Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
THAP3	90326	broad.mit.edu	37	1	6692962	6692962	+	Missense_Mutation	SNP	T	C	C			TCGA-81-5911-01	TCGA-81-5911-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:6692962T>C	uc001aoc.2	+	6	704	c.545T>C	c.(544-546)CTT>CCT	p.L182P	THAP3_uc001aod.2_Missense_Mutation_p.L181P|THAP3_uc001aoe.1_Intron			Q8WTV1	THAP3_HUMAN	RecName: Full=THAP domain-containing protein 3;	182							DNA binding|metal ion binding				0	Ovarian(185;0.0212)|all_lung(157;0.154)	all_cancers(23;7.39e-28)|all_epithelial(116;1.76e-17)|all_lung(118;2.27e-05)|Lung NSC(185;9.97e-05)|Renal(390;0.00188)|Breast(487;0.00289)|Colorectal(325;0.00342)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.156)		Colorectal(212;1.29e-07)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(185;4.89e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000513)|KIRC - Kidney renal clear cell carcinoma(229;0.000896)|STAD - Stomach adenocarcinoma(132;0.0167)|READ - Rectum adenocarcinoma(331;0.0642)		AGCTATGCCCTTTTGGACTTA	0.567													3	124	---	---	---	---	capture	Missense_Mutation	SNP	6692962	6692962	THAP3	1	T	C	C	C	1	0	0	0	0	1	0	0	0	716	56	3	3	15730	290
NOTCH2	4853	broad.mit.edu	37	1	120512286	120512286	+	Missense_Mutation	SNP	T	C	C	rs144936899		TCGA-81-5911-01	TCGA-81-5911-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:120512286T>C	uc001eik.2	-	6	1212	c.956A>G	c.(955-957)AAT>AGT	p.N319S	NOTCH2_uc001eil.2_Missense_Mutation_p.N319S|NOTCH2_uc001eim.3_Missense_Mutation_p.N236S	NM_024408	NP_077719	Q04721	NOTC2_HUMAN	notch 2 preproprotein	319	Extracellular (Potential).|EGF-like 8; calcium-binding (Potential).				anti-apoptosis|bone remodeling|cell cycle arrest|cell fate determination|cell growth|hemopoiesis|induction of apoptosis|negative regulation of cell proliferation|nervous system development|Notch receptor processing|Notch signaling pathway|organ morphogenesis|positive regulation of Ras protein signal transduction|regulation of transcription, DNA-dependent|stem cell maintenance|transcription, DNA-dependent	cell surface|cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to plasma membrane|nucleoplasm	calcium ion binding|ligand-regulated transcription factor activity|protein binding|receptor activity			lung(8)|haematopoietic_and_lymphoid_tissue(7)|ovary(4)|central_nervous_system(2)|skin(2)|kidney(2)|breast(1)|prostate(1)	27	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		ATAGCCTCCATTGCGGTTGGC	0.532			N|F|Mis		marginal zone lymphoma|DLBCL				Alagille_Syndrome				40	44	---	---	---	---	capture	Missense_Mutation	SNP	120512286	120512286	NOTCH2	1	T	C	C	C	1	0	0	0	0	1	0	0	0	676	52	3	3	10455	290
NBPF10	100132406	broad.mit.edu	37	1	145293478	145293478	+	Missense_Mutation	SNP	C	T	T			TCGA-81-5911-01	TCGA-81-5911-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:145293478C>T	uc001end.3	+	1	108	c.73C>T	c.(73-75)CGC>TGC	p.R25C	NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|NBPF10_uc001emp.3_Missense_Mutation_p.R25C|NOTCH2NL_uc010oyh.1_RNA|NBPF10_uc001emq.1_Missense_Mutation_p.R25C	NM_001039703	NP_001034792	A6NDV3	A6NDV3_HUMAN	hypothetical protein LOC100132406	25											0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		CGAGACATTGCGCCCCCAGCT	0.502													7	835	---	---	---	---	capture	Missense_Mutation	SNP	145293478	145293478	NBPF10	1	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	10100	290
TCHH	7062	broad.mit.edu	37	1	152081317	152081317	+	Missense_Mutation	SNP	C	T	T			TCGA-81-5911-01	TCGA-81-5911-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:152081317C>T	uc001ezp.2	-	2	4376	c.4376G>A	c.(4375-4377)CGT>CAT	p.R1459H	TCHH_uc009wne.1_Missense_Mutation_p.R1459H	NM_007113	NP_009044	Q07283	TRHY_HUMAN	trichohyalin	1459	23 X 26 AA approximate tandem repeats.				keratinization	cytoskeleton	calcium ion binding			ovary(3)|kidney(1)|central_nervous_system(1)	5	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TTTTCTGTGACGCTCCTGGCG	0.547													4	134	---	---	---	---	capture	Missense_Mutation	SNP	152081317	152081317	TCHH	1	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	15585	290
