Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
ESPNP	284729	broad.mit.edu	37	1	17023321	17023321	+	Missense_Mutation	SNP	T	G	G			TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17023321T>G	uc001azn.1	-	9	1627	c.1513A>C	c.(1513-1515)AAG>CAG	p.K505Q		NR_026567				RecName: Full=Espin; AltName: Full=Ectoplasmic specialization protein; AltName: Full=Autosomal recessive deafness type 36 protein;												0						GTCAGCCCCTTGCTCTGTGGC	0.637													5	46	---	---	---	---	PASS
TRIM33	51592	broad.mit.edu	37	1	114967253	114967253	+	Missense_Mutation	SNP	C	A	A			TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:114967253C>A	uc001eew.2	-	10	1904	c.1820G>T	c.(1819-1821)GGC>GTC	p.G607V	TRIM33_uc010owr.1_Missense_Mutation_p.G197V|TRIM33_uc010ows.1_Missense_Mutation_p.G215V|TRIM33_uc001eex.2_Missense_Mutation_p.G607V	NM_015906	NP_056990	Q9UPN9	TRI33_HUMAN	tripartite motif-containing 33 protein isoform	607					negative regulation of BMP signaling pathway|negative regulation of transcription, DNA-dependent|protein ubiquitination|regulation of transforming growth factor beta receptor signaling pathway|transcription, DNA-dependent	nucleus	co-SMAD binding|DNA binding|ligase activity|R-SMAD binding|zinc ion binding			lung(4)|central_nervous_system(3)|large_intestine(1)|breast(1)|skin(1)|ovary(1)	11	all_epithelial(7;0.000132)|all_lung(7;0.00106)|Lung SC(450;0.184)	all_cancers(81;3.03e-08)|all_epithelial(167;3.24e-08)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		ATATTGAGGGCCGCTGTGCCT	0.433			T	RET	papillary thyroid								50	98	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	1	142803783	142803783	+	Intron	SNP	A	T	T			TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142803783A>T	uc001eiw.1	+						uc001ejb.2_RNA|uc001ejc.2_Intron					Homo sapiens PNAS-130 mRNA, complete cds.																		atagttaacaaagtagctggc	0.065													3	5	---	---	---	---	PASS
GRHL1	29841	broad.mit.edu	37	2	10101473	10101473	+	Missense_Mutation	SNP	G	C	C			TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:10101473G>C	uc002raa.2	+	4	748	c.577G>C	c.(577-579)GAC>CAC	p.D193H	GRHL1_uc002rab.2_RNA|GRHL1_uc002rad.2_Silent_p.L29L|GRHL1_uc010yjb.1_Missense_Mutation_p.D42H	NM_198182	NP_937825	Q9NZI5	GRHL1_HUMAN	grainyhead-like 1	193					cellular lipid metabolic process|multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	Golgi apparatus|nucleus	DNA binding			pancreas(1)|skin(1)	2	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.172)|OV - Ovarian serous cystadenocarcinoma(76;0.246)		TCTCAATACTGACCAGTTCAG	0.542													68	155	---	---	---	---	PASS
TMEM214	54867	broad.mit.edu	37	2	27256957	27256957	+	Silent	SNP	C	A	A			TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27256957C>A	uc002ria.3	+	2	284	c.174C>A	c.(172-174)ACC>ACA	p.T58T	TMEM214_uc010yle.1_RNA|TMEM214_uc002rib.3_Silent_p.T58T	NM_017727	NP_060197	Q6NUQ4	TM214_HUMAN	transmembrane protein 214 isoform 1	58						integral to membrane	protein binding				0						CCACAAGCACCCTTTATGAGC	0.547													69	148	---	---	---	---	PASS
PPM1B	5495	broad.mit.edu	37	2	44457623	44457623	+	Missense_Mutation	SNP	T	G	G			TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:44457623T>G	uc002rtt.2	+	6	1634	c.1206T>G	c.(1204-1206)AAT>AAG	p.N402K	PPM1B_uc002rtu.2_3'UTR|PPM1B_uc002rtv.2_Missense_Mutation_p.N115K|PPM1B_uc002rtw.2_Intron|PPM1B_uc002rtx.2_Intron	NM_002706	NP_002697	O75688	PPM1B_HUMAN	protein phosphatase 1B isoform 1	402					protein dephosphorylation	protein serine/threonine phosphatase complex	magnesium ion binding|manganese ion binding|protein binding|protein serine/threonine phosphatase activity			kidney(1)|skin(1)	2		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)				TGAGAATTAATCATAGGGGAA	0.473													22	169	---	---	---	---	PASS
NEURL3	93082	broad.mit.edu	37	2	97164150	97164150	+	RNA	SNP	T	C	C			TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:97164150T>C	uc010fhx.2	-	6		c.955A>G			NEURL3_uc002swc.2_RNA					Homo sapiens cDNA FLJ54814 complete cds.												0						GGCAGCGTGATAGAAGCAGAT	0.607													10	31	---	---	---	---	PASS
UXS1	80146	broad.mit.edu	37	2	106717553	106717553	+	Silent	SNP	C	A	A			TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:106717553C>A	uc002tdm.2	-	12	1028	c.930G>T	c.(928-930)GTG>GTT	p.V310V	UXS1_uc002tdl.2_Silent_p.V142V|UXS1_uc002tdn.2_Silent_p.V315V|UXS1_uc002tdo.2_Silent_p.V253V|UXS1_uc010ywh.1_Silent_p.V154V	NM_025076	NP_079352	Q8NBZ7	UXS1_HUMAN	UDP-glucuronate decarboxylase 1	310	Lumenal (Potential).				cellular metabolic process	Golgi cisterna membrane|integral to membrane	coenzyme binding|UDP-glucuronate decarboxylase activity			ovary(2)	2						TCATGAGAGCCACGAGGCCAT	0.557													39	98	---	---	---	---	PASS
RBM43	375287	broad.mit.edu	37	2	152112099	152112099	+	Missense_Mutation	SNP	T	C	C			TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:152112099T>C	uc002txh.2	-	2	310	c.162A>G	c.(160-162)ATA>ATG	p.I54M		NM_198557	NP_940959	Q6ZSC3	RBM43_HUMAN	RNA binding motif protein 43	54	RRM.						nucleotide binding|RNA binding				0				BRCA - Breast invasive adenocarcinoma(221;0.131)		TTGTCGGATATATCACATCTT	0.338													128	251	---	---	---	---	PASS
GALNT5	11227	broad.mit.edu	37	2	158165154	158165154	+	Nonsense_Mutation	SNP	G	T	T			TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:158165154G>T	uc002tzg.2	+	9	2851	c.2596G>T	c.(2596-2598)GGA>TGA	p.G866*	GALNT5_uc010zci.1_RNA	NM_014568	NP_055383	Q7Z7M9	GALT5_HUMAN	N-acetylgalactosaminyltransferase 5	866	Lumenal (Potential).|Ricin B-type lectin.				glycosaminoglycan biosynthetic process	Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			breast(3)|skin(1)	4						CCCTGATAAAGGAGCCGTAAG	0.403													5	282	---	---	---	---	PASS
COQ10B	80219	broad.mit.edu	37	2	198338613	198338613	+	Silent	SNP	C	A	A	rs144430610		TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:198338613C>A	uc002uuh.1	+	5	736	c.682C>A	c.(682-684)CGG>AGG	p.R228R	COQ10B_uc010fsl.1_Silent_p.R200R	NM_025147	NP_079423	Q9H8M1	CQ10B_HUMAN	coenzyme Q10 homolog B precursor	228						mitochondrial inner membrane					0			Epithelial(96;0.231)|OV - Ovarian serous cystadenocarcinoma(117;0.246)			AAATATACCTCGGGAGTTAAT	0.408													4	132	---	---	---	---	PASS
TMBIM1	64114	broad.mit.edu	37	2	219140112	219140112	+	3'UTR	SNP	C	T	T			TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219140112C>T	uc002vho.1	-	13					PNKD_uc002vhn.2_Intron|TMBIM1_uc002vhp.1_3'UTR|TMBIM1_uc010zjz.1_3'UTR|TMBIM1_uc010zka.1_3'UTR	NM_022152	NP_071435	Q969X1	TMBI1_HUMAN	transmembrane BAX inhibitor motif containing 1							integral to membrane					0		Renal(207;0.0474)		Epithelial(149;8.56e-07)|all cancers(144;0.000154)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		AGGAAAGGGGCCTAAAGCCCA	0.572													13	58	---	---	---	---	PASS
SETD5	55209	broad.mit.edu	37	3	9512240	9512240	+	Missense_Mutation	SNP	A	T	T			TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:9512240A>T	uc003brt.2	+	19	3257	c.2822A>T	c.(2821-2823)CAT>CTT	p.H941L	SETD5_uc003bru.2_Missense_Mutation_p.H843L|SETD5_uc003brv.2_Missense_Mutation_p.H830L|SETD5_uc010hck.2_Missense_Mutation_p.H423L|SETD5_uc003brx.2_Missense_Mutation_p.H610L	NM_001080517	NP_001073986	Q9C0A6	SETD5_HUMAN	SET domain containing 5	941										ovary(2)	2	Medulloblastoma(99;0.227)			OV - Ovarian serous cystadenocarcinoma(96;0.112)		AACTCAGGTCATTCTGACCTG	0.507													5	261	---	---	---	---	PASS
VHL	7428	broad.mit.edu	37	3	10191488	10191488	+	Nonsense_Mutation	SNP	C	T	T	rs5030818		TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10191488C>T	uc003bvc.2	+	3	694	c.481C>T	c.(481-483)CGA>TGA	p.R161*	VHL_uc003bvd.2_Nonsense_Mutation_p.R120*	NM_000551	NP_000542	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor isoform 1	161	Interaction with Elongin BC complex.		R -> P (in pheochromocytoma and VHLD; type I).|R -> Q (in pheochromocytoma and VHLD; type II).		anti-apoptosis|cell morphogenesis|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of cell differentiation|positive regulation of transcription, DNA-dependent|protein stabilization|protein ubiquitination|proteolysis	cytosol|endoplasmic reticulum|membrane|mitochondrion|nucleus	protein binding|transcription factor binding	p.R161*(10)|p.R161P(3)|p.R161del(1)|p.R161fs*13(1)|p.R161fs*12(1)|p.E160fs*9(1)|p.?fs(1)|p.L158fs*6(1)|p.E160fs*13(1)|p.R161Q(1)		kidney(1273)|soft_tissue(24)|adrenal_gland(15)|large_intestine(13)|pancreas(5)|endometrium(4)|thyroid(3)|upper_aerodigestive_tract(3)|central_nervous_system(2)|lung(2)|pleura(1)|paratesticular_tissues(1)	1346				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		TCTGAAAGAGCGATGCCTCCA	0.502		1	D|Mis|N|F|S		renal|hemangioma|pheochromocytoma	renal|hemangioma|pheochromocytoma			von_Hippel-Lindau_disease|Chuvash_Polycythemia_|Pheochromocytoma_(Adrenal)_Familial				23	24	---	---	---	---	PASS
SETD2	29072	broad.mit.edu	37	3	47162162	47162162	+	Nonsense_Mutation	SNP	G	A	A			TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:47162162G>A	uc003cqs.2	-	3	4017	c.3964C>T	c.(3964-3966)CGA>TGA	p.R1322*	SETD2_uc003cqv.2_Nonsense_Mutation_p.R1311*	NM_014159	NP_054878	Q9BYW2	SETD2_HUMAN	SET domain containing 2	1322					regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleus	DNA binding|histone-lysine N-methyltransferase activity|oxidoreductase activity|transition metal ion binding			kidney(24)|ovary(5)|skin(1)|central_nervous_system(1)|breast(1)	32		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		CCTTGAGTTCGATCATACACA	0.463			N|F|S|Mis		clear cell renal carcinoma								50	51	---	---	---	---	PASS
QARS	5859	broad.mit.edu	37	3	49135499	49135499	+	Missense_Mutation	SNP	C	T	T			TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49135499C>T	uc003cvx.2	-	23	2208	c.2203G>A	c.(2203-2205)GCA>ACA	p.A735T	QARS_uc011bcc.1_Missense_Mutation_p.A188T|QARS_uc011bcd.1_Missense_Mutation_p.A590T|QARS_uc003cvy.2_Missense_Mutation_p.A590T|QARS_uc011bce.1_Missense_Mutation_p.A724T	NM_005051	NP_005042	P47897	SYQ_HUMAN	glutaminyl-tRNA synthetase	735					glutaminyl-tRNA aminoacylation	cytosol|mitochondrial matrix	ATP binding|glutamine-tRNA ligase activity|protein binding			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)	L-Glutamine(DB00130)	AAGGGTTTTGCCAGGGCCACA	0.552													4	160	---	---	---	---	PASS
PBRM1	55193	broad.mit.edu	37	3	52620568	52620568	+	Missense_Mutation	SNP	G	T	T			TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52620568G>T	uc003des.2	-	20	3272	c.3260C>A	c.(3259-3261)CCT>CAT	p.P1087H	PBRM1_uc003dex.2_RNA|PBRM1_uc003deq.2_Missense_Mutation_p.P1087H|PBRM1_uc003der.2_Missense_Mutation_p.P1055H|PBRM1_uc003det.2_Missense_Mutation_p.P1102H|PBRM1_uc003deu.2_Missense_Mutation_p.P1102H|PBRM1_uc003dev.2_RNA|PBRM1_uc003dew.2_Missense_Mutation_p.P1087H|PBRM1_uc010hmk.1_Missense_Mutation_p.P1062H|PBRM1_uc003dey.2_Missense_Mutation_p.P1062H|PBRM1_uc003dez.1_Missense_Mutation_p.P1086H|PBRM1_uc003dfb.1_Missense_Mutation_p.P999H|PBRM1_uc003dfa.1_Missense_Mutation_p.P433H	NM_181042	NP_060635	Q86U86	PB1_HUMAN	polybromo 1 isoform 4	1087					chromatin remodeling|mitosis|negative regulation of cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear chromosome	chromatin binding|DNA binding|protein binding			kidney(136)|breast(4)	140				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		CACATCCCGAGGGACAAACCT	0.453			Mis|N|F|S|D|O		clear cell renal carcinoma|breast								4	175	---	---	---	---	PASS
PHC3	80012	broad.mit.edu	37	3	169846583	169846583	+	Silent	SNP	T	C	C			TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:169846583T>C	uc010hws.1	-	8	1705	c.1641A>G	c.(1639-1641)GAA>GAG	p.E547E	PHC3_uc003fgl.2_Silent_p.E559E|PHC3_uc011bpq.1_Silent_p.E506E|PHC3_uc011bpr.1_Silent_p.E473E	NM_024947	NP_079223	Q8NDX5	PHC3_HUMAN	polyhomeotic like 3	547	Pro-rich.				multicellular organismal development	PcG protein complex	DNA binding|zinc ion binding			ovary(1)|central_nervous_system(1)	2	all_cancers(22;2.67e-22)|all_epithelial(15;4.73e-27)|all_lung(20;6.31e-17)|Lung NSC(18;2.61e-16)|Ovarian(172;0.000337)|Breast(254;0.169)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.0655)			CAGCTGGAAGTTCCTCTTCTG	0.512													4	221	---	---	---	---	PASS
