Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
AK2	204	broad.mit.edu	37	1	33487201	33487201	+	Missense_Mutation	SNP	G	T	T			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:33487201G>T	uc001bwp.1	-	3	365	c.323C>A	c.(322-324)GCA>GAA	p.A108E	uc001bwn.2_Intron|AK2_uc001bwo.1_Missense_Mutation_p.A108E|AK2_uc010ohq.1_Missense_Mutation_p.A108E|AK2_uc009vud.1_Missense_Mutation_p.A66E|AK2_uc010ohr.1_Missense_Mutation_p.A60E|AK2_uc001bwq.1_Missense_Mutation_p.A60E	NM_001625	NP_001616	P54819	KAD2_HUMAN	adenylate kinase 2 isoform a	108					nucleobase, nucleoside and nucleotide interconversion	mitochondrial intermembrane space	adenylate kinase activity|ATP binding				0		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)				CACCATTTCTGCCTGCCTCAC	0.418													37	70	---	---	---	---	PASS
TMEM48	55706	broad.mit.edu	37	1	54262374	54262374	+	Missense_Mutation	SNP	A	C	C			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:54262374A>C	uc001cvs.2	-	13	1813	c.1572T>G	c.(1570-1572)AAT>AAG	p.N524K	TMEM48_uc010onu.1_Missense_Mutation_p.N484K|TMEM48_uc001cvt.2_Missense_Mutation_p.N401K|TMEM48_uc009vzk.2_Intron|TMEM48_uc010onv.1_Missense_Mutation_p.N189K	NM_018087	NP_060557	Q9BTX1	NDC1_HUMAN	transmembrane protein 48	524	Cytoplasmic (Potential).				mRNA transport|nuclear pore complex assembly|nuclear pore distribution|protein transport|transmembrane transport	nuclear membrane|nuclear pore	protein binding|structural constituent of nuclear pore			ovary(1)|pancreas(1)	2						GTTCACGTTTATTCTGAATCC	0.348													40	136	---	---	---	---	PASS
LOC400759	400759	broad.mit.edu	37	1	89889894	89889894	+	RNA	SNP	A	C	C			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:89889894A>C	uc009wcy.1	+	5		c.635A>C				NR_003133				Homo sapiens cDNA, FLJ17004.												0						TGAGCAGATGATGGAACAGAA	0.468													201	587	---	---	---	---	PASS
NBPF10	100132406	broad.mit.edu	37	1	145367767	145367767	+	Missense_Mutation	SNP	G	A	A	rs77484671		TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145367767G>A	uc001end.3	+	85	10623	c.10588G>A	c.(10588-10590)GAA>AAA	p.E3530K	NBPF9_uc010oye.1_Intron|NBPF10_uc001emp.3_Intron|NBPF10_uc010oyi.1_Intron|NBPF10_uc010oyk.1_Intron|NBPF10_uc010oyl.1_Intron	NM_001039703	NP_001034792	A6NDV3	A6NDV3_HUMAN	hypothetical protein LOC100132406	3455											0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		atcaaagaaggaaagaagaag	0.254													6	124	---	---	---	---	PASS
C1orf56	54964	broad.mit.edu	37	1	151021076	151021076	+	Silent	SNP	A	G	G			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151021076A>G	uc001ewn.2	+	1	818	c.753A>G	c.(751-753)CAA>CAG	p.Q251Q		NM_017860	NP_060330	Q9BUN1	CA056_HUMAN	hypothetical protein LOC54964 precursor	251						extracellular region					0	Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			GCACCTATCAACAATGTCCCT	0.617											OREG0013793	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	56	142	---	---	---	---	PASS
FCRL3	115352	broad.mit.edu	37	1	157650775	157650775	+	Silent	SNP	G	A	A			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157650775G>A	uc001frb.2	-	12	2245	c.1953C>T	c.(1951-1953)AGC>AGT	p.S651S	FCRL3_uc001fqx.3_RNA|FCRL3_uc001fqy.3_RNA|FCRL3_uc001fqz.3_Silent_p.S651S|FCRL3_uc009wsn.2_RNA|FCRL3_uc009wso.2_RNA|FCRL3_uc001fra.2_Silent_p.S377S|FCRL3_uc001frc.1_Silent_p.S651S	NM_052939	NP_443171	Q96P31	FCRL3_HUMAN	Fc receptor-like 3 precursor	651	ITIM motif 1.|Cytoplasmic (Potential).					integral to membrane|plasma membrane	receptor activity			ovary(3)|breast(1)	4	all_hematologic(112;0.0378)					CCTCACCATTGCTGTACATTG	0.557													19	53	---	---	---	---	PASS
SELL	6402	broad.mit.edu	37	1	169677787	169677787	+	Silent	SNP	A	T	T			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169677787A>T	uc001ggk.2	-	3	441	c.243T>A	c.(241-243)CCT>CCA	p.P81P	C1orf112_uc001ggj.2_Intron|SELL_uc010pls.1_Silent_p.P34P|SELL_uc001ggl.1_Silent_p.P94P	NM_000655	NP_000646	P14151	LYAM1_HUMAN	selectin L precursor	81	C-type lectin.|Extracellular (Potential).				blood coagulation|cell adhesion|leukocyte migration|regulation of immune response	integral to plasma membrane	glycosphingolipid binding|heparin binding|protease binding|sugar binding				0	all_hematologic(923;0.208)					AACGACTGAAAGGCAGAGTCT	0.448													20	33	---	---	---	---	PASS
TNR	7143	broad.mit.edu	37	1	175299227	175299227	+	Missense_Mutation	SNP	C	A	A			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:175299227C>A	uc001gkp.1	-	19	3857	c.3776G>T	c.(3775-3777)AGC>ATC	p.S1259I	TNR_uc009wwu.1_Missense_Mutation_p.S1259I	NM_003285	NP_003276	Q92752	TENR_HUMAN	tenascin R precursor	1259	Fibrinogen C-terminal.				axon guidance|cell adhesion|signal transduction	proteinaceous extracellular matrix				pancreas(5)|ovary(4)|central_nervous_system(1)|skin(1)	11	Renal(580;0.146)					GCCGTTGTAGCTTCCTATGCG	0.597													31	62	---	---	---	---	PASS
HMCN1	83872	broad.mit.edu	37	1	186064396	186064396	+	Nonsense_Mutation	SNP	C	G	G			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186064396C>G	uc001grq.1	+	68	10545	c.10316C>G	c.(10315-10317)TCA>TGA	p.S3439*		NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN	hemicentin 1 precursor	3439	Ig-like C2-type 33.				response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)|skin(1)	23						ATGGACAATTCAATGGGGACA	0.383													19	149	---	---	---	---	PASS
RGS13	6003	broad.mit.edu	37	1	192628688	192628688	+	3'UTR	SNP	T	C	C			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:192628688T>C	uc001gsj.2	+	7					RGS13_uc001gsk.2_3'UTR	NM_002927	NP_002918	O14921	RGS13_HUMAN	regulator of G-protein signalling 13							plasma membrane	GTPase activator activity|signal transducer activity				0						AAACAGTATATTGAAAGTGGT	0.294													9	31	---	---	---	---	PASS
DENND1B	163486	broad.mit.edu	37	1	197684180	197684180	+	Missense_Mutation	SNP	G	A	A			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:197684180G>A	uc001guf.3	-	3	445	c.107C>T	c.(106-108)CCA>CTA	p.P36L	DENND1B_uc010ppe.1_Missense_Mutation_p.P36L|DENND1B_uc010ppf.1_RNA|DENND1B_uc001gue.3_Missense_Mutation_p.P26L	NM_144977	NP_659414	Q6P3S1	DEN1B_HUMAN	DENN/MADD domain containing 1B isoform 2	36	UDENN.					clathrin-coated vesicle|cytosol	guanyl-nucleotide exchange factor activity				0						AAAGTCCTCTGGGAATTTCCA	0.333													6	99	---	---	---	---	PASS
TAF1A	9015	broad.mit.edu	37	1	222743918	222743918	+	Missense_Mutation	SNP	T	C	C			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:222743918T>C	uc009xdz.1	-	6	883	c.694A>G	c.(694-696)ATT>GTT	p.I232V	TAF1A_uc001hni.1_Missense_Mutation_p.I118V|TAF1A_uc001hnj.2_Missense_Mutation_p.I232V|TAF1A_uc001hnk.2_Missense_Mutation_p.I118V|TAF1A_uc010pur.1_Missense_Mutation_p.I232V	NM_139352	NP_647603	Q15573	TAF1A_HUMAN	TBP-associated factor 1A isoform 2	232					regulation of transcription, DNA-dependent|termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase I promoter	RNA polymerase I transcription factor complex	DNA binding				0				GBM - Glioblastoma multiforme(131;0.0186)		ACTCCAGGAATTTTAATCAAT	0.353													63	143	---	---	---	---	PASS
ACTN2	88	broad.mit.edu	37	1	236925938	236925938	+	3'UTR	SNP	A	T	T			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236925938A>T	uc001hyf.2	+	21					ACTN2_uc001hyg.2_3'UTR|ACTN2_uc009xgi.1_3'UTR|ACTN2_uc010pxu.1_3'UTR|ACTN2_uc001hyh.2_3'UTR	NM_001103	NP_001094	P35609	ACTN2_HUMAN	actinin, alpha 2						focal adhesion assembly|microspike assembly|muscle filament sliding|platelet activation|platelet degranulation|protein homotetramerization|regulation of apoptosis|synaptic transmission	actin filament|cytosol|dendritic spine|extracellular region|filopodium|focal adhesion|nucleolus|platelet alpha granule lumen|pseudopodium|Z disc	actin binding|calcium ion binding|FATZ 1 binding|identical protein binding|integrin binding|protein dimerization activity|structural constituent of muscle|titin binding|titin Z domain binding|ZASP binding			ovary(4)|skin(1)	5	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;0.00661)|Acute lymphoblastic leukemia(190;0.109)|Prostate(94;0.174)	OV - Ovarian serous cystadenocarcinoma(106;0.00168)			TTCTGTAATCACTCATCCCAT	0.478													10	22	---	---	---	---	PASS
ZNF496	84838	broad.mit.edu	37	1	247463962	247463962	+	Silent	SNP	G	C	C			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247463962G>C	uc001ico.2	-	9	2088	c.1623C>G	c.(1621-1623)CGC>CGG	p.R541R	ZNF496_uc009xgv.2_Silent_p.R577R|ZNF496_uc001icp.2_Silent_p.R541R	NM_032752	NP_116141	Q96IT1	ZN496_HUMAN	zinc finger protein 496	541	C2H2-type 4.				positive regulation of transcription, DNA-dependent|viral reproduction		DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2	all_cancers(71;0.000136)|all_epithelial(71;2.62e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0607)|Lung NSC(105;0.0661)		OV - Ovarian serous cystadenocarcinoma(106;0.00703)			GAAAGTGGCTGCGGTGCCGAG	0.622													22	45	---	---	---	---	PASS
ACTG2	72	broad.mit.edu	37	2	74146772	74146772	+	3'UTR	SNP	C	A	A			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74146772C>A	uc002sjw.2	+	9					ACTG2_uc010fey.2_3'UTR|ACTG2_uc010yrn.1_3'UTR	NM_001615	NP_001606	P63267	ACTH_HUMAN	actin, gamma 2 propeptide						muscle contraction	cytoskeleton|cytosol	ATP binding				0						TTAAAACCTACAAGCCTTACT	0.328													11	12	---	---	---	---	PASS
IL1F8	27177	broad.mit.edu	37	2	113785368	113785368	+	Intron	SNP	G	T	T			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:113785368G>T	uc002tiq.1	-						IL1F8_uc002tir.1_3'UTR	NM_014438	NP_055253	Q9NZH7	IL36B_HUMAN	interleukin 1 family, member 8 isoform 1						immune response	extracellular space	cytokine activity|interleukin-1 receptor binding			ovary(1)	1						AATGAGGTAAGCTATGGATGG	0.458													7	4	---	---	---	---	PASS
ZEB2	9839	broad.mit.edu	37	2	145157573	145157573	+	Missense_Mutation	SNP	G	A	A			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:145157573G>A	uc002tvu.2	-	8	1661	c.1181C>T	c.(1180-1182)CCA>CTA	p.P394L	ZEB2_uc002tvv.2_Missense_Mutation_p.P388L|ZEB2_uc010zbm.1_Missense_Mutation_p.P365L|ZEB2_uc010fnp.2_Intron|ZEB2_uc010fnq.1_Missense_Mutation_p.P423L	NM_014795	NP_055610	O60315	ZEB2_HUMAN	zinc finger homeobox 1b	394						cytoplasm|nucleolus	phosphatase regulator activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|SMAD binding|zinc ion binding			ovary(5)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)	9				BRCA - Breast invasive adenocarcinoma(221;0.112)		GAAGTCTAGTGGTTCTGTTTT	0.413													11	178	---	---	---	---	PASS
IFIH1	64135	broad.mit.edu	37	2	163144684	163144684	+	Missense_Mutation	SNP	T	G	G			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:163144684T>G	uc002uce.2	-	5	1278	c.1056A>C	c.(1054-1056)AAA>AAC	p.K352N		NM_022168	NP_071451	Q9BYX4	IFIH1_HUMAN	interferon induced with helicase C domain 1	352	Helicase ATP-binding.				detection of virus|innate immune response|interspecies interaction between organisms|negative regulation of type I interferon production|positive regulation of interferon-alpha production|positive regulation of interferon-beta production|regulation of apoptosis	cytosol|nucleus	ATP binding|DNA binding|double-stranded RNA binding|helicase activity|protein binding|ribonucleoprotein binding|zinc ion binding			ovary(1)	1						GCTCAGATGCTTTTTTCTTCT	0.368													66	148	---	---	---	---	PASS
XIRP2	129446	broad.mit.edu	37	2	168104032	168104032	+	Missense_Mutation	SNP	A	G	G			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:168104032A>G	uc002udx.2	+	8	6148	c.6130A>G	c.(6130-6132)AGA>GGA	p.R2044G	XIRP2_uc010fpn.2_Intron|XIRP2_uc010fpo.2_Intron|XIRP2_uc010fpp.2_Intron|XIRP2_uc002udy.2_Missense_Mutation_p.R1869G|XIRP2_uc010fpq.2_Missense_Mutation_p.R1822G|XIRP2_uc010fpr.2_Intron|XIRP2_uc010fps.1_5'Flank	NM_152381	NP_689594	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2 isoform 1	1869					actin cytoskeleton organization	cell junction	actin binding			skin(7)|ovary(6)|pancreas(1)	14						GAAAAGCCTTAGAAGACTATC	0.393													22	69	---	---	---	---	PASS
RAPGEF4	11069	broad.mit.edu	37	2	173679206	173679206	+	Intron	SNP	G	C	C			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:173679206G>C	uc002uhv.3	+						RAPGEF4_uc002uhu.2_Intron|RAPGEF4_uc010fqn.2_Missense_Mutation_p.S149T	NM_007023	NP_008954	Q8WZA2	RPGF4_HUMAN	Rap guanine nucleotide exchange factor (GEF) 4						blood coagulation|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|regulation of insulin secretion|regulation of protein phosphorylation|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cAMP-dependent protein kinase complex|membrane fraction|plasma membrane	cAMP binding|cAMP-dependent protein kinase regulator activity|Ras GTPase binding|Ras guanyl-nucleotide exchange factor activity			large_intestine(2)|skin(2)|kidney(1)|central_nervous_system(1)	6			OV - Ovarian serous cystadenocarcinoma(117;0.194)			AAGAAAGGGAGCTGCCACATG	0.418													5	18	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179466064	179466064	+	Nonsense_Mutation	SNP	G	A	A			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179466064G>A	uc010zfg.1	-	236	48180	c.47956C>T	c.(47956-47958)CGA>TGA	p.R15986*	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Nonsense_Mutation_p.R9681*|TTN_uc010zfi.1_Nonsense_Mutation_p.R9614*|TTN_uc010zfj.1_Nonsense_Mutation_p.R9489*	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	16913							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTTTCTGCTCGCACACGGAAG	0.428													23	67	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179571302	179571302	+	Missense_Mutation	SNP	C	A	A			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179571302C>A	uc010zfg.1	-	99	25791	c.25567G>T	c.(25567-25569)GGG>TGG	p.G8523W	TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Missense_Mutation_p.G5184W	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	9450							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CGGTATAACCCAGAATCAGTT	0.423													98	265	---	---	---	---	PASS
OBFC2A	64859	broad.mit.edu	37	2	192546733	192546733	+	Missense_Mutation	SNP	A	C	C			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:192546733A>C	uc002usx.2	+	3	772	c.292A>C	c.(292-294)AAA>CAA	p.K98Q	OBFC2A_uc002usw.2_Missense_Mutation_p.K18Q|OBFC2A_uc002usy.2_RNA|OBFC2A_uc002usz.2_RNA|OBFC2A_uc002uta.2_Missense_Mutation_p.K18Q	NM_001031716	NP_001026886	Q96AH0	SOSB2_HUMAN	oligonucleotide/oligosaccharide-binding fold	98	OB.				double-strand break repair via homologous recombination|G2/M transition checkpoint|response to ionizing radiation	SOSS complex	single-stranded DNA binding				0			OV - Ovarian serous cystadenocarcinoma(117;0.061)|Epithelial(96;0.244)			TGAACTTCAAAAAATTGGGGA	0.308													18	55	---	---	---	---	PASS
COL4A4	1286	broad.mit.edu	37	2	227919340	227919340	+	Missense_Mutation	SNP	G	T	T			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:227919340G>T	uc010zlt.1	-	31	3484	c.2830C>A	c.(2830-2832)CCT>ACT	p.P944T		NM_000092	NP_000083	P53420	CO4A4_HUMAN	alpha 4 type IV collagen precursor	944	Triple-helical region.				axon guidance|glomerular basement membrane development	basal lamina|collagen type IV	extracellular matrix structural constituent|protein binding			ovary(5)|central_nervous_system(3)|pancreas(1)|breast(1)|skin(1)	11		Renal(207;0.00844)|all_lung(227;0.0187)|Lung NSC(271;0.0879)|all_hematologic(139;0.21)|Esophageal squamous(248;0.242)		Epithelial(121;6.7e-11)|all cancers(144;5.39e-08)|Lung(261;0.0132)|LUSC - Lung squamous cell carcinoma(224;0.0181)		CGGTCTCCAGGAAGGCCAGAC	0.512													41	83	---	---	---	---	PASS
RFTN1	23180	broad.mit.edu	37	3	16535237	16535237	+	Missense_Mutation	SNP	C	A	A			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:16535237C>A	uc003cay.2	-	2	422	c.140G>T	c.(139-141)AGT>ATT	p.S47I		NM_015150	NP_055965	Q14699	RFTN1_HUMAN	raft-linking protein	47						plasma membrane				ovary(3)|central_nervous_system(1)	4						CTCACCAGCACTCAGAGTCGT	0.557													109	131	---	---	---	---	PASS
TRIM71	131405	broad.mit.edu	37	3	32933360	32933360	+	3'UTR	SNP	C	T	T	rs144286810	by1000genomes	TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:32933360C>T	uc003cff.2	+	4						NM_001039111	NP_001034200	Q2Q1W2	LIN41_HUMAN	tripartite motif-containing 71						multicellular organismal development	cytoplasm	zinc ion binding			ovary(2)|large_intestine(1)	3						ctctctctctctctctttctc	0.294													3	31	---	---	---	---	PASS