PTEN	5728	broad.mit.edu	37	10	89692923	89692923	+	Missense_Mutation	SNP	G	A	A			TCGA-81-5911-01	TCGA-81-5911-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:89692923G>A	uc001kfb.2	+	6	1438	c.407G>A	c.(406-408)TGT>TAT	p.C136Y		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog	136	Phosphatase tensin-type.		C -> Y (in CD; loss of phosphatase activity towards Ins(1,3,4,5)P3).		activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.C136Y(7)|p.R55fs*1(4)|p.C136F(3)|p.C136fs*1(2)|p.C136R(2)|p.?(2)|p.Y27fs*1(2)|p.Y27_N212>Y(2)|p.I135_A137>T(1)|p.A121_F145del(1)|p.I135fs*6(1)|p.C136_A137insGM(1)|p.C136W(1)|p.T131fs*42(1)|p.F56fs*2(1)		endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		GTAATGATATGTGCATATTTA	0.393		31	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			35	20	---	---	---	---	capture	Missense_Mutation	SNP	89692923	89692923	PTEN	10	G	A	A	A	1	0	0	0	0	1	0	0	0	624	48	2	2	12633	290
OR4C11	219429	broad.mit.edu	37	11	55371120	55371120	+	Missense_Mutation	SNP	C	G	G			TCGA-81-5911-01	TCGA-81-5911-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:55371120C>G	uc010rii.1	-	1	730	c.730G>C	c.(730-732)GTA>CTA	p.V244L		NM_001004700	NP_001004700	Q6IEV9	OR4CB_HUMAN	olfactory receptor, family 4, subfamily C,	244	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1						AAGATGACTACAATTATGTGA	0.408													3	35	---	---	---	---	capture	Missense_Mutation	SNP	55371120	55371120	OR4C11	11	C	G	G	G	1	0	0	0	0	1	0	0	0	221	17	4	4	10949	290
OR5D13	390142	broad.mit.edu	37	11	55541619	55541619	+	Missense_Mutation	SNP	C	T	T			TCGA-81-5911-01	TCGA-81-5911-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:55541619C>T	uc010ril.1	+	1	706	c.706C>T	c.(706-708)CGC>TGC	p.R236C		NM_001001967	NP_001001967	Q8NGL4	OR5DD_HUMAN	olfactory receptor, family 5, subfamily D,	236	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|pancreas(1)|skin(1)	3		all_epithelial(135;0.196)				TGCAAGTGGGCGCCAGAAAAC	0.408													36	73	---	---	---	---	capture	Missense_Mutation	SNP	55541619	55541619	OR5D13	11	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	11058	290
OR5AS1	219447	broad.mit.edu	37	11	55798503	55798503	+	Silent	SNP	C	T	T			TCGA-81-5911-01	TCGA-81-5911-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:55798503C>T	uc010riw.1	+	1	609	c.609C>T	c.(607-609)TGC>TGT	p.C203C		NM_001001921	NP_001001921	Q8N127	O5AS1_HUMAN	olfactory receptor, family 5, subfamily AS,	203	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(3)|liver(1)|skin(1)	5	Esophageal squamous(21;0.00693)					TTGCTTTGTGCAGCTTCATCC	0.423													5	274	---	---	---	---	capture	Silent	SNP	55798503	55798503	OR5AS1	11	C	T	T	T	1	0	0	0	0	0	0	0	1	324	25	2	2	11050	290
FADS2	9415	broad.mit.edu	37	11	61615699	61615699	+	Silent	SNP	G	A	A			TCGA-81-5911-01	TCGA-81-5911-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:61615699G>A	uc001nsl.1	+	5	837	c.687G>A	c.(685-687)AAG>AAA	p.K229K	FADS2_uc001nsj.2_Silent_p.K207K|FADS2_uc010rlo.1_Silent_p.K198K|FADS2_uc001nsk.2_Silent_p.K229K	NM_004265	NP_004256	O95864	FADS2_HUMAN	fatty acid desaturase 2	229	Cytoplasmic (Potential).				electron transport chain|transport|unsaturated fatty acid biosynthetic process	endoplasmic reticulum membrane|integral to plasma membrane|membrane fraction	heme binding			ovary(1)|pancreas(1)	2					Alpha-Linolenic Acid(DB00132)	TCTTCCACAAGGATCCCGATG	0.557													31	52	---	---	---	---	capture	Silent	SNP	61615699	61615699	FADS2	11	G	A	A	A	1	0	0	0	0	0	0	0	1	451	35	2	2	5320	290
CWF19L2	143884	broad.mit.edu	37	11	107224390	107224390	+	Missense_Mutation	SNP	G	A	A	rs146937549	by1000genomes	TCGA-81-5911-01	TCGA-81-5911-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:107224390G>A	uc010rvp.1	-	13	1975	c.1945C>T	c.(1945-1947)CGT>TGT	p.R649C	CWF19L2_uc001pjh.3_RNA|CWF19L2_uc009yxo.2_RNA	NM_152434	NP_689647	Q2TBE0	C19L2_HUMAN	CWF19-like 2, cell cycle control	649	Potential.						catalytic activity				0		Melanoma(852;1.75e-05)|all_epithelial(67;6.27e-05)|Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Breast(348;0.0258)		Epithelial(105;7.18e-06)|BRCA - Breast invasive adenocarcinoma(274;1.65e-05)|all cancers(92;1.76e-05)		TCACCAAGACGTTCTCTCTCA	0.403													55	75	---	---	---	---	capture	Missense_Mutation	SNP	107224390	107224390	CWF19L2	11	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	4032	290
