---	---	---	capture	Missense_Mutation	SNP	32780862	32780862	CCDC7	10	C	T	T	T	1	0	0	0	0	1	0	0	0	377	29	2	2	2816	284
SLC18A3	6572	broad.mit.edu	37	10	50819867	50819867	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6660-01	TCGA-76-6660-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:50819867G>A	uc001jhw.2	+	1	1521	c.1081G>A	c.(1081-1083)GCG>ACG	p.A361T	CHAT_uc001jhv.1_Intron|CHAT_uc001jhx.1_5'Flank|CHAT_uc001jhy.1_5'Flank|CHAT_uc001jia.2_5'Flank|CHAT_uc001jhz.2_5'Flank|CHAT_uc010qgs.1_5'Flank	NM_003055	NP_003046	Q16572	VACHT_HUMAN	vesicular acetylcholine transporter	361	Helical; (Potential).				neurotransmitter secretion	clathrin sculpted acetylcholine transport vesicle membrane|integral to plasma membrane|membrane fraction	acetylcholine transmembrane transporter activity			ovary(2)	2						GCTGTACGGCGCGCTTGGGCT	0.687													13	61	---	---	---	---	capture	Missense_Mutation	SNP	50819867	50819867	SLC18A3	10	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	14320	284
LIPF	8513	broad.mit.edu	37	10	90428330	90428330	+	Missense_Mutation	SNP	T	A	A			TCGA-76-6660-01	TCGA-76-6660-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:90428330T>A	uc001kfg.1	+	4	405	c.239T>A	c.(238-240)GTG>GAG	p.V80E	LIPF_uc009xtk.2_Missense_Mutation_p.V80E|LIPF_uc001kfh.1_Intron|LIPF_uc010qmt.1_Missense_Mutation_p.V90E|LIPF_uc010qmu.1_Intron	NM_004190	NP_004181	P07098	LIPG_HUMAN	lipase, gastric precursor	80					lipid catabolic process|triglyceride metabolic process	extracellular region	lipid binding|triglyceride lipase activity				0		Colorectal(252;0.0161)		Colorectal(12;3.91e-05)|COAD - Colon adenocarcinoma(12;5.43e-05)		AGACCTGTTGTGTTTTTGCAG	0.408													19	41	---	---	---	---	capture	Missense_Mutation	SNP	90428330	90428330	LIPF	10	T	A	A	A	1	0	0	0	0	1	0	0	0	767	59	4	4	8742	284
DMBT1	1755	broad.mit.edu	37	10	124395540	124395540	+	Silent	SNP	A	G	G			TCGA-76-6660-01	TCGA-76-6660-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:124395540A>G	uc001lgk.1	+	50	6301	c.6195A>G	c.(6193-6195)GAA>GAG	p.E2065E	DMBT1_uc001lgl.1_Silent_p.E2055E|DMBT1_uc001lgm.1_Silent_p.E1437E|DMBT1_uc009xzz.1_Silent_p.E2064E|DMBT1_uc010qtx.1_Silent_p.E785E|DMBT1_uc009yab.1_Silent_p.E768E|DMBT1_uc009yac.1_Silent_p.E359E	NM_007329	NP_015568	Q9UGM3	DMBT1_HUMAN	deleted in malignant brain tumors 1 isoform b	2065	CUB 2.				epithelial cell differentiation|induction of bacterial agglutination|innate immune response|interspecies interaction between organisms|protein transport|response to virus	extrinsic to membrane|phagocytic vesicle membrane|zymogen granule membrane	calcium-dependent protein binding|Gram-negative bacterial cell surface binding|Gram-positive bacterial cell surface binding|pattern recognition receptor activity|scavenger receptor activity|zymogen binding			central_nervous_system(7)	7		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)				ATTATATTGAAGTTTTCGATG	0.507													19	33	---	---	---	---	capture	Silent	SNP	124395540	124395540	DMBT1	10	A	G	G	G	1	0	0	0	0	0	0	0	1	37	3	3	3	4535	284
NLRP14	338323	broad.mit.edu	37	11	7083705	7083705	+	Silent	SNP	A	G	G			TCGA-76-6660-01	TCGA-76-6660-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:7083705A>G	uc001mfb.1	+	10	3269	c.2946A>G	c.(2944-2946)AGA>AGG	p.R982R		NM_176822	NP_789792	Q86W24	NAL14_HUMAN	NLR family, pyrin domain containing 14	982					cell differentiation|multicellular organismal development|spermatogenesis		ATP binding			ovary(3)|breast(2)|pancreas(1)|lung(1)|skin(1)	8				Epithelial(150;4.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0871)		ATGCTTTGAGATATCCAAACT	0.403													40	50	---	---	---	---	capture	Silent	SNP	7083705	7083705	NLRP14	11	A	G	G	G	1	0	0	0	0	0	0	0	1	154	12	3	3	10383	284
RNF141	50862	broad.mit.edu	37	11	10536581	10536581	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6660-01	TCGA-76-6660-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:10536581C>T	uc001mis.1	-	6	728	c.575G>A	c.(574-576)CGC>CAC	p.R192H	RNF141_uc009yga.1_RNA	NM_016422	NP_057506	Q8WVD5	RN141_HUMAN	ring finger protein 141	192	RING-type.						zinc ion binding				0				all cancers(16;4.63e-08)|Epithelial(150;1.38e-07)|BRCA - Breast invasive adenocarcinoma(625;0.064)		CATCTGTAGGCGACAAATAGG	0.378													34	83	---	---	---	---	capture	Missense_Mutation	SNP	10536581	10536581	RNF141	11	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	13336	284
WT1	7490	broad.mit.edu	37	11	32421505	32421505	+	Silent	SNP	T	G	G			TCGA-76-6660-01	TCGA-76-6660-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:32421505T>G	uc001mtn.1	-	6	1283	c.1087A>C	c.(1087-1089)AGA>CGA	p.R363R	WT1_uc001mtl.1_Silent_p.R151R|WT1_uc001mtm.1_Silent_p.R134R|WT1_uc001mto.1_Silent_p.R363R|WT1_uc001mtp.1_Silent_p.R346R|WT1_uc001mtq.1_Silent_p.R346R|WT1_uc009yjs.1_RNA	NM_024426	NP_077744	P19544	WT1_HUMAN	Wilms tumor 1 isoform D	295					adrenal cortex formation|branching involved in ureteric bud morphogenesis|camera-type eye development|cardiac muscle cell fate commitment|cellular response to cAMP|cellular response to gonadotropin stimulus|germ cell development|glomerular basement membrane development|glomerular visceral epithelial cell differentiation|induction of apoptosis|male genitalia development|male gonad development|mesenchymal to epithelial transition|metanephric epithelium development|metanephric S-shaped body morphogenesis|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of female gonad development|negative regulation of metanephric glomerular mesangial cell proliferation|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|negative regulation of translation|positive regulation of male gonad development|positive regulation of transcription, DNA-dependent|posterior mesonephric tubule development|regulation of organ formation|RNA splicing|sex determination|vasculogenesis|visceral serous pericardium development	cytoplasm|nuclear speck|nucleoplasm	C2H2 zinc finger domain binding|RNA binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|zinc ion binding		EWSR1/WT1(231)	haematopoietic_and_lymphoid_tissue(318)|soft_tissue(231)|kidney(132)|pleura(2)|lung(2)|upper_aerodigestive_tract(1)|peritoneum(1)	687	Breast(20;0.247)		OV - Ovarian serous cystadenocarcinoma(30;0.128)			TGAATGCCTCTGAAGACACCG	0.557			D|Mis|N|F|S	EWSR1	Wilms|desmoplastic small round cell tumor	Wilms			Denys-Drash_syndrome|Frasier_syndrome|Familial_Wilms_tumor|Wilms_tumor-Aniridia-ambiguous_Genitals-mental_Retardation				17	29	---	---	---	---	capture	Silent	SNP	32421505	32421505	WT1	11	T	G	G	G	1	0	0	0	0	0	0	0	1	713	55	4	4	17289	284
CHRM1	1128	broad.mit.edu	37	11	62677224	62677224	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6660-01	TCGA-76-6660-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:62677224C>T	uc001nwi.2	-	2	1750	c.1349G>A	c.(1348-1350)GGC>GAC	p.G450D		NM_000738	NP_000729	P11229	ACM1_HUMAN	cholinergic receptor, muscarinic 1	450	Cytoplasmic (Potential).				activation of phospholipase C activity by muscarinic acetylcholine receptor signaling pathway|activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|cell proliferation|nervous system development|positive regulation of cell proliferation|protein modification process	cell junction|integral to plasma membrane|membrane fraction|postsynaptic membrane	muscarinic acetylcholine receptor activity|phosphatidylinositol phospholipase C activity|protein binding				0					Anisotropine Methylbromide(DB00517)|Atropine(DB00572)|Benzquinamide(DB00767)|Benztropine(DB00245)|Bethanechol(DB01019)|Biperiden(DB00810)|Buclizine(DB00354)|Carbachol(DB00411)|Carbinoxamine(DB00748)|Cevimeline(DB00185)|Clidinium(DB00771)|Cryptenamine(DB00785)|Cyclizine(DB01176)|Cyclopentolate(DB00979)|Cycrimine(DB00942)|Desipramine(DB01151)|Dicyclomine(DB00804)|Diphenidol(DB01231)|Doxylamine(DB00366)|Ethopropazine(DB00392)|Flavoxate(DB01148)|Glycopyrrolate(DB00986)|Homatropine Methylbromide(DB00725)|Hyoscyamine(DB00424)|Ipratropium(DB00332)|Methantheline(DB00940)|Methotrimeprazine(DB01403)|Methylscopolamine(DB00462)|Metixene(DB00340)|Metoclopramide(DB01233)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Oxyphenonium(DB00219)|Pilocarpine(DB01085)|Pirenzepine(DB00670)|Procyclidine(DB00387)|Promazine(DB00420)|Promethazine(DB01069)|Propantheline(DB00782)|Propiomazine(DB00777)|Quinacrine(DB01103)|Scopolamine(DB00747)|Solifenacin(DB01591)|Succinylcholine(DB00202)|Thiethylperazine(DB00372)|Tolterodine(DB01036)|Tridihexethyl(DB00505)|Triflupromazine(DB00508)|Trihexyphenidyl(DB00376)|Trospium(DB00209)	GTGCACGGAGCCAGGGCGCTT	0.657													11	118	---	---	---	---	capture	Missense_Mutation	SNP	62677224	62677224	CHRM1	11	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	3341	284
STIP1	10963	broad.mit.edu	37	11	63961718	63961718	+	Nonsense_Mutation	SNP	C	T	T			TCGA-76-6660-01	TCGA-76-6660-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:63961718C>T	uc001nyk.1	+	3	424	c.277C>T	c.(277-279)CGA>TGA	p.R93*	STIP1_uc001nyj.2_Nonsense_Mutation_p.R93*|STIP1_uc010rnb.1_Intron	NM_006819	NP_006810	P31948	STIP1_HUMAN	stress-induced-phosphoprotein 1	93	TPR 3.				axon guidance|response to stress	Golgi apparatus|nucleus				ovary(2)|liver(1)	3						AGAAGCCAAGCGAACCTATGA	0.468													51	90	---	---	---	---	capture	Nonsense_Mutation	SNP	63961718	63961718	STIP1	11	C	T	T	T	1	0	0	0	0	0	1	0	0	347	27	5	1	15175	284
GRAMD1B	57476	broad.mit.edu	37	11	123471245	123471245	+	Missense_Mutation	SNP	C	G	G			TCGA-76-6660-01	TCGA-76-6660-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:123471245C>G	uc001pyx.2	+	7	939	c.610C>G	c.(610-612)CTC>GTC	p.L204V	GRAMD1B_uc001pyw.2_Missense_Mutation_p.L211V|GRAMD1B_uc010rzw.1_Missense_Mutation_p.L164V|GRAMD1B_uc010rzx.1_Missense_Mutation_p.L164V|GRAMD1B_uc009zbe.1_Missense_Mutation_p.L200V	NM_020716	NP_065767	Q3KR37	GRM1B_HUMAN	GRAM domain containing 1B	204						integral to membrane				ovary(1)	1		Breast(109;0.00204)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.32e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0394)		GCAGAATGCTCTCCTTGAAAA	0.458													17	16	---	---	---	---	capture	Missense_Mutation	SNP	123471245	123471245	GRAMD1B	11	C	G	G	G	1	0	0	0	0	1	0	0	0	416	32	4	4	6681	284
OVCH1	341350	broad.mit.edu	37	12	29630051	29630051	+	Missense_Mutation	SNP	T	C	C			TCGA-76-6660-01	TCGA-76-6660-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:29630051T>C	uc001rix.1	-	12	1361	c.1361A>G	c.(1360-1362)GAG>GGG	p.E454G		NM_183378	NP_899234	Q7RTY7	OVCH1_HUMAN	ovochymase 1 precursor	454	CUB 2.				proteolysis	extracellular region	metal ion binding|serine-type endopeptidase activity			ovary(3)|central_nervous_system(3)|pancreas(3)|large_intestine(1)	10	Lung NSC(12;1.84e-09)|Acute lymphoblastic leukemia(23;0.00885)|all_hematologic(23;0.0155)					AATGTGCTTCTCTGGAGCACA	0.393													40	16	---	---	---	---	capture	Missense_Mutation	SNP	29630051	29630051	OVCH1	12	T	C	C	C	1	0	0	0	0	1	0	0	0	702	54	3	3	11227	284