GLT8D1	55830	broad.mit.edu	37	3	52728910	52728910	+	Missense_Mutation	SNP	C	T	T			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52728910C>T	uc003dfi.3	-	10	1206	c.1067G>A	c.(1066-1068)GGC>GAC	p.G356D	GLT8D1_uc003dfj.2_Missense_Mutation_p.G356D|GLT8D1_uc003dfk.2_Missense_Mutation_p.G356D|GLT8D1_uc003dfl.2_Missense_Mutation_p.G356D|GLT8D1_uc003dfm.2_Missense_Mutation_p.G356D|GLT8D1_uc003dfn.2_Missense_Mutation_p.G356D|GLT8D1_uc003dfo.1_3'UTR	NM_152932	NP_690909	Q68CQ7	GL8D1_HUMAN	glycosyltransferase 8 domain containing 1	356	Lumenal (Potential).					integral to membrane|mitochondrion	transferase activity, transferring glycosyl groups				0				BRCA - Breast invasive adenocarcinoma(193;6.78e-05)|Kidney(197;0.000618)|KIRC - Kidney renal clear cell carcinoma(197;0.000779)|OV - Ovarian serous cystadenocarcinoma(275;0.0482)		GTTGAATTTGCCTGTTGGGTC	0.408													4	147	---	---	---	---	PASS
PCNP	57092	broad.mit.edu	37	3	101311704	101311704	+	3'UTR	SNP	T	C	C			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:101311704T>C	uc003dva.2	+	5					PCNP_uc003dvb.2_RNA|PCNP_uc003dvc.2_RNA|PCNP_uc003dvd.2_3'UTR	NM_020357	NP_065090	Q8WW12	PCNP_HUMAN	PEST proteolytic signal containing nuclear						cell cycle|proteasomal ubiquitin-dependent protein catabolic process|protein ubiquitination	nucleus	protein binding				0						TTTTTTTCTTTTTCATTTTTT	0.289													6	11	---	---	---	---	PASS
FAM55C	91775	broad.mit.edu	37	3	101520532	101520532	+	Missense_Mutation	SNP	G	T	T			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:101520532G>T	uc003dvn.2	+	5	1184	c.547G>T	c.(547-549)GTA>TTA	p.V183L	FAM55C_uc010hpn.2_Missense_Mutation_p.V183L	NM_145037	NP_659474	Q969Y0	FA55C_HUMAN	hypothetical protein LOC91775 precursor	183						extracellular region				ovary(1)|pancreas(1)|skin(1)	3						CAAAGTTAAAGTATCCGTATC	0.493													4	60	---	---	---	---	PASS
ARHGAP31	57514	broad.mit.edu	37	3	119099820	119099820	+	Missense_Mutation	SNP	C	G	G			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:119099820C>G	uc003ecj.3	+	4	950	c.418C>G	c.(418-420)CCA>GCA	p.P140A		NM_020754	NP_065805	Q2M1Z3	RHG31_HUMAN	Cdc42 GTPase-activating protein	140	Rho-GAP.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|focal adhesion|lamellipodium	GTPase activator activity			ovary(2)	2						GGAGCTTCCTCCATCCCACTA	0.493													25	39	---	---	---	---	PASS
COPG	22820	broad.mit.edu	37	3	128986841	128986841	+	Missense_Mutation	SNP	G	C	C			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:128986841G>C	uc003els.2	+	16	1706	c.1606G>C	c.(1606-1608)GAG>CAG	p.E536Q	COPG_uc010htb.2_Missense_Mutation_p.E442Q	NM_016128	NP_057212	Q9Y678	COPG_HUMAN	coatomer protein complex, subunit gamma 1	536					COPI coating of Golgi vesicle|intracellular protein transport|retrograde vesicle-mediated transport, Golgi to ER	COPI vesicle coat|cytosol	protein binding|structural molecule activity			ovary(3)|breast(1)	4						AAATGTCCTGGAGCAGAAGCA	0.517													7	25	---	---	---	---	PASS
COL29A1	256076	broad.mit.edu	37	3	130162331	130162331	+	Missense_Mutation	SNP	C	G	G			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:130162331C>G	uc010htj.1	+	36	6993	c.6499C>G	c.(6499-6501)CAG>GAG	p.Q2167E	COL29A1_uc010hti.1_RNA|COL29A1_uc010htk.1_Missense_Mutation_p.Q206E	NM_153264	NP_694996	A8TX70	CO6A5_HUMAN	collagen, type XXIX, alpha 1	2167	Nonhelical region.				axon guidance|cell adhesion	collagen					0						GGGATTCAATCAGTACCCACC	0.378													20	79	---	---	---	---	PASS
TBL1XR1	79718	broad.mit.edu	37	3	176768295	176768295	+	Missense_Mutation	SNP	C	A	A			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:176768295C>A	uc003fiw.3	-	6	791	c.531G>T	c.(529-531)TGG>TGT	p.W177C	TBL1XR1_uc003fix.3_Missense_Mutation_p.W177C|TBL1XR1_uc011bpz.1_Intron	NM_024665	NP_078941	Q9BZK7	TBL1R_HUMAN	transducin (beta)-like 1 X-linked receptor 1	177	WD 1.				canonical Wnt receptor signaling pathway|cellular lipid metabolic process|chromatin modification|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|proteasomal ubiquitin-dependent protein catabolic process|transcription, DNA-dependent	spindle microtubule|transcriptional repressor complex	beta-catenin binding|histone binding|protein N-terminus binding|transcription corepressor activity|transcription regulatory region DNA binding			ovary(1)	1	all_cancers(143;1.44e-17)|Ovarian(172;0.00163)|Breast(254;0.214)	Acute lymphoblastic leukemia(1;0.00599)|all_hematologic(1;0.0632)|Prostate(884;0.215)	OV - Ovarian serous cystadenocarcinoma(80;9.83e-31)			TAACAGGGTTCCAGGCACAGA	0.363													22	37	---	---	---	---	PASS
PIK3CA	5290	broad.mit.edu	37	3	178952090	178952090	+	Missense_Mutation	SNP	G	C	C	rs121913277		TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:178952090G>C	uc003fjk.2	+	21	3302	c.3145G>C	c.(3145-3147)GGT>CGT	p.G1049R		NM_006218	NP_006209	P42336	PK3CA_HUMAN	phosphoinositide-3-kinase, catalytic, alpha	1049	PI3K/PI4K.				epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell costimulation|T cell receptor signaling pathway		1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity	p.G1049R(19)|p.G1049S(10)|p.G1049G(9)|p.G1049A(4)		breast(1564)|large_intestine(776)|endometrium(246)|urinary_tract(195)|ovary(141)|skin(112)|stomach(98)|thyroid(77)|central_nervous_system(69)|lung(65)|upper_aerodigestive_tract(58)|haematopoietic_and_lymphoid_tissue(27)|cervix(25)|biliary_tract(22)|liver(20)|oesophagus(17)|pancreas(11)|penis(8)|pituitary(8)|autonomic_ganglia(4)|prostate(3)|kidney(2)|meninges(1)|eye(1)|NS(1)|soft_tissue(1)|bone(1)	3553	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)			TGCACATCATGGTGGCTGGAC	0.378		57	Mis		colorectal|gastric|gliobastoma|breast					HNSCC(19;0.045)|TSP Lung(28;0.18)			38	84	---	---	---	---	PASS
EIF4A2	1974	broad.mit.edu	37	3	186505363	186505363	+	Missense_Mutation	SNP	C	T	T			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186505363C>T	uc003fqs.2	+	9	1028	c.989C>T	c.(988-990)ACT>ATT	p.T330I	EIF4A2_uc003fqt.2_RNA|EIF4A2_uc003fqu.2_Missense_Mutation_p.T331I|EIF4A2_uc003fqv.2_Missense_Mutation_p.T235I|EIF4A2_uc003fqw.2_Missense_Mutation_p.T235I|EIF4A2_uc011bsb.1_Missense_Mutation_p.T203I|SNORA4_uc010hyx.1_5'Flank	NM_001967	NP_001958	Q14240	IF4A2_HUMAN	eukaryotic translation initiation factor 4A2	330	Helicase C-terminal.				interspecies interaction between organisms|nuclear-transcribed mRNA poly(A) tail shortening|regulation of translational initiation	cytosol|eukaryotic translation initiation factor 4F complex	ATP binding|ATP-dependent helicase activity|protein binding|translation initiation factor activity			ovary(2)|breast(2)	4	all_cancers(143;2.68e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;1.07e-20)	GBM - Glioblastoma multiforme(93;0.0704)		CTGATCACTACTGACTTGTTG	0.398			T	BCL6	NHL								89	202	---	---	---	---	PASS
OPA1	4976	broad.mit.edu	37	3	193366636	193366636	+	Missense_Mutation	SNP	T	C	C			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:193366636T>C	uc003ftm.2	+	19	2057	c.1823T>C	c.(1822-1824)CTG>CCG	p.L608P	OPA1_uc003ftg.2_Missense_Mutation_p.L663P|OPA1_uc003fth.2_Missense_Mutation_p.L627P|OPA1_uc003fti.2_Missense_Mutation_p.L645P|OPA1_uc003ftj.2_Missense_Mutation_p.L626P|OPA1_uc003ftk.2_Missense_Mutation_p.L609P|OPA1_uc003ftl.2_Missense_Mutation_p.L590P|OPA1_uc003ftn.2_Missense_Mutation_p.L572P	NM_015560	NP_056375	O60313	OPA1_HUMAN	optic atrophy 1 isoform 1	608	Mitochondrial intermembrane (By similarity).				apoptosis|axon transport of mitochondrion|inner mitochondrial membrane organization|mitochondrial fission|mitochondrial fusion|positive regulation of anti-apoptosis|response to stimulus|visual perception	dendrite|integral to membrane|mitochondrial crista|mitochondrial intermembrane space|mitochondrial outer membrane	GTP binding|GTPase activity|magnesium ion binding|protein binding				0	all_cancers(143;9.56e-09)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;9.19e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;0.000162)		GTTATCAGTCTGAGCCAGGTT	0.289													74	146	---	---	---	---	PASS
RNF4	6047	broad.mit.edu	37	4	2515531	2515531	+	Missense_Mutation	SNP	C	A	A			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:2515531C>A	uc003gfb.2	+	8	894	c.558C>A	c.(556-558)CAC>CAA	p.H186Q	RNF4_uc010icj.2_3'UTR|RNF4_uc003gfc.2_Missense_Mutation_p.H186Q	NM_002938	NP_002929	P78317	RNF4_HUMAN	ring finger protein 4	186					androgen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|proteasomal ubiquitin-dependent protein catabolic process|protein autoubiquitination|protein K11-linked ubiquitination|protein K48-linked ubiquitination|protein K6-linked ubiquitination|protein K63-linked ubiquitination|regulation of kinetochore assembly|regulation of spindle assembly|response to arsenic-containing substance	cytoplasm|PML body	androgen receptor binding|DNA binding|nucleosome binding|sequence-specific DNA binding transcription factor activity|SUMO polymer binding|transcription coactivator activity|ubiquitin-protein ligase activity|zinc ion binding				0		all_epithelial(65;0.241)				AACGGTACCACCCCATTTATA	0.488													35	112	---	---	---	---	PASS
SEPSECS	51091	broad.mit.edu	37	4	25160704	25160704	+	Missense_Mutation	SNP	T	C	C			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:25160704T>C	uc003grg.2	-	2	353	c.140A>G	c.(139-141)GAT>GGT	p.D47G	uc003grj.2_5'Flank|PI4K2B_uc011bxs.1_5'Flank|SEPSECS_uc003gri.2_Missense_Mutation_p.D46G|SEPSECS_uc003grh.2_Intron	NM_153825	NP_722547	Q9HD40	SPCS_HUMAN	Sep (O-phosphoserine) tRNA:Sec (selenocysteine)	47					selenocysteine incorporation	cytoplasm|nucleus	pyridoxal phosphate binding|transferase activity, transferring selenium-containing groups|tRNA binding				0		Breast(46;0.173)			Pyridoxal Phosphate(DB00114)	TGTACTTTCATCCCAGCCATT	0.353													8	42	---	---	---	---	PASS
RFC1	5981	broad.mit.edu	37	4	39324978	39324978	+	Silent	SNP	T	C	C			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:39324978T>C	uc003gty.1	-	7	836	c.702A>G	c.(700-702)GAA>GAG	p.E234E	RFC1_uc003gtx.1_Silent_p.E234E|RFC1_uc003gtz.1_Silent_p.E118E	NM_002913	NP_002904	P35251	RFC1_HUMAN	replication factor C large subunit	234					DNA strand elongation involved in DNA replication|nucleotide-excision repair, DNA gap filling|regulation of transcription, DNA-dependent|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|telomere maintenance via telomerase|transcription, DNA-dependent|transcription-coupled nucleotide-excision repair	DNA replication factor C complex|nucleoplasm	ATP binding|DNA clamp loader activity|enzyme activator activity|protein binding			ovary(2)|pancreas(1)|skin(1)	4						TCTTGGGTTCTTCATCCAACA	0.423													40	99	---	---	---	---	PASS
CEP135	9662	broad.mit.edu	37	4	56890684	56890684	+	Missense_Mutation	SNP	A	C	C			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:56890684A>C	uc003hbi.2	+	25	3572	c.3338A>C	c.(3337-3339)GAG>GCG	p.E1113A	CEP135_uc003hbj.2_Missense_Mutation_p.E819A	NM_025009	NP_079285	Q66GS9	CP135_HUMAN	centrosome protein 4	1113	Potential.				centriole replication|centriole-centriole cohesion|G2/M transition of mitotic cell cycle	centriole|cytosol	protein C-terminus binding			ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5	Glioma(25;0.08)|all_neural(26;0.101)					GCAATCCAAGAGATGCGTCGA	0.388													137	349	---	---	---	---	PASS
HELQ	113510	broad.mit.edu	37	4	84374451	84374451	+	Silent	SNP	A	C	C			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:84374451A>C	uc003hom.2	-	2	1124	c.945T>G	c.(943-945)CCT>CCG	p.P315P	HELQ_uc010ikb.2_Silent_p.P315P|HELQ_uc003hol.3_RNA|HELQ_uc010ikc.2_RNA|HELQ_uc003hon.1_Silent_p.P209P|HELQ_uc003hoo.1_Silent_p.P278P|HELQ_uc003hop.1_Silent_p.P209P|HELQ_uc003hoq.1_Silent_p.P315P|MRPS18C_uc003hor.3_5'Flank|MRPS18C_uc011ccu.1_5'Flank	NM_133636	NP_598375	Q8TDG4	HELQ_HUMAN	DNA helicase HEL308	315							ATP binding|ATP-dependent helicase activity|nucleic acid binding			ovary(1)|breast(1)|skin(1)	3						ATGAATAAAAAGGACCAAGGT	0.323								Direct_reversal_of_damage|Other_identified_genes_with_known_or_suspected_DNA_repair_function					61	156	---	---	---	---	PASS
RICTOR	253260	broad.mit.edu	37	5	38949983	38949983	+	Missense_Mutation	SNP	T	G	G			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:38949983T>G	uc003jlp.2	-	31	3991	c.3967A>C	c.(3967-3969)AGT>CGT	p.S1323R	RICTOR_uc003jlo.2_Missense_Mutation_p.S1323R|RICTOR_uc010ivf.2_Missense_Mutation_p.S1038R	NM_152756	NP_689969	Q6R327	RICTR_HUMAN	rapamycin-insensitive companion of mTOR	1323					actin cytoskeleton reorganization|embryo development|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of TOR signaling cascade|regulation of protein kinase B signaling cascade|T cell costimulation	cytosol|TORC2 complex	protein binding			ovary(3)|lung(3)|skin(2)|kidney(1)|central_nervous_system(1)	10	all_lung(31;0.000396)					TCTCTAGAACTTGTGTAACTA	0.408													16	293	---	---	---	---	PASS
GCNT4	51301	broad.mit.edu	37	5	74325838	74325838	+	Missense_Mutation	SNP	T	G	G			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:74325838T>G	uc003kdn.2	-	1	887	c.25A>C	c.(25-27)AAA>CAA	p.K9Q		NM_016591	NP_057675	Q9P109	GCNT4_HUMAN	core 2 beta-1,6-N-acetylglucosaminyltransferase	9	Cytoplasmic (Potential).				protein O-linked glycosylation	Golgi membrane|integral to membrane	beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,6-N-acetylglucosaminyltransferase activity|N-acetyllactosaminide beta-1,6-N-acetylglucosaminyltransferase activity			ovary(2)|skin(1)	3		all_lung(232;0.0131)|Lung NSC(167;0.0282)|Ovarian(174;0.0798)		OV - Ovarian serous cystadenocarcinoma(47;8.44e-57)		AGGGTATGTTTAAAATAACAT	0.313													205	273	---	---	---	---	PASS
PCDHB4	56131	broad.mit.edu	37	5	140502925	140502925	+	Missense_Mutation	SNP	G	A	A			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140502925G>A	uc003lip.1	+	1	1345	c.1345G>A	c.(1345-1347)GCC>ACC	p.A449T		NM_018938	NP_061761	Q9Y5E5	PCDB4_HUMAN	protocadherin beta 4 precursor	449	Cadherin 4.|Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	cytoplasm|integral to plasma membrane|intermediate filament cytoskeleton	calcium ion binding			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CAACGCCCCCGCCTTCACCCA	0.597													9	168	---	---	---	---	PASS
FCHSD1	89848	broad.mit.edu	37	5	141025713	141025713	+	Nonsense_Mutation	SNP	C	A	A			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:141025713C>A	uc003llk.2	-	12	1141	c.1090G>T	c.(1090-1092)GAG>TAG	p.E364*	FCHSD1_uc010jgg.2_Nonsense_Mutation_p.E47*|FCHSD1_uc003llj.2_RNA	NM_033449	NP_258260	Q86WN1	FCSD1_HUMAN	FCH and double SH3 domains 1	364	Potential.								FCHSD1/BRAF(2)	skin(2)|ovary(1)|central_nervous_system(1)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTTGGAGCCTCCCGCTCTGAA	0.582													8	16	---	---	---	---	PASS
PCDH1	5097	broad.mit.edu	37	5	141243421	141243421	+	Silent	SNP	G	A	A			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:141243421G>A	uc003llq.2	-	3	2592	c.2475C>T	c.(2473-2475)CTC>CTT	p.L825L	PCDH1_uc003llp.2_Silent_p.L825L|PCDH1_uc011dbf.1_Silent_p.L803L	NM_002587	NP_002578	Q08174	PCDH1_HUMAN	protocadherin 1 isoform 1 precursor	825	Extracellular (Potential).|Cadherin 7.				cell-cell signaling|homophilic cell adhesion|nervous system development	cell-cell junction|integral to plasma membrane	calcium ion binding			ovary(5)	5		Lung NSC(810;0.027)|all_lung(500;0.0321)|all_hematologic(541;0.0433)|Prostate(461;0.0453)|Breast(839;0.128)|Lung SC(612;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	GBM - Glioblastoma multiforme(465;1.06e-05)		TGTGGCCCAGGAGGGTCTCCA	0.582													53	147	---	---	---	---	PASS
DPYSL3	1809	broad.mit.edu	37	5	146792202	146792202	+	Missense_Mutation	SNP	A	G	G			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:146792202A>G	uc003lon.1	-	6	700	c.590T>C	c.(589-591)GTT>GCT	p.V197A	DPYSL3_uc003loo.2_Missense_Mutation_p.V311A	NM_001387	NP_001378	Q14195	DPYL3_HUMAN	dihydropyrimidinase-like 3	197					axon guidance|pyrimidine base catabolic process|signal transduction	cytosol|growth cone	dihydropyrimidinase activity			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTCAGCATGAACTTGAGCAAT	0.493													30	45	---	---	---	---	PASS
SH3TC2	79628	broad.mit.edu	37	5	148406556	148406556	+	Missense_Mutation	SNP	C	G	G			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:148406556C>G	uc003lpu.2	-	11	2891	c.2739G>C	c.(2737-2739)AAG>AAC	p.K913N	SH3TC2_uc003lpp.1_RNA|SH3TC2_uc010jgw.2_Missense_Mutation_p.K557N|SH3TC2_uc003lps.2_RNA|SH3TC2_uc003lpt.2_Missense_Mutation_p.K460N|SH3TC2_uc010jgx.2_Missense_Mutation_p.K906N|SH3TC2_uc003lpv.1_Missense_Mutation_p.K460N|SH3TC2_uc011dbz.1_Missense_Mutation_p.K798N	NM_024577	NP_078853	Q8TF17	S3TC2_HUMAN	SH3 domain and tetratricopeptide repeats 2	913							binding			ovary(2)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGTCTGTCTCCTTACTGGCCT	0.502													94	352	---	---	---	---	PASS
