Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
OXCT2	64064	broad.mit.edu	37	1	40235523	40235523	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6661-01	TCGA-76-6661-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:40235523C>T	uc001ceb.1	-	1	1498	c.1405G>A	c.(1405-1407)GAG>AAG	p.E469K	BMP8B_uc001cdz.1_Intron|BMP8B_uc001cea.1_Intron|OXCT2_uc009vvu.1_Missense_Mutation_p.E463K	NM_022120	NP_071403	Q9BYC2	SCOT2_HUMAN	3-oxoacid CoA transferase 2 precursor	469					ketone body catabolic process	microtubule-based flagellum|mitochondrion	3-oxoacid CoA-transferase activity			pancreas(1)	1	all_cancers(7;5.56e-14)|all_lung(5;3.88e-17)|all_epithelial(6;3.78e-16)|Lung NSC(20;7.03e-07)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	OV - Ovarian serous cystadenocarcinoma(33;1.87e-18)|Epithelial(16;1.92e-17)|all cancers(16;4.03e-16)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)		Succinic acid(DB00139)	ACGGCCTTCTCGGTGATGATG	0.592													30	51	---	---	---	---	capture	Missense_Mutation	SNP	40235523	40235523	OXCT2	1	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	11234	285
DMRTB1	63948	broad.mit.edu	37	1	53930361	53930361	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6661-01	TCGA-76-6661-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:53930361C>T	uc001cvq.1	+	3	857	c.802C>T	c.(802-804)CCG>TCG	p.P268S		NM_033067	NP_149056	Q96MA1	DMRTB_HUMAN	DMRT-like family B with proline-rich C-terminal,	268	Pro-rich.				sex differentiation	nucleus	DNA binding|metal ion binding|sequence-specific DNA binding transcription factor activity			ovary(1)|skin(1)	2						gccgccgccgccgccgccact	0.557													13	45	---	---	---	---	capture	Missense_Mutation	SNP	53930361	53930361	DMRTB1	1	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	4548	285
SELE	6401	broad.mit.edu	37	1	169698648	169698648	+	Silent	SNP	G	A	A			TCGA-76-6661-01	TCGA-76-6661-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:169698648G>A	uc001ggm.3	-	6	1039	c.882C>T	c.(880-882)AAC>AAT	p.N294N	C1orf112_uc001ggj.2_Intron	NM_000450	NP_000441	P16581	LYAM2_HUMAN	selectin E precursor	294	Sushi 2.|Extracellular (Potential).				actin filament-based process|activation of phospholipase C activity|calcium-mediated signaling|heterophilic cell-cell adhesion|leukocyte migration involved in inflammatory response|leukocyte tethering or rolling|positive regulation of receptor internalization|regulation of inflammatory response|response to interleukin-1|response to lipopolysaccharide|response to tumor necrosis factor	caveola|coated pit|cortical cytoskeleton|extracellular space|integral to membrane|perinuclear region of cytoplasm	oligosaccharide binding|phospholipase binding|sialic acid binding|transmembrane receptor activity			ovary(3)|skin(2)	5	all_hematologic(923;0.208)					TTGGCTTCTCGTTGTCCCAAT	0.458													43	72	---	---	---	---	capture	Silent	SNP	169698648	169698648	SELE	1	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	13906	285
USH2A	7399	broad.mit.edu	37	1	215931985	215931985	+	Missense_Mutation	SNP	T	C	C			TCGA-76-6661-01	TCGA-76-6661-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:215931985T>C	uc001hku.1	-	58	11728	c.11341A>G	c.(11341-11343)ATC>GTC	p.I3781V		NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	3781	Fibronectin type-III 23.|Extracellular (Potential).				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		ATTACTGTGATATTATATGGA	0.353										HNSCC(13;0.011)			33	51	---	---	---	---	capture	Missense_Mutation	SNP	215931985	215931985	USH2A	1	T	C	C	C	1	0	0	0	0	1	0	0	0	637	49	3	3	16918	285
OR2T4	127074	broad.mit.edu	37	1	248525822	248525822	+	Missense_Mutation	SNP	A	T	T			TCGA-76-6661-01	TCGA-76-6661-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:248525822A>T	uc001ieh.1	+	1	940	c.940A>T	c.(940-942)ACT>TCT	p.T314S		NM_001004696	NP_001004696	Q8NH00	OR2T4_HUMAN	olfactory receptor, family 2, subfamily T,	314	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			TACCATCCTCACTCCAGTGGT	0.463													35	141	---	---	---	---	capture	Missense_Mutation	SNP	248525822	248525822	OR2T4	1	A	T	T	T	1	0	0	0	0	1	0	0	0	78	6	4	4	10931	285
GRID1	2894	broad.mit.edu	37	10	87628864	87628864	+	Missense_Mutation	SNP	A	G	G			TCGA-76-6661-01	TCGA-76-6661-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:87628864A>G	uc001kdl.1	-	6	955	c.854T>C	c.(853-855)TTT>TCT	p.F285S	GRID1_uc009xsu.1_RNA	NM_017551	NP_060021	Q9ULK0	GRID1_HUMAN	glutamate receptor, ionotropic, delta 1	285	Extracellular (Potential).					cell junction|integral to membrane|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|ionotropic glutamate receptor activity			ovary(5)|upper_aerodigestive_tract(2)|large_intestine(2)|central_nervous_system(1)	10					L-Glutamic Acid(DB00142)	TGCAGACGGAAAGATTTGCCG	0.542										Multiple Myeloma(13;0.14)			50	26	---	---	---	---	capture	Missense_Mutation	SNP	87628864	87628864	GRID1	10	A	G	G	G	1	0	0	0	0	1	0	0	0	13	1	3	3	6704	285
PTEN	5728	broad.mit.edu	37	10	89720664	89720664	+	Missense_Mutation	SNP	A	C	C			TCGA-76-6661-01	TCGA-76-6661-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:89720664A>C	uc001kfb.2	+	9	1846	c.815A>C	c.(814-816)CAC>CCC	p.H272P		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog	272	C2 tensin-type.				activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.R55fs*1(4)|p.?(2)|p.D268_F279>VGQNVSLLGKYI(2)|p.N212fs*1(2)|p.Y27fs*1(2)|p.G165_*404del(1)|p.H272Y(1)|p.G165_K342del(1)|p.H272R(1)		endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		AAAATGTTTCACTTTTGGGTA	0.244		31	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			10	4	---	---	---	---	capture	Missense_Mutation	SNP	89720664	89720664	PTEN	10	A	C	C	C	1	0	0	0	0	1	0	0	0	78	6	4	4	12633	285
KCNA4	3739	broad.mit.edu	37	11	30033088	30033088	+	Missense_Mutation	SNP	C	A	A			TCGA-76-6661-01	TCGA-76-6661-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:30033088C>A	uc001msk.2	-	2	2290	c.1138G>T	c.(1138-1140)GTA>TTA	p.V380L		NM_002233	NP_002224	P22459	KCNA4_HUMAN	potassium voltage-gated channel, shaker-related	380	Helical; Name=Segment S2; (Potential).					voltage-gated potassium channel complex	potassium ion binding|protein binding|voltage-gated potassium channel activity			ovary(2)|central_nervous_system(1)|pancreas(1)	4						GAAAACCATACAATACAGACT	0.433													28	48	---	---	---	---	capture	Missense_Mutation	SNP	30033088	30033088	KCNA4	11	C	A	A	A	1	0	0	0	0	1	0	0	0	221	17	4	4	7927	285
OR5A1	219982	broad.mit.edu	37	11	59211187	59211187	+	Silent	SNP	C	T	T			TCGA-76-6661-01	TCGA-76-6661-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:59211187C>T	uc001nnx.1	+	1	546	c.546C>T	c.(544-546)TGC>TGT	p.C182C		NM_001004728	NP_001004728	Q8NGJ0	OR5A1_HUMAN	olfactory receptor, family 5, subfamily A,	182	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|central_nervous_system(1)	2						ACTTCTTCTGCGACCTCCCAC	0.537													90	161	---	---	---	---	capture	Silent	SNP	59211187	59211187	OR5A1	11	C	T	T	T	1	0	0	0	0	0	0	0	1	350	27	1	1	11043	285