H3F3C	440093	broad.mit.edu	37	12	31944946	31944946	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6660-01	TCGA-76-6660-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:31944946C>T	uc001rkr.2	-	1	230	c.155G>A	c.(154-156)CGT>CAT	p.R52H		NM_001013699	NP_001013721	Q6NXT2	H3C_HUMAN	histone H3-like	52					nucleosome assembly	nucleosome|nucleus	DNA binding				0						CTGATAACGACGAATCTCTCG	0.582										HNSCC(67;0.2)			30	78	---	---	---	---	capture	Missense_Mutation	SNP	31944946	31944946	H3F3C	12	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	6862	284
GALNT6	11226	broad.mit.edu	37	12	51773383	51773383	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6660-01	TCGA-76-6660-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:51773383C>T	uc001ryk.2	-	2	408	c.183G>A	c.(181-183)ATG>ATA	p.M61I	GALNT6_uc009zma.1_RNA|GALNT6_uc001ryl.1_Missense_Mutation_p.M61I|GALNT6_uc010snh.1_Missense_Mutation_p.M61I	NM_007210	NP_009141	Q8NCL4	GALT6_HUMAN	polypeptide N-acetylgalactosaminyltransferase 6	61	Lumenal (Potential).				protein O-linked glycosylation	Golgi membrane|integral to membrane|perinuclear region of cytoplasm	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			ovary(2)	2						TAAGGTTGTTCATGGCCTCCA	0.552													8	140	---	---	---	---	capture	Missense_Mutation	SNP	51773383	51773383	GALNT6	12	C	T	T	T	1	0	0	0	0	1	0	0	0	377	29	2	2	6157	284
OR6C1	390321	broad.mit.edu	37	12	55714592	55714592	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6660-01	TCGA-76-6660-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:55714592C>T	uc010spi.1	+	1	209	c.209C>T	c.(208-210)TCG>TTG	p.S70L		NM_001005182	NP_001005182	Q96RD1	OR6C1_HUMAN	olfactory receptor, family 6, subfamily C,	70	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			large_intestine(1)|ovary(1)	2						TTAGAAATTTCGTTCACAACC	0.378													73	42	---	---	---	---	capture	Missense_Mutation	SNP	55714592	55714592	OR6C1	12	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	11094	284
GLT8D2	83468	broad.mit.edu	37	12	104387178	104387178	+	Missense_Mutation	SNP	C	G	G			TCGA-76-6660-01	TCGA-76-6660-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:104387178C>G	uc001tkh.1	-	10	1278	c.872G>C	c.(871-873)AGG>ACG	p.R291T	GLT8D2_uc001tki.1_Missense_Mutation_p.R291T	NM_031302	NP_112592	Q9H1C3	GL8D2_HUMAN	glycosyltransferase 8 domain containing 2	291	Lumenal (Potential).					integral to membrane	transferase activity, transferring glycosyl groups			ovary(1)|skin(1)	2						ACCCAGGTGCCTTATGTGCCA	0.353													53	32	---	---	---	---	capture	Missense_Mutation	SNP	104387178	104387178	GLT8D2	12	C	G	G	G	1	0	0	0	0	1	0	0	0	312	24	4	4	6406	284
DCLK1	9201	broad.mit.edu	37	13	36686060	36686060	+	Silent	SNP	G	A	A			TCGA-76-6660-01	TCGA-76-6660-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:36686060G>A	uc001uvf.2	-	3	902	c.669C>T	c.(667-669)GCC>GCT	p.A223A		NM_004734	NP_004725	O15075	DCLK1_HUMAN	doublecortin-like kinase 1	223	Doublecortin 2.				cell differentiation|central nervous system development|endosome transport|intracellular signal transduction|response to virus	integral to plasma membrane	ATP binding|protein serine/threonine kinase activity|receptor signaling protein activity			stomach(6)|ovary(2)|skin(1)	9		Breast(139;0.0147)|Lung SC(185;0.0685)|Prostate(109;0.122)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;1.72e-06)|Epithelial(112;4.24e-05)|BRCA - Breast invasive adenocarcinoma(63;0.00159)|OV - Ovarian serous cystadenocarcinoma(117;0.0158)|GBM - Glioblastoma multiforme(144;0.0638)		CCAGCTTGATGGCATCGGTGA	0.488													57	72	---	---	---	---	capture	Silent	SNP	36686060	36686060	DCLK1	13	G	A	A	A	1	0	0	0	0	0	0	0	1	600	47	2	2	4250	284
SPG20	23111	broad.mit.edu	37	13	36909291	36909291	+	Missense_Mutation	SNP	T	C	C			TCGA-76-6660-01	TCGA-76-6660-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:36909291T>C	uc001uvn.2	-	3	947	c.677A>G	c.(676-678)AAT>AGT	p.N226S	SPG20_uc010ten.1_Missense_Mutation_p.N226S|SPG20_uc001uvm.2_Missense_Mutation_p.N226S|SPG20_uc001uvo.2_Missense_Mutation_p.N226S|SPG20_uc001uvq.2_Missense_Mutation_p.N226S|SPG20_uc001uvp.2_Missense_Mutation_p.N226S	NM_001142296	NP_001135768	Q8N0X7	SPG20_HUMAN	spartin	226					cell death	cytoplasm	ubiquitin protein ligase binding				0		Breast(139;0.014)|Lung SC(185;0.0548)|Prostate(109;0.174)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;2.42e-08)|Epithelial(112;1.58e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00128)|BRCA - Breast invasive adenocarcinoma(63;0.0125)|GBM - Glioblastoma multiforme(144;0.026)		CTGTACTCCATTTGGTATCAA	0.423													4	84	---	---	---	---	capture	Missense_Mutation	SNP	36909291	36909291	SPG20	13	T	C	C	C	1	0	0	0	0	1	0	0	0	676	52	3	3	14934	284
CTSG	1511	broad.mit.edu	37	14	25043946	25043946	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6660-01	TCGA-76-6660-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:25043946G>A	uc001wpq.2	-	3	311	c.274C>T	c.(274-276)CGC>TGC	p.R92C		NM_001911	NP_001902	P08311	CATG_HUMAN	cathepsin G preproprotein	92	Peptidase S1.				immune response|proteolysis	cell surface|extracellular space|plasma membrane|stored secretory granule	heparin binding|serine-type endopeptidase activity			ovary(2)	2				GBM - Glioblastoma multiforme(265;0.0269)		ATGGCTCTGCGCGCAGTGATG	0.532													49	54	---	---	---	---	capture	Missense_Mutation	SNP	25043946	25043946	CTSG	14	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	3996	284
ARHGAP5	394	broad.mit.edu	37	14	32560334	32560334	+	Silent	SNP	G	A	A			TCGA-76-6660-01	TCGA-76-6660-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:32560334G>A	uc001wrl.2	+	2	698	c.459G>A	c.(457-459)AAG>AAA	p.K153K	ARHGAP5_uc001wrm.2_Silent_p.K153K|ARHGAP5_uc001wrn.2_Silent_p.K153K|ARHGAP5_uc001wro.2_Intron|ARHGAP5_uc001wrp.2_Intron	NM_001173	NP_001025226	Q13017	RHG05_HUMAN	Rho GTPase activating protein 5 isoform b	153					cell adhesion|Rho protein signal transduction	cytosol|membrane	GTP binding|GTPase activity|Rho GTPase activator activity|SH2 domain binding			ovary(4)|central_nervous_system(1)	5	Hepatocellular(127;0.0604)|Prostate(35;0.15)|Breast(36;0.186)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.00714)|BRCA - Breast invasive adenocarcinoma(188;0.0952)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00566)		CTGAAGGGAAGCTCAACGTAG	0.363													31	58	---	---	---	---	capture	Silent	SNP	32560334	32560334	ARHGAP5	14	G	A	A	A	1	0	0	0	0	0	0	0	1	438	34	2	2	879	284
PTGDR	5729	broad.mit.edu	37	14	52735336	52735336	+	Silent	SNP	G	A	A			TCGA-76-6660-01	TCGA-76-6660-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:52735336G>A	uc001wzq.2	+	1	906	c.804G>A	c.(802-804)GCG>GCA	p.A268A		NM_000953	NP_000944	Q13258	PD2R_HUMAN	prostaglandin D2 receptor	268	Helical; Name=6; (Potential).					integral to membrane|plasma membrane	prostaglandin D receptor activity|protein binding			ovary(1)|lung(1)|central_nervous_system(1)|skin(1)	4	Breast(41;0.0639)|all_epithelial(31;0.0887)				Nedocromil(DB00716)	TGCTGCTGGCGCTGATGACCG	0.687													33	230	---	---	---	---	capture	Silent	SNP	52735336	52735336	PTGDR	14	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	12636	284
TGM7	116179	broad.mit.edu	37	15	43571424	43571424	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6660-01	TCGA-76-6660-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:43571424G>A	uc001zrf.1	-	11	1735	c.1730C>T	c.(1729-1731)ACG>ATG	p.T577M		NM_052955	NP_443187	Q96PF1	TGM7_HUMAN	transglutaminase 7	577					peptide cross-linking		acyltransferase activity|metal ion binding|protein-glutamine gamma-glutamyltransferase activity			ovary(2)	2		all_cancers(109;2.12e-14)|all_epithelial(112;1.99e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;9.14e-07)	L-Glutamine(DB00130)	CTTTTCGTCCGTTAGCTTGTT	0.527													15	32	---	---	---	---	capture	Missense_Mutation	SNP	43571424	43571424	TGM7	15	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	15720	284
ATP8B4	79895	broad.mit.edu	37	15	50226281	50226281	+	Silent	SNP	G	T	T			TCGA-76-6660-01	TCGA-76-6660-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:50226281G>T	uc001zxu.2	-	15	1528	c.1386C>A	c.(1384-1386)CCC>CCA	p.P462P	ATP8B4_uc010ber.2_Silent_p.P335P|ATP8B4_uc010ufd.1_Silent_p.P335P|ATP8B4_uc010ufe.1_RNA	NM_024837	NP_079113	Q8TF62	AT8B4_HUMAN	ATPase class I type 8B member 4	462	Cytoplasmic (Potential).				ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			skin(3)|ovary(2)|breast(2)|large_intestine(1)	8		all_lung(180;0.00183)		all cancers(107;2.41e-07)|GBM - Glioblastoma multiforme(94;8.28e-05)		CATGAACTTTGGGATCACCCA	0.413													45	66	---	---	---	---	capture	Silent	SNP	50226281	50226281	ATP8B4	15	G	T	T	T	1	0	0	0	0	0	0	0	1	600	47	4	4	1188	284
NEDD4	4734	broad.mit.edu	37	15	56207523	56207523	+	Missense_Mutation	SNP	T	G	G			TCGA-76-6660-01	TCGA-76-6660-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:56207523T>G	uc002adj.2	-	1	1807	c.1507A>C	c.(1507-1509)AGC>CGC	p.S503R	NEDD4_uc002adl.2_Intron|NEDD4_uc002adi.2_Missense_Mutation_p.S503R|NEDD4_uc010ugj.1_Missense_Mutation_p.S503R|NEDD4_uc010bfm.2_Missense_Mutation_p.S503R|NEDD4_uc002adk.2_RNA	NM_198400	NP_006145	P46934	NEDD4_HUMAN	neural precursor cell expressed, developmentally	503					development involved in symbiotic interaction|glucocorticoid receptor signaling pathway|negative regulation of sodium ion transport|negative regulation of transcription from RNA polymerase II promoter in response to UV-induced DNA damage|negative regulation of vascular endothelial growth factor receptor signaling pathway|neuron projection development|positive regulation of nucleocytoplasmic transport|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of protein catabolic process|progesterone receptor signaling pathway|protein K63-linked ubiquitination|protein targeting to lysosome|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|receptor catabolic process|receptor internalization|regulation of dendrite morphogenesis|response to calcium ion|transmission of virus	apicolateral plasma membrane|cell cortex|chromatin|cytosol|perinuclear region of cytoplasm|ubiquitin ligase complex	beta-2 adrenergic receptor binding|phosphoserine binding|phosphothreonine binding|proline-rich region binding|protein domain specific binding|RNA polymerase binding|sodium channel inhibitor activity|ubiquitin binding|ubiquitin-protein ligase activity			skin(2)|ovary(1)|breast(1)	4				all cancers(107;0.0299)|GBM - Glioblastoma multiforme(80;0.113)		TCTCTGTTGCTGTCTCTTGAT	0.338													33	62	---	---	---	---	capture	Missense_Mutation	SNP	56207523	56207523	NEDD4	15	T	G	G	G	1	0	0	0	0	1	0	0	0	715	55	4	4	10217	284
