Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	newbase	is_coding	is_flank	is_indel	is_ins	is_del	is_missense	is_nonsense	is_splice	is_silent	context_orig	context65	categ	categ_ignoring_null_categ	gene_idx	pat_idx
PRAMEF11	440560	broad.mit.edu	37	1	12885289	12885289	+	Silent	SNP	G	T	T	rs148273194	by1000genomes	TCGA-87-5896-01	TCGA-87-5896-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:12885289G>T	uc001auk.2	-	4	1018	c.822C>A	c.(820-822)CTC>CTA	p.L274L		NM_001146344	NP_001139816	O60813	PRA11_HUMAN	PRAME family member 11	274	LRR 3.										0						GGCACTGGGAGAGATGCTTCA	0.458													6	139	---	---	---	---	capture	Silent	SNP	12885289	12885289	PRAMEF11	1	G	T	T	T	1	0	0	0	0	0	0	0	1	418	33	4	4	12328	291
KTI12	112970	broad.mit.edu	37	1	52498511	52498511	+	Missense_Mutation	SNP	C	T	T			TCGA-87-5896-01	TCGA-87-5896-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:52498511C>T	uc001ctj.1	-	1	962	c.923G>A	c.(922-924)CGG>CAG	p.R308Q	TXNDC12_uc001cti.2_Intron	NM_138417	NP_612426	Q96EK9	KTI12_HUMAN	KTI12 homolog, chromatin associated	308							ATP binding			central_nervous_system(2)	2						CCGGGTAAACCGCAAGTGCTC	0.552													50	58	---	---	---	---	capture	Missense_Mutation	SNP	52498511	52498511	KTI12	1	C	T	T	T	1	0	0	0	0	1	0	0	0	299	23	1	1	8504	291
CACHD1	57685	broad.mit.edu	37	1	65141094	65141094	+	Missense_Mutation	SNP	C	T	T			TCGA-87-5896-01	TCGA-87-5896-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:65141094C>T	uc001dbo.1	+	20	2690	c.2585C>T	c.(2584-2586)ACG>ATG	p.T862M	CACHD1_uc001dbp.1_Missense_Mutation_p.T617M|CACHD1_uc001dbq.1_Missense_Mutation_p.T617M|CACHD1_uc010opa.1_Missense_Mutation_p.T106M	NM_020925	NP_065976	Q5VU97	CAHD1_HUMAN	cache domain containing 1	913	Extracellular (Potential).				calcium ion transport	integral to membrane				ovary(2)	2						GGGGATTTGACGAACCTTGTG	0.463											OREG0013544	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	23	36	---	---	---	---	capture	Missense_Mutation	SNP	65141094	65141094	CACHD1	1	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	2513	291
RPF1	80135	broad.mit.edu	37	1	84961638	84961638	+	Nonsense_Mutation	SNP	C	G	G			TCGA-87-5896-01	TCGA-87-5896-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:84961638C>G	uc001djv.3	+	7	818	c.773C>G	c.(772-774)TCA>TGA	p.S258*		NM_025065	NP_079341	Q9H9Y2	RPF1_HUMAN	RNA processing factor 1	258	Brix.				rRNA processing|translation	nucleolus	aminoacyl-tRNA ligase activity|ATP binding|rRNA binding				0						CTGGGTCATTCAATTGGACGT	0.373													15	38	---	---	---	---	capture	Nonsense_Mutation	SNP	84961638	84961638	RPF1	1	C	G	G	G	1	0	0	0	0	0	1	0	0	377	29	5	4	13438	291
ODF2L	57489	broad.mit.edu	37	1	86851250	86851250	+	Missense_Mutation	SNP	T	A	A			TCGA-87-5896-01	TCGA-87-5896-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:86851250T>A	uc001dll.1	-	3	477	c.137A>T	c.(136-138)GAA>GTA	p.E46V	ODF2L_uc001dlm.1_Missense_Mutation_p.E46V|ODF2L_uc001dln.2_Missense_Mutation_p.E46V|ODF2L_uc001dlo.2_Intron|ODF2L_uc001dlp.2_Missense_Mutation_p.E46V|ODF2L_uc010osg.1_Missense_Mutation_p.E46V|ODF2L_uc001dlq.1_Intron|ODF2L_uc009wcr.1_Intron	NM_020729	NP_065780	Q9ULJ1	ODF2L_HUMAN	outer dense fiber of sperm tails 2-like isoform	46	Potential.					centrosome				ovary(1)	1				all cancers(265;0.0313)|Epithelial(280;0.0611)		TTCAGTCTTTTCATTTAGAAT	0.343													17	29	---	---	---	---	capture	Missense_Mutation	SNP	86851250	86851250	ODF2L	1	T	A	A	A	1	0	0	0	0	1	0	0	0	806	62	4	4	10733	291
S100A7L2	645922	broad.mit.edu	37	1	153409549	153409549	+	Silent	SNP	G	A	A	rs140750285		TCGA-87-5896-01	TCGA-87-5896-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:153409549G>A	uc010pdx.1	-	3	402	c.324C>T	c.(322-324)TCC>TCT	p.S108S		NM_001045479	NP_001038944			S100 calcium binding protein A7-like 2											ovary(1)	1	all_lung(78;2.4e-33)|Lung NSC(65;8.13e-32)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.171)			GGCTTCCCCCGGAACAGGGTG	0.488													96	139	---	---	---	---	capture	Silent	SNP	153409549	153409549	S100A7L2	1	G	A	A	A	1	0	0	0	0	0	0	0	1	496	39	1	1	13677	291
ZP4	57829	broad.mit.edu	37	1	238048511	238048511	+	Missense_Mutation	SNP	A	C	C			TCGA-87-5896-01	TCGA-87-5896-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:238048511A>C	uc001hym.2	-	9	1265	c.1265T>G	c.(1264-1266)TTC>TGC	p.F422C	LOC100130331_uc010pyc.1_Intron	NM_021186	NP_067009	Q12836	ZP4_HUMAN	zona pellucida glycoprotein 4 preproprotein	422	ZP.|Extracellular (Potential).				acrosomal vesicle exocytosis|negative regulation of binding of sperm to zona pellucida|positive regulation of acrosome reaction|positive regulation of humoral immune response|positive regulation of protein kinase activity|positive regulation of T cell proliferation|protein kinase A signaling cascade|protein kinase C signaling cascade	integral to membrane|intracellular|plasma membrane|proteinaceous extracellular matrix	acrosin binding|receptor activity			ovary(2)|skin(1)	3	Ovarian(103;0.103)	all_cancers(173;0.00175)|all_epithelial(177;0.162)|all_neural(198;0.164)|Melanoma(53;0.211)|Prostate(94;0.214)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)			CACAAAGCTGAAGGTGAAGAT	0.537													25	27	---	---	---	---	capture	Missense_Mutation	SNP	238048511	238048511	ZP4	1	A	C	C	C	1	0	0	0	0	1	0	0	0	117	9	4	4	18094	291
OR2G6	391211	broad.mit.edu	37	1	248685273	248685273	+	Missense_Mutation	SNP	C	T	T			TCGA-87-5896-01	TCGA-87-5896-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr1:248685273C>T	uc001ien.1	+	1	326	c.326C>T	c.(325-327)TCG>TTG	p.S109L		NM_001013355	NP_001013373	Q5TZ20	OR2G6_HUMAN	olfactory receptor, family 2, subfamily G,	109	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0156)	OV - Ovarian serous cystadenocarcinoma(106;0.0265)			GGGTTGGGCTCGTCTGAGTGT	0.547													30	41	---	---	---	---	capture	Missense_Mutation	SNP	248685273	248685273	OR2G6	1	C	T	T	T	1	0	0	0	0	1	0	0	0	403	31	1	1	10904	291
ZNF37A	7587	broad.mit.edu	37	10	38407548	38407548	+	Missense_Mutation	SNP	T	C	C			TCGA-87-5896-01	TCGA-87-5896-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr10:38407548T>C	uc001izk.2	+	8	2288	c.1469T>C	c.(1468-1470)ATA>ACA	p.I490T	ZNF37A_uc001izl.2_Missense_Mutation_p.I490T|ZNF37A_uc001izm.2_Missense_Mutation_p.I490T	NM_001007094	NP_001007095	P17032	ZN37A_HUMAN	zinc finger protein 37a	490						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			breast(1)	1						AGAACTCATATAAGACAGAAA	0.413													24	8	---	---	---	---	capture	Missense_Mutation	SNP	38407548	38407548	ZNF37A	10	T	C	C	C	1	0	0	0	0	1	0	0	0	637	49	3	3	17752	291