TMEM109	79073	broad.mit.edu	37	11	60687316	60687316	+	Missense_Mutation	SNP	G	C	C			TCGA-76-6661-01	TCGA-76-6661-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:60687316G>C	uc001nqg.2	+	2	529	c.151G>C	c.(151-153)GTT>CTT	p.V51L	TMEM109_uc001nqh.2_Missense_Mutation_p.V51L	NM_024092	NP_076997	Q9BVC6	TM109_HUMAN	transmembrane protein 109 precursor	51						integral to membrane|nuclear outer membrane|sarcoplasmic reticulum membrane					0						AGAAGCCCCAGTTGATGTCTT	0.557													34	75	---	---	---	---	capture	Missense_Mutation	SNP	60687316	60687316	TMEM109	11	G	C	C	C	1	0	0	0	0	1	0	0	0	468	36	4	4	15910	285
RIN1	9610	broad.mit.edu	37	11	66102539	66102539	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6661-01	TCGA-76-6661-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:66102539C>T	uc001ohn.1	-	6	858	c.731G>A	c.(730-732)AGC>AAC	p.S244N	RIN1_uc010roy.1_5'UTR|RIN1_uc009yrd.1_5'UTR|RIN1_uc010roz.1_Missense_Mutation_p.S139N|RIN1_uc010rpa.1_Missense_Mutation_p.S139N	NM_004292	NP_004283	Q13671	RIN1_HUMAN	ras inhibitor RIN1	244					endocytosis|signal transduction	cytoplasm|cytoskeleton|plasma membrane	GTPase activator activity|protein binding			lung(2)|breast(1)	3						CACTTTGAAGCTTCTCTTGAA	0.662													28	46	---	---	---	---	capture	Missense_Mutation	SNP	66102539	66102539	RIN1	11	C	T	T	T	1	0	0	0	0	1	0	0	0	364	28	2	2	13263	285
NLRX1	79671	broad.mit.edu	37	11	119044727	119044727	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6661-01	TCGA-76-6661-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:119044727G>A	uc001pvu.2	+	5	984	c.769G>A	c.(769-771)GGA>AGA	p.G257R	NLRX1_uc010rzc.1_Missense_Mutation_p.G79R|NLRX1_uc001pvv.2_Missense_Mutation_p.G257R|NLRX1_uc001pvw.2_Missense_Mutation_p.G257R|NLRX1_uc001pvx.2_Missense_Mutation_p.G257R	NM_024618	NP_078894	Q86UT6	NLRX1_HUMAN	NLR family member X1 isoform 1	257	Required for interaction with MAVS.|NACHT.				innate immune response|interspecies interaction between organisms|negative regulation of type I interferon production	mitochondrial outer membrane	ATP binding			ovary(1)|skin(1)	2	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.7e-05)		GGCAGGCACGGGACTTTGTAG	0.592													22	32	---	---	---	---	capture	Missense_Mutation	SNP	119044727	119044727	NLRX1	11	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	10392	285
KDM5A	5927	broad.mit.edu	37	12	402172	402172	+	Nonsense_Mutation	SNP	A	C	C			TCGA-76-6661-01	TCGA-76-6661-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:402172A>C	uc001qif.1	-	27	4982	c.4619T>G	c.(4618-4620)TTA>TGA	p.L1540*	KDM5A_uc001qie.1_Nonsense_Mutation_p.L1545*	NM_001042603	NP_001036068	P29375	KDM5A_HUMAN	retinoblastoma binding protein 2 isoform 1	1540	Lys-rich.				chromatin modification|multicellular organismal development|positive regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	cytoplasm|nucleolus	DNA binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(2)|ovary(1)	3						GTCTGCACCTAATTTTAATTT	0.378			T 	NUP98	AML								51	86	---	---	---	---	capture	Nonsense_Mutation	SNP	402172	402172	KDM5A	12	A	C	C	C	1	0	0	0	0	0	1	0	0	169	13	5	4	8055	285
CD163	9332	broad.mit.edu	37	12	7639177	7639177	+	Missense_Mutation	SNP	T	A	A			TCGA-76-6661-01	TCGA-76-6661-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:7639177T>A	uc001qsz.3	-	10	2504	c.2376A>T	c.(2374-2376)GAA>GAT	p.E792D	CD163_uc001qta.3_Missense_Mutation_p.E792D|CD163_uc009zfw.2_Missense_Mutation_p.E825D	NM_004244	NP_004235	Q86VB7	C163A_HUMAN	CD163 antigen isoform a	792	SRCR 7.|Extracellular (Potential).				acute-phase response	extracellular region|integral to plasma membrane	protein binding|scavenger receptor activity			ovary(6)|pancreas(1)|skin(1)	8						AAATGCGGGATTCTTTTCCAT	0.512													87	126	---	---	---	---	capture	Missense_Mutation	SNP	7639177	7639177	CD163	12	T	A	A	A	1	0	0	0	0	1	0	0	0	673	52	4	4	2938	285
HOXC9	3225	broad.mit.edu	37	12	54396220	54396220	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6661-01	TCGA-76-6661-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:54396220C>T	uc001sep.2	+	3	643	c.545C>T	c.(544-546)CCC>CTC	p.P182L	HOXC9_uc001seq.2_Missense_Mutation_p.P182L	NM_006897	NP_008828	P31274	HXC9_HUMAN	homeobox C9	182					multicellular organismal development	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			large_intestine(1)|pancreas(1)|skin(1)	3						CCAGGCAACCCCGTGGCCAAC	0.577													40	79	---	---	---	---	capture	Missense_Mutation	SNP	54396220	54396220	HOXC9	12	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	7242	285
LRP1	4035	broad.mit.edu	37	12	57581220	57581220	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6661-01	TCGA-76-6661-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:57581220G>A	uc001snd.2	+	42	7478	c.7012G>A	c.(7012-7014)GTT>ATT	p.V2338I		NM_002332	NP_002323	Q07954	LRP1_HUMAN	low density lipoprotein-related protein 1	2338	LDL-receptor class B 22.|Extracellular (Potential).				aorta morphogenesis|apoptotic cell clearance|negative regulation of platelet-derived growth factor receptor-beta signaling pathway|negative regulation of smooth muscle cell migration|negative regulation of Wnt receptor signaling pathway|positive regulation of cholesterol efflux|regulation of actin cytoskeleton organization|regulation of phospholipase A2 activity	coated pit|integral to plasma membrane|nucleus	apolipoprotein E binding|calcium ion binding|lipoprotein transporter activity|protein complex binding|receptor activity			ovary(8)|lung(3)|breast(3)|large_intestine(2)|central_nervous_system(2)|skin(2)|pancreas(2)	22				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Alteplase(DB00009)|Anistreplase(DB00029)|Antihemophilic Factor(DB00025)|Becaplermin(DB00102)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	ACGGGCCTTCGTTTTGGACGA	0.622													20	28	---	---	---	---	capture	Missense_Mutation	SNP	57581220	57581220	LRP1	12	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	8867	285
SBNO1	55206	broad.mit.edu	37	12	123782584	123782584	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6661-01	TCGA-76-6661-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:123782584C>T	uc010tap.1	-	30	3980	c.3980G>A	c.(3979-3981)GGC>GAC	p.G1327D	SBNO1_uc009zxv.2_RNA|SBNO1_uc010tao.1_Missense_Mutation_p.G1326D|SBNO1_uc010taq.1_Missense_Mutation_p.G278D	NM_018183	NP_060653	A3KN83	SBNO1_HUMAN	sno, strawberry notch homolog 1	1327							ATP binding|DNA binding|hydrolase activity			breast(5)|skin(2)|ovary(1)|kidney(1)	9	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000701)|Epithelial(86;0.00197)		CACGTTTGTGCCACTGACAGA	0.428													4	192	---	---	---	---	capture	Missense_Mutation	SNP	123782584	123782584	SBNO1	12	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	13754	285