MAEA	10296	broad.mit.edu	37	4	1305934	1305934	+	Silent	SNP	C	T	T			TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:1305934C>T	uc003gda.2	+	2	267	c.237C>T	c.(235-237)AGC>AGT	p.S79S	MAEA_uc010ibs.1_Silent_p.S79S|MAEA_uc003gdb.2_Silent_p.S79S|MAEA_uc011bvb.1_Silent_p.S79S|MAEA_uc003gdc.2_Silent_p.S79S|MAEA_uc003gdd.2_RNA|MAEA_uc011bvc.1_Silent_p.S78S|MAEA_uc011bvd.1_Silent_p.S31S	NM_001017405	NP_001017405	Q7L5Y9	MAEA_HUMAN	macrophage erythroblast attacher isoform 1	79	Extracellular and involved in cell to cell contact.				cell adhesion|cell cycle|cell division|erythrocyte maturation|negative regulation of myeloid cell apoptosis|regulation of mitotic cell cycle	actomyosin contractile ring|integral to plasma membrane|membrane fraction|nuclear matrix|spindle	actin binding			ovary(1)|central_nervous_system(1)	2			OV - Ovarian serous cystadenocarcinoma(23;0.0201)			AGAAGCTCAGCGTCCTCAAGA	0.622													15	52	---	---	---	---	PASS
GRPEL1	80273	broad.mit.edu	37	4	7062876	7062876	+	Nonsense_Mutation	SNP	G	A	A			TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:7062876G>A	uc003gjy.1	-	4	408	c.367C>T	c.(367-369)CAG>TAG	p.Q123*	GRPEL1_uc003gjz.1_3'UTR	NM_025196	NP_079472	Q9HAV7	GRPE1_HUMAN	GrpE-like 1, mitochondrial precursor	123					protein folding|protein import into mitochondrial matrix	mitochondrial matrix	adenyl-nucleotide exchange factor activity|chaperone binding|protein homodimerization activity|unfolded protein binding				0						GGAACACACTGTGTTGCCTTC	0.463													68	140	---	---	---	---	PASS
SLIT2	9353	broad.mit.edu	37	4	20599967	20599967	+	Missense_Mutation	SNP	G	A	A			TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:20599967G>A	uc003gpr.1	+	33	3845	c.3641G>A	c.(3640-3642)CGT>CAT	p.R1214H	SLIT2_uc003gps.1_Missense_Mutation_p.R1206H	NM_004787	NP_004778	O94813	SLIT2_HUMAN	slit homolog 2 precursor	1214	Laminin G-like.				apoptosis involved in luteolysis|axon extension involved in axon guidance|branching morphogenesis of a tube|cell migration involved in sprouting angiogenesis|cellular response to heparin|cellular response to hormone stimulus|chemorepulsion involved in postnatal olfactory bulb interneuron migration|corticospinal neuron axon guidance through spinal cord|induction of negative chemotaxis|motor axon guidance|negative regulation of actin filament polymerization|negative regulation of cell growth|negative regulation of cellular response to growth factor stimulus|negative regulation of chemokine-mediated signaling pathway|negative regulation of endothelial cell migration|negative regulation of lamellipodium assembly|negative regulation of mononuclear cell migration|negative regulation of neutrophil chemotaxis|negative regulation of protein phosphorylation|negative regulation of retinal ganglion cell axon guidance|negative regulation of small GTPase mediated signal transduction|negative regulation of smooth muscle cell chemotaxis|negative regulation of vascular permeability|positive regulation of apoptosis|positive regulation of axonogenesis|response to cortisol stimulus|retinal ganglion cell axon guidance|Roundabout signaling pathway|ureteric bud development	cell surface|cytoplasm|extracellular space|plasma membrane	calcium ion binding|GTPase inhibitor activity|heparin binding|laminin-1 binding|protein homodimerization activity|proteoglycan binding|Roundabout binding			central_nervous_system(4)|skin(4)|ovary(3)	11						TATCGGGGGCGTGTTCGTGCC	0.473													82	160	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	4	69403349	69403349	+	IGR	SNP	C	T	T	rs146629248	byFrequency	TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:69403349C>T								YTHDC1 (187525 upstream) : UGT2B15 (108967 downstream)																							ATAACTAATCCCTTTTCTTCT	0.408													4	97	---	---	---	---	PASS
PITX2	5308	broad.mit.edu	37	4	111539589	111539589	+	Missense_Mutation	SNP	A	T	T			TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:111539589A>T	uc003iad.2	-	5	1228	c.646T>A	c.(646-648)TCT>ACT	p.S216T	PITX2_uc003iac.2_Missense_Mutation_p.S223T|PITX2_uc003iae.2_Missense_Mutation_p.S170T|PITX2_uc010iml.2_Missense_Mutation_p.S87T|PITX2_uc003iaf.2_Missense_Mutation_p.S216T	NM_153426	NP_700475	Q99697	PITX2_HUMAN	paired-like homeodomain transcription factor 2	216					determination of left/right symmetry|organ morphogenesis	transcription factor complex	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding|transcription factor binding				0		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.00222)		GACGAGATAGAGTTGGGTGGG	0.547													35	73	---	---	---	---	PASS
NUP153	9972	broad.mit.edu	37	6	17662260	17662260	+	Silent	SNP	T	C	C			TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:17662260T>C	uc003ncd.1	-	10	1457	c.1257A>G	c.(1255-1257)GAA>GAG	p.E419E	NUP153_uc011dje.1_Silent_p.E419E|NUP153_uc010jpl.1_Silent_p.E419E	NM_005124	NP_005115	P49790	NU153_HUMAN	nucleoporin 153kDa	419					carbohydrate metabolic process|glucose transport|interspecies interaction between organisms|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	cytoplasm|nuclear membrane|nuclear pore|nucleolus|nucleoplasm	DNA binding|protein binding|transporter activity|zinc ion binding			lung(4)|ovary(2)|breast(2)|skin(1)	9	Breast(50;0.0259)|Ovarian(93;0.0584)	all_hematologic(90;0.125)	all cancers(50;0.0981)|Epithelial(50;0.112)			TTTCTCGTTGTTCTCTATTTT	0.303													93	195	---	---	---	---	PASS
COL11A2	1302	broad.mit.edu	37	6	33140387	33140387	+	Missense_Mutation	SNP	C	A	A			TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33140387C>A	uc003ocx.1	-	39	3046	c.2818G>T	c.(2818-2820)GGG>TGG	p.G940W	COL11A2_uc010jul.1_Intron|COL11A2_uc003ocy.1_Missense_Mutation_p.G854W|COL11A2_uc003ocz.1_Missense_Mutation_p.G833W	NM_080680	NP_542411	P13942	COBA2_HUMAN	collagen, type XI, alpha 2 isoform 1	940	Triple-helical region.		Missing (in STL3).		cartilage development|cell adhesion|collagen fibril organization|sensory perception of sound|soft palate development	collagen type XI	extracellular matrix structural constituent conferring tensile strength|protein binding, bridging			ovary(3)|skin(2)	5						CCTCTCTCCCCCATAGGGCCG	0.627													61	108	---	---	---	---	PASS
WDR46	9277	broad.mit.edu	37	6	33254931	33254931	+	Missense_Mutation	SNP	C	T	T			TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33254931C>T	uc003ods.2	-	9	996	c.952G>A	c.(952-954)GGG>AGG	p.G318R	WDR46_uc011dra.1_Missense_Mutation_p.G264R|WDR46_uc010juo.1_RNA|PFDN6_uc003odt.1_5'Flank|PFDN6_uc010jup.1_5'Flank	NM_005452	NP_005443	O15213	WDR46_HUMAN	WD repeat domain 46 isoform 1	318	WD 4.										0						TCGAGCCGCCCAGCTCGAGCA	0.502													61	117	---	---	---	---	PASS
ASCC3	10973	broad.mit.edu	37	6	101095127	101095127	+	Silent	SNP	C	A	A			TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:101095127C>A	uc003pqk.2	-	21	3782	c.3453G>T	c.(3451-3453)CTG>CTT	p.L1151L	ASCC3_uc011eai.1_Silent_p.L1053L	NM_006828	NP_006819	Q8N3C0	HELC1_HUMAN	activating signal cointegrator 1 complex subunit	1151	SEC63 1.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|microtubule cytoskeleton	ATP binding|ATP-dependent helicase activity|nucleic acid binding			ovary(5)|skin(1)	6		all_cancers(76;1.45e-07)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(87;0.00149)|Hepatocellular(1;0.0893)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0539)|all cancers(137;0.103)|GBM - Glioblastoma multiforme(226;0.199)		TCATGTCTTTCAGCTTATCCA	0.368													11	93	---	---	---	---	PASS
MED23	9439	broad.mit.edu	37	6	131949200	131949200	+	5'UTR	SNP	A	C	C			TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:131949200A>C	uc003qcs.1	-	1					ENPP3_uc010kfn.1_5'Flank|ENPP3_uc003qcu.3_5'Flank|MED23_uc003qcq.2_5'UTR|MED23_uc003qct.1_5'UTR|MED23_uc011ecb.1_RNA	NM_004830	NP_004821	Q9ULK4	MED23_HUMAN	mediator complex subunit 23 isoform a						regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	transcription factor complex	protein binding|transcription coactivator activity			ovary(1)|kidney(1)|central_nervous_system(1)	3	Breast(56;0.0753)			GBM - Glioblastoma multiforme(226;0.0115)|OV - Ovarian serous cystadenocarcinoma(155;0.0608)		CTGTACTATCACCCCCGCCTT	0.622											OREG0017663	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	9	107	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	6	153603806	153603806	+	IGR	SNP	G	T	T			TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:153603806G>T								RGS17 (151417 upstream) : OPRM1 (727830 downstream)																							GCTTGCCTATGCGGCCGTGGC	0.572													32	149	---	---	---	---	PASS
POM121C	100101267	broad.mit.edu	37	7	75054987	75054987	+	Missense_Mutation	SNP	C	G	G			TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:75054987C>G	uc003udk.3	-	9	1462	c.577G>C	c.(577-579)GAA>CAA	p.E193Q		NM_001099415	NP_001092885	A8CG34	P121C_HUMAN	POM121 membrane glycoprotein (rat)-like	435	Pore side (Potential).|Ser-rich.				mRNA transport|protein transport|transmembrane transport	endoplasmic reticulum membrane|nuclear membrane|nuclear pore	protein binding				0						CACAGCTCTTCTTCTCTGTTG	0.453													8	18	---	---	---	---	PASS
DOCK4	9732	broad.mit.edu	37	7	111555908	111555908	+	Missense_Mutation	SNP	C	T	T			TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:111555908C>T	uc003vfx.2	-	13	1387	c.1118G>A	c.(1117-1119)AGG>AAG	p.R373K	DOCK4_uc003vfy.2_Missense_Mutation_p.R373K|DOCK4_uc003vga.1_5'UTR	NM_014705	NP_055520	Q8N1I0	DOCK4_HUMAN	dedicator of cytokinesis 4	373					cell chemotaxis	cytosol|endomembrane system|membrane|stereocilium	GTP binding|guanyl-nucleotide exchange factor activity|PDZ domain binding|Rac GTPase activator activity|Rac GTPase binding|receptor tyrosine kinase binding|SH3 domain binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)	4		Acute lymphoblastic leukemia(1;0.0441)				TGAATATTCCCTTCTGATTTG	0.368													13	26	---	---	---	---	PASS
NUP205	23165	broad.mit.edu	37	7	135307659	135307659	+	Missense_Mutation	SNP	C	T	T			TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:135307659C>T	uc003vsw.2	+	31	4496	c.4465C>T	c.(4465-4467)CAT>TAT	p.H1489Y	NUP205_uc003vsx.2_RNA	NM_015135	NP_055950	Q92621	NU205_HUMAN	nucleoporin 205kDa	1489					carbohydrate metabolic process|glucose transport|mRNA transport|protein import into nucleus, docking|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear pore	protein binding			ovary(3)|breast(1)|central_nervous_system(1)|skin(1)	6						TTGTGATGGTCATGAGATTGG	0.328													62	139	---	---	---	---	PASS
PTGES	9536	broad.mit.edu	37	9	132502051	132502051	+	Missense_Mutation	SNP	A	C	C			TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:132502051A>C	uc004byi.2	-	3	351	c.298T>G	c.(298-300)TGG>GGG	p.W100G	PTGES_uc010myy.2_RNA|PTGES_uc004byj.2_3'UTR	NM_004878	NP_004869	O14684	PTGES_HUMAN	prostaglandin E synthase	100	Helical.				prostaglandin biosynthetic process|signal transduction	integral to membrane|membrane fraction	glutathione binding|prostaglandin-E synthase activity			skin(1)	1		Ovarian(14;0.00556)				AAGTGCATCCAGGCGACAAAA	0.617													3	18	---	---	---	---	PASS
TAF3	83860	broad.mit.edu	37	10	8006092	8006092	+	Missense_Mutation	SNP	G	T	T			TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:8006092G>T	uc010qbd.1	+	3	619	c.619G>T	c.(619-621)GTT>TTT	p.V207F		NM_031923	NP_114129	Q5VWG9	TAF3_HUMAN	RNA polymerase II transcription factor TAFII140	207					maintenance of protein location in nucleus|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	transcription factor TFIID complex	protein binding|zinc ion binding			ovary(1)	1						CACGCTAGATGTTGTGTTATT	0.488													17	105	---	---	---	---	PASS
GPR158	57512	broad.mit.edu	37	10	25887796	25887796	+	Missense_Mutation	SNP	A	C	C			TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:25887796A>C	uc001isj.2	+	11	3301	c.3241A>C	c.(3241-3243)ATT>CTT	p.I1081L	GPR158_uc001isk.2_Missense_Mutation_p.I456L	NM_020752	NP_065803	Q5T848	GP158_HUMAN	G protein-coupled receptor 158 precursor	1081	Cytoplasmic (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(4)|large_intestine(2)|pancreas(1)|skin(1)	8						AGGCCAGTCCATTTTGGAAGA	0.502													85	194	---	---	---	---	PASS