PGR	5241	broad.mit.edu	37	11	100999671	100999671	+	Missense_Mutation	SNP	G	T	T	rs141862537		TCGA-87-5896-01	TCGA-87-5896-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr11:100999671G>T	uc001pgh.2	-	1	874	c.131C>A	c.(130-132)ACC>AAC	p.T44N	PGR_uc001pgi.2_Missense_Mutation_p.T44N|PGR_uc009yww.1_RNA|PGR_uc001pgj.2_RNA|PGR_uc009ywx.1_RNA|uc010rum.1_5'Flank	NM_000926	NP_000917	P06401	PRGR_HUMAN	progesterone receptor	44	Modulating, Pro-Rich.				cell-cell signaling|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	cytoplasm|nucleoplasm	enzyme binding|receptor binding|sequence-specific DNA binding transcription factor activity|steroid binding|steroid hormone receptor activity|zinc ion binding			lung(1)|liver(1)|central_nervous_system(1)|pancreas(1)	4		Acute lymphoblastic leukemia(157;0.000885)|all_hematologic(158;0.014)		LUSC - Lung squamous cell carcinoma(1;0.0387)|BRCA - Breast invasive adenocarcinoma(274;0.124)|OV - Ovarian serous cystadenocarcinoma(223;0.148)|Lung(307;0.164)	Desogestrel(DB00304)|Drospirenone(DB01395)|Dydrogesterone(DB00378)|Ethynodiol Diacetate(DB00823)|Etonogestrel(DB00294)|Levonorgestrel(DB00367)|Medroxyprogesterone(DB00603)|Megestrol(DB00351)|Mifepristone(DB00834)|Norethindrone(DB00717)|Norgestimate(DB00957)|Norgestrel(DB00506)|Progesterone(DB00396)	TTCAGGCAAGGTGTCCGAGGT	0.692													9	10	---	---	---	---	capture	Missense_Mutation	SNP	100999671	100999671	PGR	11	G	T	T	T	1	0	0	0	0	1	0	0	0	572	44	4	4	11708	291
COL2A1	1280	broad.mit.edu	37	12	48371798	48371798	+	Nonsense_Mutation	SNP	G	A	A	rs145684327		TCGA-87-5896-01	TCGA-87-5896-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:48371798G>A	uc001rqu.2	-	44	3287	c.3106C>T	c.(3106-3108)CGA>TGA	p.R1036*	COL2A1_uc001rqt.2_5'Flank|COL2A1_uc009zkw.2_RNA|COL2A1_uc001rqv.2_Nonsense_Mutation_p.R967*	NM_001844	NP_001835	P02458	CO2A1_HUMAN	collagen, type II, alpha 1 isoform 1 precursor	1036	Triple-helical region.				axon guidance|collagen fibril organization|embryonic skeletal joint morphogenesis|sensory perception of sound|visual perception	collagen type II	identical protein binding|platelet-derived growth factor binding			ovary(1)|skin(1)	2		Acute lymphoblastic leukemia(13;0.108)|all_hematologic(14;0.214)			Collagenase(DB00048)	CTCACCTCTCGTCCAGGTTCA	0.662													7	10	---	---	---	---	capture	Nonsense_Mutation	SNP	48371798	48371798	COL2A1	12	G	A	A	A	1	0	0	0	0	0	1	0	0	519	40	5	1	3652	291
GLT8D2	83468	broad.mit.edu	37	12	104390580	104390580	+	Missense_Mutation	SNP	G	A	A			TCGA-87-5896-01	TCGA-87-5896-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:104390580G>A	uc001tkh.1	-	8	939	c.533C>T	c.(532-534)GCG>GTG	p.A178V	GLT8D2_uc001tki.1_Missense_Mutation_p.A178V	NM_031302	NP_112592	Q9H1C3	GL8D2_HUMAN	glycosyltransferase 8 domain containing 2	178	Lumenal (Potential).					integral to membrane	transferase activity, transferring glycosyl groups			ovary(1)|skin(1)	2						GAAAGCCGCCGCGTGGCCCAG	0.483													36	59	---	---	---	---	capture	Missense_Mutation	SNP	104390580	104390580	GLT8D2	12	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	6406	291
CUX2	23316	broad.mit.edu	37	12	111772341	111772341	+	Missense_Mutation	SNP	G	A	A			TCGA-87-5896-01	TCGA-87-5896-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr12:111772341G>A	uc001tsa.1	+	19	3176	c.3023G>A	c.(3022-3024)AGC>AAC	p.S1008N		NM_015267	NP_056082	O14529	CUX2_HUMAN	cut-like 2	1008						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(3)|skin(2)|breast(1)	6						TCCCTGGAGAGCAGCAAGGAG	0.647													17	33	---	---	---	---	capture	Missense_Mutation	SNP	111772341	111772341	CUX2	12	G	A	A	A	1	0	0	0	0	1	0	0	0	442	34	2	2	4025	291
ABCC4	10257	broad.mit.edu	37	13	95705392	95705392	+	Missense_Mutation	SNP	A	C	C			TCGA-87-5896-01	TCGA-87-5896-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr13:95705392A>C	uc001vmd.3	-	27	3532	c.3413T>G	c.(3412-3414)TTT>TGT	p.F1138C	ABCC4_uc010afj.2_Missense_Mutation_p.F22C|ABCC4_uc010afk.2_Missense_Mutation_p.F1091C	NM_005845	NP_005836	O15439	MRP4_HUMAN	ATP-binding cassette, sub-family C, member 4	1138	ABC transporter 2.				platelet activation|platelet degranulation	integral to membrane|membrane fraction|plasma membrane|platelet dense granule membrane	15-hydroxyprostaglandin dehydrogenase (NAD+) activity|ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|chloride channel activity			central_nervous_system(3)|skin(1)	4	all_neural(89;0.0878)|Medulloblastoma(90;0.163)				Cefazolin(DB01327)	GTGCTCATTAAAGGGATCCAG	0.373													24	60	---	---	---	---	capture	Missense_Mutation	SNP	95705392	95705392	ABCC4	13	A	C	C	C	1	0	0	0	0	1	0	0	0	13	1	4	4	55	291
TEP1	7011	broad.mit.edu	37	14	20846241	20846241	+	Missense_Mutation	SNP	G	A	A			TCGA-87-5896-01	TCGA-87-5896-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:20846241G>A	uc001vxe.2	-	39	5703	c.5663C>T	c.(5662-5664)GCT>GTT	p.A1888V	TEP1_uc010ahk.2_Missense_Mutation_p.A1231V|TEP1_uc010tlf.1_RNA|TEP1_uc010tlg.1_Missense_Mutation_p.A1780V|TEP1_uc010tlh.1_Missense_Mutation_p.A226V	NM_007110	NP_009041	Q99973	TEP1_HUMAN	telomerase-associated protein 1	1888	WD 7.				telomere maintenance via recombination	chromosome, telomeric region|cytoplasm|nuclear matrix|soluble fraction|telomerase holoenzyme complex	ATP binding|RNA binding			ovary(5)	5	all_cancers(95;0.00123)	all_lung(585;0.235)	Epithelial(56;7.42e-08)|all cancers(55;6.46e-07)	GBM - Glioblastoma multiforme(265;0.028)|READ - Rectum adenocarcinoma(17;0.233)		AAGCGCAGCAGCAACAAAGCC	0.632													3	69	---	---	---	---	capture	Missense_Mutation	SNP	20846241	20846241	TEP1	14	G	A	A	A	1	0	0	0	0	1	0	0	0	442	34	2	2	15644	291
MGAT2	4247	broad.mit.edu	37	14	50089072	50089072	+	Nonsense_Mutation	SNP	G	A	A			TCGA-87-5896-01	TCGA-87-5896-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:50089072G>A	uc001wwr.2	+	1	1584	c.1086G>A	c.(1084-1086)TGG>TGA	p.W362*	SDCCAG1_uc010anj.1_Intron|RPL36AL_uc001wwq.1_5'Flank	NM_002408	NP_002399	Q10469	MGAT2_HUMAN	mannosyl (alpha-1,6-)-glycoprotein	362	Lumenal (Potential).				oligosaccharide biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|Golgi stack|integral to membrane|membrane fraction	alpha-1,6-mannosylglycoprotein 2-beta-N-acetylglucosaminyltransferase activity				0	all_epithelial(31;0.0021)|Breast(41;0.0124)					CAAAATTCTGGAAAGTGCTGG	0.423													39	72	---	---	---	---	capture	Nonsense_Mutation	SNP	50089072	50089072	MGAT2	14	G	A	A	A	1	0	0	0	0	0	1	0	0	533	41	5	2	9455	291
SFRS5	6430	broad.mit.edu	37	14	70237710	70237710	+	Splice_Site	SNP	A	T	T			TCGA-87-5896-01	TCGA-87-5896-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr14:70237710A>T	uc001xll.2	+	8	1892	c.441_splice	c.e8-2	p.G147_splice	SFRS5_uc001xlm.2_Splice_Site|SFRS5_uc001xlo.2_Splice_Site_p.G147_splice|SFRS5_uc001xlp.2_Splice_Site_p.G147_splice|SFRS5_uc001xlq.2_Splice_Site_p.G144_splice	NM_006925	NP_008856	Q13243	SRSF5_HUMAN	splicing factor, arginine/serine-rich 5						mRNA 3'-end processing|mRNA export from nucleus|mRNA splice site selection|termination of RNA polymerase II transcription	nuclear speck	nucleotide binding|protein binding|RNA binding				0				all cancers(60;0.00144)|BRCA - Breast invasive adenocarcinoma(234;0.0132)|OV - Ovarian serous cystadenocarcinoma(108;0.0154)		TTTCCATTTTAGGGTGGTTGA	0.348													6	42	---	---	---	---	capture	Splice_Site	SNP	70237710	70237710	SFRS5	14	A	T	T	T	1	0	0	0	0	0	0	1	0	195	15	5	4	14073	291
