Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
KIF1B	23095	broad.mit.edu	37	1	10318553	10318553	+	Silent	SNP	C	T	T	rs141998703	byFrequency	TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:10318553C>T	uc001aqx.3	+	4	388	c.186C>T	c.(184-186)CCC>CCT	p.P62P	KIF1B_uc001aqv.3_Silent_p.P62P|KIF1B_uc001aqw.3_Silent_p.P62P|KIF1B_uc001aqy.2_Silent_p.P62P|KIF1B_uc001aqz.2_Silent_p.P62P|KIF1B_uc001ara.2_Silent_p.P62P|KIF1B_uc001arb.2_Silent_p.P62P|KIF1B_uc009vmt.2_RNA	NM_015074	NP_055889	O60333	KIF1B_HUMAN	kinesin family member 1B isoform b	62	Kinesin-motor.				anterograde axon cargo transport|apoptosis|neuromuscular synaptic transmission|neuron-neuron synaptic transmission	cytoplasmic vesicle membrane|microtubule|microtubule associated complex|mitochondrion	ATP binding|ATPase activity|kinesin binding|microtubule motor activity|protein binding			ovary(2)|upper_aerodigestive_tract(1)	3	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.2e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0259)|Colorectal(212;9.79e-07)|COAD - Colon adenocarcinoma(227;0.000143)|BRCA - Breast invasive adenocarcinoma(304;0.000413)|Kidney(185;0.00134)|KIRC - Kidney renal clear cell carcinoma(229;0.0037)|STAD - Stomach adenocarcinoma(132;0.0113)|READ - Rectum adenocarcinoma(331;0.0642)		CTTTACAGCCCGAAGATCCCT	0.353													45	229	---	---	---	---	PASS
VPS13D	55187	broad.mit.edu	37	1	12460355	12460355	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12460355C>T	uc001atv.2	+	61	11893	c.11752C>T	c.(11752-11754)CCC>TCC	p.P3918S	VPS13D_uc001atw.2_Missense_Mutation_p.P3893S|VPS13D_uc001atx.2_Missense_Mutation_p.P3105S|VPS13D_uc009vnl.2_RNA	NM_015378	NP_056193	Q5THJ4	VP13D_HUMAN	vacuolar protein sorting 13D isoform 1	3917					protein localization					ovary(4)|pancreas(1)	5	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)		AGTGAAGTTCCCCAGTAAGAG	0.542													4	153	---	---	---	---	PASS
DDOST	1650	broad.mit.edu	37	1	20979188	20979188	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:20979188C>T	uc001bdo.1	-	10	1290	c.1147G>A	c.(1147-1149)GAC>AAC	p.D383N	DDOST_uc009vpw.1_Missense_Mutation_p.D386N|DDOST_uc010odd.1_Missense_Mutation_p.D182N|DDOST_uc010ode.1_Missense_Mutation_p.D346N	NM_005216	NP_005207	P39656	OST48_HUMAN	dolichyl-diphosphooligosaccharide-protein	383	Lumenal (Potential).				innate immune response|post-translational protein modification|response to cytokine stimulus|T cell activation	integral to membrane|microsome|oligosaccharyltransferase complex	dolichyl-diphosphooligosaccharide-protein glycotransferase activity|protein binding				0		all_lung(284;2.98e-05)|Lung NSC(340;3.25e-05)|Colorectal(325;3.46e-05)|Renal(390;0.000147)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0181)|COAD - Colon adenocarcinoma(152;1.17e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000141)|Kidney(64;0.000177)|GBM - Glioblastoma multiforme(114;0.00046)|KIRC - Kidney renal clear cell carcinoma(64;0.00262)|STAD - Stomach adenocarcinoma(196;0.00303)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		CCATACACGTCGGGCAACTTG	0.498													13	238	---	---	---	---	PASS
CLSPN	63967	broad.mit.edu	37	1	36205079	36205079	+	Silent	SNP	C	T	T			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:36205079C>T	uc001bzi.2	-	19	3275	c.3195G>A	c.(3193-3195)GTG>GTA	p.V1065V	CLSPN_uc009vux.2_Silent_p.V1001V	NM_022111	NP_071394	Q9HAW4	CLSPN_HUMAN	claspin	1065					activation of protein kinase activity|cell cycle|cellular component disassembly involved in apoptosis|DNA repair|DNA replication|G2/M transition DNA damage checkpoint|mitotic cell cycle DNA replication checkpoint|peptidyl-serine phosphorylation	nucleoplasm	anaphase-promoting complex binding|DNA binding			breast(2)|ovary(2)|central_nervous_system(1)|lung(1)|skin(1)|kidney(1)	8		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				CTTCGCTTCCCACATCACTTC	0.408													6	743	---	---	---	---	PASS
HECTD3	79654	broad.mit.edu	37	1	45471468	45471468	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:45471468G>T	uc009vxk.2	-	15	2031	c.1933C>A	c.(1933-1935)CTG>ATG	p.L645M	HECTD3_uc001cmx.3_5'Flank|HECTD3_uc001cmy.3_Missense_Mutation_p.L255M|HECTD3_uc010olh.1_Missense_Mutation_p.L361M	NM_024602	NP_078878	Q5T447	HECD3_HUMAN	HECT domain containing 3	645	HECT.				proteasomal ubiquitin-dependent protein catabolic process|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	perinuclear region of cytoplasm	ubiquitin-protein ligase activity				0	Acute lymphoblastic leukemia(166;0.155)					CTACTCACCAGCACAGAGTCC	0.358													9	57	---	---	---	---	PASS
TESK2	10420	broad.mit.edu	37	1	45810498	45810498	+	3'UTR	SNP	G	T	T			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:45810498G>T	uc001cns.1	-	11					TESK2_uc009vxr.1_3'UTR|TESK2_uc010olo.1_3'UTR|TESK2_uc009vxs.1_3'UTR	NM_007170	NP_009101	Q96S53	TESK2_HUMAN	testis-specific protein kinase 2						actin cytoskeleton organization|focal adhesion assembly|spermatogenesis	nucleus	ATP binding|metal ion binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(2)|breast(2)|pancreas(1)	5	Acute lymphoblastic leukemia(166;0.155)					AGGTGAGGCAGGGACTAAACC	0.587													14	38	---	---	---	---	PASS
CCDC17	149483	broad.mit.edu	37	1	46086385	46086385	+	Intron	SNP	G	C	C			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:46086385G>C	uc010olt.1	-						CCDC17_uc009vxy.2_Intron|CCDC17_uc010ols.1_Intron|CCDC17_uc001com.3_Intron|CCDC17_uc001con.3_RNA|CCDC17_uc009vxz.2_Intron	NM_001114938	NP_001108410	Q96LX7	CCD17_HUMAN	coiled-coil domain containing 17											ovary(1)	1	Acute lymphoblastic leukemia(166;0.155)					AGCTGCAGCTGGGCCCTCACC	0.433													21	44	---	---	---	---	PASS
ZYG11B	79699	broad.mit.edu	37	1	53245564	53245564	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:53245564C>A	uc001cuj.2	+	4	1186	c.991C>A	c.(991-993)CTG>ATG	p.L331M	ZYG11B_uc009vzg.2_RNA|ZYG11B_uc010onj.1_Missense_Mutation_p.L322M	NM_024646	NP_078922	Q9C0D3	ZY11B_HUMAN	zyg-11 homolog B	331							protein binding			upper_aerodigestive_tract(2)|ovary(1)|pancreas(1)	4						TGCAGAAGCACTGAAGCGTTA	0.378													105	374	---	---	---	---	PASS
SLC1A7	6512	broad.mit.edu	37	1	53569191	53569191	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:53569191T>C	uc001cuy.2	-	5	692	c.524A>G	c.(523-525)GAG>GGG	p.E175G		NM_006671	NP_006662	O00341	EAA5_HUMAN	solute carrier family 1 (glutamate transporter),	175	Extracellular (Potential).					integral to membrane|plasma membrane	high-affinity glutamate transmembrane transporter activity|sodium:dicarboxylate symporter activity			ovary(2)|large_intestine(1)	3				Colorectal(1306;0.234)	L-Glutamic Acid(DB00142)	AGGGGCCTCCTCTGGTGCCAC	0.637													4	70	---	---	---	---	PASS
TNNI3K	51086	broad.mit.edu	37	1	74819043	74819043	+	Silent	SNP	T	A	A			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:74819043T>A	uc001dgf.1	+	10	1077	c.1026T>A	c.(1024-1026)ACT>ACA	p.T342T	TNNI3K_uc001dgc.1_Silent_p.T443T|TNNI3K_uc001dgd.2_Silent_p.T443T|TNNI3K_uc001dge.1_Silent_p.T443T	NM_015978	NP_057062	Q59H18	TNI3K_HUMAN	TNNI3 interacting kinase isoform b	342	ANK 9.					cytoplasm|nucleus	ATP binding|metal ion binding|protein C-terminus binding|protein serine/threonine kinase activity|troponin I binding			large_intestine(4)|lung(3)|ovary(2)|upper_aerodigestive_tract(1)	10						ATGGGCACACTGGTAAGACTG	0.418													80	105	---	---	---	---	PASS
WDR63	126820	broad.mit.edu	37	1	85546981	85546981	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:85546981A>G	uc001dkt.2	+	4	359	c.168A>G	c.(166-168)ATA>ATG	p.I56M	WDR63_uc009wcl.2_Missense_Mutation_p.I56M	NM_145172	NP_660155	Q8IWG1	WDR63_HUMAN	WD repeat domain 63	56										upper_aerodigestive_tract(2)|ovary(2)|skin(1)	5				all cancers(265;0.00391)|Epithelial(280;0.00922)|Colorectal(170;0.166)		ACTGCCGAATAGATGAAGATG	0.368													5	331	---	---	---	---	PASS
POGZ	23126	broad.mit.edu	37	1	151400320	151400320	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151400320C>T	uc001eyd.1	-	7	1363	c.1057G>A	c.(1057-1059)GGA>AGA	p.G353R	POGZ_uc001eye.1_Missense_Mutation_p.G300R|POGZ_uc010pdb.1_Missense_Mutation_p.G344R|POGZ_uc001eyf.1_Missense_Mutation_p.G300R|POGZ_uc010pdc.1_Missense_Mutation_p.G291R|POGZ_uc009wmv.1_Missense_Mutation_p.G258R|POGZ_uc010pdd.1_Intron|POGZ_uc001eyg.1_Missense_Mutation_p.G353R	NM_015100	NP_055915	Q7Z3K3	POGZ_HUMAN	pogo transposable element with ZNF domain	353					cell division|kinetochore assembly|mitotic sister chromatid cohesion|regulation of transcription, DNA-dependent	cytoplasm|nuclear chromatin	DNA binding|protein binding|zinc ion binding			ovary(3)	3	Lung SC(34;0.00471)|Ovarian(49;0.00672)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			GACTCAGGTCCGCTGGTTCTT	0.458													73	137	---	---	---	---	PASS
ASH1L	55870	broad.mit.edu	37	1	155317569	155317569	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155317569C>A	uc009wqq.2	-	20	8176	c.7696G>T	c.(7696-7698)GAC>TAC	p.D2566Y	RAG1AP1_uc010pey.1_Intron|ASH1L_uc001fkt.2_Missense_Mutation_p.D2561Y|MIR555_hsa-mir-555|MI0003561_5'Flank	NM_018489	NP_060959	Q9NR48	ASH1L_HUMAN	absent, small, or homeotic 1-like	2566					cell-cell signaling|DNA packaging|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	chromosome|Golgi apparatus|nucleus|tight junction	DNA binding|histone-lysine N-methyltransferase activity|zinc ion binding			skin(5)|ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	11	Hepatocellular(266;0.0997)|all_neural(408;0.129)|all_hematologic(923;0.145)		Epithelial(20;1.74e-08)|all cancers(21;3.29e-08)|BRCA - Breast invasive adenocarcinoma(34;0.021)			TCACTGCTGTCTGCCTCACTT	0.498													6	265	---	---	---	---	PASS
YY1AP1	55249	broad.mit.edu	37	1	155642422	155642422	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155642422A>G	uc001fln.2	-	7	734	c.710T>C	c.(709-711)ATG>ACG	p.M237T	YY1AP1_uc001flg.2_5'Flank|YY1AP1_uc010pgg.1_Missense_Mutation_p.M76T|YY1AP1_uc010pgh.1_Missense_Mutation_p.M160T|YY1AP1_uc010pgi.1_Missense_Mutation_p.M309T|YY1AP1_uc001flh.2_Missense_Mutation_p.M309T|YY1AP1_uc009wqt.2_Missense_Mutation_p.M160T|YY1AP1_uc001flk.2_Missense_Mutation_p.M160T|YY1AP1_uc001fll.2_Missense_Mutation_p.M171T|YY1AP1_uc009wqv.2_5'UTR|YY1AP1_uc001flm.2_Missense_Mutation_p.M160T|YY1AP1_uc001fli.2_Missense_Mutation_p.M171T|YY1AP1_uc009wqu.2_Missense_Mutation_p.M4T|YY1AP1_uc001flj.2_Missense_Mutation_p.M171T|YY1AP1_uc009wqw.2_Missense_Mutation_p.M160T|YY1AP1_uc001flo.2_Missense_Mutation_p.M105T|YY1AP1_uc001flp.2_Missense_Mutation_p.M171T|YY1AP1_uc010pgj.1_Missense_Mutation_p.M237T|YY1AP1_uc009wqx.2_Missense_Mutation_p.M309T|YY1AP1_uc010pgk.1_Missense_Mutation_p.M309T	NM_139118	NP_620829	Q9H869	YYAP1_HUMAN	YY1-associated protein isoform 2	237					regulation of cell cycle|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	protein binding			ovary(2)|skin(1)	3	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)					AATCAGCTGCATAGCTCCCAT	0.473													54	238	---	---	---	---	PASS
TTC24	164118	broad.mit.edu	37	1	156552877	156552877	+	Silent	SNP	C	T	T			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156552877C>T	uc009wsc.1	+	2	254	c.114C>T	c.(112-114)AGC>AGT	p.S38S		NM_001105669	NP_001099139	A2A3L6	TTC24_HUMAN	tetratricopeptide repeat domain 24	318	TPR 7.						binding			pancreas(1)	1	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					GCTTTGGCAGCCTGGCCTTTG	0.652													19	24	---	---	---	---	PASS
CASQ1	844	broad.mit.edu	37	1	160171310	160171310	+	3'UTR	SNP	A	G	G			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160171310A>G	uc010pja.1	+	11						NM_001231	NP_001222	P31415	CASQ1_HUMAN	calsequestrin 1							mitochondrial matrix|sarcoplasmic reticulum lumen|smooth endoplasmic reticulum	calcium ion binding			central_nervous_system(1)	1	all_cancers(52;2.56e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			GTGCTGAGACACTGATCCCCC	0.483													4	26	---	---	---	---	PASS
USH2A	7399	broad.mit.edu	37	1	216219777	216219777	+	Silent	SNP	G	T	T			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:216219777G>T	uc001hku.1	-	32	6708	c.6321C>A	c.(6319-6321)GTC>GTA	p.V2107V		NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	2107	Extracellular (Potential).|Fibronectin type-III 7.				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		TCTTACCTGTGACTATGTAGT	0.313										HNSCC(13;0.011)			41	204	---	---	---	---	PASS
HEATR1	55127	broad.mit.edu	37	1	236757365	236757365	+	Silent	SNP	T	C	C			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236757365T>C	uc001hyd.1	-	9	1265	c.1140A>G	c.(1138-1140)GAA>GAG	p.E380E		NM_018072	NP_060542	Q9H583	HEAT1_HUMAN	protein BAP28	380					rRNA processing	nucleolus|ribonucleoprotein complex	protein binding			ovary(2)|skin(1)	3	Ovarian(103;0.0634)|Breast(184;0.133)	all_cancers(173;0.0255)|Prostate(94;0.175)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)			TAAGTATAGCTTCTAAGTGTC	0.303													7	576	---	---	---	---	PASS
FMN2	56776	broad.mit.edu	37	1	240370978	240370978	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:240370978C>A	uc010pyd.1	+	5	3091	c.2866C>A	c.(2866-2868)CCG>ACG	p.P956T	FMN2_uc010pye.1_Missense_Mutation_p.P960T	NM_020066	NP_064450	Q9NZ56	FMN2_HUMAN	formin 2	956	Pro-rich.|FH1.				actin cytoskeleton organization|establishment of meiotic spindle localization|intracellular signal transduction|meiotic chromosome movement towards spindle pole|meiotic metaphase I|multicellular organismal development|oogenesis|polar body extrusion after meiotic divisions		actin binding			ovary(4)|pancreas(3)|skin(3)|large_intestine(1)|central_nervous_system(1)	12	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			AATACCCCCTCCGCCCCCTCT	0.697													9	32	---	---	---	---	PASS
MYT1L	23040	broad.mit.edu	37	2	1946900	1946900	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1946900T>C	uc002qxe.2	-	9	1186	c.359A>G	c.(358-360)GAG>GGG	p.E120G	MYT1L_uc002qxd.2_Missense_Mutation_p.E120G	NM_015025	NP_055840	Q9UL68	MYT1L_HUMAN	myelin transcription factor 1-like	120	Asp/Glu-rich.				cell differentiation|nervous system development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|central_nervous_system(1)	6	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)		ctcctcgtcctcatccCCTGG	0.149													7	364	---	---	---	---	PASS
ITGB1BP1	9270	broad.mit.edu	37	2	9558787	9558787	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:9558787A>G	uc002qzj.2	-	2	217	c.40T>C	c.(40-42)TCC>CCC	p.S14P	ITGB1BP1_uc002qzk.2_Missense_Mutation_p.S14P|ITGB1BP1_uc002qzl.2_RNA|ITGB1BP1_uc002qzm.2_RNA|ITGB1BP1_uc010yiy.1_Intron|ITGB1BP1_uc002qzn.1_Missense_Mutation_p.S14P	NM_004763	NP_004754	O14713	ITBP1_HUMAN	integrin cytoplasmic domain-associated protein 1	14	Ser/Thr-rich.				cell migration|cell-matrix adhesion|intracellular protein kinase cascade	cytosol|lamellipodium|membrane|ruffle	protein binding|protein binding				0	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.23)		CTACTTTGGGAACTGCTACTA	0.393													8	750	---	---	---	---	PASS
WDR35	57539	broad.mit.edu	37	2	20114023	20114023	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:20114023T>C	uc002rdi.2	-	27	3278	c.3170A>G	c.(3169-3171)GAC>GGC	p.D1057G	WDR35_uc002rdj.2_Missense_Mutation_p.D1046G|WDR35_uc010ext.2_RNA|WDR35_uc002rdh.2_Intron	NM_001006657	NP_001006658	Q9P2L0	WDR35_HUMAN	WD repeat domain 35 isoform 1	1057										ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GTCTTCATAGTCTTTCAGGTG	0.393													7	230	---	---	---	---	PASS
MGAT4A	11320	broad.mit.edu	37	2	99272830	99272830	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:99272830G>A	uc002sze.2	-	7	997	c.683C>T	c.(682-684)TCC>TTC	p.S228F	MGAT4A_uc010yvm.1_Missense_Mutation_p.S100F|MGAT4A_uc010fil.2_5'UTR|MGAT4A_uc010fim.1_Missense_Mutation_p.S100F	NM_012214	NP_036346	Q9UM21	MGT4A_HUMAN	alpha-1,3-mannosyl-glycoprotein	228	Lumenal (Potential).				N-glycan processing|post-translational protein modification|protein N-linked glycosylation via asparagine	extracellular region|Golgi membrane|integral to membrane	alpha-1,3-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity|metal ion binding			skin(1)	1						TCTTTCTTTGGAGTCTCCAAA	0.368													186	365	---	---	---	---	PASS
IL1F9	56300	broad.mit.edu	37	2	113736198	113736198	+	5'UTR	SNP	T	A	A			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:113736198T>A	uc002tio.1	+	2					IL1F9_uc010fkr.1_5'UTR	NM_019618	NP_062564	Q9NZH8	IL36G_HUMAN	interleukin 1 family, member 9						cell-cell signaling	extracellular space	cytokine activity|interleukin-1 receptor antagonist activity				0						CTTTCACAGGTGCTGAGACAA	0.517													81	121	---	---	---	---	PASS
ACVR1C	130399	broad.mit.edu	37	2	158412667	158412667	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:158412667A>G	uc002tzk.3	-	3	725	c.482T>C	c.(481-483)GTA>GCA	p.V161A	ACVR1C_uc002tzl.3_Intron|ACVR1C_uc010fof.2_Intron|ACVR1C_uc010foe.2_Missense_Mutation_p.V111A	NM_145259	NP_660302	Q8NER5	ACV1C_HUMAN	activin A receptor, type IC isoform 1	161	Cytoplasmic (Potential).				apoptosis|cell differentiation|regulation of apoptosis	activin receptor complex	activin receptor activity, type I|ATP binding|transforming growth factor beta receptor activity			lung(3)|ovary(2)|skin(2)	7						TCCAGCATTTACCAGATTGCA	0.443													155	275	---	---	---	---	PASS
SCN1A	6323	broad.mit.edu	37	2	166896059	166896059	+	Silent	SNP	G	A	A			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:166896059G>A	uc010zcz.1	-	14	2448	c.2430C>T	c.(2428-2430)GCC>GCT	p.A810A	SCN1A_uc002udo.3_Silent_p.A690A|SCN1A_uc010fpk.2_Silent_p.A662A	NM_006920	NP_008851	P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha	821	Helical; Name=S2 of repeat II; (By similarity).|II.					voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(6)|skin(6)|large_intestine(1)	13					Lamotrigine(DB00555)|Levetiracetam(DB01202)|Phenacemide(DB01121)|Phenytoin(DB00252)|Topiramate(DB00273)|Zonisamide(DB00909)	AAGGATCCATGGCAATAATTT	0.363													6	321	---	---	---	---	PASS
SCN9A	6335	broad.mit.edu	37	2	167055543	167055543	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:167055543G>T	uc010fpl.2	-	27	5914	c.5573C>A	c.(5572-5574)TCT>TAT	p.S1858Y	uc002udp.2_Intron	NM_002977	NP_002968	Q15858	SCN9A_HUMAN	sodium channel, voltage-gated, type IX, alpha	1869						voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(6)|central_nervous_system(5)|skin(2)	13					Lamotrigine(DB00555)|Lidocaine(DB00281)	AGGATTTGCAGACATGAACCT	0.428													102	179	---	---	---	---	PASS
SCN9A	6335	broad.mit.edu	37	2	167083102	167083102	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:167083102T>C	uc010fpl.2	-	24	4681	c.4340A>G	c.(4339-4341)GAT>GGT	p.D1447G	uc002udp.2_Intron	NM_002977	NP_002968	Q15858	SCN9A_HUMAN	sodium channel, voltage-gated, type IX, alpha	1458	III.					voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(6)|central_nervous_system(5)|skin(2)	13					Lamotrigine(DB00555)|Lidocaine(DB00281)	GTTGAAATTATCTATGATGAC	0.274													7	423	---	---	---	---	PASS
XIRP2	129446	broad.mit.edu	37	2	168101957	168101957	+	Nonsense_Mutation	SNP	G	A	A			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:168101957G>A	uc002udx.2	+	8	4073	c.4055G>A	c.(4054-4056)TGG>TAG	p.W1352*	XIRP2_uc010fpn.2_Intron|XIRP2_uc010fpo.2_Intron|XIRP2_uc010fpp.2_Intron|XIRP2_uc002udy.2_Nonsense_Mutation_p.W1177*|XIRP2_uc010fpq.2_Nonsense_Mutation_p.W1130*|XIRP2_uc010fpr.2_Intron|XIRP2_uc010fps.1_5'Flank	NM_152381	NP_689594	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2 isoform 1	1177	Xin 23.				actin cytoskeleton organization	cell junction	actin binding			skin(7)|ovary(6)|pancreas(1)	14						GGAACAAGGTGGCTTTTTGAA	0.383													8	199	---	---	---	---	PASS
CPS1	1373	broad.mit.edu	37	2	211523393	211523393	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:211523393T>C	uc002vee.3	+	31	3869	c.3737T>C	c.(3736-3738)GTC>GCC	p.V1246A	CPS1_uc010fur.2_Missense_Mutation_p.V1252A|CPS1_uc010fus.2_Missense_Mutation_p.V795A	NM_001875	NP_001866	P31327	CPSM_HUMAN	carbamoyl-phosphate synthetase 1 isoform b	1246	ATP-grasp 2.				carbamoyl phosphate biosynthetic process|citrulline biosynthetic process|glutamine metabolic process|glycogen catabolic process|nitric oxide metabolic process|positive regulation of vasodilation|response to lipopolysaccharide|triglyceride catabolic process|urea cycle	mitochondrial nucleoid	ATP binding|carbamoyl-phosphate synthase (ammonia) activity			ovary(8)|central_nervous_system(3)|breast(1)|skin(1)	13				Epithelial(149;0.00697)|Lung(261;0.0521)|LUSC - Lung squamous cell carcinoma(261;0.0544)|all cancers(144;0.0843)		CAATTTCTTGTCAAAGGAAAT	0.433													6	266	---	---	---	---	PASS
SPP2	6694	broad.mit.edu	37	2	234967498	234967498	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234967498A>G	uc002vvk.1	+	3	314	c.229A>G	c.(229-231)AAC>GAC	p.N77D	SPP2_uc010fyl.1_5'UTR	NM_006944	NP_008875	Q13103	SPP24_HUMAN	secreted phosphoprotein 2, 24kDa precursor	77					bone remodeling|skeletal system development	extracellular region	endopeptidase inhibitor activity				0		Breast(86;0.0109)|Renal(207;0.019)|all_lung(227;0.13)|all_hematologic(139;0.182)		Epithelial(121;5.73e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000166)|Lung(119;0.00539)|LUSC - Lung squamous cell carcinoma(224;0.00846)		CCTAGATGAGAACAACTTGGT	0.413													6	354	---	---	---	---	PASS
SETD2	29072	broad.mit.edu	37	3	47143045	47143045	+	Missense_Mutation	SNP	A	T	T			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:47143045A>T	uc003cqs.2	-	8	4971	c.4918T>A	c.(4918-4920)TGG>AGG	p.W1640R	SETD2_uc003cqv.2_Missense_Mutation_p.W1707R	NM_014159	NP_054878	Q9BYW2	SETD2_HUMAN	SET domain containing 2	1640	SET.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleus	DNA binding|histone-lysine N-methyltransferase activity|oxidoreductase activity|transition metal ion binding			kidney(24)|ovary(5)|skin(1)|central_nervous_system(1)|breast(1)	32		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		TTCACAGTCCACTGAGATGAT	0.308			N|F|S|Mis		clear cell renal carcinoma								53	75	---	---	---	---	PASS
KBTBD8	84541	broad.mit.edu	37	3	67049417	67049417	+	Missense_Mutation	SNP	C	G	G			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:67049417C>G	uc003dmy.2	+	2	82	c.29C>G	c.(28-30)TCT>TGT	p.S10C	KBTBD8_uc011bfv.1_Intron	NM_032505	NP_115894	Q8NFY9	KBTB8_HUMAN	T-cell activation kelch repeat protein	10										ovary(2)|large_intestine(1)|breast(1)	4		Lung NSC(201;0.0765)		BRCA - Breast invasive adenocarcinoma(55;6.02e-06)|KIRC - Kidney renal clear cell carcinoma(39;0.105)|Kidney(39;0.125)		TTAAGTAAGTCTTCCCCAACA	0.468													68	150	---	---	---	---	PASS
KBTBD8	84541	broad.mit.edu	37	3	67049444	67049444	+	Missense_Mutation	SNP	C	G	G			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:67049444C>G	uc003dmy.2	+	2	109	c.56C>G	c.(55-57)TCT>TGT	p.S19C	KBTBD8_uc011bfv.1_Intron	NM_032505	NP_115894	Q8NFY9	KBTB8_HUMAN	T-cell activation kelch repeat protein	19										ovary(2)|large_intestine(1)|breast(1)	4		Lung NSC(201;0.0765)		BRCA - Breast invasive adenocarcinoma(55;6.02e-06)|KIRC - Kidney renal clear cell carcinoma(39;0.105)|Kidney(39;0.125)		GGGATTCCATCTTCAGACCCA	0.468													77	156	---	---	---	---	PASS
KBTBD8	84541	broad.mit.edu	37	3	67049590	67049590	+	Missense_Mutation	SNP	C	G	G			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:67049590C>G	uc003dmy.2	+	2	255	c.202C>G	c.(202-204)CTT>GTT	p.L68V	KBTBD8_uc011bfv.1_Intron	NM_032505	NP_115894	Q8NFY9	KBTB8_HUMAN	T-cell activation kelch repeat protein	68	BTB.									ovary(2)|large_intestine(1)|breast(1)	4		Lung NSC(201;0.0765)		BRCA - Breast invasive adenocarcinoma(55;6.02e-06)|KIRC - Kidney renal clear cell carcinoma(39;0.105)|Kidney(39;0.125)		TAGAAACGTTCTTGCTGCAAT	0.428													88	123	---	---	---	---	PASS
GPR27	2850	broad.mit.edu	37	3	71804019	71804019	+	Silent	SNP	G	T	T			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:71804019G>T	uc011bge.1	+	1	819	c.819G>T	c.(817-819)CTG>CTT	p.L273L	EIF4E3_uc003dox.2_5'Flank|EIF4E3_uc011bgd.1_5'Flank|EIF4E3_uc010hoc.2_5'Flank	NM_018971	NP_061844	Q9NS67	GPR27_HUMAN	G protein-coupled receptor 27	273	Cytoplasmic (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(1)	1		Prostate(10;0.00899)		BRCA - Breast invasive adenocarcinoma(55;1.78e-05)|Epithelial(33;5.75e-05)|Lung(16;0.0012)|LUSC - Lung squamous cell carcinoma(21;0.00156)		TCCTCGTGCTGGAAGAATTCA	0.542													6	16	---	---	---	---	PASS
GXYLT2	727936	broad.mit.edu	37	3	73006438	73006438	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:73006438A>G	uc003dpg.2	+	5	911	c.911A>G	c.(910-912)AAG>AGG	p.K304R		NM_001080393	NP_001073862	A0PJZ3	GXLT2_HUMAN	glycosyltransferase 8 domain containing 4	304	Lumenal (Potential).				O-glycan processing	integral to membrane	UDP-xylosyltransferase activity				0						CTGTACCAGAAGTACAAGAAT	0.413													5	175	---	---	---	---	PASS
PHLDB2	90102	broad.mit.edu	37	3	111693466	111693466	+	3'UTR	SNP	G	A	A			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:111693466G>A	uc010hqa.2	+	18					PHLDB2_uc003dyc.2_3'UTR|PHLDB2_uc003dyd.2_3'UTR|PHLDB2_uc003dyg.2_3'UTR|PHLDB2_uc003dyh.2_3'UTR|PHLDB2_uc003dyi.2_3'UTR|PHLDB2_uc003dyj.2_3'UTR	NM_001134438	NP_001127910	Q86SQ0	PHLB2_HUMAN	pleckstrin homology-like domain, family B,							cytoplasm|intermediate filament cytoskeleton|plasma membrane				ovary(4)|skin(2)	6						TTACAAGAATGAAGCCATATT	0.418													5	47	---	---	---	---	PASS
SI	6476	broad.mit.edu	37	3	164793760	164793760	+	Missense_Mutation	SNP	A	C	C			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:164793760A>C	uc003fei.2	-	2	103	c.41T>G	c.(40-42)ATT>AGT	p.I14S		NM_001041	NP_001032	P14410	SUIS_HUMAN	sucrase-isomaltase	14	Helical; Signal-anchor for type II membrane protein; (Potential).				carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|brush border|Golgi apparatus|integral to membrane	carbohydrate binding|oligo-1,6-glucosidase activity|sucrose alpha-glucosidase activity			ovary(7)|upper_aerodigestive_tract(4)|skin(2)|pancreas(1)	14		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)	AAAAAGGACAATCAGAGAGAT	0.274										HNSCC(35;0.089)			9	140	---	---	---	---	PASS
CHRD	8646	broad.mit.edu	37	3	184100196	184100196	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184100196C>T	uc003fov.2	+	7	965	c.719C>T	c.(718-720)GCA>GTA	p.A240V	CHRD_uc003fow.2_5'UTR|CHRD_uc003fox.2_Missense_Mutation_p.A240V|CHRD_uc003foy.2_5'UTR|CHRD_uc010hyc.2_5'UTR|CHRD_uc011brr.1_5'UTR	NM_003741	NP_003732	Q9H2X0	CHRD_HUMAN	chordin precursor	240	CHRD 1.				BMP signaling pathway involved in spinal cord dorsal/ventral patterning|floor plate development|negative regulation of BMP signaling pathway|negative regulation of cell migration|positive regulation of cell adhesion|skeletal system development	extracellular space	cytokine binding			skin(2)|ovary(1)	3	all_cancers(143;6.33e-11)|Ovarian(172;0.0339)		Epithelial(37;4.96e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			GTGTGGCGGGCAGTGCCTCGG	0.602													10	85	---	---	---	---	PASS
MUC4	4585	broad.mit.edu	37	3	195505867	195505867	+	Missense_Mutation	SNP	A	T	T			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195505867A>T	uc011bto.1	-	3	12660	c.12200T>A	c.(12199-12201)GTC>GAC	p.V4067D	MUC4_uc003fva.2_5'Flank|MUC4_uc003fvb.2_5'Flank|MUC4_uc003fvc.2_5'Flank|MUC4_uc003fvd.2_5'Flank|MUC4_uc003fve.2_5'Flank|MUC4_uc010hzr.2_5'Flank|MUC4_uc011btf.1_Intron|MUC4_uc011btg.1_Intron|MUC4_uc011bth.1_Intron|MUC4_uc011bti.1_Intron|MUC4_uc011btj.1_Intron|MUC4_uc011btk.1_Intron|MUC4_uc011btl.1_Intron|MUC4_uc011btm.1_Intron|MUC4_uc011btn.1_Intron|MUC4_uc003fvo.2_Intron|MUC4_uc003fvp.2_Intron|MUC4_uc010hzu.1_Intron	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		AGTGTCGGTGACAGGAAGAGG	0.607													6	41	---	---	---	---	PASS
MUC4	4585	broad.mit.edu	37	3	195506746	195506746	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195506746G>A	uc011bto.1	-	3	11781	c.11321C>T	c.(11320-11322)GCC>GTC	p.A3774V	MUC4_uc003fva.2_5'Flank|MUC4_uc003fvb.2_5'Flank|MUC4_uc003fvc.2_5'Flank|MUC4_uc003fvd.2_5'Flank|MUC4_uc003fve.2_5'Flank|MUC4_uc010hzr.2_5'Flank|MUC4_uc011btf.1_5'Flank|MUC4_uc011btg.1_5'Flank|MUC4_uc011bth.1_5'Flank|MUC4_uc011bti.1_5'Flank|MUC4_uc011btj.1_5'Flank|MUC4_uc011btk.1_5'Flank|MUC4_uc011btl.1_5'Flank|MUC4_uc011btm.1_5'Flank|MUC4_uc011btn.1_5'Flank|MUC4_uc003fvo.2_Intron|MUC4_uc003fvp.2_Intron|MUC4_uc010hzu.1_Intron	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		AAGAGGGGTGGCGTGACGTGT	0.597													5	13	---	---	---	---	PASS
MUC4	4585	broad.mit.edu	37	3	195506775	195506775	+	Silent	SNP	G	A	A	rs79609066		TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195506775G>A	uc011bto.1	-	3	11752	c.11292C>T	c.(11290-11292)ACC>ACT	p.T3764T	MUC4_uc003fva.2_5'Flank|MUC4_uc003fvb.2_5'Flank|MUC4_uc003fvc.2_5'Flank|MUC4_uc003fvd.2_5'Flank|MUC4_uc003fve.2_5'Flank|MUC4_uc010hzr.2_5'Flank|MUC4_uc011btf.1_5'Flank|MUC4_uc011btg.1_5'Flank|MUC4_uc011bth.1_5'Flank|MUC4_uc011bti.1_5'Flank|MUC4_uc011btj.1_5'Flank|MUC4_uc011btk.1_5'Flank|MUC4_uc011btl.1_5'Flank|MUC4_uc011btm.1_5'Flank|MUC4_uc011btn.1_5'Flank|MUC4_uc003fvo.2_Intron|MUC4_uc003fvp.2_Intron|MUC4_uc010hzu.1_Intron	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a	666					cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		AGGAAGTGTCGGTGACAGGAA	0.592													14	4	---	---	---	---	PASS