RHOBTB1	9886	broad.mit.edu	37	10	62670706	62670706	+	Missense_Mutation	SNP	A	T	T			TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:62670706A>T	uc001jli.2	-	5	673	c.235T>A	c.(235-237)TCT>ACT	p.S79T	RHOBTB1_uc001jlh.2_Missense_Mutation_p.S79T|RHOBTB1_uc001jlj.2_Missense_Mutation_p.S79T|RHOBTB1_uc001jlk.2_Missense_Mutation_p.S79T|RHOBTB1_uc009xpe.1_Missense_Mutation_p.S79T|RHOBTB1_uc001jlm.2_Missense_Mutation_p.S79T	NM_014836	NP_055651	O94844	RHBT1_HUMAN	Rho-related BTB domain containing 1	79	Rho-like.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|plasma membrane	GTP binding			upper_aerodigestive_tract(1)	1	Prostate(12;0.0112)					AGCCTGAGAGAAACACTCACT	0.488													40	90	---	---	---	---	PASS
C10orf35	219738	broad.mit.edu	37	10	71392760	71392760	+	Missense_Mutation	SNP	G	A	A			TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:71392760G>A	uc001jpq.3	+	4	481	c.311G>A	c.(310-312)CGT>CAT	p.R104H		NM_145306	NP_660349	Q96D05	CJ035_HUMAN	hypothetical protein LOC219738	104	Helical; (Potential).					integral to membrane				ovary(1)|skin(1)	2						CTTGGTGTTCGTGGCCTCCTC	0.587													5	292	---	---	---	---	PASS
DNAJB12	54788	broad.mit.edu	37	10	74100574	74100574	+	Silent	SNP	C	T	T			TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:74100574C>T	uc010qjv.1	-	5	948	c.798G>A	c.(796-798)AGG>AGA	p.R266R	DNAJB12_uc001jsz.2_Silent_p.R266R|DNAJB12_uc001jta.2_Silent_p.R266R	NM_017626	NP_060096	Q9NXW2	DJB12_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 12	232					protein folding	endoplasmic reticulum|integral to membrane	heat shock protein binding|unfolded protein binding				0						TGCGGTCCTGCCTTTGCTGGT	0.642													14	32	---	---	---	---	PASS
GRID1	2894	broad.mit.edu	37	10	87966299	87966299	+	Silent	SNP	G	C	C			TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:87966299G>C	uc001kdl.1	-	3	443	c.342C>G	c.(340-342)CTC>CTG	p.L114L	GRID1_uc009xsu.1_RNA	NM_017551	NP_060021	Q9ULK0	GRID1_HUMAN	glutamate receptor, ionotropic, delta 1	114	Extracellular (Potential).					cell junction|integral to membrane|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|ionotropic glutamate receptor activity			ovary(5)|upper_aerodigestive_tract(2)|large_intestine(2)|central_nervous_system(1)	10					L-Glutamic Acid(DB00142)	GCTGGACAAAGAGGTGTGGGA	0.632										Multiple Myeloma(13;0.14)			27	83	---	---	---	---	PASS
ATRNL1	26033	broad.mit.edu	37	10	117228696	117228696	+	Missense_Mutation	SNP	G	T	T			TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:117228696G>T	uc001lcg.2	+	24	3897	c.3511G>T	c.(3511-3513)GGG>TGG	p.G1171W	ATRNL1_uc010qsm.1_Missense_Mutation_p.G300W|ATRNL1_uc010qsn.1_Intron	NM_207303	NP_997186	Q5VV63	ATRN1_HUMAN	attractin-like 1 precursor	1171	Extracellular (Potential).					integral to membrane	sugar binding			ovary(5)|lung(1)|central_nervous_system(1)	7		all_lung(145;0.0686)|Breast(234;0.0969)|Lung NSC(174;0.17)|Colorectal(252;0.234)		Epithelial(162;0.00031)|all cancers(201;0.000753)|LUSC - Lung squamous cell carcinoma(1;0.0515)|Lung(30;0.0827)		AACAATATCTGGGGAAGAGAC	0.179													8	104	---	---	---	---	PASS
B4GALNT4	338707	broad.mit.edu	37	11	375649	375649	+	Silent	SNP	C	T	T			TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:375649C>T	uc001lpb.2	+	10	870	c.861C>T	c.(859-861)GCC>GCT	p.A287A		NM_178537	NP_848632	Q76KP1	B4GN4_HUMAN	beta	287	Lumenal (Potential).					Golgi cisterna membrane|integral to membrane	N-acetyl-beta-glucosaminyl-glycoprotein 4-beta-N-acetylgalactosaminyltransferase activity			pancreas(1)	1		all_cancers(49;1.59e-06)|all_epithelial(84;0.000256)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;1.56e-27)|Epithelial(43;9.31e-27)|OV - Ovarian serous cystadenocarcinoma(40;1.11e-20)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0182)|LUSC - Lung squamous cell carcinoma(625;0.0703)		ATGAGTCAGCCTTGAAGATGG	0.667													34	84	---	---	---	---	PASS
TRIM3	10612	broad.mit.edu	37	11	6479378	6479378	+	Missense_Mutation	SNP	C	T	T			TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6479378C>T	uc001mdh.2	-	4	667	c.280G>A	c.(280-282)GAT>AAT	p.D94N	TRIM3_uc001mdi.2_Missense_Mutation_p.D94N|TRIM3_uc010raj.1_5'UTR|TRIM3_uc009yfd.2_Missense_Mutation_p.D94N|TRIM3_uc010rak.1_Missense_Mutation_p.D94N|TRIM3_uc001mdj.2_5'UTR	NM_006458	NP_006449	O75382	TRIM3_HUMAN	tripartite motif-containing 3	94					nervous system development|protein transport	early endosome	protein C-terminus binding|zinc ion binding			central_nervous_system(2)|large_intestine(1)|ovary(1)|skin(1)	5		all_lung(207;9.97e-06)|Lung NSC(207;1.74e-05)|Medulloblastoma(188;0.00225)|Breast(177;0.0204)|all_neural(188;0.0212)		Epithelial(150;9.34e-10)|Lung(200;0.0234)|LUSC - Lung squamous cell carcinoma(625;0.133)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TGGGCCCCATCAGGTGCCTGC	0.647													52	116	---	---	---	---	PASS
CSTF3	1479	broad.mit.edu	37	11	33123767	33123767	+	Missense_Mutation	SNP	C	T	T			TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:33123767C>T	uc001muh.2	-	10	948	c.782G>A	c.(781-783)AGC>AAC	p.S261N	TCP11L1_uc001muf.1_Intron	NM_001326	NP_001317	Q12996	CSTF3_HUMAN	cleavage stimulation factor subunit 3 isoform 1	261	HAT 5.				mRNA cleavage|mRNA polyadenylation|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	nucleoplasm	protein binding|RNA binding				0						AAGAGGGTTGCTCTTTTCCCA	0.338													52	142	---	---	---	---	PASS
RPLP0P2	113157	broad.mit.edu	37	11	61404307	61404307	+	Silent	SNP	G	T	T			TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61404307G>T	uc001nrz.1	+	5	911	c.156G>T	c.(154-156)GTG>GTT	p.V52V		NR_002775				SubName: Full=cDNA FLJ51469, highly similar to 60S acidic ribosomal protein P0;												0						GCAAGGCCGTGGTGCTGATGG	0.552													17	32	---	---	---	---	PASS
PCF11	51585	broad.mit.edu	37	11	82877725	82877725	+	Missense_Mutation	SNP	A	G	G			TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:82877725A>G	uc001ozx.3	+	5	2131	c.1786A>G	c.(1786-1788)AGA>GGA	p.R596G	PCF11_uc010rsu.1_Missense_Mutation_p.R596G	NM_015885	NP_056969	O94913	PCF11_HUMAN	pre-mRNA cleavage complex II protein Pcf11	596					mRNA 3'-end processing|mRNA cleavage|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	mRNA cleavage factor complex				ovary(1)	1						GTCTGCCAAAAGATGGAAATC	0.348													38	125	---	---	---	---	PASS
PDZD3	79849	broad.mit.edu	37	11	119059779	119059779	+	Silent	SNP	C	T	T			TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:119059779C>T	uc001pwb.2	+	8	2075	c.1551C>T	c.(1549-1551)AAC>AAT	p.N517N	PDZD3_uc001pvy.2_Silent_p.N437N|PDZD3_uc001pvz.2_Silent_p.N451N|PDZD3_uc010rzd.1_Silent_p.N438N|PDZD3_uc001pwa.2_Silent_p.N147N			Q86UT5	NHRF4_HUMAN	RecName: Full=Na(+)/H(+) exchange regulatory cofactor NHE-RF4;          Short=NHERF-4; AltName: Full=PDZ domain-containing protein 3; AltName: Full=PDZ domain-containing protein 2; AltName: Full=Intestinal and kidney-enriched PDZ protein; AltName: Full=Sodium-hydrogen exchanger regulatory factor 4;	517	PDZ 4.				cGMP-mediated signaling|ion transport|negative regulation of cGMP biosynthetic process|response to toxin|water transport	apical part of cell|brush border|cytosol|membrane fraction|subapical complex	guanylate cyclase inhibitor activity|ion channel inhibitor activity|protein C-terminus binding			breast(1)	1	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0523)|Breast(348;0.174)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;7.52e-05)		TGGAAGTGAACGGGTATCCTG	0.632													6	146	---	---	---	---	PASS
TMEM136	219902	broad.mit.edu	37	11	120198001	120198001	+	Intron	SNP	A	T	T			TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:120198001A>T	uc001pxh.1	+						TMEM136_uc001pxg.2_5'UTR|TMEM136_uc010rzm.1_Intron|TMEM136_uc001pxj.2_5'UTR|TMEM136_uc009zas.1_Intron|TMEM136_uc001pxi.1_Intron	NM_174926	NP_777586	Q6ZRR5	TM136_HUMAN	transmembrane protein 136							integral to membrane				ovary(1)	1		Breast(109;0.00663)|Medulloblastoma(222;0.0523)|Hepatocellular(160;0.206)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;5.07e-06)		TAAATAGAAGATTCTTGGCCG	0.343													20	32	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	11	124121146	124121146	+	IGR	SNP	A	T	T			TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124121146A>T								OR8G2 (24836 upstream) : OR8D1 (58591 downstream)																							CAGCACTTGTAGCTCCCACAT	0.493													50	111	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	11	124121147	124121147	+	IGR	SNP	G	A	A			TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124121147G>A								OR8G2 (24837 upstream) : OR8D1 (58590 downstream)																							AGCACTTGTAGCTCCCACATG	0.493													51	110	---	---	---	---	PASS
STYK1	55359	broad.mit.edu	37	12	10783738	10783738	+	Silent	SNP	C	T	T			TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:10783738C>T	uc001qys.2	-	5	878	c.357G>A	c.(355-357)CAG>CAA	p.Q119Q		NM_018423	NP_060893	Q6J9G0	STYK1_HUMAN	serine/threonine/tyrosine kinase 1	119	Protein kinase.					integral to membrane|plasma membrane	ATP binding|non-membrane spanning protein tyrosine kinase activity			central_nervous_system(3)|ovary(2)|lung(2)|breast(1)	8						CACTGCAAATCTGCTCCAGAA	0.507										HNSCC(73;0.22)			14	143	---	---	---	---	PASS
ITPR2	3709	broad.mit.edu	37	12	26848561	26848561	+	Missense_Mutation	SNP	G	C	C			TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:26848561G>C	uc001rhg.2	-	10	1391	c.974C>G	c.(973-975)GCC>GGC	p.A325G		NM_002223	NP_002214	Q14571	ITPR2_HUMAN	inositol 1,4,5-triphosphate receptor, type 2	325	Cytoplasmic (Potential).|MIR 4.				activation of phospholipase C activity|energy reserve metabolic process|nerve growth factor receptor signaling pathway|platelet activation|regulation of insulin secretion|response to hypoxia	integral to membrane|plasma membrane enriched fraction|platelet dense tubular network membrane|sarcoplasmic reticulum membrane	calcium ion transmembrane transporter activity|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity			kidney(6)|ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)	14	Colorectal(261;0.0847)					TTCATTTTGGGCATCTCGATA	0.303													24	85	---	---	---	---	PASS
ITPR2	3709	broad.mit.edu	37	12	26848562	26848562	+	Missense_Mutation	SNP	C	T	T			TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:26848562C>T	uc001rhg.2	-	10	1390	c.973G>A	c.(973-975)GCC>ACC	p.A325T		NM_002223	NP_002214	Q14571	ITPR2_HUMAN	inositol 1,4,5-triphosphate receptor, type 2	325	Cytoplasmic (Potential).|MIR 4.				activation of phospholipase C activity|energy reserve metabolic process|nerve growth factor receptor signaling pathway|platelet activation|regulation of insulin secretion|response to hypoxia	integral to membrane|plasma membrane enriched fraction|platelet dense tubular network membrane|sarcoplasmic reticulum membrane	calcium ion transmembrane transporter activity|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity			kidney(6)|ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)	14	Colorectal(261;0.0847)					TCATTTTGGGCATCTCGATAA	0.299													25	84	---	---	---	---	PASS
WDR66	144406	broad.mit.edu	37	12	122369710	122369710	+	Missense_Mutation	SNP	A	T	T			TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122369710A>T	uc009zxk.2	+	4	948	c.806A>T	c.(805-807)GAA>GTA	p.E269V		NM_144668	NP_653269	Q8TBY9	WDR66_HUMAN	WD repeat domain 66	269							calcium ion binding			ovary(1)|skin(1)	2	all_neural(191;0.0496)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;0.000155)|Epithelial(86;0.000634)|BRCA - Breast invasive adenocarcinoma(302;0.248)		ATTCGAGAGGAAAGGCAGAGA	0.453													41	96	---	---	---	---	PASS
BUB1B	701	broad.mit.edu	37	15	40505655	40505655	+	Silent	SNP	G	A	A	rs146821149		TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40505655G>A	uc001zkx.3	+	20	2870	c.2658G>A	c.(2656-2658)AGG>AGA	p.R886R		NM_001211	NP_001202	O60566	BUB1B_HUMAN	budding uninhibited by benzimidazoles 1 beta	886	Protein kinase.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|cell division|cell proliferation|mitotic cell cycle spindle assembly checkpoint|mitotic prometaphase|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|phosphatidylinositol-mediated signaling|protein localization to kinetochore|spindle organization	anaphase-promoting complex|condensed chromosome outer kinetochore|cytosol|microtubule organizing center|perinuclear region of cytoplasm|spindle midzone	ATP binding|protein binding|protein serine/threonine kinase activity			stomach(2)|ovary(1)|kidney(1)	4		all_cancers(109;1.12e-18)|all_epithelial(112;1.61e-15)|Lung NSC(122;5.63e-11)|all_lung(180;1.4e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;1.83e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0556)		TGAGTCCAAGGTGTCTGATTC	0.338			Mis|N|F|S			rhabdomyosarcoma			Mosaic_Variegated_Aneuploidy_Syndrome				52	112	---	---	---	---	PASS