UBR1	197131	broad.mit.edu	37	15	43269028	43269028	+	Missense_Mutation	SNP	T	A	A			TCGA-87-5896-01	TCGA-87-5896-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:43269028T>A	uc001zqq.2	-	39	4322	c.4256A>T	c.(4255-4257)GAT>GTT	p.D1419V		NM_174916	NP_777576	Q8IWV7	UBR1_HUMAN	ubiquitin protein ligase E3 component n-recognin	1419					cellular response to leucine|negative regulation of TOR signaling cascade	cytosol	leucine binding|zinc ion binding			lung(1)	1		all_cancers(109;4.32e-15)|all_epithelial(112;4.05e-13)|Lung NSC(122;1.75e-08)|all_lung(180;2e-07)|Melanoma(134;0.0179)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;4.08e-07)|COAD - Colon adenocarcinoma(120;0.185)|Colorectal(105;0.214)		AACAGGGTCATCCCAATACAA	0.388													17	27	---	---	---	---	capture	Missense_Mutation	SNP	43269028	43269028	UBR1	15	T	A	A	A	1	0	0	0	0	1	0	0	0	650	50	4	4	16783	291
EDC3	80153	broad.mit.edu	37	15	74925078	74925078	+	Missense_Mutation	SNP	C	A	A			TCGA-87-5896-01	TCGA-87-5896-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:74925078C>A	uc002ayn.2	-	10	1890	c.1402G>T	c.(1402-1404)GGG>TGG	p.G468W	EDC3_uc002ayo.2_Missense_Mutation_p.G468W|EDC3_uc002aym.2_Missense_Mutation_p.G468W	NM_001142443	NP_001135915	Q96F86	EDC3_HUMAN	enhancer of mRNA decapping 3	468	YjeF N-terminal.				exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay	cytoplasmic mRNA processing body|cytosol	protein binding|RNA binding			ovary(1)	1						GCGTGCTCCCCCAGTGGCAGA	0.577											OREG0023286	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	16	32	---	---	---	---	capture	Missense_Mutation	SNP	74925078	74925078	EDC3	15	C	A	A	A	1	0	0	0	0	1	0	0	0	286	22	4	4	4862	291
CSPG4	1464	broad.mit.edu	37	15	75980829	75980829	+	Nonsense_Mutation	SNP	A	C	C			TCGA-87-5896-01	TCGA-87-5896-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:75980829A>C	uc002baw.2	-	3	2670	c.2577T>G	c.(2575-2577)TAT>TAG	p.Y859*		NM_001897	NP_001888	Q6UVK1	CSPG4_HUMAN	chondroitin sulfate proteoglycan 4 precursor	859	CSPG 4.|Extracellular (Potential).|Gly/Ser-rich (glycosaminoglycan attachment domain).|Interaction with COL5A1 (By similarity).|Interaction with COL6A2 (By similarity).				angiogenesis|cell differentiation|intracellular signal transduction|positive regulation of peptidyl-tyrosine phosphorylation|tissue remodeling	apical plasma membrane|cell surface|integral to plasma membrane|intracellular|lamellipodium membrane	protein kinase binding|signal transducer activity			ovary(2)|pancreas(1)	3						CTGTGGCCCCATAGGTCACCC	0.577													13	22	---	---	---	---	capture	Nonsense_Mutation	SNP	75980829	75980829	CSPG4	15	A	C	C	C	1	0	0	0	0	0	1	0	0	102	8	5	4	3925	291
C15orf42	90381	broad.mit.edu	37	15	90142688	90142688	+	Silent	SNP	A	G	G			TCGA-87-5896-01	TCGA-87-5896-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr15:90142688A>G	uc002boe.2	+	8	2034	c.2034A>G	c.(2032-2034)AAA>AAG	p.K678K		NM_152259	NP_689472	Q7Z2Z1	TICRR_HUMAN	leucine-rich repeat kinase 1	678					cell cycle|DNA repair|DNA replication|formation of translation preinitiation complex|G2/M transition checkpoint|mitotic cell cycle DNA replication checkpoint|regulation of DNA-dependent DNA replication initiation|response to ionizing radiation	nucleus	chromatin binding|protein binding			ovary(4)|central_nervous_system(2)|skin(1)	7	Lung NSC(78;0.0237)|all_lung(78;0.0478)		BRCA - Breast invasive adenocarcinoma(143;0.128)			TAAAATCAAAAGGCACCAAGG	0.358													3	67	---	---	---	---	capture	Silent	SNP	90142688	90142688	C15orf42	15	A	G	G	G	1	0	0	0	0	0	0	0	1	37	3	3	3	1782	291
SPG7	6687	broad.mit.edu	37	16	89598461	89598461	+	Silent	SNP	G	A	A			TCGA-87-5896-01	TCGA-87-5896-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr16:89598461G>A	uc002fnj.2	+	8	1158	c.1137G>A	c.(1135-1137)GTG>GTA	p.V379V	SPG7_uc002fni.2_Silent_p.V379V	NM_003119	NP_003110	Q9UQ90	SPG7_HUMAN	spastic paraplegia 7 isoform 1	379	Mitochondrial matrix (Potential).				cell death|nervous system development|protein catabolic process|proteolysis	integral to membrane|mitochondrial membrane	ATP binding|metalloendopeptidase activity|nucleoside-triphosphatase activity|unfolded protein binding|zinc ion binding				0		all_hematologic(23;0.00824)|Colorectal(91;0.102)		all cancers(4;1.39e-07)|OV - Ovarian serous cystadenocarcinoma(4;5.64e-06)|BRCA - Breast invasive adenocarcinoma(80;0.015)		CAGAGTTCGTGGAGGTCATTG	0.647													16	20	---	---	---	---	capture	Silent	SNP	89598461	89598461	SPG7	16	G	A	A	A	1	0	0	0	0	0	0	0	1	600	47	2	2	14936	291
CCL2	6347	broad.mit.edu	37	17	32583358	32583358	+	Missense_Mutation	SNP	T	A	A			TCGA-87-5896-01	TCGA-87-5896-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:32583358T>A	uc002hhy.2	+	2	267	c.194T>A	c.(193-195)ATC>AAC	p.I65N		NM_002982	NP_002973	P13500	CCL2_HUMAN	small inducible cytokine A2 precursor	65				Missing: 90% reduction in activity.|Missing: 83% reduction in activity.	angiogenesis|anti-apoptosis|apoptotic cell clearance|astrocyte cell migration|cell adhesion|cellular response to interferon-gamma|cellular response to interleukin-1|cellular response to lipopolysaccharide|cellular response to tumor necrosis factor|G-protein signaling, coupled to cyclic nucleotide second messenger|helper T cell extravasation|humoral immune response|inflammatory response|JAK-STAT cascade|macrophage chemotaxis|monocyte chemotaxis|positive regulation of nitric-oxide synthase biosynthetic process|positive regulation of T cell activation|viral genome replication	extracellular space	CCR2 chemokine receptor binding|chemokine activity|protein kinase activity|signal transducer activity			pancreas(1)	1	Breast(3;0.00224)	Ovarian(249;0.0694)|Breast(31;0.151)|Lung NSC(157;0.153)		UCEC - Uterine corpus endometrioid carcinoma (308;0.000241)|BRCA - Breast invasive adenocarcinoma(366;0.0103)	Atorvastatin(DB01076)|Danazol(DB01406)|Mimosine(DB01055)|Simvastatin(DB00641)	GAAGCTGTGATGTGAGTTCAG	0.478													15	23	---	---	---	---	capture	Missense_Mutation	SNP	32583358	32583358	CCL2	17	T	A	A	A	1	0	0	0	0	1	0	0	0	663	51	4	4	2864	291
TNS4	84951	broad.mit.edu	37	17	38641225	38641225	+	Silent	SNP	G	A	A			TCGA-87-5896-01	TCGA-87-5896-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:38641225G>A	uc010cxb.2	-	5	1487	c.1323C>T	c.(1321-1323)TTC>TTT	p.F441F		NM_032865	NP_116254	Q8IZW8	TENS4_HUMAN	tensin 4 precursor	441					apoptosis|protein localization	cytoplasm|cytoskeleton|focal adhesion	actin binding			large_intestine(1)|ovary(1)|central_nervous_system(1)|skin(1)	4		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(5;5.91e-05)			TGTCCATCACGAACTTCATGG	0.547													24	34	---	---	---	---	capture	Silent	SNP	38641225	38641225	TNS4	17	G	A	A	A	1	0	0	0	0	0	0	0	1	477	37	1	1	16228	291
KRT39	390792	broad.mit.edu	37	17	39116597	39116597	+	Missense_Mutation	SNP	C	T	T			TCGA-87-5896-01	TCGA-87-5896-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:39116597C>T	uc002hvo.1	-	6	1189	c.1153G>A	c.(1153-1155)GTC>ATC	p.V385I	KRT39_uc010wfm.1_Missense_Mutation_p.V118I	NM_213656	NP_998821	Q6A163	K1C39_HUMAN	type I hair keratin KA35	385	Coil 2.|Rod.					intermediate filament	structural molecule activity				0		Breast(137;0.00043)|Ovarian(249;0.15)				CGGGACTTGACGTCCAGCAGG	0.493													44	51	---	---	---	---	capture	Missense_Mutation	SNP	39116597	39116597	KRT39	17	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	8396	291