FRYL	285527	broad.mit.edu	37	4	48563628	48563628	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:48563628T>C	uc003gyh.1	-	33	4327	c.3722A>G	c.(3721-3723)TAT>TGT	p.Y1241C	FRYL_uc003gyk.2_Missense_Mutation_p.Y1241C|FRYL_uc003gyi.1_Missense_Mutation_p.Y130C	NM_015030	NP_055845	O94915	FRYL_HUMAN	furry-like	1241					regulation of transcription, DNA-dependent|transcription, DNA-dependent		protein binding			skin(1)	1						TTTGTGAGCATAGCGAAACAT	0.368													5	148	---	---	---	---	PASS
METAP1	23173	broad.mit.edu	37	4	99955422	99955422	+	Nonsense_Mutation	SNP	G	T	T			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:99955422G>T	uc003huf.3	+	3	325	c.208G>T	c.(208-210)GAA>TAA	p.E70*	METAP1_uc003hug.2_RNA	NM_015143	NP_055958	P53582	AMPM1_HUMAN	methionyl aminopeptidase 1	70					N-terminal protein amino acid modification|peptidyl-methionine modification|proteolysis|regulation of translation	cytoplasm	aminopeptidase activity|metal ion binding|metalloexopeptidase activity|protein binding				0				OV - Ovarian serous cystadenocarcinoma(123;3.12e-07)		CTGGACTGTGGAAGGTGATAT	0.428													103	93	---	---	---	---	PASS
CXXC4	80319	broad.mit.edu	37	4	105393478	105393478	+	3'UTR	SNP	T	C	C			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:105393478T>C	uc003hxg.2	-	2					uc003hxf.1_5'Flank|CXXC4_uc010ilo.2_RNA	NM_025212	NP_079488	Q9H2H0	CXXC4_HUMAN	CXXC finger 4						negative regulation of Wnt receptor signaling pathway|Wnt receptor signaling pathway|zygotic specification of dorsal/ventral axis		DNA binding|PDZ domain binding|zinc ion binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(123;3.05e-08)		ATACTACTGCTTTAAAAGAAC	0.348													5	194	---	---	---	---	PASS
C4orf33	132321	broad.mit.edu	37	4	130032842	130032842	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:130032842C>T	uc003igu.3	+	6	860	c.496C>T	c.(496-498)CAT>TAT	p.H166Y	C4orf33_uc010iod.2_Missense_Mutation_p.H166Y	NM_173487	NP_775758	Q8N1A6	CD033_HUMAN	hypothetical protein LOC132321	166										upper_aerodigestive_tract(1)	1						TGCTTTTAGCCATTGCCTAGA	0.353													5	485	---	---	---	---	PASS
CDH18	1016	broad.mit.edu	37	5	19747207	19747207	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:19747207G>T	uc003jgc.2	-	3	744	c.367C>A	c.(367-369)CAC>AAC	p.H123N	CDH18_uc003jgd.2_Missense_Mutation_p.H123N|CDH18_uc011cnm.1_Missense_Mutation_p.H123N	NM_004934	NP_004925	Q13634	CAD18_HUMAN	cadherin 18, type 2 preproprotein	123	Extracellular (Potential).|Cadherin 1.				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(5)|large_intestine(1)|skin(1)	7	Lung NSC(1;0.00734)|all_lung(1;0.0197)					AGCACATAGTGGGTCTTCTGC	0.443													5	527	---	---	---	---	PASS
PRLR	5618	broad.mit.edu	37	5	35084671	35084671	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:35084671A>G	uc003jjm.2	-	5	804	c.274T>C	c.(274-276)TAC>CAC	p.Y92H	PRLR_uc003jjg.1_Missense_Mutation_p.Y92H|PRLR_uc003jjh.1_Missense_Mutation_p.Y92H|PRLR_uc003jji.1_Missense_Mutation_p.Y21H|PRLR_uc003jjj.1_Missense_Mutation_p.Y92H|PRLR_uc003jjk.1_Missense_Mutation_p.Y21H|PRLR_uc003jjl.3_Intron|PRLR_uc010iuw.1_Missense_Mutation_p.Y21H	NM_000949	NP_000940	P16471	PRLR_HUMAN	prolactin receptor precursor	92	Fibronectin type-III 1.|Extracellular (Potential).				activation of JAK2 kinase activity|activation of transmembrane receptor protein tyrosine kinase activity|anti-apoptosis|embryo implantation|lactation|steroid biosynthetic process|T cell activation	cell surface|extracellular region|integral to membrane	metal ion binding|ornithine decarboxylase activator activity|peptide hormone binding|prolactin receptor activity|protein homodimerization activity			ovary(2)|skin(1)	3	all_lung(31;3.83e-05)		COAD - Colon adenocarcinoma(61;0.174)|Colorectal(62;0.229)		Dromostanolone(DB00858)|Fluoxymesterone(DB01185)|Pegvisomant(DB00082)|Somatropin recombinant(DB00052)	ATGGAGGTGTACTGCTTGCCA	0.453													105	214	---	---	---	---	PASS
ITGA1	3672	broad.mit.edu	37	5	52227879	52227879	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:52227879A>G	uc003jou.2	+	22	2826	c.2774A>G	c.(2773-2775)GAC>GGC	p.D925G	ITGA1_uc003jov.2_RNA|ITGA1_uc003jow.2_Missense_Mutation_p.D456G	NM_181501	NP_852478	P56199	ITA1_HUMAN	integrin, alpha 1 precursor	925	Extracellular (Potential).				axon guidance|cell-matrix adhesion|integrin-mediated signaling pathway|muscle contraction	integrin complex	collagen binding|receptor activity			ovary(2)|lung(1)	3		Lung NSC(810;5.05e-05)|Breast(144;0.0851)				TTTTCTAGTGACAGCGAAGAA	0.353													8	705	---	---	---	---	PASS
MBLAC2	153364	broad.mit.edu	37	5	89757120	89757120	+	Missense_Mutation	SNP	A	C	C			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:89757120A>C	uc003kjp.2	-	2	1180	c.704T>G	c.(703-705)TTT>TGT	p.F235C		NM_203406	NP_981951	Q68D91	MBLC2_HUMAN	beta-lactamase-like	235							hydrolase activity|metal ion binding				0						TTCAGCACCAAAGGTATTGAA	0.408													55	118	---	---	---	---	PASS
SLC12A2	6558	broad.mit.edu	37	5	127484475	127484475	+	Silent	SNP	T	C	C			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:127484475T>C	uc003kus.2	+	12	2075	c.1911T>C	c.(1909-1911)GCT>GCC	p.A637A	SLC12A2_uc010jdf.2_RNA|SLC12A2_uc010jdg.2_Silent_p.A637A	NM_001046	NP_001037	P55011	S12A2_HUMAN	solute carrier family 12	637	Cytoplasmic (Potential).				potassium ion transport|sodium ion transport|transepithelial ammonium transport|transepithelial chloride transport	integral to plasma membrane|membrane fraction	ammonia transmembrane transporter activity|sodium:potassium:chloride symporter activity			ovary(3)	3		all_cancers(142;0.0972)|Prostate(80;0.151)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	Epithelial(69;0.0433)|OV - Ovarian serous cystadenocarcinoma(64;0.0978)	Bumetanide(DB00887)|Potassium Chloride(DB00761)	TCTACCCAGCTTTCCAGATGT	0.328													8	711	---	---	---	---	PASS
UBE2D2	7322	broad.mit.edu	37	5	139006366	139006366	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:139006366A>G	uc003ler.2	+	7	1050	c.424A>G	c.(424-426)ACT>GCT	p.T142A	UBE2D2_uc003leq.2_Missense_Mutation_p.T113A	NM_003339	NP_003330	P62837	UB2D2_HUMAN	ubiquitin-conjugating enzyme E2D 2 isoform 1	142					protein K48-linked ubiquitination|ubiquitin-dependent protein catabolic process		ATP binding|protein binding|ubiquitin-protein ligase activity			central_nervous_system(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			TCGGGAATGGACTCAGAAGTA	0.378													7	461	---	---	---	---	PASS
TCERG1	10915	broad.mit.edu	37	5	145858117	145858117	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:145858117A>G	uc003lob.2	+	10	1703	c.1663A>G	c.(1663-1665)ATG>GTG	p.M555V	TCERG1_uc003loc.2_Missense_Mutation_p.M534V|TCERG1_uc011dbt.1_Missense_Mutation_p.M534V	NM_006706	NP_006697	O14776	TCRG1_HUMAN	transcription elongation regulator 1 isoform 1	555	WW 3.				regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	nucleus	protein binding|transcription coactivator activity			ovary(1)|skin(1)	2		Lung NSC(249;0.00188)|all_lung(500;0.00307)|all_neural(839;0.0424)|Breast(839;0.0743)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TCGTCTTTCTATGTGGGACCG	0.418													24	516	---	---	---	---	PASS
KIF4B	285643	broad.mit.edu	37	5	154393631	154393631	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:154393631C>T	uc010jih.1	+	1	372	c.212C>T	c.(211-213)CCG>CTG	p.P71L		NM_001099293	NP_001092763	Q2VIQ3	KIF4B_HUMAN	kinesin family member 4B	71	Kinesin-motor.				axon guidance|blood coagulation|microtubule-based movement	cytosol|microtubule|nuclear matrix	ATP binding|DNA binding|microtubule motor activity			ovary(1)	1	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			GCAGTAGCGCCGCTCATAAAA	0.463													5	310	---	---	---	---	PASS
DOCK2	1794	broad.mit.edu	37	5	169098102	169098102	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:169098102C>T	uc003maf.2	+	5	325	c.245C>T	c.(244-246)CCT>CTT	p.P82L	DOCK2_uc011der.1_RNA	NM_004946	NP_004937	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	82					actin cytoskeleton organization|regulation of defense response to virus by virus|viral reproduction	cytoskeleton|cytosol|endomembrane system|membrane	electron carrier activity|GTP binding|GTPase binding|heme binding|Rac guanyl-nucleotide exchange factor activity|T cell receptor binding			ovary(5)|pancreas(2)	7	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			AACATCATTCCTGCAGAAATT	0.418													8	261	---	---	---	---	PASS
NSD1	64324	broad.mit.edu	37	5	176722349	176722349	+	Silent	SNP	G	A	A			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176722349G>A	uc003mfr.3	+	23	8118	c.7980G>A	c.(7978-7980)CAG>CAA	p.Q2660Q	NSD1_uc003mft.3_Silent_p.Q2391Q|NSD1_uc011dfx.1_Silent_p.Q2308Q	NM_022455	NP_071900	Q96L73	NSD1_HUMAN	nuclear receptor binding SET domain protein 1	2660					negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleus	androgen receptor binding|chromatin binding|estrogen receptor binding|histone methyltransferase activity (H3-K36 specific)|histone methyltransferase activity (H4-K20 specific)|ligand-dependent nuclear receptor binding|retinoid X receptor binding|thyroid hormone receptor binding|transcription corepressor activity|zinc ion binding			ovary(2)|kidney(1)	3	all_cancers(89;1.57e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.198)	Kidney(146;0.235)		CATTGGCACAGACTTGCTGGT	0.547			T	NUP98	AML		Sotos Syndrome		Beckwith-Wiedemann_syndrome|Sotos_syndrome|Weaver_syndrome	HNSCC(47;0.14)			4	73	---	---	---	---	PASS
TMEM14C	51522	broad.mit.edu	37	6	10731090	10731090	+	3'UTR	SNP	A	G	G			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:10731090A>G	uc003mzh.2	+	6					TMEM14C_uc003mzi.2_3'UTR	NM_016462	NP_057546	Q9P0S9	TM14C_HUMAN	transmembrane protein 14C						heme biosynthetic process	integral to membrane|mitochondrial membrane					0	Ovarian(93;0.107)|Breast(50;0.137)	all_hematologic(90;0.135)	Epithelial(50;0.246)			CGAGTATGTAACACAAGAGCT	0.358													12	13	---	---	---	---	PASS
FAM65B	9750	broad.mit.edu	37	6	24850839	24850839	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:24850839A>G	uc003neo.1	-	10	960	c.784T>C	c.(784-786)TTC>CTC	p.F262L	FAM65B_uc011djs.1_Missense_Mutation_p.F291L|FAM65B_uc011dju.1_Missense_Mutation_p.F296L|FAM65B_uc003nep.2_Missense_Mutation_p.F262L|FAM65B_uc011djt.1_Missense_Mutation_p.F262L	NM_014722	NP_055537	Q9Y4F9	FA65B_HUMAN	hypothetical protein LOC9750 isoform 1	262					cell differentiation|muscle organ development	cytoskeleton|filopodium|mitochondrion	binding			ovary(1)	1						ATGGAGATGAACCCAACTATC	0.517													5	230	---	---	---	---	PASS
TAF11	6882	broad.mit.edu	37	6	34846156	34846156	+	3'UTR	SNP	C	A	A			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:34846156C>A	uc003ojw.1	-	5					UHRF1BP1_uc010jvm.1_Intron|TAF11_uc011dsr.1_3'UTR	NM_005643	NP_005634	Q15544	TAF11_HUMAN	TBP-associated factor 11						positive regulation by host of viral transcription|regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter|viral reproduction	transcription factor TFIID complex	protein N-terminus binding|thyroid hormone receptor binding|transcription coactivator activity|vitamin D receptor binding				0						TTCAAAATGCCCCAAGAGGTC	0.398													13	14	---	---	---	---	PASS
TCP11	6954	broad.mit.edu	37	6	35087006	35087006	+	Silent	SNP	A	T	T			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:35087006A>T	uc003okd.2	-	9	1498	c.1317T>A	c.(1315-1317)ATT>ATA	p.I439I	TCP11_uc003ojz.1_Silent_p.I364I|TCP11_uc003oka.2_Silent_p.I364I|TCP11_uc003okb.2_Silent_p.I363I|TCP11_uc003okc.2_Silent_p.I363I|TCP11_uc011dsu.1_Silent_p.I421I|TCP11_uc011dsv.1_Silent_p.I388I|TCP11_uc011dsw.1_Silent_p.I393I	NM_001093728	NP_001087197	Q8WWU5	TCP11_HUMAN	t-complex 11 isoform 1	426					cell differentiation|multicellular organismal development|spermatogenesis	integral to membrane				ovary(3)|skin(2)	5						CATACTCACCAATAACACTGC	0.453													261	413	---	---	---	---	PASS
SFRS3	6428	broad.mit.edu	37	6	36569822	36569822	+	3'UTR	SNP	T	A	A			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:36569822T>A	uc003omj.2	+	6					SFRS3_uc003omk.2_RNA	NM_003017	NP_003008	P84103	SRSF3_HUMAN	splicing factor, arginine/serine-rich 3						mRNA 3'-end processing|mRNA export from nucleus|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	nucleoplasm	nucleotide binding|protein binding|RNA binding				0						GACAGGAGTATGTACAGAAAA	0.323			T	BCL6	follicular lymphoma								96	332	---	---	---	---	PASS
SLC25A27	9481	broad.mit.edu	37	6	46636474	46636474	+	Silent	SNP	C	T	T			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:46636474C>T	uc003oyh.2	+	6	899	c.648C>T	c.(646-648)CAC>CAT	p.H216H	SLC25A27_uc011dwb.1_Silent_p.H216H|SLC25A27_uc003oyg.2_Silent_p.H216H|SLC25A27_uc011dwc.1_Silent_p.H130H|SLC25A27_uc003oyi.2_Silent_p.H146H	NM_004277	NP_004268	O95847	UCP4_HUMAN	solute carrier family 25, member 27	216	Solcar 2.				generation of precursor metabolites and energy|transport	integral to membrane|mitochondrial inner membrane					0			Lung(136;0.192)			CAGTGAAACACTACTTGGTAT	0.333													5	484	---	---	---	---	PASS
GSTA3	2940	broad.mit.edu	37	6	52764813	52764813	+	Silent	SNP	T	C	C			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:52764813T>C	uc003pbb.2	-	5	412	c.333A>G	c.(331-333)TTA>TTG	p.L111L	GSTA3_uc010jzq.2_Silent_p.L55L	NM_000847	NP_000838	Q16772	GSTA3_HUMAN	glutathione S-transferase alpha 3	111	GST C-terminal.				glutathione metabolic process|xenobiotic metabolic process	cytosol	glutathione transferase activity				0	Lung NSC(77;0.0912)				Glutathione(DB00143)	CAGGTCGACATAAGGGCAGAA	0.403													53	264	---	---	---	---	PASS
CGA	1081	broad.mit.edu	37	6	87795372	87795372	+	3'UTR	SNP	A	T	T			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:87795372A>T	uc003plj.1	-	4						NM_000735	NP_000726	P01215	GLHA_HUMAN	glycoprotein hormones, alpha polypeptide						hormone biosynthetic process|peptide hormone processing|signal transduction	extracellular region|soluble fraction	hormone activity			ovary(1)	1		all_cancers(76;5.98e-09)|Acute lymphoblastic leukemia(125;2.15e-10)|Prostate(29;5.29e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;0.000102)		BRCA - Breast invasive adenocarcinoma(108;0.0484)		GTGGTATGGTAAGGAAAAGGA	0.378													18	70	---	---	---	---	PASS
EPHA7	2045	broad.mit.edu	37	6	94129154	94129154	+	5'UTR	SNP	T	A	A			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:94129154T>A	uc003poe.2	-	1					EPHA7_uc003pof.2_5'UTR|EPHA7_uc011eac.1_5'UTR|EPHA7_uc003pog.3_5'UTR	NM_004440	NP_004431	Q15375	EPHA7_HUMAN	ephrin receptor EphA7 precursor							integral to plasma membrane	ATP binding|ephrin receptor activity			lung(8)|ovary(7)|upper_aerodigestive_tract(3)|central_nervous_system(3)|skin(3)|large_intestine(2)|stomach(1)|pancreas(1)	28		all_cancers(76;7.47e-10)|Acute lymphoblastic leukemia(125;1.88e-09)|all_hematologic(75;1.75e-07)|all_epithelial(107;3.6e-05)|Lung NSC(302;0.0368)|all_lung(197;0.0509)|Colorectal(196;0.142)		BRCA - Breast invasive adenocarcinoma(108;0.0847)		TTTATTGTGCTCCTTGCATCG	0.458													25	50	---	---	---	---	PASS
FAM184A	79632	broad.mit.edu	37	6	119337998	119337998	+	Missense_Mutation	SNP	T	C	C	rs35838236		TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:119337998T>C	uc003pyj.2	-	5	1792	c.1444A>G	c.(1444-1446)ACT>GCT	p.T482A	FAM184A_uc003pyk.3_Missense_Mutation_p.T362A|FAM184A_uc003pyl.3_Missense_Mutation_p.T362A	NM_024581	NP_078857	Q8NB25	F184A_HUMAN	hypothetical protein LOC79632 isoform 1	482	Potential.									ovary(2)|central_nervous_system(2)|skin(2)|pancreas(1)	7						TCTTCCAAAGTCTTAGAATGG	0.373													7	559	---	---	---	---	PASS
FBXO5	26271	broad.mit.edu	37	6	153292194	153292194	+	3'UTR	SNP	G	A	A			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:153292194G>A	uc003qpg.2	-	5					FBXO5_uc003qph.2_3'UTR	NM_012177	NP_036309	Q9UKT4	FBX5_HUMAN	F-box only protein 5 isoform a						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|mitotic metaphase/anaphase transition|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of mitotic cell cycle|regulation of transcription involved in G1/S phase of mitotic cell cycle	cytosol|nucleoplasm|spindle	metal ion binding|protein binding				0		Ovarian(120;0.125)		OV - Ovarian serous cystadenocarcinoma(155;4.38e-10)|BRCA - Breast invasive adenocarcinoma(81;0.0893)		ATACTACACCGATTTCAACAT	0.259													18	86	---	---	---	---	PASS
TBP	6908	broad.mit.edu	37	6	170866043	170866043	+	5'UTR	SNP	C	T	T			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:170866043C>T	uc003qxt.2	+	2					TBP_uc003qxu.2_5'UTR|TBP_uc011ehf.1_Intron|TBP_uc011ehg.1_5'UTR	NM_003194	NP_003185	P20226	TBP_HUMAN	TATA box binding protein						cell death|interspecies interaction between organisms|transcription elongation from RNA polymerase II promoter|transcription from RNA polymerase III promoter|viral reproduction	transcription factor TFIIA complex|transcription factor TFIID complex	repressing transcription factor binding|transcription regulatory region DNA binding			ovary(1)	1		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;1.07e-22)|BRCA - Breast invasive adenocarcinoma(81;5.01e-06)|GBM - Glioblastoma multiforme(31;0.00591)		GCTGGAGATGCTCTAGGAAAA	0.438													24	117	---	---	---	---	PASS
SDK1	221935	broad.mit.edu	37	7	4051762	4051762	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:4051762C>T	uc003smx.2	+	16	2454	c.2315C>T	c.(2314-2316)CCG>CTG	p.P772L	SDK1_uc010kso.2_Missense_Mutation_p.P48L	NM_152744	NP_689957	Q7Z5N4	SDK1_HUMAN	sidekick 1 precursor	772	Fibronectin type-III 2.				cell adhesion	integral to membrane				large_intestine(3)|ovary(2)|skin(1)	6		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		AGTGCTCCCCCGAAAAATATA	0.517													18	273	---	---	---	---	PASS
SNX13	23161	broad.mit.edu	37	7	17915293	17915293	+	Silent	SNP	T	C	C			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:17915293T>C	uc003stw.1	-	6	774	c.561A>G	c.(559-561)AAA>AAG	p.K187K	SNX13_uc003stv.2_Silent_p.K187K|SNX13_uc010kuc.2_5'UTR|SNX13_uc003stx.1_Silent_p.K107K			Q9Y5W8	SNX13_HUMAN	SubName: Full=Putative uncharacterized protein SNX13; SubName: Full=Sorting nexin 13, isoform CRA_g;	187	PXA.				cell communication|intracellular protein transport|negative regulation of signal transduction|positive regulation of GTPase activity	early endosome membrane	phosphatidylinositol binding|signal transducer activity			central_nervous_system(2)|kidney(1)	3	Lung NSC(10;0.0261)|all_lung(11;0.0521)					AGATATTACCTTTCACTTGAT	0.313													8	780	---	---	---	---	PASS
C7orf10	79783	broad.mit.edu	37	7	40900017	40900017	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:40900017A>G	uc003thn.1	+	14	1301	c.1256A>G	c.(1255-1257)GAT>GGT	p.D419G	C7orf10_uc003thm.1_Missense_Mutation_p.D415G|C7orf10_uc003tho.1_Missense_Mutation_p.D371G|C7orf10_uc003thp.1_RNA	NM_024728	NP_079004	Q9HAC7	CG010_HUMAN	dermal papilla derived protein 13	426							transferase activity			ovary(2)	2						CTGAGATACGATGACAGGGCC	0.562													24	30	---	---	---	---	PASS
UPK3B	80761	broad.mit.edu	37	7	76140064	76140064	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:76140064G>T	uc003ufq.2	+	1	320	c.95G>T	c.(94-96)GGG>GTG	p.G32V	UPK3B_uc003ufo.2_Intron|UPK3B_uc010ldk.1_Intron	NM_030570	NP_085047	Q9BT76	UPK3B_HUMAN	uroplakin 3B isoform a	32	Lumenal (Potential).				negative regulation of gene expression	integral to membrane|plasma membrane				central_nervous_system(1)	1		Myeloproliferative disorder(862;0.204)				GGTGAGTGGGGGTCCTGGATG	0.697													12	7	---	---	---	---	PASS
PEX1	5189	broad.mit.edu	37	7	92136429	92136429	+	Missense_Mutation	SNP	G	C	C			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:92136429G>C	uc003uly.2	-	10	1778	c.1682C>G	c.(1681-1683)TCC>TGC	p.S561C	PEX1_uc011khr.1_Missense_Mutation_p.S353C|PEX1_uc010ley.2_Missense_Mutation_p.S561C|PEX1_uc011khs.1_Missense_Mutation_p.S239C|PEX1_uc011kht.1_RNA	NM_000466	NP_000457	O43933	PEX1_HUMAN	peroxin1	561					microtubule-based peroxisome localization|protein import into peroxisome matrix	cytosol|nucleus|peroxisomal membrane	ATP binding|ATPase activity, coupled|protein C-terminus binding|protein complex binding			ovary(1)|central_nervous_system(1)	2	all_cancers(62;9.35e-11)|all_epithelial(64;4.59e-10)|Breast(17;0.00201)|all_lung(186;0.0438)|Lung NSC(181;0.0592)	Breast(660;0.000932)|all_neural(109;0.00391)|Myeloproliferative disorder(862;0.0122)|Ovarian(593;0.023)|Medulloblastoma(109;0.123)	GBM - Glioblastoma multiforme(5;4.06e-06)|STAD - Stomach adenocarcinoma(4;4.51e-05)|all cancers(6;5.32e-05)|LUSC - Lung squamous cell carcinoma(200;0.225)|Lung(22;0.23)			TACGCCTAAGGAATTCACTCC	0.428													46	102	---	---	---	---	PASS
FAM200A	221786	broad.mit.edu	37	7	99144587	99144587	+	Missense_Mutation	SNP	A	C	C			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99144587A>C	uc003ura.2	-	2	1783	c.1444T>G	c.(1444-1446)TCA>GCA	p.S482A	FAM200A_uc003urb.2_Missense_Mutation_p.S482A	NM_145111	NP_659802	Q8TCP9	F200A_HUMAN	hypothetical protein LOC221786	482	Extracellular (Potential).					integral to membrane	nucleic acid binding				0						gtgaatgatgaactgagctgc	0.000													46	74	---	---	---	---	PASS
FAM200A	221786	broad.mit.edu	37	7	99144589	99144589	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99144589C>T	uc003ura.2	-	2	1781	c.1442G>A	c.(1441-1443)AGT>AAT	p.S481N	FAM200A_uc003urb.2_Missense_Mutation_p.S481N	NM_145111	NP_659802	Q8TCP9	F200A_HUMAN	hypothetical protein LOC221786	481	Extracellular (Potential).					integral to membrane	nucleic acid binding				0						gaatgatgaactgagctgcaa	0.000													47	75	---	---	---	---	PASS
RBM28	55131	broad.mit.edu	37	7	127950752	127950752	+	3'UTR	SNP	T	C	C			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:127950752T>C	uc003vmp.2	-	19					RBM28_uc003vmo.2_3'UTR|RBM28_uc011koj.1_3'UTR	NM_018077	NP_060547	Q9NW13	RBM28_HUMAN	RNA binding motif protein 28						mRNA processing|RNA splicing	Golgi apparatus|nucleolus|spliceosomal complex	nucleotide binding|RNA binding			ovary(2)	2						CCTTGGGGATTTTCTTTCCCT	0.542													4	82	---	---	---	---	PASS
AGBL3	340351	broad.mit.edu	37	7	134672743	134672743	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:134672743A>G	uc011kpw.1	+	2	312	c.59A>G	c.(58-60)GAA>GGA	p.E20G		NM_178563	NP_848658	Q8NEM8	CBPC3_HUMAN	carboxypeptidase 3, cytosolic	20					proteolysis	cytosol	metallocarboxypeptidase activity|zinc ion binding				0						GATGAAGATGAATCGGTATGT	0.279													7	495	---	---	---	---	PASS
C7orf49	78996	broad.mit.edu	37	7	134853617	134853617	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:134853617G>T	uc003vsl.2	-	2	325	c.58C>A	c.(58-60)CAG>AAG	p.Q20K	C7orf49_uc003vsh.2_Missense_Mutation_p.P5Q|C7orf49_uc003vsj.2_5'Flank|C7orf49_uc003vsk.2_RNA|C7orf49_uc003vsm.2_RNA|C7orf49_uc003vsn.2_Missense_Mutation_p.P5Q|C7orf49_uc003vso.2_Intron	NM_024033	NP_076938	Q9BWK5	MRI_HUMAN	modulator of retrovirus infection	20						cytoplasm				large_intestine(1)|ovary(1)	2						GTAGCCACCTGGGCTGTCAGC	0.527											OREG0018340	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	55	117	---	---	---	---	PASS
TRIM24	8805	broad.mit.edu	37	7	138265317	138265317	+	Missense_Mutation	SNP	A	C	C			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:138265317A>C	uc003vuc.2	+	16	2811	c.2596A>C	c.(2596-2598)ATT>CTT	p.I866L	TRIM24_uc003vub.2_Missense_Mutation_p.I832L	NM_015905	NP_056989	O15164	TIF1A_HUMAN	transcriptional intermediary factor 1 alpha	866	PHD-type.				cellular response to estrogen stimulus|protein catabolic process|regulation of apoptosis|regulation of protein stability|transcription from RNA polymerase II promoter	cytoplasm	chromatin binding|estrogen response element binding|histone acetyl-lysine binding|p53 binding|transcription coactivator activity|ubiquitin-protein ligase activity|zinc ion binding			central_nervous_system(3)|ovary(2)|stomach(1)|breast(1)|skin(1)	8						TGGAGAGTGGATTTGCACTTT	0.403													130	321	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	142423544	142423544	+	Intron	SNP	A	G	G			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142423544A>G	uc011krr.1	+						uc003vzp.2_Intron|uc011ksh.1_Intron|uc011ksi.1_Intron|uc003vzw.1_Intron|uc010loj.1_Intron|uc003wad.2_5'Flank|uc011ksg.1_Intron|uc010lol.1_Missense_Mutation_p.Y67C|uc011ksj.1_RNA					SubName: Full=V_segment translation product; Flags: Fragment;																		CAGATCTACTATTCAATGAAT	0.458													4	152	---	---	---	---	PASS
MTMR7	9108	broad.mit.edu	37	8	17157630	17157630	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:17157630A>G	uc003wxm.2	-	14	1963	c.1724T>C	c.(1723-1725)ATA>ACA	p.I575T	MTMR7_uc011kya.1_Missense_Mutation_p.I209T|MTMR7_uc011kyb.1_Missense_Mutation_p.I166T	NM_004686	NP_004677	Q9Y216	MTMR7_HUMAN	myotubularin related protein 7	575							protein tyrosine phosphatase activity			skin(1)	1				Colorectal(111;0.112)		AGTGTTGGCTATGCTGTTGTC	0.453													12	479	---	---	---	---	PASS
TEX15	56154	broad.mit.edu	37	8	30705108	30705108	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:30705108T>C	uc003xil.2	-	1	1426	c.1426A>G	c.(1426-1428)ACA>GCA	p.T476A		NM_031271	NP_112561	Q9BXT5	TEX15_HUMAN	testis expressed 15	476										ovary(3)|upper_aerodigestive_tract(2)|skin(2)	7				KIRC - Kidney renal clear cell carcinoma(542;0.0918)|Kidney(114;0.111)		TCTCTATCTGTTTGTTTTTTG	0.338													8	627	---	---	---	---	PASS
NRG1	3084	broad.mit.edu	37	8	32611992	32611992	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:32611992A>G	uc003xiv.2	+	8	1320	c.803A>G	c.(802-804)AAG>AGG	p.K268R	NRG1_uc011lbf.1_Missense_Mutation_p.K265R|NRG1_uc010lvo.2_Missense_Mutation_p.K265R|NRG1_uc003xiu.2_Missense_Mutation_p.K273R|NRG1_uc003xiw.2_Missense_Mutation_p.K265R|NRG1_uc003xit.2_Missense_Mutation_p.K268R|NRG1_uc010lvr.2_Missense_Mutation_p.K10R|NRG1_uc010lvs.2_Missense_Mutation_p.K10R|NRG1_uc010lvp.2_Missense_Mutation_p.K222R|NRG1_uc010lvq.2_Missense_Mutation_p.K205R|NRG1_uc011lbg.1_Missense_Mutation_p.K114R|NRG1_uc011lbh.1_Missense_Mutation_p.K111R|NRG1_uc003xiz.1_RNA|NRG1_uc003xja.2_Missense_Mutation_p.K79R	NM_013964	NP_039258	Q02297	NRG1_HUMAN	neuregulin 1 isoform HRG-alpha	268	Cytoplasmic (Potential).				activation of transmembrane receptor protein tyrosine kinase activity|anti-apoptosis|cardiac muscle cell differentiation|cell communication|cell proliferation|cellular protein complex disassembly|embryo development|mammary gland development|negative regulation of cardiac muscle cell apoptosis|negative regulation of secretion|negative regulation of transcription, DNA-dependent|nervous system development|neural crest cell development|Notch signaling pathway|positive regulation of cardiac muscle cell proliferation|positive regulation of cell adhesion|positive regulation of cell growth|positive regulation of striated muscle cell differentiation|regulation of protein heterodimerization activity|regulation of protein homodimerization activity|transmembrane receptor protein tyrosine kinase signaling pathway|ventricular cardiac muscle cell differentiation|wound healing|wound healing	apical plasma membrane|extracellular region|extracellular space|integral to membrane|nucleus|plasma membrane	cytokine activity|ErbB-3 class receptor binding|growth factor activity|growth factor activity|protein binding|protein tyrosine kinase activator activity|receptor tyrosine kinase binding|transcription cofactor activity|transmembrane receptor protein tyrosine kinase activator activity				0		Breast(100;0.203)		KIRC - Kidney renal clear cell carcinoma(67;0.0768)|Kidney(114;0.0943)		TGCAAAACCAAGTAAACCTTC	0.537													6	269	---	---	---	---	PASS
WHSC1L1	54904	broad.mit.edu	37	8	38175500	38175500	+	Intron	SNP	C	A	A			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38175500C>A	uc003xli.2	-						WHSC1L1_uc011lbm.1_Intron|WHSC1L1_uc010lwe.2_Intron|WHSC1L1_uc003xlj.2_Missense_Mutation_p.A638S	NM_023034	NP_075447	Q9BZ95	NSD3_HUMAN	WHSC1L1 protein isoform long						cell differentiation|cell growth|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome	histone-lysine N-methyltransferase activity|zinc ion binding			breast(1)	1	Colorectal(12;0.000442)|Esophageal squamous(3;0.0725)	all_lung(54;0.00787)|Lung NSC(58;0.0295)|Hepatocellular(245;0.065)	Epithelial(3;3.12e-43)|all cancers(3;1.72e-38)|BRCA - Breast invasive adenocarcinoma(5;2.84e-27)|LUSC - Lung squamous cell carcinoma(2;2.79e-25)|Lung(2;5.03e-23)|COAD - Colon adenocarcinoma(9;0.0511)			TCAATCGCTGCGGAGACGGAG	0.527			T	NUP98	AML								28	85	---	---	---	---	PASS
VPS13B	157680	broad.mit.edu	37	8	100520072	100520072	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:100520072G>A	uc003yiv.2	+	28	4343	c.4232G>A	c.(4231-4233)CGC>CAC	p.R1411H	VPS13B_uc003yiw.2_Intron|VPS13B_uc003yiu.1_3'UTR|VPS13B_uc003yix.1_Missense_Mutation_p.R881H	NM_017890	NP_060360	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13B isoform 5	1411					protein transport					ovary(7)|skin(4)|lung(3)|central_nervous_system(2)|pancreas(2)|breast(1)|kidney(1)	20	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			CTGAACAGACGCACCTTGTTG	0.458													5	388	---	---	---	---	PASS