ZNF609	23060	broad.mit.edu	37	15	64968024	64968024	+	Missense_Mutation	SNP	C	A	A			TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:64968024C>A	uc002ann.2	+	4	2971	c.2971C>A	c.(2971-2973)CAC>AAC	p.H991N		NM_015042	NP_055857	O15014	ZN609_HUMAN	zinc finger protein 609	991						nucleus	zinc ion binding			upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	3						CCAGAGTTACCACACCCACCT	0.552													5	310	---	---	---	---	PASS
LOC645752	645752	broad.mit.edu	37	15	78211548	78211548	+	Silent	SNP	T	C	C			TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:78211548T>C	uc010bky.2	-	11	983	c.219A>G	c.(217-219)CAA>CAG	p.Q73Q		NR_027024				SubName: Full=GOLGA6 protein; Flags: Fragment;												0						CCACCTGGGATTGGAGCTTTC	0.562													4	257	---	---	---	---	PASS
GOLGA6L5	374650	broad.mit.edu	37	15	85053142	85053142	+	RNA	SNP	C	T	T			TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85053142C>T	uc002bkm.2	-	9		c.1905G>A			uc002bkl.1_5'Flank	NR_003246				Homo sapiens cDNA FLJ33459 fis, clone BRAMY2000585.												0						TTTTTCAATTCCTTGACCCGC	0.393													4	10	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	15	102304747	102304747	+	5'Flank	SNP	A	C	C	rs146447248	by1000genomes	TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:102304747A>C	uc002cbx.1	-						uc002ccc.1_5'Flank|uc002ccf.3_RNA|uc002ccg.3_5'Flank|uc010uth.1_5'Flank|uc002cci.2_5'Flank|uc002ccj.2_5'Flank|uc002cck.2_5'Flank|uc002ccl.1_5'Flank|uc002ccm.1_5'Flank					DQ582460																		CTCGTGGAGGAGTCGGCAGAG	0.607													3	35	---	---	---	---	PASS
LOC100134368	100134368	broad.mit.edu	37	16	437229	437229	+	Intron	SNP	T	C	C			TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:437229T>C	uc002cgw.1	+						uc002cgx.3_Missense_Mutation_p.I180T	NR_024453				Homo sapiens cDNA clone IMAGE:3636396, partial cds.												0						ATTGGGATCATCTAAACTGAG	0.313													3	98	---	---	---	---	PASS
CORO7	79585	broad.mit.edu	37	16	4412076	4412076	+	Silent	SNP	G	T	T			TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4412076G>T	uc002cwh.3	-	16	1608	c.1488C>A	c.(1486-1488)ACC>ACA	p.T496T	CORO7_uc002cwe.2_RNA|CORO7_uc002cwf.2_Silent_p.T496T|CORO7_uc002cwg.3_Silent_p.T276T|CORO7_uc010uxh.1_Silent_p.T478T|CORO7_uc010uxi.1_Silent_p.T411T|CORO7_uc002cwi.1_Silent_p.T276T|CORO7_uc010uxj.1_RNA|CORO7_uc010btp.1_Silent_p.T276T	NM_024535	NP_078811	P57737	CORO7_HUMAN	coronin 7	496						cytoplasmic membrane-bounded vesicle|cytosol|Golgi membrane|integral to membrane of membrane fraction|soluble fraction					0						CACCAGGTGTGGTGAGGTTGA	0.647													28	45	---	---	---	---	PASS
RBBP6	5930	broad.mit.edu	37	16	24564874	24564874	+	Missense_Mutation	SNP	C	A	A			TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:24564874C>A	uc002dmh.2	+	4	1384	c.344C>A	c.(343-345)ACA>AAA	p.T115K	RBBP6_uc010vcb.1_5'UTR|RBBP6_uc002dmi.2_Missense_Mutation_p.T115K|RBBP6_uc010bxr.2_Missense_Mutation_p.T115K|RBBP6_uc002dmk.2_5'Flank	NM_006910	NP_008841	Q7Z6E9	RBBP6_HUMAN	retinoblastoma-binding protein 6 isoform 1	115					protein ubiquitination involved in ubiquitin-dependent protein catabolic process	chromosome|nucleolus|ubiquitin ligase complex	nucleic acid binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(3)|pancreas(1)	4				GBM - Glioblastoma multiforme(48;0.0518)		GCCCAGCTTACAAAGGTATAT	0.323													25	100	---	---	---	---	PASS
CLEC18C	283971	broad.mit.edu	37	16	70065826	70065826	+	Intron	SNP	T	C	C	rs3169319	by1000genomes	TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70065826T>C	uc002exy.2	+						PDXDC2_uc002eyb.2_RNA|PDXDC2_uc002eyc.2_RNA	NM_182619	NP_872425	Q8NCF0	CL18C_HUMAN	secretory protein LOC348174 precursor							extracellular region	sugar binding				0						GATCCAAACATAGTGTTACAG	0.453													5	194	---	---	---	---	PASS
MYH2	4620	broad.mit.edu	37	17	10442759	10442759	+	Splice_Site	SNP	A	G	G			TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10442759A>G	uc010coi.2	-	13	1394	c.1266_splice	c.e13+1	p.Q422_splice	uc002gml.1_Intron|MYH2_uc002gmp.3_Splice_Site_p.Q422_splice|MYH2_uc010coj.2_Splice_Site_p.Q422_splice	NM_001100112	NP_001093582	Q9UKX2	MYH2_HUMAN	myosin heavy chain IIa						muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(5)|pancreas(4)|skin(3)|lung(1)|kidney(1)	14						TTATGCACCTACCTGTTCTAC	0.443													89	274	---	---	---	---	PASS
ANKRD13B	124930	broad.mit.edu	37	17	27934892	27934892	+	Missense_Mutation	SNP	A	G	G			TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27934892A>G	uc002hei.2	+	2	360	c.247A>G	c.(247-249)ACA>GCA	p.T83A	ANKRD13B_uc002heh.2_5'UTR|ANKRD13B_uc002hej.2_RNA	NM_152345	NP_689558	Q86YJ7	AN13B_HUMAN	ankyrin repeat domain 13B	83	ANK 2.										0						CAGCGGCTGGACAGGTGGGCA	0.687													5	36	---	---	---	---	PASS
ACLY	47	broad.mit.edu	37	17	40028034	40028034	+	Missense_Mutation	SNP	C	T	T			TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40028034C>T	uc002hyg.2	-	25	3008	c.2845G>A	c.(2845-2847)GCC>ACC	p.A949T	ACLY_uc002hyh.2_Missense_Mutation_p.A939T|ACLY_uc002hyi.2_Missense_Mutation_p.A1003T|ACLY_uc010wfx.1_Missense_Mutation_p.A993T|ACLY_uc010wfy.1_Missense_Mutation_p.A678T	NM_001096	NP_001087	P53396	ACLY_HUMAN	ATP citrate lyase isoform 1	949					ATP catabolic process|cellular carbohydrate metabolic process|citrate metabolic process|coenzyme A metabolic process|energy reserve metabolic process|long-chain fatty-acyl-CoA biosynthetic process|positive regulation of cellular metabolic process|triglyceride biosynthetic process	citrate lyase complex|cytosol|nucleus	ATP binding|ATP citrate synthase activity|citrate (pro-3S)-lyase activity|metal ion binding|protein binding|succinate-CoA ligase (ADP-forming) activity			ovary(2)|central_nervous_system(1)	3		Breast(137;0.000143)				CTGTCAAAGGCTTTACTGAAC	0.502													43	105	---	---	---	---	PASS
CYTH1	9267	broad.mit.edu	37	17	76692093	76692093	+	Intron	SNP	T	A	A			TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76692093T>A	uc002jvw.2	-							NM_017456	NP_059430	Q15438	CYH1_HUMAN	cytohesin 1 isoform 2						regulation of ARF protein signal transduction|regulation of cell adhesion|vesicle-mediated transport	cytoplasm|plasma membrane	ARF guanyl-nucleotide exchange factor activity|protein binding			ovary(1)	1						ACATACCTCCTGGAGTTTGGG	0.388													30	60	---	---	---	---	PASS
CBX8	57332	broad.mit.edu	37	17	77768311	77768311	+	3'UTR	SNP	T	G	G			TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:77768311T>G	uc002jxd.1	-	5						NM_020649	NP_065700	Q9HC52	CBX8_HUMAN	chromobox homolog 8						negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nuclear chromatin|PcG protein complex	methylated histone residue binding				0			OV - Ovarian serous cystadenocarcinoma(97;0.0102)|BRCA - Breast invasive adenocarcinoma(99;0.0224)			GCTGGTGGGGTGGGGGTGACA	0.468													7	37	---	---	---	---	PASS
COL5A3	50509	broad.mit.edu	37	19	10116808	10116808	+	Missense_Mutation	SNP	C	T	T	rs144021089	byFrequency	TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10116808C>T	uc002mmq.1	-	2	274	c.188G>A	c.(187-189)CGG>CAG	p.R63Q		NM_015719	NP_056534	P25940	CO5A3_HUMAN	collagen, type V, alpha 3 preproprotein	63	TSP N-terminal.				collagen fibril organization|skin development	collagen type V	collagen binding|extracellular matrix structural constituent			ovary(7)|lung(1)|central_nervous_system(1)|skin(1)	10			Epithelial(33;7.11e-05)			TCTGAATGCCCGGTCACCCTC	0.657													5	36	---	---	---	---	PASS
LDLR	3949	broad.mit.edu	37	19	11224382	11224382	+	Silent	SNP	G	A	A			TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11224382G>A	uc002mqk.3	+	10	1698	c.1530G>A	c.(1528-1530)ACG>ACA	p.T510T	LDLR_uc010xlk.1_Silent_p.T510T|LDLR_uc010xll.1_Silent_p.T469T|LDLR_uc010xlm.1_Silent_p.T363T|LDLR_uc010xln.1_Silent_p.T383T|LDLR_uc010xlo.1_Silent_p.T342T	NM_000527	NP_000518	P01130	LDLR_HUMAN	low density lipoprotein receptor precursor	510	Extracellular (Potential).|LDL-receptor class B 3.				cholesterol homeostasis|cholesterol metabolic process|interspecies interaction between organisms|intestinal cholesterol absorption|low-density lipoprotein particle clearance|receptor-mediated endocytosis	clathrin-coated endocytic vesicle membrane|coated pit|early endosome|endosome membrane|external side of plasma membrane|integral to plasma membrane|low-density lipoprotein particle|lysosome	calcium ion binding|low-density lipoprotein receptor activity|protein binding|very-low-density lipoprotein particle receptor activity			ovary(2)|skin(2)	4		Lung NSC(9;0.000245)|Renal(1328;0.0007)|Hepatocellular(1079;0.0524)		GBM - Glioblastoma multiforme(1328;1.36e-05)|STAD - Stomach adenocarcinoma(1328;0.000766)|Lung(535;0.197)	Methyl aminolevulinate(DB00992)|Porfimer(DB00707)	AGAGGAAAACGTTATTCAGGG	0.582													37	80	---	---	---	---	PASS
WDR83	84292	broad.mit.edu	37	19	12783897	12783897	+	Missense_Mutation	SNP	T	A	A			TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12783897T>A	uc002mue.3	+	9	985	c.650T>A	c.(649-651)CTC>CAC	p.L217H	WDR83_uc002muc.2_RNA|WDR83_uc010dyw.2_Missense_Mutation_p.L217H	NM_001099737	NP_001093207	Q9BRX9	WDR83_HUMAN	mitogen-activated protein kinase organizer 1	217	WD 5.				nuclear mRNA splicing, via spliceosome	catalytic step 2 spliceosome|cytoplasm				lung(1)|breast(1)	2						ACATTGCGGCTCCTGGACAAA	0.657													28	50	---	---	---	---	PASS
ZNF738	148203	broad.mit.edu	37	19	21567223	21567223	+	3'UTR	SNP	G	T	T			TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:21567223G>T	uc002nps.3	+	5						NR_027130				SubName: Full=cDNA FLJ14673 fis, clone NT2RP2003714, moderately similar to Zinc finger protein 430;												0						CCCTACAAATGTTTAGAATGT	0.368													11	25	---	---	---	---	PASS
FAM187B	148109	broad.mit.edu	37	19	35719152	35719152	+	Missense_Mutation	SNP	C	A	A			TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35719152C>A	uc002nyk.1	-	1	477	c.432G>T	c.(430-432)TGG>TGT	p.W144C		NM_152481	NP_689694	Q17R55	F187B_HUMAN	family with sequence similarity 187, member B	144	Extracellular (Potential).					integral to membrane				ovary(2)	2						AGGGCTCCCACCAGGTAAAAA	0.587													7	284	---	---	---	---	PASS
SIPA1L3	23094	broad.mit.edu	37	19	38573642	38573642	+	Silent	SNP	C	T	T			TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38573642C>T	uc002ohk.2	+	3	1946	c.1437C>T	c.(1435-1437)CCC>CCT	p.P479P		NM_015073	NP_055888	O60292	SI1L3_HUMAN	signal-induced proliferation-associated 1 like	479					regulation of small GTPase mediated signal transduction	intracellular	GTPase activator activity			ovary(1)|central_nervous_system(1)	2			Lung(45;0.000246)|LUSC - Lung squamous cell carcinoma(53;0.000292)			TGGAAGTTCCCAAGGAGCAGC	0.672													27	49	---	---	---	---	PASS
FCAR	2204	broad.mit.edu	37	19	55399613	55399613	+	Missense_Mutation	SNP	C	T	T			TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55399613C>T	uc002qhr.1	+	4	798	c.601C>T	c.(601-603)CCC>TCC	p.P201S	FCAR_uc002qhq.2_Missense_Mutation_p.P201S|FCAR_uc002qhs.1_Intron|FCAR_uc002qht.1_Intron|FCAR_uc010esi.1_Intron|FCAR_uc002qhu.1_Intron|FCAR_uc002qhv.1_Intron|FCAR_uc002qhw.1_Missense_Mutation_p.P189S|FCAR_uc002qhx.1_Intron|FCAR_uc002qhy.1_Intron|FCAR_uc002qhz.1_Intron|FCAR_uc002qia.1_Missense_Mutation_p.P92S	NM_002000	NP_001991	P24071	FCAR_HUMAN	Fc alpha receptor isoform a precursor	201	Extracellular (Potential).				immune response	extracellular region|integral to plasma membrane	IgA binding|receptor activity			ovary(1)|skin(1)	2				GBM - Glioblastoma multiforme(193;0.0443)		CAACAGGAGCCCCTACCTGTG	0.582													11	52	---	---	---	---	PASS
ZIM2	23619	broad.mit.edu	37	19	57286079	57286079	+	Missense_Mutation	SNP	T	G	G			TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57286079T>G	uc002qnr.2	-	11	1943	c.1561A>C	c.(1561-1563)ACT>CCT	p.T521P	uc010ygp.1_Intron|uc002qnp.1_Intron|ZIM2_uc010ygq.1_Missense_Mutation_p.T317P|ZIM2_uc010ygr.1_Missense_Mutation_p.T317P|ZIM2_uc002qnq.2_Missense_Mutation_p.T521P|ZIM2_uc010etp.2_Missense_Mutation_p.T521P|ZIM2_uc010ygs.1_Missense_Mutation_p.T521P	NM_015363	NP_056178	Q9NZV7	ZIM2_HUMAN	zinc finger, imprinted 2	521					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(3)	3		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0314)		CACTCAACAGTTTTCTCTTGA	0.453													4	129	---	---	---	---	PASS