KIAA1024	23251	broad.mit.edu	37	15	79748562	79748562	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6660-01	TCGA-76-6660-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:79748562G>A	uc002bew.1	+	2	148	c.73G>A	c.(73-75)GTT>ATT	p.V25I	KIAA1024_uc010unk.1_Missense_Mutation_p.V25I	NM_015206	NP_056021	Q9UPX6	K1024_HUMAN	hypothetical protein LOC23251	25						integral to membrane				pancreas(2)|ovary(1)|central_nervous_system(1)	4						GCAAAATACCGTTTCTTATCA	0.478													35	44	---	---	---	---	capture	Missense_Mutation	SNP	79748562	79748562	KIAA1024	15	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	8127	284
ADAMTSL3	57188	broad.mit.edu	37	15	84659966	84659966	+	Missense_Mutation	SNP	G	T	T			TCGA-76-6660-01	TCGA-76-6660-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:84659966G>T	uc002bjz.3	+	23	4197	c.3973G>T	c.(3973-3975)GGT>TGT	p.G1325C	ADAMTSL3_uc010bmt.1_Missense_Mutation_p.G1325C|ADAMTSL3_uc010bmu.1_Missense_Mutation_p.G1325C	NM_207517	NP_997400	P82987	ATL3_HUMAN	ADAMTS-like 3 precursor	1325	Ig-like C2-type 3.					proteinaceous extracellular matrix	metallopeptidase activity|zinc ion binding			ovary(6)|central_nervous_system(5)|lung(5)|large_intestine(4)|breast(3)|skin(2)|kidney(1)|pancreas(1)	27			BRCA - Breast invasive adenocarcinoma(143;0.211)			TCCTGTAAAAGGTAAGTGTGG	0.502													64	108	---	---	---	---	capture	Missense_Mutation	SNP	84659966	84659966	ADAMTSL3	15	G	T	T	T	1	0	0	0	0	1	0	0	0	455	35	4	4	276	284
MYH13	8735	broad.mit.edu	37	17	10209843	10209843	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6660-01	TCGA-76-6660-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:10209843C>T	uc002gmk.1	-	37	5489	c.5399G>A	c.(5398-5400)CGT>CAT	p.R1800H		NM_003802	NP_003793	Q9UKX3	MYH13_HUMAN	myosin, heavy polypeptide 13, skeletal muscle	1800	Potential.				muscle contraction	muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(4)|skin(2)	6						CTCATCTAGACGGTGCTGCAG	0.547													5	176	---	---	---	---	capture	Missense_Mutation	SNP	10209843	10209843	MYH13	17	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	9942	284
MYH8	4626	broad.mit.edu	37	17	10322097	10322097	+	Missense_Mutation	SNP	C	A	A			TCGA-76-6660-01	TCGA-76-6660-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:10322097C>A	uc002gmm.2	-	5	471	c.376G>T	c.(376-378)GTC>TTC	p.V126F	uc002gml.1_Intron	NM_002472	NP_002463	P13535	MYH8_HUMAN	myosin, heavy chain 8, skeletal muscle,	126	Myosin head-like.				muscle filament sliding	cytosol|muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity|structural constituent of muscle			skin(6)|ovary(3)|breast(2)	11						TTGACGGTGACACAGAAGAGG	0.512									Trismus-Pseudocamptodactyly_Syndrome_with_Cardiac_Myxoma_and_Freckling				12	85	---	---	---	---	capture	Missense_Mutation	SNP	10322097	10322097	MYH8	17	C	A	A	A	1	0	0	0	0	1	0	0	0	221	17	4	4	9951	284
AOC2	314	broad.mit.edu	37	17	41001205	41001205	+	Missense_Mutation	SNP	T	G	G			TCGA-76-6660-01	TCGA-76-6660-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:41001205T>G	uc002ibu.2	+	2	1726	c.1691T>G	c.(1690-1692)GTC>GGC	p.V564G	AOC2_uc002ibt.2_Missense_Mutation_p.V564G|AOC3_uc002ibv.2_5'Flank	NM_009590	NP_033720	O75106	AOC2_HUMAN	amine oxidase, copper containing 2 isoform b	564					catecholamine metabolic process|visual perception	cytoplasm|plasma membrane	aliphatic-amine oxidase activity|aminoacetone:oxygen oxidoreductase(deaminating) activity|copper ion binding|electron carrier activity|phenethylamine:oxygen oxidoreductase (deaminating) activity|primary amine oxidase activity|quinone binding|tryptamine:oxygen oxidoreductase (deaminating) activity			ovary(2)	2		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.156)		ACTCGGCAGGTCCTGGGAAAG	0.597													8	57	---	---	---	---	capture	Missense_Mutation	SNP	41001205	41001205	AOC2	17	T	G	G	G	1	0	0	0	0	1	0	0	0	754	58	4	4	720	284
XYLT2	64132	broad.mit.edu	37	17	48435599	48435599	+	Missense_Mutation	SNP	T	C	C			TCGA-76-6660-01	TCGA-76-6660-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:48435599T>C	uc002iqo.2	+	10	2082	c.1973T>C	c.(1972-1974)CTT>CCT	p.L658P	XYLT2_uc010dbo.2_RNA	NM_022167	NP_071450	Q9H1B5	XYLT2_HUMAN	xylosyltransferase II	658	Lumenal (Potential).				glycosaminoglycan biosynthetic process	endoplasmic reticulum membrane|Golgi membrane|integral to membrane	acetylglucosaminyltransferase activity|protein xylosyltransferase activity			pancreas(1)	1	Breast(11;7.18e-19)					AAAGAGCGTCTTTTCCGGAAC	0.443													20	33	---	---	---	---	capture	Missense_Mutation	SNP	48435599	48435599	XYLT2	17	T	C	C	C	1	0	0	0	0	1	0	0	0	728	56	3	3	17345	284
RNF43	54894	broad.mit.edu	37	17	56492699	56492699	+	Silent	SNP	T	C	C			TCGA-76-6660-01	TCGA-76-6660-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:56492699T>C	uc002iwf.2	-	1	2196	c.240A>G	c.(238-240)GGA>GGG	p.G80G	RNF43_uc010wnv.1_Silent_p.G80G|RNF43_uc002iwh.3_Silent_p.G80G|RNF43_uc002iwg.3_Silent_p.G80G|RNF43_uc010dcw.2_Intron	NM_017763	NP_060233	Q68DV7	RNF43_HUMAN	ring finger protein 43 precursor	80	Extracellular (Potential).					endoplasmic reticulum membrane|integral to membrane|nuclear envelope	ligase activity|protein binding|zinc ion binding			ovary(1)	1	Medulloblastoma(34;0.127)|all_neural(34;0.237)					GCATTAATTTTCCTTCTGCTG	0.378													33	51	---	---	---	---	capture	Silent	SNP	56492699	56492699	RNF43	17	T	C	C	C	1	0	0	0	0	0	0	0	1	795	62	3	3	13387	284
DDX5	1655	broad.mit.edu	37	17	62502217	62502217	+	Missense_Mutation	SNP	G	C	C			TCGA-76-6660-01	TCGA-76-6660-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:62502217G>C	uc002jek.2	-	1	268	c.21C>G	c.(19-21)GAC>GAG	p.D7E	CCDC45_uc002jem.2_5'Flank|CCDC45_uc002jen.2_5'Flank|CCDC45_uc010wqb.1_5'Flank|DDX5_uc010deh.2_5'Flank|DDX5_uc002jej.2_5'UTR|DDX5_uc010wqa.1_Missense_Mutation_p.D7E|DDX5_uc002jel.1_5'Flank	NM_004396	NP_004387	P17844	DDX5_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 5	7					cell growth|regulation of alternative nuclear mRNA splicing, via spliceosome	catalytic step 2 spliceosome|nucleolus	ATP binding|ATP-dependent helicase activity|mRNA binding|protein binding|RNA helicase activity|transcription cofactor activity			ovary(2)|lung(1)	3	Breast(5;2.15e-14)		BRCA - Breast invasive adenocarcinoma(8;8.6e-12)			CGCGGTCTCGGTCACTCGAAT	0.657			T	ETV4	prostate								12	19	---	---	---	---	capture	Missense_Mutation	SNP	62502217	62502217	DDX5	17	G	C	C	C	1	0	0	0	0	1	0	0	0	568	44	4	4	4325	284
LAMA1	284217	broad.mit.edu	37	18	6956660	6956660	+	Missense_Mutation	SNP	A	T	T			TCGA-76-6660-01	TCGA-76-6660-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:6956660A>T	uc002knm.2	-	56	8163	c.8069T>A	c.(8068-8070)CTC>CAC	p.L2690H	LAMA1_uc002knk.2_5'Flank|LAMA1_uc002knl.2_Missense_Mutation_p.L143H|LAMA1_uc010wzj.1_Missense_Mutation_p.L2166H	NM_005559	NP_005550	P25391	LAMA1_HUMAN	laminin, alpha 1 precursor	2690					axon guidance|cell adhesion|cell surface receptor linked signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	extracellular space|laminin-1 complex|laminin-3 complex	extracellular matrix structural constituent|receptor binding			ovary(8)|large_intestine(4)|upper_aerodigestive_tract(2)|breast(2)|skin(2)|pancreas(2)|central_nervous_system(1)	21		Colorectal(10;0.172)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	CTCTGGCAAGAGCTTGCTGTC	0.552													36	60	---	---	---	---	capture	Missense_Mutation	SNP	6956660	6956660	LAMA1	18	A	T	T	T	1	0	0	0	0	1	0	0	0	143	11	4	4	8525	284
RIT2	6014	broad.mit.edu	37	18	40554049	40554049	+	Missense_Mutation	SNP	G	T	T			TCGA-76-6660-01	TCGA-76-6660-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:40554049G>T	uc002lav.2	-	3	397	c.224C>A	c.(223-225)ACT>AAT	p.T75N	RIT2_uc010dnf.2_Missense_Mutation_p.T75N	NM_002930	NP_002921	Q99578	RIT2_HUMAN	Ras-like without CAAX 2	75	GTP (By similarity).				nerve growth factor receptor signaling pathway|small GTPase mediated signal transduction|synaptic transmission	intracellular|plasma membrane	calmodulin binding|GTP binding|GTPase activity			ovary(1)	1						CTGGCCAGCAGTGTCCAAGAT	0.368													7	14	---	---	---	---	capture	Missense_Mutation	SNP	40554049	40554049	RIT2	18	G	T	T	T	1	0	0	0	0	1	0	0	0	468	36	4	4	13279	284
DNM2	1785	broad.mit.edu	37	19	10886491	10886491	+	Silent	SNP	G	A	A			TCGA-76-6660-01	TCGA-76-6660-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:10886491G>A	uc002mps.1	+	4	662	c.498G>A	c.(496-498)CGG>CGA	p.R166R	DNM2_uc010dxk.2_RNA|DNM2_uc002mpt.1_Silent_p.R166R|DNM2_uc002mpv.1_Silent_p.R166R|DNM2_uc002mpu.1_Silent_p.R166R|DNM2_uc010dxl.1_Silent_p.R166R	NM_001005361	NP_001005361	P50570	DYN2_HUMAN	dynamin 2 isoform 2	166					G2/M transition of mitotic cell cycle|positive regulation of apoptosis|positive regulation of transcription, DNA-dependent|post-Golgi vesicle-mediated transport|receptor internalization|signal transduction|synaptic vesicle transport|transferrin transport	cell junction|cytosol|Golgi membrane|microtubule|postsynaptic density|postsynaptic membrane	GTP binding|GTPase activity|microtubule binding			central_nervous_system(2)|skin(2)|ovary(1)|breast(1)	6			Epithelial(33;4.17e-05)|all cancers(31;8.48e-05)			TCATCAGCCGGGAGAGCAGCC	0.607													46	131	---	---	---	---	capture	Silent	SNP	10886491	10886491	DNM2	19	G	A	A	A	1	0	0	0	0	0	0	0	1	548	43	2	2	4628	284
RGL3	57139	broad.mit.edu	37	19	11526753	11526753	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6660-01	TCGA-76-6660-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:11526753G>A	uc002mrp.2	-	5	561	c.497C>T	c.(496-498)TCG>TTG	p.S166L	RGL3_uc002mrn.2_5'UTR|RGL3_uc002mrm.2_5'UTR|RGL3_uc002mro.2_Missense_Mutation_p.S166L	NM_001035223	NP_001030300	Q3MIN7	RGL3_HUMAN	ral guanine nucleotide dissociation	166	N-terminal Ras-GEF.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	intracellular				ovary(1)	1						GCCCAGGTCCGAATGGGCAGG	0.617													22	65	---	---	---	---	capture	Missense_Mutation	SNP	11526753	11526753	RGL3	19	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	13173	284