MTHFD1	4522	broad.mit.edu	37	14	64882182	64882182	+	Missense_Mutation	SNP	A	G	G			TCGA-76-6661-01	TCGA-76-6661-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:64882182A>G	uc001xhb.2	+	5	734	c.347A>G	c.(346-348)AAT>AGT	p.N116S	MTHFD1_uc010aqe.2_Missense_Mutation_p.N152S|MTHFD1_uc010aqf.2_Missense_Mutation_p.N172S	NM_005956	NP_005947	P11586	C1TC_HUMAN	methylenetetrahydrofolate dehydrogenase 1	116	Methylenetetrahydrofolate dehydrogenase and cyclohydrolase.				folic acid metabolic process|folic acid-containing compound biosynthetic process|histidine biosynthetic process|methionine biosynthetic process|one-carbon metabolic process|purine nucleotide biosynthetic process	cytosol|mitochondrion	ATP binding|formate-tetrahydrofolate ligase activity|methenyltetrahydrofolate cyclohydrolase activity|methylenetetrahydrofolate dehydrogenase (NADP+) activity|methylenetetrahydrofolate dehydrogenase|protein binding			ovary(2)	2				OV - Ovarian serous cystadenocarcinoma(108;8.7e-12)|all cancers(60;3.29e-11)|BRCA - Breast invasive adenocarcinoma(234;0.0488)	NADH(DB00157)|Tetrahydrofolic acid(DB00116)	GAAGTGATCAATGCTATTGCA	0.383													57	100	---	---	---	---	capture	Missense_Mutation	SNP	64882182	64882182	MTHFD1	14	A	G	G	G	1	0	0	0	0	1	0	0	0	52	4	3	3	9837	285
CCDC88C	440193	broad.mit.edu	37	14	91770270	91770270	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6661-01	TCGA-76-6661-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:91770270G>A	uc010aty.2	-	20	3509	c.3410C>T	c.(3409-3411)ACG>ATG	p.T1137M		NM_001080414	NP_001073883	Q9P219	DAPLE_HUMAN	DVL-binding protein DAPLE	1137					microtubule cytoskeleton organization|protein destabilization|protein homooligomerization|regulation of protein phosphorylation|Wnt receptor signaling pathway	cytoplasm|insoluble fraction	microtubule binding|PDZ domain binding|protein self-association			ovary(3)	3		all_cancers(154;0.0468)				CTGCAGCAGCGTGTACTGCGC	0.657													4	94	---	---	---	---	capture	Missense_Mutation	SNP	91770270	91770270	CCDC88C	14	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	2838	285
ATF7IP2	80063	broad.mit.edu	37	16	10527480	10527480	+	Missense_Mutation	SNP	G	C	C			TCGA-76-6661-01	TCGA-76-6661-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:10527480G>C	uc002czu.2	+	4	1161	c.934G>C	c.(934-936)GAA>CAA	p.E312Q	ATF7IP2_uc002czv.2_Missense_Mutation_p.E312Q|ATF7IP2_uc010uyo.1_RNA|ATF7IP2_uc010uyp.1_Intron|ATF7IP2_uc002czw.2_Missense_Mutation_p.E312Q|ATF7IP2_uc010uyq.1_RNA	NM_024997	NP_079273	Q5U623	MCAF2_HUMAN	activating transcription factor 7 interacting	312					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus					0						TGTAAGTTTGGAAAGGCAAAC	0.328													26	40	---	---	---	---	capture	Missense_Mutation	SNP	10527480	10527480	ATF7IP2	16	G	C	C	C	1	0	0	0	0	1	0	0	0	533	41	4	4	1079	285
VWA3A	146177	broad.mit.edu	37	16	22137566	22137566	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6661-01	TCGA-76-6661-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:22137566C>T	uc010vbq.1	+	17	1696	c.1600C>T	c.(1600-1602)CGG>TGG	p.R534W	VWA3A_uc010bxd.2_RNA|VWA3A_uc010bxc.2_Missense_Mutation_p.R542W	NM_173615	NP_775886	A6NCI4	VWA3A_HUMAN	von Willebrand factor A domain containing 3A	534	VWFA 1.					extracellular region				skin(1)	1				GBM - Glioblastoma multiforme(48;0.0439)		GCACTCCCTGCGGCTGCTGCT	0.512													35	93	---	---	---	---	capture	Missense_Mutation	SNP	22137566	22137566	VWA3A	16	C	T	T	T	1	0	0	0	0	1	0	0	0	347	27	1	1	17122	285
PLCG2	5336	broad.mit.edu	37	16	81942086	81942086	+	Silent	SNP	G	A	A			TCGA-76-6661-01	TCGA-76-6661-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:81942086G>A	uc002fgt.2	+	17	1775	c.1623G>A	c.(1621-1623)ACG>ACA	p.T541T	PLCG2_uc010chg.1_Silent_p.T541T	NM_002661	NP_002652	P16885	PLCG2_HUMAN	phospholipase C, gamma 2	541	SH2 1.				intracellular signal transduction|phospholipid catabolic process|platelet activation	plasma membrane	phosphatidylinositol phospholipase C activity|protein binding|signal transducer activity			large_intestine(4)|lung(2)|ovary(1)|skin(1)	8						AGAAGAGGACGAGTGCCGAGA	0.552													23	30	---	---	---	---	capture	Silent	SNP	81942086	81942086	PLCG2	16	G	A	A	A	1	0	0	0	0	0	0	0	1	470	37	1	1	11939	285
UBTF	7343	broad.mit.edu	37	17	42284949	42284949	+	Missense_Mutation	SNP	T	C	C			TCGA-76-6661-01	TCGA-76-6661-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:42284949T>C	uc002igb.2	-	19	2109	c.2042A>G	c.(2041-2043)GAT>GGT	p.D681G	UBTF_uc002igc.2_Missense_Mutation_p.D644G|UBTF_uc010czs.2_Missense_Mutation_p.D681G|UBTF_uc002igd.2_Missense_Mutation_p.D644G|UBTF_uc010czt.2_Missense_Mutation_p.D681G	NM_014233	NP_055048	P17480	UBF1_HUMAN	upstream binding transcription factor, RNA	681	Asp/Glu/Ser-rich (acidic).				positive regulation of transcription from RNA polymerase I promoter|termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription initiation from RNA polymerase I promoter	nucleolus|nucleoplasm	DNA binding|protein binding				0		Breast(137;0.00765)|Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.114)		atcctcttcatcatcctcctc	0.453													22	22	---	---	---	---	capture	Missense_Mutation	SNP	42284949	42284949	UBTF	17	T	C	C	C	1	0	0	0	0	1	0	0	0	650	50	3	3	16791	285
DSC2	1824	broad.mit.edu	37	18	28671015	28671015	+	Silent	SNP	A	C	C			TCGA-76-6661-01	TCGA-76-6661-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:28671015A>C	uc002kwl.3	-	4	904	c.450T>G	c.(448-450)GGT>GGG	p.G150G	DSC2_uc002kwk.3_Silent_p.G150G	NM_024422	NP_077740	Q02487	DSC2_HUMAN	desmocollin 2 isoform Dsc2a preproprotein	150	Cadherin 1.|Extracellular (Potential).				homophilic cell adhesion	desmosome|integral to membrane	calcium ion binding			ovary(2)|skin(1)	3			OV - Ovarian serous cystadenocarcinoma(10;0.0241)			GTGGAAAAGGACCCAAGGAGT	0.408													23	24	---	---	---	---	capture	Silent	SNP	28671015	28671015	DSC2	18	A	C	C	C	1	0	0	0	0	0	0	0	1	119	10	4	4	4721	285
DSG3	1830	broad.mit.edu	37	18	29046498	29046498	+	Missense_Mutation	SNP	A	T	T			TCGA-76-6661-01	TCGA-76-6661-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:29046498A>T	uc002kws.2	+	11	1526	c.1417A>T	c.(1417-1419)ACG>TCG	p.T473S		NM_001944	NP_001935	P32926	DSG3_HUMAN	desmoglein 3 preproprotein	473	Cadherin 4.|Extracellular (Potential).				cellular component disassembly involved in apoptosis|homophilic cell adhesion	cytosol|desmosome|integral to membrane	calcium ion binding			skin(4)|ovary(3)|lung(1)|central_nervous_system(1)	9			OV - Ovarian serous cystadenocarcinoma(10;0.00504)			TACAGAATACACGGGTAAAAC	0.358													4	82	---	---	---	---	capture	Missense_Mutation	SNP	29046498	29046498	DSG3	18	A	T	T	T	1	0	0	0	0	1	0	0	0	78	6	4	4	4733	285