CACNA1C	775	broad.mit.edu	37	12	2795380	2795380	+	Missense_Mutation	SNP	G	A	A			TCGA-81-5911-01	TCGA-81-5911-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:2795380G>A	uc009zdu.1	+	48	6291	c.5978G>A	c.(5977-5979)CGA>CAA	p.R1993Q	CACNA1C_uc009zdv.1_Missense_Mutation_p.R1907Q|CACNA1C_uc001qkb.2_Missense_Mutation_p.R1910Q|CACNA1C_uc001qkc.2_Missense_Mutation_p.R1929Q|CACNA1C_uc001qke.2_Missense_Mutation_p.R1899Q|CACNA1C_uc001qkf.2_Missense_Mutation_p.R1918Q|CACNA1C_uc001qjz.2_Missense_Mutation_p.R1910Q|CACNA1C_uc001qkd.2_Missense_Mutation_p.R1929Q|CACNA1C_uc001qkg.2_Missense_Mutation_p.R1916Q|CACNA1C_uc009zdw.1_Missense_Mutation_p.R1951Q|CACNA1C_uc001qkh.2_Missense_Mutation_p.R1918Q|CACNA1C_uc001qkl.2_Missense_Mutation_p.R1958Q|CACNA1C_uc001qkn.2_Missense_Mutation_p.R1910Q|CACNA1C_uc001qko.2_Missense_Mutation_p.R1930Q|CACNA1C_uc001qkp.2_Missense_Mutation_p.R1910Q|CACNA1C_uc001qkr.2_Missense_Mutation_p.R1927Q|CACNA1C_uc001qku.2_Missense_Mutation_p.R1945Q|CACNA1C_uc001qkq.2_Missense_Mutation_p.R1938Q|CACNA1C_uc001qks.2_Missense_Mutation_p.R1910Q|CACNA1C_uc001qkt.2_Missense_Mutation_p.R1929Q|CACNA1C_uc001qki.1_Missense_Mutation_p.R1717Q|CACNA1C_uc001qkj.1_Missense_Mutation_p.R1681Q|CACNA1C_uc001qkk.1_Missense_Mutation_p.R1646Q|CACNA1C_uc001qkm.1_Missense_Mutation_p.R1706Q|CACNA1C_uc010sea.1_Missense_Mutation_p.R601Q|uc001qkx.1_Intron|CACNA1C_uc001qky.1_Missense_Mutation_p.R228Q	NM_199460	NP_955630	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type,	1993	Cytoplasmic (Potential).				axon guidance|calcium ion transport into cytosol|energy reserve metabolic process|regulation of insulin secretion	cytoplasm|postsynaptic density|voltage-gated calcium channel complex	calmodulin binding|voltage-gated calcium channel activity			ovary(10)|central_nervous_system(1)	11			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Mibefradil(DB01388)|Nicardipine(DB00622)|Verapamil(DB00661)	CAGAAGGACCGAGGGGGAGAC	0.582													44	88	---	---	---	---	capture	Missense_Mutation	SNP	2795380	2795380	CACNA1C	12	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	2516	290
RB1	5925	broad.mit.edu	37	13	48934208	48934208	+	Nonsense_Mutation	SNP	T	A	A			TCGA-81-5911-01	TCGA-81-5911-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:48934208T>A	uc001vcb.2	+	7	829	c.663T>A	c.(661-663)TGT>TGA	p.C221*	RB1_uc010acs.1_RNA|RB1_uc010act.1_5'UTR	NM_000321	NP_000312	P06400	RB_HUMAN	retinoblastoma 1	221					androgen receptor signaling pathway|cell cycle arrest|chromatin remodeling|G1 phase of mitotic cell cycle|interspecies interaction between organisms|maintenance of mitotic sister chromatid cohesion|mitotic cell cycle G1/S transition checkpoint|myoblast differentiation|negative regulation of cell growth|negative regulation of protein kinase activity|negative regulation of S phase of mitotic cell cycle|negative regulation of sequence-specific DNA binding transcription factor activity|positive regulation of mitotic metaphase/anaphase transition|protein localization to chromosome, centromeric region|Ras protein signal transduction|regulation of centromere complex assembly|regulation of cohesin localization to chromatin|regulation of lipid kinase activity|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle|sister chromatid biorientation	chromatin|PML body|Rb-E2F complex|SWI/SNF complex	androgen receptor binding|DNA binding|kinase binding|phosphoprotein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription factor binding|ubiquitin protein ligase binding	p.?(5)		lung(94)|eye(89)|central_nervous_system(47)|bone(22)|breast(21)|urinary_tract(17)|haematopoietic_and_lymphoid_tissue(14)|ovary(10)|prostate(9)|soft_tissue(8)|skin(7)|endometrium(5)|cervix(3)|liver(3)|salivary_gland(2)|stomach(2)|oesophagus(1)|adrenal_gland(1)|kidney(1)|gastrointestinal_tract_(site_indeterminate)(1)|pituitary(1)	358		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	TAATGCTATGTGTCCTTGACT	0.289		6	D|Mis|N|F|S		retinoblastoma|sarcoma|breast|small cell lung	retinoblastoma|sarcoma|breast|small cell lung			Hereditary_Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)			24	13	---	---	---	---	capture	Nonsense_Mutation	SNP	48934208	48934208	RB1	13	T	A	A	A	1	0	0	0	0	0	1	0	0	764	59	5	4	12993	290
C15orf42	90381	broad.mit.edu	37	15	90161424	90161424	+	Missense_Mutation	SNP	C	A	A			TCGA-81-5911-01	TCGA-81-5911-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:90161424C>A	uc002boe.2	+	17	3002	c.3002C>A	c.(3001-3003)TCC>TAC	p.S1001Y		NM_152259	NP_689472	Q7Z2Z1	TICRR_HUMAN	leucine-rich repeat kinase 1	1001					cell cycle|DNA repair|DNA replication|formation of translation preinitiation complex|G2/M transition checkpoint|mitotic cell cycle DNA replication checkpoint|regulation of DNA-dependent DNA replication initiation|response to ionizing radiation	nucleus	chromatin binding|protein binding			ovary(4)|central_nervous_system(2)|skin(1)	7	Lung NSC(78;0.0237)|all_lung(78;0.0478)		BRCA - Breast invasive adenocarcinoma(143;0.128)			GTTGAAGAGTCCCCTGAAAAA	0.388													78	177	---	---	---	---	capture	Missense_Mutation	SNP	90161424	90161424	C15orf42	15	C	A	A	A	1	0	0	0	0	1	0	0	0	390	30	4	4	1782	290