FBXW11	23291	broad.mit.edu	37	5	171299957	171299957	+	Missense_Mutation	SNP	A	G	G			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:171299957A>G	uc003mbm.1	-	9	1567	c.1196T>C	c.(1195-1197)CTC>CCC	p.L399P	FBXW11_uc011dey.1_Missense_Mutation_p.L367P|FBXW11_uc003mbl.1_Missense_Mutation_p.L386P|FBXW11_uc003mbn.1_Missense_Mutation_p.L365P	NM_012300	NP_036432	Q9UKB1	FBW1B_HUMAN	F-box and WD repeat domain containing 11 isoform	399					cell cycle|negative regulation of transcription, DNA-dependent|positive regulation of circadian rhythm|positive regulation of proteolysis|positive regulation of transcription, DNA-dependent|protein dephosphorylation|protein destabilization|protein polyubiquitination|rhythmic process|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process|Wnt receptor signaling pathway	centrosome|cytosol|nucleus|SCF ubiquitin ligase complex	protein binding|ubiquitin-protein ligase activity			ovary(1)|breast(1)	2	Renal(175;0.000159)|Lung NSC(126;0.00384)|all_lung(126;0.00659)	Medulloblastoma(196;0.00853)|all_neural(177;0.026)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			GTGCCCATTGAGAGTACGAAC	0.443													28	102	---	---	---	---	PASS
KIAA0319	9856	broad.mit.edu	37	6	24547467	24547467	+	Missense_Mutation	SNP	C	G	G			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:24547467C>G	uc011djo.1	-	21	3382	c.3145G>C	c.(3145-3147)GGG>CGG	p.G1049R	KIAA0319_uc011djp.1_Missense_Mutation_p.G1004R|KIAA0319_uc003neh.1_Missense_Mutation_p.G1049R|KIAA0319_uc011djq.1_Missense_Mutation_p.G1040R|KIAA0319_uc011djr.1_Missense_Mutation_p.G988R|KIAA0319_uc010jpt.1_Missense_Mutation_p.G460R	NM_014809	NP_055624	Q5VV43	K0319_HUMAN	KIAA0319 precursor	1049	Cytoplasmic (Potential).				negative regulation of dendrite development|neuron migration	early endosome membrane|integral to membrane|plasma membrane	protein binding			ovary(1)|skin(1)	2						TTTGGATTCCCTCTCTCCATC	0.468													78	216	---	---	---	---	PASS
TAP1	6890	broad.mit.edu	37	6	32816567	32816567	+	Missense_Mutation	SNP	C	A	A			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32816567C>A	uc003ocg.2	-	7	1763	c.1608G>T	c.(1606-1608)GAG>GAT	p.E536D	TAP1_uc011dqi.1_Missense_Mutation_p.E275D	NM_000593	NP_000584	Q03518	TAP1_HUMAN	transporter 1, ATP-binding cassette, sub-family	536	Involved in peptide-binding site.|Cytoplasmic (Potential).				antigen processing and presentation of endogenous peptide antigen via MHC class I|cytosol to ER transport|intracellular transport of viral proteins in host cell|positive regulation of T cell mediated cytotoxicity	cytosol|plasma membrane|TAP complex	ADP binding|ATP binding|MHC class I protein binding|oligopeptide-transporting ATPase activity|peptide antigen binding|protein homodimerization activity|TAP1 binding|TAP2 binding|tapasin binding			skin(1)	1						CAAATATTTTCTCTGAGGAGC	0.527													6	111	---	---	---	---	PASS
COL9A1	1297	broad.mit.edu	37	6	71004163	71004163	+	Missense_Mutation	SNP	C	T	T			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:71004163C>T	uc003pfg.3	-	5	562	c.403G>A	c.(403-405)GAT>AAT	p.D135N		NM_001851	NP_001842	P20849	CO9A1_HUMAN	alpha 1 type IX collagen isoform 1 precursor	135	Nonhelical region (NC4).|TSP N-terminal.				axon guidance|cell adhesion|organ morphogenesis	collagen type IX	metal ion binding			ovary(4)	4						CCAGAGGAATCCTGAATCTGC	0.433													72	328	---	---	---	---	PASS
ZUFSP	221302	broad.mit.edu	37	6	116987929	116987929	+	Missense_Mutation	SNP	T	G	G			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:116987929T>G	uc003pxf.1	-	2	673	c.427A>C	c.(427-429)AAA>CAA	p.K143Q	ZUFSP_uc010kef.1_Intron	NM_145062	NP_659499	Q96AP4	ZUFSP_HUMAN	zinc finger with UFM1-specific peptidase domain	143						intracellular	zinc ion binding			skin(1)	1				GBM - Glioblastoma multiforme(226;0.0258)|all cancers(137;0.0368)|OV - Ovarian serous cystadenocarcinoma(136;0.0464)|Epithelial(106;0.186)		ACAGATCCTTTTATTTCGGTC	0.358													66	166	---	---	---	---	PASS
FOXK1	221937	broad.mit.edu	37	7	4794095	4794095	+	Missense_Mutation	SNP	C	T	T			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:4794095C>T	uc003snc.1	+	3	762	c.752C>T	c.(751-753)CCC>CTC	p.P251L	FOXK1_uc003sna.1_Missense_Mutation_p.P88L|FOXK1_uc003snb.1_Missense_Mutation_p.P251L	NM_001037165	NP_001032242	P85037	FOXK1_HUMAN	forkhead box K1	251					cell differentiation|embryo development|muscle organ development|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|magnesium ion binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			upper_aerodigestive_tract(1)|skin(1)	2		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.101)|OV - Ovarian serous cystadenocarcinoma(56;7.43e-15)		CTCAGTGTCCCCAACTCCTGC	0.622													15	33	---	---	---	---	PASS
SP4	6671	broad.mit.edu	37	7	21469100	21469100	+	Missense_Mutation	SNP	C	T	T			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:21469100C>T	uc003sva.2	+	3	498	c.317C>T	c.(316-318)GCC>GTC	p.A106V	SP4_uc003svb.2_5'UTR	NM_003112	NP_003103	Q02446	SP4_HUMAN	Sp4 transcription factor	106					regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|transcription coactivator activity|zinc ion binding			ovary(3)|skin(2)	5						CAACTTGTTGCCTCCACTCCT	0.438													32	60	---	---	---	---	PASS
TAX1BP1	8887	broad.mit.edu	37	7	27868314	27868314	+	Missense_Mutation	SNP	T	A	A			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:27868314T>A	uc003szl.2	+	17	2394	c.2236T>A	c.(2236-2238)TTT>ATT	p.F746I	TAX1BP1_uc011jzo.1_Missense_Mutation_p.F704I|TAX1BP1_uc003szk.2_Missense_Mutation_p.F704I|TAX1BP1_uc011jzp.1_Missense_Mutation_p.F547I	NM_006024	NP_006015	Q86VP1	TAXB1_HUMAN	Tax1 (human T-cell leukemia virus type I)	746					anti-apoptosis|apoptosis|negative regulation of NF-kappaB transcription factor activity|negative regulation of type I interferon production	cytosol	identical protein binding|kinase binding|zinc ion binding			breast(1)	1			GBM - Glioblastoma multiforme(3;0.0823)			TCAGAGCAAATTTGAAGAACA	0.428													72	180	---	---	---	---	PASS
CLIP2	7461	broad.mit.edu	37	7	73790732	73790732	+	Missense_Mutation	SNP	G	T	T			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:73790732G>T	uc003uam.2	+	10	2328	c.2001G>T	c.(1999-2001)TTG>TTT	p.L667F	CLIP2_uc003uan.2_Missense_Mutation_p.L632F|CLIP2_uc003uao.2_Missense_Mutation_p.L61F	NM_003388	NP_003379	Q9UDT6	CLIP2_HUMAN	CAP-GLY domain containing linker protein 2	667						microtubule associated complex				skin(3)	3						TGGGTAACTTGCAGGCCAAGC	0.642													9	48	---	---	---	---	PASS
KRIT1	889	broad.mit.edu	37	7	91842561	91842561	+	Missense_Mutation	SNP	A	T	T			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:91842561A>T	uc003ulq.1	-	15	2144	c.1973T>A	c.(1972-1974)GTG>GAG	p.V658E	KRIT1_uc010lev.1_Missense_Mutation_p.V415E|KRIT1_uc003ulr.1_Missense_Mutation_p.V658E|KRIT1_uc003uls.1_Missense_Mutation_p.V658E|KRIT1_uc003ult.1_Missense_Mutation_p.V610E|KRIT1_uc003ulu.1_Missense_Mutation_p.V658E|KRIT1_uc003ulv.1_Missense_Mutation_p.V658E	NM_194456	NP_919438	O00522	KRIT1_HUMAN	krev interaction trapped 1 isoform 1	658	Required for RAP1A binding.|FERM.				angiogenesis|cell redox homeostasis|negative regulation of angiogenesis|negative regulation of endothelial cell apoptosis|negative regulation of endothelial cell migration|negative regulation of endothelial cell proliferation|regulation of establishment of cell polarity|small GTPase mediated signal transduction	cell-cell junction|cytoskeleton	protein binding|small GTPase regulator activity			ovary(2)|lung(1)	3	all_cancers(62;1.04e-09)|all_epithelial(64;5.75e-09)|Breast(17;0.00206)|all_lung(186;0.0509)|Lung NSC(181;0.0692)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			TCCTACATACACAGGGATGAC	0.358									Familial_Cerebral_Cavernous_Angioma				55	162	---	---	---	---	PASS
WASL	8976	broad.mit.edu	37	7	123329154	123329154	+	Silent	SNP	T	C	C			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:123329154T>C	uc003vkz.2	-	10	1726	c.1398A>G	c.(1396-1398)GGA>GGG	p.G466G		NM_003941	NP_003932	O00401	WASL_HUMAN	Wiskott-Aldrich syndrome gene-like protein	466					actin polymerization or depolymerization|axon guidance|cellular component movement|nitric oxide metabolic process|protein complex assembly|regulation of nitric-oxide synthase activity|regulation of transcription, DNA-dependent|transcription, DNA-dependent	actin cytoskeleton|cytosol|nucleolus|plasma membrane	actin binding|small GTPase regulator activity				0						CACCCACAATTCCTGAAGTGG	0.343													139	298	---	---	---	---	PASS
WHSC1L1	54904	broad.mit.edu	37	8	38189086	38189086	+	Missense_Mutation	SNP	C	A	A			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38189086C>A	uc003xli.2	-	5	1446	c.928G>T	c.(928-930)GTC>TTC	p.V310F	WHSC1L1_uc011lbm.1_Missense_Mutation_p.V310F|WHSC1L1_uc010lwe.2_Missense_Mutation_p.V310F|WHSC1L1_uc003xlj.2_Missense_Mutation_p.V310F	NM_023034	NP_075447	Q9BZ95	NSD3_HUMAN	WHSC1L1 protein isoform long	310	PWWP 1.				cell differentiation|cell growth|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome	histone-lysine N-methyltransferase activity|zinc ion binding			breast(1)	1	Colorectal(12;0.000442)|Esophageal squamous(3;0.0725)	all_lung(54;0.00787)|Lung NSC(58;0.0295)|Hepatocellular(245;0.065)	Epithelial(3;3.12e-43)|all cancers(3;1.72e-38)|BRCA - Breast invasive adenocarcinoma(5;2.84e-27)|LUSC - Lung squamous cell carcinoma(2;2.79e-25)|Lung(2;5.03e-23)|COAD - Colon adenocarcinoma(9;0.0511)			AAAAACTGGACATGATATTCT	0.403			T	NUP98	AML								34	95	---	---	---	---	PASS
FRMD3	257019	broad.mit.edu	37	9	85950490	85950490	+	Missense_Mutation	SNP	G	T	T			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:85950490G>T	uc004ams.1	-	6	739	c.537C>A	c.(535-537)TTC>TTA	p.F179L	FRMD3_uc004amr.1_Missense_Mutation_p.F165L	NM_174938	NP_777598	A2A2Y4	FRMD3_HUMAN	FERM domain containing 3	179	FERM.					cytoplasm|cytoskeleton|extrinsic to membrane|integral to membrane	cytoskeletal protein binding			ovary(1)|central_nervous_system(1)	2						ACTGCTTGGGGAAAATCTCAA	0.368													33	54	---	---	---	---	PASS
DAPK1	1612	broad.mit.edu	37	9	90255297	90255297	+	Silent	SNP	T	C	C			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:90255297T>C	uc004apc.2	+	8	852	c.714T>C	c.(712-714)GAT>GAC	p.D238D	DAPK1_uc004ape.2_Silent_p.D238D|DAPK1_uc004apd.2_Silent_p.D238D|DAPK1_uc011ltg.1_Silent_p.D238D|DAPK1_uc011lth.1_5'UTR	NM_004938	NP_004929	P53355	DAPK1_HUMAN	death-associated protein kinase 1	238	Protein kinase.				apoptosis|induction of apoptosis by extracellular signals|intracellular protein kinase cascade	actin cytoskeleton|cytoplasm	ATP binding|calmodulin binding|protein serine/threonine kinase activity			ovary(1)|breast(1)	2						AATTTGAGGATGAATACTTCA	0.433									Chronic_Lymphocytic_Leukemia_Familial_Clustering_of				38	82	---	---	---	---	PASS
ODF2	4957	broad.mit.edu	37	9	131256864	131256864	+	Silent	SNP	C	T	T			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131256864C>T	uc011mbd.1	+	17	2139	c.1828C>T	c.(1828-1830)CTG>TTG	p.L610L	ODF2_uc011maz.1_Silent_p.L610L|ODF2_uc011mbc.1_Silent_p.L529L|ODF2_uc004bva.2_Silent_p.L563L|ODF2_uc004bvb.2_Silent_p.L586L|ODF2_uc011mbe.1_Silent_p.L605L|ODF2_uc004bvc.2_Silent_p.L586L|ODF2_uc011mbf.1_Silent_p.L591L|ODF2_uc004bvd.3_Silent_p.L610L|ODF2_uc004bve.2_Silent_p.L591L|ODF2_uc004bvh.2_5'Flank	NM_002540	NP_002531	Q5BJF6	ODFP2_HUMAN	outer dense fiber of sperm tails 2 isoform 1	610	Potential.				cell differentiation|G2/M transition of mitotic cell cycle|multicellular organismal development|spermatogenesis	centriole|cilium|cytosol|microtubule|spindle pole	protein binding|structural molecule activity			ovary(1)	1						GGAGGCGAAGCTGGCTGAGTG	0.572													22	54	---	---	---	---	PASS
NEBL	10529	broad.mit.edu	37	10	21076186	21076186	+	Missense_Mutation	SNP	T	C	C			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:21076186T>C	uc001iqi.2	-	27	3210	c.2813A>G	c.(2812-2814)TAC>TGC	p.Y938C	NEBL_uc001iqj.2_RNA|NEBL_uc001iqk.2_Missense_Mutation_p.Y194C	NM_006393	NP_006384	O76041	NEBL_HUMAN	nebulette sarcomeric isoform	938	Linker.				regulation of actin filament length		actin binding|structural constituent of muscle			ovary(2)	2						CTGGTGCATGTAGCCATAGCC	0.458													8	24	---	---	---	---	PASS
ERCC6	2074	broad.mit.edu	37	10	50678573	50678573	+	Missense_Mutation	SNP	C	T	T			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:50678573C>T	uc001jhs.3	-	18	3587	c.3433G>A	c.(3433-3435)GAA>AAA	p.E1145K	ERCC6_uc009xod.2_Missense_Mutation_p.E305K|ERCC6_uc010qgr.1_Missense_Mutation_p.E515K|ERCC6_uc001jhr.3_Missense_Mutation_p.E513K	NM_000124	NP_000115	Q03468	ERCC6_HUMAN	excision repair cross-complementing rodent	1145					base-excision repair|positive regulation of transcription elongation, DNA-dependent|transcription from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair	nucleolus|soluble fraction|transcription elongation factor complex	ATP binding|chromatin binding|DNA binding|DNA-dependent ATPase activity|helicase activity|protein C-terminus binding|protein complex binding|protein N-terminus binding			lung(5)|breast(5)|ovary(3)|large_intestine(2)|skin(1)	16						TCAATGCTTTCATCACCAGAT	0.378								Direct_reversal_of_damage|NER					109	223	---	---	---	---	PASS
JMJD1C	221037	broad.mit.edu	37	10	64954117	64954117	+	Missense_Mutation	SNP	C	G	G			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:64954117C>G	uc001jmn.2	-	14	5963	c.5663G>C	c.(5662-5664)TGG>TCG	p.W1888S	JMJD1C_uc001jml.2_Missense_Mutation_p.W1669S|JMJD1C_uc001jmm.2_Missense_Mutation_p.W1600S|JMJD1C_uc010qiq.1_Missense_Mutation_p.W1706S|JMJD1C_uc009xpi.2_Missense_Mutation_p.W1706S|JMJD1C_uc009xpj.1_RNA|JMJD1C_uc009xpk.1_Missense_Mutation_p.W786S	NM_032776	NP_116165	Q15652	JHD2C_HUMAN	jumonji domain containing 1C isoform a	1888					blood coagulation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleoplasm	histone demethylase activity (H3-K9 specific)|metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|thyroid hormone receptor binding			ovary(4)|breast(1)|central_nervous_system(1)	6	Prostate(12;0.0119)|all_hematologic(501;0.191)					ACACTTCATCCAAGCATATAG	0.303													47	130	---	---	---	---	PASS
KIF20B	9585	broad.mit.edu	37	10	91492692	91492692	+	Silent	SNP	C	T	T			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:91492692C>T	uc001kgs.1	+	19	2496	c.2424C>T	c.(2422-2424)AAC>AAT	p.N808N	KIF20B_uc001kgr.1_Silent_p.N768N|KIF20B_uc001kgt.1_Silent_p.N19N|KIF20B_uc001kgu.2_5'Flank	NM_016195	NP_057279	Q96Q89	KI20B_HUMAN	M-phase phosphoprotein 1	808					cell cycle arrest|cell division|microtubule-based movement|mitosis|regulation of mitosis	centrosome|microtubule|nucleolus|nucleoplasm|spindle	ATP binding|ATPase activity|microtubule motor activity|WW domain binding			ovary(1)|pancreas(1)|skin(1)	3						TAATAATAAACAATAAATTGA	0.264													8	209	---	---	---	---	PASS
KIF11	3832	broad.mit.edu	37	10	94405242	94405242	+	Missense_Mutation	SNP	C	T	T			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:94405242C>T	uc001kic.2	+	18	2698	c.2390C>T	c.(2389-2391)TCT>TTT	p.S797F	KIF11_uc010qnq.1_Intron	NM_004523	NP_004514	P52732	KIF11_HUMAN	kinesin family member 11	797					blood coagulation|cell division|microtubule-based movement|spindle assembly involved in mitosis	chromatin remodeling complex|cytosol|kinesin complex|microtubule|spindle pole	ATP binding|microtubule motor activity|protein kinase binding			skin(1)	1						GTTGAAGAATCTGTGAAACAC	0.343													7	127	---	---	---	---	PASS
OR2AG1	144125	broad.mit.edu	37	11	6806547	6806547	+	Silent	SNP	C	T	T			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6806547C>T	uc001mer.1	+	1	279	c.279C>T	c.(277-279)TCC>TCT	p.S93S		NM_001004489	NP_001004489	Q9H205	O2AG1_HUMAN	olfactory receptor, family 2, subfamily AG,	93	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)		Epithelial(150;2.19e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		ACACCATCTCCTTTGGAGGCT	0.547													47	169	---	---	---	---	PASS