FRG1B	284802	broad.mit.edu	37	20	29633992	29633992	+	Intron	SNP	A	G	G			TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29633992A>G	uc010ztl.1	+						FRG1B_uc002wvm.1_RNA|FRG1B_uc010ztj.1_Intron|FRG1B_uc010ztk.1_Intron					Homo sapiens cDNA FLJ32537 fis, clone SMINT2000400, highly similar to Homo sapiens FRG1 mRNA.												0						TAAAATATTCAGAGGAAATGC	0.308													3	56	---	---	---	---	PASS
DSCAM	1826	broad.mit.edu	37	21	41452141	41452141	+	Missense_Mutation	SNP	G	T	T			TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:41452141G>T	uc002yyq.1	-	25	4810	c.4358C>A	c.(4357-4359)GCC>GAC	p.A1453D	DSCAM_uc002yyr.1_RNA	NM_001389	NP_001380	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule isoform	1453	Fibronectin type-III 5.|Extracellular (Potential).				cell adhesion|dendrite self-avoidance|negative regulation of cell adhesion|positive regulation of axon extension involved in axon guidance|positive regulation of phosphorylation	axon|extracellular region|growth cone|integral to plasma membrane|membrane fraction	protein binding			ovary(6)|skin(4)|upper_aerodigestive_tract(1)	11		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)				TCCATTTTGGGCTGTCAGTGT	0.458													7	285	---	---	---	---	PASS
GGT3P	2679	broad.mit.edu	37	22	18769145	18769145	+	Intron	SNP	G	A	A			TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:18769145G>A	uc010gri.1	-						GGT3P_uc011ago.1_Intron|GGT3P_uc011agp.1_RNA|GGT3P_uc002zob.1_RNA					Homo sapiens cDNA clone IMAGE:5761295, **** WARNING: chimeric clone ****.												0						TGAGGCTGCCGTTGTAGAAGG	0.612													9	18	---	---	---	---	PASS
CHEK2	11200	broad.mit.edu	37	22	29091841	29091841	+	Silent	SNP	G	A	A	rs146546850	byFrequency	TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29091841G>A	uc003adu.1	-	11	1188	c.1116C>T	c.(1114-1116)TCC>TCT	p.S372S	CHEK2_uc003ads.1_Silent_p.S151S|CHEK2_uc010gvh.1_Silent_p.S281S|CHEK2_uc010gvi.1_Intron|CHEK2_uc010gvj.1_Intron|CHEK2_uc003adr.1_RNA|CHEK2_uc010gvk.1_RNA|CHEK2_uc003adt.1_Silent_p.S415S|CHEK2_uc003adv.1_Silent_p.S343S|CHEK2_uc003adw.1_Silent_p.S372S|CHEK2_uc003adx.1_Silent_p.S151S|CHEK2_uc003ady.1_Silent_p.S372S|CHEK2_uc003adz.1_Silent_p.S176S	NM_007194	NP_009125	O96017	CHK2_HUMAN	protein kinase CHK2 isoform a	372	Protein kinase.				cell cycle|DNA damage checkpoint|DNA damage response, signal transduction resulting in induction of apoptosis|replicative senescence	PML body	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity	p.S372S(1)		central_nervous_system(17)|stomach(1)|ovary(1)|lung(1)	20						CCAAAATCTTGGAGTGCCCAA	0.413			F			breast 		Direct_reversal_of_damage|Other_conserved_DNA_damage_response_genes	Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|CHEK2-associated_cancer				6	126	---	---	---	---	PASS
MEI1	150365	broad.mit.edu	37	22	42191421	42191421	+	Missense_Mutation	SNP	C	T	T			TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42191421C>T	uc003baz.1	+	29	3566	c.3541C>T	c.(3541-3543)CGG>TGG	p.R1181W	WBP2NL_uc011ape.1_Intron|LOC339674_uc003bba.1_Intron|MEI1_uc011apd.1_RNA|MEI1_uc003bbb.1_Missense_Mutation_p.R567W|MEI1_uc003bbc.1_Missense_Mutation_p.R549W|MEI1_uc010gym.1_Missense_Mutation_p.R514W|MEI1_uc003bbd.1_Missense_Mutation_p.R424W|MEI1_uc010gyn.1_RNA|MEI1_uc003bbe.1_RNA|MEI1_uc003bbf.2_Missense_Mutation_p.R195W|MEI1_uc003bbg.2_Intron	NM_152513	NP_689726	Q5TIA1	MEI1_HUMAN	meiosis defective 1	1181							binding			central_nervous_system(1)|skin(1)	2						CCAGTTTATGCGGTACCGGAG	0.527													4	131	---	---	---	---	PASS
NCAPH2	29781	broad.mit.edu	37	22	50954874	50954874	+	Splice_Site	SNP	A	C	C			TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50954874A>C	uc003blr.3	+	2	231	c.109_splice	c.e2-2	p.L37_splice	NCAPH2_uc003blq.3_Splice_Site_p.L37_splice|NCAPH2_uc003blv.2_Splice_Site_p.L37_splice|NCAPH2_uc010hbb.2_Splice_Site|NCAPH2_uc003blu.3_Splice_Site|NCAPH2_uc003bls.3_Splice_Site|NCAPH2_uc003blt.3_Splice_Site|NCAPH2_uc003blw.3_Splice_Site|NCAPH2_uc003blx.3_Splice_Site_p.L37_splice|NCAPH2_uc003bly.3_Splice_Site	NM_152299	NP_689512	Q6IBW4	CNDH2_HUMAN	kleisin beta isoform 2						chromosome condensation	chromosome|nucleus				ovary(1)|skin(1)	2		all_cancers(38;4.58e-14)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.212)		TGTTTCTTGCAGCTGGATCAG	0.537													27	63	---	---	---	---	PASS
SHROOM2	357	broad.mit.edu	37	X	9914789	9914789	+	Missense_Mutation	SNP	C	T	T			TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:9914789C>T	uc004csu.1	+	10	4753	c.4663C>T	c.(4663-4665)CGC>TGC	p.R1555C	SHROOM2_uc004csv.2_Missense_Mutation_p.R389C|SHROOM2_uc011mic.1_Missense_Mutation_p.R390C|SHROOM2_uc004csw.1_Missense_Mutation_p.R390C	NM_001649	NP_001640	Q13796	SHRM2_HUMAN	apical protein of Xenopus-like	1555	ASD2.				apical protein localization|brain development|cell migration|cell morphogenesis|cellular pigment accumulation|ear development|establishment of melanosome localization|eye pigment granule organization|lens morphogenesis in camera-type eye|melanosome organization	apical plasma membrane|cell-cell adherens junction|microtubule|tight junction	actin filament binding|beta-catenin binding|ligand-gated sodium channel activity			ovary(3)|skin(3)|upper_aerodigestive_tract(1)|breast(1)	8		Hepatocellular(5;0.000888)				CCTGGACCGCCGCGAGCGCAT	0.547													6	11	---	---	---	---	PASS
CT47B1	643311	broad.mit.edu	37	X	120007830	120007830	+	Missense_Mutation	SNP	C	T	T			TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:120007830C>T	uc011muc.1	-	2	1075	c.820G>A	c.(820-822)GAT>AAT	p.D274N		NM_001145718	NP_001139190	P0C2W7	CT47B_HUMAN	cancer/testis antigen family 147, member B1	274	Potential.										0						CCTGCAGCATCTTGGGCCTCT	0.463													32	662	---	---	---	---	PASS
MAGEA5	4104	broad.mit.edu	37	X	151283038	151283038	+	3'UTR	SNP	C	A	A			TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:151283038C>A	uc004ffj.2	-	3						NM_021049	NP_066387	P43359	MAGA5_HUMAN	melanoma antigen family A, 5												0	Acute lymphoblastic leukemia(192;6.56e-05)					CTGGCCCAGCCCCCCTCGCAG	0.552													25	40	---	---	---	---	PASS
PLEKHM2	23207	broad.mit.edu	37	1	16056542	16056556	+	Intron	DEL	GGGCGGGGCGGGGCG	-	-	rs12729712		TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16056542_16056556delGGGCGGGGCGGGGCG	uc010obo.1	+							NM_015164	NP_055979	Q8IWE5	PKHM2_HUMAN	pleckstrin homology domain containing, family M						Golgi organization	cytoplasm	kinesin binding			ovary(1)	1		Colorectal(325;0.000259)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.00057)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;9.18e-07)|COAD - Colon adenocarcinoma(227;4.5e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000133)|KIRC - Kidney renal clear cell carcinoma(229;0.00262)|STAD - Stomach adenocarcinoma(313;0.00774)|READ - Rectum adenocarcinoma(331;0.0657)		TCGCCTACCTgggcggggcggggcggggcggggcg	0.465													15	7	---	---	---	---	
RPE65	6121	broad.mit.edu	37	1	68897205	68897206	+	Frame_Shift_Ins	INS	-	A	A			TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:68897205_68897206insA	uc001dei.1	-	11	1245_1246	c.1191_1192insT	c.(1189-1194)AGTGACfs	p.S397fs		NM_000329	NP_000320	Q16518	RPE65_HUMAN	retinal pigment epithelium-specific protein	397_398					visual perception	cytoplasm|plasma membrane	all-trans-retinyl-palmitate hydrolase activity|metal ion binding|retinol isomerase activity			ovary(1)	1						ATAGTCTCGTCACTGCACAGAA	0.470													58	33	---	---	---	---	
PHTF1	10745	broad.mit.edu	37	1	114301136	114301137	+	Intron	INS	-	T	T			TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:114301136_114301137insT	uc009wgp.1	-						PHTF1_uc001edn.2_Intron|PHTF1_uc010own.1_Intron|PHTF1_uc001edp.2_Intron	NM_006608	NP_006599	Q9UMS5	PHTF1_HUMAN	putative homeodomain transcription factor 1							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1	Lung SC(450;0.184)	all_cancers(81;3.78e-08)|all_epithelial(167;5.56e-08)|all_lung(203;6.97e-06)|Lung NSC(69;1.18e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		CCTTGTACATCTTTTTTTTTTT	0.391													6	4	---	---	---	---	
POGZ	23126	broad.mit.edu	37	1	151384338	151384339	+	Intron	INS	-	A	A			TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151384338_151384339insA	uc001eyd.1	-						POGZ_uc001eye.1_Intron|POGZ_uc010pdb.1_Intron|POGZ_uc001eyf.1_Intron|POGZ_uc010pdc.1_Intron|POGZ_uc009wmv.1_Intron|POGZ_uc010pdd.1_Intron	NM_015100	NP_055915	Q7Z3K3	POGZ_HUMAN	pogo transposable element with ZNF domain						cell division|kinetochore assembly|mitotic sister chromatid cohesion|regulation of transcription, DNA-dependent	cytoplasm|nuclear chromatin	DNA binding|protein binding|zinc ion binding			ovary(3)	3	Lung SC(34;0.00471)|Ovarian(49;0.00672)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			atttttaaattaaaaaaaaaaa	0.297													4	3	---	---	---	---	
TDRD10	126668	broad.mit.edu	37	1	154479802	154479802	+	Intron	DEL	T	-	-			TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154479802delT	uc009wow.2	+						TDRD10_uc001ffd.2_Intron	NM_001098475	NP_001091945	Q5VZ19	TDR10_HUMAN	tudor domain containing 10 isoform a								nucleotide binding|RNA binding			ovary(1)	1	all_lung(78;1.72e-29)|Lung NSC(65;2.96e-27)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		LUSC - Lung squamous cell carcinoma(543;0.185)			TCCAGGTAAGTTAGGCTGGGG	0.483													33	16	---	---	---	---	
BCAN	63827	broad.mit.edu	37	1	156616443	156616449	+	Intron	DEL	CCCTGGC	-	-	rs113490499		TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156616443_156616449delCCCTGGC	uc001fpp.2	+						BCAN_uc001fpo.2_Intron	NM_021948	NP_068767	Q96GW7	PGCB_HUMAN	brevican isoform 1						cell adhesion	anchored to membrane|proteinaceous extracellular matrix	hyaluronic acid binding|sugar binding			ovary(1)|pancreas(1)	2	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					GGCTGCAGGAccctggcccctggcccc	0.575													3	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	189961345	189961346	+	IGR	DEL	GG	-	-	rs112920414		TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:189961345_189961346delGG								None (None upstream) : FAM5C (105451 downstream)																							ttttttttttggtttttttttt	0.292													3	3	---	---	---	---	
LGTN	1939	broad.mit.edu	37	1	206766800	206766803	+	Intron	DEL	GAGA	-	-	rs71570017		TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:206766800_206766803delGAGA	uc001heh.2	-						LGTN_uc009xbw.2_Intron	NM_006893	NP_008824	P41214	EIF2D_HUMAN	ligatin						intracellular protein transport	cytoplasm	protein binding|receptor activity|translation initiation factor activity				0	Breast(84;0.183)		BRCA - Breast invasive adenocarcinoma(75;0.166)			AAACTAAATGgagagagagagaga	0.196													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	227987663	227987666	+	IGR	DEL	TCCT	-	-	rs112328936		TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:227987663_227987666delTCCT								SNAP47 (18731 upstream) : PRSS38 (15752 downstream)																							tttttCtccctccttccttccttc	0.005													2	4	---	---	---	---	
WDR64	128025	broad.mit.edu	37	1	241920951	241920951	+	Intron	DEL	G	-	-			TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:241920951delG	uc001hzf.1	+						WDR64_uc001hzg.1_Intron	NM_144625	NP_653226	B1ANS9	WDR64_HUMAN	WD repeat domain 64											skin(1)	1	Ovarian(103;0.103)	all_cancers(173;0.0121)	OV - Ovarian serous cystadenocarcinoma(106;0.0116)			caatggatttgtttttttttt	0.000													5	3	---	---	---	---	
C2orf28	51374	broad.mit.edu	37	2	27440014	27440014	+	3'UTR	DEL	T	-	-	rs78234645		TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27440014delT	uc002rjf.2	+	7					C2orf28_uc002rjg.2_3'UTR|C2orf28_uc002rjh.2_RNA|CAD_uc002rji.2_5'Flank|CAD_uc010eyw.2_5'Flank	NM_080592	NP_542159	Q6UW56	APR3_HUMAN	apoptosis related protein 3 isoform b							integral to membrane|plasma membrane				skin(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TAATAAACACTTTTTTCTTTT	0.453													4	2	---	---	---	---	