ACSM2B	348158	broad.mit.edu	37	16	20554273	20554273	+	Missense_Mutation	SNP	G	A	A			TCGA-81-5911-01	TCGA-81-5911-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:20554273G>A	uc002dhj.3	-	13	1682	c.1472C>T	c.(1471-1473)ACG>ATG	p.T491M	ACSM2B_uc002dhk.3_Missense_Mutation_p.T491M|ACSM2B_uc010bwf.1_Missense_Mutation_p.T491M	NM_182617	NP_872423	Q68CK6	ACS2B_HUMAN	acyl-CoA synthetase medium-chain family member	491					fatty acid metabolic process|xenobiotic metabolic process	mitochondrial matrix	ATP binding|butyrate-CoA ligase activity|CoA-ligase activity|metal ion binding			skin(3)|ovary(1)|central_nervous_system(1)	5						GATCACAGCCGTCTCAACCAC	0.517													20	48	---	---	---	---	capture	Missense_Mutation	SNP	20554273	20554273	ACSM2B	16	G	A	A	A	1	0	0	0	0	1	0	0	0	520	40	1	1	184	290
ATP2A3	489	broad.mit.edu	37	17	3851127	3851127	+	Missense_Mutation	SNP	T	A	A			TCGA-81-5911-01	TCGA-81-5911-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:3851127T>A	uc002fxb.1	-	8	804	c.653A>T	c.(652-654)AAA>ATA	p.K218I	ATP2A3_uc002fwx.1_Missense_Mutation_p.K218I|ATP2A3_uc002fwy.1_Missense_Mutation_p.K218I|ATP2A3_uc002fwz.1_Missense_Mutation_p.K218I|ATP2A3_uc002fxa.1_Missense_Mutation_p.K218I|ATP2A3_uc002fxc.1_Missense_Mutation_p.K218I|ATP2A3_uc002fxd.1_Missense_Mutation_p.K218I	NM_174955	NP_777615	Q93084	AT2A3_HUMAN	ATPase, Ca++ transporting, ubiquitous isoform b	218	Cytoplasmic (By similarity).				ATP biosynthetic process|platelet activation	integral to membrane|nuclear membrane|platelet dense tubular network membrane|sarcoplasmic reticulum membrane	ATP binding|calcium-transporting ATPase activity|metal ion binding|protein binding			ovary(3)|breast(1)|central_nervous_system(1)	5				LUAD - Lung adenocarcinoma(1115;0.000692)|Lung(3;0.0766)		ACCCACCGCTTTGCCCGATGT	0.682													10	21	---	---	---	---	capture	Missense_Mutation	SNP	3851127	3851127	ATP2A3	17	T	A	A	A	1	0	0	0	0	1	0	0	0	832	64	4	4	1129	290
ANKFN1	162282	broad.mit.edu	37	17	54450196	54450196	+	Missense_Mutation	SNP	A	T	T			TCGA-81-5911-01	TCGA-81-5911-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:54450196A>T	uc002iun.1	+	6	835	c.800A>T	c.(799-801)CAT>CTT	p.H267L		NM_153228	NP_694960	Q8N957	ANKF1_HUMAN	ankyrin-repeat and fibronectin type III domain	267										large_intestine(1)|ovary(1)	2						GGCTTTGAGCATGCCAGTGAG	0.433													11	96	---	---	---	---	capture	Missense_Mutation	SNP	54450196	54450196	ANKFN1	17	A	T	T	T	1	0	0	0	0	1	0	0	0	104	8	4	4	622	290
CYB561	1534	broad.mit.edu	37	17	61514742	61514742	+	Missense_Mutation	SNP	C	A	A			TCGA-81-5911-01	TCGA-81-5911-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:61514742C>A	uc002jap.2	-	1	569	c.167G>T	c.(166-168)TGC>TTC	p.C56F	CYB561_uc002jaq.2_Missense_Mutation_p.C102F|CYB561_uc002jar.2_Missense_Mutation_p.C56F|CYB561_uc002jas.2_Missense_Mutation_p.C56F|CYB561_uc010ddt.2_Missense_Mutation_p.C56F|CYB561_uc002jat.2_Missense_Mutation_p.C56F|CYB561_uc010wpf.1_Missense_Mutation_p.C56F|CYB561_uc010wpg.1_Missense_Mutation_p.C27F	NM_001915	NP_001906	P49447	CY561_HUMAN	cytochrome b-561	56	Helical; (Potential).|Cytochrome b561.				electron transport chain|transport	integral to plasma membrane	cytochrome-b5 reductase activity|ferric-chelate reductase activity|metal ion binding			ovary(1)	1				READ - Rectum adenocarcinoma(1115;0.0689)		TATGACCATGCAGAGGGGGTG	0.647													29	51	---	---	---	---	capture	Missense_Mutation	SNP	61514742	61514742	CYB561	17	C	A	A	A	1	0	0	0	0	1	0	0	0	325	25	4	4	4079	290
CCDC45	90799	broad.mit.edu	37	17	62532771	62532771	+	Nonsense_Mutation	SNP	C	T	T			TCGA-81-5911-01	TCGA-81-5911-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:62532771C>T	uc002jem.2	+	18	2180	c.2122C>T	c.(2122-2124)CGA>TGA	p.R708*	CCDC45_uc002jen.2_RNA|CCDC45_uc010wqb.1_Nonsense_Mutation_p.R544*	NM_138363	NP_612372	Q96GE4	CEP95_HUMAN	coiled-coil domain containing 45	708	Potential.					centrosome|spindle pole	protein binding				0	Breast(5;1.32e-14)		BRCA - Breast invasive adenocarcinoma(8;8.6e-12)			GCAAAGATTACGAGACCTAAG	0.373													37	55	---	---	---	---	capture	Nonsense_Mutation	SNP	62532771	62532771	CCDC45	17	C	T	T	T	1	0	0	0	0	0	1	0	0	243	19	5	1	2790	290