ASAP1	50807	broad.mit.edu	37	8	131124378	131124378	+	Missense_Mutation	SNP	G	A	A	rs147401049	byFrequency	TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:131124378G>A	uc003yta.1	-	23	2391	c.2363C>T	c.(2362-2364)ACG>ATG	p.T788M	ASAP1_uc003ysz.1_Missense_Mutation_p.T599M|ASAP1_uc011liw.1_Missense_Mutation_p.T781M	NM_018482	NP_060952	Q9ULH1	ASAP1_HUMAN	development and differentiation enhancing factor	788	Pro-rich.				cilium morphogenesis|filopodium assembly|regulation of ARF GTPase activity|signal transduction	cytoplasm|membrane	ARF GTPase activator activity|cytoskeletal adaptor activity|SH3 domain binding|zinc ion binding			ovary(4)	4						GGGAGCCTCCGTGGTTGGTGA	0.567													5	286	---	---	---	---	PASS
POLR1E	64425	broad.mit.edu	37	9	37495942	37495942	+	Silent	SNP	C	T	T			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:37495942C>T	uc003zzz.1	+	7	1185	c.897C>T	c.(895-897)AAC>AAT	p.N299N	POLR1E_uc011lqj.1_Missense_Mutation_p.T177M|POLR1E_uc003zzy.1_Silent_p.N237N|POLR1E_uc011lqk.1_Silent_p.N166N	NM_022490	NP_071935	Q9GZS1	RPA49_HUMAN	RNA polymerase I associated factor 53	299					rRNA transcription	cell junction|cytoplasm|nucleolus	DNA binding|DNA-directed RNA polymerase activity|protein binding				0				GBM - Glioblastoma multiforme(29;0.00851)|Lung(182;0.229)		CTTTCAGGAACGTCACGTCAG	0.458													5	243	---	---	---	---	PASS
DCAF10	79269	broad.mit.edu	37	9	37819308	37819308	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:37819308A>G	uc004aao.2	+	2	637	c.563A>G	c.(562-564)GAA>GGA	p.E188G	DCAF10_uc010mlz.2_Missense_Mutation_p.E15G	NM_024345	NP_077321	Q5QP82	DCA10_HUMAN	WD repeat domain 32	188	WD 1.					CUL4 RING ubiquitin ligase complex				central_nervous_system(1)	1						GTTGCTTGTGAACAAACTGAA	0.328													6	401	---	---	---	---	PASS
FAM120A	23196	broad.mit.edu	37	9	96318810	96318810	+	Missense_Mutation	SNP	C	G	G			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:96318810C>G	uc004atw.2	+	13	2446	c.2421C>G	c.(2419-2421)TTC>TTG	p.F807L	FAM120A_uc004aty.2_Missense_Mutation_p.F588L|FAM120A_uc004atz.2_Missense_Mutation_p.F456L|FAM120A_uc010mrg.2_Missense_Mutation_p.F120L	NM_014612	NP_055427	Q9NZB2	F120A_HUMAN	oxidative stress-associated Src activator	807						cytoplasm|plasma membrane	RNA binding				0						GGAAGCTCTTCCAATCCAAAC	0.522													32	84	---	---	---	---	PASS
PPP3R2	5535	broad.mit.edu	37	9	104356590	104356590	+	3'UTR	SNP	C	T	T			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:104356590C>T	uc004bbr.2	-	1					GRIN3A_uc004bbp.1_Intron|GRIN3A_uc004bbq.1_Intron|PPP3R2_uc010mtf.1_RNA	NM_147180	NP_671709	Q96LZ3	CANB2_HUMAN	protein phosphatase 3 regulatory subunit B, beta								calcium ion binding			ovary(1)|skin(1)	2		Acute lymphoblastic leukemia(62;0.0527)			Cyclosporine(DB00091)	AAAAGAAATACTTCCAGATAA	0.428													3	9	---	---	---	---	PASS
KIAA0368	23392	broad.mit.edu	37	9	114159361	114159361	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:114159361C>A	uc004bfe.1	-	26	3259	c.3259G>T	c.(3259-3261)GCT>TCT	p.A1087S		NM_001080398	NP_001073867			KIAA0368 protein												0						TCTCGGGCAGCCACAGAACTA	0.423													52	143	---	---	---	---	PASS
TUBBP5	643224	broad.mit.edu	37	9	141071456	141071456	+	Missense_Mutation	SNP	C	T	T	rs145186342	by1000genomes	TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:141071456C>T	uc004com.2	+	4	1120	c.859C>T	c.(859-861)CGG>TGG	p.R287W	TUBBP5_uc010ncq.2_3'UTR					RecName: Full=Putative tubulin beta-4q chain;												0						CATCCCACCCCGGGGGCTAAA	0.488													4	53	---	---	---	---	PASS
CUBN	8029	broad.mit.edu	37	10	16949733	16949733	+	Intron	SNP	C	T	T			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:16949733C>T	uc001ioo.2	-						CUBN_uc009xjq.1_RNA|CUBN_uc009xjr.1_5'UTR	NM_001081	NP_001072	O60494	CUBN_HUMAN	cubilin precursor						cholesterol metabolic process|cobalamin transport|hormone biosynthetic process|lipoprotein metabolic process|receptor-mediated endocytosis|tissue homeostasis|vitamin D metabolic process	brush border membrane|cytosol|endosome membrane|extrinsic to external side of plasma membrane|lysosomal lumen|lysosomal membrane	calcium ion binding|cobalamin binding|protein homodimerization activity|receptor activity|transporter activity			ovary(9)|breast(4)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|kidney(1)	19					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	CTGCATATTTCCTAGGAGGTG	0.438													25	63	---	---	---	---	PASS
NEBL	10529	broad.mit.edu	37	10	21120233	21120233	+	Silent	SNP	T	C	C			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:21120233T>C	uc001iqi.2	-	16	1960	c.1563A>G	c.(1561-1563)AAA>AAG	p.K521K	NEBL_uc001iqj.2_RNA|NEBL_uc001iqk.2_Intron|NEBL_uc001iql.1_RNA	NM_006393	NP_006384	O76041	NEBL_HUMAN	nebulette sarcomeric isoform	521	Nebulin 14.				regulation of actin filament length		actin binding|structural constituent of muscle			ovary(2)	2						TCTTGTATTGTTTCTAAAAGA	0.353													6	325	---	---	---	---	PASS
ARMC3	219681	broad.mit.edu	37	10	23321851	23321851	+	Missense_Mutation	SNP	G	C	C			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:23321851G>C	uc001irm.3	+	18	2391	c.2308G>C	c.(2308-2310)GAA>CAA	p.E770Q	ARMC3_uc010qcv.1_Missense_Mutation_p.E763Q|ARMC3_uc010qcw.1_Missense_Mutation_p.E507Q	NM_173081	NP_775104	Q5W041	ARMC3_HUMAN	armadillo repeat containing 3	770							binding				0						TTTCAGCTGGGAACTTCACAT	0.348													43	206	---	---	---	---	PASS
MTPAP	55149	broad.mit.edu	37	10	30602666	30602666	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:30602666A>G	uc001iva.3	-	9	1684	c.1621T>C	c.(1621-1623)TTT>CTT	p.F541L	MTPAP_uc001ivb.3_Missense_Mutation_p.F671L	NM_018109	NP_060579	Q9NVV4	PAPD1_HUMAN	PAP associated domain containing 1 precursor	541					cell death|histone mRNA catabolic process|mRNA polyadenylation|transcription, DNA-dependent	mitochondrion	ATP binding|magnesium ion binding|manganese ion binding|polynucleotide adenylyltransferase activity|protein homodimerization activity|RNA binding|UTP binding			ovary(1)	1						TTCTTGGTAAAGGACTTTCTG	0.388													8	696	---	---	---	---	PASS
ZNF22	7570	broad.mit.edu	37	10	45499247	45499247	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:45499247G>T	uc001jbw.2	+	2	674	c.431G>T	c.(430-432)TGT>TTT	p.C144F	C10orf25_uc010qff.1_5'Flank|C10orf25_uc001jbv.1_5'Flank|uc001jbx.1_RNA	NM_006963	NP_008894	P17026	ZNF22_HUMAN	zinc finger protein 22 (KOX 15)	144	C2H2-type 4.				odontogenesis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleolus|plasma membrane	DNA binding|zinc ion binding			breast(1)|kidney(1)	2		Prostate(175;0.0352)|all_neural(218;0.202)				TGTGATGAGTGTGGCCGGTGT	0.458													66	84	---	---	---	---	PASS
CDH23	64072	broad.mit.edu	37	10	73442209	73442209	+	Silent	SNP	C	T	T			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:73442209C>T	uc001jrx.3	+	17	2243	c.1866C>T	c.(1864-1866)AGC>AGT	p.S622S	CDH23_uc001jry.2_Silent_p.S238S|CDH23_uc001jrz.2_Silent_p.S238S	NM_022124	NP_071407	Q9H251	CAD23_HUMAN	cadherin-like 23 isoform 1 precursor	622	Cadherin 6.|Extracellular (Potential).				calcium ion transport|calcium-dependent cell-cell adhesion|cytosolic calcium ion homeostasis|equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	cytosol|integral to membrane|plasma membrane|stereocilium	calcium ion binding|protein binding			central_nervous_system(5)|large_intestine(4)|ovary(2)	11						CAGTGATCAGCGTCAGTCGCC	0.552													9	95	---	---	---	---	PASS
ASCC1	51008	broad.mit.edu	37	10	73912709	73912709	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:73912709C>A	uc001jst.1	-	8	856	c.748G>T	c.(748-750)GCA>TCA	p.A250S	ASCC1_uc001jsr.1_Missense_Mutation_p.A137S|ASCC1_uc001jss.1_Missense_Mutation_p.A222S|ASCC1_uc001jsu.1_Missense_Mutation_p.A222S|ASCC1_uc010qju.1_Missense_Mutation_p.A243S			Q8N9N2	ASCC1_HUMAN	RecName: Full=Activating signal cointegrator 1 complex subunit 1; AltName: Full=ASC-1 complex subunit p50; AltName: Full=Trip4 complex subunit p50;	250				A -> P (in Ref. 1 and 2).	regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|transcription factor complex	RNA binding				0						TCTATCCCTGCCATCTCCACT	0.393													52	247	---	---	---	---	PASS
FAM22D	728130	broad.mit.edu	37	10	89118059	89118059	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:89118059T>C	uc001kes.2	+	1	583	c.37T>C	c.(37-39)TTT>CTT	p.F13L	FAM22D_uc009xte.1_Missense_Mutation_p.F13L	NM_001009610	NP_001009610	Q5VT03	FA22D_HUMAN	hypothetical protein LOC728130	13											0						AATTTTCCTGTTTCAGTTGGA	0.532													7	598	---	---	---	---	PASS
TALDO1	6888	broad.mit.edu	37	11	764925	764925	+	3'UTR	SNP	C	T	T	rs72844779	by1000genomes	TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:764925C>T	uc001lqz.2	+	8					TALDO1_uc001lra.2_3'UTR	NM_006755	NP_006746	P37837	TALDO_HUMAN	transaldolase 1						energy reserve metabolic process|xylulose biosynthetic process	cytosol	protein binding|sedoheptulose-7-phosphate:D-glyceraldehyde-3-phosphate glyceronetransferase activity				0		all_cancers(49;1.13e-08)|all_epithelial(84;2.95e-05)|Breast(177;0.000286)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.159)|all_lung(207;0.198)		all cancers(45;4.66e-26)|Epithelial(43;2.97e-25)|OV - Ovarian serous cystadenocarcinoma(40;1.48e-19)|BRCA - Breast invasive adenocarcinoma(625;4.41e-05)|Lung(200;0.0595)|LUSC - Lung squamous cell carcinoma(625;0.0712)		ATGAATCTTGCGTTTTTTACA	0.443											OREG0020662	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	99	---	---	---	---	PASS
OR5T3	390154	broad.mit.edu	37	11	56020415	56020415	+	Missense_Mutation	SNP	C	A	A	rs149435695		TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56020415C>A	uc010rjd.1	+	1	740	c.740C>A	c.(739-741)TCC>TAC	p.S247Y		NM_001004747	NP_001004747	Q8NGG3	OR5T3_HUMAN	olfactory receptor, family 5, subfamily T,	247	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	Esophageal squamous(21;0.00448)					GTCCTCATTTCCTGTGATTTC	0.423													121	236	---	---	---	---	PASS
CNTF	1270	broad.mit.edu	37	11	58391531	58391531	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:58391531A>G	uc001nna.3	+	2	219	c.139A>G	c.(139-141)AAC>GAC	p.N47D	ZFP91-CNTF_uc010rkm.1_RNA	NM_000614	NP_000605	P26441	CNTF_HUMAN	ciliary neurotrophic factor	47					ciliary neurotrophic factor-mediated signaling pathway|growth|negative regulation of neuron apoptosis|positive regulation of tyrosine phosphorylation of Stat3 protein		ciliary neurotrophic factor receptor binding|growth factor activity|interleukin-6 receptor binding			ovary(1)	1		Breast(21;0.00725)|all_epithelial(135;0.0101)|all_lung(304;0.24)				CCTGAACAAGAACATCAACCT	0.512													5	147	---	---	---	---	PASS
MOGAT2	80168	broad.mit.edu	37	11	75439854	75439854	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:75439854T>C	uc010rru.1	+	5	670	c.670T>C	c.(670-672)TTC>CTC	p.F224L	MOGAT2_uc001oww.1_3'UTR|MOGAT2_uc010rrv.1_Missense_Mutation_p.F142L	NM_025098	NP_079374	Q3SYC2	MOGT2_HUMAN	monoacylglycerol O-acyltransferase 2	224					glycerol metabolic process	endoplasmic reticulum membrane|integral to membrane	2-acylglycerol O-acyltransferase activity			ovary(2)	2	Ovarian(111;0.103)					GGTGCCAATCTTCTCCTTCGG	0.537													45	84	---	---	---	---	PASS
TMEM126B	55863	broad.mit.edu	37	11	85346818	85346818	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:85346818A>G	uc001pao.2	+	5	667	c.415A>G	c.(415-417)ACC>GCC	p.T139A	TMEM126B_uc001pap.2_Missense_Mutation_p.T139A|TMEM126B_uc001paq.1_Missense_Mutation_p.T139A	NM_018480	NP_060950	Q8IUX1	T126B_HUMAN	transmembrane protein 126B	169						integral to membrane					0		Acute lymphoblastic leukemia(157;4.88e-06)|all_hematologic(158;0.00572)				ACGCCTGGCAACCAAGTAAGt	0.279													7	468	---	---	---	---	PASS
MTNR1B	4544	broad.mit.edu	37	11	92714908	92714908	+	Silent	SNP	G	C	C			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:92714908G>C	uc001pdk.1	+	2	622	c.519G>C	c.(517-519)CTG>CTC	p.L173L		NM_005959	NP_005950	P49286	MTR1B_HUMAN	melatonin receptor 1B	173	Helical; Name=4; (Potential).				G-protein signaling, coupled to cyclic nucleotide second messenger|glucose homeostasis|regulation of insulin secretion|synaptic transmission	integral to plasma membrane	melatonin receptor activity			ovary(1)|central_nervous_system(1)	2		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)			Ramelteon(DB00980)	TGGCCTTGCTGCCCAACTTCT	0.612													56	98	---	---	---	---	PASS
PLEKHA5	54477	broad.mit.edu	37	12	19436378	19436378	+	Missense_Mutation	SNP	G	C	C			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:19436378G>C	uc001reb.2	+	11	1546	c.1460G>C	c.(1459-1461)GGA>GCA	p.G487A	PLEKHA5_uc010sie.1_Missense_Mutation_p.G493A|PLEKHA5_uc001rea.2_Missense_Mutation_p.G487A|PLEKHA5_uc009zin.2_Missense_Mutation_p.G245A|PLEKHA5_uc010sif.1_Missense_Mutation_p.G379A|PLEKHA5_uc010sig.1_Missense_Mutation_p.G379A|PLEKHA5_uc010sih.1_Missense_Mutation_p.G379A|PLEKHA5_uc001rec.1_Missense_Mutation_p.G175A	NM_019012	NP_061885	Q9HAU0	PKHA5_HUMAN	pleckstrin homology domain containing, family A	487							1-phosphatidylinositol binding|protein binding			ovary(1)|kidney(1)|skin(1)	3	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.00804)					TTAGGACCCGGAGCGGAGGAG	0.498													48	90	---	---	---	---	PASS
TRHDE	29953	broad.mit.edu	37	12	73012774	73012774	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:73012774C>A	uc001sxa.2	+	13	2320	c.2290C>A	c.(2290-2292)CTA>ATA	p.L764I		NM_013381	NP_037513	Q9UKU6	TRHDE_HUMAN	thyrotropin-releasing hormone degrading enzyme	764	Extracellular (Potential).				cell-cell signaling|proteolysis|signal transduction	integral to plasma membrane	aminopeptidase activity|metallopeptidase activity|zinc ion binding			ovary(2)|skin(1)	3						TCTTTATCCTCTAGATAAATT	0.353													43	100	---	---	---	---	PASS
PPP1R12A	4659	broad.mit.edu	37	12	80203775	80203775	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:80203775T>C	uc001syz.2	-	10	1522	c.1255A>G	c.(1255-1257)ACA>GCA	p.T419A	PPP1R12A_uc010suc.1_Missense_Mutation_p.T332A|PPP1R12A_uc001sza.2_Missense_Mutation_p.T419A|PPP1R12A_uc010sud.1_Missense_Mutation_p.T419A|PPP1R12A_uc001szb.2_Missense_Mutation_p.T419A|PPP1R12A_uc001szc.2_Missense_Mutation_p.T419A	NM_002480	NP_002471	O14974	MYPT1_HUMAN	protein phosphatase 1, regulatory (inhibitor)	419						contractile fiber	protein binding|signal transducer activity			ovary(2)|breast(2)|large_intestine(1)|central_nervous_system(1)|skin(1)	7						GAAATTTTTGTAGCTGTGGTT	0.353													6	477	---	---	---	---	PASS
SLC6A15	55117	broad.mit.edu	37	12	85286086	85286086	+	5'UTR	SNP	A	T	T			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:85286086A>T	uc001szv.2	-	2					SLC6A15_uc010sul.1_Intron|SLC6A15_uc001szy.2_5'UTR	NM_182767	NP_877499	Q9H2J7	S6A15_HUMAN	solute carrier family 6, member 15 isoform 1						cellular nitrogen compound metabolic process|leucine transport|proline transport	integral to plasma membrane	amino acid transmembrane transporter activity|neurotransmitter:sodium symporter activity			pancreas(2)|ovary(1)	3						TTCTGTAGGTACCTGTAAAAT	0.284													10	18	---	---	---	---	PASS
NTS	4922	broad.mit.edu	37	12	86276190	86276190	+	3'UTR	SNP	A	T	T			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:86276190A>T	uc001tag.2	+	4						NM_006183	NP_006174	P30990	NEUT_HUMAN	neurotensin/neuromedin N preproprotein						regulation of blood vessel size|signal transduction	extracellular region|soluble fraction|transport vesicle	neuropeptide hormone activity				0						ATTGTGATTCATCATCCCTTA	0.299													58	96	---	---	---	---	PASS
GIT2	9815	broad.mit.edu	37	12	110386642	110386642	+	Intron	SNP	T	C	C			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110386642T>C	uc001tps.2	-						TCHP_uc001tpo.1_Intron|GIT2_uc001tpr.2_Intron|GIT2_uc001tpq.2_Intron|GIT2_uc001tpv.2_Intron|GIT2_uc001tpu.2_Intron|GIT2_uc001tpt.2_Intron|GIT2_uc010sxu.1_Intron|GIT2_uc001tpw.2_Missense_Mutation_p.K468E	NM_057169	NP_476510	Q14161	GIT2_HUMAN	G protein-coupled receptor kinase interacting						regulation of ARF GTPase activity|regulation of G-protein coupled receptor protein signaling pathway	nucleoplasm	ARF GTPase activator activity|protein binding|zinc ion binding			central_nervous_system(1)	1						TTAGCATCTTTTCCAAGCAAC	0.289													7	533	---	---	---	---	PASS
NAA25	80018	broad.mit.edu	37	12	112528650	112528650	+	Silent	SNP	A	G	G			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:112528650A>G	uc001ttm.2	-	3	183	c.163T>C	c.(163-165)TTA>CTA	p.L55L	NAA25_uc001ttn.3_RNA|NAA25_uc009zvz.1_Silent_p.L27L|NAA25_uc009zwa.1_Silent_p.L55L	NM_024953	NP_079229	Q14CX7	NAA25_HUMAN	mitochondrial distribution and morphology 20	55	TPR 2.					cytoplasm	protein binding			ovary(1)|breast(1)|pancreas(1)	3						GTTCTCTGTAAACCAATTGCC	0.408													5	207	---	---	---	---	PASS
DKFZp686A1627	266695	broad.mit.edu	37	13	19626616	19626616	+	RNA	SNP	G	T	T			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:19626616G>T	uc001umb.1	-	8		c.1907C>A				NR_002801				Homo sapiens mRNA; cDNA DKFZp686A1627 (from clone DKFZp686A1627).												0						TTGGTGTCATGAGTGGAGTGT	0.453													5	2	---	---	---	---	PASS
ATP12A	479	broad.mit.edu	37	13	25266644	25266644	+	Silent	SNP	C	T	T			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:25266644C>T	uc001upp.2	+	9	1333	c.1146C>T	c.(1144-1146)CTC>CTT	p.L382L	ATP12A_uc010aaa.2_Silent_p.L388L	NM_001676	NP_001667	P54707	AT12A_HUMAN	hydrogen/potassium-exchanging ATPase 12A	382	Cytoplasmic (Potential).			L -> P (in Ref. 9; AAA35576).	ATP biosynthetic process	hydrogen:potassium-exchanging ATPase complex	ATP binding|hydrogen:potassium-exchanging ATPase activity|metal ion binding			ovary(2)|central_nervous_system(2)|large_intestine(1)|breast(1)	6		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0307)|Epithelial(112;0.086)|OV - Ovarian serous cystadenocarcinoma(117;0.228)	Esomeprazole(DB00736)|Pantoprazole(DB00213)	TGGAGACCCTCGGCTCCACCT	0.567													30	29	---	---	---	---	PASS
EBPL	84650	broad.mit.edu	37	13	50235160	50235160	+	Missense_Mutation	SNP	G	C	C			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:50235160G>C	uc001vdg.2	-	4	628	c.565C>G	c.(565-567)CTA>GTA	p.L189V	EBPL_uc001vdh.2_RNA|EBPL_uc001vdi.2_3'UTR	NM_032565	NP_115954	Q9BY08	EBPL_HUMAN	emopamil binding related protein, delta8-delta7	189					sterol metabolic process	endoplasmic reticulum membrane|integral to membrane	cholestenol delta-isomerase activity				0		Lung NSC(96;0.000468)|Breast(56;0.0011)|Prostate(109;0.00243)|Hepatocellular(98;0.0556)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(99;2.06e-09)		TTGAGTTCTAGCCATGACTGC	0.418													5	173	---	---	---	---	PASS
AHNAK2	113146	broad.mit.edu	37	14	105420074	105420074	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105420074C>T	uc010axc.1	-	7	1834	c.1714G>A	c.(1714-1716)GGC>AGC	p.G572S	AHNAK2_uc001ypx.2_Missense_Mutation_p.G472S	NM_138420	NP_612429	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	572						nucleus				ovary(1)	1		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			TCTTCCCTGCCCTTGTCCTGT	0.527													128	459	---	---	---	---	PASS
JAG2	3714	broad.mit.edu	37	14	105618587	105618587	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105618587A>G	uc001yqg.2	-	6	1234	c.830T>C	c.(829-831)GTC>GCC	p.V277A	JAG2_uc001yqf.2_5'Flank|JAG2_uc001yqh.2_Missense_Mutation_p.V277A	NM_002226	NP_002217	Q9Y219	JAG2_HUMAN	jagged 2 isoform a precursor	277	Extracellular (Potential).|EGF-like 2; atypical.				auditory receptor cell fate commitment|cell communication|cell cycle|Notch receptor processing|Notch signaling pathway|regulation of cell migration|regulation of cell proliferation|spermatogenesis|thymic T cell selection	integral to plasma membrane	calcium ion binding|growth factor activity|Notch binding			lung(3)|breast(2)	5		all_cancers(154;0.0336)|all_epithelial(191;0.0729)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.00989)|all cancers(16;0.0114)|Epithelial(46;0.0272)	Epithelial(152;0.047)|OV - Ovarian serous cystadenocarcinoma(161;0.148)|all cancers(159;0.208)		GGGGTAGGGGACACACTCATC	0.632													4	39	---	---	---	---	PASS
TJP1	7082	broad.mit.edu	37	15	30012669	30012669	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:30012669A>G	uc001zcr.2	-	19	3131	c.2656T>C	c.(2656-2658)TCT>CCT	p.S886P	TJP1_uc010azl.2_Missense_Mutation_p.S874P|TJP1_uc001zcq.2_Missense_Mutation_p.S890P|TJP1_uc001zcs.2_Missense_Mutation_p.S886P	NM_003257	NP_003248	Q07157	ZO1_HUMAN	tight junction protein 1 isoform a	886					cell-cell junction assembly|cellular component disassembly involved in apoptosis	basolateral plasma membrane|cell-cell adherens junction|Golgi apparatus|tight junction				ovary(4)|central_nervous_system(1)|pancreas(1)	6		all_lung(180;7.48e-11)|Breast(32;0.000153)		all cancers(64;3.29e-10)|Epithelial(43;5.34e-09)|BRCA - Breast invasive adenocarcinoma(123;0.0034)|GBM - Glioblastoma multiforme(186;0.0139)|Lung(196;0.186)		TGCATTCCAGAGGAGTCCTCT	0.473													8	552	---	---	---	---	PASS
UACA	55075	broad.mit.edu	37	15	70961382	70961382	+	Silent	SNP	T	C	C			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:70961382T>C	uc002asr.2	-	16	1745	c.1641A>G	c.(1639-1641)AAA>AAG	p.K547K	UACA_uc010uke.1_Silent_p.K438K|UACA_uc002asq.2_Silent_p.K534K|UACA_uc010bin.1_Silent_p.K522K	NM_018003	NP_060473	Q9BZF9	UACA_HUMAN	uveal autoantigen with coiled-coil domains and	547	Potential.					cytoskeleton|extracellular region				ovary(2)|pancreas(1)|skin(1)	4						CTTTCAAGTCTTTCAACTGAT	0.388													7	521	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	16	16418789	16418789	+	3'UTR	SNP	T	C	C			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:16418789T>C	uc010vab.1	+	12					uc002der.3_RNA|uc010vac.1_Missense_Mutation_p.M1T					SubName: Full=cDNA FLJ59085, highly similar to Polycystin-1;																		TTCGAATGCATGGGTGAGTGC	0.682													5	7	---	---	---	---	PASS
ZBTB4	57659	broad.mit.edu	37	17	7369782	7369782	+	Silent	SNP	A	G	G			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7369782A>G	uc002ghc.3	-	3	589	c.339T>C	c.(337-339)CCT>CCC	p.P113P	ZBTB4_uc002ghd.3_Silent_p.P113P	NM_001128833	NP_001122305	Q9P1Z0	ZBTB4_HUMAN	zinc finger and BTB domain containing 4	113	BTB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(2)|ovary(1)|central_nervous_system(1)	4		Colorectal(1115;3.46e-05)|Myeloproliferative disorder(207;0.0255)		COAD - Colon adenocarcinoma(228;4.1e-06)|READ - Rectum adenocarcinoma(115;0.0642)		GAGAGGCTGGAGGGGGagagg	0.383													6	25	---	---	---	---	PASS
TP53	7157	broad.mit.edu	37	17	7578211	7578211	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7578211C>T	uc002gim.2	-	6	832	c.638G>A	c.(637-639)CGA>CAA	p.R213Q	TP53_uc002gig.1_Missense_Mutation_p.R213Q|TP53_uc002gih.2_Missense_Mutation_p.R213Q|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.R81Q|TP53_uc010cng.1_Missense_Mutation_p.R81Q|TP53_uc002gii.1_Missense_Mutation_p.R81Q|TP53_uc010cnh.1_Missense_Mutation_p.R213Q|TP53_uc010cni.1_Missense_Mutation_p.R213Q|TP53_uc002gij.2_Missense_Mutation_p.R213Q|TP53_uc010cnj.1_Intron|TP53_uc002gin.2_Missense_Mutation_p.R120Q|TP53_uc002gio.2_Missense_Mutation_p.R81Q|TP53_uc010vug.1_Missense_Mutation_p.R174Q	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	213	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		R -> L (in sporadic cancers; somatic mutation).|R -> W (in sporadic cancers; somatic mutation).|R -> Q (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> G (in sporadic cancers; somatic mutation).|R -> P (in LFS; germline mutation and in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.R213*(182)|p.R213L(25)|p.R213Q(22)|p.R213fs*34(10)|p.0?(7)|p.R213P(5)|p.R213G(2)|p.K164_P219del(1)|p.D208_V216delDRNTFRHSV(1)|p.D207_R213delDDRNTFR(1)|p.T211_S215delTFRHS(1)|p.R213*33(1)|p.D208fs*1(1)|p.R213>L(1)|p.R209_R213delRNTFR(1)|p.R213fs*2(1)|p.T211fs*28(1)|p.R213_S215>X(1)|p.D207_V216del10(1)|p.R213R(1)|p.R213fs*32(1)|p.R209fs*6(1)|p.R213W(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		CACACTATGTCGAAAAGTGTT	0.532		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			83	247	---	---	---	---	PASS
CCDC42	146849	broad.mit.edu	37	17	8638483	8638483	+	Missense_Mutation	SNP	C	A	A	rs147736220	byFrequency	TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8638483C>A	uc002gln.2	-	6	1031	c.804G>T	c.(802-804)CAG>CAT	p.Q268H	CCDC42_uc002glo.2_Missense_Mutation_p.Q194H	NM_144681	NP_653282	Q96M95	CCD42_HUMAN	coiled-coil domain containing 42 isoform 1	268										ovary(1)	1						TGCTCACGATCTGGAAGAGGT	0.602													59	176	---	---	---	---	PASS
SCO1	6341	broad.mit.edu	37	17	10596183	10596183	+	Missense_Mutation	SNP	C	G	G			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10596183C>G	uc002gmr.3	-	3	521	c.460G>C	c.(460-462)GAC>CAC	p.D154H	SCO1_uc002gms.3_Missense_Mutation_p.D154H	NM_004589	NP_004580	O75880	SCO1_HUMAN	cytochrome oxidase deficient homolog 1	154					cellular copper ion homeostasis|copper ion transport|generation of precursor metabolites and energy|respiratory chain complex IV assembly	mitochondrial inner membrane	copper ion binding				0						CCCAAGTAGTCCTTGTCAGTT	0.448													40	121	---	---	---	---	PASS
NCOR1	9611	broad.mit.edu	37	17	16004763	16004763	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:16004763T>C	uc002gpo.2	-	20	2731	c.2491A>G	c.(2491-2493)AAC>GAC	p.N831D	NCOR1_uc002gpn.2_Missense_Mutation_p.N847D|NCOR1_uc002gpp.1_Missense_Mutation_p.N738D|NCOR1_uc002gpr.2_Missense_Mutation_p.N738D	NM_006311	NP_006302	O75376	NCOR1_HUMAN	nuclear receptor co-repressor 1	831					cellular lipid metabolic process|chromatin modification|negative regulation of JNK cascade|regulation of glycolysis by negative regulation of transcription from an RNA polymerase II promoter|regulation of lipid transport by negative regulation of transcription from an RNA polymerase II promoter|spindle assembly|transcription from RNA polymerase II promoter	nuclear chromatin|spindle microtubule|transcriptional repressor complex	histone deacetylase binding|transcription corepressor activity|transcription regulatory region DNA binding			upper_aerodigestive_tract(2)|ovary(1)|central_nervous_system(1)|kidney(1)	5				UCEC - Uterine corpus endometrioid carcinoma (92;0.101)		GATGCATGGTTTTCTGGCACC	0.478													6	429	---	---	---	---	PASS
MYO19	80179	broad.mit.edu	37	17	34857066	34857066	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34857066G>T	uc010wcy.1	-	23	3082	c.2090C>A	c.(2089-2091)CCA>CAA	p.P697Q	MYO19_uc002hmw.2_Missense_Mutation_p.P497Q|MYO19_uc010cuu.2_RNA	NM_001163735	NP_001157207	Q96H55	MYO19_HUMAN	myosin XIX isoform 2	697						mitochondrial outer membrane|myosin complex	actin binding|ATP binding|motor activity			ovary(1)	1		Breast(25;0.00957)|Ovarian(249;0.17)	Kidney(155;0.104)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0185)		CTCGCTGTGTGGACACCATTC	0.567													22	38	---	---	---	---	PASS
KRT37	8688	broad.mit.edu	37	17	39579887	39579887	+	Intron	SNP	G	A	A			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39579887G>A	uc002hwp.1	-						uc002hwo.1_RNA	NM_003770	NP_003761	O76014	KRT37_HUMAN	keratin 37							intermediate filament	structural molecule activity			skin(1)	1		Breast(137;0.000496)				AATTTAAGGTGTGGAGAGAAA	0.194													20	18	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	17	41382128	41382128	+	Intron	SNP	C	T	T			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41382128C>T	uc002ido.2	-						uc010wia.1_RNA					Homo sapiens cDNA clone IMAGE:5169062, partial cds.																		tggggaggagcggggatttgg	0.010													3	30	---	---	---	---	PASS
EFTUD2	9343	broad.mit.edu	37	17	42936450	42936450	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42936450T>C	uc002ihn.2	-	19	2221	c.1960A>G	c.(1960-1962)AAG>GAG	p.K654E	EFTUD2_uc010wje.1_Missense_Mutation_p.K619E|EFTUD2_uc010wjf.1_Missense_Mutation_p.K644E	NM_004247	NP_004238	Q15029	U5S1_HUMAN	elongation factor Tu GTP binding domain	654						Cajal body|catalytic step 2 spliceosome|cytoplasm|nuclear speck	GTP binding|GTPase activity|protein binding			ovary(1)	1		Prostate(33;0.109)				TGCTGTACCTTGATGTCTATC	0.522													31	104	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	17	76491993	76491993	+	5'Flank	SNP	C	T	T			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76491993C>T	uc002jvt.1	+											Homo sapiens cDNA FLJ45552 fis, clone BRTHA2038279.																		CAGCTCCGCGCGTCCGGCGTA	0.557													35	158	---	---	---	---	PASS
KIAA0802	23255	broad.mit.edu	37	18	8796313	8796313	+	Silent	SNP	A	G	G			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:8796313A>G	uc002knr.2	+	9	2236	c.2094A>G	c.(2092-2094)CGA>CGG	p.R698R	KIAA0802_uc002knq.2_Silent_p.R657R|KIAA0802_uc002kns.2_Silent_p.R28R	NM_015210	NP_056025	Q9Y4B5	CC165_HUMAN	hypothetical protein LOC23255	1008											0						TCCATGAGCGAACCTGGAGTG	0.493													5	175	---	---	---	---	PASS
MBD1	4152	broad.mit.edu	37	18	47803512	47803512	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:47803512T>C	uc010dow.1	-	3	610	c.173A>G	c.(172-174)GAT>GGT	p.D58G	MBD1_uc002lef.2_5'Flank|MBD1_uc002leg.2_Missense_Mutation_p.D58G|MBD1_uc010xdi.1_Missense_Mutation_p.D84G|MBD1_uc002leh.3_Missense_Mutation_p.D58G|MBD1_uc002len.2_Missense_Mutation_p.D58G|MBD1_uc002lei.3_Missense_Mutation_p.D58G|MBD1_uc002lej.3_Missense_Mutation_p.D58G|MBD1_uc002lek.3_Missense_Mutation_p.D58G|MBD1_uc002lel.3_Missense_Mutation_p.D58G|MBD1_uc002lem.3_Missense_Mutation_p.D58G|MBD1_uc010xdj.1_Missense_Mutation_p.D58G|MBD1_uc010xdk.1_Missense_Mutation_p.D58G|MBD1_uc010dox.1_Missense_Mutation_p.D58G|MBD1_uc002leo.2_Missense_Mutation_p.D58G	NM_015846	NP_056671	Q9UIS9	MBD1_HUMAN	methyl-CpG binding domain protein 1 isoform 1	58	MBD.				negative regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	chromosome|nuclear speck	methyl-CpG binding|protein binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2						GAGGGTGAGATCACACGCAGG	0.552													6	253	---	---	---	---	PASS