CCDC73	493860	broad.mit.edu	37	11	32657351	32657351	+	Missense_Mutation	SNP	T	C	C			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:32657351T>C	uc001mtv.2	-	14	1120	c.1076A>G	c.(1075-1077)AAT>AGT	p.N359S	CCDC73_uc001mtw.1_Missense_Mutation_p.N349S	NM_001008391	NP_001008392	Q6ZRK6	CCD73_HUMAN	sarcoma antigen NY-SAR-79	359	Potential.									ovary(1)|central_nervous_system(1)	2	Breast(20;0.112)					TTTAATCTTATTAATTTCTCC	0.229													21	46	---	---	---	---	PASS
OR5L2	26338	broad.mit.edu	37	11	55595213	55595213	+	Silent	SNP	G	C	C			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55595213G>C	uc001nhy.1	+	1	519	c.519G>C	c.(517-519)GTG>GTC	p.V173V		NM_001004739	NP_001004739	Q8NGL0	OR5L2_HUMAN	olfactory receptor, family 5, subfamily L,	173	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		all_epithelial(135;0.208)				GATCTAATGTGATTAACCACT	0.478										HNSCC(27;0.073)			16	541	---	---	---	---	PASS
SLC29A2	3177	broad.mit.edu	37	11	66136951	66136951	+	Missense_Mutation	SNP	C	G	G			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66136951C>G	uc001oht.2	-	3	393	c.164G>C	c.(163-165)AGC>ACC	p.S55T	SLC29A2_uc001ohs.2_5'UTR|SLC29A2_uc010rpb.1_RNA|SLC29A2_uc009yrf.2_5'UTR|SLC29A2_uc001ohu.2_Missense_Mutation_p.S55T|SLC29A2_uc001ohv.2_Missense_Mutation_p.S55T|uc001ohw.1_RNA	NM_001532	NP_001523	Q14542	S29A2_HUMAN	solute carrier family 29 (nucleoside	55					cell proliferation|nucleobase, nucleoside and nucleotide metabolic process	basolateral plasma membrane|integral to plasma membrane|nuclear membrane|nucleolus	nucleoside transmembrane transporter activity			ovary(1)	1						GTGGTTGGTGCTCAGGATCCT	0.637													70	208	---	---	---	---	PASS
IL18BP	10068	broad.mit.edu	37	11	71711432	71711432	+	Missense_Mutation	SNP	C	T	T			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:71711432C>T	uc001ore.1	+	4	342	c.64C>T	c.(64-66)CAC>TAC	p.H22Y	IL18BP_uc001orf.1_Missense_Mutation_p.H22Y|IL18BP_uc009ysu.1_RNA|IL18BP_uc001org.1_Missense_Mutation_p.H22Y|IL18BP_uc001orh.1_Missense_Mutation_p.H22Y|IL18BP_uc001ori.2_Missense_Mutation_p.H22Y|IL18BP_uc009ysv.1_Missense_Mutation_p.H22Y	NM_001039659	NP_001034748	O95998	I18BP_HUMAN	interleukin 18 binding protein isoform a	22					T-helper 1 type immune response	extracellular region	interleukin-18 binding|receptor antagonist activity				0						CCTGTGTGCCCACGTCGTCAC	0.612													36	123	---	---	---	---	PASS
FAM55B	120406	broad.mit.edu	37	11	114568953	114568953	+	Missense_Mutation	SNP	A	T	T			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:114568953A>T	uc009yyy.2	+	3	417	c.319A>T	c.(319-321)ACC>TCC	p.T107S		NM_182495	NP_872301	Q96DL1	FA55B_HUMAN	hypothetical protein LOC120406	107						integral to membrane				ovary(1)	1						GAATACCACCACCAGTGCCAC	0.512													32	63	---	---	---	---	PASS
C3AR1	719	broad.mit.edu	37	12	8212018	8212018	+	Missense_Mutation	SNP	T	A	A			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:8212018T>A	uc001qtv.1	-	2	856	c.764A>T	c.(763-765)TAT>TTT	p.Y255F		NM_004054	NP_004045	Q16581	C3AR_HUMAN	complement component 3a receptor 1	255	Extracellular (Potential).				blood circulation|chemotaxis|elevation of cytosolic calcium ion concentration|inflammatory response	integral to plasma membrane	C3a anaphylatoxin receptor activity|complement component C3a receptor activity|phosphatidylinositol phospholipase C activity			ovary(1)	1				Kidney(36;0.0893)		TACATTAGAATACAGATTTTG	0.443													53	106	---	---	---	---	PASS
SYT10	341359	broad.mit.edu	37	12	33579108	33579108	+	Silent	SNP	C	T	T	rs111713819		TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:33579108C>T	uc001rll.1	-	2	771	c.474G>A	c.(472-474)GTG>GTA	p.V158V	SYT10_uc009zju.1_5'UTR	NM_198992	NP_945343	Q6XYQ8	SYT10_HUMAN	synaptotagmin X	158	Cytoplasmic (Potential).					cell junction|integral to membrane|synaptic vesicle membrane	metal ion binding|transporter activity			ovary(1)|skin(1)	2	Lung NSC(5;8.37e-07)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0334)					TTTGTCTTTGCACACGTGCAT	0.313													144	367	---	---	---	---	PASS
SLC38A2	54407	broad.mit.edu	37	12	46754841	46754841	+	3'UTR	SNP	G	T	T			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:46754841G>T	uc001rpg.2	-	16					SLC38A2_uc010sli.1_3'UTR|SLC38A2_uc001rph.2_3'UTR	NM_018976	NP_061849	Q96QD8	S38A2_HUMAN	solute carrier family 38, member 2						cellular nitrogen compound metabolic process|glutamate secretion|neurotransmitter secretion|sodium ion transport	integral to membrane|plasma membrane	amino acid transmembrane transporter activity|symporter activity			urinary_tract(1)|skin(1)	2	Lung SC(27;0.192)|Renal(347;0.236)		OV - Ovarian serous cystadenocarcinoma(5;0.0048)|Epithelial(2;0.0374)	GBM - Glioblastoma multiforme(48;0.226)		TAGTAGTTGAGTTTACTCAAC	0.403													9	27	---	---	---	---	PASS
POC1B	282809	broad.mit.edu	37	12	89885862	89885862	+	Silent	SNP	A	G	G			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:89885862A>G	uc001tbc.2	-	4	408	c.303T>C	c.(301-303)CAT>CAC	p.H101H	POC1B_uc001tba.2_Silent_p.H59H|POC1B_uc001tbb.2_5'UTR|POC1B_uc010sun.1_RNA|POC1B_uc009zsp.2_RNA|POC1B_uc009zsq.2_RNA	NM_172240	NP_758440	Q8TC44	POC1B_HUMAN	WD repeat domain 51B	101	WD 3.				cell projection organization	centriole|microtubule basal body				ovary(1)	1						CTGGAGCTGTATGAGCTTTAA	0.343													37	93	---	---	---	---	PASS
ACACB	32	broad.mit.edu	37	12	109660697	109660697	+	Missense_Mutation	SNP	T	C	C			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109660697T>C	uc001tob.2	+	26	3891	c.3772T>C	c.(3772-3774)TTC>CTC	p.F1258L	ACACB_uc001toc.2_Missense_Mutation_p.F1258L	NM_001093	NP_001084	O00763	ACACB_HUMAN	acetyl-Coenzyme A carboxylase beta	1258					acetyl-CoA metabolic process|carnitine shuttle|energy reserve metabolic process|fatty acid biosynthetic process|positive regulation of cellular metabolic process|protein homotetramerization|regulation of fatty acid oxidation	cytosol|endomembrane system|Golgi apparatus|membrane	acetyl-CoA carboxylase activity|ATP binding|biotin carboxylase activity|metal ion binding|protein binding			ovary(5)|upper_aerodigestive_tract(1)|pancreas(1)|skin(1)	8					Biotin(DB00121)	CGGCCACCAGTTCTGCCCCGA	0.602													5	12	---	---	---	---	PASS
UBE3B	89910	broad.mit.edu	37	12	109935725	109935725	+	Silent	SNP	T	C	C			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109935725T>C	uc001top.2	+	10	1419	c.816T>C	c.(814-816)CCT>CCC	p.P272P	UBE3B_uc001toq.2_Silent_p.P272P|UBE3B_uc001too.1_RNA|UBE3B_uc009zvj.1_Silent_p.P272P	NM_130466	NP_569733	Q7Z3V4	UBE3B_HUMAN	ubiquitin protein ligase E3B	272					protein ubiquitination involved in ubiquitin-dependent protein catabolic process	intracellular	ubiquitin-protein ligase activity			ovary(2)|lung(2)	4						CAGTGACCCCTGAGGTAAGCA	0.458													53	114	---	---	---	---	PASS
VPS29	51699	broad.mit.edu	37	12	110939747	110939747	+	Intron	SNP	G	C	C			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110939747G>C	uc001tqy.2	-						VPS29_uc001tqw.2_5'Flank|VPS29_uc001tqx.2_Intron|VPS29_uc001tqz.2_Intron|RAD9B_uc001trc.1_RNA|RAD9B_uc001trf.3_5'Flank|RAD9B_uc001trg.3_5'Flank|RAD9B_uc010sya.1_5'Flank|RAD9B_uc001tre.3_5'Flank|RAD9B_uc001trd.3_5'Flank	NM_016226	NP_057310	Q9UBQ0	VPS29_HUMAN	vacuolar protein sorting 29 isoform 1						protein transport	endosome membrane	metal ion binding|phosphoserine phosphatase activity				0						CTGACGCCGAGGCCTCCGGGA	0.687													6	15	---	---	---	---	PASS
DCT	1638	broad.mit.edu	37	13	95092274	95092274	+	Missense_Mutation	SNP	G	C	C			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:95092274G>C	uc001vlv.3	-	8	1865	c.1438C>G	c.(1438-1440)CTG>GTG	p.L480V	DCT_uc010afh.2_Missense_Mutation_p.L513V	NM_001922	NP_001913	P40126	TYRP2_HUMAN	dopachrome tautomerase isoform 1	480	Helical; (Potential).				epidermis development|melanin biosynthetic process from tyrosine	cytosol|integral to membrane|melanosome membrane|microsome	copper ion binding|dopachrome isomerase activity|oxidoreductase activity			ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	5	all_neural(89;0.0684)|Medulloblastoma(90;0.163)	all_cancers(2;3.71e-42)|all_epithelial(2;3.76e-31)|all_lung(2;5.16e-14)|Lung NSC(4;1.33e-13)|Breast(118;0.0013)|Hepatocellular(115;0.00886)|Renal(2;0.00988)		COAD - Colon adenocarcinoma(199;7.07e-05)|GBM - Glioblastoma multiforme(99;0.000472)		AAAGCCACCAGTGTTCCCATG	0.418													31	104	---	---	---	---	PASS
CCNB1IP1	57820	broad.mit.edu	37	14	20779855	20779855	+	Missense_Mutation	SNP	C	T	T			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20779855C>T	uc001vwv.2	-	7	1337	c.688G>A	c.(688-690)GAT>AAT	p.D230N	CCNB1IP1_uc001vww.2_Missense_Mutation_p.D230N|CCNB1IP1_uc001vwx.2_Missense_Mutation_p.D230N|CCNB1IP1_uc001vwy.2_Missense_Mutation_p.D230N|CCNB1IP1_uc001vwz.2_Missense_Mutation_p.D230N	NM_182851	NP_878271	Q9NPC3	CIP1_HUMAN	cyclin B1 interacting protein 1 isoform 3	230						chromosome|nucleus	ligase activity|metal ion binding|protein binding		HMGA2/CCNB1IP1(2)	soft_tissue(2)|ovary(1)	3	all_cancers(95;0.00092)	all_lung(585;0.235)	Epithelial(56;8.86e-07)|all cancers(55;4.98e-06)	GBM - Glioblastoma multiforme(265;0.0164)		AAATCTCCATCTCCATCGCCC	0.398			T	HMGA2	leiomyoma								60	153	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	14	22337492	22337492	+	Missense_Mutation	SNP	C	T	T			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22337492C>T	uc010tmf.1	+	2	365	c.286C>T	c.(286-288)CAC>TAC	p.H96Y	uc001wbw.2_Intron|uc010tmg.1_Intron|uc010tmh.1_Missense_Mutation_p.H95Y|uc001wby.2_Intron					SubName: Full=Putative uncharacterized protein ENSP00000374943;																		TTTCTCCCTGCACATCACAGA	0.468													7	200	---	---	---	---	PASS
PCNX	22990	broad.mit.edu	37	14	71479737	71479737	+	Silent	SNP	G	A	A			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:71479737G>A	uc001xmo.2	+	11	3260	c.2814G>A	c.(2812-2814)TTG>TTA	p.L938L	PCNX_uc010are.1_Silent_p.L827L|PCNX_uc010arf.1_5'UTR	NM_014982	NP_055797	Q96RV3	PCX1_HUMAN	pecanex-like 1	938						integral to membrane				ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(12;0.206)	all cancers(60;0.00835)|BRCA - Breast invasive adenocarcinoma(234;0.00951)|OV - Ovarian serous cystadenocarcinoma(108;0.0417)		ATAGACTATTGACCATTGATA	0.363													64	132	---	---	---	---	PASS
RBM25	58517	broad.mit.edu	37	14	73570036	73570036	+	Missense_Mutation	SNP	G	C	C			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:73570036G>C	uc001xno.2	+	10	1212	c.1004G>C	c.(1003-1005)CGA>CCA	p.R335P	RBM25_uc010ttu.1_Missense_Mutation_p.R335P|RBM25_uc001xnp.2_Missense_Mutation_p.R130P	NM_021239	NP_067062	P49756	RBM25_HUMAN	RNA binding motif protein 25	335	Necessary for nuclear speckle localization.|Glu-rich.|Arg-rich.				apoptosis|mRNA processing|regulation of alternative nuclear mRNA splicing, via spliceosome|RNA splicing	cytoplasm|nuclear speck	mRNA binding|nucleotide binding|protein binding			central_nervous_system(2)|ovary(1)|breast(1)	4				BRCA - Breast invasive adenocarcinoma(234;0.00362)|OV - Ovarian serous cystadenocarcinoma(108;0.0688)		gaacgtgaacgagaaaaggag	0.020													7	25	---	---	---	---	PASS
FLRT2	23768	broad.mit.edu	37	14	86088731	86088731	+	Silent	SNP	G	T	T			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:86088731G>T	uc001xvr.2	+	2	1640	c.873G>T	c.(871-873)CTG>CTT	p.L291L	FLRT2_uc010atd.2_Silent_p.L291L	NM_013231	NP_037363	O43155	FLRT2_HUMAN	fibronectin leucine rich transmembrane protein 2	291	Extracellular (Potential).|LRR 10.				cell adhesion	integral to plasma membrane|proteinaceous extracellular matrix	protein binding, bridging|receptor signaling protein activity			ovary(3)|haematopoietic_and_lymphoid_tissue(1)	4				BRCA - Breast invasive adenocarcinoma(234;0.0319)		TGCGGATGCTGACTCAAGGGG	0.458													159	172	---	---	---	---	PASS
RIN3	79890	broad.mit.edu	37	14	93118453	93118453	+	Silent	SNP	C	A	A			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:93118453C>A	uc001yap.2	+	6	1211	c.1059C>A	c.(1057-1059)CCC>CCA	p.P353P	RIN3_uc010auk.2_Silent_p.P15P|RIN3_uc001yaq.2_Silent_p.P278P|RIN3_uc001yar.1_Silent_p.P15P|RIN3_uc001yas.1_Silent_p.P15P	NM_024832	NP_079108	Q8TB24	RIN3_HUMAN	Ras and Rab interactor 3	353	Pro-rich.				endocytosis|signal transduction	cytoplasmic membrane-bounded vesicle|early endosome	GTPase activator activity|Ras GTPase binding			lung(2)|ovary(1)	3		all_cancers(154;0.0701)				GCCTGGGCCCCCTCAGGGAGG	0.672													12	17	---	---	---	---	PASS
ATP8B4	79895	broad.mit.edu	37	15	50336887	50336887	+	Silent	SNP	T	A	A			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:50336887T>A	uc001zxu.2	-	5	346	c.204A>T	c.(202-204)CTA>CTT	p.L68L	ATP8B4_uc010ber.2_5'UTR|ATP8B4_uc010ufd.1_5'UTR|ATP8B4_uc010ufe.1_RNA	NM_024837	NP_079113	Q8TF62	AT8B4_HUMAN	ATPase class I type 8B member 4	68	Extracellular (Potential).				ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			skin(3)|ovary(2)|breast(2)|large_intestine(1)	8		all_lung(180;0.00183)		all cancers(107;2.41e-07)|GBM - Glioblastoma multiforme(94;8.28e-05)		TTTCTGGAATTAGCTGAAACA	0.358													25	66	---	---	---	---	PASS
HERC1	8925	broad.mit.edu	37	15	63950916	63950916	+	Silent	SNP	A	T	T			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:63950916A>T	uc002amp.2	-	48	9574	c.9426T>A	c.(9424-9426)GGT>GGA	p.G3142G		NM_003922	NP_003913	Q15751	HERC1_HUMAN	hect domain and RCC1-like domain 1	3142					protein modification process|transport	cytosol|Golgi apparatus|membrane	acid-amino acid ligase activity|ARF guanyl-nucleotide exchange factor activity			ovary(6)|breast(6)|lung(5)|central_nervous_system(2)	19						AGCCATGGCAACCTGAAAAAC	0.418													21	56	---	---	---	---	PASS
ZWILCH	55055	broad.mit.edu	37	15	66821217	66821217	+	Missense_Mutation	SNP	G	A	A	rs140914823	byFrequency	TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:66821217G>A	uc002aqb.2	+	11	1243	c.997G>A	c.(997-999)GAT>AAT	p.D333N	ZWILCH_uc010bhu.1_Missense_Mutation_p.D219N|ZWILCH_uc002aqa.2_Missense_Mutation_p.D219N|ZWILCH_uc010bhv.2_Missense_Mutation_p.D219N	NM_017975	NP_060445	Q9H900	ZWILC_HUMAN	Zwilch	333					cell division|mitotic cell cycle checkpoint|mitotic prometaphase	condensed chromosome kinetochore|cytosol	protein binding			ovary(1)	1						TGCTGCAGTCGATCGTTCCGT	0.393													4	109	---	---	---	---	PASS
IREB2	3658	broad.mit.edu	37	15	78765670	78765670	+	Missense_Mutation	SNP	G	T	T	rs149685388		TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:78765670G>T	uc002bdr.2	+	8	1132	c.970G>T	c.(970-972)GGG>TGG	p.G324W	IREB2_uc010unb.1_Missense_Mutation_p.G74W|IREB2_uc002bdq.2_Missense_Mutation_p.G324W	NM_004136	NP_004127	P48200	IREB2_HUMAN	iron-responsive element binding protein 2	324							4 iron, 4 sulfur cluster binding|metal ion binding|protein binding				0				UCEC - Uterine corpus endometrioid carcinoma (272;0.232)		TGAGTTAACTGGGTCATCAAA	0.383													65	148	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	15	102296140	102296140	+	5'Flank	SNP	C	T	T			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:102296140C>T	uc002bxr.2	-						uc010usk.1_5'Flank|uc002bxs.2_5'Flank|uc002bxu.1_5'Flank|uc002bxv.1_5'Flank|uc002bxw.1_5'Flank|uc002bxy.1_5'Flank|uc002byb.1_5'Flank|uc002byc.2_5'Flank|uc002byh.2_5'Flank|uc002byj.2_5'Flank|uc002byl.1_5'Flank|uc010usl.1_5'Flank|uc010usn.1_5'Flank|uc002byq.2_5'Flank|uc002byu.2_RNA|uc002byv.2_RNA|uc002byx.3_5'Flank|uc002bza.2_5'Flank|uc002bzb.2_5'Flank|uc002bzc.1_5'Flank|uc002bzd.2_5'Flank|uc002bze.2_5'Flank|uc002bzg.2_5'Flank|uc002bzi.1_5'Flank|uc002bzj.2_5'Flank|uc002bzl.2_5'Flank|uc002bzm.2_5'Flank|uc002bzo.2_5'Flank|uc002bzp.2_5'Flank|uc002bzq.2_5'Flank|uc002bzr.2_5'Flank|uc002bzt.2_5'Flank|uc010usp.1_5'Flank|uc002bzu.2_5'Flank|uc002bzv.3_5'Flank|uc010usq.1_5'Flank|uc010usr.1_5'Flank|uc010uss.1_5'Flank|uc002bzz.2_5'Flank|uc002cab.2_5'Flank|uc002cac.2_5'Flank|uc010ust.1_5'Flank|uc002cad.2_5'Flank|uc010usu.1_5'Flank|uc002cae.2_5'Flank|uc002caf.2_5'Flank					DQ598276																		GTCCAACCTGCACTCGCGTGG	0.602													3	8	---	---	---	---	PASS
MYH11	4629	broad.mit.edu	37	16	15854414	15854414	+	Missense_Mutation	SNP	C	A	A			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15854414C>A	uc002ddy.2	-	11	1338	c.1231G>T	c.(1231-1233)GCT>TCT	p.A411S	MYH11_uc002ddv.2_Missense_Mutation_p.A418S|MYH11_uc002ddw.2_Missense_Mutation_p.A411S|MYH11_uc002ddx.2_Missense_Mutation_p.A418S|MYH11_uc010bvg.2_Missense_Mutation_p.A243S|MYH11_uc002dea.1_Missense_Mutation_p.A117S	NM_002474	NP_002465	P35749	MYH11_HUMAN	smooth muscle myosin heavy chain 11 isoform	411	Myosin head-like.				axon guidance|cardiac muscle fiber development|elastic fiber assembly|skeletal muscle myosin thick filament assembly|smooth muscle contraction	cytosol|melanosome|muscle myosin complex|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity|structural constituent of muscle			ovary(6)|skin(3)|lung(2)|breast(2)|upper_aerodigestive_tract(1)|pancreas(1)	15						TTTGTCTGAGCTTTCTGTACC	0.299			T	CBFB	AML								85	230	---	---	---	---	PASS