PEG3	5178	broad.mit.edu	37	19	57325278	57325278	+	Missense_Mutation	SNP	G	C	C			TCGA-76-6660-01	TCGA-76-6660-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:57325278G>C	uc002qnu.2	-	7	4883	c.4532C>G	c.(4531-4533)ACA>AGA	p.T1511R	ZIM2_uc010ygq.1_Intron|ZIM2_uc010ygr.1_Intron|ZIM2_uc002qnr.2_Intron|ZIM2_uc002qnq.2_Intron|ZIM2_uc010etp.2_Intron|ZIM2_uc010ygs.1_Intron|PEG3_uc002qnt.2_Missense_Mutation_p.T1482R|PEG3_uc002qnv.2_Missense_Mutation_p.T1511R|PEG3_uc002qnw.2_Missense_Mutation_p.T1387R|PEG3_uc002qnx.2_Missense_Mutation_p.T1385R|PEG3_uc010etr.2_Missense_Mutation_p.T1511R	NM_001146186	NP_001139658	Q9GZU2	PEG3_HUMAN	paternally expressed 3 isoform 1	1511	Glu-rich.|C2H2-type 11.				apoptosis|viral reproduction	cytoplasm|nucleus	nucleic acid binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(7)|skin(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	12		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)		GAAGGTTTCTGTGCATTCATG	0.483													56	108	---	---	---	---	capture	Missense_Mutation	SNP	57325278	57325278	PEG3	19	G	C	C	C	1	0	0	0	0	1	0	0	0	624	48	4	4	11623	284
SEMA4F	10505	broad.mit.edu	37	2	74900663	74900663	+	Silent	SNP	G	A	A			TCGA-76-6660-01	TCGA-76-6660-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:74900663G>A	uc002sna.1	+	6	741	c.630G>A	c.(628-630)GAG>GAA	p.E210E	SEMA4F_uc010ysb.1_3'UTR|SEMA4F_uc010ffq.1_Silent_p.E177E|SEMA4F_uc010ffr.1_5'UTR|SEMA4F_uc002snb.1_5'UTR|SEMA4F_uc002snc.1_Intron	NM_004263	NP_004254	O95754	SEM4F_HUMAN	semaphorin W precursor	210	Sema.|Extracellular (Potential).				cell-cell signaling	endoplasmic reticulum|integral to plasma membrane	receptor activity			ovary(2)|pancreas(1)|skin(1)	4						GTCGTGCCGAGGACTGGATTC	0.612													3	71	---	---	---	---	capture	Silent	SNP	74900663	74900663	SEMA4F	2	G	A	A	A	1	0	0	0	0	0	0	0	1	451	35	2	2	13928	284
REV1	51455	broad.mit.edu	37	2	100065960	100065960	+	Missense_Mutation	SNP	G	C	C			TCGA-76-6660-01	TCGA-76-6660-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:100065960G>C	uc002tad.2	-	4	400	c.188C>G	c.(187-189)TCC>TGC	p.S63C	REV1_uc002tac.2_Missense_Mutation_p.S63C|REV1_uc002tae.1_Missense_Mutation_p.S42C	NM_016316	NP_057400	Q9UBZ9	REV1_HUMAN	REV1-like isoform 1	63	BRCT.				DNA replication|error-prone translesion synthesis|response to UV	nucleoplasm	damaged DNA binding|DNA-directed DNA polymerase activity|magnesium ion binding|protein binding			ovary(2)	2						TTCCTCAGCGGAAGGATCTGC	0.313								DNA_polymerases_(catalytic_subunits)|Direct_reversal_of_damage					36	36	---	---	---	---	capture	Missense_Mutation	SNP	100065960	100065960	REV1	2	G	C	C	C	1	0	0	0	0	1	0	0	0	533	41	4	4	13134	284
CNTNAP5	129684	broad.mit.edu	37	2	125530548	125530548	+	Silent	SNP	G	A	A			TCGA-76-6660-01	TCGA-76-6660-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:125530548G>A	uc002tno.2	+	17	3067	c.2703G>A	c.(2701-2703)TCG>TCA	p.S901S	CNTNAP5_uc010flu.2_Silent_p.S902S	NM_130773	NP_570129	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5 precursor	901	Laminin G-like 3.|Extracellular (Potential).				cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(10)	10				BRCA - Breast invasive adenocarcinoma(221;0.248)		GGGAGACGTCGGAGGAGGGCC	0.532													70	99	---	---	---	---	capture	Silent	SNP	125530548	125530548	CNTNAP5	2	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	3615	284
POTEE	445582	broad.mit.edu	37	2	132021658	132021658	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6660-01	TCGA-76-6660-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:132021658G>A	uc002tsn.2	+	15	2682	c.2630G>A	c.(2629-2631)CGC>CAC	p.R877H	PLEKHB2_uc002tsh.2_Intron|POTEE_uc002tsk.2_Missense_Mutation_p.R477H|POTEE_uc002tsl.2_Missense_Mutation_p.R459H|POTEE_uc010fmy.1_Missense_Mutation_p.R341H	NM_001083538	NP_001077007	Q6S8J3	POTEE_HUMAN	protein expressed in prostate, ovary, testis,	877	Actin-like.						ATP binding				0						GCCACCCTGCGCCTAGACCTG	0.612													30	94	---	---	---	---	capture	Missense_Mutation	SNP	132021658	132021658	POTEE	2	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	12165	284
TTN	7273	broad.mit.edu	37	2	179458769	179458769	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6660-01	TCGA-76-6660-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179458769G>A	uc010zfg.1	-	246	50871	c.50647C>T	c.(50647-50649)CGT>TGT	p.R16883C	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.R10578C|TTN_uc010zfi.1_Missense_Mutation_p.R10511C|TTN_uc010zfj.1_Missense_Mutation_p.R10386C	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	17810							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GAATCTGAACGTTTGGCCTTG	0.423													75	96	---	---	---	---	capture	Missense_Mutation	SNP	179458769	179458769	TTN	2	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	16617	284
WDR75	84128	broad.mit.edu	37	2	190313200	190313200	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6660-01	TCGA-76-6660-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:190313200C>T	uc002uql.1	+	2	242	c.182C>T	c.(181-183)ACT>ATT	p.T61I	WDR75_uc002uqm.1_5'UTR|WDR75_uc002uqn.1_5'UTR	NM_032168	NP_115544	Q8IWA0	WDR75_HUMAN	WD repeat domain 75	61	WD 2.					nucleolus				ovary(2)	2			OV - Ovarian serous cystadenocarcinoma(117;0.00105)|Epithelial(96;0.0129)|all cancers(119;0.0456)			AATCTGGTGACTGGAATCCAG	0.398													37	48	---	---	---	---	capture	Missense_Mutation	SNP	190313200	190313200	WDR75	2	C	T	T	T	1	0	0	0	0	1	0	0	0	260	20	2	2	17206	284
TRIP12	9320	broad.mit.edu	37	2	230683176	230683176	+	Silent	SNP	T	C	C			TCGA-76-6660-01	TCGA-76-6660-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:230683176T>C	uc002vpw.1	-	8	1468	c.1359A>G	c.(1357-1359)CAA>CAG	p.Q453Q	TRIP12_uc002vpx.1_Silent_p.Q501Q|TRIP12_uc002vpy.1_Silent_p.Q156Q|TRIP12_uc010zlz.1_Intron|TRIP12_uc010fxh.1_Silent_p.Q459Q	NM_004238	NP_004229	Q14669	TRIPC_HUMAN	thyroid hormone receptor interactor 12	453					protein ubiquitination involved in ubiquitin-dependent protein catabolic process	proteasome complex	thyroid hormone receptor binding|ubiquitin-protein ligase activity			ovary(4)|lung(2)|breast(1)|central_nervous_system(1)|skin(1)	9		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.126)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;4.76e-13)|all cancers(144;4.34e-10)|LUSC - Lung squamous cell carcinoma(224;0.00864)|Lung(119;0.0116)		CCTGAAGCTGTTGACTTTCAT	0.373													63	75	---	---	---	---	capture	Silent	SNP	230683176	230683176	TRIP12	2	T	C	C	C	1	0	0	0	0	0	0	0	1	777	60	3	3	16439	284
ILKAP	80895	broad.mit.edu	37	2	239079263	239079263	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6660-01	TCGA-76-6660-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:239079263C>T	uc002vxv.2	-	12	1223	c.1093G>A	c.(1093-1095)GCA>ACA	p.A365T	ILKAP_uc010zns.1_Missense_Mutation_p.A297T|ILKAP_uc002vxw.2_Missense_Mutation_p.A245T	NM_030768	NP_110395	Q9H0C8	ILKAP_HUMAN	integrin-linked kinase-associated protein	365	PP2C-like.					cytoplasm|protein serine/threonine phosphatase complex	metal ion binding|protein binding			ovary(3)	3		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0481)|all_lung(227;0.152)|all_hematologic(139;0.158)|Melanoma(123;0.203)|Hepatocellular(293;0.244)		Epithelial(121;5.49e-24)|OV - Ovarian serous cystadenocarcinoma(60;3.93e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.82e-08)|BRCA - Breast invasive adenocarcinoma(100;0.00012)|Lung(119;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.0163)		TTGCAGGCTGCTTCGTAGCGG	0.637													3	63	---	---	---	---	capture	Missense_Mutation	SNP	239079263	239079263	ILKAP	2	C	T	T	T	1	0	0	0	0	1	0	0	0	364	28	2	2	7637	284
PTPRA	5786	broad.mit.edu	37	20	3002794	3002794	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6660-01	TCGA-76-6660-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:3002794G>A	uc010zqd.1	+	14	1606	c.1289G>A	c.(1288-1290)GGC>GAC	p.G430D	PTPRA_uc002whj.2_Missense_Mutation_p.G419D|PTPRA_uc002whk.2_Missense_Mutation_p.G410D|PTPRA_uc002whl.2_Missense_Mutation_p.G410D|PTPRA_uc002whm.2_Missense_Mutation_p.G186D|PTPRA_uc002whn.2_Missense_Mutation_p.G410D|PTPRA_uc002who.2_Missense_Mutation_p.G82D	NM_002836	NP_002827	P18433	PTPRA_HUMAN	protein tyrosine phosphatase, receptor type, A	419	Tyrosine-protein phosphatase 1.|Cytoplasmic (Potential).				axon guidance|protein phosphorylation	integral to plasma membrane	transmembrane receptor protein tyrosine phosphatase activity			upper_aerodigestive_tract(1)	1						ACCCCGATCGGCATGCTCAAG	0.572													4	122	---	---	---	---	capture	Missense_Mutation	SNP	3002794	3002794	PTPRA	20	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	12690	284
RIN2	54453	broad.mit.edu	37	20	19981289	19981289	+	Silent	SNP	C	T	T			TCGA-76-6660-01	TCGA-76-6660-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:19981289C>T	uc002wro.1	+	11	2433	c.2397C>T	c.(2395-2397)AAC>AAT	p.N799N	RIN2_uc010gcu.1_Silent_p.N366N|RIN2_uc010gcv.1_Silent_p.N593N	NM_018993	NP_061866	Q8WYP3	RIN2_HUMAN	Ras and Rab interactor 2	799	Ras-associating.				endocytosis|small GTPase mediated signal transduction	cytoplasm	GTPase activator activity|Rab guanyl-nucleotide exchange factor activity			lung(4)|ovary(1)	5						AGGAGGTCAACAGTGGTTGCA	0.507													7	165	---	---	---	---	capture	Silent	SNP	19981289	19981289	RIN2	20	C	T	T	T	1	0	0	0	0	0	0	0	1	220	17	2	2	13264	284
AURKA	6790	broad.mit.edu	37	20	54963223	54963223	+	Missense_Mutation	SNP	C	T	T	rs6069717		TCGA-76-6660-01	TCGA-76-6660-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:54963223C>T	uc002xxd.1	-	4	597	c.31G>A	c.(31-33)GGA>AGA	p.G11R	AURKA_uc002xxe.1_Missense_Mutation_p.G11R|AURKA_uc002xxf.1_Missense_Mutation_p.G11R|AURKA_uc002xxg.1_Missense_Mutation_p.G11R|AURKA_uc002xxh.1_Missense_Mutation_p.G11R|AURKA_uc002xxi.1_Missense_Mutation_p.G11R|AURKA_uc002xxj.1_Missense_Mutation_p.G11R|AURKA_uc002xxk.1_Missense_Mutation_p.G11R|AURKA_uc010zzd.1_RNA	NM_198433	NP_940835	O14965	AURKA_HUMAN	serine/threonine protein kinase 6	11					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|mitosis|phosphatidylinositol-mediated signaling|regulation of protein stability|spindle organization	cytosol|nucleus|perinuclear region of cytoplasm|spindle microtubule|spindle pole centrosome	ATP binding|protein kinase binding|protein serine/threonine kinase activity			lung(3)|ovary(2)|breast(1)|large_intestine(1)|skin(1)	8			Colorectal(105;0.202)			TTAACAGGTCCTGAAATGCAG	0.383													42	89	---	---	---	---	capture	Missense_Mutation	SNP	54963223	54963223	AURKA	20	C	T	T	T	1	0	0	0	0	1	0	0	0	312	24	2	2	1211	284