WDR18	57418	broad.mit.edu	37	19	994289	994289	+	Silent	SNP	C	T	T			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:994289C>T	uc002lqm.1	+	10	1271	c.1245C>T	c.(1243-1245)ATC>ATT	p.I415I	WDR18_uc002lqn.1_RNA|WDR18_uc010drx.1_Silent_p.I378I|WDR18_uc010dry.1_Silent_p.I392I	NM_024100	NP_077005	Q9BV38	WDR18_HUMAN	WD repeat domain 18	415										skin(1)	1		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TGCGCAAGATCAATCGGGACC	0.697													17	29	---	---	---	---	PASS
IFI30	10437	broad.mit.edu	37	19	18286174	18286174	+	Silent	SNP	G	A	A			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18286174G>A	uc002nic.1	+	3	442	c.369G>A	c.(367-369)GAG>GAA	p.E123E	PIK3R2_uc002nib.1_RNA	NM_006332	NP_006323	P13284	GILT_HUMAN	interferon, gamma-inducible protein 30	123					antigen processing and presentation of exogenous peptide antigen via MHC class I|interferon-gamma-mediated signaling pathway	cell junction|extracellular region|lysosome	oxidoreductase activity, acting on a sulfur group of donors				0						GAGAAGAGGAGTGCAAATTCA	0.597													37	110	---	---	---	---	PASS
ARMC6	93436	broad.mit.edu	37	19	19166161	19166161	+	Missense_Mutation	SNP	G	C	C			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19166161G>C	uc002nld.2	+	7	1459	c.1111G>C	c.(1111-1113)GAG>CAG	p.E371Q	ARMC6_uc002nlc.2_Missense_Mutation_p.E346Q|ARMC6_uc010xql.1_Missense_Mutation_p.E278Q|ARMC6_uc002nle.2_Missense_Mutation_p.E346Q|ARMC6_uc010xqm.1_Missense_Mutation_p.E371Q	NM_033415	NP_219483	Q6NXE6	ARMC6_HUMAN	armadillo repeat containing 6	371	ARM 4.						protein binding				0			OV - Ovarian serous cystadenocarcinoma(5;5.66e-06)|Epithelial(12;0.000391)			TGGTGGGACGGAGTCCATCGT	0.612													35	38	---	---	---	---	PASS
CCNE1	898	broad.mit.edu	37	19	30303636	30303636	+	Missense_Mutation	SNP	G	C	C			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:30303636G>C	uc002nsn.2	+	3	247	c.64G>C	c.(64-66)GCG>CCG	p.A22P	CCNE1_uc002nso.2_Missense_Mutation_p.A7P	NM_001238	NP_001229	P24864	CCNE1_HUMAN	cyclin E1 isoform 1	22					androgen receptor signaling pathway|cell division|positive regulation of transcription, DNA-dependent|regulation of cyclin-dependent protein kinase activity|regulation of transcription involved in G1/S phase of mitotic cell cycle	cytosol|nucleoplasm	androgen receptor binding|protein kinase binding|transcription coactivator activity			lung(2)	2	all_cancers(1;2.19e-31)|all_epithelial(1;1.49e-30)|all_lung(1;1.37e-11)|Lung NSC(1;2.35e-11)|Ovarian(5;0.000902)|Breast(6;0.0203)|Esophageal squamous(110;0.195)		UCEC - Uterine corpus endometrioid carcinoma (4;2.65e-06)|Epithelial(1;6.85e-98)|all cancers(1;1.38e-94)|OV - Ovarian serous cystadenocarcinoma(1;1.38e-90)|STAD - Stomach adenocarcinoma(5;5.8e-07)|GBM - Glioblastoma multiforme(4;0.0394)|Lung(7;0.092)|LUAD - Lung adenocarcinoma(5;0.115)|BRCA - Breast invasive adenocarcinoma(6;0.183)|COAD - Colon adenocarcinoma(1;0.188)|Colorectal(1;0.202)			GGACGGCGGCGCGGAGTTCTC	0.672													12	38	---	---	---	---	PASS
CCNE1	898	broad.mit.edu	37	19	30303637	30303637	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:30303637C>T	uc002nsn.2	+	3	248	c.65C>T	c.(64-66)GCG>GTG	p.A22V	CCNE1_uc002nso.2_Missense_Mutation_p.A7V	NM_001238	NP_001229	P24864	CCNE1_HUMAN	cyclin E1 isoform 1	22					androgen receptor signaling pathway|cell division|positive regulation of transcription, DNA-dependent|regulation of cyclin-dependent protein kinase activity|regulation of transcription involved in G1/S phase of mitotic cell cycle	cytosol|nucleoplasm	androgen receptor binding|protein kinase binding|transcription coactivator activity			lung(2)	2	all_cancers(1;2.19e-31)|all_epithelial(1;1.49e-30)|all_lung(1;1.37e-11)|Lung NSC(1;2.35e-11)|Ovarian(5;0.000902)|Breast(6;0.0203)|Esophageal squamous(110;0.195)		UCEC - Uterine corpus endometrioid carcinoma (4;2.65e-06)|Epithelial(1;6.85e-98)|all cancers(1;1.38e-94)|OV - Ovarian serous cystadenocarcinoma(1;1.38e-90)|STAD - Stomach adenocarcinoma(5;5.8e-07)|GBM - Glioblastoma multiforme(4;0.0394)|Lung(7;0.092)|LUAD - Lung adenocarcinoma(5;0.115)|BRCA - Breast invasive adenocarcinoma(6;0.183)|COAD - Colon adenocarcinoma(1;0.188)|Colorectal(1;0.202)			GACGGCGGCGCGGAGTTCTCG	0.677													13	38	---	---	---	---	PASS
FCGBP	8857	broad.mit.edu	37	19	40368701	40368701	+	Missense_Mutation	SNP	A	G	G			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40368701A>G	uc002omp.3	-	28	12655	c.12647T>C	c.(12646-12648)CTC>CCC	p.L4216P		NM_003890	NP_003881	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein precursor	4216	VWFD 10.					extracellular region	protein binding			ovary(4)|skin(4)|central_nervous_system(1)	9	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			GTTACCGCAGAGCCCGCACAC	0.612													6	297	---	---	---	---	PASS
PSG7	5676	broad.mit.edu	37	19	43428847	43428847	+	3'UTR	SNP	C	A	A			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43428847C>A	uc002ovl.3	-	7					PSG3_uc002ouf.2_Intron|PSG11_uc002ouw.2_Intron|PSG7_uc002ous.1_Intron|PSG7_uc002out.1_Intron|PSG10_uc002ouv.1_Intron|PSG6_uc002ovh.1_Intron|PSG6_uc002ovi.2_Intron|PSG6_uc010xwk.1_Intron|PSG11_uc002ovk.1_Intron|PSG7_uc010xwl.1_3'UTR	NM_002783	NP_002774	Q13046	PSG7_HUMAN	pregnancy specific beta-1-glycoprotein 7						female pregnancy	extracellular region					0		Prostate(69;0.00682)				aggattttcccatgaaattta	0.000													70	163	---	---	---	---	PASS
ZNF221	7638	broad.mit.edu	37	19	44470618	44470618	+	Silent	SNP	A	C	C			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44470618A>C	uc002oxx.2	+	6	1292	c.964A>C	c.(964-966)AGA>CGA	p.R322R	ZNF221_uc010ejb.1_Silent_p.R322R|ZNF221_uc010xws.1_Silent_p.R322R	NM_013359	NP_037491	Q9UK13	ZN221_HUMAN	zinc finger protein 221	322	C2H2-type 6.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(1)	1		Prostate(69;0.0352)				CTTCCGTGTTAGATCAAGACT	0.403													110	197	---	---	---	---	PASS
MYH14	79784	broad.mit.edu	37	19	50812921	50812921	+	Silent	SNP	C	G	G			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50812921C>G	uc002prr.1	+	41	5909	c.5862C>G	c.(5860-5862)ACC>ACG	p.T1954T	MYH14_uc010enu.1_Silent_p.T1995T|MYH14_uc002prq.1_Silent_p.T1962T|MYH14_uc010ycb.1_Silent_p.T305T|MYH14_uc002prs.1_Silent_p.T305T	NM_024729	NP_079005	Q7Z406	MYH14_HUMAN	myosin, heavy chain 14 isoform 2	1954					axon guidance|regulation of cell shape	myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			central_nervous_system(1)	1		all_neural(266;0.0571)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00389)|GBM - Glioblastoma multiforme(134;0.0195)		CCTTCACCACCCGCACGGTGC	0.592													11	67	---	---	---	---	PASS
LILRA2	11027	broad.mit.edu	37	19	55085835	55085835	+	Silent	SNP	C	A	A			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55085835C>A	uc002qgg.3	+	3	227	c.138C>A	c.(136-138)ACC>ACA	p.T46T	LILRA2_uc010ern.2_Silent_p.T46T|LILRA2_uc002qgf.2_Silent_p.T46T|LILRA2_uc010yfe.1_Silent_p.T46T|LILRA2_uc010yff.1_Silent_p.T34T|LILRA2_uc010ero.2_Silent_p.T34T|LILRA2_uc010yfg.1_Silent_p.T46T	NM_001130917	NP_001124389	Q8N149	LIRA2_HUMAN	leukocyte immunoglobulin-like receptor,	46	Extracellular (Potential).|Ig-like C2-type 1.				defense response	integral to membrane	antigen binding|receptor activity			ovary(1)	1				GBM - Glioblastoma multiforme(193;0.0963)		GTCCTGTGACCCTCAGGTGTC	0.542													57	118	---	---	---	---	PASS
FCAR	2204	broad.mit.edu	37	19	55396904	55396904	+	Missense_Mutation	SNP	C	T	T	rs143972917		TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55396904C>T	uc002qhr.1	+	3	525	c.328C>T	c.(328-330)CGG>TGG	p.R110W	FCAR_uc002qhq.2_Missense_Mutation_p.R110W|FCAR_uc002qhs.1_RNA|FCAR_uc002qht.1_Missense_Mutation_p.R83W|FCAR_uc010esi.1_Missense_Mutation_p.R83W|FCAR_uc002qhu.1_Missense_Mutation_p.R110W|FCAR_uc002qhv.1_Missense_Mutation_p.R110W|FCAR_uc002qhw.1_Missense_Mutation_p.R98W|FCAR_uc002qhx.1_Missense_Mutation_p.R98W|FCAR_uc002qhy.1_Missense_Mutation_p.R98W|FCAR_uc002qhz.1_Missense_Mutation_p.R98W|FCAR_uc002qia.1_Intron	NM_002000	NP_001991	P24071	FCAR_HUMAN	Fc alpha receptor isoform a precursor	110	Extracellular (Potential).				immune response	extracellular region|integral to plasma membrane	IgA binding|receptor activity			ovary(1)|skin(1)	2				GBM - Glioblastoma multiforme(193;0.0443)		CTACAGATTCCGGTACAGTGA	0.443													34	69	---	---	---	---	PASS
NLRP5	126206	broad.mit.edu	37	19	56552314	56552314	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56552314C>T	uc002qmj.2	+	11	2813	c.2813C>T	c.(2812-2814)ACG>ATG	p.T938M	NLRP5_uc002qmi.2_Missense_Mutation_p.T919M	NM_153447	NP_703148	P59047	NALP5_HUMAN	NACHT, LRR and PYD containing protein 5	938						mitochondrion|nucleolus	ATP binding			ovary(3)|skin(2)|kidney(1)|central_nervous_system(1)	7		Colorectal(82;3.46e-05)|Ovarian(87;0.0481)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0326)		ATCACAGCCACGGGTTGCCAG	0.537													36	59	---	---	---	---	PASS
PLCB4	5332	broad.mit.edu	37	20	9382178	9382178	+	Missense_Mutation	SNP	A	C	C			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:9382178A>C	uc002wnf.2	+	19	1688	c.1552A>C	c.(1552-1554)AAT>CAT	p.N518H	PLCB4_uc010gbw.1_Missense_Mutation_p.N518H|PLCB4_uc010gbx.2_Missense_Mutation_p.N518H|PLCB4_uc002wne.2_Missense_Mutation_p.N518H|PLCB4_uc002wnh.2_Missense_Mutation_p.N365H	NM_182797	NP_877949	Q15147	PLCB4_HUMAN	phospholipase C beta 4 isoform b	518					intracellular signal transduction|lipid catabolic process	cytosol	calcium ion binding|phosphatidylinositol phospholipase C activity|protein binding|signal transducer activity			skin(11)|ovary(3)|pancreas(1)	15						CAAATTTGGAAATGAACTTTC	0.458													49	124	---	---	---	---	PASS
TUBB1	81027	broad.mit.edu	37	20	57599843	57599843	+	3'UTR	SNP	G	T	T			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57599843G>T	uc002yak.2	+	4						NM_030773	NP_110400	Q9H4B7	TBB1_HUMAN	beta tubulin 1, class VI						'de novo' posttranslational protein folding|microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity			ovary(1)	1	all_lung(29;0.00711)		Colorectal(105;0.109)		Colchicine(DB01394)|Docetaxel(DB01248)|Paclitaxel(DB01229)|Vindesine(DB00309)	CATTAACTGTGAGAGAAGCTG	0.483													17	28	---	---	---	---	PASS
MAOA	4128	broad.mit.edu	37	X	43571201	43571201	+	Missense_Mutation	SNP	C	T	T			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:43571201C>T	uc004dfy.2	+	4	570	c.389C>T	c.(388-390)ACA>ATA	p.T130I	MAOA_uc011mkw.1_5'UTR	NM_000240	NP_000231	P21397	AOFA_HUMAN	monoamine oxidase A	130	Cytoplasmic.				behavior|neurotransmitter biosynthetic process|neurotransmitter catabolic process|neurotransmitter secretion|xenobiotic metabolic process	integral to membrane|mitochondrial outer membrane	primary amine oxidase activity|protein binding			breast(2)|ovary(1)	3					Almotriptan(DB00918)|Carbidopa(DB00190)|Clonazepam(DB01068)|Dopamine(DB00988)|Fluvoxamine(DB00176)|Ginkgo biloba(DB01381)|Imipramine(DB00458)|Isocarboxazid(DB01247)|Levodopa(DB01235)|Linezolid(DB00601)|Lorazepam(DB00186)|Moclobemide(DB01171)|Nicotine(DB00184)|Norepinephrine(DB00368)|Phenelzine(DB00780)|Phenmetrazine(DB00830)|Phentermine(DB00191)|Phenylephrine(DB00388)|Phenylpropanolamine(DB00397)|Pseudoephedrine(DB00852)|Rasagiline(DB01367)|Riboflavin(DB00140)|Rizatriptan(DB00953)|Selegiline(DB01037)|Sumatriptan(DB00669)|Testosterone(DB00624)|Tranylcypromine(DB00752)|Zolmitriptan(DB00315)	CTGTGGAGGACAATAGATAAC	0.393													219	430	---	---	---	---	PASS
ZMYM3	9203	broad.mit.edu	37	X	70467240	70467240	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:70467240G>T	uc004dzh.1	-	13	2356	c.2269C>A	c.(2269-2271)CAA>AAA	p.Q757K	BCYRN1_uc011mpt.1_Intron|ZMYM3_uc004dzi.1_Missense_Mutation_p.Q757K|ZMYM3_uc004dzj.1_Missense_Mutation_p.Q757K	NM_201599	NP_963893	Q14202	ZMYM3_HUMAN	zinc finger protein 261	757					multicellular organismal development	nucleus	DNA binding|zinc ion binding			ovary(1)	1	Renal(35;0.156)					AGGTTGGGTTGGTTCTGCTGG	0.577													36	66	---	---	---	---	PASS
PABPC5	140886	broad.mit.edu	37	X	90691460	90691460	+	Missense_Mutation	SNP	A	C	C			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:90691460A>C	uc004efg.2	+	2	1324	c.884A>C	c.(883-885)GAA>GCA	p.E295A	PABPC5_uc004eff.1_Missense_Mutation_p.E131A	NM_080832	NP_543022	Q96DU9	PABP5_HUMAN	poly(A) binding protein, cytoplasmic 5	295						cytoplasm	nucleotide binding|RNA binding			ovary(1)|lung(1)|pancreas(1)	3						AGGTTAAAAGAAAAAAGTCGG	0.438													46	84	---	---	---	---	PASS
RPA4	29935	broad.mit.edu	37	X	96139817	96139817	+	Nonsense_Mutation	SNP	A	T	T			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:96139817A>T	uc004efv.3	+	1	806	c.508A>T	c.(508-510)AAA>TAA	p.K170*	DIAPH2_uc004eft.3_Intron|DIAPH2_uc004efu.3_Intron|DIAPH2_uc004efs.2_Intron	NM_013347	NP_037479	Q13156	RFA4_HUMAN	replication protein A4, 34kDa	170					DNA damage checkpoint|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|nucleotide-excision repair	DNA replication factor A complex|nucleoplasm	single-stranded DNA binding				0						GATGCTGGATAAAGCCCGTCG	0.458								Other_identified_genes_with_known_or_suspected_DNA_repair_function					90	163	---	---	---	---	PASS
ARMCX2	9823	broad.mit.edu	37	X	100912452	100912452	+	Silent	SNP	G	A	A			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:100912452G>A	uc004eid.2	-	3	478	c.123C>T	c.(121-123)CCC>CCT	p.P41P	ARMCX2_uc004eie.3_Silent_p.P41P|ARMCX2_uc004eif.3_Silent_p.P41P|ARMCX2_uc004eig.3_Silent_p.P41P|ARMCX2_uc010nnt.2_Silent_p.P41P	NM_177949	NP_808818	Q7L311	ARMX2_HUMAN	ALEX2 protein	41						integral to membrane	binding			ovary(6)	6						cccGGTTTTTGGGCTTGGCCA	0.453													40	83	---	---	---	---	PASS
NXF5	55998	broad.mit.edu	37	X	101098107	101098107	+	5'UTR	SNP	G	A	A			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:101098107G>A	uc011mrk.1	-	2					NXF5_uc004eih.1_RNA|NXF5_uc004eii.1_RNA|NXF5_uc004eij.1_RNA|NXF5_uc004eik.1_RNA|NXF5_uc004eil.1_RNA	NM_032946	NP_116564	Q9H1B4	NXF5_HUMAN	nuclear RNA export factor 5						mRNA export from nucleus|multicellular organismal development	actin cytoskeleton|cytoplasm|nucleus	nucleocytoplasmic transporter activity|nucleotide binding|protein binding|RNA binding			central_nervous_system(1)	1						CTTAGTTGGCGGTCCTTGTGG	0.507													112	266	---	---	---	---	PASS
IGSF1	3547	broad.mit.edu	37	X	130409532	130409532	+	Missense_Mutation	SNP	C	T	T	rs141065877		TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:130409532C>T	uc004ewd.2	-	16	3342	c.3104G>A	c.(3103-3105)CGT>CAT	p.R1035H	IGSF1_uc004ewe.3_Missense_Mutation_p.R1029H|IGSF1_uc004ewf.2_Missense_Mutation_p.R1015H	NM_001555	NP_001546	Q8N6C5	IGSF1_HUMAN	immunoglobulin superfamily, member 1 isoform 1	1035	Extracellular (Potential).|Ig-like C2-type 10.				regulation of transcription, DNA-dependent	extracellular region|integral to membrane	inhibin beta-A binding|inhibin beta-B binding			ovary(3)|lung(1)|central_nervous_system(1)	5						GCAGCTGTAACGCCCCATGCT	0.522													9	296	---	---	---	---	PASS
MAGEC1	9947	broad.mit.edu	37	X	140996270	140996270	+	Missense_Mutation	SNP	G	C	C			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:140996270G>C	uc004fbt.2	+	4	3366	c.3080G>C	c.(3079-3081)GGG>GCG	p.G1027A	MAGEC1_uc010nsl.1_Missense_Mutation_p.G94A	NM_005462	NP_005453	O60732	MAGC1_HUMAN	melanoma antigen family C, 1	1027	MAGE.						protein binding			ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4	Acute lymphoblastic leukemia(192;6.56e-05)					AGTGGAATAGGGGTGCGTGCT	0.542										HNSCC(15;0.026)			44	103	---	---	---	---	PASS
GABRE	2564	broad.mit.edu	37	X	151130895	151130895	+	Missense_Mutation	SNP	C	A	A			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:151130895C>A	uc004ffi.2	-	4	617	c.563G>T	c.(562-564)AGG>ATG	p.R188M	GABRE_uc011myd.1_RNA|GABRE_uc011mye.1_RNA|MIR452_hsa-mir-452|MI0001733_5'Flank	NM_004961	NP_004952	P78334	GBRE_HUMAN	gamma-aminobutyric acid (GABA) A receptor,	188	Extracellular (Probable).				gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			ovary(2)	2	Acute lymphoblastic leukemia(192;6.56e-05)					CTTGACATACCTAATTGTGTA	0.453													6	151	---	---	---	---	PASS
MAGEA10	4109	broad.mit.edu	37	X	151303633	151303633	+	Missense_Mutation	SNP	G	T	T			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:151303633G>T	uc004ffk.2	-	5	868	c.460C>A	c.(460-462)CCG>ACG	p.P154T	MAGEA10_uc004ffl.2_Missense_Mutation_p.P154T	NM_001011543	NP_001011543	P43363	MAGAA_HUMAN	melanoma antigen family A, 10	154	MAGE.										0	Acute lymphoblastic leukemia(192;6.56e-05)					TTTGTGATCGGCTCCTTCATT	0.443													37	185	---	---	---	---	PASS
GABRQ	55879	broad.mit.edu	37	X	151820004	151820004	+	Missense_Mutation	SNP	T	C	C			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:151820004T>C	uc004ffp.1	+	8	937	c.917T>C	c.(916-918)CTC>CCC	p.L306P		NM_018558	NP_061028	Q9UN88	GBRT_HUMAN	gamma-aminobutyric acid (GABA) receptor, theta	306						cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity|neurotransmitter transporter activity			ovary(2)|pancreas(1)	3	Acute lymphoblastic leukemia(192;6.56e-05)					ACTTCAATGCTCATCCTGACC	0.473													7	561	---	---	---	---	PASS
MAGEA12	4111	broad.mit.edu	37	X	151896589	151896589	+	RNA	SNP	C	A	A			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:151896589C>A	uc004fgb.2	-	3		c.388G>T						P43365	MAGAC_HUMAN	Homo sapiens melanoma antigen family A, 12, mRNA (cDNA clone MGC:4914 IMAGE:3450217), complete cds.											skin(1)	1	Acute lymphoblastic leukemia(192;6.56e-05)					GGTTGTTGGACAATGGGCTGG	0.557													6	646	---	---	---	---	PASS
F8	2157	broad.mit.edu	37	X	154194857	154194857	+	Missense_Mutation	SNP	G	A	A			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:154194857G>A	uc004fmt.2	-	8	1286	c.1115C>T	c.(1114-1116)TCT>TTT	p.S372F		NM_000132	NP_000123	P00451	FA8_HUMAN	coagulation factor VIII isoform a precursor	372					acute-phase response|blood coagulation, intrinsic pathway|cell adhesion|platelet activation|platelet degranulation	extracellular space|plasma membrane|platelet alpha granule lumen	copper ion binding|oxidoreductase activity|protein binding			ovary(5)|large_intestine(2)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	11	all_cancers(53;7.19e-17)|all_epithelial(53;9.83e-11)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)				Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Drotrecogin alfa(DB00055)	ATCCATTTCAGAATCAGTAAG	0.398													57	299	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	2345	2345	+	5'Flank	SNP	G	A	A			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:2345G>A	uc004coq.3	-						uc004cos.3_RNA					Homo sapiens cDNA: FLJ22857 fis, clone KAT01615.																		GCATAAGCCTGCGTCAGATCA	0.403													7	163	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	3531	3531	+	RNA	SNP	G	A	A			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:3531G>A	uc004cos.3	+	2		c.1824G>A			uc011mfh.1_5'Flank					Homo sapiens mRNA expressed only in placental villi, clone SMAP47.																		ATCACCGCCCCGACCTTAGCT	0.547													87	40	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	9163	9163	+	RNA	SNP	G	A	A			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:9163G>A	uc011mfi.1	+	1		c.501G>A			uc004cov.3_5'Flank					Homo sapiens mRNA for OK/SW-CL.16, complete cds.																		TCCAAGCCTACGTTTTCACAC	0.418													5	192	---	---	---	---	PASS
CROCC	9696	broad.mit.edu	37	1	17124806	17124806	+	Intron	DEL	G	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17124806delG	uc009voy.1	+									Q5TZA2	CROCC_HUMAN	Homo sapiens mRNA for KIAA0445 protein, partial cds.						cell cycle|cell projection organization|centrosome organization|protein localization	actin cytoskeleton|centriole|ciliary rootlet|plasma membrane	kinesin binding|structural molecule activity			ovary(2)|breast(2)|central_nervous_system(1)	5		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)		CTGGATCCCTGCAAGGAAACA	0.453													4	2	---	---	---	---	
CDA	978	broad.mit.edu	37	1	20943187	20943188	+	Intron	INS	-	G	G			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:20943187_20943188insG	uc001bdk.2	+						CDA_uc001bdl.2_Intron|CDA_uc009vpv.2_Intron	NM_001785	NP_001776	P32320	CDD_HUMAN	cytidine deaminase						cell surface receptor linked signaling pathway|cytosine metabolic process|negative regulation of cell growth|negative regulation of nucleotide metabolic process|protein homotetramerization|pyrimidine nucleoside salvage	cytosol|extracellular region	cytidine deaminase activity|nucleoside binding|protein homodimerization activity|zinc ion binding			ovary(1)	1		Lung NSC(340;1.75e-08)|all_lung(284;5.99e-08)|Colorectal(325;3.46e-05)|Renal(390;0.000147)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|GBM - Glioblastoma multiforme(114;1.06e-08)|COAD - Colon adenocarcinoma(152;1.22e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000148)|Kidney(64;0.000184)|KIRC - Kidney renal clear cell carcinoma(64;0.0027)|STAD - Stomach adenocarcinoma(196;0.00308)|READ - Rectum adenocarcinoma(331;0.0652)|Lung(427;0.199)	Azacitidine(DB00928)|Capecitabine(DB01101)|Cytarabine(DB00987)|Gemcitabine(DB00441)	TGAAGGAGGCAGGGGGGAAACT	0.505													4	2	---	---	---	---	
PUM1	9698	broad.mit.edu	37	1	31479763	31479763	+	Intron	DEL	T	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:31479763delT	uc001bsi.1	-						PUM1_uc001bsg.1_5'Flank|PUM1_uc001bsh.1_Intron|PUM1_uc001bsj.1_Intron|PUM1_uc010oga.1_Intron|PUM1_uc001bsk.1_Intron|PUM1_uc010ogb.1_Intron	NM_014676	NP_055491	Q14671	PUM1_HUMAN	pumilio 1 isoform 2						cellular membrane organization|post-Golgi vesicle-mediated transport|regulation of translation	cytosol	RNA binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3		Colorectal(325;0.0211)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|all_neural(195;0.0381)|Breast(348;0.0848)|Medulloblastoma(700;0.123)		STAD - Stomach adenocarcinoma(196;0.0232)|READ - Rectum adenocarcinoma(331;0.0681)		TGATGTAAAATTCATGACTTG	0.378													103	75	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	37134831	37134831	+	IGR	DEL	T	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:37134831delT								CSF3R (186322 upstream) : GRIK3 (126297 downstream)																							ACGTTGGAGATTTTTTTTCTG	0.373													5	3	---	---	---	---	
ZSWIM5	57643	broad.mit.edu	37	1	45517000	45517001	+	Intron	DEL	TT	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:45517000_45517001delTT	uc001cnd.2	-							NM_020883	NP_065934	Q9P217	ZSWM5_HUMAN	zinc finger, SWIM domain containing 5								zinc ion binding				0	Acute lymphoblastic leukemia(166;0.155)					TTCAGTTTCATTTTTAGATGGT	0.337													17	14	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	56280603	56280603	+	IGR	DEL	T	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:56280603delT								USP24 (599841 upstream) : PPAP2B (679830 downstream)																							TTCACATAGGTTAGGGGACCA	0.373													4	2	---	---	---	---	
WDR78	79819	broad.mit.edu	37	1	67358718	67358720	+	Intron	DEL	GAA	-	-	rs60496796		TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:67358718_67358720delGAA	uc001dcx.2	-						WDR78_uc001dcy.2_Intron|WDR78_uc001dcz.2_Intron|WDR78_uc009wax.2_5'Flank	NM_024763	NP_079039	Q5VTH9	WDR78_HUMAN	WD repeat domain 78 isoform 1											ovary(2)	2						agaaagagaggaaagaaagaaag	0.039													6	3	---	---	---	---	
ST6GALNAC3	256435	broad.mit.edu	37	1	76614839	76614840	+	Intron	DEL	TT	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:76614839_76614840delTT	uc001dhh.2	+						ST6GALNAC3_uc001dhg.3_Intron|ST6GALNAC3_uc010orh.1_Intron	NM_152996	NP_694541	Q8NDV1	SIA7C_HUMAN	sialyltransferase 7C isoform 1						protein glycosylation	integral to Golgi membrane	sialyltransferase activity			ovary(3)|skin(2)	5						CTTTTCTGGCTTATGGGGCTTA	0.282													4	2	---	---	---	---	
ABCA4	24	broad.mit.edu	37	1	94573467	94573468	+	Intron	INS	-	C	C			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:94573467_94573468insC	uc001dqh.2	-						ABCA4_uc010otn.1_Intron	NM_000350	NP_000341	P78363	ABCA4_HUMAN	ATP-binding cassette, sub-family A member 4						phototransduction, visible light|visual perception	integral to plasma membrane|membrane fraction	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(4)|skin(4)|central_nervous_system(2)|upper_aerodigestive_tract(1)|breast(1)	12		all_lung(203;0.000757)|Lung NSC(277;0.00335)		all cancers(265;0.00432)|GBM - Glioblastoma multiforme(16;0.00715)|Epithelial(280;0.171)		cctcttcatttcccccagtcca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	99690138	99690138	+	IGR	DEL	G	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:99690138delG								LPPR5 (219689 upstream) : LPPR4 (39762 downstream)																							ACCAGTGAGAGGGGAgaattc	0.214													4	2	---	---	---	---	
NBPF9	400818	broad.mit.edu	37	1	145049563	145049563	+	Intron	DEL	C	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145049563delC	uc010oye.1	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001emh.2_Intron			Q3BBV1	NBPFK_HUMAN	RecName: Full=Neuroblastoma breakpoint family member 8;							cytoplasm					0						caaagggaagcccatcagact	0.000													4	2	---	---	---	---	
NBPF9	400818	broad.mit.edu	37	1	145054268	145054269	+	Intron	INS	-	G	G	rs149978567		TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145054268_145054269insG	uc010oye.1	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001emh.2_Intron			Q3BBV1	NBPFK_HUMAN	RecName: Full=Neuroblastoma breakpoint family member 8;							cytoplasm					0						TGTGGTTACCTTCATTCATTTA	0.386													6	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	148864013	148864013	+	IGR	DEL	C	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148864013delC								NBPF16 (105702 upstream) : LOC645166 (64273 downstream)																							gatttataatcccaccccagc	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	151705598	151705598	+	IGR	DEL	T	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151705598delT								C1orf230 (3516 upstream) : MRPL9 (26527 downstream)																							tgtGTTTTTGTTTTTTTTTGT	0.060													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	157365537	157365537	+	IGR	DEL	G	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157365537delG								ETV3 (257154 upstream) : FCRL5 (117631 downstream)																							ataagaggatggaaaagatat	0.000													4	2	---	---	---	---	
PVRL4	81607	broad.mit.edu	37	1	161046141	161046141	+	Intron	DEL	T	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161046141delT	uc001fxo.2	-						PVRL4_uc010pjy.1_5'Flank|PVRL4_uc010pjz.1_Intron	NM_030916	NP_112178	Q96NY8	PVRL4_HUMAN	poliovirus receptor-related 4 precursor						adherens junction organization|cell adhesion|cell junction assembly	adherens junction|extracellular region|integral to membrane				ovary(2)	2	all_cancers(52;8.9e-20)|Breast(13;0.00188)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00165)			GCTCGGGCCCTTACCGTGTCC	0.547													55	24	---	---	---	---	
ADAMTS4	9507	broad.mit.edu	37	1	161165724	161165725	+	Intron	INS	-	AC	AC	rs143918790	by1000genomes	TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161165724_161165725insAC	uc001fyt.3	-							NM_005099	NP_005090	O75173	ATS4_HUMAN	ADAM metallopeptidase with thrombospondin type 1						proteolysis|skeletal system development	extracellular space|proteinaceous extracellular matrix	metalloendopeptidase activity|protease binding|zinc ion binding			ovary(4)|central_nervous_system(1)	5	all_cancers(52;3.73e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00275)			cacacacacagacacacacaca	0.347													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	165953449	165953449	+	IGR	DEL	T	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:165953449delT								UCK2 (76112 upstream) : FAM78B (75967 downstream)																							tcctggggactttttgtgatg	0.000													4	2	---	---	---	---	
C1orf125	126859	broad.mit.edu	37	1	179462338	179462339	+	Intron	INS	-	CTAT	CTAT	rs142692537		TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:179462338_179462339insCTAT	uc001gmo.2	+						C1orf125_uc009wxg.2_Intron|C1orf125_uc001gmp.2_Intron|C1orf125_uc009wxh.2_Intron	NM_144696	NP_653297	Q5T1B0	AXDN1_HUMAN	hypothetical protein LOC126859 isoform 1												0						tgtctgatctactaacaccaaa	0.000													3	4	---	---	---	---	
RGSL1	353299	broad.mit.edu	37	1	182499673	182499674	+	Intron	INS	-	AC	AC	rs141531543	by1000genomes	TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:182499673_182499674insAC	uc009wxw.2	+						RGSL1_uc010pnu.1_Intron|RGSL1_uc009wxx.1_Intron	NM_001137669	NP_001131141	A5PLK6	RGSL_HUMAN	regulator of G-protein signaling like 1							integral to membrane	signal transducer activity			central_nervous_system(1)	1						cacacacacatacacacacaca	0.272													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	200192178	200192179	+	IGR	DEL	AC	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:200192178_200192179delAC								FAM58B (8535 upstream) : ZNF281 (183247 downstream)																							CAACCGTGTGACACACACACAC	0.322													4	2	---	---	---	---	