CREB3L3	84699	broad.mit.edu	37	19	4171163	4171163	+	Silent	SNP	C	T	T			TCGA-76-6661-01	TCGA-76-6661-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:4171163C>T	uc002lzl.2	+	8	1082	c.966C>T	c.(964-966)ACC>ACT	p.T322T	CREB3L3_uc002lzm.2_Silent_p.T312T|CREB3L3_uc010xib.1_Silent_p.T311T|CREB3L3_uc010xic.1_Silent_p.L278L	NM_032607	NP_115996	Q68CJ9	CR3L3_HUMAN	cAMP responsive element binding protein 3-like	322	Cytoplasmic (Potential).				response to unfolded protein	endoplasmic reticulum membrane|integral to membrane|nucleus	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)|skin(1)	2				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0232)|STAD - Stomach adenocarcinoma(1328;0.18)		AGACAGGCACCTGTGTCGCAG	0.602													22	68	---	---	---	---	capture	Silent	SNP	4171163	4171163	CREB3L3	19	C	T	T	T	1	0	0	0	0	0	0	0	1	301	24	2	2	3823	285
MYO1F	4542	broad.mit.edu	37	19	8616651	8616651	+	Silent	SNP	G	A	A			TCGA-76-6661-01	TCGA-76-6661-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:8616651G>A	uc002mkg.2	-	8	858	c.744C>T	c.(742-744)GAC>GAT	p.D248D	MYO1F_uc002mkh.2_Silent_p.D248D|MYO1F_uc010xkf.1_3'UTR	NM_012335	NP_036467	O00160	MYO1F_HUMAN	myosin IF	248	Myosin head-like.					unconventional myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			ovary(2)|skin(1)	3						CGCTTCTGTCGTCCGTGCCGT	0.582													40	112	---	---	---	---	capture	Silent	SNP	8616651	8616651	MYO1F	19	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	9983	285
JAK3	3718	broad.mit.edu	37	19	17937673	17937673	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6661-01	TCGA-76-6661-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:17937673C>T	uc002nhn.3	-	24	3354	c.3254G>A	c.(3253-3255)CGG>CAG	p.R1085Q	JAK3_uc010ebh.2_Intron	NM_000215	NP_000206	P52333	JAK3_HUMAN	Janus kinase 3	1085	Protein kinase 2.				B cell differentiation|cytokine-mediated signaling pathway|enzyme linked receptor protein signaling pathway|intracellular protein kinase cascade|negative regulation of dendritic cell cytokine production|negative regulation of FasL biosynthetic process|negative regulation of interleukin-10 production|negative regulation of interleukin-12 production|negative regulation of T-helper 1 cell differentiation|negative regulation of thymocyte apoptosis|peptidyl-tyrosine phosphorylation|positive regulation of anti-apoptosis|response to interleukin-15|response to interleukin-2|response to interleukin-4|response to interleukin-9|T cell homeostasis	cytoskeleton|cytosol|endomembrane system|membrane	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein binding			haematopoietic_and_lymphoid_tissue(40)|lung(5)|breast(5)|ovary(3)|stomach(2)|upper_aerodigestive_tract(1)	56						GAATGATGGCCGGTCCTGTGG	0.632		2	Mis		acute megakaryocytic leukemia|								41	98	---	---	---	---	capture	Missense_Mutation	SNP	17937673	17937673	JAK3	19	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	7862	285
PAK4	10298	broad.mit.edu	37	19	39665625	39665625	+	Missense_Mutation	SNP	T	C	C			TCGA-76-6661-01	TCGA-76-6661-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:39665625T>C	uc002okj.1	+	7	1614	c.1153T>C	c.(1153-1155)TAC>CAC	p.Y385H	PAK4_uc002okl.1_Missense_Mutation_p.Y385H|PAK4_uc002okn.1_Missense_Mutation_p.Y385H|PAK4_uc002okm.1_Missense_Mutation_p.Y232H|PAK4_uc002oko.1_Missense_Mutation_p.Y232H|PAK4_uc002okp.1_Missense_Mutation_p.Y295H	NM_001014831	NP_001014831	O96013	PAK4_HUMAN	p21-activated kinase 4 isoform 1	385	Protein kinase.				cellular component movement|signal transduction	Golgi apparatus	ATP binding|protein binding|protein serine/threonine kinase activity			lung(3)|ovary(1)	4	all_cancers(60;1.03e-07)|all_epithelial(25;9.66e-08)|all_lung(34;1.58e-07)|Lung NSC(34;1.88e-07)|Ovarian(47;0.0454)		Epithelial(26;4.82e-25)|all cancers(26;2.94e-22)|Lung(45;0.000797)|LUSC - Lung squamous cell carcinoma(53;0.00113)			GTACAACAGCTACCTGGTGGG	0.617													58	124	---	---	---	---	capture	Missense_Mutation	SNP	39665625	39665625	PAK4	19	T	C	C	C	1	0	0	0	0	1	0	0	0	689	53	3	3	11307	285
ZNF8	7554	broad.mit.edu	37	19	58805490	58805490	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6661-01	TCGA-76-6661-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:58805490G>A	uc002qry.1	+	4	446	c.316G>A	c.(316-318)GCA>ACA	p.A106T	ZNF8_uc002qrz.2_RNA	NM_021089	NP_066575	P17098	ZNF8_HUMAN	zinc finger protein 8	106					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		all_cancers(17;6.46e-05)|Lung NSC(17;0.0233)|all_neural(62;0.0381)|all_epithelial(17;0.0427)|all_lung(17;0.057)|Ovarian(87;0.17)|Colorectal(82;0.227)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.00619)		TGAAAGCCAAGCATCACGCAA	0.542													19	64	---	---	---	---	capture	Missense_Mutation	SNP	58805490	58805490	ZNF8	19	G	A	A	A	1	0	0	0	0	1	0	0	0	442	34	2	2	18043	285
MERTK	10461	broad.mit.edu	37	2	112785992	112785992	+	Missense_Mutation	SNP	A	G	G			TCGA-76-6661-01	TCGA-76-6661-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:112785992A>G	uc002thk.1	+	19	2673	c.2551A>G	c.(2551-2553)AGG>GGG	p.R851G	MERTK_uc002thl.1_Missense_Mutation_p.R675G	NM_006343	NP_006334	Q12866	MERTK_HUMAN	MER receptor tyrosine kinase precursor	851	Protein kinase.|Cytoplasmic (Potential).				cell surface receptor linked signaling pathway|cell-cell signaling|leukocyte migration	integral to plasma membrane|soluble fraction	ATP binding|transmembrane receptor protein tyrosine kinase activity			lung(6)|upper_aerodigestive_tract(1)|stomach(1)|kidney(1)	9						TTCAGTATTGAGGCTGCAGCT	0.453													3	94	---	---	---	---	capture	Missense_Mutation	SNP	112785992	112785992	MERTK	2	A	G	G	G	1	0	0	0	0	1	0	0	0	140	11	3	3	9392	285
TTN	7273	broad.mit.edu	37	2	179594237	179594237	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6661-01	TCGA-76-6661-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:179594237C>T	uc010zfg.1	-	61	15138	c.14914G>A	c.(14914-14916)GTG>ATG	p.V4972M	TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Missense_Mutation_p.V1633M	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	5899							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCCAGCTCCACGTCACTATAT	0.448													9	121	---	---	---	---	capture	Missense_Mutation	SNP	179594237	179594237	TTN	2	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	16617	285
PIKFYVE	200576	broad.mit.edu	37	2	209153464	209153464	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6661-01	TCGA-76-6661-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:209153464C>T	uc002vcz.2	+	7	991	c.833C>T	c.(832-834)CCA>CTA	p.P278L	PIKFYVE_uc010fun.1_5'UTR|PIKFYVE_uc002vcy.1_Missense_Mutation_p.P278L|PIKFYVE_uc002vcv.2_Missense_Mutation_p.P181L|PIKFYVE_uc002vcw.2_Missense_Mutation_p.P278L|PIKFYVE_uc002vcx.2_Missense_Mutation_p.P192L	NM_015040	NP_055855	Q9Y2I7	FYV1_HUMAN	phosphatidylinositol-3-phosphate 5-kinase type	278					cellular protein metabolic process|intracellular signal transduction|protein localization to nucleus|retrograde transport, endosome to Golgi	early endosome membrane|membrane raft	1-phosphatidylinositol-3-phosphate 5-kinase activity|1-phosphatidylinositol-4-phosphate 5-kinase activity|ATP binding|metal ion binding|protein binding			ovary(5)|kidney(2)|pancreas(1)|central_nervous_system(1)|skin(1)	10						TTGATTCATCCAGATTCCTCA	0.343													26	46	---	---	---	---	capture	Missense_Mutation	SNP	209153464	209153464	PIKFYVE	2	C	T	T	T	1	0	0	0	0	1	0	0	0	273	21	2	2	11827	285