MORC3	23515	broad.mit.edu	37	21	37732374	37732374	+	Missense_Mutation	SNP	A	G	G			TCGA-76-6660-01	TCGA-76-6660-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:37732374A>G	uc002yvi.2	+	11	1406	c.1330A>G	c.(1330-1332)AGA>GGA	p.R444G		NM_015358	NP_056173	Q14149	MORC3_HUMAN	MORC family CW-type zinc finger 3	444	CW-type.				cell aging|maintenance of protein location in nucleus|negative regulation of fibroblast proliferation|peptidyl-serine phosphorylation|protein stabilization	aggresome|intermediate filament cytoskeleton|PML body	ATP binding|zinc ion binding			ovary(2)	2						CCCACAGTTCAGGTACCATAG	0.433													3	114	---	---	---	---	capture	Missense_Mutation	SNP	37732374	37732374	MORC3	21	A	G	G	G	1	0	0	0	0	1	0	0	0	88	7	3	3	9615	284
SH3BGR	6450	broad.mit.edu	37	21	40883645	40883645	+	Silent	SNP	C	T	T			TCGA-76-6660-01	TCGA-76-6660-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:40883645C>T	uc002yya.2	+	6	717	c.663C>T	c.(661-663)GCC>GCT	p.A221A	SH3BGR_uc002yxz.2_Silent_p.A110A	NM_007341	NP_031367	P55822	SH3BG_HUMAN	SH3-binding domain and glutamic acid-rich	221	Glu-rich (acidic).				protein complex assembly	cytosol	SH3 domain binding|SH3/SH2 adaptor activity				0		all_cancers(19;1.16e-23)|all_epithelial(19;1.22e-20)|Prostate(19;2.55e-06)|Breast(209;0.0133)		STAD - Stomach adenocarcinoma(101;0.00151)		AAGGGGAAGCCGAGGAGGAGG	0.448													43	84	---	---	---	---	capture	Silent	SNP	40883645	40883645	SH3BGR	21	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	14133	284
TPST2	8459	broad.mit.edu	37	22	26937392	26937392	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6660-01	TCGA-76-6660-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr22:26937392G>A	uc003acv.2	-	2	373	c.205C>T	c.(205-207)CCG>TCG	p.P69S	TPST2_uc003acw.2_Missense_Mutation_p.P69S|TPST2_uc003acx.2_Missense_Mutation_p.P69S|TPST2_uc011akf.1_Missense_Mutation_p.P69S	NM_003595	NP_003586	O60704	TPST2_HUMAN	tyrosylprotein sulfotransferase 2	69	Lumenal (Potential).				peptidyl-tyrosine sulfation	endoplasmic reticulum|Golgi membrane|integral to membrane|membrane fraction	protein-tyrosine sulfotransferase activity			central_nervous_system(1)	1						AAGATGAGCGGCATGGCCTTG	0.701													3	36	---	---	---	---	capture	Missense_Mutation	SNP	26937392	26937392	TPST2	22	G	A	A	A	1	0	0	0	0	1	0	0	0	546	42	2	2	16311	284
CNTN4	152330	broad.mit.edu	37	3	3076439	3076439	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6660-01	TCGA-76-6660-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:3076439C>T	uc003bpc.2	+	16	2128	c.1907C>T	c.(1906-1908)ACT>ATT	p.T636I	CNTN4_uc003bpb.1_Missense_Mutation_p.T307I|CNTN4_uc003bpd.1_Missense_Mutation_p.T636I|CNTN4_uc003bpe.2_Missense_Mutation_p.T308I|CNTN4_uc003bpf.2_Missense_Mutation_p.T307I	NM_175607	NP_783200	Q8IWV2	CNTN4_HUMAN	contactin 4 isoform a precursor	636	Fibronectin type-III 1.				axon guidance|axonal fasciculation|brain development|negative regulation of neuron differentiation|neuron cell-cell adhesion|regulation of synaptic plasticity	anchored to membrane|axon|extracellular region|plasma membrane	protein binding			large_intestine(2)|ovary(2)|lung(1)|central_nervous_system(1)|pancreas(1)	7		Ovarian(110;0.156)		Epithelial(13;0.000695)|all cancers(10;0.0047)|OV - Ovarian serous cystadenocarcinoma(96;0.01)		CAAGCCAGGACTCCATTCTCC	0.532													36	49	---	---	---	---	capture	Missense_Mutation	SNP	3076439	3076439	CNTN4	3	C	T	T	T	1	0	0	0	0	1	0	0	0	260	20	2	2	3608	284
ITIH4	3700	broad.mit.edu	37	3	52853785	52853785	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6660-01	TCGA-76-6660-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:52853785C>T	uc003dfz.2	-	16	1972	c.1936G>A	c.(1936-1938)GGA>AGA	p.G646R	ITIH4_uc011bel.1_Intron|ITIH4_uc003dfy.2_Intron|ITIH4_uc011bem.1_Missense_Mutation_p.G651R|ITIH4_uc011ben.1_Intron	NM_002218	NP_002209	Q14624	ITIH4_HUMAN	inter-alpha (globulin) inhibitor H4	646					acute-phase response|hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity			ovary(2)|central_nervous_system(1)	3				BRCA - Breast invasive adenocarcinoma(193;7e-05)|Kidney(197;0.000656)|KIRC - Kidney renal clear cell carcinoma(197;0.000794)|OV - Ovarian serous cystadenocarcinoma(275;0.0496)		CTATTCCATCCTCTTCTTGGA	0.547													10	222	---	---	---	---	capture	Missense_Mutation	SNP	52853785	52853785	ITIH4	3	C	T	T	T	1	0	0	0	0	1	0	0	0	312	24	2	2	7829	284
ROBO1	6091	broad.mit.edu	37	3	78683176	78683176	+	Silent	SNP	G	A	A			TCGA-76-6660-01	TCGA-76-6660-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:78683176G>A	uc003dqe.2	-	24	3598	c.3390C>T	c.(3388-3390)GAC>GAT	p.D1130D	ROBO1_uc003dqb.2_Silent_p.D1091D|ROBO1_uc003dqc.2_Silent_p.D1030D|ROBO1_uc003dqd.2_Silent_p.D1085D|ROBO1_uc010hoh.2_Silent_p.D322D|ROBO1_uc011bgl.1_Silent_p.D702D	NM_002941	NP_002932	Q9Y6N7	ROBO1_HUMAN	roundabout 1 isoform a	1130	Cytoplasmic (Potential).				activation of caspase activity|axon midline choice point recognition|cell migration involved in sprouting angiogenesis|chemorepulsion involved in postnatal olfactory bulb interneuron migration|homophilic cell adhesion|negative regulation of chemokine-mediated signaling pathway|negative regulation of mammary gland epithelial cell proliferation|negative regulation of negative chemotaxis|positive regulation of axonogenesis|Roundabout signaling pathway	cell surface|cytoplasm|integral to plasma membrane	axon guidance receptor activity|identical protein binding|LRR domain binding			large_intestine(2)	2		Lung SC(41;0.0257)|Lung NSC(201;0.0439)		LUSC - Lung squamous cell carcinoma(21;0.008)|Epithelial(33;0.00999)|Lung(72;0.0177)|BRCA - Breast invasive adenocarcinoma(55;0.0274)		GAGGAACTGTGTCATTTGCTC	0.393													7	59	---	---	---	---	capture	Silent	SNP	78683176	78683176	ROBO1	3	G	A	A	A	1	0	0	0	0	0	0	0	1	620	48	2	2	13405	284
ARL6	84100	broad.mit.edu	37	3	97499015	97499015	+	Missense_Mutation	SNP	A	T	T			TCGA-76-6660-01	TCGA-76-6660-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:97499015A>T	uc003drv.2	+	4	449	c.136A>T	c.(136-138)AAT>TAT	p.N46Y	ARL6_uc003drw.2_RNA|ARL6_uc003dru.2_Missense_Mutation_p.N46Y|ARL6_uc010hoy.2_Missense_Mutation_p.N46Y	NM_177976	NP_816931	Q9H0F7	ARL6_HUMAN	ADP-ribosylation factor-like 6	46					cilium assembly|determination of left/right symmetry|melanosome transport|protein polymerization|protein targeting to membrane|small GTPase mediated signal transduction|visual perception|Wnt receptor signaling pathway	axonemal microtubule|cilium axoneme|cilium membrane|membrane coat|microtubule basal body	GTP binding|metal ion binding|phospholipid binding|protein binding				0		Lung NSC(201;0.0193)|Prostate(884;0.174)		LUSC - Lung squamous cell carcinoma(29;0.0118)|Lung(72;0.0189)		TCAATCTCAAAATATCCTTCC	0.308									Bardet-Biedl_syndrome				15	65	---	---	---	---	capture	Missense_Mutation	SNP	97499015	97499015	ARL6	3	A	T	T	T	1	0	0	0	0	1	0	0	0	13	1	4	4	934	284
NPHP3	27031	broad.mit.edu	37	3	132432101	132432101	+	Silent	SNP	G	A	A	rs138124482		TCGA-76-6660-01	TCGA-76-6660-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:132432101G>A	uc003epe.1	-	6	1064	c.987C>T	c.(985-987)TGC>TGT	p.C329C	NPHP3_uc003epf.1_Silent_p.C84C	NM_153240	NP_694972	Q7Z494	NPHP3_HUMAN	nephrocystin 3	329					maintenance of organ identity|negative regulation of canonical Wnt receptor signaling pathway|photoreceptor cell maintenance|regulation of Wnt receptor signaling pathway, planar cell polarity pathway|Wnt receptor signaling pathway	cilium	protein binding			ovary(1)	1						CCATTGTCTCGCACATTCTCT	0.289													21	30	---	---	---	---	capture	Silent	SNP	132432101	132432101	NPHP3	3	G	A	A	A	1	0	0	0	0	0	0	0	1	490	38	1	1	10487	284
KIAA0226	9711	broad.mit.edu	37	3	197431552	197431552	+	Silent	SNP	G	A	A			TCGA-76-6660-01	TCGA-76-6660-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:197431552G>A	uc003fyc.2	-	4	507	c.324C>T	c.(322-324)AAC>AAT	p.N108N	KIAA0226_uc003fyd.3_Silent_p.N48N|KIAA0226_uc003fye.1_5'Flank|KIAA0226_uc003fyf.2_Translation_Start_Site|KIAA0226_uc003fyg.2_Silent_p.N101N	NM_014687	NP_055502	Q92622	RUBIC_HUMAN	hypothetical protein LOC9711 isoform 2.	108	RUN.				autophagy|endocytosis|negative regulation of autophagy|negative regulation of endocytosis	early endosome|late endosome|lysosome	protein binding				0	all_cancers(143;8.26e-10)|Ovarian(172;0.0418)|Breast(254;0.0976)		Epithelial(36;2.19e-23)|all cancers(36;1.39e-21)|OV - Ovarian serous cystadenocarcinoma(49;1.21e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(93;0.0446)		TGCTCTGGTCGTTCTCGTGCA	0.567													20	22	---	---	---	---	capture	Silent	SNP	197431552	197431552	KIAA0226	3	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	8084	284
TACC3	10460	broad.mit.edu	37	4	1729779	1729779	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6660-01	TCGA-76-6660-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:1729779C>T	uc003gdo.2	+	4	758	c.650C>T	c.(649-651)CCG>CTG	p.P217L	TACC3_uc010ibz.2_Missense_Mutation_p.P217L|TACC3_uc003gdp.2_Intron	NM_006342	NP_006333	Q9Y6A5	TACC3_HUMAN	transforming, acidic coiled-coil containing	217						centrosome				ovary(1)|central_nervous_system(1)	2		Breast(71;0.212)|all_epithelial(65;0.241)	OV - Ovarian serous cystadenocarcinoma(23;0.00765)|Epithelial(3;0.0126)			GCGGAGACTCCGCACGGAGCC	0.597													26	31	---	---	---	---	capture	Missense_Mutation	SNP	1729779	1729779	TACC3	4	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	15391	284
SLIT2	9353	broad.mit.edu	37	4	20597371	20597371	+	Silent	SNP	C	T	T			TCGA-76-6660-01	TCGA-76-6660-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:20597371C>T	uc003gpr.1	+	31	3438	c.3234C>T	c.(3232-3234)GAC>GAT	p.D1078D	SLIT2_uc003gps.1_Silent_p.D1070D	NM_004787	NP_004778	O94813	SLIT2_HUMAN	slit homolog 2 precursor	1078	EGF-like 5; calcium-binding (Potential).				apoptosis involved in luteolysis|axon extension involved in axon guidance|branching morphogenesis of a tube|cell migration involved in sprouting angiogenesis|cellular response to heparin|cellular response to hormone stimulus|chemorepulsion involved in postnatal olfactory bulb interneuron migration|corticospinal neuron axon guidance through spinal cord|induction of negative chemotaxis|motor axon guidance|negative regulation of actin filament polymerization|negative regulation of cell growth|negative regulation of cellular response to growth factor stimulus|negative regulation of chemokine-mediated signaling pathway|negative regulation of endothelial cell migration|negative regulation of lamellipodium assembly|negative regulation of mononuclear cell migration|negative regulation of neutrophil chemotaxis|negative regulation of protein phosphorylation|negative regulation of retinal ganglion cell axon guidance|negative regulation of small GTPase mediated signal transduction|negative regulation of smooth muscle cell chemotaxis|negative regulation of vascular permeability|positive regulation of apoptosis|positive regulation of axonogenesis|response to cortisol stimulus|retinal ganglion cell axon guidance|Roundabout signaling pathway|ureteric bud development	cell surface|cytoplasm|extracellular space|plasma membrane	calcium ion binding|GTPase inhibitor activity|heparin binding|laminin-1 binding|protein homodimerization activity|proteoglycan binding|Roundabout binding	p.D1078D(1)		central_nervous_system(4)|skin(4)|ovary(3)	11						TCGATTTTGACGACTGCCAAG	0.468													80	123	---	---	---	---	capture	Silent	SNP	20597371	20597371	SLIT2	4	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	14632	284