FPR2	2358	broad.mit.edu	37	19	52272612	52272612	+	Missense_Mutation	SNP	T	C	C			TCGA-81-5911-01	TCGA-81-5911-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:52272612T>C	uc002pxr.2	+	2	746	c.701T>C	c.(700-702)ATT>ACT	p.I234T	FPR2_uc002pxs.3_Missense_Mutation_p.I234T|FPR2_uc010epf.2_Missense_Mutation_p.I234T	NM_001005738	NP_001005738	P25090	FPR2_HUMAN	formyl peptide receptor-like 1	234	Cytoplasmic (Potential).				cell adhesion|cellular component movement|chemotaxis|inflammatory response	integral to membrane|plasma membrane	N-formyl peptide receptor activity			lung(3)|ovary(1)	4						AAGGGCATGATTAAATCCAGC	0.507													4	83	---	---	---	---	capture	Missense_Mutation	SNP	52272612	52272612	FPR2	19	T	C	C	C	1	0	0	0	0	1	0	0	0	676	52	3	3	5983	290
LILRA4	23547	broad.mit.edu	37	19	54848923	54848923	+	Missense_Mutation	SNP	C	T	T			TCGA-81-5911-01	TCGA-81-5911-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:54848923C>T	uc002qfj.2	-	5	757	c.700G>A	c.(700-702)GTG>ATG	p.V234M	LILRA4_uc002qfi.2_Missense_Mutation_p.V168M	NM_012276	NP_036408	P59901	LIRA4_HUMAN	leukocyte immunoglobulin-like receptor subfamily	234	Extracellular (Potential).|Ig-like C2-type 3.					integral to membrane	receptor activity			upper_aerodigestive_tract(1)|central_nervous_system(1)	2	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.0565)		CCGGGGGTCACGACAGGGCCC	0.647													17	48	---	---	---	---	capture	Missense_Mutation	SNP	54848923	54848923	LILRA4	19	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	8707	290
LAIR1	3903	broad.mit.edu	37	19	54872745	54872745	+	Missense_Mutation	SNP	C	T	T			TCGA-81-5911-01	TCGA-81-5911-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:54872745C>T	uc002qfk.1	-	3	452	c.142G>A	c.(142-144)GTG>ATG	p.V48M	LAIR1_uc002qfl.1_Missense_Mutation_p.V48M|LAIR1_uc002qfm.1_Missense_Mutation_p.V47M|LAIR1_uc002qfn.1_Missense_Mutation_p.V47M|LAIR1_uc010yex.1_Missense_Mutation_p.V41M|LAIR1_uc002qfo.2_Missense_Mutation_p.V30M	NM_002287	NP_002278	Q6GTX8	LAIR1_HUMAN	leukocyte-associated immunoglobulin-like	48	Extracellular (Potential).|Ig-like C2-type.					integral to membrane|plasma membrane	protein binding|receptor activity			ovary(4)	4	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.0573)		CCCCGGCACACGAAAGTCACA	0.567													39	163	---	---	---	---	capture	Missense_Mutation	SNP	54872745	54872745	LAIR1	19	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	8522	290
SOS1	6654	broad.mit.edu	37	2	39234297	39234297	+	Missense_Mutation	SNP	C	A	A			TCGA-81-5911-01	TCGA-81-5911-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:39234297C>A	uc002rrk.3	-	16	2589	c.2548G>T	c.(2548-2550)GCT>TCT	p.A850S	SOS1_uc002rrj.3_Missense_Mutation_p.A464S	NM_005633	NP_005624	Q07889	SOS1_HUMAN	son of sevenless homolog 1	850	Ras-GEF.				apoptosis|axon guidance|blood coagulation|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|induction of apoptosis by extracellular signals|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|Ras protein signal transduction	cytosol	DNA binding|protein binding|Rho GTPase activator activity|Rho guanyl-nucleotide exchange factor activity			ovary(4)|breast(3)|lung(2)|central_nervous_system(1)	10		all_hematologic(82;0.21)				CTCACCACAGCTACTCTTTCT	0.323									Noonan_syndrome				41	115	---	---	---	---	capture	Missense_Mutation	SNP	39234297	39234297	SOS1	2	C	A	A	A	1	0	0	0	0	1	0	0	0	364	28	4	4	14828	290
IL1RL2	8808	broad.mit.edu	37	2	102805705	102805705	+	Silent	SNP	C	T	T			TCGA-81-5911-01	TCGA-81-5911-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:102805705C>T	uc002tbs.2	+	3	354	c.228C>T	c.(226-228)GAC>GAT	p.D76D	IL1RL2_uc002tbt.2_Intron	NM_003854	NP_003845	Q9HB29	ILRL2_HUMAN	interleukin 1 receptor-like 2 precursor	76	Extracellular (Potential).|Ig-like C2-type 1.				cellular defense response|innate immune response	integral to plasma membrane	interleukin-1, Type I, activating receptor activity			ovary(2)	2						TTCACCAGGACGAGACTTGGA	0.398													8	21	---	---	---	---	capture	Silent	SNP	102805705	102805705	IL1RL2	2	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	7587	290
PLEKHM3	389072	broad.mit.edu	37	2	208842070	208842070	+	Missense_Mutation	SNP	G	C	C			TCGA-81-5911-01	TCGA-81-5911-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:208842070G>C	uc002vcl.2	-	3	1341	c.851C>G	c.(850-852)ACT>AGT	p.T284S	PLEKHM3_uc002vcm.2_Missense_Mutation_p.T284S	NM_001080475	NP_001073944	Q6ZWE6	PKHM3_HUMAN	pleckstrin homology domain containing, family M,	284	PH 1.				intracellular signal transduction		metal ion binding			ovary(1)	1						CTGTAGCTGAGTGTTGTCATA	0.512													24	60	---	---	---	---	capture	Missense_Mutation	SNP	208842070	208842070	PLEKHM3	2	G	C	C	C	1	0	0	0	0	1	0	0	0	468	36	4	4	11985	290