KRTAP4-11	653240	broad.mit.edu	37	17	39274291	39274291	+	Missense_Mutation	SNP	T	C	C	rs149439944	by1000genomes	TCGA-87-5896-01	TCGA-87-5896-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:39274291T>C	uc002hvz.2	-	1	316	c.277A>G	c.(277-279)ATG>GTG	p.M93V		NM_033059	NP_149048	Q9BYQ6	KR411_HUMAN	keratin associated protein 4-11	93	14.|27 X 5 AA repeats of C-C-[GIKRQVHEL]- [SPTR]-[STVQRMC].					keratin filament					0		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			TGGCAGCACATAGACTGGCAG	0.388													3	29	---	---	---	---	capture	Missense_Mutation	SNP	39274291	39274291	KRTAP4-11	17	T	C	C	C	1	0	0	0	0	1	0	0	0	637	49	3	3	8469	291
SGCA	6442	broad.mit.edu	37	17	48246591	48246591	+	Silent	SNP	C	T	T			TCGA-87-5896-01	TCGA-87-5896-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:48246591C>T	uc002iqi.2	+	6	759	c.723C>T	c.(721-723)CGC>CGT	p.R241R	SGCA_uc010wmh.1_Silent_p.R139R|SGCA_uc002iqj.2_Intron|SGCA_uc010wmi.1_RNA|uc010dbn.1_5'Flank	NM_000023	NP_000014	Q16586	SGCA_HUMAN	sarcoglycan, alpha isoform 1 precursor	241	Extracellular (Potential).				muscle contraction|muscle organ development	cytoplasm|cytoskeleton|integral to membrane|sarcoglycan complex|sarcolemma	calcium ion binding			ovary(2)	2						CCCACTTCCGCGTTGACTGGT	0.662											OREG0024558	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	9	15	---	---	---	---	capture	Silent	SNP	48246591	48246591	SGCA	17	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	14092	291
EPX	8288	broad.mit.edu	37	17	56277732	56277732	+	Nonsense_Mutation	SNP	C	T	T			TCGA-87-5896-01	TCGA-87-5896-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:56277732C>T	uc002ivq.2	+	10	1770	c.1684C>T	c.(1684-1686)CGA>TGA	p.R562*		NM_000502	NP_000493	P11678	PERE_HUMAN	eosinophil peroxidase preproprotein	562					hydrogen peroxide catabolic process		heme binding|peroxidase activity|protein binding			ovary(2)	2						CAACATGCAACGAAGCCGGGA	0.617											OREG0024608	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	20	29	---	---	---	---	capture	Nonsense_Mutation	SNP	56277732	56277732	EPX	17	C	T	T	T	1	0	0	0	0	0	1	0	0	243	19	5	1	5155	291
ENPP7	339221	broad.mit.edu	37	17	77711814	77711814	+	Missense_Mutation	SNP	G	A	A			TCGA-87-5896-01	TCGA-87-5896-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr17:77711814G>A	uc002jxa.2	+	5	1366	c.1346G>A	c.(1345-1347)GGG>GAG	p.G449E		NM_178543	NP_848638	Q6UWV6	ENPP7_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase	449	Helical; (Potential).				negative regulation of cell proliferation|negative regulation of DNA replication|sphingomyelin metabolic process	Golgi apparatus|integral to membrane|microvillus	sphingomyelin phosphodiesterase activity			central_nervous_system(2)|ovary(1)	3			OV - Ovarian serous cystadenocarcinoma(97;0.016)|BRCA - Breast invasive adenocarcinoma(99;0.0224)			GGACTGCTGGGGACCGTGATT	0.632													26	44	---	---	---	---	capture	Missense_Mutation	SNP	77711814	77711814	ENPP7	17	G	A	A	A	1	0	0	0	0	1	0	0	0	559	43	2	2	5090	291
LAMA1	284217	broad.mit.edu	37	18	6977852	6977852	+	Silent	SNP	G	A	A			TCGA-87-5896-01	TCGA-87-5896-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:6977852G>A	uc002knm.2	-	44	6313	c.6219C>T	c.(6217-6219)GAC>GAT	p.D2073D	LAMA1_uc010wzj.1_Silent_p.D1549D	NM_005559	NP_005550	P25391	LAMA1_HUMAN	laminin, alpha 1 precursor	2073	Domain II and I.				axon guidance|cell adhesion|cell surface receptor linked signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	extracellular space|laminin-1 complex|laminin-3 complex	extracellular matrix structural constituent|receptor binding			ovary(8)|large_intestine(4)|upper_aerodigestive_tract(2)|breast(2)|skin(2)|pancreas(2)|central_nervous_system(1)	21		Colorectal(10;0.172)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	GAATTTCCACGTCTTTGACTT	0.398													6	11	---	---	---	---	capture	Silent	SNP	6977852	6977852	LAMA1	18	G	A	A	A	1	0	0	0	0	0	0	0	1	516	40	1	1	8525	291
POTEC	388468	broad.mit.edu	37	18	14542921	14542921	+	Silent	SNP	G	A	A			TCGA-87-5896-01	TCGA-87-5896-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:14542921G>A	uc010dln.2	-	1	679	c.225C>T	c.(223-225)AGC>AGT	p.S75S	POTEC_uc010xaj.1_RNA	NM_001137671	NP_001131143	B2RU33	POTEC_HUMAN	ANKRD26-like family B, member 2	75										skin(3)	3						TGCTCGTGCCGCTCCCCCTGC	0.567													45	168	---	---	---	---	capture	Silent	SNP	14542921	14542921	POTEC	18	G	A	A	A	1	0	0	0	0	0	0	0	1	490	38	1	1	12164	291
SERPINB11	89778	broad.mit.edu	37	18	61387390	61387390	+	Splice_Site	SNP	G	A	A			TCGA-87-5896-01	TCGA-87-5896-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr18:61387390G>A	uc002ljk.3	+	7	680	c.618_splice	c.e7+1	p.E206_splice	SERPINB11_uc010xes.1_Splice_Site_p.E31_splice|SERPINB11_uc010dqd.2_Splice_Site_p.E92_splice|SERPINB11_uc002ljj.3_Splice_Site_p.E92_splice|SERPINB11_uc010dqe.2_Intron|SERPINB11_uc010dqf.2_Intron	NM_080475	NP_536723	Q96P15	SPB11_HUMAN	serpin peptidase inhibitor, clade B, member 11						regulation of proteolysis	cytoplasm	serine-type endopeptidase inhibitor activity			breast(1)	1		Esophageal squamous(42;0.129)				GCTAAGTGAGGTAAGTATTTT	0.313													12	17	---	---	---	---	capture	Splice_Site	SNP	61387390	61387390	SERPINB11	18	G	A	A	A	1	0	0	0	0	0	0	1	0	572	44	5	2	13991	291
PTPRS	5802	broad.mit.edu	37	19	5273496	5273496	+	Silent	SNP	C	T	T			TCGA-87-5896-01	TCGA-87-5896-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:5273496C>T	uc002mbv.2	-	4	570	c.336G>A	c.(334-336)TCG>TCA	p.S112S	PTPRS_uc002mbu.1_Silent_p.S112S|PTPRS_uc010xin.1_Silent_p.S112S|PTPRS_uc002mbw.2_Silent_p.S112S|PTPRS_uc002mbx.2_Silent_p.S112S|PTPRS_uc002mby.2_Silent_p.S112S|PTPRS_uc002mbz.1_Silent_p.S112S	NM_002850	NP_002841	Q13332	PTPRS_HUMAN	protein tyrosine phosphatase, receptor type,	112	Ig-like C2-type 1.|Extracellular (Potential).				cell adhesion	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			large_intestine(2)|ovary(1)|central_nervous_system(1)	4				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0321)|Lung(535;0.182)		TCTCCCCAACCGAGTTCTGGG	0.587													18	43	---	---	---	---	capture	Silent	SNP	5273496	5273496	PTPRS	19	C	T	T	T	1	0	0	0	0	0	0	0	1	288	23	1	1	12706	291
KRTDAP	388533	broad.mit.edu	37	19	35979579	35979579	+	Silent	SNP	G	A	A			TCGA-87-5896-01	TCGA-87-5896-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:35979579G>A	uc002nzh.2	-	3	165	c.153C>T	c.(151-153)ATC>ATT	p.I51I		NM_207392	NP_997275	P60985	KTDAP_HUMAN	keratinocyte differentiation-associated protein	51					cell differentiation	extracellular region					0	all_lung(56;1.89e-08)|Lung NSC(56;2.9e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)			GCAATTTGTCGATGTTCAGGA	0.512													40	128	---	---	---	---	capture	Silent	SNP	35979579	35979579	KRTDAP	19	G	A	A	A	1	0	0	0	0	0	0	0	1	473	37	1	1	8500	291