PLEKHA6	22874	broad.mit.edu	37	1	204289965	204289965	+	Intron	DEL	A	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:204289965delA	uc001hau.2	-							NM_014935	NP_055750	Q9Y2H5	PKHA6_HUMAN	phosphoinositol 3-phosphate-binding protein-3											ovary(3)|pancreas(1)	4	all_cancers(21;0.0222)|Breast(84;0.179)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|BRCA - Breast invasive adenocarcinoma(75;0.0833)|Kidney(21;0.0934)|Epithelial(59;0.229)			GCCTTCCCCCAAAAAACCCAG	0.512													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	218828829	218828829	+	IGR	DEL	C	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:218828829delC								TGFB2 (210870 upstream) : LYPLAL1 (518363 downstream)																							gcacacataaccccctcagag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	218843289	218843290	+	IGR	INS	-	T	T	rs139100359	by1000genomes	TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:218843289_218843290insT								TGFB2 (225330 upstream) : LYPLAL1 (503902 downstream)																							TGAGCCACTTGtttttttttgc	0.208													4	2	---	---	---	---	
PCNXL2	80003	broad.mit.edu	37	1	233202882	233202882	+	Intron	DEL	T	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:233202882delT	uc001hvl.2	-						PCNXL2_uc001hvm.1_Intron|PCNXL2_uc009xfu.2_Intron	NM_014801	NP_055616	A6NKB5	PCX2_HUMAN	pecanex-like 2							integral to membrane				central_nervous_system(1)|pancreas(1)	2		all_cancers(173;0.0347)|Prostate(94;0.137)				ggtgtaaatattatccagagg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	847481	847482	+	Intron	DEL	GT	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:847481_847482delGT	uc002qwn.1	-						uc002qwo.1_Intron					Homo sapiens cDNA clone IMAGE:5174186.																		gtgtgtgtgagtgtgtgtgtgt	0.094													4	2	---	---	---	---	
MYT1L	23040	broad.mit.edu	37	2	1927018	1927018	+	Frame_Shift_Del	DEL	A	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1927018delA	uc002qxe.2	-	10	1350	c.523delT	c.(523-525)TGTfs	p.C175fs	MYT1L_uc002qxd.2_Frame_Shift_Del_p.C175fs|MYT1L_uc010ewl.1_RNA	NM_015025	NP_055840	Q9UL68	MYT1L_HUMAN	myelin transcription factor 1-like	175					cell differentiation|nervous system development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|central_nervous_system(1)	6	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)		GTATTGTGACAATTCATTTGA	0.308													134	74	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	13024831	13024831	+	IGR	DEL	C	-	-	rs1879543	by1000genomes	TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:13024831delC								TRIB2 (141975 upstream) : None (None downstream)																							GGAGTCAGGGCTGGGAAACAG	0.403													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	20619989	20619990	+	IGR	INS	-	T	T			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:20619989_20619990insT								PUM2 (69526 upstream) : RHOB (26845 downstream)																							AAAGGTAGAAATTGAAGTAATG	0.436													4	2	---	---	---	---	
CRIM1	51232	broad.mit.edu	37	2	36677184	36677184	+	Intron	DEL	T	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:36677184delT	uc002rpd.2	+							NM_016441	NP_057525	Q9NZV1	CRIM1_HUMAN	cysteine-rich motor neuron 1 precursor						nervous system development|regulation of cell growth	extracellular region|integral to membrane|plasma membrane	insulin-like growth factor binding|insulin-like growth factor receptor activity|serine-type endopeptidase inhibitor activity			ovary(2)|skin(1)	3		all_hematologic(82;0.131)|Acute lymphoblastic leukemia(82;0.154)				TTAGTTAACCTTTTTTTTTTC	0.363													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	49154617	49154617	+	IGR	DEL	G	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:49154617delG								LHCGR (171737 upstream) : FSHR (35036 downstream)																							GAGAAACTTTGGGGCAGATGA	0.463													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	49875647	49875647	+	IGR	DEL	T	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:49875647delT								FSHR (494017 upstream) : NRXN1 (269997 downstream)																							GAAGCAAAAATTCTAGGGAGC	0.299													4	2	---	---	---	---	
EHBP1	23301	broad.mit.edu	37	2	63224187	63224187	+	Intron	DEL	A	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:63224187delA	uc002sby.2	+						EHBP1_uc010fcp.2_Intron|EHBP1_uc002sbz.2_Intron|EHBP1_uc002scb.2_Intron	NM_015252	NP_056067	Q8NDI1	EHBP1_HUMAN	EH domain binding protein 1 isoform 1							cytoplasm|membrane				ovary(1)|breast(1)	2	Lung NSC(7;0.0951)|all_lung(7;0.169)		LUSC - Lung squamous cell carcinoma(7;7.74e-05)|Epithelial(17;0.189)			GCCACTGCTTAAAAAAAAAGT	0.418									Hereditary_Prostate_Cancer				4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	64639888	64639889	+	IGR	DEL	GC	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:64639888_64639889delGC								PELI1 (268283 upstream) : HSPC159 (41438 downstream)																							atagcatcttgcttcagtctac	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	69138980	69138981	+	IGR	INS	-	C	C	rs148644857	by1000genomes	TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:69138980_69138981insC								BMP10 (40331 upstream) : GKN2 (33384 downstream)																							ACTCAACCTCACCCCCCCAACC	0.421													4	2	---	---	---	---	
SLC4A5	57835	broad.mit.edu	37	2	74471273	74471273	+	Intron	DEL	C	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74471273delC	uc002sko.1	-						SLC4A5_uc002skl.2_Intron|SLC4A5_uc002skn.2_Intron|SLC4A5_uc010ffc.1_Intron|SLC4A5_uc002skp.1_Intron|SLC4A5_uc002sks.1_Intron	NM_021196	NP_067019	Q9BY07	S4A5_HUMAN	sodium bicarbonate transporter 4 isoform a							apical plasma membrane|integral to membrane	inorganic anion exchanger activity|sodium:bicarbonate symporter activity			ovary(5)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	9						ATTTTCCTTTCCATGTTATCT	0.403													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	74958215	74958215	+	IGR	DEL	G	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74958215delG								SEMA4F (49030 upstream) : HK2 (101567 downstream)																							tcacagatatggaagtccaag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	76030915	76030915	+	IGR	DEL	A	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:76030915delA								C2orf3 (92804 upstream) : LRRTM4 (943943 downstream)																							tgcttttttgaagtgactaaa	0.090													4	2	---	---	---	---	
USP39	10713	broad.mit.edu	37	2	85856020	85856020	+	Intron	DEL	C	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:85856020delC	uc002sqe.2	+						USP39_uc002sqb.2_Intron|USP39_uc010ysu.1_Intron|USP39_uc010ysv.1_Intron|USP39_uc010fgn.1_Intron|USP39_uc002sqf.2_Intron|USP39_uc002sqg.2_Intron|USP39_uc010fgo.2_Intron	NM_006590	NP_006581	Q53GS9	SNUT2_HUMAN	ubiquitin specific protease 39						spliceosome assembly|ubiquitin-dependent protein catabolic process	nucleus	protein binding|ubiquitin thiolesterase activity|zinc ion binding			ovary(1)	1						CTTAGAGGTGCCTGGGTTATT	0.453													4	2	---	---	---	---	
USP39	10713	broad.mit.edu	37	2	85856023	85856023	+	Intron	DEL	G	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:85856023delG	uc002sqe.2	+						USP39_uc002sqb.2_Intron|USP39_uc010ysu.1_Intron|USP39_uc010ysv.1_Intron|USP39_uc010fgn.1_Intron|USP39_uc002sqf.2_Intron|USP39_uc002sqg.2_Intron|USP39_uc010fgo.2_Intron	NM_006590	NP_006581	Q53GS9	SNUT2_HUMAN	ubiquitin specific protease 39						spliceosome assembly|ubiquitin-dependent protein catabolic process	nucleus	protein binding|ubiquitin thiolesterase activity|zinc ion binding			ovary(1)	1						AGAGGTGCCTGGGTTATTACA	0.458													4	2	---	---	---	---	
RMND5A	64795	broad.mit.edu	37	2	87873888	87873888	+	Intron	DEL	G	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:87873888delG	uc002srs.3	+									Q9H871	RMD5A_HUMAN	SubName: Full=cDNA FLJ10361 fis, clone NT2RM2001256, highly similar to Anaphase-promoting complex subunit 1;											ovary(1)|skin(1)	2						TTGTGGGCCTGGGGTGACAGT	0.512													4	2	---	---	---	---	
LOC654342	654342	broad.mit.edu	37	2	91820066	91820067	+	Intron	DEL	AG	-	-	rs59236395		TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91820066_91820067delAG	uc002sts.3	-						LOC654342_uc002stt.2_Intron					Homo sapiens cDNA clone IMAGE:4801360.												0						aaaaaaaaaaagaaagaaagaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	103602204	103602204	+	IGR	DEL	T	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:103602204delT								TMEM182 (168068 upstream) : None (None downstream)																							CTATCCTTCCTTTGAAGCTTT	0.383													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	103861007	103861007	+	IGR	DEL	A	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:103861007delA								TMEM182 (426871 upstream) : None (None downstream)																							TAAAAAATGGAAAAAGGAAGG	0.328													4	2	---	---	---	---	
NCK2	8440	broad.mit.edu	37	2	106441161	106441162	+	Intron	INS	-	G	G			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:106441161_106441162insG	uc002tdg.2	+						NCK2_uc002tdh.2_Intron	NM_003581	NP_003572	O43639	NCK2_HUMAN	NCK adaptor protein 2 isoform A						axon guidance|epidermal growth factor receptor signaling pathway|negative regulation of cell proliferation|positive regulation of actin filament polymerization|positive regulation of T cell proliferation|regulation of epidermal growth factor receptor activity|regulation of translation|signal complex assembly|T cell activation	cytosol|endoplasmic reticulum	cytoskeletal adaptor activity|receptor signaling complex scaffold activity			ovary(1)|lung(1)	2						CTTTCATGGCTGGGTTTTAACT	0.530													5	3	---	---	---	---	
IL1RN	3557	broad.mit.edu	37	2	113876066	113876067	+	Intron	INS	-	T	T	rs143010578	by1000genomes	TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:113876066_113876067insT	uc002tiz.2	+						IL1RN_uc002tix.1_Intron|IL1RN_uc002tiy.2_Intron|IL1RN_uc002tja.2_Intron	NM_173841	NP_776213	P18510	IL1RA_HUMAN	interleukin 1 receptor antagonist isoform 2						immune response|inflammatory response|response to glucocorticoid stimulus	centrosome|extracellular space|nucleus|plasma membrane	cytokine activity|interleukin-1 receptor antagonist activity			skin(2)	2					Anakinra(DB00026)	GGGCTTGGCACAGTCAGTTCCA	0.272									Lichen_Sclerosis_et_Atrophicus_Familial_Clustering_of				4	2	---	---	---	---	
EPB41L5	57669	broad.mit.edu	37	2	120793504	120793505	+	Intron	DEL	GT	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:120793504_120793505delGT	uc002tmg.2	+						EPB41L5_uc010flk.2_Intron|EPB41L5_uc010fll.2_Intron|EPB41L5_uc002tmh.3_Intron	NM_020909	NP_065960	Q9HCM4	E41L5_HUMAN	erythrocyte membrane protein band 4.1 like 5							cytoplasm|cytoskeleton|extrinsic to membrane	cytoskeletal protein binding			ovary(1)	1						TGATACTGGAGTGTGTGTGTGG	0.441													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	125753213	125753214	+	IGR	INS	-	G	G	rs139214147	by1000genomes	TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:125753213_125753214insG								CNTNAP5 (80352 upstream) : None (None downstream)																							tgtggcggtgcggggggttggt	0.000													3	3	---	---	---	---	
LOC440905	440905	broad.mit.edu	37	2	130792162	130792163	+	Intron	DEL	TG	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:130792162_130792163delTG	uc002tpz.2	-						LOC440905_uc002tpy.1_5'Flank	NR_026758				Homo sapiens cDNA FLJ43933 fis, clone TESTI4013685.												0						GGTGGGGGGATGTGTGTGTGTG	0.366													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	132281962	132281962	+	IGR	DEL	T	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:132281962delT								LOC150776 (2813 upstream) : CCDC74A (3530 downstream)																							ttacacattatttcctggcag	0.000													4	2	---	---	---	---	
CCDC148	130940	broad.mit.edu	37	2	159250187	159250188	+	Intron	INS	-	T	T	rs76341038	by1000genomes	TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:159250187_159250188insT	uc002tzq.2	-						CCDC148_uc002tzr.2_Intron|CCDC148_uc010foh.2_Intron|CCDC148_uc010foi.1_Intron|CCDC148_uc010foj.1_Intron|CCDC148_uc010fok.1_Intron|CCDC148_uc002tzs.1_Intron	NM_138803	NP_620158	Q8NFR7	CC148_HUMAN	coiled-coil domain containing 148											ovary(2)	2						GATGGCTTCAATTTTGAAAAGG	0.406													4	2	---	---	---	---	
RBMS1	5937	broad.mit.edu	37	2	161220418	161220418	+	Intron	DEL	A	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:161220418delA	uc002ubo.2	-						RBMS1_uc002ubj.2_Intron|RBMS1_uc002ubk.2_Intron|RBMS1_uc002ubl.2_Intron|RBMS1_uc002ubn.2_Intron|RBMS1_uc002ubi.3_Intron|RBMS1_uc002ubm.2_Intron|RBMS1_uc002ubp.2_Intron|RBMS1_uc010fox.2_Intron	NM_016836	NP_058520	P29558	RBMS1_HUMAN	RNA binding motif, single stranded interacting						DNA replication|RNA processing	nucleus	double-stranded DNA binding|nucleotide binding|protein binding|RNA binding|single-stranded DNA binding				0						GATGAGAGTGAAAAAAAAAGC	0.408													4	2	---	---	---	---	
SLC4A10	57282	broad.mit.edu	37	2	162807001	162807001	+	Intron	DEL	A	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:162807001delA	uc002ubx.3	+						SLC4A10_uc002uby.3_Intron|SLC4A10_uc010zcs.1_Intron	NM_022058	NP_071341	Q6U841	S4A10_HUMAN	solute carrier family 4, sodium bicarbonate						bicarbonate transport|chloride transport|sodium ion transport	integral to membrane|plasma membrane	inorganic anion exchanger activity|symporter activity			ovary(2)|lung(2)|pancreas(1)	5						tgttgtgaagaaaaaaaaaat	0.080													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	168575264	168575264	+	IGR	DEL	T	-	-	rs71397604		TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:168575264delT								XIRP2 (459005 upstream) : B3GALT1 (99918 downstream)																							tcaggggagatttagcaaggc	0.104													0	7	---	---	---	---	
GAD1	2571	broad.mit.edu	37	2	171678390	171678390	+	Intron	DEL	C	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:171678390delC	uc002ugi.2	+						GAD1_uc002ugh.2_Intron	NM_000817	NP_000808	Q99259	DCE1_HUMAN	glutamate decarboxylase 1 isoform GAD67						glutamate decarboxylation to succinate|neurotransmitter biosynthetic process|neurotransmitter secretion|protein-pyridoxal-5-phosphate linkage	clathrin sculpted gamma-aminobutyric acid transport vesicle membrane|plasma membrane	glutamate decarboxylase activity|protein binding|pyridoxal phosphate binding			ovary(1)	1					L-Glutamic Acid(DB00142)|Pyridoxal Phosphate(DB00114)	ATATTTGAAGCCAGGAGCAGG	0.602													4	2	---	---	---	---	
NAB1	4664	broad.mit.edu	37	2	191537539	191537539	+	Intron	DEL	A	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:191537539delA	uc002usb.2	+						NAB1_uc010fsc.2_Intron|NAB1_uc010fsd.2_Intron|NAB1_uc002usc.2_Intron|NAB1_uc010zgh.1_Intron	NM_005966	NP_005957	Q13506	NAB1_HUMAN	NGFI-A binding protein 1						negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus					0			OV - Ovarian serous cystadenocarcinoma(117;0.00318)|Epithelial(96;0.0405)|all cancers(119;0.109)			ccccatctttaaaaaaaaaaa	0.174													4	2	---	---	---	---	
CASP10	843	broad.mit.edu	37	2	202052152	202052152	+	Intron	DEL	T	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:202052152delT	uc002uxl.1	+						CASP10_uc002uxi.1_Intron|CASP10_uc010zhn.1_Intron|CASP10_uc002uxj.1_Intron|CASP10_uc002uxk.1_Intron|CASP10_uc010fta.1_Intron|CASP10_uc002uxm.1_Intron|CASP10_uc010ftb.1_Intron	NM_032974	NP_116756	Q92851	CASPA_HUMAN	caspase 10 isoform b preproprotein						apoptosis|induction of apoptosis by extracellular signals|proteolysis	cytosol|plasma membrane	cysteine-type endopeptidase activity|identical protein binding|protein binding			skin(3)|ovary(1)|pancreas(1)|breast(1)	6						GTTTTATGCCTTTTTTTTTTT	0.259													4	2	---	---	---	---	
ICA1L	130026	broad.mit.edu	37	2	203690197	203690197	+	Intron	DEL	A	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:203690197delA	uc002uzh.1	-						ICA1L_uc002uzi.1_Intron|ICA1L_uc002uzj.2_Intron|ICA1L_uc002uzk.1_3'UTR	NM_138468	NP_612477	Q8NDH6	ICA1L_HUMAN	islet cell autoantigen 1,69kDa-like isoform 1												0						tgtctcaaagaaaaaaaaTAT	0.169													4	2	---	---	---	---	
ICA1L	130026	broad.mit.edu	37	2	203693916	203693916	+	Intron	DEL	A	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:203693916delA	uc002uzh.1	-						ICA1L_uc002uzi.1_Intron|ICA1L_uc002uzj.2_5'UTR|ICA1L_uc002uzk.1_Intron	NM_138468	NP_612477	Q8NDH6	ICA1L_HUMAN	islet cell autoantigen 1,69kDa-like isoform 1												0						ctaaaaatacaaaaaaaaatt	0.000													4	3	---	---	---	---	
PARD3B	117583	broad.mit.edu	37	2	206041750	206041750	+	Intron	DEL	A	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:206041750delA	uc002var.1	+						PARD3B_uc010fub.1_Intron|PARD3B_uc002vao.1_Intron|PARD3B_uc002vap.1_Intron|PARD3B_uc002vaq.1_Intron	NM_152526	NP_689739	Q8TEW8	PAR3L_HUMAN	par-3 partitioning defective 3 homolog B isoform						cell cycle|cell division	endomembrane system|tight junction				skin(2)|ovary(1)|breast(1)	4		all_cancers(1;2.88e-06)|all_epithelial(1;3.23e-06)		Epithelial(149;0.0739)		TGAATATCCTAACCTGAAACC	0.348													4	2	---	---	---	---	
DIRC3	729582	broad.mit.edu	37	2	218611345	218611346	+	Intron	INS	-	AACTC	AACTC	rs144775187	by1000genomes	TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:218611345_218611346insAACTC	uc002vgo.2	-							NR_026597				Homo sapiens cDNA FLJ14199 fis, clone NT2RP3002713.												0						ccctagaggaaaactcatgtct	0.000													4	2	---	---	---	---	
TNS1	7145	broad.mit.edu	37	2	218668980	218668981	+	3'UTR	DEL	TC	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:218668980_218668981delTC	uc002vgt.2	-	33					TNS1_uc002vgr.2_3'UTR|TNS1_uc002vgs.2_3'UTR|TNS1_uc002vgq.2_3'UTR	NM_022648	NP_072174	Q9HBL0	TENS1_HUMAN	tensin							cytoplasm|cytoskeleton|focal adhesion	actin binding			ovary(3)|breast(1)	4		Renal(207;0.0483)|Lung NSC(271;0.213)		Epithelial(149;4.43e-06)|all cancers(144;0.000653)|LUSC - Lung squamous cell carcinoma(224;0.0091)|Lung(261;0.013)		CCTCCAtctttctctctctctc	0.431													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	220638895	220638895	+	IGR	DEL	C	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220638895delC								SLC4A3 (132194 upstream) : None (None downstream)																							CTCATCACAGCCCTGATCACA	0.368													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	224231701	224231701	+	IGR	DEL	T	-	-	rs76060077		TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:224231701delT								KCNE4 (311348 upstream) : SCG2 (229959 downstream)																							caacagtctattttttttttc	0.075													4	2	---	---	---	---	
TRIP12	9320	broad.mit.edu	37	2	230675664	230675665	+	Frame_Shift_Ins	INS	-	T	T			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:230675664_230675665insT	uc002vpw.1	-	14	2117_2118	c.2008_2009insA	c.(2008-2010)ATGfs	p.M670fs	TRIP12_uc002vpx.1_Frame_Shift_Ins_p.M718fs|TRIP12_uc002vpy.1_Frame_Shift_Ins_p.M373fs|TRIP12_uc010zlz.1_Intron|TRIP12_uc010fxh.1_Frame_Shift_Ins_p.M676fs	NM_004238	NP_004229	Q14669	TRIPC_HUMAN	thyroid hormone receptor interactor 12	670					protein ubiquitination involved in ubiquitin-dependent protein catabolic process	proteasome complex	thyroid hormone receptor binding|ubiquitin-protein ligase activity			ovary(4)|lung(2)|breast(1)|central_nervous_system(1)|skin(1)	9		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.126)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;4.76e-13)|all cancers(144;4.34e-10)|LUSC - Lung squamous cell carcinoma(224;0.00864)|Lung(119;0.0116)		GCGAACCACCATTATAAACATC	0.381													233	113	---	---	---	---	
KIF1A	547	broad.mit.edu	37	2	241714177	241714177	+	Intron	DEL	A	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241714177delA	uc002vzy.2	-						KIF1A_uc010fzk.2_Intron|KIF1A_uc002vzz.1_Intron	NM_004321	NP_004312	Q12756	KIF1A_HUMAN	axonal transport of synaptic vesicles						anterograde axon cargo transport	cytoplasm|microtubule|nucleus	ATP binding|microtubule motor activity			lung(1)	1		all_epithelial(40;1.35e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0295)|all_neural(83;0.0459)|Lung NSC(271;0.0942)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;6.12e-30)|all cancers(36;3.46e-27)|OV - Ovarian serous cystadenocarcinoma(60;1.38e-14)|Kidney(56;5e-09)|KIRC - Kidney renal clear cell carcinoma(57;5e-08)|BRCA - Breast invasive adenocarcinoma(100;5.87e-06)|Lung(119;0.00209)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Colorectal(34;0.0282)|COAD - Colon adenocarcinoma(134;0.176)		CTTTCTCTTGAGGGAATCCTG	0.502													4	2	---	---	---	---	
HDLBP	3069	broad.mit.edu	37	2	242178792	242178792	+	Intron	DEL	T	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242178792delT	uc002waz.2	-						HDLBP_uc002wba.2_Intron|HDLBP_uc002wbb.2_Intron	NM_203346	NP_976221	Q00341	VIGLN_HUMAN	high density lipoprotein binding protein						cholesterol metabolic process|lipid transport	cytoplasm|high-density lipoprotein particle|nucleus|plasma membrane	lipid binding|protein binding|RNA binding			breast(3)|skin(1)	4		all_cancers(19;7.77e-41)|all_epithelial(40;1.74e-18)|Breast(86;1.53e-05)|Renal(207;0.00179)|all_lung(227;0.00338)|Ovarian(221;0.00556)|Lung NSC(271;0.0121)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;8.13e-34)|all cancers(36;4.71e-31)|OV - Ovarian serous cystadenocarcinoma(60;2.34e-15)|Kidney(56;3.72e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.76e-08)|BRCA - Breast invasive adenocarcinoma(100;3.38e-06)|Lung(119;0.000109)|LUSC - Lung squamous cell carcinoma(224;0.000964)|Colorectal(34;0.0132)|COAD - Colon adenocarcinoma(134;0.0928)		tctctctctctTTTTTTTTTT	0.294													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	11107253	11107254	+	IGR	DEL	TG	-	-	rs55855023		TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:11107253_11107254delTG								SLC6A1 (26319 upstream) : HRH1 (71525 downstream)																							ttctggtgattgtgtgtgtgtg	0.000													4	2	---	---	---	---	
ADAMTS9	56999	broad.mit.edu	37	3	64610561	64610561	+	Intron	DEL	T	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:64610561delT	uc003dmg.2	-						ADAMTS9_uc011bfo.1_Intron|ADAMTS9_uc003dmh.1_Intron|ADAMTS9_uc003dmk.1_Intron	NM_182920	NP_891550	Q9P2N4	ATS9_HUMAN	ADAM metallopeptidase with thrombospondin type 1						glycoprotein catabolic process|multicellular organismal development|proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(2)|urinary_tract(1)|skin(1)	4		Lung NSC(201;0.00682)		BRCA - Breast invasive adenocarcinoma(55;0.00142)|Kidney(15;0.00202)|KIRC - Kidney renal clear cell carcinoma(15;0.00221)		ATTGTGCTGCTTTTTTCTCCC	0.294													4	2	---	---	---	---	
GPR15	2838	broad.mit.edu	37	3	98250629	98250629	+	5'Flank	DEL	A	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:98250629delA	uc011bgy.1	+							NM_005290	NP_005281	P49685	GPR15_HUMAN	G protein-coupled receptor 15							integral to plasma membrane	purinergic nucleotide receptor activity, G-protein coupled			ovary(1)	1		Lung NSC(201;7.93e-06)|all_neural(597;0.00172)|Hepatocellular(537;0.00825)|Myeloproliferative disorder(1037;0.0255)		Lung(72;0.246)		AATGCAAATTAAAAAAACCAC	0.353													3	3	---	---	---	---	
GAP43	2596	broad.mit.edu	37	3	115386506	115386506	+	Intron	DEL	A	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:115386506delA	uc003ebq.2	+						GAP43_uc003ebr.2_Intron	NM_002045	NP_002036	P17677	NEUM_HUMAN	growth associated protein 43 isoform 2						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|cell differentiation|nervous system development|regulation of filopodium assembly|regulation of growth|response to wounding	cell junction|filopodium membrane|growth cone membrane|synapse	calmodulin binding			ovary(1)	1				GBM - Glioblastoma multiforme(114;0.164)		GGAGCTTGGCATGTGCTTTGC	0.507													4	2	---	---	---	---	
IGSF11	152404	broad.mit.edu	37	3	118677894	118677894	+	Intron	DEL	G	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:118677894delG	uc003ebw.2	-						IGSF11_uc011biv.1_Intron|IGSF11_uc003ebx.2_Intron|IGSF11_uc003eby.2_Intron|IGSF11_uc003ebz.2_Intron|IGSF11_uc010hqs.2_Intron	NM_001015887	NP_001015887	Q5DX21	IGS11_HUMAN	immunoglobulin superfamily, member 11 isoform b						cell adhesion|regulation of growth	integral to membrane|plasma membrane	receptor activity				0						AATACGTGTAGGGGAGAGAAG	0.408													4	2	---	---	---	---	
MYLK	4638	broad.mit.edu	37	3	123478829	123478830	+	Intron	INS	-	A	A			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:123478829_123478830insA	uc003ego.2	-						MYLK_uc011bjw.1_Intron|MYLK_uc003egp.2_Intron|MYLK_uc003egq.2_Intron|MYLK_uc003egr.2_Intron|MYLK_uc003egs.2_Intron|MYLK_uc010hrs.1_Intron|MYLK_uc003egu.1_Intron	NM_053025	NP_444253	Q15746	MYLK_HUMAN	myosin light chain kinase isoform 1						aorta smooth muscle tissue morphogenesis|muscle contraction	cytosol	actin binding|ATP binding|calmodulin binding|metal ion binding|myosin light chain kinase activity			ovary(6)|skin(2)|stomach(1)	9		Lung NSC(201;0.0496)		GBM - Glioblastoma multiforme(114;0.0736)		ctgtcacctgcaaaaaaaagtc	0.015													4	2	---	---	---	---	
ITGB5	3693	broad.mit.edu	37	3	124520909	124520911	+	Intron	DEL	CTT	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:124520909_124520911delCTT	uc003eho.2	-						ITGB5_uc010hrx.2_Intron	NM_002213	NP_002204	P18084	ITB5_HUMAN	integrin, beta 5 precursor						cell-matrix adhesion|integrin-mediated signaling pathway|multicellular organismal development|muscle contraction	integrin complex	receptor activity			skin(2)	2				GBM - Glioblastoma multiforme(114;0.163)		gtgctgggcccttcttccttggg	0.000													4	2	---	---	---	---	
ZXDC	79364	broad.mit.edu	37	3	126190544	126190544	+	Intron	DEL	A	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:126190544delA	uc003eiv.2	-						ZXDC_uc010hsh.2_Intron|ZXDC_uc003eix.2_Intron	NM_025112	NP_079388	Q2QGD7	ZXDC_HUMAN	ZXD family zinc finger C isoform 1						positive regulation of transcription, DNA-dependent	nucleus	C2H2 zinc finger domain binding|identical protein binding|LRR domain binding|nucleic acid binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1				GBM - Glioblastoma multiforme(114;0.155)		atgttaagttaaaaaaaaaac	0.065													4	2	---	---	---	---	
H1FOO	132243	broad.mit.edu	37	3	129267588	129267589	+	Intron	INS	-	G	G			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:129267588_129267589insG	uc003emu.2	+						H1FOO_uc003emv.2_Intron	NM_153833	NP_722575	Q8IZA3	H1FOO_HUMAN	H1 histone family, member O, oocyte-specific						meiosis|nucleosome assembly	cytoplasm|nucleosome	DNA binding			skin(1)	1						TTCAGGGTAGTGGGGGAGGAGG	0.599													4	2	---	---	---	---	
CPNE4	131034	broad.mit.edu	37	3	131602552	131602554	+	Intron	DEL	CTT	-	-	rs141972187		TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:131602552_131602554delCTT	uc003eok.2	-						CPNE4_uc011blq.1_Intron|CPNE4_uc003eol.2_Intron|CPNE4_uc003eom.2_Intron	NM_130808	NP_570720	Q96A23	CPNE4_HUMAN	copine IV											upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3						ccttgctgcccttctttattatt	0.000													6	6	---	---	---	---	
ESYT3	83850	broad.mit.edu	37	3	138181921	138181921	+	Intron	DEL	T	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:138181921delT	uc003esk.2	+						ESYT3_uc010hug.2_Intron	NM_031913	NP_114119	A0FGR9	ESYT3_HUMAN	family with sequence similarity 62 (C2 domain							integral to membrane|plasma membrane					0						CCCAGCATGCTTTTTTTTGGG	0.299													4	2	---	---	---	---	
ECT2	1894	broad.mit.edu	37	3	172468472	172468472	+	5'Flank	DEL	T	-	-	rs5854482		TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:172468472delT	uc003fii.2	+						ECT2_uc010hwv.1_5'Flank|ECT2_uc003fih.2_5'Flank	NM_018098	NP_060568	Q9H8V3	ECT2_HUMAN	epithelial cell transforming sequence 2 oncogene						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	Rho guanyl-nucleotide exchange factor activity|signal transducer activity			breast(2)|ovary(1)|skin(1)	4	Ovarian(172;0.00197)|Breast(254;0.158)		Lung(28;1.33e-14)|LUSC - Lung squamous cell carcinoma(14;1.48e-14)			TCACCGCCCCTCTGGAGACTC	0.587											OREG0015928	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	9	5	---	---	---	---	
AHSG	197	broad.mit.edu	37	3	186335992	186335992	+	Intron	DEL	G	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186335992delG	uc003fqk.3	+						AHSG_uc003fql.3_Intron|AHSG_uc003fqm.3_Intron|AHSG_uc010hyp.2_Intron	NM_001622	NP_001613	P02765	FETUA_HUMAN	alpha-2-HS-glycoprotein						acute-phase response|negative regulation of bone mineralization|negative regulation of insulin receptor signaling pathway|pinocytosis|positive regulation of phagocytosis|regulation of inflammatory response|skeletal system development	extracellular space	cysteine-type endopeptidase inhibitor activity|protein binding				0	all_cancers(143;3.64e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;3.27e-20)	GBM - Glioblastoma multiforme(93;0.0463)		AGTGAGGGCTGGGGGGAGGCA	0.438													4	2	---	---	---	---	