MYLK3	91807	broad.mit.edu	37	16	46743538	46743538	+	Missense_Mutation	SNP	A	T	T			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46743538A>T	uc002eei.3	-	12	2429	c.2313T>A	c.(2311-2313)AAT>AAA	p.N771K	MYLK3_uc010vge.1_Missense_Mutation_p.N430K	NM_182493	NP_872299	Q32MK0	MYLK3_HUMAN	myosin light chain kinase 3	771					cardiac myofibril assembly|cellular response to interleukin-1|positive regulation of sarcomere organization|regulation of vascular permeability involved in acute inflammatory response|sarcomere organization|sarcomerogenesis	cytosol	ATP binding|calmodulin-dependent protein kinase activity|myosin light chain kinase activity			stomach(2)|skin(2)|large_intestine(1)|ovary(1)|central_nervous_system(1)	7		all_cancers(37;0.00023)|all_epithelial(9;0.000543)|all_lung(18;0.00585)|Lung NSC(13;0.0496)|Breast(268;0.116)				CAGGCAAATTATTCAGCCACT	0.413													72	158	---	---	---	---	PASS
RPGRIP1L	23322	broad.mit.edu	37	16	53692370	53692370	+	Missense_Mutation	SNP	C	G	G			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:53692370C>G	uc002ehp.2	-	12	1421	c.1357G>C	c.(1357-1359)GAT>CAT	p.D453H	RPGRIP1L_uc002eho.3_Missense_Mutation_p.D453H|RPGRIP1L_uc010vgy.1_Missense_Mutation_p.D453H|RPGRIP1L_uc010cbx.2_Missense_Mutation_p.D453H|RPGRIP1L_uc010vgz.1_Missense_Mutation_p.D453H	NM_015272	NP_056087	Q68CZ1	FTM_HUMAN	RPGRIP1-like isoform a	453	Potential.				negative regulation of G-protein coupled receptor protein signaling pathway	cell-cell junction|centrosome|cilium axoneme|microtubule basal body	thromboxane A2 receptor binding			ovary(1)	1		all_cancers(37;0.0973)				GCATTAATATCATTCTCCTGC	0.333													34	90	---	---	---	---	PASS
FBXO31	79791	broad.mit.edu	37	16	87394002	87394002	+	Intron	SNP	A	T	T			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:87394002A>T	uc002fjw.2	-						FBXO31_uc010vot.1_Intron|FBXO31_uc002fjv.2_5'UTR	NM_024735	NP_079011	Q5XUX0	FBX31_HUMAN	F-box protein 31						cell cycle|cyclin catabolic process|mitotic cell cycle G1/S transition DNA damage checkpoint|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process	SCF ubiquitin ligase complex	cyclin binding			lung(1)	1				BRCA - Breast invasive adenocarcinoma(80;0.0272)		CAGAAATTTAAGATCAACAAC	0.517													8	27	---	---	---	---	PASS
OR3A4	390756	broad.mit.edu	37	17	3213556	3213556	+	5'UTR	SNP	C	T	T			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3213556C>T	uc002fvi.2	+	1						NR_024128				RecName: Full=Olfactory receptor 3A4; AltName: Full=Olfactory receptor 17-24;          Short=OR17-24;											ovary(1)	1						CTTCTGCCACCACCGGCCCCA	0.502													19	41	---	---	---	---	PASS
C17orf68	80169	broad.mit.edu	37	17	8141397	8141397	+	Missense_Mutation	SNP	G	A	A			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8141397G>A	uc002gkq.3	-	4	658	c.599C>T	c.(598-600)CCT>CTT	p.P200L	C17orf68_uc010cnv.2_RNA	NM_025099	NP_079375	Q2NKJ3	CTC1_HUMAN	alpha accessory factor 132	200					positive regulation of DNA replication|telomere maintenance	Stn1-Ten1 complex	protein binding|single-stranded DNA binding				0						GACAGGGATAGGCGTGACGGG	0.587													20	61	---	---	---	---	PASS
NCOR1	9611	broad.mit.edu	37	17	15961009	15961009	+	Missense_Mutation	SNP	G	T	T			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:15961009G>T	uc002gpo.2	-	40	6451	c.6211C>A	c.(6211-6213)CAG>AAG	p.Q2071K	NCOR1_uc002gpn.2_Missense_Mutation_p.Q1968K|NCOR1_uc002gpl.2_Missense_Mutation_p.Q86K|NCOR1_uc002gpm.2_Missense_Mutation_p.Q591K|NCOR1_uc010vwb.1_Missense_Mutation_p.Q655K|NCOR1_uc010coy.2_Missense_Mutation_p.Q979K|NCOR1_uc010vwc.1_Missense_Mutation_p.Q881K	NM_006311	NP_006302	O75376	NCOR1_HUMAN	nuclear receptor co-repressor 1	2071	Interaction with C1D (By similarity).|ID1 (By similarity).				cellular lipid metabolic process|chromatin modification|negative regulation of JNK cascade|regulation of glycolysis by negative regulation of transcription from an RNA polymerase II promoter|regulation of lipid transport by negative regulation of transcription from an RNA polymerase II promoter|spindle assembly|transcription from RNA polymerase II promoter	nuclear chromatin|spindle microtubule|transcriptional repressor complex	histone deacetylase binding|transcription corepressor activity|transcription regulatory region DNA binding			upper_aerodigestive_tract(2)|ovary(1)|central_nervous_system(1)|kidney(1)	5				UCEC - Uterine corpus endometrioid carcinoma (92;0.101)		TGGGGAGTCTGCGAGGAAACT	0.398													53	111	---	---	---	---	PASS
SLFN11	91607	broad.mit.edu	37	17	33689790	33689790	+	Missense_Mutation	SNP	T	G	G			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:33689790T>G	uc010ctp.2	-	4	1479	c.1037A>C	c.(1036-1038)AAA>ACA	p.K346T	SLFN11_uc010ctq.2_Missense_Mutation_p.K346T|SLFN11_uc002hjh.3_Missense_Mutation_p.K346T|SLFN11_uc002hjg.3_Missense_Mutation_p.K346T|SLFN11_uc010ctr.2_Missense_Mutation_p.K346T	NM_001104588	NP_001098058	Q7Z7L1	SLN11_HUMAN	schlafen family member 11	346						nucleus	ATP binding			large_intestine(1)|ovary(1)|skin(1)	3		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		GCCTACCCATTTCTCGGTTGT	0.483													52	118	---	---	---	---	PASS
PLXDC1	57125	broad.mit.edu	37	17	37265509	37265509	+	Nonsense_Mutation	SNP	G	A	A			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37265509G>A	uc002hrg.2	-	3	603	c.391C>T	c.(391-393)CAG>TAG	p.Q131*	PLXDC1_uc002hrh.2_RNA|PLXDC1_uc002hri.2_RNA|PLXDC1_uc002hrj.1_RNA|PLXDC1_uc002hrk.1_RNA	NM_020405	NP_065138	Q8IUK5	PXDC1_HUMAN	plexin domain containing 1 precursor	131	Extracellular (Potential).				angiogenesis	cytoplasm|extracellular region|integral to membrane|tight junction				ovary(1)|kidney(1)|skin(1)	3						ACCGAAGCCTGCCGGTGGGTG	0.662													3	7	---	---	---	---	PASS
TUBG1	7283	broad.mit.edu	37	17	40764111	40764111	+	Missense_Mutation	SNP	G	A	A			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40764111G>A	uc002ian.2	+	4	747	c.349G>A	c.(349-351)GAC>AAC	p.D117N		NM_001070	NP_001061	P23258	TBG1_HUMAN	tubulin, gamma 1	117					G2/M transition of mitotic cell cycle|meiotic spindle organization|protein polymerization	condensed nuclear chromosome|cytosol|gamma-tubulin complex|polar microtubule	GTP binding|GTPase activity|protein binding|structural constituent of cytoskeleton			ovary(1)	1		Breast(137;0.00116)		BRCA - Breast invasive adenocarcinoma(366;0.129)		GATCCATGAGGACATTTTTGA	0.522													21	49	---	---	---	---	PASS
GPATCH8	23131	broad.mit.edu	37	17	42501794	42501794	+	Nonsense_Mutation	SNP	C	A	A			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42501794C>A	uc002igw.1	-	6	479	c.415G>T	c.(415-417)GAA>TAA	p.E139*	GPATCH8_uc002igv.1_Nonsense_Mutation_p.E61*|GPATCH8_uc010wiz.1_Nonsense_Mutation_p.E61*	NM_001002909	NP_001002909	Q9UKJ3	GPTC8_HUMAN	G patch domain containing 8	139	C2H2-type.					intracellular	nucleic acid binding|zinc ion binding			ovary(2)|kidney(1)|skin(1)	4		Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.206)		TCACACAGTTCACAATAAAAG	0.373													4	154	---	---	---	---	PASS
IMP5	162540	broad.mit.edu	37	17	43923235	43923235	+	Silent	SNP	G	A	A	rs140813443		TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43923235G>A	uc010wka.1	+	1	963	c.963G>A	c.(961-963)CCG>CCA	p.P321P	LOC100128977_uc010wjz.1_Intron	NM_175882	NP_787078	Q8IUH8	IMP5_HUMAN	intramembrane protease 5 precursor	321	Helical; (Potential).					integral to membrane	aspartic-type endopeptidase activity			pancreas(2)	2	Colorectal(2;0.0416)			BRCA - Breast invasive adenocarcinoma(366;0.148)		CCTCTCTGCCGCTGCCTCTGC	0.662													10	32	---	---	---	---	PASS
PAF1	54623	broad.mit.edu	37	19	39880356	39880356	+	Silent	SNP	A	G	G			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39880356A>G	uc002old.2	-	4	391	c.216T>C	c.(214-216)CAT>CAC	p.H72H	PAF1_uc002ole.1_Silent_p.H62H|PAF1_uc010xuv.1_Intron|MED29_uc010xuw.1_5'Flank|MED29_uc002olf.2_5'Flank|MED29_uc010xux.1_5'Flank	NM_019088	NP_061961	Q8N7H5	PAF1_HUMAN	Paf1, RNA polymerase II associated factor,	72					histone H2B ubiquitination|histone monoubiquitination|regulation of transcription, DNA-dependent|transcription, DNA-dependent	Cdc73/Paf1 complex	protein binding			pancreas(1)	1	all_cancers(60;9.14e-07)|all_lung(34;4.03e-08)|Lung NSC(34;4.66e-08)|all_epithelial(25;1.88e-06)|Ovarian(47;0.0512)		Epithelial(26;9.6e-28)|all cancers(26;9.14e-25)|Lung(45;0.000168)|LUSC - Lung squamous cell carcinoma(53;0.000199)			TCAGGAGGTCATGTTTGTGCT	0.552													81	140	---	---	---	---	PASS
ZNF284	342909	broad.mit.edu	37	19	44589959	44589959	+	Missense_Mutation	SNP	G	A	A			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44589959G>A	uc002oyg.1	+	5	544	c.328G>A	c.(328-330)GAG>AAG	p.E110K	ZNF284_uc010ejd.2_RNA	NM_001037813	NP_001032902	Q2VY69	ZN284_HUMAN	zinc finger protein 284	110					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Prostate(69;0.0435)				AACTGCAAGTGAGTTAACTAG	0.468													40	81	---	---	---	---	PASS
ZNF234	10780	broad.mit.edu	37	19	44661744	44661744	+	Silent	SNP	G	A	A			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44661744G>A	uc002oym.2	+	6	1882	c.1575G>A	c.(1573-1575)TCG>TCA	p.S525S	ZNF234_uc002oyl.3_Silent_p.S525S	NM_006630	NP_006621	Q14588	ZN234_HUMAN	zinc finger protein 234	525	C2H2-type 14.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Prostate(69;0.0435)				GTCAGGCCTCGCATCTTCTAA	0.458													51	111	---	---	---	---	PASS
SPHK2	56848	broad.mit.edu	37	19	49129392	49129392	+	Missense_Mutation	SNP	C	T	T			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49129392C>T	uc002pjr.2	+	3	650	c.284C>T	c.(283-285)GCC>GTC	p.A95V	SPHK2_uc010xzt.1_Missense_Mutation_p.A36V|SPHK2_uc002pjs.2_Missense_Mutation_p.A95V|SPHK2_uc002pjt.2_Intron|SPHK2_uc002pju.2_Missense_Mutation_p.A59V|SPHK2_uc002pjv.2_Missense_Mutation_p.A59V|SPHK2_uc002pjw.2_Missense_Mutation_p.A157V|SPHK2_uc010xzu.1_Missense_Mutation_p.A59V	NM_020126	NP_064511	Q9NRA0	SPHK2_HUMAN	sphingosine kinase 2	95	Required for binding to sulfatide and phosphoinositides and for membrane localization.				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|anti-apoptosis|cell proliferation|sphinganine-1-phosphate biosynthetic process	cytosol|lysosomal membrane|membrane fraction	ATP binding|D-erythro-sphingosine kinase activity|diacylglycerol kinase activity|Ras GTPase binding|sphinganine kinase activity			lung(1)	1		all_lung(116;0.000125)|Lung NSC(112;0.000202)|all_epithelial(76;0.000283)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000102)|all cancers(93;0.000117)|GBM - Glioblastoma multiforme(486;0.00627)|Epithelial(262;0.0158)		GTCCCGTTGGCCGAGGTCTCA	0.597													10	18	---	---	---	---	PASS
SYT3	84258	broad.mit.edu	37	19	51140596	51140596	+	Silent	SNP	G	T	T			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51140596G>T	uc002pst.2	-	1	707	c.73C>A	c.(73-75)CGA>AGA	p.R25R	SYT3_uc002psv.2_Silent_p.R25R|SYT3_uc010ycd.1_Silent_p.R25R	NM_032298	NP_115674	Q9BQG1	SYT3_HUMAN	synaptotagmin III	25	Vesicular (Potential).					cell junction|endosome|integral to membrane|synaptic vesicle membrane	metal ion binding|transporter activity			ovary(2)|breast(1)	3		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00462)|GBM - Glioblastoma multiforme(134;0.0188)		TCAGCATCTCGGACCCGCGCA	0.632													38	62	---	---	---	---	PASS
ZNF610	162963	broad.mit.edu	37	19	52869689	52869689	+	Missense_Mutation	SNP	T	A	A			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52869689T>A	uc002pyx.3	+	6	1464	c.1058T>A	c.(1057-1059)TTT>TAT	p.F353Y	ZNF610_uc002pyy.3_Missense_Mutation_p.F353Y|ZNF610_uc002pyz.3_Missense_Mutation_p.F310Y|ZNF610_uc002pza.2_Missense_Mutation_p.F353Y	NM_001161426	NP_001154898	Q8N9Z0	ZN610_HUMAN	zinc finger protein 610 isoform a	353	C2H2-type 6.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)|upper_aerodigestive_tract(1)	3				OV - Ovarian serous cystadenocarcinoma(262;0.00396)|GBM - Glioblastoma multiforme(134;0.00434)		GGCAAGGTCTTTAGTCTGCTT	0.428													42	116	---	---	---	---	PASS
SYT5	6861	broad.mit.edu	37	19	55686593	55686593	+	Missense_Mutation	SNP	G	T	T			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55686593G>T	uc002qjm.1	-	5	1715	c.655C>A	c.(655-657)CTG>ATG	p.L219M	SYT5_uc002qjp.2_Missense_Mutation_p.L216M|SYT5_uc002qjn.1_Missense_Mutation_p.L219M|SYT5_uc002qjo.1_Missense_Mutation_p.L219M	NM_003180	NP_003171	O00445	SYT5_HUMAN	synaptotagmin V	219	Cytoplasmic (Potential).				energy reserve metabolic process|regulation of insulin secretion|synaptic transmission	cell junction|integral to membrane|recycling endosome membrane|synaptic vesicle membrane	metal ion binding|transporter activity				0			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0452)		GGCCGCCCCAGGTCCACGGAG	0.726													6	5	---	---	---	---	PASS
C20orf141	128653	broad.mit.edu	37	20	2795845	2795845	+	Silent	SNP	C	T	T			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:2795845C>T	uc010gat.2	+	2	98	c.15C>T	c.(13-15)TGC>TGT	p.C5C	C20orf141_uc002wgv.1_Silent_p.C5C|C20orf141_uc002wgw.2_Silent_p.C5C|uc002wgx.1_5'Flank|uc002wgy.1_5'Flank	NM_080739	NP_542777	Q9NUB4	CT141_HUMAN	hypothetical protein LOC128653	5						integral to membrane					0						CCCGGCTCTGCTTACCCAGAC	0.607													56	119	---	---	---	---	PASS
KIF16B	55614	broad.mit.edu	37	20	16316573	16316573	+	Missense_Mutation	SNP	C	T	T			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:16316573C>T	uc002wpg.1	-	24	3867	c.3709G>A	c.(3709-3711)GAG>AAG	p.E1237K	KIF16B_uc002wpe.1_Intron|KIF16B_uc002wpf.1_Missense_Mutation_p.E578K|KIF16B_uc010gch.1_Missense_Mutation_p.E1186K	NM_024704	NP_078980	Q96L93	KI16B_HUMAN	kinesin-like motor protein C20orf23	1237	PX.				cell communication|early endosome to late endosome transport|endoderm development|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|formation of primary germ layer|Golgi to endosome transport|microtubule-based movement|receptor catabolic process|regulation of receptor recycling	early endosome membrane|microtubule	ATP binding|phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3,4-bisphosphate binding|phosphatidylinositol-3,5-bisphosphate binding|phosphatidylinositol-3-phosphate binding|plus-end-directed microtubule motor activity			skin(2)|large_intestine(1)|central_nervous_system(1)|lung(1)|breast(1)|ovary(1)|kidney(1)	8						TAACTTACCTCTGCATACTTT	0.348													53	136	---	---	---	---	PASS
KIF16B	55614	broad.mit.edu	37	20	16316574	16316574	+	Silent	SNP	T	G	G			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:16316574T>G	uc002wpg.1	-	24	3866	c.3708A>C	c.(3706-3708)GCA>GCC	p.A1236A	KIF16B_uc002wpe.1_Intron|KIF16B_uc002wpf.1_Silent_p.A577A|KIF16B_uc010gch.1_Silent_p.A1185A	NM_024704	NP_078980	Q96L93	KI16B_HUMAN	kinesin-like motor protein C20orf23	1236	PX.				cell communication|early endosome to late endosome transport|endoderm development|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|formation of primary germ layer|Golgi to endosome transport|microtubule-based movement|receptor catabolic process|regulation of receptor recycling	early endosome membrane|microtubule	ATP binding|phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3,4-bisphosphate binding|phosphatidylinositol-3,5-bisphosphate binding|phosphatidylinositol-3-phosphate binding|plus-end-directed microtubule motor activity			skin(2)|large_intestine(1)|central_nervous_system(1)|lung(1)|breast(1)|ovary(1)|kidney(1)	8						AACTTACCTCTGCATACTTTA	0.343													53	138	---	---	---	---	PASS
GGT7	2686	broad.mit.edu	37	20	33433135	33433135	+	Missense_Mutation	SNP	A	C	C			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33433135A>C	uc002xay.2	-	15	2028	c.1985T>G	c.(1984-1986)CTG>CGG	p.L662R	GGT7_uc010gex.2_RNA	NM_178026	NP_821158	Q9UJ14	GGT7_HUMAN	gamma-glutamyltransferase 7	662	Extracellular (Potential).				glutathione biosynthetic process	integral to membrane	acyltransferase activity|gamma-glutamyltransferase activity			ovary(1)	1						GCTGCTCTACAGGATGGTGGC	0.602													13	25	---	---	---	---	PASS