SIPA1L3	23094	broad.mit.edu	37	19	38621245	38621245	+	Silent	SNP	C	T	T			TCGA-87-5896-01	TCGA-87-5896-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:38621245C>T	uc002ohk.2	+	10	3485	c.2976C>T	c.(2974-2976)GAC>GAT	p.D992D		NM_015073	NP_055888	O60292	SI1L3_HUMAN	signal-induced proliferation-associated 1 like	992	PDZ.				regulation of small GTPase mediated signal transduction	intracellular	GTPase activator activity			ovary(1)|central_nervous_system(1)	2			Lung(45;0.000246)|LUSC - Lung squamous cell carcinoma(53;0.000292)			AGGTTGAGGACTATGGGTTCG	0.662													54	54	---	---	---	---	capture	Silent	SNP	38621245	38621245	SIPA1L3	19	C	T	T	T	1	0	0	0	0	0	0	0	1	259	20	2	2	14224	291
LTBP4	8425	broad.mit.edu	37	19	41133127	41133127	+	Silent	SNP	C	T	T			TCGA-87-5896-01	TCGA-87-5896-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:41133127C>T	uc002ooh.1	+	32	4434	c.4434C>T	c.(4432-4434)GAC>GAT	p.D1478D	LTBP4_uc002oog.1_Silent_p.D1441D|LTBP4_uc002ooi.1_Silent_p.D1411D|LTBP4_uc002ooj.1_Silent_p.D351D|LTBP4_uc002ook.1_Silent_p.D612D|LTBP4_uc002ool.1_Silent_p.D490D|LTBP4_uc010xvp.1_Silent_p.D238D	NM_001042544	NP_001036009	Q8N2S1	LTBP4_HUMAN	latent transforming growth factor beta binding	1478	Pro-rich.				growth hormone secretion|multicellular organismal development|protein folding|regulation of cell differentiation|regulation of cell growth|regulation of proteolysis|regulation of transforming growth factor beta receptor signaling pathway	extracellular space|proteinaceous extracellular matrix	calcium ion binding|glycosaminoglycan binding|integrin binding|transforming growth factor beta binding|transforming growth factor beta receptor activity			central_nervous_system(1)	1			Lung(22;0.000158)|LUSC - Lung squamous cell carcinoma(20;0.000384)			ACTTTGAGGACGATGGTGGCC	0.701													3	5	---	---	---	---	capture	Silent	SNP	41133127	41133127	LTBP4	19	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	8991	291
CEACAM3	1084	broad.mit.edu	37	19	42301582	42301582	+	Silent	SNP	G	A	A			TCGA-87-5896-01	TCGA-87-5896-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:42301582G>A	uc002orn.1	+	2	202	c.126G>A	c.(124-126)CCG>CCA	p.P42P	CEACAM3_uc010eia.1_Silent_p.P42P|CEACAM3_uc002oro.1_RNA	NM_001815	NP_001806	P40198	CEAM3_HUMAN	carcinoembryonic antigen-related cell adhesion	42	Ig-like V-type.|Extracellular (Potential).					integral to membrane				skin(1)	1						AATCCATGCCGCTCAGTGTCG	0.522													43	95	---	---	---	---	capture	Silent	SNP	42301582	42301582	CEACAM3	19	G	A	A	A	1	0	0	0	0	0	0	0	1	483	38	1	1	3162	291
PSG1	5669	broad.mit.edu	37	19	43383725	43383725	+	Silent	SNP	G	T	T			TCGA-87-5896-01	TCGA-87-5896-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr19:43383725G>T	uc002ovb.2	-	1	147	c.9C>A	c.(7-9)ACC>ACA	p.T3T	PSG3_uc002ouf.2_Intron|PSG1_uc002oug.1_Silent_p.T3T|PSG11_uc002ouw.2_Intron|PSG7_uc002ous.1_Intron|PSG7_uc002out.1_Intron|PSG10_uc002ouv.1_Intron|PSG1_uc002oun.2_RNA|PSG1_uc002our.1_Silent_p.T3T|PSG1_uc010eio.1_Silent_p.T3T|PSG1_uc002oux.1_5'Flank|PSG1_uc002ouy.1_Silent_p.T3T|PSG1_uc002ouz.1_Silent_p.T3T|PSG1_uc002ova.1_Silent_p.T3T|PSG1_uc002ovc.2_Silent_p.T3T|PSG1_uc002ovd.1_Silent_p.T3T	NM_006905	NP_008836	P11464	PSG1_HUMAN	pregnancy specific beta-1-glycoprotein 1	3					female pregnancy	extracellular region				ovary(2)	2		Prostate(69;0.00682)				GGGCTGAGAGGGTTCCCATGG	0.572													36	108	---	---	---	---	capture	Silent	SNP	43383725	43383725	PSG1	19	G	T	T	T	1	0	0	0	0	0	0	0	1	548	43	4	4	12548	291
TTC15	51112	broad.mit.edu	37	2	3392072	3392072	+	Silent	SNP	C	T	T			TCGA-87-5896-01	TCGA-87-5896-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:3392072C>T	uc002qxm.1	+	2	884	c.678C>T	c.(676-678)TCC>TCT	p.S226S	TTC15_uc002qxn.1_Silent_p.S226S|TTC15_uc010ewm.1_Silent_p.S226S|TTC15_uc002qxl.1_Silent_p.S226S	NM_016030	NP_057114	Q8WVT3	TTC15_HUMAN	tetratricopeptide repeat domain 15	226							binding			ovary(2)|breast(1)|pancreas(1)	4	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.093)	all_cancers(51;0.214)		OV - Ovarian serous cystadenocarcinoma(76;0.0402)|Epithelial(75;0.0986)|all cancers(51;0.149)		TCTTCGACTCCTTTACTACCT	0.547													10	15	---	---	---	---	capture	Silent	SNP	3392072	3392072	TTC15	2	C	T	T	T	1	0	0	0	0	0	0	0	1	301	24	2	2	16564	291
MAP4K4	9448	broad.mit.edu	37	2	102440436	102440436	+	Missense_Mutation	SNP	A	T	T			TCGA-87-5896-01	TCGA-87-5896-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:102440436A>T	uc002tbg.2	+	4	282	c.227A>T	c.(226-228)TAC>TTC	p.Y76F	MAP4K4_uc002tbc.2_Missense_Mutation_p.Y76F|MAP4K4_uc002tbd.2_Missense_Mutation_p.Y76F|MAP4K4_uc002tbe.2_Missense_Mutation_p.Y76F|MAP4K4_uc002tbf.2_Missense_Mutation_p.Y76F|MAP4K4_uc010yvy.1_Missense_Mutation_p.Y76F|MAP4K4_uc002tbh.2_Missense_Mutation_p.Y76F|MAP4K4_uc002tbi.2_Missense_Mutation_p.Y76F|MAP4K4_uc010yvz.1_Missense_Mutation_p.Y56F|MAP4K4_uc010fiw.1_Intron|MAP4K4_uc002tbj.1_5'Flank	NM_145687	NP_663720	O95819	M4K4_HUMAN	mitogen-activated protein kinase kinase kinase	76	Protein kinase.				intracellular protein kinase cascade|regulation of JNK cascade|response to stress	cytoplasm	ATP binding|protein binding|protein serine/threonine kinase activity|small GTPase regulator activity			stomach(1)|lung(1)|central_nervous_system(1)|skin(1)	4						CTAAAGAAATACTCTCATCAC	0.368													4	8	---	---	---	---	capture	Missense_Mutation	SNP	102440436	102440436	MAP4K4	2	A	T	T	T	1	0	0	0	0	1	0	0	0	182	14	4	4	9176	291
ST6GAL2	84620	broad.mit.edu	37	2	107460197	107460197	+	Silent	SNP	C	T	T			TCGA-87-5896-01	TCGA-87-5896-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr2:107460197C>T	uc002tdq.2	-	2	356	c.237G>A	c.(235-237)GCG>GCA	p.A79A	ST6GAL2_uc002tdr.2_Silent_p.A79A|ST6GAL2_uc002tds.3_Silent_p.A79A	NM_001142351	NP_001135823	Q96JF0	SIAT2_HUMAN	ST6 beta-galactosamide	79	Lumenal (Potential).				growth|multicellular organismal development|oligosaccharide metabolic process|protein glycosylation	Golgi cisterna membrane|integral to Golgi membrane	beta-galactoside alpha-2,6-sialyltransferase activity	p.A79V(1)		pancreas(6)|ovary(4)|skin(1)	11						CGCGGGGCAGCGCCTGGCGTG	0.657													20	14	---	---	---	---	capture	Silent	SNP	107460197	107460197	ST6GAL2	2	C	T	T	T	1	0	0	0	0	0	0	0	1	340	27	1	1	15112	291
GPR149	344758	broad.mit.edu	37	3	154139085	154139085	+	Missense_Mutation	SNP	T	C	C			TCGA-87-5896-01	TCGA-87-5896-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:154139085T>C	uc003faa.2	-	3	1466	c.1366A>G	c.(1366-1368)ATC>GTC	p.I456V		NM_001038705	NP_001033794	Q86SP6	GP149_HUMAN	G protein-coupled receptor 149	456	Cytoplasmic (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(6)	6			LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.173)			GTGGTGCTGATTTCTACTTTT	0.393													67	114	---	---	---	---	capture	Missense_Mutation	SNP	154139085	154139085	GPR149	3	T	C	C	C	1	0	0	0	0	1	0	0	0	676	52	3	3	6588	291
SI	6476	broad.mit.edu	37	3	164716358	164716358	+	Nonsense_Mutation	SNP	G	A	A			TCGA-87-5896-01	TCGA-87-5896-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:164716358G>A	uc003fei.2	-	38	4572	c.4510C>T	c.(4510-4512)CGA>TGA	p.R1504*		NM_001041	NP_001032	P14410	SUIS_HUMAN	sucrase-isomaltase	1504	Sucrase.|Lumenal.				carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|brush border|Golgi apparatus|integral to membrane	carbohydrate binding|oligo-1,6-glucosidase activity|sucrose alpha-glucosidase activity			ovary(7)|upper_aerodigestive_tract(4)|skin(2)|pancreas(1)	14		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)	TTGTCCCATCGTGCATAGTTG	0.403										HNSCC(35;0.089)			33	52	---	---	---	---	capture	Nonsense_Mutation	SNP	164716358	164716358	SI	3	G	A	A	A	1	0	0	0	0	0	1	0	0	519	40	5	1	14190	291