LPP	4026	broad.mit.edu	37	3	188393020	188393020	+	Intron	DEL	T	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:188393020delT	uc003frs.1	+						LPP_uc011bsg.1_Intron|LPP_uc011bsi.1_Intron|LPP_uc003frt.2_Intron|LPP_uc011bsj.1_Intron	NM_005578	NP_005569	Q93052	LPP_HUMAN	LIM domain containing preferred translocation						cell adhesion	cytoplasm|focal adhesion|nucleus	protein binding|zinc ion binding		HMGA2/LPP(161)	soft_tissue(134)|bone(27)|lung(2)|ovary(1)|breast(1)	165	all_cancers(143;1.37e-09)|all_hematologic(3;0.0429)|Ovarian(172;0.088)	all_lung(153;0.00139)|Lung NSC(153;0.00202)		GBM - Glioblastoma multiforme(93;0.00602)		AAGCAGTGTGTCAAGCCAGTG	0.458			T	HMGA2|MLL|C12orf9	lipoma|leukemia								4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	11203129	11203131	+	IGR	DEL	CCA	-	-	rs34606866		TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:11203129_11203131delCCA								CLNK (516743 upstream) : MIR572 (167320 downstream)																							CCAAGAGAAGCCACCACCACCAC	0.453													4	2	---	---	---	---	
SLIT2	9353	broad.mit.edu	37	4	20544483	20544486	+	Intron	DEL	GTGC	-	-	rs10546726	by1000genomes	TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:20544483_20544486delGTGC	uc003gpr.1	+						SLIT2_uc003gps.1_Intron	NM_004787	NP_004778	O94813	SLIT2_HUMAN	slit homolog 2 precursor						apoptosis involved in luteolysis|axon extension involved in axon guidance|branching morphogenesis of a tube|cell migration involved in sprouting angiogenesis|cellular response to heparin|cellular response to hormone stimulus|chemorepulsion involved in postnatal olfactory bulb interneuron migration|corticospinal neuron axon guidance through spinal cord|induction of negative chemotaxis|motor axon guidance|negative regulation of actin filament polymerization|negative regulation of cell growth|negative regulation of cellular response to growth factor stimulus|negative regulation of chemokine-mediated signaling pathway|negative regulation of endothelial cell migration|negative regulation of lamellipodium assembly|negative regulation of mononuclear cell migration|negative regulation of neutrophil chemotaxis|negative regulation of protein phosphorylation|negative regulation of retinal ganglion cell axon guidance|negative regulation of small GTPase mediated signal transduction|negative regulation of smooth muscle cell chemotaxis|negative regulation of vascular permeability|positive regulation of apoptosis|positive regulation of axonogenesis|response to cortisol stimulus|retinal ganglion cell axon guidance|Roundabout signaling pathway|ureteric bud development	cell surface|cytoplasm|extracellular space|plasma membrane	calcium ion binding|GTPase inhibitor activity|heparin binding|laminin-1 binding|protein homodimerization activity|proteoglycan binding|Roundabout binding			central_nervous_system(4)|skin(4)|ovary(3)	11						gtgtgtgtgtgtgCGctataagat	0.103													4	2	---	---	---	---	
PPARGC1A	10891	broad.mit.edu	37	4	23797733	23797733	+	Intron	DEL	A	-	-	rs3821952	by1000genomes	TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:23797733delA	uc003gqs.2	-						PPARGC1A_uc003gqt.2_Intron	NM_013261	NP_037393	Q9UBK2	PRGC1_HUMAN	peroxisome proliferator-activated receptor						androgen receptor signaling pathway|brown fat cell differentiation|cellular glucose homeostasis|digestion|fatty acid oxidation|gluconeogenesis|mitochondrion organization|mRNA processing|neuron death|positive regulation of fatty acid oxidation|positive regulation of gluconeogenesis|positive regulation of histone acetylation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|protein complex assembly|protein stabilization|response to muscle activity|response to starvation|RNA splicing|temperature homeostasis|transcription initiation from RNA polymerase II promoter	DNA-directed RNA polymerase II, core complex	androgen receptor binding|DNA binding|ligand-dependent nuclear receptor binding|ligand-dependent nuclear receptor transcription coactivator activity|nucleotide binding|RNA binding|RNA polymerase II transcription cofactor activity|transcription factor binding			ovary(2)|lung(2)|kidney(2)|skin(2)	8		Breast(46;0.0503)				GTGAGCTTTCAAAAACACGCA	0.408													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	33970102	33970102	+	Intron	DEL	T	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:33970102delT	uc003gsn.2	-											Homo sapiens, clone IMAGE:5172449, mRNA.																		TATGTACCTGTTACCACTTTC	0.358													4	2	---	---	---	---	
ARAP2	116984	broad.mit.edu	37	4	36083943	36083943	+	Intron	DEL	A	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:36083943delA	uc003gsq.1	-							NM_015230	NP_056045	Q8WZ64	ARAP2_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH						regulation of ARF GTPase activity|small GTPase mediated signal transduction	cytosol	ARF GTPase activator activity|phosphatidylinositol-3,4,5-trisphosphate binding|zinc ion binding			ovary(1)|pancreas(1)|skin(1)	3						CACATAAATTAAAAATAATAC	0.348													127	104	---	---	---	---	
TBC1D1	23216	broad.mit.edu	37	4	38070041	38070041	+	Intron	DEL	C	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:38070041delC	uc003gtb.2	+						TBC1D1_uc011byd.1_Intron|TBC1D1_uc010ifd.2_Intron|TBC1D1_uc011byf.1_Intron	NM_015173	NP_055988	Q86TI0	TBCD1_HUMAN	TBC1 (tre-2/USP6, BUB2, cdc16) domain family,							nucleus	Rab GTPase activator activity			ovary(1)	1						CCTCACCAAACCCACAGTGCA	0.502													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	62963813	62963813	+	IGR	DEL	A	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:62963813delA								LPHN3 (25646 upstream) : None (None downstream)																							tagaaggcataatcttgctac	0.000													4	2	---	---	---	---	
FRAS1	80144	broad.mit.edu	37	4	79268183	79268183	+	Intron	DEL	C	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:79268183delC	uc003hlb.2	+						FRAS1_uc003hkw.2_Intron	NM_025074	NP_079350	Q86XX4	FRAS1_HUMAN	Fraser syndrome 1						cell communication	integral to membrane|plasma membrane	metal ion binding			large_intestine(5)	5						ATAATCCCCTCCAGATCCTCA	0.448													4	2	---	---	---	---	
FRAS1	80144	broad.mit.edu	37	4	79371640	79371640	+	Intron	DEL	T	-	-	rs72327343		TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:79371640delT	uc003hlb.2	+							NM_025074	NP_079350	Q86XX4	FRAS1_HUMAN	Fraser syndrome 1						cell communication	integral to membrane|plasma membrane	metal ion binding			large_intestine(5)	5						tgttttcttattttttttttc	0.279													5	3	---	---	---	---	
C4orf22	255119	broad.mit.edu	37	4	81564582	81564582	+	Intron	DEL	A	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:81564582delA	uc003hmf.2	+						C4orf22_uc010ijp.2_Intron	NM_152770	NP_689983	Q6V702	CD022_HUMAN	hypothetical protein LOC255119											skin(2)	2						gattgtggataaatgggccag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	82410707	82410708	+	IGR	DEL	CA	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:82410707_82410708delCA								RASGEF1B (17646 upstream) : HNRNPD (863759 downstream)																							CACATCCCACCACACACACAGA	0.426													4	2	---	---	---	---	
HELQ	113510	broad.mit.edu	37	4	84339020	84339020	+	Intron	DEL	T	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:84339020delT	uc003hom.2	-						HELQ_uc010ikb.2_Intron|HELQ_uc003hol.3_Intron|HELQ_uc010ikc.2_Intron	NM_133636	NP_598375	Q8TDG4	HELQ_HUMAN	DNA helicase HEL308								ATP binding|ATP-dependent helicase activity|nucleic acid binding			ovary(1)|breast(1)|skin(1)	3						TCCTGTTATGTTTTTTTTTTC	0.398								Direct_reversal_of_damage|Other_identified_genes_with_known_or_suspected_DNA_repair_function					4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	84982331	84982332	+	Intron	INS	-	A	A	rs143697542	by1000genomes	TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:84982331_84982332insA	uc010ikd.1	-						uc003hoz.1_Intron					Homo sapiens cDNA FLJ37966 fis, clone CTONG2009871.																		TAGGTTGGAGGAAAAAAAAATG	0.351													0	6	---	---	---	---	
WDFY3	23001	broad.mit.edu	37	4	85648391	85648391	+	Intron	DEL	A	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:85648391delA	uc003hpd.2	-						WDFY3_uc003hpe.1_Intron	NM_014991	NP_055806	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3 isoform							cytoplasmic part|extrinsic to membrane|nuclear envelope	1-phosphatidylinositol binding|metal ion binding|protein binding			ovary(2)|central_nervous_system(1)	3		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		TACATTGTTTAAAAAAAAAAA	0.368													6	3	---	---	---	---	
GRID2	2895	broad.mit.edu	37	4	94688306	94688306	+	Intron	DEL	T	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:94688306delT	uc011cdt.1	+						GRID2_uc011cdu.1_Intron	NM_001510	NP_001501	O43424	GRID2_HUMAN	glutamate receptor, ionotropic, delta 2						glutamate signaling pathway	cell junction|integral to plasma membrane|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|ionotropic glutamate receptor activity			ovary(3)|skin(2)|large_intestine(1)	6		Hepatocellular(203;0.114)|all_hematologic(202;0.177)		OV - Ovarian serous cystadenocarcinoma(123;3.22e-06)|LUSC - Lung squamous cell carcinoma(81;0.185)|Lung(65;0.191)	L-Glutamic Acid(DB00142)	Aggtcataagtttgggaaatg	0.159													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	97560105	97560105	+	IGR	DEL	A	-	-	rs7679806	by1000genomes	TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:97560105delA								PDHA2 (797481 upstream) : C4orf37 (919929 downstream)																							CAGCTTCCACAAAAAAAAAAA	0.358													5	3	---	---	---	---	
C4orf21	55345	broad.mit.edu	37	4	113507396	113507396	+	Intron	DEL	A	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:113507396delA	uc003iau.2	-						C4orf21_uc003iav.2_Intron	NM_018392	NP_060862	Q6ZU11	YD002_HUMAN	prematurely terminated mRNA decay factor-like							integral to membrane	zinc ion binding				0		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000676)		atcctgtctcaaaaaaaaaaa	0.104													4	3	---	---	---	---	
MAML3	55534	broad.mit.edu	37	4	140735180	140735181	+	Intron	DEL	AC	-	-	rs34105167		TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:140735180_140735181delAC	uc003ihz.1	-						MAML3_uc011chd.1_Intron	NM_018717	NP_061187	Q96JK9	MAML3_HUMAN	mastermind-like 3						Notch signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nuclear speck	transcription coactivator activity			ovary(1)	1	all_hematologic(180;0.162)					acaaacacaaacacacacacac	0.020													4	2	---	---	---	---	
OTUD4	54726	broad.mit.edu	37	4	146099717	146099718	+	Intron	INS	-	C	C	rs143481609	by1000genomes	TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:146099717_146099718insC	uc003ika.3	-						OTUD4_uc003ijz.3_Intron|OTUD4_uc003ikb.3_Intron	NM_001102653	NP_001096123	Q01804	OTUD4_HUMAN	OTU domain containing 4 protein isoform 3								protein binding			ovary(2)|breast(1)	3	all_hematologic(180;0.151)					ATACCCCACAGCAACACTGAAA	0.455													6	5	---	---	---	---	
TMEM154	201799	broad.mit.edu	37	4	153573426	153573426	+	Intron	DEL	A	-	-	rs11331839		TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:153573426delA	uc003imw.1	-							NM_152680	NP_689893	Q6P9G4	TM154_HUMAN	transmembrane protein 154 precursor							integral to membrane					0	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.138)				tcaatttgttaaaaaaaaaaa	0.015													3	4	---	---	---	---	
FSTL5	56884	broad.mit.edu	37	4	162894047	162894047	+	Intron	DEL	C	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:162894047delC	uc003iqh.2	-						FSTL5_uc003iqi.2_Intron|FSTL5_uc010iqv.2_Intron	NM_020116	NP_064501	Q8N475	FSTL5_HUMAN	follistatin-like 5 isoform a							extracellular region	calcium ion binding			ovary(2)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|skin(1)	8	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.179)		AAAACATTCACCACAATTTAC	0.254													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	4659838	4659839	+	IGR	INS	-	C	C	rs139831068	by1000genomes	TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:4659838_4659839insC								None (None upstream) : LOC340094 (374633 downstream)																							CAATTCAGCTTCCCTCTCAGCG	0.455													8	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	24273092	24273092	+	IGR	DEL	A	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:24273092delA								PRDM9 (744388 upstream) : CDH10 (214118 downstream)																							GGTTCCTTTTAAGGCAGGCGT	0.488													4	2	---	---	---	---	
SUB1	10923	broad.mit.edu	37	5	32589959	32589960	+	Intron	INS	-	T	T	rs140021059	by1000genomes	TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:32589959_32589960insT	uc003jhs.2	+						SUB1_uc003jht.2_Intron	NM_006713	NP_006704	P53999	TCP4_HUMAN	activated RNA polymerase II transcription						regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleolus|transcription factor complex	protein binding|single-stranded DNA binding|transcription coactivator activity				0						GGCTCCCTATCTTTTTTTTTTC	0.342													2	5	---	---	---	---	
SUB1	10923	broad.mit.edu	37	5	32592819	32592819	+	Intron	DEL	A	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:32592819delA	uc003jhs.2	+						SUB1_uc003jht.2_Intron	NM_006713	NP_006704	P53999	TCP4_HUMAN	activated RNA polymerase II transcription						regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleolus|transcription factor complex	protein binding|single-stranded DNA binding|transcription coactivator activity				0						GATGTGATTGAAAAAAAAAAT	0.398													6	3	---	---	---	---	
LIFR	3977	broad.mit.edu	37	5	38597882	38597882	+	5'Flank	DEL	G	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:38597882delG	uc003jli.2	-						uc003jlj.2_Intron	NM_002310	NP_002301	P42702	LIFR_HUMAN	leukemia inhibitory factor receptor precursor						positive regulation of cell proliferation	extracellular region|integral to plasma membrane	ciliary neurotrophic factor receptor binding|growth factor binding|leukemia inhibitory factor receptor activity			ovary(3)|large_intestine(1)	4	all_lung(31;0.00021)					TGGCAGTGGTGGGGAGGGAAG	0.363			T	PLAG1	salivary adenoma								4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	43064077	43064077	+	IGR	DEL	C	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:43064077delC								LOC153684 (18707 upstream) : ZNF131 (56908 downstream)																							aaggagtcagccagcttgctt	0.239													4	2	---	---	---	---	
SKIV2L2	23517	broad.mit.edu	37	5	54647037	54647037	+	Intron	DEL	A	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:54647037delA	uc003jpy.3	+						SKIV2L2_uc011cqi.1_Intron	NM_015360	NP_056175	P42285	SK2L2_HUMAN	superkiller viralicidic activity 2-like 2						maturation of 5.8S rRNA	catalytic step 2 spliceosome|nucleolus	ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding			ovary(1)|skin(1)	2		Lung NSC(810;0.000744)|Breast(144;0.181)|Prostate(74;0.194)				AAGTGTAGGTAAAAAAAAAAC	0.169													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	57419195	57419195	+	IGR	DEL	G	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:57419195delG								ACTBL2 (640559 upstream) : PLK2 (330617 downstream)																							tccattcactggacaactatc	0.020													4	2	---	---	---	---	
ERCC8	1161	broad.mit.edu	37	5	60198185	60198197	+	Intron	DEL	AAATATATACATT	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:60198185_60198197delAAATATATACATT	uc003jsm.3	-						ERCC8_uc003jsk.2_Intron|ERCC8_uc003jsl.3_Intron|ERCC8_uc011cqp.1_Intron	NM_000082	NP_000073	Q13216	ERCC8_HUMAN	excision repair cross-complementing rodent						positive regulation of DNA repair|proteasomal ubiquitin-dependent protein catabolic process|protein autoubiquitination|protein polyubiquitination|response to oxidative stress|response to UV|response to UV|transcription-coupled nucleotide-excision repair	Cul4A-RING ubiquitin ligase complex|nuclear matrix|nucleoplasm|nucleotide-excision repair complex|soluble fraction	protein binding|protein complex binding				0		Lung NSC(810;1.51e-06)|Prostate(74;0.0322)|Ovarian(174;0.0481)|Breast(144;0.077)				AAATATGCTAAAATATATACATTACATAAATGT	0.235								Direct_reversal_of_damage|NER					40	42	---	---	---	---	
CENPK	64105	broad.mit.edu	37	5	64848599	64848599	+	Intron	DEL	A	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:64848599delA	uc003jts.2	-						CENPK_uc003jtt.2_Intron|CENPK_uc003jtu.2_Intron	NM_022145	NP_071428	Q9BS16	CENPK_HUMAN	SoxLZ/Sox6 leucine zipper binding protein						CenH3-containing nucleosome assembly at centromere|mitotic prometaphase	condensed chromosome kinetochore|cytosol|nucleoplasm					0		Lung NSC(167;7.21e-05)|Prostate(74;0.0174)|Ovarian(174;0.186)		Lung(70;0.00466)		AATGAAGAGGAAAAAAAAAAA	0.318													9	4	---	---	---	---	
ATP6AP1L	92270	broad.mit.edu	37	5	81583544	81583544	+	Intron	DEL	T	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:81583544delT	uc003khv.2	+							NM_001017971	NP_001017971	Q52LC2	VAS1L_HUMAN	ATPase, H+ transporting, lysosomal accessory						ATP hydrolysis coupled proton transport	integral to membrane|proton-transporting V-type ATPase, V1 domain	hydrogen ion transporting ATP synthase activity, rotational mechanism|proton-transporting ATPase activity, rotational mechanism				0						GATGAGGAGATTTAGGTCAAG	0.363													4	2	---	---	---	---	
ANKRD32	84250	broad.mit.edu	37	5	93990100	93990100	+	Intron	DEL	A	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:93990100delA	uc003kkr.3	+						ANKRD32_uc011cul.1_Intron	NM_032290	NP_115666	Q9BQI6	ANR32_HUMAN	ankyrin repeat domain 32											ovary(2)	2		all_cancers(142;1.51e-09)|all_epithelial(76;4.68e-12)|all_lung(232;5.94e-05)|Ovarian(174;0.000953)|Lung NSC(167;0.00105)|Colorectal(57;0.122)|Lung SC(612;0.152)		all cancers(79;3.88e-18)		gagtaaaaagaaaaaaaaaaa	0.254													9	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	103222308	103222308	+	IGR	DEL	A	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:103222308delA								NUDT12 (323818 upstream) : None (None downstream)																							gaataaagtgaaaaaaaaaat	0.010													4	2	---	---	---	---	
C5orf13	9315	broad.mit.edu	37	5	111310973	111310973	+	Frame_Shift_Del	DEL	A	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:111310973delA	uc011cvr.1	-	2	325	c.133delT	c.(133-135)TGTfs	p.C45fs	C5orf13_uc011cvs.1_Intron	NM_001142475	NP_001135947	Q16612	NP311_HUMAN	neuronal protein 3.1 isoform c	Error:Variant_position_missing_in_Q16612_after_alignment						cytoplasm				skin(1)	1		all_cancers(142;0.00597)|all_epithelial(76;0.000144)|Prostate(80;0.0115)|Colorectal(10;0.0446)|Ovarian(225;0.156)		OV - Ovarian serous cystadenocarcinoma(64;5.45e-09)|Epithelial(69;2e-08)|all cancers(49;1.9e-06)|COAD - Colon adenocarcinoma(37;0.0514)|Colorectal(14;0.0629)		TGTCTTACACAATTCAGAACA	0.338													341	155	---	---	---	---	
IRF1	3659	broad.mit.edu	37	5	131821643	131821658	+	Intron	DEL	CCTACTTCCTTCCTCA	-	-	rs41474248		TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:131821643_131821658delCCTACTTCCTTCCTCA	uc003kxa.2	-						C5orf56_uc010jds.1_Intron|IRF1_uc003kxd.2_Intron|IRF1_uc003kxb.2_Intron|IRF1_uc010jdt.1_Intron	NM_002198	NP_002189	P10914	IRF1_HUMAN	interferon regulatory factor 1						blood coagulation|cellular response to mechanical stimulus|interferon-gamma-mediated signaling pathway|transcription from RNA polymerase II promoter|type I interferon-mediated signaling pathway	nucleoplasm					0		all_cancers(142;0.026)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	LUAD - Lung adenocarcinoma(142;0.247)		CCACCCCTACCCTACTTCCTTCCTCACCCTCAGATG	0.611													8	4	---	---	---	---	
CDKL3	51265	broad.mit.edu	37	5	133566578	133566578	+	Intron	DEL	A	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:133566578delA	uc011cxm.1	-						CDKL3_uc011cxn.1_Intron	NM_001113575	NP_001107047	Q8IVW4	CDKL3_HUMAN	cyclin-dependent kinase-like 3 isoform 1							cytoplasm	ATP binding|cyclin-dependent protein kinase activity			breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			CCATTACAGGAAAAAAAAACT	0.358													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	134530080	134530080	+	Intron	DEL	T	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:134530080delT	uc003laj.1	+											Homo sapiens cDNA: FLJ23312 fis, clone HEP11874.																		gtcaccctcattttagagata	0.328													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	134567127	134567127	+	Intron	DEL	A	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:134567127delA	uc003laj.1	+											Homo sapiens cDNA: FLJ23312 fis, clone HEP11874.																		CACAGCATGGAAGAGGGCTGG	0.627													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	148812920	148812920	+	IGR	DEL	A	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:148812920delA								LOC728264 (521 upstream) : CSNK1A1 (60029 downstream)																							TTTTGAGGGGAAAAAAAAACA	0.299													5	4	---	---	---	---	
GLRA1	2741	broad.mit.edu	37	5	151228719	151228719	+	Intron	DEL	T	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:151228719delT	uc003lut.2	-						GLRA1_uc003lur.2_Intron|GLRA1_uc003lus.2_Intron	NM_001146040	NP_001139512	P23415	GLRA1_HUMAN	glycine receptor, alpha 1 isoform 1 precursor						muscle contraction|negative regulation of transmission of nerve impulse|neuropeptide signaling pathway|positive regulation of acrosome reaction|regulation of membrane potential|startle response	cell junction|chloride channel complex|integral to plasma membrane|intracellular membrane-bounded organelle|postsynaptic membrane	extracellular-glycine-gated chloride channel activity|glycine binding|protein binding|receptor activity|taurine binding|transmitter-gated ion channel activity			ovary(1)|central_nervous_system(1)	2		all_hematologic(541;0.0341)|Medulloblastoma(196;0.0912)	Kidney(363;0.000171)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		Desflurane(DB01189)|Enflurane(DB00228)|Ethanol(DB00898)|Glycine(DB00145)|Halothane(DB01159)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)	ctttcttttcttttcttttct	0.025													3	4	---	---	---	---	
ADAM19	8728	broad.mit.edu	37	5	156990633	156990633	+	Intron	DEL	G	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:156990633delG	uc003lwz.2	-						ADAM19_uc003lww.1_Intron|ADAM19_uc011ddr.1_Intron	NM_033274	NP_150377	Q9H013	ADA19_HUMAN	ADAM metallopeptidase domain 19 preproprotein						proteolysis	integral to membrane	metalloendopeptidase activity|SH3 domain binding|zinc ion binding			ovary(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)|skin(1)	8	Renal(175;0.00488)	Medulloblastoma(196;0.0359)|all_neural(177;0.14)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			GACGGTCAGTGGGGAAACACC	0.552													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	157726370	157726371	+	IGR	DEL	AT	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:157726370_157726371delAT								CLINT1 (440202 upstream) : EBF1 (396553 downstream)																							ttggagtcacatgtggccatgt	0.218													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	160431888	160431888	+	IGR	DEL	T	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:160431888delT								LOC285629 (66255 upstream) : GABRB2 (283548 downstream)																							ctttatgtgatttttttttat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	164223726	164223726	+	IGR	DEL	T	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:164223726delT								None (None upstream) : None (None downstream)																							GCTTTGGCGCTTCCTTGATTA	0.413													4	2	---	---	---	---	
ODZ2	57451	broad.mit.edu	37	5	167087902	167087902	+	Intron	DEL	G	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:167087902delG	uc010jjd.2	+							NM_001122679	NP_001116151			odz, odd Oz/ten-m homolog 2											ovary(6)|central_nervous_system(4)	10	Renal(175;0.00124)|Lung NSC(126;0.136)|all_lung(126;0.242)	Medulloblastoma(196;0.0241)|all_neural(177;0.026)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0444)|OV - Ovarian serous cystadenocarcinoma(192;0.0694)|Epithelial(171;0.124)		agtagcttgtgggtgctgggg	0.129													4	2	---	---	---	---	
SLIT3	6586	broad.mit.edu	37	5	168180651	168180652	+	Intron	DEL	GT	-	-	rs6867055	by1000genomes	TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:168180651_168180652delGT	uc003mab.2	-						SLIT3_uc010jjg.2_Intron	NM_003062	NP_003053	O75094	SLIT3_HUMAN	slit homolog 3 precursor						apoptosis involved in luteolysis|axon extension involved in axon guidance|cellular response to hormone stimulus|negative chemotaxis|negative regulation of cell growth|negative regulation of chemokine-mediated signaling pathway|response to cortisol stimulus|Roundabout signaling pathway	extracellular space|mitochondrion	calcium ion binding|Roundabout binding			ovary(3)|skin(1)	4	Renal(175;0.000159)|Lung NSC(126;0.0174)|all_lung(126;0.0392)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			tgtgtgtgtggtgtgtgtgtgt	0.386													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	175336278	175336278	+	IGR	DEL	T	-	-	rs67243038		TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:175336278delT								CPLX2 (25255 upstream) : THOC3 (50258 downstream)																							ggctcccccctcttgccagcc	0.000													8	5	---	---	---	---	
COL23A1	91522	broad.mit.edu	37	5	177783380	177783381	+	Intron	INS	-	A	A	rs138129577	by1000genomes	TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:177783380_177783381insA	uc003mje.2	-							NM_173465	NP_775736	Q86Y22	CONA1_HUMAN	collagen, type XXIII, alpha 1							collagen|integral to membrane|plasma membrane	protein binding			central_nervous_system(1)|skin(1)	2	all_cancers(89;0.00188)|Renal(175;0.000159)|Lung NSC(126;0.00814)|all_lung(126;0.0129)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	OV - Ovarian serous cystadenocarcinoma(192;0.153)|all cancers(165;0.172)		aagctgttatgaaaaaAGGCAA	0.243													8	6	---	---	---	---	
ADAMTS2	9509	broad.mit.edu	37	5	178632537	178632537	+	Intron	DEL	G	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:178632537delG	uc003mjw.2	-						ADAMTS2_uc011dgm.1_Intron	NM_014244	NP_055059	O95450	ATS2_HUMAN	ADAM metallopeptidase with thrombospondin type 1						collagen catabolic process	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			large_intestine(1)|lung(1)|ovary(1)|pancreas(1)	4	all_cancers(89;0.000456)|all_epithelial(37;0.000138)|Renal(175;0.000159)|Lung NSC(126;0.00184)|all_lung(126;0.00326)	all_cancers(40;0.00604)|all_neural(177;0.00411)|Medulloblastoma(196;0.00508)|Lung NSC(249;0.0569)|all_lung(500;0.129)|all_hematologic(541;0.211)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	GBM - Glioblastoma multiforme(465;0.0473)		agtcgccatcggactgtaatt	0.134													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	6931952	6931952	+	IGR	DEL	G	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:6931952delG								LY86 (276736 upstream) : RREB1 (176236 downstream)																							CTCAACCTGTGGGGGGAATTT	0.408													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	16152279	16152279	+	IGR	DEL	G	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:16152279delG								MYLIP (3803 upstream) : GMPR (86532 downstream)																							TTCTTAAAGTGGGTAAGTTGT	0.373													4	2	---	---	---	---	
LRRC16A	55604	broad.mit.edu	37	6	25566218	25566219	+	Intron	DEL	CA	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:25566218_25566219delCA	uc011djw.1	+						LRRC16A_uc010jpx.2_Intron|LRRC16A_uc010jpy.2_Intron	NM_017640	NP_060110	Q5VZK9	LR16A_HUMAN	leucine rich repeat containing 16A						actin filament organization|blood coagulation|cell migration|lamellipodium assembly|ruffle organization|urate metabolic process	cytosol|lamellipodium|nucleus				ovary(1)|breast(1)|central_nervous_system(1)|pancreas(1)	4						cctaaggcttcaccatcagctt	0.000													4	2	---	---	---	---	
HLA-DQA1	3117	broad.mit.edu	37	6	32605027	32605028	+	5'Flank	INS	-	ACA	ACA	rs144342006	by1000genomes	TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32605027_32605028insACA	uc003obr.2	+						HLA-DQA1_uc003obs.2_5'Flank|HLA-DQA1_uc003obt.1_5'Flank	NM_002122	NP_002113	P01909	DQA1_HUMAN	major histocompatibility complex, class II, DQ						antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|interferon-gamma-mediated signaling pathway|T cell costimulation|T cell receptor signaling pathway	endoplasmic reticulum membrane|endosome membrane|Golgi apparatus|integral to plasma membrane|lysosomal membrane|MHC class II protein complex	MHC class II receptor activity				0						GAGGCTGCATCACAAGGGGATT	0.450													3	3	---	---	---	---	
ANKS1A	23294	broad.mit.edu	37	6	35054984	35054997	+	Intron	DEL	GCAGCGTAGACGCT	-	-	rs143879091		TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:35054984_35054997delGCAGCGTAGACGCT	uc003ojx.3	+						ANKS1A_uc011dss.1_Intron|ANKS1A_uc011dst.1_Intron|ANKS1A_uc010jvp.1_Intron	NM_015245	NP_056060	Q92625	ANS1A_HUMAN	ankyrin repeat and sterile alpha motif domain							cytoplasm	protein binding			ovary(3)|upper_aerodigestive_tract(1)	4						TGGGCGGGCGGCAGCGTAGACGCTGTACACTTGC	0.603													4	10	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	42099714	42099714	+	IGR	DEL	G	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:42099714delG								C6orf132 (27225 upstream) : GUCA1A (23430 downstream)																							agggaaacgtgatacgggagc	0.080													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	44456457	44456457	+	IGR	DEL	T	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:44456457delT								CDC5L (41678 upstream) : SUPT3H (320597 downstream)																							TCCTTGCTTCTGGACCTCCTT	0.483													4	2	---	---	---	---	