NAB1	4664	broad.mit.edu	37	2	191554898	191554898	+	Intron	DEL	T	-	-			TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:191554898delT	uc002usb.2	+						NAB1_uc010fsc.2_Intron|NAB1_uc010fsd.2_Intron|NAB1_uc002usc.2_Intron|NAB1_uc010zgh.1_Intron	NM_005966	NP_005957	Q13506	NAB1_HUMAN	NGFI-A binding protein 1						negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus					0			OV - Ovarian serous cystadenocarcinoma(117;0.00318)|Epithelial(96;0.0405)|all cancers(119;0.109)			TGGGGGTTTGTTTTAAAACTT	0.254													71	33	---	---	---	---	
FN1	2335	broad.mit.edu	37	2	216235270	216235270	+	Intron	DEL	C	-	-	rs1250208		TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:216235270delC	uc002vfa.2	-						FN1_uc002vfb.2_Intron|FN1_uc002vfc.2_Intron|FN1_uc002vfd.2_Intron|FN1_uc002vfe.2_Intron|FN1_uc002vff.2_Intron|FN1_uc002vfg.2_Intron|FN1_uc002vfh.2_Intron|FN1_uc002vfi.2_Intron|FN1_uc002vfj.2_Intron|FN1_uc002vez.2_Intron|FN1_uc010zjp.1_Intron|FN1_uc002vfk.1_Intron|FN1_uc010fva.1_Intron|FN1_uc010fvb.1_Intron|FN1_uc010fvc.1_Intron|FN1_uc010fvd.1_Intron	NM_212482	NP_997647	P02751	FINC_HUMAN	fibronectin 1 isoform 1 preproprotein						acute-phase response|angiogenesis|leukocyte migration|peptide cross-linking|platelet activation|platelet degranulation|regulation of cell shape|substrate adhesion-dependent cell spreading	ER-Golgi intermediate compartment|fibrinogen complex|platelet alpha granule lumen|proteinaceous extracellular matrix	collagen binding|extracellular matrix structural constituent|heparin binding			central_nervous_system(7)|large_intestine(2)|breast(2)|ovary(1)|pancreas(1)	13		Renal(323;0.127)		Epithelial(149;9.59e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	AGACaaaaaacaaaaaacaaa	0.403													11	5	---	---	---	---	
VPRBP	9730	broad.mit.edu	37	3	51467343	51467343	+	Intron	DEL	A	-	-	rs112905156		TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:51467343delA	uc003dbe.1	-							NM_014703	NP_055518	Q9Y4B6	VPRBP_HUMAN	HIV-1 Vpr binding protein						interspecies interaction between organisms	cytoplasm|nucleus	protein binding			ovary(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(193;0.000272)|Kidney(197;0.000729)|KIRC - Kidney renal clear cell carcinoma(197;0.000875)		GAAGAAAGGGAAAAAAAAAAA	0.403													4	2	---	---	---	---	
PBRM1	55193	broad.mit.edu	37	3	52702569	52702569	+	Frame_Shift_Del	DEL	T	-	-			TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52702569delT	uc003des.2	-	3	341	c.329delA	c.(328-330)AATfs	p.N110fs	PBRM1_uc003dex.2_RNA|PBRM1_uc003deq.2_Frame_Shift_Del_p.N110fs|PBRM1_uc003der.2_Frame_Shift_Del_p.N110fs|PBRM1_uc003det.2_Frame_Shift_Del_p.N110fs|PBRM1_uc003deu.2_Frame_Shift_Del_p.N110fs|PBRM1_uc003dev.2_RNA|PBRM1_uc003dew.2_Frame_Shift_Del_p.N110fs|PBRM1_uc010hmk.1_Frame_Shift_Del_p.N110fs|PBRM1_uc003dey.2_Frame_Shift_Del_p.N110fs|PBRM1_uc003dez.1_Frame_Shift_Del_p.N110fs|PBRM1_uc003dfb.1_Frame_Shift_Del_p.N8fs	NM_181042	NP_060635	Q86U86	PB1_HUMAN	polybromo 1 isoform 4	110	Bromo 1.				chromatin remodeling|mitosis|negative regulation of cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear chromosome	chromatin binding|DNA binding|protein binding			kidney(136)|breast(4)	140				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		AGTCAGCAAATTAACATCATC	0.328			Mis|N|F|S|D|O		clear cell renal carcinoma|breast								29	25	---	---	---	---	
NFKBIZ	64332	broad.mit.edu	37	3	101574898	101574899	+	Intron	INS	-	T	T			TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:101574898_101574899insT	uc003dvp.2	+						NFKBIZ_uc003dvo.2_Intron|NFKBIZ_uc010hpo.2_Intron|NFKBIZ_uc003dvq.2_Intron	NM_031419	NP_113607	Q9BYH8	IKBZ_HUMAN	nuclear factor of kappa light polypeptide gene						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus				ovary(2)	2						GAAGCCCAGAAttttttttttt	0.183													3	3	---	---	---	---	
GUCA1C	9626	broad.mit.edu	37	3	108627203	108627203	+	Intron	DEL	C	-	-			TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108627203delC	uc003dxj.2	-						GUCA1C_uc003dxk.2_Intron	NM_005459	NP_005450	O95843	GUC1C_HUMAN	guanylate cyclase activator 1C						signal transduction|visual perception		calcium ion binding|calcium sensitive guanylate cyclase activator activity				0						TTCATTTAAACAAAAAAAAAA	0.313													4	2	---	---	---	---	
SLIT2	9353	broad.mit.edu	37	4	20544477	20544486	+	Intron	DEL	GTGTGTGTGC	-	-	rs66622951	by1000genomes	TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:20544477_20544486delGTGTGTGTGC	uc003gpr.1	+						SLIT2_uc003gps.1_Intron	NM_004787	NP_004778	O94813	SLIT2_HUMAN	slit homolog 2 precursor						apoptosis involved in luteolysis|axon extension involved in axon guidance|branching morphogenesis of a tube|cell migration involved in sprouting angiogenesis|cellular response to heparin|cellular response to hormone stimulus|chemorepulsion involved in postnatal olfactory bulb interneuron migration|corticospinal neuron axon guidance through spinal cord|induction of negative chemotaxis|motor axon guidance|negative regulation of actin filament polymerization|negative regulation of cell growth|negative regulation of cellular response to growth factor stimulus|negative regulation of chemokine-mediated signaling pathway|negative regulation of endothelial cell migration|negative regulation of lamellipodium assembly|negative regulation of mononuclear cell migration|negative regulation of neutrophil chemotaxis|negative regulation of protein phosphorylation|negative regulation of retinal ganglion cell axon guidance|negative regulation of small GTPase mediated signal transduction|negative regulation of smooth muscle cell chemotaxis|negative regulation of vascular permeability|positive regulation of apoptosis|positive regulation of axonogenesis|response to cortisol stimulus|retinal ganglion cell axon guidance|Roundabout signaling pathway|ureteric bud development	cell surface|cytoplasm|extracellular space|plasma membrane	calcium ion binding|GTPase inhibitor activity|heparin binding|laminin-1 binding|protein homodimerization activity|proteoglycan binding|Roundabout binding			central_nervous_system(4)|skin(4)|ovary(3)	11						gtgtgtgtgtgtgtgtgtgCGctataagat	0.114													4	3	---	---	---	---	
MARCH1	55016	broad.mit.edu	37	4	165119006	165119007	+	Intron	INS	-	AT	AT	rs140822955	by1000genomes	TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:165119006_165119007insAT	uc003iqs.1	-						ANP32C_uc011cjk.1_5'Flank	NM_017923	NP_060393	Q8TCQ1	MARH1_HUMAN	membrane-associated RING-CH protein I						antigen processing and presentation of peptide antigen via MHC class II|immune response	cytoplasmic vesicle membrane|early endosome membrane|Golgi apparatus|integral to membrane|late endosome membrane|lysosomal membrane|plasma membrane	MHC protein binding|ubiquitin-protein ligase activity|zinc ion binding			lung(2)	2	all_hematologic(180;0.166)	Prostate(90;0.0959)|all_neural(102;0.223)				CAAATATTATAATAAAGGGACT	0.401													4	2	---	---	---	---	
FAM172A	83989	broad.mit.edu	37	5	93300097	93300097	+	Intron	DEL	A	-	-			TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:93300097delA	uc010jbd.2	-						FAM172A_uc011cuf.1_Intron|FAM172A_uc011cug.1_Intron|FAM172A_uc011cuh.1_Intron|FAM172A_uc011cui.1_Intron|FAM172A_uc011cuj.1_Intron|FAM172A_uc003kkm.3_Intron	NM_032042	NP_114431	Q8WUF8	F172A_HUMAN	hypothetical protein LOC83989 isoform 1							endoplasmic reticulum|extracellular region					0						CTTCTGAATTAAAAACTATTT	0.239													14	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	114727034	114727034	+	IGR	DEL	A	-	-			TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:114727034delA								CCDC112 (94576 upstream) : FEM1C (129574 downstream)																							CATGTACTCCAAAAGCAGGTC	0.498													74	35	---	---	---	---	
UBLCP1	134510	broad.mit.edu	37	5	158702410	158702410	+	Intron	DEL	G	-	-			TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:158702410delG	uc003lxq.2	+							NM_145049	NP_659486	Q8WVY7	UBCP1_HUMAN	ubiquitin-like domain containing CTD phosphatase							nucleus	phosphoprotein phosphatase activity			ovary(1)	1	Renal(175;0.00196)	Medulloblastoma(196;0.0523)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			AAGGTTAAAAGAttttttttt	0.139													7	5	---	---	---	---	
CCNG1	900	broad.mit.edu	37	5	162866031	162866031	+	Intron	DEL	A	-	-	rs72299838		TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:162866031delA	uc003lzb.2	+						CCNG1_uc011dek.1_Intron|CCNG1_uc011del.1_Intron|CCNG1_uc003lzc.2_Intron	NM_199246	NP_954854	P51959	CCNG1_HUMAN	cyclin G1						cell division|mitosis|regulation of cyclin-dependent protein kinase activity	nucleus				lung(1)|kidney(1)	2	Renal(175;0.000281)	Medulloblastoma(196;0.00853)|all_neural(177;0.0408)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0597)|OV - Ovarian serous cystadenocarcinoma(192;0.107)|Epithelial(171;0.164)		actccttctcaaaaaaaaaaa	0.169													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	170261080	170261082	+	IGR	DEL	CAT	-	-	rs111380690		TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:170261080_170261082delCAT								GABRP (20032 upstream) : RANBP17 (27940 downstream)																							ccaccatcaccatcaccaccacc	0.118													4	2	---	---	---	---	
NOP16	51491	broad.mit.edu	37	5	175814066	175814069	+	Intron	DEL	TCTC	-	-	rs145796794		TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:175814066_175814069delTCTC	uc011dfl.1	-						NOP16_uc003med.2_Intron|NOP16_uc003mee.2_Intron|NOP16_uc011dfm.1_Intron|HIGD2A_uc003meg.2_5'Flank	NM_016391	NP_057475	Q9Y3C1	NOP16_HUMAN	NOP16 nucleolar protein homolog							nucleolus				ovary(1)|central_nervous_system(1)	2						GGAGGCTTTTTCTCTCTCtctctc	0.245													9	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	7481945	7481945	+	IGR	DEL	G	-	-			TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:7481945delG								RIOK1 (63677 upstream) : DSP (59925 downstream)																							CATGAGGACAGGGCTGTCGGG	0.572													11	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	46946468	46946473	+	IGR	DEL	ACACAC	-	-	rs3997194		TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:46946468_46946473delACACAC								GPR116 (23793 upstream) : GPR110 (21341 downstream)																							GAAAATacatacacacacacacacac	0.214													4	3	---	---	---	---	
KHDC1	80759	broad.mit.edu	37	6	74000432	74000436	+	Intron	DEL	TCACT	-	-			TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:74000432_74000436delTCACT	uc003pgo.2	-						uc003pgq.2_RNA|C6orf147_uc011dym.1_Intron	NM_030568	NP_085045	Q4VXA5	KHDC1_HUMAN	KH homology domain containing 1							integral to membrane	RNA binding			skin(1)	1						GTATTGCTGGTCACTTCACTTCTGG	0.493													8	6	---	---	---	---	
ECT2L	345930	broad.mit.edu	37	6	139170711	139170711	+	Intron	DEL	T	-	-	rs72395106		TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:139170711delT	uc003qif.1	+						ECT2L_uc011edq.1_Intron	NM_001077706	NP_001071174	Q008S8	ECT2L_HUMAN	epithelial cell transforming sequence 2						regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity				0						AAAGCGAAGCttttttttttt	0.229													6	3	---	---	---	---	
SLC22A2	6582	broad.mit.edu	37	6	160677934	160677934	+	Intron	DEL	C	-	-	rs2504941		TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:160677934delC	uc003qtf.2	-						SLC22A2_uc003qte.1_Intron|SLC22A2_uc003qth.1_Intron	NM_003058	NP_003049	O15244	S22A2_HUMAN	solute carrier family 22 member 2						body fluid secretion|neurotransmitter biosynthetic process|neurotransmitter secretion	integral to plasma membrane|membrane fraction	neurotransmitter transporter activity|organic cation transmembrane transporter activity			breast(1)|skin(1)	2		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;2.28e-17)|BRCA - Breast invasive adenocarcinoma(81;6.29e-06)		CTCTCTCTCtctttttttttt	0.169													4	2	---	---	---	---	
ATP6V0A4	50617	broad.mit.edu	37	7	138400253	138400255	+	Intron	DEL	TGT	-	-	rs35618960		TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:138400253_138400255delTGT	uc003vuf.2	-						ATP6V0A4_uc003vug.2_Intron|ATP6V0A4_uc003vuh.2_Intron	NM_130841	NP_570856	Q9HBG4	VPP4_HUMAN	ATPase, H+ transporting, lysosomal V0 subunit						cellular iron ion homeostasis|excretion|insulin receptor signaling pathway|ossification|regulation of pH|sensory perception of sound|transferrin transport	apical plasma membrane|brush border membrane|endosome membrane|integral to membrane|proton-transporting two-sector ATPase complex, proton-transporting domain	ATPase binding|hydrogen ion transmembrane transporter activity			pancreas(1)	1						gccaaatttgtgttgttttaagc	0.123													1	9	---	---	---	---	