TNIK	23043	broad.mit.edu	37	3	170800078	170800078	+	Missense_Mutation	SNP	T	G	G			TCGA-87-5896-01	TCGA-87-5896-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr3:170800078T>G	uc003fhh.2	-	27	3620	c.3275A>C	c.(3274-3276)GAT>GCT	p.D1092A	TNIK_uc003fhi.2_Missense_Mutation_p.D1037A|TNIK_uc003fhj.2_Missense_Mutation_p.D1063A|TNIK_uc003fhk.2_Missense_Mutation_p.D1084A|TNIK_uc003fhl.2_Missense_Mutation_p.D1008A|TNIK_uc003fhm.2_Missense_Mutation_p.D1029A|TNIK_uc003fhn.2_Missense_Mutation_p.D1055A|TNIK_uc003fho.2_Missense_Mutation_p.D1000A|TNIK_uc003fhg.2_Missense_Mutation_p.D270A|TNIK_uc003fhp.2_Missense_Mutation_p.D24A	NM_015028	NP_055843	Q9UKE5	TNIK_HUMAN	TRAF2 and NCK interacting kinase isoform 1	1092	CNH.				actin cytoskeleton reorganization|activation of JNKK activity|protein autophosphorylation|regulation of dendrite morphogenesis|Wnt receptor signaling pathway	cytoskeleton|nucleus|recycling endosome	ATP binding|protein binding|protein serine/threonine kinase activity|small GTPase regulator activity			ovary(4)|large_intestine(1)	5	all_cancers(22;2.55e-19)|all_lung(20;2.22e-14)|Ovarian(172;0.00197)|Breast(254;0.122)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)			CTCTAGCACATCCATCTGCTG	0.483													7	14	---	---	---	---	capture	Missense_Mutation	SNP	170800078	170800078	TNIK	3	T	G	G	G	1	0	0	0	0	1	0	0	0	650	50	4	4	16196	291
FYB	2533	broad.mit.edu	37	5	39153687	39153687	+	Silent	SNP	C	T	T			TCGA-87-5896-01	TCGA-87-5896-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:39153687C>T	uc003jls.2	-	2	1222	c.1155G>A	c.(1153-1155)ACG>ACA	p.T385T	FYB_uc003jlt.2_Silent_p.T385T|FYB_uc003jlu.2_Silent_p.T385T|FYB_uc011cpl.1_Silent_p.T395T	NM_199335	NP_955367	O15117	FYB_HUMAN	FYN binding protein (FYB-120/130) isoform 2	385	Interaction with SKAP1.				cell junction assembly|immune response|intracellular protein kinase cascade|NLS-bearing substrate import into nucleus|protein phosphorylation|T cell receptor signaling pathway	cytosol|nucleus	protein binding			ovary(2)	2	all_lung(31;0.000343)		Epithelial(62;0.235)			TTGAGTAAGACGTCTGGCCTT	0.423													26	45	---	---	---	---	capture	Silent	SNP	39153687	39153687	FYB	5	C	T	T	T	1	0	0	0	0	0	0	0	1	236	19	1	1	6066	291
IQGAP2	10788	broad.mit.edu	37	5	75998408	75998408	+	Missense_Mutation	SNP	A	G	G			TCGA-87-5896-01	TCGA-87-5896-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:75998408A>G	uc003kek.2	+	35	4829	c.4607A>G	c.(4606-4608)AAT>AGT	p.N1536S	IQGAP2_uc011csv.1_Missense_Mutation_p.N1032S|IQGAP2_uc003kel.2_Missense_Mutation_p.N1032S	NM_006633	NP_006624	Q13576	IQGA2_HUMAN	IQ motif containing GTPase activating protein 2	1536					small GTPase mediated signal transduction	actin cytoskeleton	actin binding|calmodulin binding|GTPase inhibitor activity|Ras GTPase activator activity			ovary(6)|central_nervous_system(1)	7		all_lung(232;0.000514)|Lung NSC(167;0.00135)|Prostate(461;0.00838)|Ovarian(174;0.0149)		all cancers(79;1.38e-36)		GTGCAACTCAATATTCAGGTA	0.353													19	29	---	---	---	---	capture	Missense_Mutation	SNP	75998408	75998408	IQGAP2	5	A	G	G	G	1	0	0	0	0	1	0	0	0	52	4	3	3	7738	291
CEP120	153241	broad.mit.edu	37	5	122754205	122754205	+	Silent	SNP	C	T	T			TCGA-87-5896-01	TCGA-87-5896-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr5:122754205C>T	uc003ktk.2	-	3	136	c.54G>A	c.(52-54)CGG>CGA	p.R18R	CEP120_uc011cwq.1_5'UTR|CEP120_uc010jcz.1_5'UTR	NM_153223	NP_694955	Q8N960	CE120_HUMAN	coiled-coil domain containing 100	18						centrosome				ovary(1)	1						TGGGGAAATGCCGACCTGGAG	0.353													3	41	---	---	---	---	capture	Silent	SNP	122754205	122754205	CEP120	5	C	T	T	T	1	0	0	0	0	0	0	0	1	327	26	2	2	3214	291
DSP	1832	broad.mit.edu	37	6	7565623	7565623	+	Missense_Mutation	SNP	G	A	A			TCGA-87-5896-01	TCGA-87-5896-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:7565623G>A	uc003mxp.1	+	7	1088	c.809G>A	c.(808-810)CGA>CAA	p.R270Q	DSP_uc003mxq.1_Missense_Mutation_p.R270Q	NM_004415	NP_004406	P15924	DESP_HUMAN	desmoplakin isoform I	270	Globular 1.|Interacts with plakophilin 1 and junction plakoglobin.				cellular component disassembly involved in apoptosis|keratinocyte differentiation|peptide cross-linking	cornified envelope|cytoplasm|desmosome	protein binding, bridging|structural constituent of cytoskeleton			central_nervous_system(6)|ovary(2)|skin(1)	9	Ovarian(93;0.0584)	all_hematologic(90;0.236)		OV - Ovarian serous cystadenocarcinoma(45;0.000508)		GATCACCTGCGACAGCTGCAG	0.502													26	40	---	---	---	---	capture	Missense_Mutation	SNP	7565623	7565623	DSP	6	G	A	A	A	1	0	0	0	0	1	0	0	0	481	37	1	1	4736	291
DNAH8	1769	broad.mit.edu	37	6	38957817	38957817	+	Silent	SNP	G	A	A	rs143472136	byFrequency	TCGA-87-5896-01	TCGA-87-5896-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:38957817G>A	uc003ooe.1	+	86	13032	c.12432G>A	c.(12430-12432)CCG>CCA	p.P4144P		NM_001371	NP_001362			dynein, axonemal, heavy polypeptide 8											skin(8)|ovary(7)|lung(2)|large_intestine(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	21						TGTTTGAACCGTCATTCTGCT	0.368													38	67	---	---	---	---	capture	Silent	SNP	38957817	38957817	DNAH8	6	G	A	A	A	1	0	0	0	0	0	0	0	1	509	40	1	1	4563	291
GSTA1	2938	broad.mit.edu	37	6	52658945	52658945	+	Missense_Mutation	SNP	C	T	T			TCGA-87-5896-01	TCGA-87-5896-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:52658945C>T	uc003paz.2	-	5	504	c.392G>A	c.(391-393)CGC>CAC	p.R131H		NM_145740	NP_665683	P08263	GSTA1_HUMAN	glutathione S-transferase alpha 1	131	GST C-terminal.				glutathione metabolic process|xenobiotic metabolic process	cytosol	glutathione transferase activity			ovary(1)	1	Lung NSC(77;0.118)				Amsacrine(DB00276)|Busulfan(DB01008)|Glutathione(DB00143)	AGGGAAGTAGCGATTTTTTAT	0.438													85	162	---	---	---	---	capture	Missense_Mutation	SNP	52658945	52658945	GSTA1	6	C	T	T	T	1	0	0	0	0	1	0	0	0	351	27	1	1	6762	291
AKD1	221264	broad.mit.edu	37	6	109827537	109827537	+	Missense_Mutation	SNP	T	C	C			TCGA-87-5896-01	TCGA-87-5896-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr6:109827537T>C	uc003ptn.2	-	35	4919	c.4842A>G	c.(4840-4842)ATA>ATG	p.I1614M	AKD1_uc011eas.1_Missense_Mutation_p.I13M	NM_001145128	NP_001138600	Q5TCS8	AKD1_HUMAN	adenylate kinase domain containing 1 isoform 1	1614					nucleobase, nucleoside, nucleotide and nucleic acid metabolic process		ATP binding|nucleobase, nucleoside, nucleotide kinase activity|nucleoside-triphosphatase activity			ovary(1)	1						TACCTGCTTTTATTCTTTCCA	0.323													46	82	---	---	---	---	capture	Missense_Mutation	SNP	109827537	109827537	AKD1	6	T	C	C	C	1	0	0	0	0	1	0	0	0	784	61	3	3	460	291