PKHD1	5314	broad.mit.edu	37	6	51923570	51923573	+	Intron	DEL	TCTA	-	-	rs66624918		TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:51923570_51923573delTCTA	uc003pah.1	-						PKHD1_uc003pai.2_Intron	NM_138694	NP_619639	P08F94	PKHD1_HUMAN	fibrocystin isoform 1						cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity			lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44	Lung NSC(77;0.0605)					TCTCCAGCTCtctatctatctatc	0.333													4	3	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57389262	57389262	+	Intron	DEL	G	-	-	rs5876591		TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57389262delG	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		AGAGGGAAAAGTTCCTCAGGT	0.284													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	57541095	57541095	+	IGR	DEL	A	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57541095delA								PRIM2 (27720 upstream) : GUSBL2 (705064 downstream)																							ACAAATGGGTAAATGAGGTAT	0.308													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	57593772	57593772	+	IGR	DEL	A	-	-	rs11311756		TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57593772delA								PRIM2 (80397 upstream) : GUSBL2 (652387 downstream)																							CTTAAgagtcatttttttagt	0.189													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	64190432	64190432	+	IGR	DEL	A	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:64190432delA								LGSN (160550 upstream) : PTP4A1 (41219 downstream)																							AAAGAAAGCCAAAAAAAAAAC	0.353													4	3	---	---	---	---	
EYS	346007	broad.mit.edu	37	6	65987336	65987338	+	Intron	DEL	GTT	-	-	rs151199701		TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:65987336_65987338delGTT	uc011dxu.1	-							NM_001142800	NP_001136272	Q5T1H1	EYS_HUMAN	eyes shut homolog isoform 1						response to stimulus|visual perception	extracellular region	calcium ion binding			lung(4)|ovary(1)|skin(1)	6						aaaaaaaaaagttaattaattaa	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	66542166	66542166	+	IGR	DEL	A	-	-	rs35777515		TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:66542166delA								MCART3P (42791 upstream) : None (None downstream)																							CAATTCCCCTAAAAGCCATTA	0.284													4	2	---	---	---	---	
C6orf150	115004	broad.mit.edu	37	6	74155680	74155680	+	Intron	DEL	T	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:74155680delT	uc003pgx.1	-							NM_138441	NP_612450	Q8N884	M21D1_HUMAN	hypothetical protein LOC115004												0						ACTCAATTAATTTTTTTTACC	0.323													4	2	---	---	---	---	
TTK	7272	broad.mit.edu	37	6	80715274	80715274	+	Intron	DEL	T	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:80715274delT	uc003pjc.2	+						TTK_uc003pjb.3_Intron	NM_003318	NP_003309	P33981	TTK_HUMAN	TTK protein kinase						mitotic cell cycle spindle assembly checkpoint|mitotic spindle organization|positive regulation of cell proliferation|positive regulation of pathway-restricted SMAD protein phosphorylation	spindle	ATP binding|identical protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(4)|stomach(2)|lung(2)|large_intestine(2)|pancreas(1)	11		all_cancers(76;0.00177)|Acute lymphoblastic leukemia(125;1.24e-05)|all_hematologic(105;0.00223)|all_epithelial(107;0.2)		BRCA - Breast invasive adenocarcinoma(397;0.0321)		CTCTATCATATTTTTTTTAAG	0.358													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	86420987	86420988	+	IGR	DEL	AC	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:86420987_86420988delAC								SNHG5 (32536 upstream) : None (None downstream)																							gAACTAGGATacacacacacac	0.015													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	106895961	106895962	+	IGR	INS	-	G	G	rs150559591	by1000genomes	TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:106895961_106895962insG								ATG5 (122266 upstream) : AIM1 (63768 downstream)																							CCTGAGTTTCCGGGGCTGGGCA	0.550													4	2	---	---	---	---	
ALDH8A1	64577	broad.mit.edu	37	6	135270801	135270801	+	Intron	DEL	A	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:135270801delA	uc003qew.2	-						ALDH8A1_uc003qex.2_Intron|ALDH8A1_uc010kgh.2_Intron|ALDH8A1_uc011ecx.1_Intron	NM_022568	NP_072090	Q9H2A2	AL8A1_HUMAN	aldehyde dehydrogenase 8A1 isoform 1						retinal metabolic process	cytoplasm	retinal dehydrogenase activity			ovary(2)|pancreas(1)|skin(1)	4	Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.00401)|GBM - Glioblastoma multiforme(68;0.0058)		TGAGAATTGCAAAAAAAAACT	0.358													10	5	---	---	---	---	
LPAL2	80350	broad.mit.edu	37	6	160912137	160912137	+	Intron	DEL	G	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:160912137delG	uc003qtj.2	-						LPAL2_uc011efy.1_Intron	NR_028093				Homo sapiens cDNA FLJ43922 fis, clone TESTI4012406.												0		Breast(66;0.000496)|Ovarian(120;0.0303)|Prostate(117;0.214)		OV - Ovarian serous cystadenocarcinoma(65;2.5e-17)|BRCA - Breast invasive adenocarcinoma(81;6.48e-06)		GGTTATTTGTGGTCCTGACAG	0.418													4	2	---	---	---	---	
RPS6KA2	6196	broad.mit.edu	37	6	166853810	166853810	+	Intron	DEL	C	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:166853810delC	uc003qvb.1	-						RPS6KA2_uc011ego.1_Intron|RPS6KA2_uc010kkl.1_Intron|RPS6KA2_uc003qvc.1_Intron|RPS6KA2_uc003qvd.1_Intron	NM_021135	NP_066958	Q15349	KS6A2_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide						axon guidance|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|stress-activated MAPK cascade|synaptic transmission|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|magnesium ion binding|protein serine/threonine kinase activity			ovary(2)|lung(2)|skin(2)|large_intestine(1)|central_nervous_system(1)	8		Breast(66;2.04e-05)|Ovarian(120;0.0652)|Prostate(117;0.105)		OV - Ovarian serous cystadenocarcinoma(33;2.76e-18)|GBM - Glioblastoma multiforme(31;9.94e-06)|BRCA - Breast invasive adenocarcinoma(81;1.36e-05)		TGACCGTCCTCCGCCGCATGC	0.463													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	169785407	169785408	+	Intron	DEL	CA	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:169785407_169785408delCA	uc003qwu.1	-											Homo sapiens cDNA FLJ31008 fis, clone HLUNG2000130.																		catgcactctcacacacacggc	0.183													4	2	---	---	---	---	
ELFN1	392617	broad.mit.edu	37	7	1763538	1763538	+	Intron	DEL	T	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:1763538delT	uc010ksg.2	+							NM_001128636	NP_001122108			extracellular leucine-rich repeat and												0						CTCCTCCCACTTTTTTTTGGA	0.572													4	3	---	---	---	---	
HDAC9	9734	broad.mit.edu	37	7	18934566	18934566	+	Intron	DEL	G	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:18934566delG	uc003suh.2	+						HDAC9_uc003sue.2_Intron|HDAC9_uc003sui.2_Intron|HDAC9_uc003suj.2_Intron|HDAC9_uc003suk.2_Intron	NM_058176	NP_478056	Q9UKV0	HDAC9_HUMAN	histone deacetylase 9 isoform 1						B cell differentiation|cellular response to insulin stimulus|heart development|histone H3 deacetylation|histone H4 deacetylation|inflammatory response|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|peptidyl-lysine deacetylation|positive regulation of cell migration involved in sprouting angiogenesis|regulation of skeletal muscle fiber development|transcription, DNA-dependent	cytoplasm|histone deacetylase complex|histone methyltransferase complex|transcription factor complex	histone deacetylase activity (H3-K16 specific)|histone deacetylase binding|histone deacetylase binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|protein binding|protein kinase C binding|repressing transcription factor binding|transcription corepressor activity			lung(2)|central_nervous_system(2)|kidney(1)	5	all_lung(11;0.187)				Valproic Acid(DB00313)	gtgtaatggtgggagatatat	0.000													4	2	---	---	---	---	
AQP1	358	broad.mit.edu	37	7	30955415	30955415	+	Intron	DEL	C	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:30955415delC	uc003tbv.1	+						AQP1_uc011kac.1_Intron	NM_198098	NP_932766	P29972	AQP1_HUMAN	aquaporin 1						ammonium transport|cell volume homeostasis|cellular hyperosmotic response|cellular response to cAMP|cellular response to copper ion|cellular response to dexamethasone stimulus|cellular response to hydrogen peroxide|cellular response to hypoxia|cellular response to mechanical stimulus|cellular response to mercury ion|cellular response to nitric oxide|cellular response to retinoic acid|cellular response to salt stress|cellular response to UV|cerebrospinal fluid secretion|cGMP biosynthetic process|establishment or maintenance of actin cytoskeleton polarity|lateral ventricle development|maintenance of symbiont-containing vacuole via substance secreted by host|negative regulation of apoptosis|odontogenesis|pancreatic juice secretion|positive regulation of angiogenesis|positive regulation of fibroblast proliferation|positive regulation of saliva secretion|renal water transport|response to drug|transepithelial water transport	apical plasma membrane|basal plasma membrane|brush border membrane|cytoplasm|integral to plasma membrane|nuclear membrane|sarcolemma|symbiont-containing vacuole	ammonia transmembrane transporter activity|carbon dioxide transmembrane transporter activity|glycerol transmembrane transporter activity|intracellular cGMP activated cation channel activity|nitric oxide transmembrane transporter activity|potassium channel activity|potassium ion transmembrane transporter activity|protein binding|water channel activity				0		Melanoma(862;0.16)			Acetazolamide(DB00819)	gcttcagtttccccagtcata	0.458													4	2	---	---	---	---	
AVL9	23080	broad.mit.edu	37	7	32591631	32591631	+	Intron	DEL	A	-	-	rs11312395		TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:32591631delA	uc003tcv.1	+						AVL9_uc011kai.1_Intron|AVL9_uc010kwj.1_Intron	NM_015060	NP_055875	Q8NBF6	AVL9_HUMAN	AVL9 homolog (S. cerevisiase)							integral to membrane					0						TTTCATACTCAACTGCCCACG	0.418													4	14	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	34256288	34256288	+	IGR	DEL	G	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:34256288delG								BMPER (62177 upstream) : AAA1 (133747 downstream)																							TTTTCATCCTGGGGGGAAGGA	0.423													4	2	---	---	---	---	
DPY19L1	23333	broad.mit.edu	37	7	35029258	35029259	+	Intron	INS	-	C	C	rs143800034	by1000genomes	TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:35029258_35029259insC	uc003tem.3	-							NM_015283	NP_056098	Q2PZI1	D19L1_HUMAN	dpy-19-like 1							integral to membrane					0						aacaacaacaaaaaaAAAAAAC	0.139													4	2	---	---	---	---	
ABCA13	154664	broad.mit.edu	37	7	48315960	48315961	+	Frame_Shift_Ins	INS	-	A	A			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:48315960_48315961insA	uc003toq.2	+	17	6722_6723	c.6697_6698insA	c.(6697-6699)CAAfs	p.Q2233fs	ABCA13_uc010kyr.2_Frame_Shift_Ins_p.Q1736fs	NM_152701	NP_689914	Q86UQ4	ABCAD_HUMAN	ATP binding cassette, sub-family A (ABC1),	2233					transport	integral to membrane	ATP binding|ATPase activity			ovary(5)|central_nervous_system(4)|skin(1)	10						TACTGACCTTCAAATAATGAAT	0.347													64	48	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	61827624	61827624	+	IGR	DEL	T	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:61827624delT								None (None upstream) : LOC643955 (924048 downstream)																							aagcaaatgctgagagatttg	0.000													5	3	---	---	---	---	
SPDYE7P	441251	broad.mit.edu	37	7	72339826	72339826	+	5'Flank	DEL	G	-	-	rs237936	by1000genomes	TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:72339826delG	uc010lal.1	-							NR_003666				Homo sapiens speedy homolog E7 (Xenopus laevis), pseudogene (SPDYE7P), non-coding RNA.												0						TCTTTTTTttgttgttgttgt	0.254													6	4	---	---	---	---	
CD36	948	broad.mit.edu	37	7	80303701	80303716	+	3'UTR	DEL	GCACAAATAAAGCACT	-	-	rs3212018		TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:80303701_80303716delGCACAAATAAAGCACT	uc003uhc.2	+	17					CD36_uc003uhd.3_3'UTR|CD36_uc011kgv.1_3'UTR|CD36_uc003uhe.3_3'UTR|CD36_uc003uhf.3_Intron|CD36_uc003uhg.3_3'UTR|CD36_uc003uhh.3_3'UTR	NM_001127444	NP_001120916	P16671	CD36_HUMAN	CD36 antigen						cell adhesion|cGMP-mediated signaling|cholesterol transport|lipid metabolic process|lipid storage|lipoprotein transport|low-density lipoprotein particle clearance|nitric oxide mediated signal transduction|plasma membrane long-chain fatty acid transport|platelet activation|platelet degranulation|positive regulation of cell-matrix adhesion|positive regulation of macrophage derived foam cell differentiation	integral to plasma membrane|membrane fraction|platelet alpha granule membrane	lipid binding|low-density lipoprotein receptor activity|thrombospondin receptor activity|transforming growth factor beta binding			ovary(1)	1						TGTAACAATAGCACAAATAAAGCACTTGTGCCAAAG	0.287													3	3	---	---	---	---	
TRRAP	8295	broad.mit.edu	37	7	98606320	98606320	+	Intron	DEL	T	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:98606320delT	uc003upp.2	+						TRRAP_uc011kis.1_Intron|TRRAP_uc003upr.2_Intron	NM_003496	NP_003487	Q9Y4A5	TRRAP_HUMAN	transformation/transcription domain-associated						histone deubiquitination|histone H2A acetylation|histone H4 acetylation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	NuA4 histone acetyltransferase complex|PCAF complex|STAGA complex|transcription factor TFTC complex	phosphotransferase activity, alcohol group as acceptor|protein binding|transcription cofactor activity			ovary(9)|large_intestine(8)|central_nervous_system(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(1)|lung(1)|liver(1)	37	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			AGTAACTTTATTAGACTCATG	0.512													4	2	---	---	---	---	
AGBL3	340351	broad.mit.edu	37	7	134819418	134819418	+	Intron	DEL	A	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:134819418delA	uc011kpw.1	+						uc003vsg.2_Intron|C7orf49_uc003vsh.2_Intron	NM_178563	NP_848658	Q8NEM8	CBPC3_HUMAN	carboxypeptidase 3, cytosolic						proteolysis	cytosol	metallocarboxypeptidase activity|zinc ion binding				0						GAATAGTGCTAAAAAAAAAAT	0.303													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	141564233	141564234	+	IGR	INS	-	T	T	rs142575113	by1000genomes	TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:141564233_141564234insT								PRSS37 (22948 upstream) : OR9A4 (54442 downstream)																							AGAAAGAAACATTTTTTTTTAC	0.406													7	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	145119186	145119186	+	IGR	DEL	G	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:145119186delG								TPK1 (586040 upstream) : CNTNAP2 (694267 downstream)																							CAGACAcagtggtatgctgga	0.214													4	2	---	---	---	---	
GALNT11	63917	broad.mit.edu	37	7	151814871	151814871	+	Intron	DEL	G	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151814871delG	uc010lqg.1	+						GALNT11_uc011kvm.1_Intron|GALNT11_uc003wku.2_Intron|GALNT11_uc003wkw.1_3'UTR	NM_022087	NP_071370	Q8NCW6	GLT11_HUMAN	N-acetylgalactosaminyltransferase 11							Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding				0	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.214)	OV - Ovarian serous cystadenocarcinoma(82;0.00168)	UCEC - Uterine corpus endometrioid carcinoma (81;0.177)|BRCA - Breast invasive adenocarcinoma(188;0.0932)		GGGTCAGAGTGGGGACATGGA	0.488													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	155021594	155021595	+	IGR	INS	-	G	G	rs139508747	by1000genomes	TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:155021594_155021595insG								HTR5A (144135 upstream) : INSIG1 (67891 downstream)																							CCTGCCTGCTAGATTGCATGTT	0.490													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	155986815	155986815	+	IGR	DEL	A	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:155986815delA								SHH (381848 upstream) : C7orf4 (346370 downstream)																							tagcacctttaaaaaggtaag	0.050													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	2208254	2208255	+	IGR	INS	-	C	C			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:2208254_2208255insC								MYOM2 (114875 upstream) : CSMD1 (584621 downstream)																							CAGGGCCAGTGCCTTCTCTCCC	0.485													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	2322062	2322063	+	IGR	DEL	CT	-	-	rs33995221		TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:2322062_2322063delCT								MYOM2 (228683 upstream) : CSMD1 (470813 downstream)																							gagaccctacctatacacacac	0.109													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	2386918	2386919	+	IGR	INS	-	A	A			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:2386918_2386919insA								MYOM2 (293539 upstream) : CSMD1 (405957 downstream)																							TCTGCAAAGCGAAAAAAAAACG	0.322													4	2	---	---	---	---	
CSMD1	64478	broad.mit.edu	37	8	4785538	4785538	+	Intron	DEL	G	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:4785538delG	uc011kwk.1	-							NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1 precursor							integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		catcctcagcggcaaaagtag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	11490250	11490250	+	IGR	DEL	A	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11490250delA								BLK (68143 upstream) : GATA4 (44218 downstream)																							aaaacaaaacaaaaaaaagca	0.423													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	92746238	92746238	+	IGR	DEL	G	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:92746238delG								SLC26A7 (335858 upstream) : RUNX1T1 (224914 downstream)																							CTATTTTTTTGCTATATGTCA	0.368													4	2	---	---	---	---	
TM7SF4	81501	broad.mit.edu	37	8	105358302	105358302	+	Intron	DEL	G	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:105358302delG	uc003ylx.1	+							NM_030788	NP_110415	Q9H295	TM7S4_HUMAN	dendritic cell-specific transmembrane protein						osteoclast differentiation	cell surface|integral to membrane|plasma membrane				pancreas(2)|large_intestine(1)|ovary(1)	4			OV - Ovarian serous cystadenocarcinoma(57;1.61e-06)|STAD - Stomach adenocarcinoma(118;0.229)			atcctgctgtgccgtctccac	0.095													4	2	---	---	---	---	
NDRG1	10397	broad.mit.edu	37	8	134261266	134261266	+	Intron	DEL	T	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:134261266delT	uc003yuh.2	-						NDRG1_uc003yuf.1_Intron|NDRG1_uc003yug.2_Intron|NDRG1_uc010mee.2_Intron|NDRG1_uc010mef.2_Intron|NDRG1_uc011ljh.1_Intron|NDRG1_uc011lji.1_Intron	NM_001135242	NP_001128714	Q92597	NDRG1_HUMAN	N-myc downstream regulated 1						cellular response to hypoxia|response to metal ion	cytoplasm|microtubule cytoskeleton|nucleus|plasma membrane	protein binding			ovary(4)	4	all_epithelial(106;4.26e-24)|Lung NSC(106;7.26e-07)|all_lung(105;2.77e-06)|Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0107)			TTTGTGGGGCTTTTTTTTCCA	0.473													4	2	---	---	---	---	
ZFAT	57623	broad.mit.edu	37	8	135669293	135669293	+	Intron	DEL	A	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:135669293delA	uc003yup.2	-						ZFAT_uc003yun.2_Intron|ZFAT_uc003yuo.2_Intron|ZFAT_uc010meh.2_Intron|ZFAT_uc010mei.2_Intron|ZFAT_uc003yuq.2_Intron|ZFAT_uc010mej.2_Intron|ZFAT_uc003yur.2_Intron	NM_020863	NP_065914	Q9P243	ZFAT_HUMAN	zinc finger protein 406 isoform ZFAT-1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|nucleus	DNA binding|zinc ion binding			central_nervous_system(1)	1	all_epithelial(106;8.26e-19)|Lung NSC(106;3.47e-07)|all_lung(105;1.39e-06)|Ovarian(258;0.0102)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0432)			AAAATGCTGTAAGATTATATA	0.259													4	2	---	---	---	---	
FAM135B	51059	broad.mit.edu	37	8	139200934	139200934	+	Intron	DEL	C	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139200934delC	uc003yuy.2	-						FAM135B_uc003yux.2_Intron|FAM135B_uc003yuz.2_Intron	NM_015912	NP_056996	Q49AJ0	F135B_HUMAN	hypothetical protein LOC51059											ovary(7)|skin(2)	9	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			GCCCTGCCTTCCTGCAGCCCT	0.582										HNSCC(54;0.14)			4	2	---	---	---	---	
COL22A1	169044	broad.mit.edu	37	8	139725953	139725953	+	Intron	DEL	A	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139725953delA	uc003yvd.2	-						COL22A1_uc011ljo.1_Intron	NM_152888	NP_690848	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1						cell adhesion	collagen|cytoplasm	structural molecule activity			ovary(11)|pancreas(1)|skin(1)	13	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			CTATGAGTCCACCCCCACCGC	0.488										HNSCC(7;0.00092)			4	3	---	---	---	---	
COL22A1	169044	broad.mit.edu	37	8	139725961	139725962	+	Intron	DEL	CG	-	-	rs142870183	by1000genomes	TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139725961_139725962delCG	uc003yvd.2	-						COL22A1_uc011ljo.1_Intron	NM_152888	NP_690848	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1						cell adhesion	collagen|cytoplasm	structural molecule activity			ovary(11)|pancreas(1)|skin(1)	13	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			CCACCCCCACCGCCCCGCCGTA	0.495										HNSCC(7;0.00092)			6	3	---	---	---	---	
GLI4	2738	broad.mit.edu	37	8	144352382	144352382	+	Intron	DEL	G	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144352382delG	uc003yxx.2	+						ZFP41_uc003yxv.2_Intron	NM_138465	NP_612474	P10075	GLI4_HUMAN	GLI-Kruppel family member GLI4							nucleus	DNA binding|zinc ion binding				0	all_cancers(97;1.01e-10)|all_epithelial(106;4.86e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.156)|Colorectal(110;0.173)			GCCCAGGAATGGGGGCAACCT	0.657													4	2	---	---	---	---	
UBAP2	55833	broad.mit.edu	37	9	33960612	33960612	+	Intron	DEL	A	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:33960612delA	uc003ztq.1	-						UBAP2_uc011loc.1_Intron|UBAP2_uc011lod.1_Intron|UBAP2_uc011loe.1_Intron|UBAP2_uc011lof.1_Intron|UBAP2_uc011log.1_Intron|UBAP2_uc003ztr.2_Intron	NM_018449	NP_060919	Q5T6F2	UBAP2_HUMAN	ubiquitin associated protein 2											ovary(3)	3			LUSC - Lung squamous cell carcinoma(29;0.00575)	GBM - Glioblastoma multiforme(74;0.168)		cgtctctactaaaaaaaaaat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	66465028	66465029	+	Intron	INS	-	A	A			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66465028_66465029insA	uc004aec.2	+											Homo sapiens, clone IMAGE:5213378, mRNA.																		GCAGGCTGAGGGATCCAAGGGG	0.376													4	4	---	---	---	---	
GNA14	9630	broad.mit.edu	37	9	80073211	80073211	+	Intron	DEL	G	-	-	rs34006361		TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:80073211delG	uc004aku.2	-							NM_004297	NP_004288	O95837	GNA14_HUMAN	G alpha 14						activation of phospholipase C activity by dopamine receptor signaling pathway|G-protein signaling, coupled to cAMP nucleotide second messenger|platelet activation|protein ADP-ribosylation	heterotrimeric G-protein complex	G-protein beta/gamma-subunit complex binding|G-protein-coupled receptor binding|GTP binding|GTPase activity|signal transducer activity			ovary(2)	2						ACAGCTTTGAGGGGGGAAAAG	0.552											OREG0019264	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	94935614	94935615	+	IGR	INS	-	T	T			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:94935614_94935615insT								C9orf44 (13724 upstream) : IARS (37010 downstream)																							CTCTCCCTACCTGCTGTCCGAC	0.639													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	104543444	104543445	+	IGR	INS	-	C	C	rs148685830	by1000genomes	TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:104543444_104543445insC								GRIN3A (42582 upstream) : None (None downstream)																							agtgaacttgacccccagctca	0.000													3	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	109568923	109568923	+	IGR	DEL	C	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:109568923delC								None (None upstream) : ZNF462 (56455 downstream)																							TAGGTTTCCTCCATCAGTCAC	0.348													4	2	---	---	---	---	
SUSD1	64420	broad.mit.edu	37	9	114920104	114920104	+	Intron	DEL	C	-	-	rs112000459		TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:114920104delC	uc004bfu.2	-						SUSD1_uc010mui.2_Intron|SUSD1_uc010muj.2_Intron	NM_022486	NP_071931	Q6UWL2	SUSD1_HUMAN	sushi domain containing 1 precursor							integral to membrane	calcium ion binding				0						ttctttctttctttttttttt	0.179													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	3079634	3079634	+	IGR	DEL	G	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:3079634delG								None (None upstream) : PFKP (30118 downstream)																							acctggcattggggtgcaggg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	8413544	8413544	+	IGR	DEL	A	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:8413544delA								GATA3 (296382 upstream) : None (None downstream)																							ACAGGAGTTGAATGTGAGTTG	0.348													4	2	---	---	---	---	
SEC61A2	55176	broad.mit.edu	37	10	12185733	12185733	+	Intron	DEL	A	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:12185733delA	uc001ile.2	+						SEC61A2_uc010qbq.1_Intron|SEC61A2_uc001ilf.3_Intron|SEC61A2_uc001ilh.3_Intron|SEC61A2_uc001ilg.3_Intron	NM_018144	NP_060614	Q9H9S3	S61A2_HUMAN	Sec61 alpha form 2 isoform a							endoplasmic reticulum membrane|integral to membrane	P-P-bond-hydrolysis-driven protein transmembrane transporter activity			ovary(1)	1		Renal(717;0.228)				ctctgcctccaaaaaaaaaGG	0.259													3	3	---	---	---	---	
MCM10	55388	broad.mit.edu	37	10	13249348	13249348	+	Intron	DEL	T	-	-	rs76611895		TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:13249348delT	uc001ima.2	+						MCM10_uc001imb.2_Intron|MCM10_uc001imc.2_Intron	NM_182751	NP_877428	Q7L590	MCM10_HUMAN	minichromosome maintenance complex component 10						cell cycle checkpoint|DNA replication|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle	nucleoplasm	metal ion binding|protein binding			ovary(2)|central_nervous_system(1)	3						AGAATAGTGATTTTTTTTTTC	0.209													3	3	---	---	---	---	
RPP38	10557	broad.mit.edu	37	10	15142294	15142295	+	Intron	DEL	CT	-	-	rs144189457		TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:15142294_15142295delCT	uc001iny.3	+						C10orf111_uc001inw.2_5'Flank|RPP38_uc009xjm.2_Intron|RPP38_uc001inx.3_Intron	NM_183005	NP_892117	P78345	RPP38_HUMAN	ribonuclease P/MRP 38 subunit						tRNA processing	nucleolar ribonuclease P complex	protein binding|ribonuclease P activity			ovary(1)	1						GTTTCACCCCCTGTCACTTATT	0.465													2	5	---	---	---	---	
C1QL3	389941	broad.mit.edu	37	10	16563614	16563614	+	5'UTR	DEL	T	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:16563614delT	uc001ioj.1	-	1						NM_001010908	NP_001010908	Q5VWW1	C1QL3_HUMAN	complement component 1, q subcomponent-like 3							collagen				ovary(1)	1						GTCCGCTGCCTTTTTTTTTTA	0.453													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	22805694	22805694	+	IGR	DEL	A	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:22805694delA								SPAG6 (99156 upstream) : PIP4K2A (18073 downstream)																							taagagactcaaaaaaaagag	0.000													4	2	---	---	---	---	
SVIL	6840	broad.mit.edu	37	10	29844269	29844274	+	Intron	DEL	ACACAT	-	-	rs72046228		TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:29844269_29844274delACACAT	uc001iut.1	-						SVIL_uc001iuu.1_Intron|SVIL_uc009xld.1_Intron	NM_021738	NP_068506	O95425	SVIL_HUMAN	supervillin isoform 2						cytoskeleton organization|skeletal muscle tissue development	cell junction|costamere|invadopodium|nucleus|podosome	actin filament binding			ovary(5)|upper_aerodigestive_tract(1)	6		Breast(68;0.103)				acacacacacacacatggacacacCC	0.214													4	2	---	---	---	---	
EPC1	80314	broad.mit.edu	37	10	32605026	32605026	+	Intron	DEL	T	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:32605026delT	uc001iwg.1	-						EPC1_uc001iwi.3_Intron|EPC1_uc009xlt.2_Intron|EPC1_uc001iwh.1_Intron	NM_025209	NP_079485	Q9H2F5	EPC1_HUMAN	enhancer of polycomb 1						histone H2A acetylation|histone H4 acetylation|negative regulation of gene expression, epigenetic|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|regulation of growth|transcription, DNA-dependent	NuA4 histone acetyltransferase complex|nuclear membrane|Piccolo NuA4 histone acetyltransferase complex				ovary(3)|central_nervous_system(1)	4		Prostate(175;0.0199)				tcacctcaagtttttgtttca	0.000													4	2	---	---	---	---	
EPC1	80314	broad.mit.edu	37	10	32655628	32655628	+	Intron	DEL	A	-	-	rs10713304		TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:32655628delA	uc001iwi.3	-						EPC1_uc009xlt.2_Intron	NM_025209	NP_079485	Q9H2F5	EPC1_HUMAN	enhancer of polycomb 1						histone H2A acetylation|histone H4 acetylation|negative regulation of gene expression, epigenetic|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|regulation of growth|transcription, DNA-dependent	NuA4 histone acetyltransferase complex|nuclear membrane|Piccolo NuA4 histone acetyltransferase complex				ovary(3)|central_nervous_system(1)	4		Prostate(175;0.0199)				ATGACAGAACAAAAAGCAGCA	0.363													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42905775	42905775	+	Intron	DEL	T	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42905775delT	uc001izx.2	-											Homo sapiens cyclin Y-like 2, mRNA (cDNA clone IMAGE:4704933), with apparent retained intron.																		ttttttttggttttttttttt	0.154													4	3	---	---	---	---	