PALLD	23022	broad.mit.edu	37	4	169845564	169845564	+	Nonsense_Mutation	SNP	C	T	T			TCGA-76-6660-01	TCGA-76-6660-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:169845564C>T	uc011cjx.1	+	19	3428	c.3217C>T	c.(3217-3219)CGA>TGA	p.R1073*	CBR4_uc011cjy.1_Intron|PALLD_uc003iru.2_Nonsense_Mutation_p.R1056*|PALLD_uc003irv.2_Nonsense_Mutation_p.R674*|PALLD_uc003irw.2_Nonsense_Mutation_p.R558*|PALLD_uc003irx.2_Nonsense_Mutation_p.R282*	NM_016081	NP_057165	Q8WX93	PALLD_HUMAN	palladin isoform 2	1280	Ig-like C2-type 5.|Interaction with EZR.				cytoskeleton organization	actin filament|focal adhesion|lamellipodium|nucleus|ruffle|sarcomere	actin binding|muscle alpha-actinin binding			ovary(1)	1		Prostate(90;0.00996)|Renal(120;0.0203)|Melanoma(52;0.144)		GBM - Glioblastoma multiforme(119;0.204)		CAGCACTGACCGAGTGAGGTA	0.418									Pancreatic_Cancer_Familial_Clustering_of				29	41	---	---	---	---	capture	Nonsense_Mutation	SNP	169845564	169845564	PALLD	4	C	T	T	T	1	0	0	0	0	0	1	0	0	295	23	5	1	11311	284
EDIL3	10085	broad.mit.edu	37	5	83402578	83402578	+	Missense_Mutation	SNP	G	T	T			TCGA-76-6660-01	TCGA-76-6660-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:83402578G>T	uc003kio.1	-	6	959	c.540C>A	c.(538-540)CAC>CAA	p.H180Q	EDIL3_uc003kip.1_Missense_Mutation_p.H170Q	NM_005711	NP_005702	O43854	EDIL3_HUMAN	EGF-like repeats and discoidin I-like	180	F5/8 type C 1.				cell adhesion|multicellular organismal development	extracellular region	calcium ion binding|integrin binding			skin(2)	2		Lung NSC(167;0.000121)|all_lung(232;0.000154)|Ovarian(174;0.0425)		OV - Ovarian serous cystadenocarcinoma(54;4.3e-40)|Epithelial(54;4.79e-32)|all cancers(79;1.54e-26)		AAAGAGCTCGGTGAGTAGAGG	0.418													12	184	---	---	---	---	capture	Missense_Mutation	SNP	83402578	83402578	EDIL3	5	G	T	T	T	1	0	0	0	0	1	0	0	0	568	44	4	4	4870	284
WDR36	134430	broad.mit.edu	37	5	110461398	110461398	+	Missense_Mutation	SNP	G	C	C			TCGA-76-6660-01	TCGA-76-6660-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:110461398G>C	uc003kpd.2	+	22	2728	c.2611G>C	c.(2611-2613)GAA>CAA	p.E871Q	WDR36_uc010jbu.2_RNA	NM_139281	NP_644810	Q8NI36	WDR36_HUMAN	WD repeat domain 36	871					response to stimulus|rRNA processing|visual perception	small-subunit processome				ovary(1)|skin(1)	2		all_cancers(142;2.72e-05)|all_epithelial(76;4.4e-07)|Prostate(80;0.00955)|Lung NSC(167;0.0418)|Ovarian(225;0.0443)|Colorectal(57;0.0465)|all_lung(232;0.0508)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;1.39e-08)|Epithelial(69;1.82e-07)|all cancers(49;2.04e-05)|COAD - Colon adenocarcinoma(37;0.111)		TGGGTCCATAGAAGTTATGCA	0.443													23	24	---	---	---	---	capture	Missense_Mutation	SNP	110461398	110461398	WDR36	5	G	C	C	C	1	0	0	0	0	1	0	0	0	429	33	4	4	17171	284
GABRA1	2554	broad.mit.edu	37	5	161300157	161300157	+	Nonsense_Mutation	SNP	G	A	A			TCGA-76-6660-01	TCGA-76-6660-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:161300157G>A	uc010jiw.2	+	6	758	c.290G>A	c.(289-291)TGG>TAG	p.W97*	GABRA1_uc010jix.2_Nonsense_Mutation_p.W97*|GABRA1_uc010jiy.2_Nonsense_Mutation_p.W97*|GABRA1_uc003lyx.3_Nonsense_Mutation_p.W97*|GABRA1_uc010jiz.2_Nonsense_Mutation_p.W97*|GABRA1_uc010jja.2_Nonsense_Mutation_p.W97*|GABRA1_uc010jjb.2_Nonsense_Mutation_p.W97*	NM_000806	NP_000797	P14867	GBRA1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha	97	Extracellular (Probable).				gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			ovary(2)|pancreas(1)	3	Renal(175;0.00259)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.228)	Alprazolam(DB00404)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ethanol(DB00898)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Flumazenil(DB01205)|Flurazepam(DB00690)|Halazepam(DB00801)|Halothane(DB01159)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Metharbital(DB00463)|Methohexital(DB00474)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Picrotoxin(DB00466)|Prazepam(DB01588)|Primidone(DB00794)|Progabide(DB00837)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Thiamylal(DB01154)|Thiopental(DB00599)|Topiramate(DB00273)|Zaleplon(DB00962)|Zolpidem(DB00425)	CGTCAAAGCTGGAAGGATGAA	0.363													4	173	---	---	---	---	capture	Nonsense_Mutation	SNP	161300157	161300157	GABRA1	5	G	A	A	A	1	0	0	0	0	0	1	0	0	611	47	5	2	6102	284
N4BP3	23138	broad.mit.edu	37	5	177547670	177547670	+	Silent	SNP	C	T	T			TCGA-76-6660-01	TCGA-76-6660-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:177547670C>T	uc003mik.1	+	3	1069	c.822C>T	c.(820-822)GGC>GGT	p.G274G	N4BP3_uc003mil.1_5'Flank	NM_015111	NP_055926	O15049	N4BP3_HUMAN	Nedd4 binding protein 3	274						cytoplasmic vesicle membrane					0	all_cancers(89;0.00294)|Renal(175;0.000269)|Lung NSC(126;0.00858)|all_lung(126;0.0139)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GGGGCCTTGGCGATGAGGACG	0.662													9	21	---	---	---	---	capture	Silent	SNP	177547670	177547670	N4BP3	5	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	10023	284
BTN2A2	10385	broad.mit.edu	37	6	26385257	26385257	+	Missense_Mutation	SNP	G	A	A	rs143653188	byFrequency	TCGA-76-6660-01	TCGA-76-6660-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:26385257G>A	uc003nhq.2	+	3	195	c.109G>A	c.(109-111)GTG>ATG	p.V37M	BTN2A2_uc011dkf.1_Intron|BTN2A2_uc011dkg.1_Missense_Mutation_p.V37M|BTN2A2_uc003nhr.2_Intron|BTN2A2_uc011dkh.1_Intron|BTN2A2_uc003nhs.2_Missense_Mutation_p.V37M|BTN2A2_uc003nht.2_Missense_Mutation_p.V37M	NM_006995	NP_008926	Q8WVV5	BT2A2_HUMAN	butyrophilin, subfamily 2, member A2 isoform a	37	Extracellular (Potential).|Ig-like V-type.				negative regulation of activated T cell proliferation|negative regulation of cellular metabolic process|negative regulation of cytokine secretion	integral to membrane					0						GTTTACTGTCGTGGGGCCAGC	0.438													33	24	---	---	---	---	capture	Missense_Mutation	SNP	26385257	26385257	BTN2A2	6	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	1549	284
CUL9	23113	broad.mit.edu	37	6	43160945	43160945	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6660-01	TCGA-76-6660-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:43160945C>T	uc003ouk.2	+	9	2462	c.2387C>T	c.(2386-2388)GCG>GTG	p.A796V	CUL9_uc003oul.2_Missense_Mutation_p.A796V|CUL9_uc010jyk.2_5'UTR	NM_015089	NP_055904	Q8IWT3	CUL9_HUMAN	p53-associated parkin-like cytoplasmic protein	796					ubiquitin-dependent protein catabolic process	cullin-RING ubiquitin ligase complex|cytoplasm	ATP binding|ubiquitin protein ligase binding|zinc ion binding	p.A796T(1)		ovary(5)|lung(3)|skin(2)|breast(1)|central_nervous_system(1)	12						GCTGGGCTGGCGGTGAGTACA	0.567													4	145	---	---	---	---	capture	Missense_Mutation	SNP	43160945	43160945	CUL9	6	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	4021	284
BCKDHB	594	broad.mit.edu	37	6	80838915	80838915	+	Silent	SNP	T	C	C			TCGA-76-6660-01	TCGA-76-6660-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:80838915T>C	uc003pjd.2	+	3	379	c.312T>C	c.(310-312)TTT>TTC	p.F104F	BCKDHB_uc003pje.2_Silent_p.F104F	NM_000056	NP_000047	P21953	ODBB_HUMAN	branched chain keto acid dehydrogenase E1 beta	104					branched chain family amino acid catabolic process	mitochondrial alpha-ketoglutarate dehydrogenase complex	3-methyl-2-oxobutanoate dehydrogenase (2-methylpropanoyl-transferring) activity|carboxy-lyase activity|protein binding				0		all_cancers(76;1.38e-05)|Acute lymphoblastic leukemia(125;1.15e-05)|all_hematologic(105;0.00118)|all_epithelial(107;0.0149)		BRCA - Breast invasive adenocarcinoma(397;0.0291)		GTGGAGTCTTTAGATGCACTG	0.259													14	100	---	---	---	---	capture	Silent	SNP	80838915	80838915	BCKDHB	6	T	C	C	C	1	0	0	0	0	0	0	0	1	790	61	3	3	1349	284
AHI1	54806	broad.mit.edu	37	6	135748441	135748441	+	Silent	SNP	T	C	C			TCGA-76-6660-01	TCGA-76-6660-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:135748441T>C	uc003qgi.2	-	20	3012	c.2628A>G	c.(2626-2628)GAA>GAG	p.E876E	AHI1_uc003qgf.2_RNA|AHI1_uc003qgg.2_Silent_p.E326E|AHI1_uc003qgh.2_Silent_p.E876E|AHI1_uc003qgj.2_Silent_p.E876E|AHI1_uc003qgk.3_RNA|AHI1_uc003qgl.3_Silent_p.E876E	NM_001134831	NP_001128303	Q8N157	AHI1_HUMAN	Abelson helper integration site 1 isoform a	876	WD 6.					adherens junction|cilium|microtubule basal body				ovary(1)|kidney(1)|central_nervous_system(1)	3	Breast(56;0.239)|Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00904)|OV - Ovarian serous cystadenocarcinoma(155;0.00991)		TGGCTACTTGTTCTCCTAAAT	0.323													20	10	---	---	---	---	capture	Silent	SNP	135748441	135748441	AHI1	6	T	C	C	C	1	0	0	0	0	0	0	0	1	777	60	3	3	413	284
RPS6KA2	6196	broad.mit.edu	37	6	166912027	166912027	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6660-01	TCGA-76-6660-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:166912027C>T	uc003qvb.1	-	8	935	c.716G>A	c.(715-717)AGT>AAT	p.S239N	RPS6KA2_uc011ego.1_Missense_Mutation_p.S150N|RPS6KA2_uc010kkl.1_Missense_Mutation_p.S150N|RPS6KA2_uc003qvc.1_Missense_Mutation_p.S247N|RPS6KA2_uc003qvd.1_Missense_Mutation_p.S264N	NM_021135	NP_066958	Q15349	KS6A2_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide	239	Protein kinase 1.				axon guidance|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|stress-activated MAPK cascade|synaptic transmission|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|magnesium ion binding|protein serine/threonine kinase activity			ovary(2)|lung(2)|skin(2)|large_intestine(1)|central_nervous_system(1)	8		Breast(66;2.04e-05)|Ovarian(120;0.0652)|Prostate(117;0.105)		OV - Ovarian serous cystadenocarcinoma(33;2.76e-18)|GBM - Glioblastoma multiforme(31;9.94e-06)|BRCA - Breast invasive adenocarcinoma(81;1.36e-05)		CCAGTCGGCACTCTGCGTGTG	0.637													14	9	---	---	---	---	capture	Missense_Mutation	SNP	166912027	166912027	RPS6KA2	6	C	T	T	T	1	0	0	0	0	1	0	0	0	260	20	2	2	13543	284