MIOS	54468	broad.mit.edu	37	7	7612689	7612689	+	Nonsense_Mutation	SNP	C	T	T			TCGA-87-5896-01	TCGA-87-5896-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:7612689C>T	uc003srf.2	+	4	891	c.583C>T	c.(583-585)CGA>TGA	p.R195*	MIOS_uc010ktp.1_Nonsense_Mutation_p.R195*	NM_019005	NP_061878	Q9NXC5	MIO_HUMAN	missing oocyte, meiosis regulator, homolog	195	WD 3.										0						TTGGCTTCCACGAGACCAGAA	0.383													17	47	---	---	---	---	capture	Nonsense_Mutation	SNP	7612689	7612689	MIOS	7	C	T	T	T	1	0	0	0	0	0	1	0	0	243	19	5	1	9501	291
ABCA13	154664	broad.mit.edu	37	7	48450229	48450229	+	Silent	SNP	G	T	T			TCGA-87-5896-01	TCGA-87-5896-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:48450229G>T	uc003toq.2	+	40	12208	c.12183G>T	c.(12181-12183)CTG>CTT	p.L4061L	ABCA13_uc010kys.1_Silent_p.L1135L|ABCA13_uc010kyt.1_RNA	NM_152701	NP_689914	Q86UQ4	ABCAD_HUMAN	ATP binding cassette, sub-family A (ABC1),	4061	ABC transporter 1.				transport	integral to membrane	ATP binding|ATPase activity			ovary(5)|central_nervous_system(4)|skin(1)	10						CCTTCTGCCTGAAGGAGGCAT	0.582													49	139	---	---	---	---	capture	Silent	SNP	48450229	48450229	ABCA13	7	G	T	T	T	1	0	0	0	0	0	0	0	1	574	45	4	4	31	291
POM121L12	285877	broad.mit.edu	37	7	53104048	53104048	+	Silent	SNP	C	A	A			TCGA-87-5896-01	TCGA-87-5896-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:53104048C>A	uc003tpz.2	+	1	700	c.684C>A	c.(682-684)TCC>TCA	p.S228S		NM_182595	NP_872401	Q8N7R1	P1L12_HUMAN	POM121 membrane glycoprotein-like 12	228											0						CGGTTGCTTCCTTCGTGCCCA	0.637													23	49	---	---	---	---	capture	Silent	SNP	53104048	53104048	POM121L12	7	C	A	A	A	1	0	0	0	0	0	0	0	1	301	24	4	4	12143	291
NSUN5	55695	broad.mit.edu	37	7	72717906	72717906	+	Silent	SNP	G	A	A			TCGA-87-5896-01	TCGA-87-5896-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:72717906G>A	uc003txw.2	-	8	1098	c.1062C>T	c.(1060-1062)CTC>CTT	p.L354L	FKBP6_uc003twz.2_Intron|NSUN5_uc003txv.2_Silent_p.L354L|NSUN5_uc003txx.2_Silent_p.L316L|NSUN5_uc011kev.1_Silent_p.L354L	NM_018044	NP_060514	Q96P11	NSUN5_HUMAN	NOL1/NOP2/Sun domain family, member 5 isoform 2	354							methyltransferase activity				0		Lung NSC(55;0.163)				TGGAGTAGACGAGCCGCTGCA	0.677													17	24	---	---	---	---	capture	Silent	SNP	72717906	72717906	NSUN5	7	G	A	A	A	1	0	0	0	0	0	0	0	1	470	37	1	1	10588	291
EPHB6	2051	broad.mit.edu	37	7	142566033	142566033	+	Silent	SNP	C	T	T			TCGA-87-5896-01	TCGA-87-5896-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr7:142566033C>T	uc011kst.1	+	14	2740	c.1953C>T	c.(1951-1953)TAC>TAT	p.Y651Y	EPHB6_uc011ksu.1_Silent_p.Y651Y|EPHB6_uc003wbs.2_Silent_p.Y359Y|EPHB6_uc003wbt.2_Silent_p.Y125Y|EPHB6_uc003wbu.2_Silent_p.Y359Y|EPHB6_uc003wbv.2_Silent_p.Y35Y	NM_004445	NP_004436	O15197	EPHB6_HUMAN	ephrin receptor EphB6 precursor	651	Cytoplasmic (Potential).					extracellular region|integral to plasma membrane	ATP binding|ephrin receptor activity			lung(8)|large_intestine(4)|central_nervous_system(3)|stomach(1)|skin(1)|ovary(1)|pancreas(1)	19	Melanoma(164;0.059)					CCTCCACCTACGAGGACCCCT	0.577													38	60	---	---	---	---	capture	Silent	SNP	142566033	142566033	EPHB6	7	C	T	T	T	1	0	0	0	0	0	0	0	1	246	19	1	1	5133	291
FAM110B	90362	broad.mit.edu	37	8	59059474	59059474	+	Missense_Mutation	SNP	A	C	C	rs139483735		TCGA-87-5896-01	TCGA-87-5896-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:59059474A>C	uc003xtj.1	+	5	1565	c.685A>C	c.(685-687)AAA>CAA	p.K229Q		NM_147189	NP_671722	Q8TC76	F110B_HUMAN	hypothetical protein LOC90362	229						microtubule organizing center|mitochondrion|nucleus				large_intestine(1)	1		all_epithelial(80;0.025)|all_lung(136;0.0274)|Lung NSC(129;0.0355)				TCCCAAGCCCAAAATCGCAGC	0.632													3	89	---	---	---	---	capture	Missense_Mutation	SNP	59059474	59059474	FAM110B	8	A	C	C	C	1	0	0	0	0	1	0	0	0	65	5	4	4	5351	291
MYBL1	4603	broad.mit.edu	37	8	67507922	67507922	+	Nonsense_Mutation	SNP	G	A	A			TCGA-87-5896-01	TCGA-87-5896-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr8:67507922G>A	uc003xwj.2	-	6	990	c.583C>T	c.(583-585)CAA>TAA	p.Q195*	MYBL1_uc003xwl.2_Nonsense_Mutation_p.Q195*|MYBL1_uc003xwk.2_Nonsense_Mutation_p.Q195*	NM_001080416	NP_001073885	P10243	MYBA_HUMAN	v-myb myeloblastosis viral oncogene homolog	195					positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(2)|pancreas(1)	3			Epithelial(68;0.00211)|all cancers(69;0.00726)|OV - Ovarian serous cystadenocarcinoma(28;0.00989)|BRCA - Breast invasive adenocarcinoma(89;0.0938)			ATTCCATCTTGTAAATAGCCC	0.343													5	8	---	---	---	---	capture	Nonsense_Mutation	SNP	67507922	67507922	MYBL1	8	G	A	A	A	1	0	0	0	0	0	1	0	0	624	48	5	2	9919	291
NOL8	55035	broad.mit.edu	37	9	95077750	95077750	+	Missense_Mutation	SNP	G	A	A			TCGA-87-5896-01	TCGA-87-5896-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:95077750G>A	uc004arv.2	-	7	1494	c.1157C>T	c.(1156-1158)GCG>GTG	p.A386V	NOL8_uc010mqw.2_RNA|NOL8_uc004arw.2_Intron|NOL8_uc011ltw.1_Missense_Mutation_p.A318V	NM_017948	NP_060418	Q76FK4	NOL8_HUMAN	nucleolar protein 8	386					DNA replication|positive regulation of cell growth	nucleolus	nucleotide binding|protein binding|RNA binding			ovary(1)	1						TTTTTTCATCGCAATAATTTC	0.323													8	13	---	---	---	---	capture	Missense_Mutation	SNP	95077750	95077750	NOL8	9	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	10434	291
PALM2-AKAP2	445815	broad.mit.edu	37	9	112687347	112687347	+	Missense_Mutation	SNP	T	C	C			TCGA-87-5896-01	TCGA-87-5896-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:112687347T>C	uc004bei.2	+	5	571	c.379T>C	c.(379-381)TCC>CCC	p.S127P	PALM2_uc004bef.2_Missense_Mutation_p.S129P|PALM2_uc004beg.2_Missense_Mutation_p.S129P|PALM2_uc004beh.3_Missense_Mutation_p.S127P|PALM2-AKAP2_uc004bek.3_Missense_Mutation_p.S127P|PALM2-AKAP2_uc004bej.3_Missense_Mutation_p.S127P|PALM2-AKAP2_uc004bel.1_5'UTR	NM_001136562	NP_001130034	Q9Y2D5	AKAP2_HUMAN	A kinase (PRKA) anchor protein 2 isoform 2	Error:Variant_position_missing_in_Q9Y2D5_after_alignment							enzyme binding	p.S127Y(1)		ovary(3)|central_nervous_system(2)|skin(1)	6						ACAGGGTTTCTCCAGTACGGA	0.463													17	29	---	---	---	---	capture	Missense_Mutation	SNP	112687347	112687347	PALM2-AKAP2	9	T	C	C	C	1	0	0	0	0	1	0	0	0	702	54	3	3	11314	291
CEL	1056	broad.mit.edu	37	9	135945919	135945919	+	Missense_Mutation	SNP	C	T	T			TCGA-87-5896-01	TCGA-87-5896-01									Unknown	Unspecified	Unspecified				Unspecified	g.chr9:135945919C>T	uc010naa.1	+	10	1383	c.1367C>T	c.(1366-1368)GCC>GTC	p.A456V		NM_001807	NP_001798	P19835	CEL_HUMAN	carboxyl ester lipase precursor	453					cholesterol catabolic process|fatty acid catabolic process|intestinal cholesterol absorption|intestinal lipid catabolic process|pancreatic juice secretion|protein esterification	cytosol|extracellular space	acylglycerol lipase activity|carboxylesterase activity|heparin binding|sterol esterase activity|triglyceride lipase activity			pancreas(1)	1				OV - Ovarian serous cystadenocarcinoma(145;1.03e-40)|Epithelial(140;3.58e-37)|GBM - Glioblastoma multiforme(294;0.00164)|READ - Rectum adenocarcinoma(205;0.196)		TGGGTGGGGGCCGACCATGCA	0.607													4	63	---	---	---	---	capture	Missense_Mutation	SNP	135945919	135945919	CEL	9	C	T	T	T	1	0	0	0	0	1	0	0	0	338	26	2	2	3177	291