COL4A4	1286	broad.mit.edu	37	2	227942664	227942664	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6661-01	TCGA-76-6661-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:227942664C>T	uc010zlt.1	-	25	2587	c.1933G>A	c.(1933-1935)GGA>AGA	p.G645R		NM_000092	NP_000083	P53420	CO4A4_HUMAN	alpha 4 type IV collagen precursor	645	Triple-helical region.				axon guidance|glomerular basement membrane development	basal lamina|collagen type IV	extracellular matrix structural constituent|protein binding			ovary(5)|central_nervous_system(3)|pancreas(1)|breast(1)|skin(1)	11		Renal(207;0.00844)|all_lung(227;0.0187)|Lung NSC(271;0.0879)|all_hematologic(139;0.21)|Esophageal squamous(248;0.242)		Epithelial(121;6.7e-11)|all cancers(144;5.39e-08)|Lung(261;0.0132)|LUSC - Lung squamous cell carcinoma(224;0.0181)		CCTGGAACTCCTGGGTGGCCT	0.493													12	28	---	---	---	---	capture	Missense_Mutation	SNP	227942664	227942664	COL4A4	2	C	T	T	T	1	0	0	0	0	1	0	0	0	312	24	2	2	3658	285
COL4A4	1286	broad.mit.edu	37	2	227942679	227942679	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6661-01	TCGA-76-6661-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:227942679C>T	uc010zlt.1	-	25	2572	c.1918G>A	c.(1918-1920)GAG>AAG	p.E640K		NM_000092	NP_000083	P53420	CO4A4_HUMAN	alpha 4 type IV collagen precursor	640	Triple-helical region.				axon guidance|glomerular basement membrane development	basal lamina|collagen type IV	extracellular matrix structural constituent|protein binding			ovary(5)|central_nervous_system(3)|pancreas(1)|breast(1)|skin(1)	11		Renal(207;0.00844)|all_lung(227;0.0187)|Lung NSC(271;0.0879)|all_hematologic(139;0.21)|Esophageal squamous(248;0.242)		Epithelial(121;6.7e-11)|all cancers(144;5.39e-08)|Lung(261;0.0132)|LUSC - Lung squamous cell carcinoma(224;0.0181)		TGGCCTCGCTCTCCTGGTGGA	0.547													7	29	---	---	---	---	capture	Missense_Mutation	SNP	227942679	227942679	COL4A4	2	C	T	T	T	1	0	0	0	0	1	0	0	0	416	32	2	2	3658	285
COL4A4	1286	broad.mit.edu	37	2	227942699	227942699	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6661-01	TCGA-76-6661-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:227942699C>T	uc010zlt.1	-	25	2552	c.1898G>A	c.(1897-1899)GGA>GAA	p.G633E		NM_000092	NP_000083	P53420	CO4A4_HUMAN	alpha 4 type IV collagen precursor	633	Triple-helical region.				axon guidance|glomerular basement membrane development	basal lamina|collagen type IV	extracellular matrix structural constituent|protein binding			ovary(5)|central_nervous_system(3)|pancreas(1)|breast(1)|skin(1)	11		Renal(207;0.00844)|all_lung(227;0.0187)|Lung NSC(271;0.0879)|all_hematologic(139;0.21)|Esophageal squamous(248;0.242)		Epithelial(121;6.7e-11)|all cancers(144;5.39e-08)|Lung(261;0.0132)|LUSC - Lung squamous cell carcinoma(224;0.0181)		ACCAGGAAATCCCAGTCCTGG	0.602													5	26	---	---	---	---	capture	Missense_Mutation	SNP	227942699	227942699	COL4A4	2	C	T	T	T	1	0	0	0	0	1	0	0	0	390	30	2	2	3658	285
BPI	671	broad.mit.edu	37	20	36964027	36964027	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6661-01	TCGA-76-6661-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:36964027C>T	uc002xib.2	+	14	1438	c.1376C>T	c.(1375-1377)CCG>CTG	p.P459L		NM_001725	NP_001716	P17213	BPI_HUMAN	bactericidal/permeability-increasing protein	459					defense response to bacterium|negative regulation of interleukin-6 production|negative regulation of interleukin-8 production|negative regulation of macrophage activation|negative regulation of tumor necrosis factor production	extracellular region|integral to plasma membrane	lipid binding|lipopolysaccharide binding			ovary(4)	4		Myeloproliferative disorder(115;0.00878)				TTCCCTCTCCCGACGCCGGCC	0.557													21	110	---	---	---	---	capture	Missense_Mutation	SNP	36964027	36964027	BPI	20	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	1478	285
TTPAL	79183	broad.mit.edu	37	20	43118147	43118147	+	Nonsense_Mutation	SNP	C	T	T			TCGA-76-6661-01	TCGA-76-6661-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:43118147C>T	uc002xmc.1	+	6	1118	c.994C>T	c.(994-996)CGA>TGA	p.R332*	TTPAL_uc002xmd.1_Nonsense_Mutation_p.R332*|TTPAL_uc010ggr.1_Nonsense_Mutation_p.R145*	NM_024331	NP_077307	Q9BTX7	TTPAL_HUMAN	tocopherol (alpha) transfer protein-like	332						intracellular	transporter activity			breast(1)	1						CGACTCCTTGCGAGCTGTGAA	0.547													14	32	---	---	---	---	capture	Nonsense_Mutation	SNP	43118147	43118147	TTPAL	20	C	T	T	T	1	0	0	0	0	0	1	0	0	347	27	5	1	16619	285
RIPK4	54101	broad.mit.edu	37	21	43162031	43162031	+	Missense_Mutation	SNP	A	T	T			TCGA-76-6661-01	TCGA-76-6661-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:43162031A>T	uc002yzn.1	-	8	1370	c.1322T>A	c.(1321-1323)CTG>CAG	p.L441Q		NM_020639	NP_065690	P57078	RIPK4_HUMAN	ankyrin repeat domain 3	441						cytoplasm|nucleus	ATP binding|protein serine/threonine kinase activity			ovary(2)|central_nervous_system(2)|large_intestine(1)|lung(1)|skin(1)	7						CAGGTGCAGCAGGCTGGCACC	0.637													56	117	---	---	---	---	capture	Missense_Mutation	SNP	43162031	43162031	RIPK4	21	A	T	T	T	1	0	0	0	0	1	0	0	0	91	7	4	4	13275	285
LAMP3	27074	broad.mit.edu	37	3	182871533	182871533	+	Silent	SNP	G	A	A	rs140803277	by1000genomes	TCGA-76-6661-01	TCGA-76-6661-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:182871533G>A	uc003flh.3	-	2	920	c.696C>T	c.(694-696)AAC>AAT	p.N232N		NM_014398	NP_055213	Q9UQV4	LAMP3_HUMAN	lysosomal-associated membrane protein 3	232	Lumenal (Potential).				cell proliferation	integral to membrane|lysosomal membrane				ovary(2)|central_nervous_system(1)	3	all_cancers(143;9.14e-14)|Ovarian(172;0.0355)		all cancers(12;2.91e-44)|Epithelial(37;5.52e-38)|LUSC - Lung squamous cell carcinoma(7;7.12e-25)|Lung(8;6.39e-23)|OV - Ovarian serous cystadenocarcinoma(80;4.16e-21)			GTCTGCTTCCGTTTAGAACCT	0.502													5	101	---	---	---	---	capture	Silent	SNP	182871533	182871533	LAMP3	3	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	8539	285
EPHB3	2049	broad.mit.edu	37	3	184295702	184295702	+	Silent	SNP	G	A	A			TCGA-76-6661-01	TCGA-76-6661-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:184295702G>A	uc003foz.2	+	8	2093	c.1656G>A	c.(1654-1656)CAG>CAA	p.Q552Q		NM_004443	NP_004434	P54753	EPHB3_HUMAN	ephrin receptor EphB3 precursor	552	Extracellular (Potential).					integral to plasma membrane	ATP binding|ephrin receptor activity			lung(5)|breast(2)|upper_aerodigestive_tract(1)|stomach(1)|skin(1)|ovary(1)	11	all_cancers(143;1.89e-10)|Ovarian(172;0.0339)		Epithelial(37;1.27e-34)|OV - Ovarian serous cystadenocarcinoma(80;3.8e-22)			GGGCCCAGCAGCTCCAGGAGC	0.637													38	40	---	---	---	---	capture	Silent	SNP	184295702	184295702	EPHB3	3	G	A	A	A	1	0	0	0	0	0	0	0	1	438	34	2	2	5131	285