IKZF1	10320	broad.mit.edu	37	7	50358674	50358674	+	Missense_Mutation	SNP	G	T	T			TCGA-76-6660-01	TCGA-76-6660-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:50358674G>T	uc003tow.3	+	3	185	c.17G>T	c.(16-18)GGT>GTT	p.G6V	IKZF1_uc003tox.3_Missense_Mutation_p.G6V|IKZF1_uc003toy.3_Missense_Mutation_p.G6V|IKZF1_uc011kck.1_Missense_Mutation_p.G6V|IKZF1_uc003tov.1_Missense_Mutation_p.G6V	NM_006060	NP_006051	Q13422	IKZF1_HUMAN	zinc finger protein, subfamily 1A, 1 (Ikaros)	6					cell cycle|chromatin modification|mesoderm development	cytoplasm|nucleus	zinc ion binding	p.?(24)		haematopoietic_and_lymphoid_tissue(147)|lung(1)	148	Glioma(55;0.08)|all_neural(89;0.245)	Acute lymphoblastic leukemia(4;7.29e-10)|all_hematologic(4;4.8e-07)				GCTGATGAGGGTCAAGACATG	0.433			D		ALL								44	204	---	---	---	---	capture	Missense_Mutation	SNP	50358674	50358674	IKZF1	7	G	T	T	T	1	0	0	0	0	1	0	0	0	572	44	4	4	7537	284
SEPT14	346288	broad.mit.edu	37	7	55912359	55912359	+	Silent	SNP	G	A	A			TCGA-76-6660-01	TCGA-76-6660-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:55912359G>A	uc003tqz.2	-	4	345	c.228C>T	c.(226-228)AAC>AAT	p.N76N		NM_207366	NP_997249	Q6ZU15	SEP14_HUMAN	septin 14	76					cell cycle|cell division	septin complex	GTP binding|protein binding				0	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			TATCTTTCAAGTTAGTATTAA	0.353													37	78	---	---	---	---	capture	Silent	SNP	55912359	55912359	SEPT14	7	G	A	A	A	1	0	0	0	0	0	0	0	1	464	36	2	2	13956	284
EIF4H	7458	broad.mit.edu	37	7	73609098	73609098	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6660-01	TCGA-76-6660-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:73609098G>A	uc003uad.1	+	6	505	c.497G>A	c.(496-498)AGG>AAG	p.R166K	RFC2_uc011kfa.1_Intron|EIF4H_uc010lbm.2_Intron|EIF4H_uc003uae.1_Missense_Mutation_p.R146K|EIF4H_uc003uaf.1_RNA	NM_022170	NP_071496	Q15056	IF4H_HUMAN	eukaryotic translation initiation factor 4H	166					interspecies interaction between organisms|regulation of translational initiation	cytosol|eukaryotic translation initiation factor 4F complex|perinuclear region of cytoplasm	nucleotide binding|protein binding|translation initiation factor activity				0						TTAGGGGGCAGGGGAGGTAGT	0.542													32	174	---	---	---	---	capture	Missense_Mutation	SNP	73609098	73609098	EIF4H	7	G	A	A	A	1	0	0	0	0	1	0	0	0	455	35	2	2	4994	284
MUC17	140453	broad.mit.edu	37	7	100683326	100683326	+	Missense_Mutation	SNP	A	G	G			TCGA-76-6660-01	TCGA-76-6660-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:100683326A>G	uc003uxp.1	+	3	8682	c.8629A>G	c.(8629-8631)AGC>GGC	p.S2877G	MUC17_uc010lho.1_RNA	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN	mucin 17 precursor	2877	Extracellular (Potential).|Ser-rich.|59 X approximate tandem repeats.|46.					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity			ovary(14)|skin(8)|breast(3)|lung(2)	27	Lung NSC(181;0.136)|all_lung(186;0.182)					TATACCTGTCAGCACCACGCC	0.478													98	499	---	---	---	---	capture	Missense_Mutation	SNP	100683326	100683326	MUC17	7	A	G	G	G	1	0	0	0	0	1	0	0	0	91	7	3	3	9884	284
RELN	5649	broad.mit.edu	37	7	103338368	103338368	+	Missense_Mutation	SNP	C	T	T	rs114926265	byFrequency;by1000genomes	TCGA-76-6660-01	TCGA-76-6660-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:103338368C>T	uc003vca.2	-	10	1235	c.1075G>A	c.(1075-1077)GTT>ATT	p.V359I	RELN_uc010liz.2_Missense_Mutation_p.V359I	NM_005045	NP_005036	P78509	RELN_HUMAN	reelin isoform a	359					axon guidance|cell adhesion|cerebral cortex tangential migration|glial cell differentiation|neuron migration|peptidyl-tyrosine phosphorylation|positive regulation of protein kinase activity|positive regulation of small GTPase mediated signal transduction|response to pain|spinal cord patterning	cytoplasm|dendrite|extracellular space|proteinaceous extracellular matrix	metal ion binding|protein serine/threonine/tyrosine kinase activity|serine-type peptidase activity			ovary(8)|upper_aerodigestive_tract(5)|large_intestine(2)|central_nervous_system(2)|skin(1)|pancreas(1)	19				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		TCTTCTAAAACGACTTGTCTG	0.428													27	108	---	---	---	---	capture	Missense_Mutation	SNP	103338368	103338368	RELN	7	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	13115	284
SLC26A3	1811	broad.mit.edu	37	7	107415299	107415299	+	Nonsense_Mutation	SNP	G	A	A			TCGA-76-6660-01	TCGA-76-6660-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:107415299G>A	uc003ver.2	-	16	1907	c.1696C>T	c.(1696-1698)CGA>TGA	p.R566*	SLC26A3_uc003ves.2_Nonsense_Mutation_p.R531*	NM_000111	NP_000102	P40879	S26A3_HUMAN	solute carrier family 26, member 3	566	STAS.				excretion	integral to membrane|membrane fraction	inorganic anion exchanger activity|secondary active sulfate transmembrane transporter activity|sequence-specific DNA binding transcription factor activity|transcription cofactor activity			ovary(3)|skin(1)	4						CGTAGAATTCGAAGTGGACTA	0.398													50	80	---	---	---	---	capture	Nonsense_Mutation	SNP	107415299	107415299	SLC26A3	7	G	A	A	A	1	0	0	0	0	0	1	0	0	480	37	5	1	14410	284
PPP1R3A	5506	broad.mit.edu	37	7	113558926	113558926	+	Missense_Mutation	SNP	A	C	C			TCGA-76-6660-01	TCGA-76-6660-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:113558926A>C	uc010ljy.1	-	1	157	c.126T>G	c.(124-126)AGT>AGG	p.S42R		NM_002711	NP_002702	Q16821	PPR3A_HUMAN	protein phosphatase 1, regulatory (inhibitor)	42					glycogen metabolic process	integral to membrane				lung(9)|ovary(9)|pancreas(7)|skin(6)|breast(2)|prostate(1)	34						AACCTCGTCTACTTGGTTGAG	0.373													11	121	---	---	---	---	capture	Missense_Mutation	SNP	113558926	113558926	PPP1R3A	7	A	C	C	C	1	0	0	0	0	1	0	0	0	180	14	4	4	12272	284
IMPDH1	3614	broad.mit.edu	37	7	128034510	128034510	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6660-01	TCGA-76-6660-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:128034510C>T	uc011kol.1	-	12	1545	c.1439G>A	c.(1438-1440)CGG>CAG	p.R480Q	IMPDH1_uc011kom.1_Missense_Mutation_p.R475Q|IMPDH1_uc003vmt.2_Missense_Mutation_p.R455Q|IMPDH1_uc003vmu.2_Missense_Mutation_p.R565Q|IMPDH1_uc003vmw.2_Missense_Mutation_p.R555Q|IMPDH1_uc011kon.1_Missense_Mutation_p.R532Q|IMPDH1_uc003vmv.2_Missense_Mutation_p.R529Q|IMPDH1_uc003vmx.2_Missense_Mutation_p.R488Q|IMPDH1_uc003vmy.2_Missense_Mutation_p.R496Q|uc011koo.1_5'Flank	NM_001142573	NP_001136045	P20839	IMDH1_HUMAN	inosine monophosphate dehydrogenase 1 isoform e	480					GMP biosynthetic process|purine base metabolic process	cytosol|nucleus	DNA binding|IMP dehydrogenase activity|metal ion binding			skin(2)|lung(1)|central_nervous_system(1)	4					Mycophenolate mofetil(DB00688)|Mycophenolic acid(DB01024)|NADH(DB00157)|Ribavirin(DB00811)|Thioguanine(DB00352)	CAGCACTCACCGAAGGACAGA	0.582													7	69	---	---	---	---	capture	Missense_Mutation	SNP	128034510	128034510	IMPDH1	7	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	7649	284
KCNB2	9312	broad.mit.edu	37	8	73849104	73849104	+	Missense_Mutation	SNP	A	T	T			TCGA-76-6660-01	TCGA-76-6660-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:73849104A>T	uc003xzb.2	+	3	2102	c.1514A>T	c.(1513-1515)AAC>ATC	p.N505I		NM_004770	NP_004761	Q92953	KCNB2_HUMAN	potassium voltage-gated channel, Shab-related	505	Cytoplasmic (Potential).				regulation of smooth muscle contraction	voltage-gated potassium channel complex	delayed rectifier potassium channel activity|protein binding			skin(3)|large_intestine(1)|pancreas(1)|ovary(1)|central_nervous_system(1)	7	Breast(64;0.137)		Epithelial(68;0.105)			ACAAGCTCCAACAAGTCTTTC	0.562													50	71	---	---	---	---	capture	Missense_Mutation	SNP	73849104	73849104	KCNB2	8	A	T	T	T	1	0	0	0	0	1	0	0	0	26	2	4	4	7935	284
CSMD3	114788	broad.mit.edu	37	8	113256734	113256734	+	Missense_Mutation	SNP	C	G	G			TCGA-76-6660-01	TCGA-76-6660-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:113256734C>G	uc003ynu.2	-	65	10450	c.10291G>C	c.(10291-10293)GGG>CGG	p.G3431R	CSMD3_uc003yns.2_Missense_Mutation_p.G2633R|CSMD3_uc003ynt.2_Missense_Mutation_p.G3391R|CSMD3_uc011lhx.1_Missense_Mutation_p.G3262R	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	3431	Extracellular (Potential).|Sushi 28.					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						AGTGTATACCCATGAGATGGA	0.428										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			24	36	---	---	---	---	capture	Missense_Mutation	SNP	113256734	113256734	CSMD3	8	C	G	G	G	1	0	0	0	0	1	0	0	0	273	21	4	4	3911	284
GPR20	2843	broad.mit.edu	37	8	142367058	142367058	+	Silent	SNP	G	A	A			TCGA-76-6660-01	TCGA-76-6660-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:142367058G>A	uc003ywf.2	-	2	1055	c.966C>T	c.(964-966)AGC>AGT	p.S322S		NM_005293	NP_005284	Q99678	GPR20_HUMAN	G protein-coupled receptor 20	322	Cytoplasmic (Potential).					integral to plasma membrane	G-protein coupled receptor activity			upper_aerodigestive_tract(1)	1	all_cancers(97;4.32e-16)|all_epithelial(106;6.61e-14)|Lung NSC(106;9.4e-06)|all_lung(105;1.35e-05)|Ovarian(258;0.0303)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0415)			CCACGTCACCGCTGCTGGGCT	0.657													28	27	---	---	---	---	capture	Silent	SNP	142367058	142367058	GPR20	8	G	A	A	A	1	0	0	0	0	0	0	0	1	490	38	1	1	6614	284
TMEM2	23670	broad.mit.edu	37	9	74319626	74319626	+	Nonsense_Mutation	SNP	G	A	A			TCGA-76-6660-01	TCGA-76-6660-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:74319626G>A	uc011lsa.1	-	18	3619	c.3079C>T	c.(3079-3081)CAG>TAG	p.Q1027*	TMEM2_uc011lrz.1_Nonsense_Mutation_p.Q20*|TMEM2_uc010mos.2_Nonsense_Mutation_p.Q964*|TMEM2_uc011lsb.1_RNA	NM_013390	NP_037522	Q9UHN6	TMEM2_HUMAN	transmembrane protein 2 isoform a	1027						integral to membrane				ovary(2)	2		all_epithelial(88;4.56e-14)|Myeloproliferative disorder(762;0.0255)		GBM - Glioblastoma multiforme(74;7.45e-21)|OV - Ovarian serous cystadenocarcinoma(323;1.02e-16)		GCAGCCTTCTGATTAATACCT	0.483													63	53	---	---	---	---	capture	Nonsense_Mutation	SNP	74319626	74319626	TMEM2	9	G	A	A	A	1	0	0	0	0	0	1	0	0	585	45	5	2	16004	284
ZNF883	169834	broad.mit.edu	37	9	115760403	115760403	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6660-01	TCGA-76-6660-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:115760403C>T	uc011lwy.1	-	5	1376	c.137G>A	c.(136-138)TGT>TAT	p.C46Y		NM_001101338	NP_001094808	P0CG24	ZN883_HUMAN	hypothetical protein LOC169834	46	C2H2-type 2.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						GGACTTACCACATATTTTACA	0.373													55	36	---	---	---	---	capture	Missense_Mutation	SNP	115760403	115760403	ZNF883	9	C	T	T	T	1	0	0	0	0	1	0	0	0	221	17	2	2	18074	284