SIGLEC1	6614	broad.mit.edu	37	20	3682241	3682241	+	Missense_Mutation	SNP	C	T	T			TCGA-81-5911-01	TCGA-81-5911-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr20:3682241C>T	uc002wja.2	-	6	1276	c.1276G>A	c.(1276-1278)GGA>AGA	p.G426R	SIGLEC1_uc002wiz.3_Missense_Mutation_p.G426R	NM_023068	NP_075556	Q9BZZ2	SN_HUMAN	sialoadhesin precursor	426	Ig-like C2-type 4.|Extracellular (Potential).				cell-cell adhesion|cell-matrix adhesion|endocytosis|inflammatory response	extracellular region|integral to membrane|plasma membrane	sugar binding			pancreas(4)|ovary(2)|skin(2)|breast(1)|central_nervous_system(1)	10						CCCACAAGTCCCGCCTGGGTC	0.632													18	37	---	---	---	---	capture	Missense_Mutation	SNP	3682241	3682241	SIGLEC1	20	C	T	T	T	1	0	0	0	0	1	0	0	0	286	22	2	2	14198	290
DNAJC28	54943	broad.mit.edu	37	21	34861310	34861310	+	Missense_Mutation	SNP	G	A	A			TCGA-81-5911-01	TCGA-81-5911-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr21:34861310G>A	uc002yrv.2	-	2	840	c.391C>T	c.(391-393)CCC>TCC	p.P131S	DNAJC28_uc002yrw.2_Missense_Mutation_p.P131S	NM_017833	NP_060303	Q9NX36	DJC28_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 28	131							heat shock protein binding				0						CGGTGTTGGGGTGTTTTATAT	0.393													23	49	---	---	---	---	capture	Missense_Mutation	SNP	34861310	34861310	DNAJC28	21	G	A	A	A	1	0	0	0	0	1	0	0	0	572	44	2	2	4602	290
CNTN6	27255	broad.mit.edu	37	3	1424680	1424680	+	Missense_Mutation	SNP	C	T	T			TCGA-81-5911-01	TCGA-81-5911-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:1424680C>T	uc003boz.2	+	18	2488	c.2221C>T	c.(2221-2223)CGG>TGG	p.R741W	CNTN6_uc011asj.1_Missense_Mutation_p.R669W|CNTN6_uc003bpa.2_Missense_Mutation_p.R741W	NM_014461	NP_055276	Q9UQ52	CNTN6_HUMAN	contactin 6 precursor	741	Fibronectin type-III 2.				axon guidance|cell adhesion|central nervous system development|Notch signaling pathway	anchored to membrane|plasma membrane				skin(3)|lung(2)|breast(2)|pancreas(1)	8		all_cancers(2;0.000164)|all_epithelial(2;0.107)		Epithelial(13;0.000233)|all cancers(10;0.0013)|OV - Ovarian serous cystadenocarcinoma(96;0.0139)		CATCATGTTCCGGCCAGTGGG	0.433													26	59	---	---	---	---	capture	Missense_Mutation	SNP	1424680	1424680	CNTN6	3	C	T	T	T	1	0	0	0	0	1	0	0	0	295	23	1	1	3610	290
FRAS1	80144	broad.mit.edu	37	4	79400817	79400817	+	Silent	SNP	C	T	T			TCGA-81-5911-01	TCGA-81-5911-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:79400817C>T	uc003hlb.2	+	56	8828	c.8388C>T	c.(8386-8388)AAC>AAT	p.N2796N		NM_025074	NP_079350	Q86XX4	FRAS1_HUMAN	Fraser syndrome 1	2791	Calx-beta 3.|Extracellular (Potential).				cell communication	integral to membrane|plasma membrane	metal ion binding			large_intestine(5)	5						GTGGTCCCAACGATGCCTCGA	0.532													15	20	---	---	---	---	capture	Silent	SNP	79400817	79400817	FRAS1	4	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	5986	290
SLC10A6	345274	broad.mit.edu	37	4	87749309	87749309	+	Missense_Mutation	SNP	C	T	T			TCGA-81-5911-01	TCGA-81-5911-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr4:87749309C>T	uc003hqd.2	-	4	746	c.598G>A	c.(598-600)GTT>ATT	p.V200I		NM_197965	NP_932069	Q3KNW5	SOAT_HUMAN	sodium-dependent organic anion transporter	200	Helical; (Potential).					integral to membrane|plasma membrane	bile acid:sodium symporter activity				0		Acute lymphoblastic leukemia(40;0.244)|all_hematologic(202;0.248)		OV - Ovarian serous cystadenocarcinoma(123;0.00099)		ACCCCACCAACAACGGCCCCA	0.428													32	49	---	---	---	---	capture	Missense_Mutation	SNP	87749309	87749309	SLC10A6	4	C	T	T	T	1	0	0	0	0	1	0	0	0	221	17	2	2	14271	290
RAMP3	10268	broad.mit.edu	37	7	45216936	45216936	+	Silent	SNP	C	T	T	rs145890722	byFrequency	TCGA-81-5911-01	TCGA-81-5911-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:45216936C>T	uc003tnb.2	+	2	148	c.87C>T	c.(85-87)AAC>AAT	p.N29N	RAMP3_uc003tnc.2_Translation_Start_Site	NM_005856	NP_005847	O60896	RAMP3_HUMAN	receptor activity modifying protein 3 precursor	29	Extracellular (Potential).				intracellular protein transport|receptor-mediated endocytosis|regulation of G-protein coupled receptor protein signaling pathway	integral to plasma membrane|lysosome	protein transporter activity				0					Pramlintide(DB01278)	GCGGCTGCAACGAGACAGGCA	0.597													16	51	---	---	---	---	capture	Silent	SNP	45216936	45216936	RAMP3	7	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	12918	290