MAP7D2	256714	broad.mit.edu	37	X	20074865	20074865	+	Silent	SNP	C	T	T			TCGA-87-5896-01	TCGA-87-5896-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:20074865C>T	uc004czr.1	-	4	436	c.417G>A	c.(415-417)CAG>CAA	p.Q139Q	MAP7D2_uc004czq.1_Silent_p.Q10Q|MAP7D2_uc011mji.1_Silent_p.Q95Q|MAP7D2_uc010nfo.1_Silent_p.Q139Q|MAP7D2_uc011mjj.1_Silent_p.Q139Q|MAP7D2_uc004czs.1_Silent_p.Q95Q	NM_152780	NP_689993	Q96T17	MA7D2_HUMAN	MAP7 domain containing 2	139	Potential.									ovary(2)|breast(1)	3						GCTCCAGCTGCTGTGTGCGCT	0.557													13	28	---	---	---	---	capture	Silent	SNP	20074865	20074865	MAP7D2	23	C	T	T	T	1	0	0	0	0	0	0	0	1	363	28	2	2	9181	291
BCOR	54880	broad.mit.edu	37	X	39933293	39933293	+	Missense_Mutation	SNP	C	T	T			TCGA-87-5896-01	TCGA-87-5896-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:39933293C>T	uc004den.3	-	4	1598	c.1306G>A	c.(1306-1308)GTC>ATC	p.V436I	BCOR_uc004dep.3_Missense_Mutation_p.V436I|BCOR_uc004deo.3_Missense_Mutation_p.V436I|BCOR_uc004dem.3_Missense_Mutation_p.V436I|BCOR_uc004deq.3_Missense_Mutation_p.V436I	NM_001123385	NP_001116857	Q6W2J9	BCOR_HUMAN	BCL-6 interacting corepressor isoform c	436					heart development|histone H2A monoubiquitination|negative regulation of bone mineralization|negative regulation of histone H3-K36 methylation|negative regulation of histone H3-K4 methylation|negative regulation of tooth mineralization|negative regulation of transcription from RNA polymerase II promoter|odontogenesis|palate development|specification of axis polarity|transcription, DNA-dependent	nucleus	heat shock protein binding|histone deacetylase binding|transcription corepressor activity|transcription factor binding|transcription regulatory region DNA binding			ovary(2)|kidney(1)|central_nervous_system(1)	4						TTATCTGTGACGTCTTTGGTA	0.527													19	25	---	---	---	---	capture	Missense_Mutation	SNP	39933293	39933293	BCOR	23	C	T	T	T	1	0	0	0	0	1	0	0	0	247	19	1	1	1375	291
ITIH5L	347365	broad.mit.edu	37	X	54783873	54783873	+	Missense_Mutation	SNP	G	T	T			TCGA-87-5896-01	TCGA-87-5896-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:54783873G>T	uc004dtj.2	-	8	2664	c.2634C>A	c.(2632-2634)AAC>AAA	p.N878K		NM_198510	NP_940912	Q6UXX5	ITH5L_HUMAN	inter-alpha (globulin) inhibitor H5-like	878	Pro-rich.				hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity			lung(2)|skin(2)|ovary(1)|breast(1)	6						GCATATGGGGGTTTGGGGTCT	0.483													25	34	---	---	---	---	capture	Missense_Mutation	SNP	54783873	54783873	ITIH5L	23	G	T	T	T	1	0	0	0	0	1	0	0	0	568	44	4	4	7831	291
ZXDA	7789	broad.mit.edu	37	X	57935325	57935325	+	Silent	SNP	G	A	A			TCGA-87-5896-01	TCGA-87-5896-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:57935325G>A	uc004dve.2	-	1	1743	c.1530C>T	c.(1528-1530)TTC>TTT	p.F510F		NM_007156	NP_009087	P98168	ZXDA_HUMAN	zinc finger, X-linked, duplicated A	510	Required for interaction with ZXDC.|C2H2-type 9.				positive regulation of transcription, DNA-dependent	nucleus	C2H2 zinc finger domain binding|identical protein binding|nucleic acid binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1						CAGGACACACGAAAGGCTTTG	0.552													22	30	---	---	---	---	capture	Silent	SNP	57935325	57935325	ZXDA	23	G	A	A	A	1	0	0	0	0	0	0	0	1	477	37	1	1	18126	291
MAGT1	84061	broad.mit.edu	37	X	77112989	77112989	+	Missense_Mutation	SNP	G	T	T			TCGA-87-5896-01	TCGA-87-5896-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:77112989G>T	uc004fof.2	-	4	554	c.492C>A	c.(490-492)AAC>AAA	p.N164K	MAGT1_uc004fog.3_RNA	NM_032121	NP_115497	Q9H0U3	MAGT1_HUMAN	magnesium transporter 1	132					protein N-linked glycosylation via asparagine	integral to membrane|oligosaccharyltransferase complex				upper_aerodigestive_tract(1)	1						CTGAATTCATGTTTAGCTGAA	0.338													6	78	---	---	---	---	capture	Missense_Mutation	SNP	77112989	77112989	MAGT1	23	G	T	T	T	1	0	0	0	0	1	0	0	0	620	48	4	4	9110	291
RHOXF1	158800	broad.mit.edu	37	X	119243159	119243159	+	Silent	SNP	G	A	A	rs145568775		TCGA-87-5896-01	TCGA-87-5896-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:119243159G>A	uc004esk.1	-	3	621	c.546C>T	c.(544-546)GTC>GTT	p.V182V	uc004esi.1_Intron	NM_139282	NP_644811	Q8NHV9	RHXF1_HUMAN	Rhox homeobox family, member 1	182					gamete generation|multicellular organismal development|steroid hormone receptor signaling pathway	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0						GCTAGTCCACGACGATGTAGA	0.507													18	26	---	---	---	---	capture	Silent	SNP	119243159	119243159	RHOXF1	23	G	A	A	A	1	0	0	0	0	0	0	0	1	470	37	1	1	13239	291
RAP2C	57826	broad.mit.edu	37	X	131348336	131348336	+	Missense_Mutation	SNP	A	C	C			TCGA-87-5896-01	TCGA-87-5896-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:131348336A>C	uc004ewp.2	-	3	1196	c.412T>G	c.(412-414)TGG>GGG	p.W138G	RAP2C_uc004ewo.2_Missense_Mutation_p.W72G|RAP2C_uc010nrk.2_RNA|RAP2C_uc004ewq.3_Missense_Mutation_p.W138G	NM_021183	NP_067006	Q9Y3L5	RAP2C_HUMAN	RAP2C, member of RAS oncogene family precursor	138					negative regulation of cell migration|positive regulation of protein autophosphorylation|Rap protein signal transduction|regulation of protein tyrosine kinase activity	recycling endosome membrane	GTP binding|GTPase activity			ovary(1)	1	Acute lymphoblastic leukemia(192;0.000127)					GGACAGCCCCATTCTTGAGCC	0.438													38	61	---	---	---	---	capture	Missense_Mutation	SNP	131348336	131348336	RAP2C	23	A	C	C	C	1	0	0	0	0	1	0	0	0	104	8	4	4	12937	291
F9	2158	broad.mit.edu	37	X	138643011	138643011	+	Missense_Mutation	SNP	G	A	A	rs137852247		TCGA-87-5896-01	TCGA-87-5896-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:138643011G>A	uc004fas.1	+	7	864	c.835G>A	c.(835-837)GCA>ACA	p.A279T	F9_uc004fat.1_Missense_Mutation_p.A241T	NM_000133	NP_000124	P00740	FA9_HUMAN	coagulation factor IX preproprotein	279	Peptidase S1.		A -> T (in HEMB; mild).		blood coagulation, extrinsic pathway|blood coagulation, intrinsic pathway|peptidyl-glutamic acid carboxylation|post-translational protein modification|proteolysis	endoplasmic reticulum lumen|extracellular region|Golgi lumen|plasma membrane	calcium ion binding|serine-type endopeptidase activity			lung(2)|ovary(1)	3	Acute lymphoblastic leukemia(192;0.000127)				Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Heparin(DB01109)|Menadione(DB00170)	TACAGTTGTCGCAGGTAAATA	0.353													57	61	---	---	---	---	capture	Missense_Mutation	SNP	138643011	138643011	F9	23	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	5305	291
FATE1	89885	broad.mit.edu	37	X	150891145	150891145	+	Missense_Mutation	SNP	G	A	A			TCGA-87-5896-01	TCGA-87-5896-01									Unknown	Unspecified	Unspecified				Unspecified	g.chrX:150891145G>A	uc004fex.2	+	5	550	c.466G>A	c.(466-468)GCC>ACC	p.A156T		NM_033085	NP_149076	Q969F0	FATE1_HUMAN	fetal and adult testis expressed transcript	156						endoplasmic reticulum|integral to membrane				ovary(1)	1	Acute lymphoblastic leukemia(192;6.56e-05)					GGAACAGGGCGCCACCTGGCG	0.652													42	39	---	---	---	---	capture	Missense_Mutation	SNP	150891145	150891145	FATE1	23	G	A	A	A	1	0	0	0	0	1	0	0	0	494	38	1	1	5639	291