FAM66D	100132923	broad.mit.edu	37	8	12397630	12397631	+	Intron	INS	-	A	A	rs144512072	by1000genomes	TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:12397630_12397631insA	uc011kxp.1	+						uc003wvm.1_Intron|uc003wvv.2_Intron|uc003wvw.1_Intron|uc003wvx.1_Intron|uc003wvy.3_Intron					Homo sapiens cDNA FLJ37098 fis, clone BRACE2019004.												0						ATACTATTATTAATTTTGGGGG	0.208													4	3	---	---	---	---	
RBPMS	11030	broad.mit.edu	37	8	30336999	30337000	+	Intron	INS	-	T	T			TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:30336999_30337000insT	uc003xic.1	+						RBPMS_uc003xid.1_Intron|RBPMS_uc003xie.1_Intron|RBPMS_uc003xif.1_Intron|RBPMS_uc011lba.1_Intron|RBPMS_uc003xib.2_Intron|RBPMS_uc010lvh.1_Intron	NM_006867	NP_006858	Q93062	RBPMS_HUMAN	RNA-binding protein with multiple splicing						positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of SMAD protein import into nucleus|regulation of transcription, DNA-dependent|RNA processing|transcription, DNA-dependent	cytoplasm|nucleus	nucleotide binding|poly(A) RNA binding|protein binding|transcription coactivator activity			ovary(1)	1				KIRC - Kidney renal clear cell carcinoma(542;0.144)|Kidney(114;0.172)		ACTGCACAGTCTAAGAGGGAGG	0.371													55	29	---	---	---	---	
CPNE3	8895	broad.mit.edu	37	8	87560829	87560829	+	Intron	DEL	T	-	-			TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:87560829delT	uc003ydv.2	+						CPNE3_uc003ydw.1_Intron	NM_003909	NP_003900	O75131	CPNE3_HUMAN	copine III						lipid metabolic process|vesicle-mediated transport	cytosol	calcium-dependent phospholipid binding|protein serine/threonine kinase activity|transporter activity			ovary(1)|skin(1)	2						AATCTTGCTGTTTACCTTAGA	0.368													8	9	---	---	---	---	
RCL1	10171	broad.mit.edu	37	9	4803727	4803727	+	Intron	DEL	A	-	-			TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:4803727delA	uc003zis.2	+						RCL1_uc003zit.2_Intron|RCL1_uc010mhk.1_Intron	NM_005772	NP_005763	Q9Y2P8	RCL1_HUMAN	RNA terminal phosphate cyclase-like 1						ribosome biogenesis|RNA processing	nucleolus	RNA-3'-phosphate cyclase activity				0	all_hematologic(13;0.137)	Acute lymphoblastic leukemia(23;0.0206)|Breast(48;0.147)		GBM - Glioblastoma multiforme(50;0.0244)		TGTGAAAGGTAAAAAAAAAAA	0.458													3	3	---	---	---	---	
PTPRD	5789	broad.mit.edu	37	9	8331407	8331416	+	Intron	DEL	TTATTTTCAC	-	-	rs10976963		TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:8331407_8331416delTTATTTTCAC	uc003zkk.2	-						PTPRD_uc003zkp.2_Intron|PTPRD_uc003zkq.2_Intron|PTPRD_uc003zkr.2_Intron|PTPRD_uc003zks.2_Intron|PTPRD_uc003zkl.2_Intron|PTPRD_uc003zkm.2_Intron|PTPRD_uc003zkn.2_Intron|PTPRD_uc003zko.2_Intron	NM_002839	NP_002830	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D						transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(14)|large_intestine(3)|ovary(2)|breast(2)|urinary_tract(1)	22		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)		TTTCCTCTGATTATTTTCACTTATTTTCAC	0.276										TSP Lung(15;0.13)			6	3	---	---	---	---	
FBXW2	26190	broad.mit.edu	37	9	123540575	123540576	+	Intron	DEL	TG	-	-			TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:123540575_123540576delTG	uc004bkl.1	-						FBXW2_uc011lyc.1_Intron|FBXW2_uc004bkn.2_Intron|FBXW2_uc004bkm.1_Intron|FBXW2_uc010mvj.1_Intron	NM_012164	NP_036296	Q9UKT8	FBXW2_HUMAN	F-box and WD repeat domain containing 2						proteolysis		protein binding|ubiquitin-protein ligase activity			urinary_tract(1)|ovary(1)|pancreas(1)|skin(1)	4						TCTTGGCTCCTGGCTTAAAAGG	0.441													37	17	---	---	---	---	
GTPBP4	23560	broad.mit.edu	37	10	1046481	1046481	+	Intron	DEL	T	-	-			TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:1046481delT	uc001ift.2	+						GTPBP4_uc010qac.1_Intron|GTPBP4_uc001ifu.2_Intron|GTPBP4_uc010qad.1_Intron|GTPBP4_uc010qae.1_Intron	NM_012341	NP_036473	Q9BZE4	NOG1_HUMAN	G protein-binding protein CRFG						negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of cell-cell adhesion|negative regulation of collagen binding|negative regulation of DNA replication|negative regulation of protein ubiquitination|protein stabilization|regulation of cyclin-dependent protein kinase activity|ribosome biogenesis	nucleolus|perinuclear region of cytoplasm	GTP binding|GTPase activity|protein binding			ovary(1)|skin(1)	2		all_epithelial(10;0.107)|Colorectal(49;0.14)	OV - Ovarian serous cystadenocarcinoma(33;0.0814)	Epithelial(11;0.0513)|all cancers(11;0.135)|OV - Ovarian serous cystadenocarcinoma(14;0.173)		ccagccCTACTTTTTTTTTTT	0.209													4	3	---	---	---	---	
ZNF33A	7581	broad.mit.edu	37	10	38301511	38301511	+	Intron	DEL	T	-	-			TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:38301511delT	uc001izh.2	+						ZNF33A_uc001izg.2_Intron|ZNF33A_uc010qev.1_Intron|ZNF33A_uc001izi.1_Intron	NM_006974	NP_008905	Q06730	ZN33A_HUMAN	zinc finger protein 33A isoform b							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)|skin(1)	3						aggcgcatgctgccacgcctg	0.000													8	4	---	---	---	---	
LIPF	8513	broad.mit.edu	37	10	90433701	90433708	+	Intron	DEL	ACATGAAG	-	-			TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:90433701_90433708delACATGAAG	uc001kfg.1	+						LIPF_uc001kfh.1_Intron|LIPF_uc010qmt.1_Intron|LIPF_uc010qmu.1_Intron	NM_004190	NP_004181	P07098	LIPG_HUMAN	lipase, gastric precursor						lipid catabolic process|triglyceride metabolic process	extracellular region	lipid binding|triglyceride lipase activity				0		Colorectal(252;0.0161)		Colorectal(12;3.91e-05)|COAD - Colon adenocarcinoma(12;5.43e-05)		CAAATAAACAACATGAAGAAAAAACACA	0.361													4	4	---	---	---	---	
ODF3	113746	broad.mit.edu	37	11	195918	195918	+	5'Flank	DEL	A	-	-			TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:195918delA	uc001lob.2	+						ODF3_uc010qvk.1_5'Flank|ODF3_uc001loc.2_5'Flank	NM_053280	NP_444510	Q96PU9	ODF3A_HUMAN	outer dense fiber of sperm tails 3						cell differentiation|multicellular organismal development|spermatogenesis	cytoplasm				ovary(1)	1		all_cancers(49;9.23e-07)|all_epithelial(84;0.000315)|Breast(177;0.00122)|Ovarian(85;0.0202)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;3.95e-27)|Epithelial(43;2.66e-26)|OV - Ovarian serous cystadenocarcinoma(40;5.55e-21)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.105)|LUSC - Lung squamous cell carcinoma(625;0.122)		CCTGGTGAGGAGGACCTGGTG	0.637													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	112332121	112332121	+	IGR	DEL	T	-	-			TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:112332121delT								PTS (191444 upstream) : NCAM1 (499874 downstream)																							TGATTTTATGTTTTTTTTTTT	0.378													3	4	---	---	---	---	
KDM5A	5927	broad.mit.edu	37	12	459594	459594	+	Intron	DEL	A	-	-			TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:459594delA	uc001qif.1	-						KDM5A_uc001qie.1_Intron|KDM5A_uc010sdn.1_Intron|KDM5A_uc010sdo.1_Intron	NM_001042603	NP_001036068	P29375	KDM5A_HUMAN	retinoblastoma binding protein 2 isoform 1						chromatin modification|multicellular organismal development|positive regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	cytoplasm|nucleolus	DNA binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(2)|ovary(1)	3						attccttctcaaaaaaaaaaa	0.104			T 	NUP98	AML								4	3	---	---	---	---	
COL2A1	1280	broad.mit.edu	37	12	48380331	48380332	+	Intron	INS	-	G	G	rs144941834	by1000genomes	TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:48380331_48380332insG	uc001rqu.2	-						COL2A1_uc009zkw.2_Intron|COL2A1_uc001rqv.2_Intron	NM_001844	NP_001835	P02458	CO2A1_HUMAN	collagen, type II, alpha 1 isoform 1 precursor						axon guidance|collagen fibril organization|embryonic skeletal joint morphogenesis|sensory perception of sound|visual perception	collagen type II	identical protein binding|platelet-derived growth factor binding			ovary(1)|skin(1)	2		Acute lymphoblastic leukemia(13;0.108)|all_hematologic(14;0.214)			Collagenase(DB00048)	GTTTCAGGGCTGGGGGGGGGCT	0.550													6	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	106563739	106563739	+	IGR	DEL	T	-	-			TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:106563739delT								NUAK1 (29928 upstream) : CKAP4 (67921 downstream)																							GCACTAAACCTTTTTTTTCCA	0.522													4	2	---	---	---	---	
STX2	2054	broad.mit.edu	37	12	131285613	131285613	+	Intron	DEL	A	-	-			TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:131285613delA	uc001uio.2	-						STX2_uc001uip.2_Intron|STX2_uc010tbj.1_Intron	NM_194356	NP_919337	P32856	STX2_HUMAN	syntaxin 2 isoform 2						acrosome reaction|ectoderm development|intracellular protein transport|organ morphogenesis|signal transduction	basolateral plasma membrane|integral to membrane|microsome|soluble fraction	calcium-dependent protein binding|SNAP receptor activity				0	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.79e-06)|all cancers(50;5.27e-05)|Epithelial(86;5.29e-05)		GCTTTCCTAGATACATCCACT	0.279													27	15	---	---	---	---	
PDS5B	23047	broad.mit.edu	37	13	33315050	33315050	+	Intron	DEL	T	-	-			TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:33315050delT	uc010abf.2	+						PDS5B_uc010abg.2_Intron	NM_015032	NP_055847	Q9NTI5	PDS5B_HUMAN	PDS5, regulator of cohesion maintenance, homolog						cell division|cell proliferation|mitotic sister chromatid cohesion|negative regulation of cell proliferation	chromatin|nucleus	ATP binding|DNA binding|identical protein binding			ovary(2)|lung(1)|pancreas(1)	4		Lung SC(185;0.0367)		all cancers(112;5.55e-06)|Epithelial(112;2.7e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00303)|BRCA - Breast invasive adenocarcinoma(63;0.0204)		CCTTTCAACCTTTTTTTTTTT	0.358													8	4	---	---	---	---	
CDADC1	81602	broad.mit.edu	37	13	49842345	49842345	+	Intron	DEL	T	-	-			TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:49842345delT	uc001vcu.2	+						CDADC1_uc010tgk.1_Intron|CDADC1_uc001vcv.2_Intron	NM_030911	NP_112173	Q9BWV3	CDAC1_HUMAN	cytidine and dCMP deaminase domain containing 1								hydrolase activity|zinc ion binding			upper_aerodigestive_tract(1)	1		Lung NSC(96;0.000705)|Breast(56;0.0011)|Prostate(109;0.00446)|Hepatocellular(98;0.0556)|Glioma(44;0.236)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;1.06e-08)|COAD - Colon adenocarcinoma(199;0.216)		GACCCTTGAGTAGACAACTCT	0.388													5	4	---	---	---	---	
MYCBP2	23077	broad.mit.edu	37	13	77644557	77644557	+	Intron	DEL	T	-	-			TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:77644557delT	uc001vkf.2	-						MYCBP2_uc010aev.2_Intron|MYCBP2_uc001vke.2_Intron	NM_015057	NP_055872	O75592	MYCB2_HUMAN	MYC binding protein 2						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ligase activity|protein binding|zinc ion binding			ovary(4)|breast(4)|skin(3)|lung(2)|pancreas(1)	14		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)		tttcttgcaatttttttttta	0.000													3	3	---	---	---	---	
COX16	51241	broad.mit.edu	37	14	70793016	70793016	+	3'UTR	DEL	A	-	-	rs71744102		TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:70793016delA	uc001xmb.2	-	4						NM_016468	NP_057552	Q9P0S2	COX16_HUMAN	COX16 cytochrome c oxidase assembly homolog							integral to membrane|mitochondrial membrane					0						atttttatttaaaaaaaaaaa	0.353													6	3	---	---	---	---	
ACOT2	10965	broad.mit.edu	37	14	74036674	74036675	+	Intron	INS	-	C	C	rs139052625	by1000genomes	TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:74036674_74036675insC	uc001xon.3	+						ACOT1_uc010tuc.1_Intron|ACOT2_uc001xom.2_Intron	NM_006821	NP_006812	P49753	ACOT2_HUMAN	acyl-CoA thioesterase 2						acyl-CoA metabolic process|long-chain fatty acid metabolic process|very long-chain fatty acid metabolic process	mitochondrion	carboxylesterase activity|palmitoyl-CoA hydrolase activity|protein binding			skin(1)	1				BRCA - Breast invasive adenocarcinoma(234;0.0033)|OV - Ovarian serous cystadenocarcinoma(108;0.0639)		TTATGTGTATgcccccccgccg	0.272													4	3	---	---	---	---	