BRWD1	54014	broad.mit.edu	37	21	40636400	40636400	+	Missense_Mutation	SNP	C	G	G			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:40636400C>G	uc002yxk.1	-	17	2010	c.1871G>C	c.(1870-1872)GGC>GCC	p.G624A	BRWD1_uc010goc.1_5'UTR|BRWD1_uc002yxl.2_Missense_Mutation_p.G624A|BRWD1_uc010goe.1_RNA|BRWD1_uc010gof.1_Missense_Mutation_p.G77A|BRWD1_uc010gog.1_RNA|BRWD1_uc010goh.1_RNA|BRWD1_uc010goi.1_Missense_Mutation_p.G344A	NM_018963	NP_061836	Q9NSI6	BRWD1_HUMAN	bromodomain and WD repeat domain containing 1	624					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus				skin(3)|ovary(1)	4		Prostate(19;8.44e-08)|all_epithelial(19;0.223)				TGCCACATAGCCCAGCTGTGG	0.294													30	83	---	---	---	---	PASS
INPP5J	27124	broad.mit.edu	37	22	31524540	31524540	+	Missense_Mutation	SNP	G	A	A			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:31524540G>A	uc003aju.3	+	9	2185	c.2093G>A	c.(2092-2094)CGG>CAG	p.R698Q	INPP5J_uc003ajv.3_Missense_Mutation_p.R331Q|INPP5J_uc003ajs.3_Missense_Mutation_p.R331Q|INPP5J_uc011alk.1_Missense_Mutation_p.R631Q|INPP5J_uc010gwg.2_Missense_Mutation_p.R263Q|INPP5J_uc003ajw.2_Missense_Mutation_p.R134Q|INPP5J_uc003ajt.3_Missense_Mutation_p.R330Q|INPP5J_uc003ajx.2_Missense_Mutation_p.R63Q|INPP5J_uc003ajy.2_Missense_Mutation_p.R63Q|INPP5J_uc003ajz.2_Missense_Mutation_p.R138Q	NM_001002837	NP_001002837	Q15735	PI5PA_HUMAN	phosphatidylinositol (4,5) bisphosphate	698	Catalytic (Potential).					cytoplasm|ruffle	inositol 1,3,4,5-tetrakisphosphate 5-phosphatase activity|inositol-1,4,5-trisphosphate 5-phosphatase activity|inositol-polyphosphate 5-phosphatase activity|SH3 domain binding			skin(1)	1						CCCTCAGGACGGAAGAGCCAC	0.612													3	45	---	---	---	---	PASS
TOM1	10043	broad.mit.edu	37	22	35719146	35719146	+	Silent	SNP	T	C	C			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:35719146T>C	uc003ann.2	+	4	467	c.342T>C	c.(340-342)CAT>CAC	p.H114H	TOM1_uc011ami.1_Silent_p.H81H|TOM1_uc011amj.1_5'UTR|TOM1_uc003ans.2_5'UTR|TOM1_uc011amk.1_Silent_p.H76H|TOM1_uc003anp.2_Silent_p.H114H|TOM1_uc011aml.1_Silent_p.H114H|TOM1_uc003ano.2_RNA|TOM1_uc003anq.2_Silent_p.H108H|TOM1_uc003anr.2_5'UTR	NM_005488	NP_005479	O60784	TOM1_HUMAN	target of myb1 isoform 1	114	VHS.				endocytosis|endosome transport|intracellular protein transport	cytosol|early endosome|membrane	protein binding			ovary(1)	1						CCATCGTGCATGACAAAGTGC	0.622													9	28	---	---	---	---	PASS
TNRC6B	23112	broad.mit.edu	37	22	40662297	40662297	+	Missense_Mutation	SNP	A	C	C			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:40662297A>C	uc011aor.1	+	5	2274	c.2063A>C	c.(2062-2064)GAG>GCG	p.E688A	TNRC6B_uc003aym.2_Intron|TNRC6B_uc003ayn.3_Missense_Mutation_p.E688A|TNRC6B_uc003ayo.2_Missense_Mutation_p.E492A	NM_001162501	NP_001155973	Q9UPQ9	TNR6B_HUMAN	trinucleotide repeat containing 6B isoform 1	688					gene silencing by RNA|regulation of translation	cytoplasmic mRNA processing body	nucleotide binding|RNA binding				0						GCCTCTACAGAGTGGAAAGAC	0.537													3	6	---	---	---	---	PASS
TCF20	6942	broad.mit.edu	37	22	42607966	42607966	+	Missense_Mutation	SNP	G	T	T			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42607966G>T	uc003bcj.1	-	1	3480	c.3346C>A	c.(3346-3348)CAG>AAG	p.Q1116K	TCF20_uc003bck.1_Missense_Mutation_p.Q1116K|TCF20_uc003bnt.2_Missense_Mutation_p.Q1116K	NM_005650	NP_005641	Q9UGU0	TCF20_HUMAN	transcription factor 20 isoform 1	1116					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|transcription coactivator activity|zinc ion binding			ovary(4)|skin(1)	5						GGCCCCTCCTGCCTGTGCTGT	0.512													76	115	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	5979	5979	+	5'UTR	SNP	G	A	A			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:5979G>A	uc011mfh.1	+	1					uc004cou.3_5'Flank|uc011mfi.1_5'Flank					Homo sapiens cDNA: FLJ22894 fis, clone KAT04907.																		TCGGCGCATGAGCTGGAGTCC	0.502													2	3	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	9344	9344	+	RNA	SNP	C	T	T			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:9344C>T	uc011mfi.1	+	1		c.682C>T			uc004cov.3_5'Flank|uc004cow.1_5'Flank|uc004cox.3_5'Flank					Homo sapiens mRNA for OK/SW-CL.16, complete cds.																		CTCATACTAGGCCTACTAACC	0.532													2	1	---	---	---	---	PASS
TARDBP	23435	broad.mit.edu	37	1	11077259	11077259	+	Intron	DEL	C	-	-			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11077259delC	uc001art.2	+						TARDBP_uc010oap.1_Intron	NM_007375	NP_031401	Q13148	TADBP_HUMAN	TAR DNA binding protein						3'-UTR-mediated mRNA stabilization|cell death|mRNA processing|negative regulation by host of viral transcription|RNA splicing|transcription from RNA polymerase II promoter	nucleus	double-stranded DNA binding|mRNA 3'-UTR binding|nucleotide binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(2)	2	Ovarian(185;0.249)	Lung NSC(185;1.04e-05)|all_lung(284;1.31e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00262)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.0578)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.37e-07)|COAD - Colon adenocarcinoma(227;7.38e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000299)|Kidney(185;0.000754)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|READ - Rectum adenocarcinoma(331;0.0487)		TGTTACCtttctttttttttt	0.025													6	3	---	---	---	---	
PHACTR4	65979	broad.mit.edu	37	1	28733759	28733760	+	Intron	INS	-	A	A			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:28733759_28733760insA	uc001bpw.2	+						PHACTR4_uc001bpu.2_Intron|PHACTR4_uc001bpv.1_Intron|PHACTR4_uc001bpx.2_Intron	NM_001048183	NP_001041648	Q8IZ21	PHAR4_HUMAN	phosphatase and actin regulator 4 isoform 1								actin binding|protein phosphatase inhibitor activity				0		Colorectal(325;3.46e-05)|Lung NSC(340;4.37e-05)|all_lung(284;7.01e-05)|Renal(390;0.00121)|Breast(348;0.00345)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0261)		OV - Ovarian serous cystadenocarcinoma(117;1.35e-21)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00273)|STAD - Stomach adenocarcinoma(196;0.00299)|BRCA - Breast invasive adenocarcinoma(304;0.0144)|READ - Rectum adenocarcinoma(331;0.0649)		gatcctgtctcaaaaaaaaaaa	0.089													5	3	---	---	---	---	
SLC35D1	23169	broad.mit.edu	37	1	67487406	67487407	+	Intron	DEL	AG	-	-	rs71711790		TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:67487406_67487407delAG	uc001ddk.2	-						SLC35D1_uc010oph.1_Intron	NM_015139	NP_055954	Q9NTN3	S35D1_HUMAN	solute carrier family 35 (UDP-glucuronic						chondroitin sulfate biosynthetic process|UDP-glucuronate biosynthetic process|xenobiotic metabolic process	integral to endoplasmic reticulum membrane	UDP-glucuronic acid transmembrane transporter activity|UDP-N-acetylgalactosamine transmembrane transporter activity				0					Lorazepam(DB00186)	acacagacacagacacacacac	0.248													2	4	---	---	---	---	
LRRC39	127495	broad.mit.edu	37	1	100625161	100625162	+	Intron	DEL	CC	-	-	rs7521791		TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:100625161_100625162delCC	uc001dsw.1	-						LRRC39_uc001dsx.1_Intron|LRRC39_uc001dsy.1_Intron|LRRC39_uc001dsz.1_Intron	NM_144620	NP_653221	Q96DD0	LRC39_HUMAN	leucine rich repeat containing 39											ovary(2)|skin(1)	3		all_epithelial(167;0.000542)|all_lung(203;0.0154)|Lung NSC(277;0.0155)		Epithelial(280;0.0826)|all cancers(265;0.135)|COAD - Colon adenocarcinoma(174;0.148)|Lung(183;0.195)		tttttcttttcctttttttttt	0.272													6	3	---	---	---	---	
RC3H1	149041	broad.mit.edu	37	1	173952457	173952457	+	Intron	DEL	A	-	-			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:173952457delA	uc001gju.3	-						RC3H1_uc010pms.1_Intron|RC3H1_uc001gjv.2_Intron|RC3H1_uc010pmt.1_Intron	NM_172071	NP_742068	Q5TC82	RC3H1_HUMAN	roquin						cytoplasmic mRNA processing body assembly|negative regulation of activated T cell proliferation|negative regulation of B cell proliferation|negative regulation of germinal center formation|negative regulation of T-helper cell differentiation|nuclear-transcribed mRNA catabolic process|regulation of mRNA stability|regulation of T cell receptor signaling pathway	cytoplasmic mRNA processing body|stress granule	mRNA 3'-UTR binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(2)	2						TGGTAACAATAAAATACTGCA	0.313													32	24	---	---	---	---	
TOR1AIP1	26092	broad.mit.edu	37	1	179853652	179853653	+	Intron	DEL	AA	-	-	rs3831228		TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:179853652_179853653delAA	uc001gnq.2	+						TOR1AIP1_uc001gnp.1_Intron	NM_015602	NP_056417	Q5JTV8	TOIP1_HUMAN	lamina-associated polypeptide 1B							integral to membrane|nuclear inner membrane				breast(1)|central_nervous_system(1)	2						ATTCTGTCTCAAGAGGAGTTCT	0.292													2	4	---	---	---	---	
C1orf31	388753	broad.mit.edu	37	1	234519319	234519320	+	Intron	INS	-	ACAC	ACAC	rs141657444	by1000genomes	TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:234519319_234519320insACAC	uc001hwc.2	+						C1orf31_uc001hwb.2_Intron	NM_001012985	NP_001013003	Q5JTJ3	CA031_HUMAN	hypothetical protein LOC388753							mitochondrion	cytochrome-c oxidase activity				0	Ovarian(103;0.0339)	all_cancers(173;0.241)|Prostate(94;0.0353)	OV - Ovarian serous cystadenocarcinoma(106;0.000263)			AGTTACAGCTGacacacacaca	0.124													5	6	---	---	---	---	
SPTBN1	6711	broad.mit.edu	37	2	54712329	54712330	+	Intron	DEL	CT	-	-			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:54712329_54712330delCT	uc002rxu.2	+						SPTBN1_uc002rxv.1_Intron	NM_003128	NP_003119	Q01082	SPTB2_HUMAN	spectrin, beta, non-erythrocytic 1 isoform 1						actin filament capping|axon guidance	cytosol|nucleolus|plasma membrane|sarcomere|spectrin	actin binding|calmodulin binding|protein binding|structural constituent of cytoskeleton			ovary(3)|breast(2)|central_nervous_system(2)|skin(1)	8			Lung(47;0.24)			ctccgtctccctctcggtctcc	0.074													4	3	---	---	---	---	
SNRNP27	11017	broad.mit.edu	37	2	70123808	70123809	+	Intron	INS	-	T	T	rs71397375		TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:70123808_70123809insT	uc002sfw.2	+						SNRNP27_uc002sfv.2_Intron|SNRNP27_uc002sfx.2_Intron	NM_006857	NP_006848	Q8WVK2	SNR27_HUMAN	small nuclear ribonucleoprotein 27kDa						mRNA processing|RNA splicing	nucleus	nucleic acid binding				0						Gttttttttggttttttttttt	0.109													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	89399858	89399859	+	Intron	INS	-	AA	AA			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:89399858_89399859insAA	uc010ytr.1	-						uc002stl.2_Intron					Parts of antibodies, mostly variable regions.																		GATTCCTGCACAGTCTGACCAG	0.569													5	3	---	---	---	---	
ZNF2	7549	broad.mit.edu	37	2	95846644	95846644	+	Intron	DEL	T	-	-			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:95846644delT	uc002suf.2	+						ZNF2_uc002sug.2_Intron|ZNF2_uc010yue.1_Intron|ZNF2_uc010fhs.2_Intron	NM_021088	NP_066574	Q9BSG1	ZNF2_HUMAN	zinc finger protein 2 isoform a						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Ovarian(717;0.00768)		READ - Rectum adenocarcinoma(193;0.0222)		CATTCTCCTGTTTTCTGAGGT	0.483													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	113104393	113104394	+	IGR	INS	-	A	A	rs149346840	by1000genomes	TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:113104393_113104394insA								ZC3H6 (6753 upstream) : RGPD8 (21572 downstream)																							ccatcaccatcgcaccaccatc	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	139045439	139045442	+	3'UTR	DEL	TTTT	-	-	rs78349226		TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:139045439_139045442delTTTT	uc010zbk.1	-	1										SubName: Full=cDNA, FLJ79100, highly similar to 14-3-3 protein epsilon (14-3-3E);																		TTGAAAACTGtttttttaaaaaaa	0.377													5	3	---	---	---	---	
SPC25	57405	broad.mit.edu	37	2	169745615	169745616	+	Intron	DEL	AC	-	-			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:169745615_169745616delAC	uc002uel.2	-							NM_020675	NP_065726	Q9HBM1	SPC25_HUMAN	spindle pole body component 25						cell division|chromosome segregation|mitotic prometaphase|mitotic spindle organization	condensed chromosome kinetochore|cytosol|Ndc80 complex|nucleus	protein binding			central_nervous_system(1)	1						atatatatataCACACACACAA	0.153													5	3	---	---	---	---	
RAPGEF4	11069	broad.mit.edu	37	2	173659600	173659600	+	Intron	DEL	A	-	-			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:173659600delA	uc002uhv.3	+						RAPGEF4_uc002uhu.2_Intron|RAPGEF4_uc010fqn.2_Intron	NM_007023	NP_008954	Q8WZA2	RPGF4_HUMAN	Rap guanine nucleotide exchange factor (GEF) 4						blood coagulation|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|regulation of insulin secretion|regulation of protein phosphorylation|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cAMP-dependent protein kinase complex|membrane fraction|plasma membrane	cAMP binding|cAMP-dependent protein kinase regulator activity|Ras GTPase binding|Ras guanyl-nucleotide exchange factor activity			large_intestine(2)|skin(2)|kidney(1)|central_nervous_system(1)	6			OV - Ovarian serous cystadenocarcinoma(117;0.194)			ATTAGCCCAGAAATACCTATA	0.368													43	20	---	---	---	---	
RFT1	91869	broad.mit.edu	37	3	53139428	53139431	+	Intron	DEL	CCCG	-	-	rs60969367		TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:53139428_53139431delCCCG	uc003dgj.2	-						RFT1_uc003dgk.2_Intron	NM_052859	NP_443091	Q96AA3	RFT1_HUMAN	RFT1 homolog						carbohydrate transport|dolichol-linked oligosaccharide biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine	integral to membrane	lipid transporter activity			skin(1)	1				BRCA - Breast invasive adenocarcinoma(193;6.98e-05)|Kidney(197;0.0017)|KIRC - Kidney renal clear cell carcinoma(197;0.00192)|OV - Ovarian serous cystadenocarcinoma(275;0.104)		agactctatcCCCGCCCCCCCCCC	0.270													5	3	---	---	---	---	
ROBO2	6092	broad.mit.edu	37	3	77459846	77459847	+	Intron	INS	-	CTG	CTG			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:77459846_77459847insCTG	uc003dpy.3	+						ROBO2_uc003dpz.2_Intron|ROBO2_uc011bgj.1_Intron|ROBO2_uc011bgk.1_Intron	NM_002942	NP_002933	Q9HCK4	ROBO2_HUMAN	roundabout, axon guidance receptor, homolog 2						apoptosis involved in luteolysis|axon midline choice point recognition|cellular response to hormone stimulus|homophilic cell adhesion|metanephros development|negative regulation of negative chemotaxis|negative regulation of synaptogenesis|olfactory bulb interneuron development|positive regulation of axonogenesis|retinal ganglion cell axon guidance|ureteric bud development	axolemma|cell surface|integral to membrane	axon guidance receptor activity|identical protein binding			lung(5)|skin(3)|ovary(1)|large_intestine(1)|liver(1)	11				Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)		tcttcctcctcctcttcctcct	0.000													4	2	---	---	---	---	
KALRN	8997	broad.mit.edu	37	3	124418565	124418566	+	Intron	INS	-	TT	TT			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:124418565_124418566insTT	uc003ehg.2	+						KALRN_uc003ehk.2_Intron	NM_001024660	NP_001019831	O60229	KALRN_HUMAN	kalirin, RhoGEF kinase isoform 1						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|nervous system development|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|vesicle-mediated transport	actin cytoskeleton|cytosol	ATP binding|GTPase activator activity|metal ion binding|protein binding|protein serine/threonine kinase activity|Rho guanyl-nucleotide exchange factor activity			large_intestine(2)|ovary(2)|central_nervous_system(1)|skin(1)	6						AACTACCATAGTTAGCCTACAG	0.426													9	4	---	---	---	---	
CPA3	1359	broad.mit.edu	37	3	148586470	148586470	+	Intron	DEL	A	-	-			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:148586470delA	uc003ewm.2	+							NM_001870	NP_001861	P15088	CBPA3_HUMAN	carboxypeptidase A3 precursor						proteolysis	stored secretory granule|transport vesicle	metallocarboxypeptidase activity|zinc ion binding			breast(1)|skin(1)	2			LUSC - Lung squamous cell carcinoma(72;0.0934)|Lung(72;0.115)			TGAAGTCCTTAAAAAAAAAAA	0.318													4	2	---	---	---	---	
YEATS2	55689	broad.mit.edu	37	3	183521660	183521660	+	Intron	DEL	A	-	-			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183521660delA	uc003fly.2	+							NM_018023	NP_060493	Q9ULM3	YETS2_HUMAN	YEATS domain containing 2						histone H3 acetylation|negative regulation of transcription from RNA polymerase II promoter	Ada2/Gcn5/Ada3 transcription activator complex	TBP-class protein binding			ovary(3)|large_intestine(1)	4	all_cancers(143;6.55e-10)|Ovarian(172;0.0303)		all cancers(12;2.38e-42)|Epithelial(37;1.9e-36)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)			TTTTTTCTTTAAAAAAAAAAA	0.328													11	5	---	---	---	---	