C3orf70	285382	broad.mit.edu	37	3	184870498	184870498	+	Silent	SNP	G	A	A			TCGA-76-6661-01	TCGA-76-6661-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:184870498G>A	uc003fpd.2	-	1	305	c.114C>T	c.(112-114)TGC>TGT	p.C38C		NM_001025266	NP_001020437	A6NLC5	CC070_HUMAN	hypothetical protein LOC285382	38											0						ACAGCCCGTCGCACGGCTGGA	0.642													3	17	---	---	---	---	capture	Silent	SNP	184870498	184870498	C3orf70	3	G	A	A	A	1	0	0	0	0	0	0	0	1	490	38	1	1	2222	285
LIAS	11019	broad.mit.edu	37	4	39462478	39462478	+	Silent	SNP	C	A	A			TCGA-76-6661-01	TCGA-76-6661-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:39462478C>A	uc003guf.2	+	2	187	c.114C>A	c.(112-114)CTC>CTA	p.L38L	RPL9_uc003gub.2_5'Flank|RPL9_uc003guc.2_5'Flank|RPL9_uc011byk.1_5'Flank|RPL9_uc011byl.1_5'Flank|RPL9_uc003gud.1_5'Flank|LIAS_uc003gue.3_Silent_p.L38L|LIAS_uc011bym.1_Silent_p.L38L|LIAS_uc003gug.2_Silent_p.L38L|LIAS_uc003guh.2_Silent_p.L38L	NM_006859	NP_006850	O43766	LIAS_HUMAN	lipoic acid synthetase isoform 1 precursor	38					inflammatory response|response to lipopolysaccharide|response to oxidative stress	mitochondrion	4 iron, 4 sulfur cluster binding|lipoate synthase activity|metal ion binding				0					Lipoic Acid(DB00166)	AAAAGGAACTCCTACAGAATG	0.398													60	97	---	---	---	---	capture	Silent	SNP	39462478	39462478	LIAS	4	C	A	A	A	1	0	0	0	0	0	0	0	1	379	30	4	4	8698	285
FBN2	2201	broad.mit.edu	37	5	127674667	127674667	+	Nonsense_Mutation	SNP	C	A	A			TCGA-76-6661-01	TCGA-76-6661-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:127674667C>A	uc003kuu.2	-	26	3869	c.3430G>T	c.(3430-3432)GAA>TAA	p.E1144*	FBN2_uc003kuv.2_Nonsense_Mutation_p.E1111*	NM_001999	NP_001990	P35556	FBN2_HUMAN	fibrillin 2 precursor	1144	EGF-like 16; calcium-binding.				bone trabecula formation|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|positive regulation of bone mineralization|positive regulation of osteoblast differentiation	microfibril	calcium ion binding|extracellular matrix structural constituent			ovary(8)|large_intestine(4)|pancreas(1)|kidney(1)|skin(1)	15		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		TCATAGCCTTCGAAGCACTCG	0.507													23	42	---	---	---	---	capture	Nonsense_Mutation	SNP	127674667	127674667	FBN2	5	C	A	A	A	1	0	0	0	0	0	1	0	0	403	31	5	4	5649	285
ADAMTS19	171019	broad.mit.edu	37	5	128862027	128862027	+	Nonsense_Mutation	SNP	C	T	T			TCGA-76-6661-01	TCGA-76-6661-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:128862027C>T	uc003kvb.1	+	4	946	c.946C>T	c.(946-948)CGA>TGA	p.R316*	ADAMTS19_uc003kvc.1_RNA	NM_133638	NP_598377	Q8TE59	ATS19_HUMAN	ADAM metallopeptidase with thrombospondin type 1	316					proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(5)|breast(2)|lung(1)|skin(1)	9		all_cancers(142;0.0148)|Prostate(80;0.0494)|Breast(839;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.222)		AAGAGGGAAACGATATTCATA	0.398													21	23	---	---	---	---	capture	Nonsense_Mutation	SNP	128862027	128862027	ADAMTS19	5	C	T	T	T	1	0	0	0	0	0	1	0	0	243	19	5	1	264	285
PCDHA5	56143	broad.mit.edu	37	5	140203028	140203028	+	Silent	SNP	C	T	T			TCGA-76-6661-01	TCGA-76-6661-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140203028C>T	uc003lhl.2	+	1	1668	c.1668C>T	c.(1666-1668)GAC>GAT	p.D556D	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Silent_p.D556D|PCDHA5_uc003lhj.1_Silent_p.D556D	NM_018908	NP_061731	Q9Y5H7	PCDA5_HUMAN	protocadherin alpha 5 isoform 1 precursor	556	Extracellular (Potential).|Cadherin 5.				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding			ovary(1)|breast(1)|skin(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCGTGCTGGACGAGAACGACA	0.706													52	94	---	---	---	---	capture	Silent	SNP	140203028	140203028	PCDHA5	5	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	11430	285
PCDHB5	26167	broad.mit.edu	37	5	140515027	140515027	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6661-01	TCGA-76-6661-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:140515027C>T	uc003liq.2	+	1	228	c.11C>T	c.(10-12)GCG>GTG	p.A4V		NM_015669	NP_056484	Q9Y5E4	PCDB5_HUMAN	protocadherin beta 5 precursor	4					calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding|protein binding			skin(3)|ovary(2)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			ATGGAGACTGCGCTAGCAAAA	0.458													31	36	---	---	---	---	capture	Missense_Mutation	SNP	140515027	140515027	PCDHB5	5	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	11448	285
DDX41	51428	broad.mit.edu	37	5	176941751	176941751	+	Missense_Mutation	SNP	G	C	C			TCGA-76-6661-01	TCGA-76-6661-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:176941751G>C	uc003mho.2	-	9	907	c.886C>G	c.(886-888)CTC>GTC	p.L296V	DDX41_uc003mhm.2_Missense_Mutation_p.L76V|DDX41_uc003mhn.2_Missense_Mutation_p.L165V|DDX41_uc003mhp.2_Missense_Mutation_p.L165V|DDX41_uc003mhq.1_Missense_Mutation_p.L76V	NM_016222	NP_057306	Q9UJV9	DDX41_HUMAN	DEAD-box protein abstrakt	296	Helicase ATP-binding.				apoptosis|multicellular organismal development	catalytic step 2 spliceosome	ATP binding|ATP-dependent helicase activity|protein binding|RNA binding|zinc ion binding				0	all_cancers(89;0.00033)|Renal(175;0.000269)|Lung NSC(126;0.00161)|all_lung(126;0.00286)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.191)			CCAATGCAGAGGGCGCAGCGC	0.662													64	105	---	---	---	---	capture	Missense_Mutation	SNP	176941751	176941751	DDX41	5	G	C	C	C	1	0	0	0	0	1	0	0	0	455	35	4	4	4319	285
MAML1	9794	broad.mit.edu	37	5	179201198	179201198	+	Missense_Mutation	SNP	A	C	C			TCGA-76-6661-01	TCGA-76-6661-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:179201198A>C	uc003mkm.2	+	5	2634	c.2371A>C	c.(2371-2373)ACC>CCC	p.T791P	MAML1_uc003mkn.1_Intron	NM_014757	NP_055572	Q92585	MAML1_HUMAN	mastermind-like 1	791					Notch signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nuclear speck	peptide antigen binding|protein kinase binding|transcription coactivator activity			lung(4)|ovary(2)	6	all_cancers(89;0.000197)|all_epithelial(37;6.7e-05)|Renal(175;0.000159)|Lung NSC(126;0.00121)|all_lung(126;0.00218)	all_cancers(40;0.0308)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GGGCCAGAACACCTCCGTCTC	0.592													4	17	---	---	---	---	capture	Missense_Mutation	SNP	179201198	179201198	MAML1	5	A	C	C	C	1	0	0	0	0	1	0	0	0	78	6	4	4	9119	285
GTF3C6	112495	broad.mit.edu	37	6	111288823	111288823	+	Missense_Mutation	SNP	G	T	T			TCGA-76-6661-01	TCGA-76-6661-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:111288823G>T	uc003pum.2	+	6	682	c.472G>T	c.(472-474)GAT>TAT	p.D158Y		NM_138408	NP_612417	Q969F1	TF3C6_HUMAN	general transcription factor IIIC, polypeptide	158						transcription factor TFIIIC complex	DNA binding|protein binding				0		all_cancers(87;0.00328)|Acute lymphoblastic leukemia(125;2.27e-07)|all_hematologic(75;1.38e-05)|Colorectal(196;0.0466)|all_epithelial(87;0.0575)		OV - Ovarian serous cystadenocarcinoma(136;0.105)|all cancers(137;0.179)|Epithelial(106;0.186)		TTCAGCCCCAGATAAATCTTT	0.383													62	97	---	---	---	---	capture	Missense_Mutation	SNP	111288823	111288823	GTF3C6	6	G	T	T	T	1	0	0	0	0	1	0	0	0	429	33	4	4	6806	285