EGFR	1956	broad.mit.edu	37	7	55221822	55221822	+	Missense_Mutation	SNP	C	T	T	rs149840192		TCGA-81-5911-01	TCGA-81-5911-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:55221822C>T	uc003tqk.2	+	7	1112	c.866C>T	c.(865-867)GCC>GTC	p.A289V	EGFR_uc003tqh.2_Missense_Mutation_p.A289V|EGFR_uc003tqi.2_Missense_Mutation_p.A289V|EGFR_uc003tqj.2_Missense_Mutation_p.A289V|EGFR_uc010kzg.1_Missense_Mutation_p.A244V|EGFR_uc011kco.1_Missense_Mutation_p.A236V|EGFR_uc011kcp.1_5'Flank|EGFR_uc011kcq.1_5'Flank	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	289	Approximate.|Extracellular (Potential).				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	p.A289V(20)|p.V30_R297>G(5)|p.A289D(3)|p.A289T(3)		lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	AGCTTTGGTGCCACCTGCGTG	0.592		8	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			417	180	---	---	---	---	capture	Missense_Mutation	SNP	55221822	55221822	EGFR	7	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	4922	290
DTX2	113878	broad.mit.edu	37	7	76112453	76112453	+	Silent	SNP	C	T	T			TCGA-81-5911-01	TCGA-81-5911-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:76112453C>T	uc003uff.3	+	5	1453	c.897C>T	c.(895-897)TCC>TCT	p.S299S	DTX2_uc011kgk.1_Silent_p.S208S|DTX2_uc003ufg.3_Silent_p.S299S|DTX2_uc003ufh.3_Silent_p.S299S|DTX2_uc003ufj.3_Silent_p.S299S	NM_020892	NP_065943	Q86UW9	DTX2_HUMAN	deltex 2 isoform a	299					Notch signaling pathway	cytoplasm|nucleus	protein binding|zinc ion binding			ovary(1)|skin(1)	2						CCTCCACCTCCGGTGCAGTCA	0.662													7	71	---	---	---	---	capture	Silent	SNP	76112453	76112453	DTX2	7	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	4749	290
PCLO	27445	broad.mit.edu	37	7	82784468	82784468	+	Missense_Mutation	SNP	C	T	T			TCGA-81-5911-01	TCGA-81-5911-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:82784468C>T	uc003uhx.2	-	2	1778	c.1489G>A	c.(1489-1491)GCA>ACA	p.A497T	PCLO_uc003uhv.2_Missense_Mutation_p.A497T	NM_033026	NP_149015	Q9Y6V0	PCLO_HUMAN	piccolo isoform 1	443	Gln-rich.|Pro-rich.|10 X 10 AA tandem approximate repeats of P-A-K-P-Q-P-Q-Q-P-X.			A -> T (in Ref. 4; CAB60727).	cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity			ovary(7)	7						GGGGGCTTTGCTGAGCCAGGC	0.612													5	252	---	---	---	---	capture	Missense_Mutation	SNP	82784468	82784468	PCLO	7	C	T	T	T	1	0	0	0	0	1	0	0	0	364	28	2	2	11486	290
OR2A2	442361	broad.mit.edu	37	7	143807297	143807297	+	Missense_Mutation	SNP	G	A	A			TCGA-81-5911-01	TCGA-81-5911-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:143807297G>A	uc011ktz.1	+	1	622	c.622G>A	c.(622-624)GGG>AGG	p.G208R		NM_001005480	NP_001005480	Q6IF42	OR2A2_HUMAN	olfactory receptor, family 2, subfamily A,	208	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2	Melanoma(164;0.0783)					TGTCTTAGTCGGGCCTCTTTC	0.522													68	204	---	---	---	---	capture	Missense_Mutation	SNP	143807297	143807297	OR2A2	7	G	A	A	A	1	0	0	0	0	1	0	0	0	507	39	1	1	10881	290
CSMD3	114788	broad.mit.edu	37	8	114290824	114290824	+	Missense_Mutation	SNP	C	T	T			TCGA-81-5911-01	TCGA-81-5911-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:114290824C>T	uc003ynu.2	-	3	670	c.511G>A	c.(511-513)GAA>AAA	p.E171K	CSMD3_uc003ynt.2_Missense_Mutation_p.E131K|CSMD3_uc011lhx.1_Missense_Mutation_p.E171K|CSMD3_uc010mcx.1_Missense_Mutation_p.E171K	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	171	Extracellular (Potential).|CUB 1.					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						CACTTACCTTCGTAATATACC	0.378										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			10	23	---	---	---	---	capture	Missense_Mutation	SNP	114290824	114290824	CSMD3	8	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	3911	290
DENND3	22898	broad.mit.edu	37	8	142151330	142151330	+	Missense_Mutation	SNP	C	T	T			TCGA-81-5911-01	TCGA-81-5911-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:142151330C>T	uc003yvy.2	+	4	568	c.290C>T	c.(289-291)ACG>ATG	p.T97M	DENND3_uc003yvw.1_Missense_Mutation_p.T110M|DENND3_uc003yvx.2_Missense_Mutation_p.R176C|DENND3_uc010mep.2_Missense_Mutation_p.T110M	NM_014957	NP_055772	A2RUS2	DEND3_HUMAN	DENN/MADD domain containing 3	97										ovary(1)	1	all_cancers(97;7.36e-15)|all_epithelial(106;2.33e-13)|Lung NSC(106;1.23e-05)|all_lung(105;1.75e-05)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.105)			AATGGCAAAACGCACCGGGAG	0.532													5	104	---	---	---	---	capture	Missense_Mutation	SNP	142151330	142151330	DENND3	8	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	4390	290