TBCK	93627	broad.mit.edu	37	4	107092559	107092560	+	Intron	INS	-	A	A	rs142249370	by1000genomes	TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:107092559_107092560insA	uc010ilv.2	-						TBCK_uc003hyb.2_Intron|TBCK_uc003hye.2_Intron|TBCK_uc003hyc.2_Intron|TBCK_uc003hyd.2_Intron|TBCK_uc003hyf.2_Intron	NM_001163435	NP_001156907	Q8TEA7	TBCK_HUMAN	TBC domain-containing protein kinase-like							intracellular	Rab GTPase activator activity			large_intestine(2)|upper_aerodigestive_tract(1)|stomach(1)|ovary(1)	5						AAAATGTCAGTAAAAAAAACAA	0.233													8	5	---	---	---	---	
ADAMTS12	81792	broad.mit.edu	37	5	33751536	33751536	+	Frame_Shift_Del	DEL	T	-	-			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:33751536delT	uc003jia.1	-	3	770	c.607delA	c.(607-609)ACCfs	p.T203fs	ADAMTS12_uc010iuq.1_Frame_Shift_Del_p.T203fs|ADAMTS12_uc003jib.1_Frame_Shift_Del_p.T203fs	NM_030955	NP_112217	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1	203					proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)	9						GGCTCCTTGGTTTCTGGAACT	0.448										HNSCC(64;0.19)			152	115	---	---	---	---	
CCDC125	202243	broad.mit.edu	37	5	68599933	68599934	+	Intron	DEL	TT	-	-	rs35098133		TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:68599933_68599934delTT	uc003jvv.1	-						CCDC125_uc003jvx.1_Intron|CCDC125_uc003jvy.1_Intron|CCDC125_uc003jvw.2_Intron	NM_176816	NP_789786	Q86Z20	CC125_HUMAN	coiled-coil domain containing 125							cytoplasm					0		Lung NSC(167;7.26e-05)|Prostate(74;0.0143)|Ovarian(174;0.0448)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;2.2e-56)|Epithelial(20;2.31e-52)|all cancers(19;5.85e-48)|Lung(70;0.0183)		GTGGTAAGAAtttttttttttt	0.129													4	2	---	---	---	---	
AGGF1	55109	broad.mit.edu	37	5	76335241	76335245	+	Intron	DEL	GAAAA	-	-			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:76335241_76335245delGAAAA	uc003ket.2	+						AGGF1_uc003keu.1_Intron	NM_018046	NP_060516	Q8N302	AGGF1_HUMAN	angiogenic factor VG5Q						angiogenesis|cell adhesion|positive regulation of angiogenesis|positive regulation of endothelial cell proliferation|RNA processing|vasculogenesis	extracellular region|perinuclear region of cytoplasm	eukaryotic cell surface binding|nucleic acid binding|protein binding			ovary(1)|central_nervous_system(1)|skin(1)	3		all_lung(232;0.000414)|Lung NSC(167;0.0011)|Ovarian(174;0.0129)|Prostate(461;0.11)		OV - Ovarian serous cystadenocarcinoma(54;4.51e-51)|Epithelial(54;2.2e-45)|all cancers(79;6.68e-41)		ATTGTCTTCTGAAAATACTATAGTT	0.239													9	9	---	---	---	---	
HAVCR1	26762	broad.mit.edu	37	5	156469453	156469453	+	Intron	DEL	A	-	-	rs71741602		TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:156469453delA	uc010jij.1	-						HAVCR1_uc011ddl.1_Intron|HAVCR1_uc003lwi.2_Intron	NM_001099414	NP_001092884	Q96D42	HAVR1_HUMAN	hepatitis A virus cellular receptor 1						interspecies interaction between organisms	integral to membrane	receptor activity			ovary(1)|skin(1)	2	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.0999)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			actccgtctcaaaaaaaaaaa	0.100													5	3	---	---	---	---	
KLHL31	401265	broad.mit.edu	37	6	53516197	53516198	+	3'UTR	INS	-	AAAAAAA	AAAAAAA	rs67397082		TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:53516197_53516198insAAAAAAA	uc003pcb.3	-	3					uc003pcc.1_5'Flank	NM_001003760	NP_001003760	Q9H511	KLH31_HUMAN	kelch repeat and BTB (POZ) domain containing 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent					ovary(1)	1	Lung NSC(77;0.0158)					TGTATTTTGCTaaaaaaaaaaa	0.396											OREG0017507	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
ZDHHC14	79683	broad.mit.edu	37	6	158074544	158074544	+	Intron	DEL	T	-	-			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:158074544delT	uc003qqt.2	+						ZDHHC14_uc003qqs.2_Intron|ZDHHC14_uc010kjn.2_Intron	NM_024630	NP_078906	Q8IZN3	ZDH14_HUMAN	zinc finger, DHHC-type containing 14 isoform 1							integral to membrane	acyltransferase activity|zinc ion binding			ovary(1)|skin(1)	2		Breast(66;0.00586)|Ovarian(120;0.123)		OV - Ovarian serous cystadenocarcinoma(65;2.9e-17)|BRCA - Breast invasive adenocarcinoma(81;5.8e-05)		CTGTGTTTTCTTTTCTCTCGC	0.587													52	29	---	---	---	---	
ABCB5	340273	broad.mit.edu	37	7	20697950	20697951	+	Intron	INS	-	T	T	rs10643091		TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:20697950_20697951insT	uc003suw.3	+						ABCB5_uc010kuh.2_Intron|ABCB5_uc003suv.3_Intron|ABCB5_uc011jyi.1_Intron	NM_178559	NP_848654	Q2M3G0	ABCB5_HUMAN	ATP-binding cassette, sub-family B, member 5						regulation of membrane potential	apical plasma membrane|Golgi membrane|integral to plasma membrane|intercellular canaliculus	ATP binding|ATPase activity, coupled to transmembrane movement of substances|efflux transmembrane transporter activity			skin(2)|large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)|ovary(1)|pancreas(1)	6						TCTTTGGGCTCTTTTTTTTTTT	0.282													4	3	---	---	---	---	
CCDC146	57639	broad.mit.edu	37	7	76796901	76796901	+	Intron	DEL	A	-	-			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:76796901delA	uc003uga.2	+						CCDC146_uc003ufz.1_Intron	NM_020879	NP_065930	Q8IYE0	CC146_HUMAN	coiled-coil domain containing 146											ovary(1)|central_nervous_system(1)	2		all_cancers(73;0.128)|all_lung(88;0.0986)|all_epithelial(88;0.163)|Myeloproliferative disorder(862;0.205)				GTTTATTTTTATTATTTTCCA	0.264													4	3	---	---	---	---	
ORC5L	5001	broad.mit.edu	37	7	103767525	103767525	+	Intron	DEL	T	-	-	rs74901297		TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:103767525delT	uc003vcb.2	-						ORC5L_uc011klp.1_Intron	NM_002553	NP_002544	O43913	ORC5_HUMAN	origin recognition complex subunit 5 isoform 1						cell cycle checkpoint|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle	cytoplasm|nuclear origin of replication recognition complex|nucleoplasm	ATP binding|DNA replication origin binding|identical protein binding				0						aatattttaattttttttttt	0.289													4	2	---	---	---	---	
EPHA1	2041	broad.mit.edu	37	7	143096499	143096499	+	Frame_Shift_Del	DEL	A	-	-			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:143096499delA	uc003wcz.2	-	5	930	c.843delT	c.(841-843)CCTfs	p.P281fs		NM_005232	NP_005223	P21709	EPHA1_HUMAN	ephrin receptor EphA1 precursor	281	Extracellular (Potential).|Cys-rich.					integral to plasma membrane	ATP binding|ephrin receptor activity			ovary(3)|lung(1)|breast(1)	5	Melanoma(164;0.205)	Myeloproliferative disorder(862;0.0255)				AGGAGCCGCTAGGGCAGGCTG	0.577													40	18	---	---	---	---	
TMEM66	51669	broad.mit.edu	37	8	29923704	29923704	+	Intron	DEL	T	-	-			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:29923704delT	uc003xhs.2	-						TMEM66_uc003xht.2_Intron|TMEM66_uc003xhu.2_Intron|TMEM66_uc003xhv.2_Intron	NM_016127	NP_057211	Q96BY9	TMM66_HUMAN	transmembrane protein 66 precursor							integral to membrane					0				KIRC - Kidney renal clear cell carcinoma(542;0.0993)|Kidney(114;0.119)		GTGGCTATAATTTTTAAATAC	0.358													52	24	---	---	---	---	
KIAA0146	23514	broad.mit.edu	37	8	48614647	48614660	+	Intron	DEL	TCTCTCTCTCTCTT	-	-	rs35588989	by1000genomes	TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:48614647_48614660delTCTCTCTCTCTCTT	uc003xqd.2	+						KIAA0146_uc011ldb.1_Intron|KIAA0146_uc010lxs.2_Intron|KIAA0146_uc011ldc.1_Intron|KIAA0146_uc011ldd.1_Intron|KIAA0146_uc003xqe.2_Intron|KIAA0146_uc003xqf.2_Intron|KIAA0146_uc011lde.1_Intron|KIAA0146_uc010lxt.2_Intron|KIAA0146_uc011ldf.1_Intron|KIAA0146_uc011ldg.1_Intron	NM_001080394	NP_001073863	Q14159	K0146_HUMAN	hypothetical protein LOC23514												0		Lung NSC(58;0.175)				tctctctctctctctctctctctTacacacacac	0.173													8	4	---	---	---	---	
FAM49B	51571	broad.mit.edu	37	8	130867637	130867637	+	Intron	DEL	A	-	-			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:130867637delA	uc003yss.2	-						FAM49B_uc003yst.2_Intron|FAM49B_uc003ysu.2_Intron|FAM49B_uc003ysv.2_Intron|FAM49B_uc003ysw.2_Intron|FAM49B_uc003ysx.2_Intron|FAM49B_uc003ysy.1_Intron	NM_016623	NP_057707	Q9NUQ9	FA49B_HUMAN	hypothetical protein LOC51571												0	Ovarian(5;0.000567)|Esophageal squamous(12;0.00693)|Acute lymphoblastic leukemia(118;0.155)		LUAD - Lung adenocarcinoma(14;0.0989)			gctctgcctcaaaaaaaaaaa	0.149													4	2	---	---	---	---	
KIAA1797	54914	broad.mit.edu	37	9	20995373	20995374	+	Intron	INS	-	C	C	rs150489586		TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:20995373_20995374insC	uc003zog.1	+						KIAA1797_uc003zoh.1_Intron	NM_017794	NP_060264	Q5VW36	K1797_HUMAN	hypothetical protein LOC54914							integral to membrane	binding			ovary(8)|breast(1)|kidney(1)	10				GBM - Glioblastoma multiforme(3;2.1e-125)|Lung(42;2.76e-14)|LUSC - Lung squamous cell carcinoma(42;1.99e-11)		AAAAAAAAAAAAAACAACTTTC	0.267													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	83063970	83063977	+	IGR	DEL	AAGGAAGA	-	-	rs71991518		TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:83063970_83063977delAAGGAAGA								TLE4 (722313 upstream) : None (None downstream)																							ggaaggaaggaaggaagaaaggaaggaa	0.115													3	4	---	---	---	---	
FAM120A	23196	broad.mit.edu	37	9	96233827	96233828	+	Intron	INS	-	T	T			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:96233827_96233828insT	uc004atw.2	+						FAM120A_uc004atv.2_Intron|FAM120A_uc004atx.2_Intron|FAM120A_uc004aty.2_Intron	NM_014612	NP_055427	Q9NZB2	F120A_HUMAN	oxidative stress-associated Src activator							cytoplasm|plasma membrane	RNA binding				0						GCTTCGTATTATTTTTTGGCAT	0.342													13	6	---	---	---	---	
CEP110	11064	broad.mit.edu	37	9	123888337	123888337	+	Intron	DEL	T	-	-			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:123888337delT	uc004bkx.1	+						CEP110_uc004bky.1_Intron|CEP110_uc004bkz.1_Intron|CEP110_uc004bla.1_Intron	NM_007018	NP_008949	Q7Z7A1	CNTRL_HUMAN	centrosomal protein 110kDa						cell division|G2/M transition of mitotic cell cycle	centrosome|cytosol	protein binding				0						TATATGGTGATTTTTTTCTTT	0.299													5	3	---	---	---	---	
STOM	2040	broad.mit.edu	37	9	124111279	124111280	+	Intron	INS	-	A	A			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:124111279_124111280insA	uc004blh.2	-						STOM_uc011lyk.1_Intron|STOM_uc004bli.2_Intron	NM_004099	NP_004090	P27105	STOM_HUMAN	stomatin isoform a						protein homooligomerization	cytoskeleton|integral to plasma membrane|melanosome|membrane raft	protein binding				0				OV - Ovarian serous cystadenocarcinoma(323;0.00107)|GBM - Glioblastoma multiforme(294;0.0137)		TTACTATGAAGAAAAAAAAACG	0.351													6	3	---	---	---	---	
C9orf114	51490	broad.mit.edu	37	9	131590774	131590775	+	Intron	INS	-	A	A	rs35247950		TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131590774_131590775insA	uc004bwd.2	-						C9orf114_uc004bwe.2_Intron|C9orf114_uc010mym.2_Intron	NM_016390	NP_057474	Q5T280	CI114_HUMAN	hypothetical protein LOC51490												0						gactccatctcaaaaaaaaaaa	0.153													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	36597773	36597776	+	IGR	DEL	GGAA	-	-			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:36597773_36597776delGGAA								FZD8 (667411 upstream) : ANKRD30A (817009 downstream)																							aaggaaagagggaaggaaggaagg	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42680692	42680692	+	IGR	DEL	C	-	-			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42680692delC								None (None upstream) : LOC441666 (146623 downstream)																							TAGAGCACAGCCCCCTGCCCT	0.597													15	12	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	81632350	81632351	+	IGR	INS	-	CA	CA			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:81632350_81632351insCA								LOC650623 (183702 upstream) : MBL1P (32303 downstream)																							AAGCTGATATCcacacacacac	0.337													9	4	---	---	---	---	
GRIK4	2900	broad.mit.edu	37	11	120827331	120827332	+	Intron	INS	-	T	T			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:120827331_120827332insT	uc001pxn.2	+						GRIK4_uc009zav.1_Intron|GRIK4_uc009zaw.1_Intron|GRIK4_uc009zax.1_Intron	NM_014619	NP_055434	Q16099	GRIK4_HUMAN	glutamate receptor KA1 precursor						glutamate signaling pathway|synaptic transmission	cell junction|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity			ovary(2)|central_nervous_system(1)	3		Breast(109;0.000868)|Medulloblastoma(222;0.0453)|all_neural(223;0.116)|all_hematologic(192;0.21)		BRCA - Breast invasive adenocarcinoma(274;1.24e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.116)	L-Glutamic Acid(DB00142)	attttattttattttttttttg	0.114													4	2	---	---	---	---	
FOXRED1	55572	broad.mit.edu	37	11	126146195	126146195	+	Intron	DEL	T	-	-			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:126146195delT	uc001qdi.2	+						FOXRED1_uc010sbn.1_Intron|FOXRED1_uc010sbo.1_Intron|FOXRED1_uc010sbp.1_Intron|FOXRED1_uc010sbq.1_Intron|FOXRED1_uc001qdj.2_Intron|FOXRED1_uc010sbr.1_Intron|FOXRED1_uc001qdk.2_Intron	NM_017547	NP_060017	Q96CU9	FXRD1_HUMAN	FAD-dependent oxidoreductase domain containing							integral to membrane|mitochondrion	oxidoreductase activity|protein binding				0	all_hematologic(175;0.145)	Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.0739)|all_lung(97;0.0798)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0729)		tgtgtgtgtgtgtgtgtgtgt	0.483													4	2	---	---	---	---	
NCAPD3	23310	broad.mit.edu	37	11	134037240	134037241	+	Intron	INS	-	AGTT	AGTT	rs72311832		TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:134037240_134037241insAGTT	uc001qhd.1	-						NCAPD3_uc010scm.1_Intron|NCAPD3_uc009zda.1_Intron|NCAPD3_uc001qhc.1_Intron	NM_015261	NP_056076	P42695	CNDD3_HUMAN	non-SMC condensin II complex, subunit D3						cell division|mitotic chromosome condensation	nuclear centromeric heterochromatin|nuclear condensin complex	methylated histone residue binding			ovary(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)	5	all_hematologic(175;0.127)	all_cancers(12;1.68e-21)|all_epithelial(12;5.86e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000182)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;8.74e-10)|BRCA - Breast invasive adenocarcinoma(10;1e-08)|all cancers(11;1.46e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00345)|Lung(977;0.227)		GGCGCACACTCGTGAGATGAGC	0.589													4	5	---	---	---	---	
HIGD1C	613227	broad.mit.edu	37	12	51354692	51354693	+	Intron	INS	-	T	T	rs141832341	by1000genomes	TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51354692_51354693insT	uc010smw.1	+							NM_001109619	NP_001103089	A8MV81	HIG1C_HUMAN	HIG1 domain family, member 1C							integral to membrane					0						caaactcctggtctcacacgat	0.134													6	5	---	---	---	---	
RASSF3	283349	broad.mit.edu	37	12	65015997	65015997	+	Intron	DEL	T	-	-	rs35979189		TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:65015997delT	uc001ssd.2	+						RASSF3_uc009zqn.2_Intron|MIR548C_hsa-mir-548c|MI0003630_5'Flank	NM_178169	NP_835463	Q86WH2	RASF3_HUMAN	Ras association (RalGDS/AF-6) domain family						signal transduction	cytoplasm|microtubule	identical protein binding				0			Lung(2;0.00133)|LUAD - Lung adenocarcinoma(6;0.0665)|LUSC - Lung squamous cell carcinoma(43;0.132)	GBM - Glioblastoma multiforme(28;0.0611)		tgtccagctattttttttttt	0.000													4	2	---	---	---	---	
DNAH10	196385	broad.mit.edu	37	12	124315328	124315328	+	Intron	DEL	A	-	-			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124315328delA	uc001uft.3	+							NM_207437	NP_997320	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10						microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(3)|skin(2)|central_nervous_system(1)	6	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		catctatactaaaaaaaaaaa	0.139													8	5	---	---	---	---	
RXFP2	122042	broad.mit.edu	37	13	32360924	32360927	+	Intron	DEL	AAAT	-	-	rs3051238		TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:32360924_32360927delAAAT	uc001utt.2	+						RXFP2_uc010aba.2_Intron	NM_130806	NP_570718	Q8WXD0	RXFP2_HUMAN	relaxin/insulin-like family peptide receptor 2							integral to membrane|plasma membrane					0		Lung SC(185;0.0262)		all cancers(112;0.000559)|Epithelial(112;0.0017)|OV - Ovarian serous cystadenocarcinoma(117;0.0145)|BRCA - Breast invasive adenocarcinoma(63;0.0535)		ACTGAATGACAAATAAGCCTCATT	0.368													8	4	---	---	---	---	