NMBR	4829	broad.mit.edu	37	6	142409496	142409496	+	Silent	SNP	G	A	A			TCGA-76-6661-01	TCGA-76-6661-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:142409496G>A	uc003qiu.2	-	1	441	c.300C>T	c.(298-300)GAC>GAT	p.D100D		NM_002511	NP_002502	P28336	NMBR_HUMAN	neuromedin B receptor	100	Extracellular (Potential).				activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger	cytoplasm|integral to plasma membrane	bombesin receptor activity			central_nervous_system(3)|breast(1)	4	Breast(32;0.155)			OV - Ovarian serous cystadenocarcinoma(155;9.93e-06)|GBM - Glioblastoma multiforme(68;0.0013)		AGCGCGAGGCGTCCACCGGGA	0.592													14	25	---	---	---	---	capture	Silent	SNP	142409496	142409496	NMBR	6	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	10394	285
HECW1	23072	broad.mit.edu	37	7	43351508	43351508	+	Silent	SNP	C	T	T			TCGA-76-6661-01	TCGA-76-6661-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:43351508C>T	uc003tid.1	+	4	779	c.174C>T	c.(172-174)CAC>CAT	p.H58H	HECW1_uc011kbi.1_Silent_p.H58H|HECW1_uc003tie.1_Silent_p.H90H	NM_015052	NP_055867	Q76N89	HECW1_HUMAN	NEDD4-like ubiquitin-protein ligase 1	58					protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	ubiquitin-protein ligase activity			ovary(8)|lung(6)|breast(4)|skin(4)|pancreas(1)	23						GCGGCCCCCACGATGGCGTCA	0.632													29	61	---	---	---	---	capture	Silent	SNP	43351508	43351508	HECW1	7	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	6968	285
EGFR	1956	broad.mit.edu	37	7	55223543	55223543	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6661-01	TCGA-76-6661-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:55223543C>T	uc003tqk.2	+	8	1156	c.910C>T	c.(910-912)CAC>TAC	p.H304Y	EGFR_uc003tqh.2_Missense_Mutation_p.H304Y|EGFR_uc003tqi.2_Missense_Mutation_p.H304Y|EGFR_uc003tqj.2_Missense_Mutation_p.H304Y|EGFR_uc010kzg.1_Missense_Mutation_p.H259Y|EGFR_uc011kco.1_Missense_Mutation_p.H251Y|EGFR_uc011kcp.1_5'Flank|EGFR_uc011kcq.1_5'Flank	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	304	Extracellular (Potential).				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity			lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	GGTGACAGATCACGGCTCGTG	0.592		8	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			43	774	---	---	---	---	capture	Missense_Mutation	SNP	55223543	55223543	EGFR	7	C	T	T	T	1	0	0	0	0	1	0	0	0	377	29	2	2	4922	285
FZD9	8326	broad.mit.edu	37	7	72849307	72849307	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6661-01	TCGA-76-6661-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:72849307G>A	uc003tyb.2	+	1	1199	c.970G>A	c.(970-972)GGC>AGC	p.G324S		NM_003508	NP_003499	O00144	FZD9_HUMAN	frizzled 9 precursor	324	Helical; Name=3; (Potential).				B cell differentiation|brain development|canonical Wnt receptor signaling pathway|embryo development|gonad development|neuroblast proliferation|vasculature development	cell surface|filopodium membrane|integral to membrane|perinuclear region of cytoplasm	G-protein coupled receptor activity|PDZ domain binding|protein heterodimerization activity|protein homodimerization activity|Wnt receptor activity|Wnt-protein binding			central_nervous_system(1)	1		Lung NSC(55;0.0659)|all_lung(88;0.152)				CTACTACTTCGGCATGGCCAG	0.657													44	76	---	---	---	---	capture	Missense_Mutation	SNP	72849307	72849307	FZD9	7	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	6079	285
SEMA3E	9723	broad.mit.edu	37	7	82997104	82997104	+	Missense_Mutation	SNP	C	A	A			TCGA-76-6661-01	TCGA-76-6661-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:82997104C>A	uc003uhy.1	-	17	2592	c.2126G>T	c.(2125-2127)TGG>TTG	p.W709L		NM_012431	NP_036563	O15041	SEM3E_HUMAN	semaphorin 3E precursor	709					axon guidance	extracellular space|membrane	receptor activity			ovary(3)	3		Medulloblastoma(109;0.109)				TTCCTTGTACCATGGTTTTGC	0.463													4	139	---	---	---	---	capture	Missense_Mutation	SNP	82997104	82997104	SEMA3E	7	C	A	A	A	1	0	0	0	0	1	0	0	0	273	21	4	4	13921	285
CYP3A5	1577	broad.mit.edu	37	7	99261679	99261679	+	Missense_Mutation	SNP	T	G	G			TCGA-76-6661-01	TCGA-76-6661-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:99261679T>G	uc003urq.2	-	8	797	c.710A>C	c.(709-711)AAT>ACT	p.N237T	ZNF498_uc003urn.2_Intron|CYP3A5_uc003urp.2_Missense_Mutation_p.N57T|CYP3A5_uc003urr.2_Missense_Mutation_p.N124T|CYP3A5_uc011kiy.1_Missense_Mutation_p.N227T|CYP3A5_uc003urs.2_Intron|CYP3A5_uc010lgg.2_Intron	NM_000777	NP_000768	P20815	CP3A5_HUMAN	cytochrome P450, family 3, subfamily A,	237					alkaloid catabolic process|drug catabolic process|oxidative demethylation|steroid metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding|oxygen binding				0	all_epithelial(64;2.77e-08)|Lung NSC(181;0.00396)|all_lung(186;0.00659)|Esophageal squamous(72;0.0166)				Alfentanil(DB00802)|Clopidogrel(DB00758)|Cyclosporine(DB00091)|Daunorubicin(DB00694)|Indinavir(DB00224)|Irinotecan(DB00762)|Ketoconazole(DB01026)|Lapatinib(DB01259)|Mephenytoin(DB00532)|Midazolam(DB00683)|Mifepristone(DB00834)|Phenytoin(DB00252)|Quinine(DB00468)|Saquinavir(DB01232)|Tacrolimus(DB00864)|Troleandomycin(DB01361)|Verapamil(DB00661)|Vincristine(DB00541)	CAGAGAGACATTTAATGCTTC	0.328													20	57	---	---	---	---	capture	Missense_Mutation	SNP	99261679	99261679	CYP3A5	7	T	G	G	G	1	0	0	0	0	1	0	0	0	676	52	4	4	4140	285
ASZ1	136991	broad.mit.edu	37	7	117067470	117067470	+	Silent	SNP	G	A	A			TCGA-76-6661-01	TCGA-76-6661-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:117067470G>A	uc003vjb.2	-	1	108	c.45C>T	c.(43-45)GGC>GGT	p.G15G	ASZ1_uc011kno.1_Silent_p.G15G|ASZ1_uc011knp.1_5'UTR	NM_130768	NP_570124	Q8WWH4	ASZ1_HUMAN	ankyrin repeat, SAM and basic leucine zipper	15					cell differentiation|DNA methylation involved in gamete generation|gene silencing by RNA|male meiosis|multicellular organismal development|piRNA metabolic process|spermatogenesis	pi-body	signal transducer activity			central_nervous_system(2)|ovary(1)	3	Lung NSC(10;0.00156)|all_lung(10;0.00175)		STAD - Stomach adenocarcinoma(10;0.000512)			CGCTACTCTCGCCTCCGCCAG	0.662											OREG0003439	type=REGULATORY REGION|Gene=ASZ1|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	16	46	---	---	---	---	capture	Silent	SNP	117067470	117067470	ASZ1	7	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	1060	285
CHPF2	54480	broad.mit.edu	37	7	150934492	150934492	+	Silent	SNP	C	G	G			TCGA-76-6661-01	TCGA-76-6661-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:150934492C>G	uc003wjr.1	+	4	2557	c.1044C>G	c.(1042-1044)CCC>CCG	p.P348P	CHPF2_uc003wjq.1_Silent_p.P340P|MIR671_hsa-mir-671|MI0003760_5'Flank	NM_019015	NP_061888	Q9P2E5	CHPF2_HUMAN	chondroitin polymerizing factor 2	348	Lumenal (Potential).					Golgi cisterna membrane|integral to membrane	N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity			ovary(1)	1						TGCTGACCCCCGAAGGGGAGG	0.602													27	72	---	---	---	---	capture	Silent	SNP	150934492	150934492	CHPF2	7	C	G	G	G	1	0	0	0	0	0	0	0	1	288	23	4	4	3334	285