VSX2	338917	broad.mit.edu	37	14	74711683	74711690	+	Intron	DEL	GTGAGAGA	-	-	rs12587547		TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:74711683_74711690delGTGAGAGA	uc001xpq.2	+							NM_182894	NP_878314	P58304	VSX2_HUMAN	visual system homeobox 2						multicellular organismal development|response to stimulus|visual perception	nucleolus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(234;0.00154)		gtgtgtgtgtgtgagagagagagagaga	0.163													4	3	---	---	---	---	
ZNF646	9726	broad.mit.edu	37	16	31089750	31089751	+	Frame_Shift_Ins	INS	-	T	T			TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31089750_31089751insT	uc002eap.2	+	2	2394_2395	c.2105_2106insT	c.(2104-2106)AATfs	p.N702fs		NM_014699	NP_055514	O15015	ZN646_HUMAN	zinc finger protein 646	702					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			breast(2)	2						CTAGAAGACAATGAAGGCCTGG	0.619													79	39	---	---	---	---	
CNGB1	1258	broad.mit.edu	37	16	57919481	57919484	+	Intron	DEL	TCTT	-	-	rs5817124	by1000genomes	TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57919481_57919484delTCTT	uc002emt.2	-						CNGB1_uc010cdh.2_Intron	NM_001297	NP_001288	Q14028	CNGB1_HUMAN	cyclic nucleotide gated channel beta 1 isoform						sensory perception of smell	intracellular cyclic nucleotide activated cation channel complex	cAMP binding|intracellular cAMP activated cation channel activity			breast(3)|pancreas(1)	4						tctctctctctctttctttctttc	0.000													3	5	---	---	---	---	
LRRC50	123872	broad.mit.edu	37	16	84193579	84193579	+	Intron	DEL	T	-	-	rs11292642		TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:84193579delT	uc002fhl.3	+						LRRC50_uc010vnw.1_Intron	NM_178452	NP_848547	Q8NEP3	DAAF1_HUMAN	leucine rich repeat containing 50						axonemal dynein complex assembly|cilium morphogenesis	cilium axoneme|cytoplasm|spindle pole	dynein binding				0						TATTCATAGATTTTTTTatat	0.154									Kartagener_syndrome				2	7	---	---	---	---	
ZFPM1	161882	broad.mit.edu	37	16	88593211	88593211	+	Intron	DEL	T	-	-	rs35678431		TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:88593211delT	uc002fkv.2	+							NM_153813	NP_722520	Q8IX07	FOG1_HUMAN	zinc finger protein, multitype 1						blood coagulation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleoplasm	DNA binding|transcription factor binding|zinc ion binding			central_nervous_system(1)	1				BRCA - Breast invasive adenocarcinoma(80;0.0478)		GTTCCTACCCTCCCCCCCCAG	0.687													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	34292045	34292046	+	IGR	INS	-	A	A			TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34292045_34292046insA								LYZL6 (21374 upstream) : CCL16 (11490 downstream)																							gactccgtttcaaaaaaaaaaa	0.124													4	2	---	---	---	---	
SPAG9	9043	broad.mit.edu	37	17	49076857	49076858	+	Intron	INS	-	A	A			TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:49076857_49076858insA	uc002itc.2	-						SPAG9_uc002itb.2_Intron|SPAG9_uc002itd.2_Intron|SPAG9_uc002itf.2_Intron|SPAG9_uc002ita.2_Intron|SPAG9_uc002ite.2_Intron	NM_001130528	NP_001124000	O60271	JIP4_HUMAN	sperm associated antigen 9 isoform 1						positive regulation of cell migration|positive regulation of muscle cell differentiation|retrograde transport, endosome to Golgi|spermatogenesis	acrosomal vesicle|integral to membrane|perinuclear region of cytoplasm				lung(4)|breast(1)	5			BRCA - Breast invasive adenocarcinoma(22;4.24e-07)			CACtatatattaaaaaaaaaaa	0.322													6	4	---	---	---	---	
MED13	9969	broad.mit.edu	37	17	60070140	60070141	+	Intron	INS	-	T	T	rs138009503	by1000genomes	TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:60070140_60070141insT	uc002izo.2	-							NM_005121	NP_005112	Q9UHV7	MED13_HUMAN	mediator complex subunit 13						androgen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			large_intestine(1)|ovary(1)	2						cttattattacttttttttgag	0.000													3	3	---	---	---	---	
L3MBTL4	91133	broad.mit.edu	37	18	6322509	6322510	+	Intron	INS	-	A	A	rs143247312	by1000genomes	TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:6322509_6322510insA	uc002kmz.3	-						L3MBTL4_uc010dkt.2_Intron	NM_173464	NP_775735	Q8NA19	LMBL4_HUMAN	l(3)mbt-like 4						chromatin modification	nucleus	sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(2)|pancreas(1)	3		Colorectal(10;0.0249)				aggaaagaaggaaaaaaaaaac	0.000													4	2	---	---	---	---	
SLC14A2	8170	broad.mit.edu	37	18	43212094	43212097	+	Intron	DEL	GTGT	-	-			TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:43212094_43212097delGTGT	uc010dnj.2	+						SLC14A2_uc002lbb.2_Intron|SLC14A2_uc002lbe.2_Intron	NM_007163	NP_009094	Q15849	UT2_HUMAN	solute carrier family 14 (urea transporter),							apical plasma membrane|integral to membrane|membrane fraction	protein binding|urea transmembrane transporter activity			upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)|skin(1)	4						CAAGACAAGGgtgtgtgtgtgtgt	0.265													5	5	---	---	---	---	
UNC13A	23025	broad.mit.edu	37	19	17757078	17757079	+	Intron	INS	-	TGTT	TGTT	rs142508123	by1000genomes	TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17757078_17757079insTGTT	uc002nhd.2	-							NM_001080421	NP_001073890	Q9UPW8	UN13A_HUMAN	unc-13 homolog A						exocytosis|intracellular signal transduction	cell junction|cytoplasm|presynaptic membrane	metal ion binding			ovary(3)	3						Ggttttttgtgtgtttgtttgt	0.272													8	5	---	---	---	---	
HIF3A	64344	broad.mit.edu	37	19	46811249	46811264	+	Intron	DEL	AGACAGACAGATAGAT	-	-	rs59977344	by1000genomes	TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46811249_46811264delAGACAGACAGATAGAT	uc002peh.2	+						HIF3A_uc002pef.1_Intron|HIF3A_uc002peg.3_Intron|HIF3A_uc010xxx.1_Intron|HIF3A_uc002pei.3_Intron|HIF3A_uc002pej.1_Intron|HIF3A_uc002pek.2_Intron|HIF3A_uc010xxy.1_Intron|HIF3A_uc002pel.2_Intron|HIF3A_uc010xxz.1_Intron	NM_152795	NP_690008	Q9Y2N7	HIF3A_HUMAN	hypoxia inducible factor 3, alpha subunit						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|signal transducer activity			upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3		Ovarian(192;0.00965)|all_neural(266;0.0887)		OV - Ovarian serous cystadenocarcinoma(262;0.00204)|all cancers(93;0.0107)|GBM - Glioblastoma multiforme(486;0.0489)|Epithelial(262;0.136)		acagacagacagacagacagatagatagatagatag	0.000													6	4	---	---	---	---	
PRR12	57479	broad.mit.edu	37	19	50123757	50123757	+	Intron	DEL	G	-	-			TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50123757delG	uc002poo.3	+							NM_020719	NP_065770	Q9ULL5	PRR12_HUMAN	proline rich 12								DNA binding			central_nervous_system(1)|pancreas(1)	2		all_lung(116;2.45e-07)|Lung NSC(112;1.24e-06)|Ovarian(192;0.0728)|all_neural(266;0.0887)		OV - Ovarian serous cystadenocarcinoma(262;0.00319)|GBM - Glioblastoma multiforme(134;0.0132)		ctggggaggaggggggggggc	0.249													4	2	---	---	---	---	
AP2A1	160	broad.mit.edu	37	19	50309616	50309618	+	Intron	DEL	CCT	-	-	rs35426636		TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50309616_50309618delCCT	uc002ppn.2	+						AP2A1_uc002ppo.2_Intron|AP2A1_uc010enk.2_Intron	NM_014203	NP_055018	O95782	AP2A1_HUMAN	adaptor-related protein complex 2, alpha 1						axon guidance|endocytosis|epidermal growth factor receptor signaling pathway|Golgi to endosome transport|intracellular protein transport|negative regulation of epidermal growth factor receptor signaling pathway|nerve growth factor receptor signaling pathway|regulation of defense response to virus by virus|synaptic transmission|viral reproduction	AP-2 adaptor complex|clathrin coat of trans-Golgi network vesicle|cytosol	protein binding|protein transporter activity			ovary(2)	2		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.0023)|GBM - Glioblastoma multiforme(134;0.0157)		CCACTTTGACCCTCCTCCTCTCA	0.532													5	7	---	---	---	---	
PPP1R12C	54776	broad.mit.edu	37	19	55605557	55605558	+	Intron	INS	-	CTT	CTT			TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55605557_55605558insCTT	uc002qix.2	-						PPP1R12C_uc010yfs.1_Intron|PPP1R12C_uc002qiy.2_Intron	NM_017607	NP_060077	Q9BZL4	PP12C_HUMAN	protein phosphatase 1, regulatory subunit 12C							cytoplasm				ovary(1)|central_nervous_system(1)	2			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0449)		gacctccagcccctcctccctc	0.000													4	2	---	---	---	---	
DSN1	79980	broad.mit.edu	37	20	35396636	35396636	+	Intron	DEL	A	-	-			TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35396636delA	uc010gfr.2	-						DSN1_uc002xfz.2_Intron|DSN1_uc002xfy.3_Intron|DSN1_uc002xga.2_Intron|DSN1_uc010zvs.1_Intron|DSN1_uc002xgc.2_Intron|DSN1_uc002xgb.2_Intron	NM_001145316	NP_001138788	Q9H410	DSN1_HUMAN	DSN1, MIND kinetochore complex component,						cell division|chromosome segregation|mitotic prometaphase	cytosol|MIS12/MIND type complex|nucleus	protein binding			ovary(2)	2		Myeloproliferative disorder(115;0.00874)				ATCTAAACTTAAAAAAAAAAA	0.194													4	2	---	---	---	---	
CSE1L	1434	broad.mit.edu	37	20	47702100	47702113	+	Intron	DEL	TTTTTTTTTTTTTT	-	-	rs34674106		TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47702100_47702113delTTTTTTTTTTTTTT	uc002xty.2	+						CSE1L_uc010zyg.1_Intron|CSE1L_uc010ghx.2_Intron|CSE1L_uc010ghy.2_Intron|CSE1L_uc010zyh.1_Intron	NM_001316	NP_001307	P55060	XPO2_HUMAN	CSE1 chromosome segregation 1-like protein						apoptosis|cell proliferation|intracellular protein transport	cytoplasm|nucleus	importin-alpha export receptor activity			large_intestine(1)|skin(1)	2			BRCA - Breast invasive adenocarcinoma(12;0.000491)|Colorectal(8;0.198)			CTAACAATAAtttttttttttttttttttttttt	0.121													4	2	---	---	---	---	
GCFC1	94104	broad.mit.edu	37	21	34133202	34133205	+	Intron	DEL	GTGC	-	-			TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:34133202_34133205delGTGC	uc002yqn.2	-						GCFC1_uc002yqo.2_Intron|GCFC1_uc002yqp.2_Intron|GCFC1_uc002yqr.2_Intron	NM_016631	NP_057715	Q9Y5B6	GCFC1_HUMAN	GC-rich sequence DNA-binding factor candidate							cytosol|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(2)	2						GTGTCTCtgtgtgcgtgcgtgcgt	0.270													6	4	---	---	---	---	
DSCAM	1826	broad.mit.edu	37	21	41384834	41384835	+	3'UTR	INS	-	TT	TT	rs11451228		TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:41384834_41384835insTT	uc002yyq.1	-	33					DSCAM_uc002yyr.1_RNA	NM_001389	NP_001380	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule isoform						cell adhesion|dendrite self-avoidance|negative regulation of cell adhesion|positive regulation of axon extension involved in axon guidance|positive regulation of phosphorylation	axon|extracellular region|growth cone|integral to plasma membrane|membrane fraction	protein binding			ovary(6)|skin(4)|upper_aerodigestive_tract(1)	11		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)				AGTATTTTCTCttttttttttt	0.317													4	2	---	---	---	---	
KRTAP10-9	386676	broad.mit.edu	37	21	46048132	46048132	+	3'UTR	DEL	C	-	-	rs67739305		TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:46048132delC	uc002zfp.3	+	1					C21orf29_uc002zfe.1_Intron|C21orf29_uc010gpv.1_Intron	NM_198690	NP_941963	P60411	KR109_HUMAN	keratin associated protein 10-9							keratin filament					0						TCCCTGACCTCCCCCCCGGGC	0.697													6	4	---	---	---	---	
LOC96610	96610	broad.mit.edu	37	22	22511995	22511995	+	Intron	DEL	A	-	-	rs5844486		TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22511995delA	uc011aim.1	+											Parts of antibodies, mostly variable regions.												0						CTGACCCCTCAAGGGGCCCAG	0.552													2	6	---	---	---	---	
PARVG	64098	broad.mit.edu	37	22	44581576	44581577	+	Intron	INS	-	G	G			TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:44581576_44581577insG	uc011aqe.1	+						PARVG_uc010gzo.2_Intron|PARVG_uc010gzp.2_Intron|PARVG_uc003bep.2_Intron|PARVG_uc010gzq.1_Intron|PARVG_uc010gzr.1_Intron|PARVG_uc011aqf.1_Intron|PARVG_uc003beq.2_Intron|PARVG_uc003ber.2_Intron	NM_001137605	NP_001131077	Q9HBI0	PARVG_HUMAN	parvin, gamma						cell-matrix adhesion	cytoplasm|cytoskeleton|focal adhesion	actin binding				0		Ovarian(80;0.024)|all_neural(38;0.0299)				CGGAAGTGGCAGGACCGGTGCC	0.540													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	3720516	3720517	+	IGR	INS	-	T	T	rs35895769		TCGA-A3-3383-01A-01D-0966-08	TCGA-A3-3383-11A-01D-0966-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:3720516_3720517insT								TGIF2LY (272436 upstream) : None (None downstream)																							TTTTTTTCCCATTTTTTCTCTT	0.347													8	6	---	---	---	---	