DCT	1638	broad.mit.edu	37	13	95117701	95117702	+	Intron	INS	-	A	A	rs146133280	by1000genomes	TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:95117701_95117702insA	uc001vlv.3	-						DCT_uc010afh.2_Intron	NM_001922	NP_001913	P40126	TYRP2_HUMAN	dopachrome tautomerase isoform 1						epidermis development|melanin biosynthetic process from tyrosine	cytosol|integral to membrane|melanosome membrane|microsome	copper ion binding|dopachrome isomerase activity|oxidoreductase activity			ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	5	all_neural(89;0.0684)|Medulloblastoma(90;0.163)	all_cancers(2;3.71e-42)|all_epithelial(2;3.76e-31)|all_lung(2;5.16e-14)|Lung NSC(4;1.33e-13)|Breast(118;0.0013)|Hepatocellular(115;0.00886)|Renal(2;0.00988)		COAD - Colon adenocarcinoma(199;7.07e-05)|GBM - Glioblastoma multiforme(99;0.000472)		GATTTTGATATTTTTTTTTTAA	0.252													1	5	---	---	---	---	
STK24	8428	broad.mit.edu	37	13	99134321	99134321	+	Intron	DEL	A	-	-	rs34520150		TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:99134321delA	uc001vnm.1	-						STK24_uc001vnn.1_Intron|STK24_uc010tim.1_Intron	NM_003576	NP_003567	Q9Y6E0	STK24_HUMAN	serine/threonine kinase 24 isoform a						cellular component disassembly involved in apoptosis|signal transduction	cytosol|nucleoplasm	ATP binding|protein binding|protein serine/threonine kinase activity			ovary(1)|lung(1)	2	all_neural(89;0.0982)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		BRCA - Breast invasive adenocarcinoma(86;0.233)			actctatctcaaaaaaaaaaa	0.119													4	3	---	---	---	---	
COL4A1	1282	broad.mit.edu	37	13	110821801	110821804	+	Intron	DEL	AAGA	-	-	rs3832902		TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:110821801_110821804delAAGA	uc001vqw.3	-						COL4A1_uc010agl.2_Intron	NM_001845	NP_001836	P02462	CO4A1_HUMAN	alpha 1 type IV collagen preproprotein						angiogenesis|axon guidance		extracellular matrix structural constituent|platelet-derived growth factor binding			ovary(3)|lung(1)|central_nervous_system(1)|pancreas(1)	6	all_cancers(4;9.8e-13)|all_epithelial(4;9.66e-08)|all_lung(23;3.75e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00178)|all_neural(89;0.00459)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0604)	Breast(118;0.2)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.145)			GGTTACTGGCAAGAAAGAAAGAAA	0.230													3	3	---	---	---	---	
PCNX	22990	broad.mit.edu	37	14	71576040	71576040	+	Intron	DEL	T	-	-			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:71576040delT	uc001xmo.2	+						PCNX_uc010are.1_Intron|PCNX_uc010arf.1_Intron|PCNX_uc001xmp.2_Intron	NM_014982	NP_055797	Q96RV3	PCX1_HUMAN	pecanex-like 1							integral to membrane				ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(12;0.206)	all cancers(60;0.00835)|BRCA - Breast invasive adenocarcinoma(234;0.00951)|OV - Ovarian serous cystadenocarcinoma(108;0.0417)		GCTCTTAAGATTTTTTTTTTA	0.323													4	2	---	---	---	---	
ADAM6	8755	broad.mit.edu	37	14	106621957	106621958	+	Splice_Site	DEL	GT	-	-			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106621957_106621958delGT	uc010tyt.1	-	1114		c.25654_splice	c.e1114+1							Parts of antibodies, mostly variable regions.												0						GATACAGGGAGTTCCTGGAATT	0.530													118	91	---	---	---	---	
C15orf41	84529	broad.mit.edu	37	15	36983573	36983573	+	Intron	DEL	T	-	-			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:36983573delT	uc001zje.3	+						C15orf41_uc001zjd.2_Intron|C15orf41_uc010bbb.1_Intron|C15orf41_uc001zjf.2_Intron|C15orf41_uc010uci.1_Intron	NM_001130010	NP_001123482	Q9Y2V0	CO041_HUMAN	hypothetical protein LOC84529 isoform 1								protein binding			pancreas(1)	1		all_epithelial(112;3.06e-10)|Lung NSC(122;6.48e-08)|all_lung(180;8.31e-07)|Melanoma(134;0.222)		all cancers(64;1.76e-19)|GBM - Glioblastoma multiforme(113;5.03e-07)|BRCA - Breast invasive adenocarcinoma(123;0.11)		TATTTTCTGATTTTTTTTTTT	0.303													4	2	---	---	---	---	
RBPMS2	348093	broad.mit.edu	37	15	65042255	65042256	+	Intron	INS	-	A	A	rs66928243		TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65042255_65042256insA	uc002anq.2	-							NM_194272	NP_919248	Q6ZRY4	RBPS2_HUMAN	RNA binding protein with multiple splicing 2								nucleic acid binding|nucleotide binding				0						aactccatctcaaaaaaaaaaa	0.396													3	4	---	---	---	---	
SLC12A3	6559	broad.mit.edu	37	16	56904752	56904753	+	Intron	INS	-	T	T	rs71882529		TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:56904752_56904753insT	uc010ccm.2	+						SLC12A3_uc002ekd.3_Intron|SLC12A3_uc010ccn.2_Intron	NM_001126108	NP_001119580	P55017	S12A3_HUMAN	solute carrier family 12, member 3 isoform 3						sodium ion transmembrane transport	apical plasma membrane|integral to plasma membrane|membrane fraction	sodium:chloride symporter activity			ovary(2)|breast(1)	3					Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Chlorothiazide(DB00880)|Diazoxide(DB01119)|Hydrochlorothiazide(DB00999)|Metolazone(DB00524)|Polythiazide(DB01324)|Quinethazone(DB01325)	tttttcttttcttttttttttt	0.292													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	18304008	18304008	+	5'Flank	DEL	G	-	-			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18304008delG	uc010vxw.1	-						uc002gto.2_5'Flank					DQ589132																		CTGGACGCCTGGGGTGGCCAC	0.592													7	4	---	---	---	---	
MBTD1	54799	broad.mit.edu	37	17	49270644	49270644	+	Intron	DEL	T	-	-	rs66924763		TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:49270644delT	uc002itr.3	-						MBTD1_uc002itp.3_Intron|MBTD1_uc002itq.3_Intron	NM_017643	NP_060113	Q05BQ5	MBTD1_HUMAN	mbt domain containing 1						chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(2)	2			BRCA - Breast invasive adenocarcinoma(22;1.54e-08)			AAAGAAAATATTTATATTGTT	0.244													3	4	---	---	---	---	
CLTC	1213	broad.mit.edu	37	17	57741929	57741929	+	Intron	DEL	G	-	-	rs76363283		TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:57741929delG	uc002ixq.1	+						CLTC_uc002ixp.2_Intron|CLTC_uc002ixr.1_Intron	NM_004859	NP_004850	Q00610	CLH1_HUMAN	clathrin heavy chain 1						axon guidance|epidermal growth factor receptor signaling pathway|intracellular protein transport|mitosis|negative regulation of epidermal growth factor receptor signaling pathway|nerve growth factor receptor signaling pathway|post-Golgi vesicle-mediated transport|receptor internalization|transferrin transport	clathrin coat of coated pit|clathrin coat of trans-Golgi network vesicle|cytosol|melanosome|spindle	protein binding|structural molecule activity		CLTC/ALK(44)|CLTC/TFE3(2)	haematopoietic_and_lymphoid_tissue(33)|soft_tissue(11)|kidney(2)|ovary(1)|breast(1)	48	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)					aaaaaaaaaagaaaagaaaag	0.139			T	ALK|TFE3	ALCL|renal 								4	2	---	---	---	---	
HEATR6	63897	broad.mit.edu	37	17	58137627	58137628	+	Intron	INS	-	A	A	rs146546774	by1000genomes	TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:58137627_58137628insA	uc002iyk.1	-						HEATR6_uc010ddk.1_Intron|HEATR6_uc010wos.1_Intron	NM_022070	NP_071353	Q6AI08	HEAT6_HUMAN	HEAT repeat containing 6								binding			ovary(1)|skin(1)	2	all_cancers(5;2.25e-13)|Breast(5;4.84e-25)|all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		BRCA - Breast invasive adenocarcinoma(1;5.93e-19)|Epithelial(12;7.59e-12)|all cancers(12;1.26e-10)			GTCCCACACCTAAAAAAAAATC	0.173													4	2	---	---	---	---	
RPTOR	57521	broad.mit.edu	37	17	78674552	78674554	+	Intron	DEL	TGA	-	-	rs113318500		TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78674552_78674554delTGA	uc002jyt.1	+						RPTOR_uc002jys.2_Intron|RPTOR_uc010wuf.1_Intron|RPTOR_uc010wug.1_Intron	NM_020761	NP_065812	Q8N122	RPTOR_HUMAN	raptor isoform 1						cell cycle arrest|cell growth|cellular response to amino acid stimulus|cellular response to nutrient levels|insulin receptor signaling pathway|positive regulation of protein serine/threonine kinase activity|positive regulation of TOR signaling cascade|TOR signaling cascade	cytosol|lysosome|TORC1 complex	protein complex binding			lung(4)|urinary_tract(1)|ovary(1)	6						gtggtggtggtgatgatggtgat	0.000													4	2	---	---	---	---	
SAFB	6294	broad.mit.edu	37	19	5667205	5667205	+	Intron	DEL	C	-	-			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5667205delC	uc002mcf.2	+						SAFB_uc002mcg.2_Intron|SAFB_uc002mce.3_Intron|SAFB_uc010xir.1_Intron|SAFB_uc010xis.1_Intron|SAFB_uc010xit.1_Intron|SAFB_uc010xiu.1_Intron	NM_002967	NP_002958	Q15424	SAFB1_HUMAN	scaffold attachment factor B						chromatin organization|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	double-stranded DNA binding|nucleotide binding|protein binding|RNA binding			ovary(1)|liver(1)|skin(1)	3				UCEC - Uterine corpus endometrioid carcinoma (162;0.000222)		CAGTACCTGACCCCCCCCCCG	0.657													11	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	7429288	7429289	+	IGR	INS	-	AGGC	AGGC	rs11260009	by1000genomes	TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7429288_7429289insAGGC								INSR (135277 upstream) : ARHGEF18 (18431 downstream)																							ggaaggaaggaaggcaggCTGA	0.084													4	5	---	---	---	---	
EMR2	30817	broad.mit.edu	37	19	14866107	14866108	+	Intron	DEL	AT	-	-	rs141637468	by1000genomes	TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14866107_14866108delAT	uc002mzp.1	-						EMR2_uc010dzs.1_Intron|EMR2_uc010xnw.1_Intron|EMR2_uc002mzo.1_Intron|EMR2_uc002mzq.1_Intron|EMR2_uc002mzr.1_Intron|EMR2_uc002mzs.1_Intron|EMR2_uc002mzt.1_Intron|EMR2_uc002mzu.1_Intron|EMR2_uc010xnx.1_Intron|EMR2_uc010xny.1_Intron	NM_013447	NP_038475	Q9UHX3	EMR2_HUMAN	egf-like module containing, mucin-like, hormone						cell adhesion|neuropeptide signaling pathway	integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			lung(2)|ovary(1)|skin(1)	4						aaaaaaaaaaatacaaaaatta	0.000													4	2	---	---	---	---	
SLC27A1	376497	broad.mit.edu	37	19	17599636	17599638	+	Intron	DEL	CGG	-	-			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17599636_17599638delCGG	uc002ngu.1	+						SLC27A1_uc002ngt.1_Intron|SLC27A1_uc010xpp.1_Intron	NM_198580	NP_940982	Q6PCB7	S27A1_HUMAN	solute carrier family 27, member 1						cardiolipin biosynthetic process|fatty acid metabolic process|long-chain fatty acid transport|negative regulation of phospholipid biosynthetic process|phosphatidic acid biosynthetic process|phosphatidylcholine biosynthetic process|phosphatidylethanolamine biosynthetic process|phosphatidylinositol biosynthetic process|phosphatidylserine biosynthetic process|transmembrane transport	endomembrane system|integral to membrane	fatty acid transporter activity|nucleotide binding				0						TCTGCCCTCCCGGCTCCCCCTCC	0.537													18	9	---	---	---	---	
ZNF569	148266	broad.mit.edu	37	19	37903316	37903317	+	3'UTR	INS	-	T	T	rs142272008	by1000genomes	TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37903316_37903317insT	uc002ogi.2	-	6					ZNF569_uc002ogh.2_3'UTR|ZNF569_uc002ogj.2_3'UTR	NM_152484	NP_689697	Q5MCW4	ZN569_HUMAN	zinc finger protein 569						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(2)|skin(1)	3			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			gtttctggtaacagctttttCA	0.144													8	7	---	---	---	---	
AKT2	208	broad.mit.edu	37	19	40761345	40761346	+	Intron	INS	-	GT	GT	rs138053162	by1000genomes	TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40761345_40761346insGT	uc002onf.2	-						AKT2_uc010egs.2_Intron|AKT2_uc010egt.2_Intron|AKT2_uc010xvj.1_Intron|AKT2_uc010egu.1_Intron|AKT2_uc010xvk.1_Intron	NM_001626	NP_001617	P31751	AKT2_HUMAN	AKT2 kinase						insulin receptor signaling pathway|negative regulation of plasma membrane long-chain fatty acid transport|positive regulation of fatty acid beta-oxidation|positive regulation of glucose import|positive regulation of glycogen biosynthetic process	cytosol|nucleus	ATP binding|protein binding|protein serine/threonine kinase activity			lung(2)	2			Lung(22;0.000499)			ctcagggtctagtgtgtgtgtg	0.000			A		ovarian|pancreatic 								4	3	---	---	---	---	
ZSCAN5A	79149	broad.mit.edu	37	19	56755967	56755971	+	Intron	DEL	CAAGG	-	-	rs57532903		TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56755967_56755971delCAAGG	uc002qmr.2	-						ZSCAN5A_uc010ygi.1_Intron	NM_024303	NP_077279	Q9BUG6	ZSA5A_HUMAN	zinc finger and SCAN domain containing 5A						viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			large_intestine(1)|ovary(1)|skin(1)	3						tttgttgtcacaagggggaggacag	0.117													6	5	---	---	---	---	
XRN2	22803	broad.mit.edu	37	20	21321692	21321693	+	Intron	INS	-	GTA	GTA	rs141054974	by1000genomes	TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:21321692_21321693insGTA	uc002wsf.1	+						XRN2_uc002wsg.1_Intron|XRN2_uc010zsk.1_Intron	NM_012255	NP_036387	Q9H0D6	XRN2_HUMAN	5'-3' exoribonuclease 2						cell growth|DNA catabolic process, exonucleolytic|mRNA processing|regulation of transcription, DNA-dependent|RNA catabolic process|spermatogenesis|transcription termination, DNA-dependent	nucleolus	5'-3' exoribonuclease activity|nucleic acid binding|protein binding|zinc ion binding			skin(1)	1						AAGAAGAGCACGTAGGATTGTT	0.262													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	9766012	9766013	+	RNA	INS	-	A	A			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:9766012_9766013insA	uc011abu.1	+	8		c.509_510insA								Homo sapiens, clone IMAGE:4720764, mRNA.																		ACAACTATCAGAAAATGTATGT	0.262													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	15848642	15848643	+	IGR	INS	-	AAGG	AAGG			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:15848642_15848643insAAGG								HSPA13 (93133 upstream) : SAMSN1 (8906 downstream)																							agaaagaaggaaaggaaggaag	0.000													5	4	---	---	---	---	
SUN2	25777	broad.mit.edu	37	22	39138154	39138154	+	Intron	DEL	A	-	-			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:39138154delA	uc003awh.1	-						SUN2_uc011anz.1_Intron|SUN2_uc011aoa.1_Intron|SUN2_uc003awi.1_Intron|SUN2_uc010gxq.1_Intron|SUN2_uc010gxr.1_Intron|SUN2_uc010gxs.1_Intron	NM_015374	NP_056189	Q9UH99	SUN2_HUMAN	unc-84 homolog B						centrosome localization|cytoskeletal anchoring at nuclear membrane|mitotic spindle organization|nuclear envelope organization|nuclear matrix anchoring at nuclear membrane|nuclear migration along microfilament|positive regulation of cell migration	endosome membrane|integral to membrane|nuclear inner membrane|SUN-KASH complex	lamin binding|microtubule binding			large_intestine(1)|skin(1)	2						tctcaaaaagaaaaaaaaaaa	0.194													6	3	---	---	---	---	
CYP2D7P1	1564	broad.mit.edu	37	22	42537119	42537120	+	Intron	INS	-	A	A	rs142656198	by1000genomes	TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42537119_42537120insA	uc003bci.2	-						CYP2D7P1_uc003bcg.2_Intron|CYP2D7P1_uc003bch.2_Intron|CYP2D7P1_uc010gyv.2_Intron|CYP2D7P1_uc010gyw.2_Intron	NR_002570				SubName: Full=Cytochrome P450 2D6;          EC=1.14.14.1;												0						GGGCTACCACCGGGGCTGATGC	0.614													4	2	---	---	---	---	
USP11	8237	broad.mit.edu	37	X	47104944	47104944	+	Intron	DEL	T	-	-			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:47104944delT	uc004dhp.2	+						USP11_uc004dhq.2_Intron	NM_004651	NP_004642	P51784	UBP11_HUMAN	ubiquitin specific peptidase 11						protein deubiquitination|ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	cysteine-type endopeptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(1)|lung(1)|central_nervous_system(1)	3						TATATTTAGCttttttttttt	0.274													4	2	---	---	---	---	
ARHGAP4	393	broad.mit.edu	37	X	153184236	153184237	+	Intron	DEL	AT	-	-			TCGA-A3-3357-01A-02D-1421-08	TCGA-A3-3357-11A-01D-1421-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153184236_153184237delAT	uc004fjk.1	-						ARHGAP4_uc011mzf.1_Intron|ARHGAP4_uc004fjl.1_Intron|ARHGAP4_uc010nup.1_Intron	NM_001666	NP_001657	P98171	RHG04_HUMAN	Rho GTPase activating protein 4 isoform 2						apoptosis|cytoskeleton organization|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|Rho protein signal transduction	cytosol|focal adhesion|nucleus	Rho GTPase activator activity|Rho guanyl-nucleotide exchange factor activity|SH3/SH2 adaptor activity			central_nervous_system(1)	1	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					ACTGCCCACCATTACAGTGAAG	0.574													19	36	---	---	---	---	