RP1L1	94137	broad.mit.edu	37	8	10469501	10469501	+	Nonsense_Mutation	SNP	G	A	A			TCGA-76-6661-01	TCGA-76-6661-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:10469501G>A	uc003wtc.2	-	4	2336	c.2107C>T	c.(2107-2109)CGA>TGA	p.R703*		NM_178857	NP_849188	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	703					intracellular signal transduction					ovary(4)|breast(3)|central_nervous_system(1)	8				COAD - Colon adenocarcinoma(149;0.0811)		CCAGAATATCGTGGCACTGAG	0.617													18	34	---	---	---	---	capture	Nonsense_Mutation	SNP	10469501	10469501	RP1L1	8	G	A	A	A	1	0	0	0	0	0	1	0	0	519	40	5	1	13425	285
BLK	640	broad.mit.edu	37	8	11406564	11406564	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6661-01	TCGA-76-6661-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:11406564G>A	uc003wty.2	+	5	882	c.301G>A	c.(301-303)GTC>ATC	p.V101I	BLK_uc003wtz.2_Missense_Mutation_p.V30I	NM_001715	NP_001706	P51451	BLK_HUMAN	B lymphoid tyrosine kinase	101	SH3.				intracellular protein kinase cascade|positive regulation of insulin secretion		ATP binding|non-membrane spanning protein tyrosine kinase activity			large_intestine(1)|stomach(1)|ovary(1)	3			STAD - Stomach adenocarcinoma(15;0.00391)	COAD - Colon adenocarcinoma(149;0.207)		CAGGTCACTCGTCACAGGAAG	0.592													3	22	---	---	---	---	capture	Missense_Mutation	SNP	11406564	11406564	BLK	8	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	1432	285
SPATC1	375686	broad.mit.edu	37	8	145095802	145095802	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6661-01	TCGA-76-6661-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:145095802G>A	uc011lkw.1	+	3	1202	c.1100G>A	c.(1099-1101)CGA>CAA	p.R367Q	SPATC1_uc011lkx.1_Missense_Mutation_p.R367Q	NM_198572	NP_940974	Q76KD6	SPERI_HUMAN	spermatogenesis and centriole associated 1	367										ovary(1)|central_nervous_system(1)	2	all_cancers(97;8.2e-11)|all_epithelial(106;1.1e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;6.79e-41)|Epithelial(56;1.02e-39)|all cancers(56;3.67e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			CCCCCTTCCCGAATGCATAAT	0.527													17	32	---	---	---	---	capture	Missense_Mutation	SNP	145095802	145095802	SPATC1	8	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	14909	285
PIP5KL1	138429	broad.mit.edu	37	9	130689473	130689473	+	Silent	SNP	G	A	A			TCGA-76-6661-01	TCGA-76-6661-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:130689473G>A	uc011mao.1	-	7	654	c.609C>T	c.(607-609)GTC>GTT	p.V203V	PIP5KL1_uc004bsu.2_5'UTR	NM_001135219	NP_001128691	Q5T9C9	PI5L1_HUMAN	phosphatidylinositol-4-phosphate 5-kinase-like 1	203	PIPK.					cytoplasm|membrane	1-phosphatidylinositol-4-phosphate 5-kinase activity|ATP binding			lung(1)|kidney(1)	2						CGCTCTGCATGACGATGAAGT	0.697													12	30	---	---	---	---	capture	Silent	SNP	130689473	130689473	PIP5KL1	9	G	A	A	A	1	0	0	0	0	0	0	0	1	574	45	2	2	11845	285
MAGEC3	139081	broad.mit.edu	37	X	140983301	140983301	+	Missense_Mutation	SNP	G	A	A			TCGA-76-6661-01	TCGA-76-6661-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:140983301G>A	uc011mwp.1	+	6	1079	c.1079G>A	c.(1078-1080)CGC>CAC	p.R360H	MAGEC3_uc004fbs.2_Intron|MAGEC3_uc010nsj.2_5'Flank	NM_138702	NP_619647	Q8TD91	MAGC3_HUMAN	melanoma antigen family C, 3 isoform 1	360	MAGE 1.									skin(2)|central_nervous_system(1)	3	Acute lymphoblastic leukemia(192;6.56e-05)					GAAGATGGCCGCCGAGGGCTG	0.607													16	4	---	---	---	---	capture	Missense_Mutation	SNP	140983301	140983301	MAGEC3	23	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	9096	285
ARHGAP4	393	broad.mit.edu	37	X	153175809	153175809	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6661-01	TCGA-76-6661-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:153175809C>T	uc004fjk.1	-	17	2014	c.1972G>A	c.(1972-1974)GTG>ATG	p.V658M	ARHGAP4_uc004fjj.1_Missense_Mutation_p.V9M|ARHGAP4_uc011mzf.1_Missense_Mutation_p.V635M|ARHGAP4_uc004fjl.1_Missense_Mutation_p.V698M|ARHGAP4_uc010nup.1_Intron	NM_001666	NP_001657	P98171	RHG04_HUMAN	Rho GTPase activating protein 4 isoform 2	658	Rho-GAP.				apoptosis|cytoskeleton organization|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|Rho protein signal transduction	cytosol|focal adhesion|nucleus	Rho GTPase activator activity|Rho guanyl-nucleotide exchange factor activity|SH3/SH2 adaptor activity			central_nervous_system(1)	1	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					CCGAAGCACACGGCCAGGTTG	0.677													18	5	---	---	---	---	capture	Missense_Mutation	SNP	153175809	153175809	ARHGAP4	23	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	878	285
PCDH11Y	83259	broad.mit.edu	37	Y	4966872	4966872	+	Missense_Mutation	SNP	C	T	T			TCGA-76-6661-01	TCGA-76-6661-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrY:4966872C>T	uc004fqo.2	+	2	1987	c.1253C>T	c.(1252-1254)ACG>ATG	p.T418M	PCDH11Y_uc010nwg.1_Missense_Mutation_p.T407M|PCDH11Y_uc004fql.1_Missense_Mutation_p.T407M|PCDH11Y_uc004fqm.1_Missense_Mutation_p.T407M|PCDH11Y_uc004fqn.1_Missense_Mutation_p.T418M|PCDH11Y_uc004fqp.1_Missense_Mutation_p.T189M	NM_032973	NP_116755	Q9BZA8	PC11Y_HUMAN	protocadherin 11 Y-linked isoform c	418	Cadherin 4.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0						ATAACTGTGACGGATAAGGAT	0.413													24	3	---	---	---	---	capture	Missense_Mutation	SNP	4966872	4966872	PCDH11Y	24	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	11412	285
NEDD4L	23327	broad.mit.edu	37	18	55916158	55916158	+	Frame_Shift_Del	DEL	T	-	-			TCGA-76-6661-01	TCGA-76-6661-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:55916158delT	uc002lgy.2	+	4	506	c.232delT	c.(232-234)TTTfs	p.F78fs	NEDD4L_uc002lgz.2_Frame_Shift_Del_p.F78fs|NEDD4L_uc002lgx.2_Frame_Shift_Del_p.F78fs|NEDD4L_uc010xee.1_5'UTR|NEDD4L_uc002lhc.2_Frame_Shift_Del_p.F70fs|NEDD4L_uc002lhd.2_5'UTR|NEDD4L_uc002lhb.2_5'UTR|NEDD4L_uc002lhe.2_Frame_Shift_Del_p.F70fs|NEDD4L_uc002lhf.2_5'UTR|NEDD4L_uc010dpl.1_RNA|NEDD4L_uc002lhg.2_5'UTR|NEDD4L_uc002lhh.2_5'UTR	NM_001144967	NP_001138439	Q96PU5	NED4L_HUMAN	neural precursor cell expressed, developmentally	78	C2.				cellular sodium ion homeostasis|excretion|interspecies interaction between organisms|positive regulation of endocytosis|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of protein catabolic process|response to metal ion|sodium ion transport|water homeostasis	cytoplasm	protein binding|sodium channel regulator activity|ubiquitin-protein ligase activity			lung(4)	4						GAATGAAGAATTTTATTTCAG	0.313													2	4	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	55916158	55916158	NEDD4L	18	T	-	-	-	1	0	1	0	1	0	0	0	0	676	52	5	5	10218	285