TEX13B	56156	broad.mit.edu	37	X	107224904	107224904	+	Missense_Mutation	SNP	G	A	A			TCGA-81-5911-01	TCGA-81-5911-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:107224904G>A	uc004enn.1	-	2	547	c.454C>T	c.(454-456)CAT>TAT	p.H152Y		NM_031273	NP_112563	Q9BXU2	TX13B_HUMAN	testis expressed 13B	152										ovary(1)	1						CTTACGGCATGGAAGAGCTTC	0.597													20	7	---	---	---	---	capture	Missense_Mutation	SNP	107224904	107224904	TEX13B	23	G	A	A	A	1	0	0	0	0	1	0	0	0	611	47	2	2	15662	290
DUSP8	1850	broad.mit.edu	37	11	1577819	1577820	+	Frame_Shift_Del	DEL	CG	-	-	rs61747093		TCGA-81-5911-01	TCGA-81-5911-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:1577819_1577820delCG	uc001lts.2	-	7	1934_1935	c.1806_1807delCG	c.(1804-1809)CGCGGCfs	p.R602fs		NM_004420	NP_004411	Q13202	DUS8_HUMAN	dual specificity phosphatase 8	602_603					inactivation of MAPK activity	cytoplasm|nucleus	MAP kinase tyrosine/serine/threonine phosphatase activity|protein tyrosine phosphatase activity				0		all_epithelial(84;0.000134)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000621)|Lung(200;0.0687)|LUSC - Lung squamous cell carcinoma(625;0.0825)		AGCTCCTCGCCGCGCGCGCGCC	0.752													2	4	---	---	---	---	capture_indel	Frame_Shift_Del	DEL	1577819	1577820	DUSP8	11	CG	-	-	-	1	0	1	0	1	0	0	0	0	299	23	5	5	4786	290
VEGFB	7423	broad.mit.edu	37	11	64004662	64004663	+	Frame_Shift_Ins	INS	-	A	A			TCGA-81-5911-01	TCGA-81-5911-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:64004662_64004663insA	uc001nyw.2	+	5	418_419	c.378_379insA	c.(376-381)CCTAAAfs	p.P126fs	VEGFB_uc001nyx.2_Frame_Shift_Ins_p.P126fs	NM_003377	NP_003368	P49765	VEGFB_HUMAN	vascular endothelial growth factor B precursor	126_127					anti-apoptosis|induction of positive chemotaxis|negative regulation of gene expression|negative regulation of neuron apoptosis|platelet activation|platelet degranulation|positive regulation of cell division|positive regulation of endothelial cell proliferation|positive regulation of ERK1 and ERK2 cascade|positive regulation of mast cell chemotaxis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of protein kinase B signaling cascade|positive regulation of vascular endothelial growth factor receptor signaling pathway|positive regulation of vascular wound healing|vascular endothelial growth factor receptor signaling pathway	extracellular region|extracellular space|membrane|platelet alpha granule lumen	chemoattractant activity|growth factor activity|heparin binding|vascular endothelial growth factor receptor 1 binding				0						TTTTCAGACCTAAAAAAAAGGA	0.386													7	145	---	---	---	---	capture_indel	Frame_Shift_Ins	INS	64004662	64004663	VEGFB	11	-	A	A	A	1	0	1	1	0	0	0	0	0	678	53	5	5	17033	290
LMAN1	3998	broad.mit.edu	37	18	57013193	57013194	+	Frame_Shift_Ins	INS	-	T	T			TCGA-81-5911-01	TCGA-81-5911-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:57013193_57013194insT	uc002lhz.2	-	8	944_945	c.912_913insA	c.(910-915)AAAGAGfs	p.K304fs		NM_005570	NP_005561	P49257	LMAN1_HUMAN	lectin, mannose-binding, 1 precursor	304_305	Lumenal (Potential).				blood coagulation|ER to Golgi vesicle-mediated transport|post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine|protein transport	endoplasmic reticulum membrane|ER to Golgi transport vesicle membrane|ER-Golgi intermediate compartment membrane|Golgi membrane|integral to membrane	mannose binding|metal ion binding|unfolded protein binding			skin(1)	1		Colorectal(73;0.0946)			Antihemophilic Factor(DB00025)	TGGAATTCCTCTTTTTTTTTAT	0.455													7	125	---	---	---	---	capture_indel	Frame_Shift_Ins	INS	57013193	57013194	LMAN1	18	-	T	T	T	1	0	1	1	0	0	0	0	0	416	32	5	5	8756	290
PASD1	139135	broad.mit.edu	37	X	150817142	150817144	+	In_Frame_Del	DEL	GCT	-	-			TCGA-81-5911-01	TCGA-81-5911-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:150817142_150817144delGCT	uc004fev.3	+	9	1017_1019	c.685_687delGCT	c.(685-687)GCTdel	p.A236del		NM_173493	NP_775764	Q8IV76	PASD1_HUMAN	PAS domain containing 1	236	Poly-Ala.					nucleus	signal transducer activity			ovary(3)	3	Acute lymphoblastic leukemia(192;6.56e-05)					CGTTGAACCCgctgctgctgctg	0.355													7	103	---	---	---	---	capture_indel	In_Frame_Del	DEL	150817142	150817144	PASD1	23	GCT	-	-	-	1	0	1	0	1	0	0	0	0	494	38	5	5	11374	290