ZNF883	169834	broad.mit.edu	37	9	115760511	115760511	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6660-01	TCGA-76-6660-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:115760511G>A	uc011lwy.1	-	5	1268	c.29C>T	c.(28-30)GCG>GTG	p.A10V		NM_001101338	NP_001094808	P0CG24	ZN883_HUMAN	hypothetical protein LOC169834	10					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						ATATGGGTTCGCGGTCATATA	0.368													106	86	---	---	---	---	capture	Missense_Mutation	SNP	115760511	115760511	ZNF883	9	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	18074	284
PRPF4	9128	broad.mit.edu	37	9	116038922	116038922	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6660-01	TCGA-76-6660-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:116038922G>A	uc004bgx.2	+	2	175	c.125G>A	c.(124-126)CGT>CAT	p.R42H	FKBP15_uc010muu.1_5'Flank|CDC26_uc004bgw.2_5'Flank|PRPF4_uc004bgy.2_Missense_Mutation_p.R41H	NM_004697	NP_004688	O43172	PRP4_HUMAN	PRP4 pre-mRNA processing factor 4 homolog	42						Cajal body|nuclear speck|spliceosomal complex|U4/U6 snRNP	protein binding			ovary(2)|pancreas(1)	3						GAGAGGGAGCGTCTGGCCAAA	0.458													145	103	---	---	---	---	capture	Missense_Mutation	SNP	116038922	116038922	PRPF4	9	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	12466	284
PKN3	29941	broad.mit.edu	37	9	131482499	131482499	+	Silent	SNP	G	A	A			TCGA-76-6660-01	TCGA-76-6660-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:131482499G>A	uc004bvw.2	+	21	2787	c.2394G>A	c.(2392-2394)CCG>CCA	p.P798P	PKN3_uc010myh.2_Silent_p.P798P|PKN3_uc011mbk.1_Silent_p.P348P	NM_013355	NP_037487	Q6P5Z2	PKN3_HUMAN	protein kinase PKNbeta	798	Protein kinase.				signal transduction	Golgi apparatus|nucleus|perinuclear region of cytoplasm	ATP binding|protein binding|protein kinase C activity			stomach(2)|lung(2)	4						AGAAGTGCCCGGAGAAGCGCC	0.657													16	45	---	---	---	---	capture	Silent	SNP	131482499	131482499	PKN3	9	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	11884	284
KCNT1	57582	broad.mit.edu	37	9	138662162	138662162	+	Silent	SNP	G	A	A	rs138352399	byFrequency	TCGA-76-6660-01	TCGA-76-6660-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:138662162G>A	uc011mdq.1	+	17	1712	c.1638G>A	c.(1636-1638)CCG>CCA	p.P546P	KCNT1_uc011mdr.1_Silent_p.P373P|KCNT1_uc010nbf.2_Silent_p.P501P|KCNT1_uc004cgo.1_Silent_p.P295P	NM_020822	NP_065873	Q5JUK3	KCNT1_HUMAN	potassium channel, subfamily T, member 1	546						membrane	binding|calcium-activated potassium channel activity			large_intestine(2)|ovary(1)|pancreas(1)	4		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;2.11e-07)|Epithelial(140;1.57e-06)|all cancers(34;9.22e-05)		AGGAGTCTCCGGAGCAGTGGC	0.682													52	25	---	---	---	---	capture	Silent	SNP	138662162	138662162	KCNT1	9	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	8013	284
WWC3	55841	broad.mit.edu	37	X	10058926	10058926	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6660-01	TCGA-76-6660-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:10058926C>T	uc004csx.3	+	6	691	c.493C>T	c.(493-495)CGG>TGG	p.R165W	WWC3_uc010nds.2_5'UTR|WWC3_uc010ndt.2_RNA	NM_015691	NP_056506	Q9ULE0	WWC3_HUMAN	WWC family member 3	165										ovary(4)	4						GAAGGAGAGGCGGGACCTGAT	0.423													53	5	---	---	---	---	capture	Missense_Mutation	SNP	10058926	10058926	WWC3	23	C	T	T	T	1	0	0	0	0	1	0	0	0	347	27	1	1	17294	284
IGSF1	3547	broad.mit.edu	37	X	130409145	130409145	+	Silent	SNP	C	T	T			TCGA-76-6660-01	TCGA-76-6660-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:130409145C>T	uc004ewd.2	-	17	3538	c.3300G>A	c.(3298-3300)AAG>AAA	p.K1100K	IGSF1_uc004ewe.3_Silent_p.K1094K|IGSF1_uc004ewf.2_Silent_p.K1080K	NM_001555	NP_001546	Q8N6C5	IGSF1_HUMAN	immunoglobulin superfamily, member 1 isoform 1	1100	Extracellular (Potential).|Ig-like C2-type 11.				regulation of transcription, DNA-dependent	extracellular region|integral to membrane	inhibin beta-A binding|inhibin beta-B binding			ovary(3)|lung(1)|central_nervous_system(1)	5						GAGCCCCCTCCTTCAACAGGA	0.547													215	23	---	---	---	---	capture	Silent	SNP	130409145	130409145	IGSF1	23	C	T	T	T	1	0	0	0	0	0	0	0	1	311	24	2	2	7520	284
MAGEC1	9947	broad.mit.edu	37	X	140995944	140995944	+	Silent	SNP	T	C	C			TCGA-76-6660-01	TCGA-76-6660-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:140995944T>C	uc004fbt.2	+	4	3040	c.2754T>C	c.(2752-2754)TTT>TTC	p.F918F	MAGEC1_uc010nsl.1_5'UTR	NM_005462	NP_005453	O60732	MAGC1_HUMAN	melanoma antigen family C, 1	918	MAGE.						protein binding			ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4	Acute lymphoblastic leukemia(192;6.56e-05)					TGGCGCGGTTTCTTCTCCTCA	0.483										HNSCC(15;0.026)			219	28	---	---	---	---	capture	Silent	SNP	140995944	140995944	MAGEC1	23	T	C	C	C	1	0	0	0	0	0	0	0	1	803	62	3	3	9094	284
CDAN1	146059	broad.mit.edu	37	15	43028860	43028860	+	Frame_Shift_Del	DEL	G	-	-			TCGA-76-6660-01	TCGA-76-6660-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:43028860delG	uc001zql.2	-	2	326	c.209delC	c.(208-210)CCGfs	p.P70fs	CDAN1_uc001zqk.2_5'Flank|CDAN1_uc010bcx.1_5'Flank|uc001zqm.2_5'Flank	NM_138477	NP_612486	Q8IWY9	CDAN1_HUMAN	codanin 1	70						integral to membrane	protein binding			ovary(2)	2		all_cancers(109;5.4e-16)|all_epithelial(112;2.97e-14)|Lung NSC(122;1.75e-08)|all_lung(180;5.99e-08)|Melanoma(134;0.0179)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;2.49e-07)		GGCGGGGGTCGGGGGCCCCTG	0.736													2	4	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	43028860	43028860	CDAN1	15	G	-	-	-	1	0	1	0	1	0	0	0	0	507	39	5	5	3025	284
CHD9	80205	broad.mit.edu	37	16	53338029	53338037	+	In_Frame_Del	DEL	TAAAGGTAT	-	-			TCGA-76-6660-01	TCGA-76-6660-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:53338029_53338037delTAAAGGTAT	uc002ehb.2	+	30	6275_6283	c.6111_6119delTAAAGGTAT	c.(6109-6120)GCTAAAGGTATT>GCT	p.KGI2038del	CHD9_uc002egy.2_In_Frame_Del_p.KGI2038del|CHD9_uc002ehc.2_In_Frame_Del_p.KGI2038del|CHD9_uc002ehf.2_In_Frame_Del_p.KGI1152del|CHD9_uc010cbw.2_Intron|CHD9_uc002ehg.1_In_Frame_Del_p.KGI44del	NM_025134	NP_079410	Q3L8U1	CHD9_HUMAN	chromodomain helicase DNA binding protein 9	2038_2040					cellular lipid metabolic process|chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleoplasm	ATP binding|DNA binding|helicase activity|protein binding			lung(2)|central_nervous_system(1)|breast(1)|skin(1)|ovary(1)|kidney(1)	7		all_cancers(37;0.0212)				TCCTAGATGCTAAAGGTATTATTCTAGAG	0.407													21	50	---	---	---	---	capture_indel	In_Frame_Del	DEL	53338029	53338037	CHD9	16	TAAAGGTAT	-	-	-	1	0	1	0	1	0	0	0	0	678	53	5	5	3298	284
CDC27	996	broad.mit.edu	37	17	45219612	45219612	+	Frame_Shift_Del	DEL	A	-	-			TCGA-76-6660-01	TCGA-76-6660-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:45219612delA	uc002ild.3	-	11	1488	c.1361delT	c.(1360-1362)CTAfs	p.L454fs	CDC27_uc002ile.3_Frame_Shift_Del_p.L460fs|CDC27_uc002ilf.3_Frame_Shift_Del_p.L454fs|CDC27_uc010wkp.1_Frame_Shift_Del_p.L393fs|CDC27_uc010wkq.1_Intron	NM_001256	NP_001247	P30260	CDC27_HUMAN	cell division cycle protein 27 isoform 2	454					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell proliferation|mitotic cell cycle spindle assembly checkpoint|mitotic metaphase/anaphase transition|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination	anaphase-promoting complex|centrosome|cytosol|nucleoplasm|spindle microtubule	protein phosphatase binding			lung(2)|breast(2)|ovary(1)	5						TGCTTTTTGTAGATTAAAGGC	0.308													7	47	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	45219612	45219612	CDC27	17	A	-	-	-	1	0	1	0	1	0	0	0	0	195	15	5	5	3037	284
BCL2	596	broad.mit.edu	37	18	60795928	60795929	+	Frame_Shift_Del	DEL	AG	-	-			TCGA-76-6660-01	TCGA-76-6660-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:60795928_60795929delAG	uc002lit.1	-	3	1142_1143	c.649_650delCT	c.(649-651)CTGfs	p.L217fs	BCL2_uc002liu.1_Frame_Shift_Del_p.L217fs	NM_000633	NP_000624	P10415	BCL2_HUMAN	B-cell lymphoma protein 2 alpha isoform	217	Helical; (Potential).				activation of pro-apoptotic gene products|anti-apoptosis|apoptosis in response to endoplasmic reticulum stress|B cell proliferation|B cell receptor signaling pathway|defense response to virus|female pregnancy|humoral immune response|induction of apoptosis by intracellular signals|negative regulation of cellular pH reduction|negative regulation of mitochondrial depolarization|negative regulation of neuron apoptosis|neuron apoptosis|positive regulation of B cell proliferation|positive regulation of cell growth|protein polyubiquitination|regulation of mitochondrial membrane permeability|regulation of mitochondrial membrane potential|regulation of protein heterodimerization activity|regulation of protein homodimerization activity|regulation of transmembrane transporter activity|release of cytochrome c from mitochondria|response to cytokine stimulus|response to DNA damage stimulus|response to drug|response to iron ion|response to nicotine|response to toxin	endoplasmic reticulum membrane|mitochondrial outer membrane|nuclear membrane|pore complex	BH3 domain binding|channel activity|protease binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding|ubiquitin protein ligase binding			central_nervous_system(1)	1		all_hematologic(56;1.18e-20)|Prostate(75;0.0872)		Lung(128;0.0234)|READ - Rectum adenocarcinoma(59;0.0935)	Docetaxel(DB01248)|Fludarabine(DB01073)|Melatonin(DB01065)|Paclitaxel(DB01229)|Rasagiline(DB01367)	CAGAGTCTTCAGAGACAGCCAG	0.545			T	IGH@	NHL|CLL								23	23	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	60795928	60795929	BCL2	18	AG	-	-	-	1	0	1	0	1	0	0	0	0	91	7	5	5	1354	284
ZNF433	163059	broad.mit.edu	37	19	12126556	12126556	+	Frame_Shift_Del	DEL	A	-	-			TCGA-76-6660-01	TCGA-76-6660-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:12126556delA	uc002msy.1	-	4	1297	c.1126delT	c.(1126-1128)TATfs	p.Y376fs	uc002msx.1_Intron|ZNF433_uc002msz.1_Frame_Shift_Del_p.Y341fs	NM_001080411	NP_001073880	Q8N7K0	ZN433_HUMAN	zinc finger protein 433	376	C2H2-type 9.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						CTGGGAGAATAAAAGGCTTTC	0.373													38	77	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	12126556	12126556	ZNF433	19	A	-	-	-	1	0	1	0	1	0	0	0	0	169	13	5	5	17787	284
CCDC141	285025	broad.mit.edu	37	2	179720232	179720232	+	Frame_Shift_Del	DEL	T	-	-			TCGA-76-6660-01	TCGA-76-6660-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179720232delT	uc002unf.1	-	9	1234	c.1177delA	c.(1177-1179)ACCfs	p.T393fs		NM_173648	NP_775919	Q6ZP82	CC141_HUMAN	coiled-coil domain containing 141	393	Potential.						protein binding			ovary(7)|pancreas(2)|skin(1)	10			OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.0531)|all cancers(119;0.147)			GAATCAGAGGTTTTATTACTA	0.284													37	51	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	179720232	179720232	CCDC141	2	T	-	-	-	1	0	1	0	1	0	0	0	0	780	60	5	5	2749	284