GPRIN2	9721	broad.mit.edu	37	10	47004355	47004356	+	3'UTR	INS	-	A	A	rs150277144		TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:47004355_47004356insA	uc010qfq.1	+	1						NM_014696	NP_055511	O60269	GRIN2_HUMAN	G protein-regulated inducer of neurite outgrowth												0						taggtttctgctggagtcgtag	0.040													5	3	---	---	---	---	
ANXA8	653145	broad.mit.edu	37	10	47062498	47062502	+	Intron	DEL	ATAAA	-	-	rs149894739		TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:47062498_47062502delATAAA	uc001jed.3	-									P13928	ANXA8_HUMAN	Homo sapiens cDNA FLJ58071 complete cds, highly similar to Annexin A8.						blood coagulation		calcium ion binding|calcium-dependent phospholipid binding			central_nervous_system(3)	3						CAAATAAAAGATAAAATAAAAGATT	0.254													4	2	---	---	---	---	
WDFY4	57705	broad.mit.edu	37	10	50151643	50151644	+	Intron	INS	-	T	T			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:50151643_50151644insT	uc001jha.3	+						WDFY4_uc009xob.2_Intron|WDFY4_uc010qgn.1_Intron	NM_020945	NP_065996	Q6ZS81	WDFY4_HUMAN	WDFY family member 4							integral to membrane	binding				0						GCTCAGATCTCttttttttttt	0.267													5	3	---	---	---	---	
PRKG1	5592	broad.mit.edu	37	10	53622889	53622890	+	Intron	INS	-	ATCAAGCATGTAC	ATCAAGCATGTAC	rs151133770	by1000genomes	TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:53622889_53622890insATCAAGCATGTAC	uc001jjm.2	+						PRKG1_uc001jjn.2_Intron|PRKG1_uc001jjo.2_Intron	NM_001098512	NP_001091982	Q13976	KGP1_HUMAN	protein kinase, cGMP-dependent, type I isoform						actin cytoskeleton organization|platelet activation|signal transduction	cytosol	ATP binding|cGMP binding|cGMP-dependent protein kinase activity			lung(2)|stomach(1)|ovary(1)|central_nervous_system(1)|skin(1)	6		all_cancers(4;2.13e-08)|all_epithelial(4;2.44e-08)|all_lung(4;0.000173)		all cancers(4;1.18e-05)|GBM - Glioblastoma multiforme(4;0.000359)|Epithelial(53;0.00532)|Lung(62;0.0606)		AATCAGTAGGACCCCAGAGTAT	0.391													4	2	---	---	---	---	
PCDH15	65217	broad.mit.edu	37	10	55944650	55944650	+	Intron	DEL	T	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:55944650delT	uc001jju.1	-						PCDH15_uc010qhq.1_Intron|PCDH15_uc010qhr.1_Intron|PCDH15_uc010qhs.1_Intron|PCDH15_uc010qht.1_Intron|PCDH15_uc010qhu.1_Intron|PCDH15_uc001jjv.1_Intron|PCDH15_uc010qhv.1_Intron|PCDH15_uc010qhw.1_Intron|PCDH15_uc010qhx.1_Intron|PCDH15_uc010qhy.1_Intron|PCDH15_uc010qhz.1_Intron|PCDH15_uc010qia.1_Intron|PCDH15_uc010qib.1_Intron|PCDH15_uc001jjw.2_Intron	NM_033056	NP_149045	Q96QU1	PCD15_HUMAN	protocadherin 15 isoform CD1-4 precursor						equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding			pancreas(5)|ovary(4)|upper_aerodigestive_tract(2)|skin(2)	13		Melanoma(3;0.117)|Lung SC(717;0.238)				TCTCACTTTCTTTTTTTTTTG	0.249										HNSCC(58;0.16)			5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	59939188	59939189	+	IGR	DEL	AC	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:59939188_59939189delAC								None (None upstream) : IPMK (16429 downstream)																							tacagaacagacacacacacac	0.000													4	2	---	---	---	---	
IPMK	253430	broad.mit.edu	37	10	59958752	59958752	+	Intron	DEL	T	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:59958752delT	uc001jkb.2	-							NM_152230	NP_689416	Q8NFU5	IPMK_HUMAN	inositol polyphosphate multikinase							nucleus	ATP binding|inositol trisphosphate 6-kinase activity			ovary(1)	1						CAGCTGTTCATTTTTTTTTTA	0.299													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	71540330	71540330	+	IGR	DEL	C	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:71540330delC								C10orf35 (146983 upstream) : COL13A1 (21314 downstream)																							aaactggctaccacaGAGCCC	0.030													4	2	---	---	---	---	
C10orf27	219793	broad.mit.edu	37	10	72537261	72537261	+	Intron	DEL	C	-	-	rs66827681		TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:72537261delC	uc001jrj.1	-						C10orf27_uc010qjm.1_Intron|C10orf27_uc009xqh.1_Intron|C10orf27_uc010qjn.1_Intron|C10orf27_uc009xqi.1_Intron|C10orf27_uc010qjo.1_Intron	NM_152710	NP_689923	Q96M53	SPATL_HUMAN	stromal protein associated with thymii and lymph						cell differentiation|multicellular organismal development|spermatogenesis	cytosol				skin(1)	1						AGCTCTGCCACCCCCCCAACC	0.622													3	10	---	---	---	---	
LOC283050	283050	broad.mit.edu	37	10	80813450	80813451	+	Intron	DEL	GT	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:80813450_80813451delGT	uc001jzz.2	-						LOC283050_uc001jzx.2_Intron|LOC283050_uc001jzy.2_Intron|LOC283050_uc001kab.1_Intron	NR_024431				Homo sapiens cDNA FLJ40604 fis, clone THYMU2011806.												0						gtgtgcatgcgtgtgtgtggta	0.450													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	86761904	86761904	+	IGR	DEL	T	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:86761904delT								FAM190B (483628 upstream) : GRID1 (597408 downstream)																							CCACATCTGATTTTTTTTTTG	0.398													4	3	---	---	---	---	
GRID1	2894	broad.mit.edu	37	10	87996400	87996401	+	Intron	DEL	CA	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:87996400_87996401delCA	uc001kdl.1	-						GRID1_uc009xsu.1_Intron	NM_017551	NP_060021	Q9ULK0	GRID1_HUMAN	glutamate receptor, ionotropic, delta 1							cell junction|integral to membrane|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|ionotropic glutamate receptor activity			ovary(5)|upper_aerodigestive_tract(2)|large_intestine(2)|central_nervous_system(1)	10					L-Glutamic Acid(DB00142)	CTCCAGTCTTCACACAGCAAAG	0.545										Multiple Myeloma(13;0.14)			4	2	---	---	---	---	
SEC31B	25956	broad.mit.edu	37	10	102275671	102275672	+	Intron	INS	-	G	G	rs143845466	by1000genomes	TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:102275671_102275672insG	uc001krc.1	-						SEC31B_uc010qpo.1_Intron|SEC31B_uc001krd.1_Intron|SEC31B_uc001krf.1_Intron|SEC31B_uc001kre.1_Intron|SEC31B_uc010qpp.1_Intron|SEC31B_uc009xwn.1_Intron|SEC31B_uc009xwo.1_Intron|SEC31B_uc010qpq.1_Intron|SEC31B_uc010qpr.1_Intron	NM_015490	NP_056305	Q9NQW1	SC31B_HUMAN	SEC31 homolog B						protein transport|vesicle-mediated transport	endoplasmic reticulum membrane|ER to Golgi transport vesicle membrane				ovary(1)	1		Colorectal(252;0.117)		Epithelial(162;2.36e-10)|all cancers(201;2.09e-08)		CTGACTGGAAAGGGGGGGGGTG	0.480													6	8	---	---	---	---	
NT5C2	22978	broad.mit.edu	37	10	104851107	104851107	+	Intron	DEL	T	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:104851107delT	uc001kwo.2	-						NT5C2_uc010qqp.1_Intron|NT5C2_uc001kwq.2_Intron|NT5C2_uc001kwp.2_Intron	NM_012229	NP_036361	P49902	5NTC_HUMAN	5'-nucleotidase, cytosolic II						purine base metabolic process|purine nucleotide catabolic process	cytosol	5'-nucleotidase activity|metal ion binding|nucleotide binding|protein binding				0		all_hematologic(284;0.176)|Colorectal(252;0.178)		Epithelial(162;1.33e-08)|all cancers(201;1.04e-07)|BRCA - Breast invasive adenocarcinoma(275;0.159)	Adenosine triphosphate(DB00171)|Ribavirin(DB00811)	TGGAAAGAACttttttttttt	0.020													11	6	---	---	---	---	
INPP5A	3632	broad.mit.edu	37	10	134405275	134405295	+	Intron	DEL	GGAGCTCAGATCTCCTTTCCC	-	-	rs112603932		TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134405275_134405295delGGAGCTCAGATCTCCTTTCCC	uc001llp.2	+						INPP5A_uc001llo.1_Intron	NM_005539	NP_005530	Q14642	I5P1_HUMAN	inositol polyphosphate-5-phosphatase A						cell communication	membrane	inositol 1,3,4,5-tetrakisphosphate 5-phosphatase activity|inositol-1,4,5-trisphosphate 5-phosphatase activity|inositol-polyphosphate 5-phosphatase activity|PH domain binding			skin(1)	1		all_cancers(35;8.59e-13)|all_epithelial(44;5.49e-09)|Lung NSC(174;0.000854)|all_lung(145;0.00146)|all_neural(114;0.0299)|Colorectal(31;0.0599)|Breast(234;0.0849)|Melanoma(40;0.124)|all_hematologic(284;0.196)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;0.000102)|Epithelial(32;0.00023)|all cancers(32;0.000326)		GCAGGTGCAGGGAGCTCAGATCTCCTTTCCCGGAGCTGCGC	0.575													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	1116343	1116352	+	IGR	DEL	GGTCCTGACC	-	-	rs113394692		TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1116343_1116352delGGTCCTGACC								MUC2 (11926 upstream) : MUC5B (26122 downstream)																							GCCAGGCTGTGGTCCTGACCGCCCCAGGGA	0.605													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	4231312	4231312	+	IGR	DEL	A	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:4231312delA								RRM1 (7553 upstream) : OR52B4 (157271 downstream)																							TCTTCAATAGAAAAAAAAAGG	0.313													5	3	---	---	---	---	
FAR1	84188	broad.mit.edu	37	11	13695105	13695106	+	Intron	INS	-	A	A			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:13695105_13695106insA	uc001mld.2	+						FAR1_uc009ygp.2_Intron	NM_032228	NP_115604	Q8WVX9	FACR1_HUMAN	fatty acyl CoA reductase 1						ether lipid biosynthetic process	integral to membrane|peroxisomal matrix|peroxisomal membrane	protein binding			ovary(1)|skin(1)	2						ACCTTCAACTGAAAAAAAATGC	0.277													4	2	---	---	---	---	
PSMA1	5682	broad.mit.edu	37	11	14531771	14531771	+	Intron	DEL	T	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:14531771delT	uc001mlk.2	-						PSMA1_uc001mll.2_Intron|PSMA1_uc010rcp.1_Intron|PSMA1_uc001mlj.2_Intron	NM_002786	NP_002777	P25786	PSA1_HUMAN	proteasome alpha 1 subunit isoform 2						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	cytoplasm|nucleus|polysome|proteasome core complex, alpha-subunit complex	protein binding|RNA binding|threonine-type endopeptidase activity			upper_aerodigestive_tract(1)|skin(1)	2						actggcctccttgccttaaat	0.000													4	2	---	---	---	---	
NAV2	89797	broad.mit.edu	37	11	19371632	19371633	+	5'Flank	INS	-	TGATGATGA	TGATGATGA	rs148713324	by1000genomes	TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:19371632_19371633insTGATGATGA	uc001mpp.2	+							NM_001111018	NP_001104488	Q8IVL1	NAV2_HUMAN	neuron navigator 2 isoform 3							nucleus	ATP binding|helicase activity			skin(4)|ovary(1)|pancreas(1)	6						CCTTATTCCTCtgatgatgatg	0.376													3	3	---	---	---	---	
NAV2	89797	broad.mit.edu	37	11	19401996	19401996	+	Intron	DEL	G	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:19401996delG	uc001mpp.2	+							NM_001111018	NP_001104488	Q8IVL1	NAV2_HUMAN	neuron navigator 2 isoform 3							nucleus	ATP binding|helicase activity			skin(4)|ovary(1)|pancreas(1)	6						GGGCTGCTCAGGAAGTGGAGT	0.502													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	44002646	44002647	+	IGR	INS	-	AAAC	AAAC	rs142235852	by1000genomes	TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:44002646_44002647insAAAC								AG2 (37214 upstream) : ACCSL (66884 downstream)																							atggggcaggaaaacaaacaaa	0.000													3	3	---	---	---	---	
CHST1	8534	broad.mit.edu	37	11	45671655	45671655	+	Frame_Shift_Del	DEL	G	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:45671655delG	uc001mys.1	-	4	1490	c.819delC	c.(817-819)ACCfs	p.T273fs		NM_003654	NP_003645	O43916	CHST1_HUMAN	carbohydrate (keratan sulfate Gal-6)	273	Lumenal (Potential).				galactose metabolic process|inflammatory response|keratan sulfate metabolic process	Golgi membrane|integral to membrane	keratan sulfotransferase activity			skin(4)|pancreas(1)	5				GBM - Glioblastoma multiforme(35;3e-06)|BRCA - Breast invasive adenocarcinoma(625;0.0781)		CGCACACCGTGGTCAGCTGCG	0.652													22	16	---	---	---	---	
MS4A3	932	broad.mit.edu	37	11	59833170	59833170	+	Intron	DEL	C	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:59833170delC	uc001nom.2	+						MS4A3_uc001non.2_Intron|MS4A3_uc001noo.2_Intron	NM_006138	NP_006129	Q96HJ5	MS4A3_HUMAN	membrane-spanning 4-domains, subfamily A, member							endomembrane system|integral to membrane|perinuclear region of cytoplasm	protein binding|receptor activity			ovary(2)|skin(1)	3		all_epithelial(135;0.245)				tagttagtcgcccactcctcc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	63389798	63389802	+	IGR	DEL	TTTGT	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:63389798_63389802delTTTGT								PLA2G16 (7857 upstream) : ATL3 (6635 downstream)																							TAATGGATTATTTGTTTTGGTCTGC	0.429													2	6	---	---	---	---	
MACROD1	28992	broad.mit.edu	37	11	63871058	63871058	+	Intron	DEL	A	-	-	rs67084423		TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:63871058delA	uc001nyh.2	-						FLRT1_uc001nyi.1_5'Flank	NM_014067	NP_054786	Q9BQ69	MACD1_HUMAN	MACRO domain containing 1												0						TAAAGGAATTAAAAAAAAAAA	0.488													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	64748479	64748479	+	IGR	DEL	T	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64748479delT								C11orf85 (8922 upstream) : BATF2 (6938 downstream)																							TTTCTGTCAGTttttaagttt	0.020													4	2	---	---	---	---	
CLNS1A	1207	broad.mit.edu	37	11	77348740	77348742	+	In_Frame_Del	DEL	AAA	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:77348740_77348742delAAA	uc001oyk.2	-	1	110_112	c.18_20delTTT	c.(16-21)AGTTTC>AGC	p.F7del	CLNS1A_uc001oyl.2_In_Frame_Del_p.F7del	NM_001293	NP_001284	P54105	ICLN_HUMAN	chloride channel, nucleotide-sensitive, 1A	7					blood circulation|cell volume homeostasis|chloride transport|ncRNA metabolic process|spliceosomal snRNP assembly	cytoskeleton|cytosol|nucleus|plasma membrane	protein binding			ovary(1)	1	all_cancers(14;5.43e-17)|all_epithelial(13;1.78e-19)		Epithelial(5;1.02e-48)|BRCA - Breast invasive adenocarcinoma(5;1.4e-30)			AGGCGGCGGGAAACTTTTGAGGA	0.640													26	12	---	---	---	---	
MAML2	84441	broad.mit.edu	37	11	95980376	95980376	+	Intron	DEL	A	-	-	rs75115900		TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:95980376delA	uc001pfw.1	-							NM_032427	NP_115803	Q8IZL2	MAML2_HUMAN	mastermind-like 2						Notch signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nuclear speck	transcription coactivator activity		CRTC1/MAML2(516)|CRTC3/MAML2(26)	salivary_gland(500)|lung(36)|thyroid(4)|breast(3)|skin(2)|ovary(1)	546		Acute lymphoblastic leukemia(157;2.63e-05)|all_hematologic(158;0.00837)				CAGACCATGCAAAAAAAAAAT	0.378			T	MECT1|CRTC3	salivary gland mucoepidermoid								11	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	118560953	118560954	+	IGR	INS	-	C	C	rs140077459	by1000genomes	TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118560953_118560954insC								TREH (10572 upstream) : DDX6 (57519 downstream)																							GCTCACAGCTGCCCCCCGGTGG	0.718											OREG0010969|OREG0021386	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)|type=TRANSCRIPTION FACTOR BINDING SITE|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip); Conservation found by scanning with a motif model	7	7	---	---	---	---	
DDX6	1656	broad.mit.edu	37	11	118635936	118635937	+	Frame_Shift_Ins	INS	-	A	A			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118635936_118635937insA	uc001pub.2	-	6	987_988	c.626_627insT	c.(625-627)ATAfs	p.I209fs	DDX6_uc001puc.2_Frame_Shift_Ins_p.I209fs	NM_004397	NP_004388	P26196	DDX6_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 6	209	Helicase ATP-binding.				exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay	cytoplasmic mRNA processing body|cytosol|RNA-induced silencing complex|stress granule	ATP binding|ATP-dependent helicase activity|protein binding|RNA binding|RNA helicase activity			ovary(1)	1	all_hematologic(175;0.0839)	Renal(330;0.0183)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)|Hepatocellular(160;0.0893)|Breast(348;0.0979)|all_hematologic(192;0.103)		OV - Ovarian serous cystadenocarcinoma(223;3.39e-06)|BRCA - Breast invasive adenocarcinoma(274;3.4e-05)|Colorectal(284;0.0377)		CAAGCCTCATTATGTCATCTCG	0.381			T	IGH@	B-NHL								456	231	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	124209275	124209275	+	IGR	DEL	A	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124209275delA								OR8D2 (19182 upstream) : OR8B2 (43024 downstream)																							CAGAAATACCAAAAAAAAATA	0.393													4	2	---	---	---	---	
ST14	6768	broad.mit.edu	37	11	130036565	130036565	+	Intron	DEL	G	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:130036565delG	uc001qfw.2	+							NM_021978	NP_068813	Q9Y5Y6	ST14_HUMAN	matriptase						proteolysis	integral to plasma membrane	serine-type endopeptidase activity			ovary(2)|skin(2)|central_nervous_system(1)	5	all_hematologic(175;0.0429)	Lung NSC(97;0.000602)|Breast(109;0.000962)|all_lung(97;0.00126)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0183)|Lung(977;0.228)	Urokinase(DB00013)	GCATCCGTCTGGGTCAGGAGT	0.373													4	2	---	---	---	---	
NTM	50863	broad.mit.edu	37	11	131354631	131354631	+	Intron	DEL	T	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:131354631delT	uc010sci.1	+						NTM_uc001qgm.2_Intron|NTM_uc010sch.1_Intron	NM_001144058	NP_001137530	Q9P121	NTRI_HUMAN	neurotrimin isoform 3						cell adhesion|neuron recognition	anchored to membrane|plasma membrane				ovary(4)|central_nervous_system(1)|skin(1)	6						CCTAAAGACATTTTTTTGCAT	0.498													4	2	---	---	---	---	
NTF3	4908	broad.mit.edu	37	12	5543639	5543640	+	Intron	DEL	GT	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:5543639_5543640delGT	uc001qnk.3	+							NM_001102654	NP_001096124	P20783	NTF3_HUMAN	neurotrophin 3 isoform 1 preproprotein						signal transduction	extracellular region	growth factor activity|neurotrophin receptor binding			pancreas(1)	1						TTTTTCCAAAgtgtgtgtgtgt	0.416													5	3	---	---	---	---	
ANO2	57101	broad.mit.edu	37	12	5697272	5697273	+	Intron	INS	-	A	A	rs149059188	by1000genomes	TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:5697272_5697273insA	uc001qnm.2	-							NM_020373	NP_065106	Q9NQ90	ANO2_HUMAN	anoctamin 2							chloride channel complex|plasma membrane	intracellular calcium activated chloride channel activity			ovary(4)|large_intestine(2)|central_nervous_system(1)	7						CACCAGAGGCGGGGGGCAGCTT	0.579													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	24914190	24914190	+	IGR	DEL	A	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:24914190delA								SOX5 (198810 upstream) : BCAT1 (50091 downstream)																							CTTTTGAAGGAAAAAAAAAAT	0.393													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	25885416	25885417	+	IGR	INS	-	TA	TA	rs141856274	by1000genomes	TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:25885416_25885417insTA								IFLTD1 (83928 upstream) : RASSF8 (226552 downstream)																							ctgttgttaagtatatatatat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	53734256	53734257	+	IGR	DEL	CA	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53734256_53734257delCA								SP7 (4090 upstream) : SP1 (39722 downstream)																							TCCAATACTCCACACACACACC	0.559													4	2	---	---	---	---	
PPM1H	57460	broad.mit.edu	37	12	63123409	63123409	+	Intron	DEL	C	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:63123409delC	uc001srk.3	-							NM_020700	NP_065751	Q9ULR3	PPM1H_HUMAN	protein phosphatase 1H (PP2C domain containing)								phosphoprotein phosphatase activity			lung(3)|ovary(1)	4			GBM - Glioblastoma multiforme(1;0.000443)|BRCA - Breast invasive adenocarcinoma(9;0.209)	GBM - Glioblastoma multiforme(28;0.0126)		atcatcagcaccccatccaat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	63392284	63392284	+	IGR	DEL	A	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:63392284delA								PPM1H (63369 upstream) : AVPR1A (147932 downstream)																							tgaagcagataaactatccac	0.000													4	2	---	---	---	---	
LEMD3	23592	broad.mit.edu	37	12	65612527	65612528	+	Intron	INS	-	A	A			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:65612527_65612528insA	uc001ssl.1	+						LEMD3_uc009zqo.1_Intron	NM_014319	NP_055134	Q9Y2U8	MAN1_HUMAN	LEM domain containing 3						negative regulation of activin receptor signaling pathway|negative regulation of BMP signaling pathway|negative regulation of transforming growth factor beta receptor signaling pathway	integral to nuclear inner membrane|membrane fraction	DNA binding|nucleotide binding|protein binding			central_nervous_system(3)|ovary(1)	4			LUAD - Lung adenocarcinoma(6;0.0234)|LUSC - Lung squamous cell carcinoma(43;0.0975)	GBM - Glioblastoma multiforme(28;0.0104)		CTGTTTGGTATAATATGAGCAG	0.149													14	9	---	---	---	---	
TBC1D15	64786	broad.mit.edu	37	12	72317051	72317051	+	3'UTR	DEL	A	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:72317051delA	uc001swu.2	+	18					TBC1D15_uc010stt.1_3'UTR|TBC1D15_uc001swv.2_3'UTR|TBC1D15_uc001sww.2_3'UTR	NM_022771	NP_073608	Q8TC07	TBC15_HUMAN	TBC1 domain family, member 15 isoform 1								protein binding|Rab GTPase activator activity				0						TTGAAAGTTGAAAATTTGAAA	0.323													70	39	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	94951818	94951819	+	IGR	INS	-	T	T	rs140831980	by1000genomes	TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:94951818_94951819insT								LOC144486 (95476 upstream) : TMCC3 (9081 downstream)																							GAGGTGTGCTCTTTTTTTAGCC	0.441													5	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	97850736	97850736	+	IGR	DEL	A	-	-	rs77620257		TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:97850736delA								NEDD1 (503275 upstream) : RMST (8063 downstream)																							GTGACTATTCAACAGGAGGAA	0.438													4	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	98352829	98352829	+	IGR	DEL	A	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:98352829delA								RMST (394036 upstream) : LOC100128191 (553924 downstream)																							atccaaaaggaaggcagggtg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	98649026	98649027	+	IGR	INS	-	T	T	rs142254113	by1000genomes	TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:98649026_98649027insT								RMST (690233 upstream) : LOC100128191 (257726 downstream)																							ttttaccattgtttttttttct	0.119													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	98895746	98895749	+	Intron	DEL	GTCA	-	-	rs145047283		TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:98895746_98895749delGTCA	uc001tff.1	-											Homo sapiens cDNA FLJ44867 fis, clone BRALZ2017607.																		ttgggtaggggtcagtgagttggg	0.069													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	102774615	102774615	+	IGR	DEL	T	-	-	rs5800506		TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:102774615delT								PMCH (183001 upstream) : IGF1 (15030 downstream)																							TGTATACATATTTGTTCTTAG	0.408													5	3	---	---	---	---	
C12orf75	387882	broad.mit.edu	37	12	105748484	105748484	+	Intron	DEL	T	-	-	rs66504975		TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:105748484delT	uc001tlh.3	+						C12orf75_uc001tli.3_Intron	NM_001145199	NP_001138671	Q8TAD7	OCC1_HUMAN	hypothetical protein LOC387882												0						TTCCCATTGGTAGCCATGATG	0.463													3	4	---	---	---	---	
WSCD2	9671	broad.mit.edu	37	12	108602273	108602274	+	Intron	DEL	CA	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:108602273_108602274delCA	uc001tms.2	+						WSCD2_uc001tmt.2_Intron	NM_014653	NP_055468	Q2TBF2	WSCD2_HUMAN	WSC domain containing 2							integral to membrane				ovary(1)|large_intestine(1)|breast(1)	3						gaagagttatcacagtgagacc	0.000													4	2	---	---	---	---	
TCTN1	79600	broad.mit.edu	37	12	111084202	111084202	+	Intron	DEL	T	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:111084202delT	uc009zvs.2	+						TCTN1_uc001trp.3_Intron|TCTN1_uc001trn.3_Intron|TCTN1_uc001trk.3_Intron|HVCN1_uc001trq.1_Intron	NM_001082537	NP_001076006	Q2MV58	TECT1_HUMAN	tectonic family member 1 isoform 2						multicellular organismal development	extracellular region					0						ATTTTAAAGCttttttttttt	0.214													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	117566060	117566061	+	IGR	DEL	AT	-	-	rs34526222		TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:117566060_117566061delAT								TESC (28809 upstream) : FBXO21 (15525 downstream)																							gtcacatcacatgtcactgtca	0.000													2	4	---	---	---	---	
SRRM4	84530	broad.mit.edu	37	12	119591845	119591845	+	Intron	DEL	C	-	-	rs67529586		TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:119591845delC	uc001txa.1	+							NM_194286	NP_919262	A7MD48	SRRM4_HUMAN	KIAA1853 protein						cell differentiation|mRNA processing|nervous system development|regulation of RNA splicing|RNA splicing	nucleus	mRNA binding			ovary(2)	2						ACAAGCCCAGCCCCCACCCCT	0.637													4	4	---	---	---	---	
WDR66	144406	broad.mit.edu	37	12	122385328	122385329	+	Intron	INS	-	C	C			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122385328_122385329insC	uc009zxk.2	+							NM_144668	NP_653269	Q8TBY9	WDR66_HUMAN	WD repeat domain 66								calcium ion binding			ovary(1)|skin(1)	2	all_neural(191;0.0496)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;0.000155)|Epithelial(86;0.000634)|BRCA - Breast invasive adenocarcinoma(302;0.248)		gattgctttttccccttggttt	0.025													4	2	---	---	---	---	
TMEM132B	114795	broad.mit.edu	37	12	125902141	125902141	+	Intron	DEL	T	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:125902141delT	uc001uhe.1	+							NM_052907	NP_443139	Q14DG7	T132B_HUMAN	transmembrane protein 132B							integral to membrane				skin(11)|ovary(5)|large_intestine(1)|pancreas(1)|breast(1)	19	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000423)|Epithelial(86;0.00394)|all cancers(50;0.0362)		ATCAGGTGGGTTTGTGTCCCT	0.303													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	130479730	130479731	+	IGR	INS	-	TGT	TGT	rs142830430	by1000genomes	TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:130479730_130479731insTGT								TMEM132D (91518 upstream) : LOC100190940 (38268 downstream)																							tgtggccaccctgttgttgttg	0.099													3	6	---	---	---	---	
SFRS8	6433	broad.mit.edu	37	12	132240612	132240612	+	Intron	DEL	C	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:132240612delC	uc001uja.1	+						SFRS8_uc010tbn.1_Intron|SFRS8_uc001ujb.1_Intron	NM_004592	NP_004583	Q12872	SFSWA_HUMAN	splicing factor, arginine/serine-rich 8						mRNA splice site selection|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein binding|RNA binding				0	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;3.44e-07)|Epithelial(86;2.94e-06)|all cancers(50;4.82e-05)		GAGGAGATGACATGGGCCTTA	0.448													4	2	---	---	---	---	
ZDHHC20	253832	broad.mit.edu	37	13	21951540	21951541	+	Intron	DEL	CT	-	-	rs5802108		TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:21951540_21951541delCT	uc001uob.2	-						ZDHHC20_uc001uod.2_Intron|ZDHHC20_uc001uoc.2_Intron|ZDHHC20_uc001uoe.2_Intron|ZDHHC20_uc010tcs.1_Intron|uc001uoa.1_5'Flank	NM_153251	NP_694983	Q5W0Z9	ZDH20_HUMAN	zinc finger, DHHC-type containing 20							integral to membrane	acyltransferase activity|zinc ion binding			ovary(1)	1		all_cancers(29;8.1e-16)|all_epithelial(30;3.63e-14)|all_lung(29;2.04e-13)|Lung SC(185;0.0367)		all cancers(112;0.000268)|Epithelial(112;0.000735)|OV - Ovarian serous cystadenocarcinoma(117;0.00517)|Lung(94;0.171)		TGTGATCTGACTCTGCCCGACG	0.629													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	23269986	23269986	+	IGR	DEL	T	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:23269986delT								FGF9 (991346 upstream) : SGCG (485074 downstream)																							ATTTCTCTGCTTTTTTTTTGG	0.328													6	3	---	---	---	---	
ATP8A2	51761	broad.mit.edu	37	13	26401225	26401225	+	Intron	DEL	T	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:26401225delT	uc001uqk.2	+						ATP8A2_uc010tdi.1_Intron|ATP8A2_uc010tdj.1_Intron|ATP8A2_uc010aaj.1_Intron	NM_016529	NP_057613	Q9NTI2	AT8A2_HUMAN	ATPase, aminophospholipid transporter-like,						ATP biosynthetic process|negative regulation of cell proliferation	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(2)|large_intestine(1)|skin(1)	4		Breast(139;0.0201)|Lung SC(185;0.0225)		all cancers(112;0.043)|OV - Ovarian serous cystadenocarcinoma(117;0.0748)|Epithelial(112;0.079)		GTGTTTTTTGTTTTTTTTGtt	0.259													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	79745618	79745619	+	IGR	DEL	GT	-	-	rs72236282		TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:79745618_79745619delGT								RNF219 (510918 upstream) : RBM26 (148481 downstream)																							gatagaGAAAGTGTGTGGGAGT	0.188													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	86249695	86249695	+	IGR	DEL	T	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:86249695delT								None (None upstream) : SLITRK6 (117227 downstream)																							cgccaaaaaatacagtttcca	0.000													4	2	---	---	---	---	
DCT	1638	broad.mit.edu	37	13	95117700	95117701	+	Intron	INS	-	T	T	rs146133280	by1000genomes	TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:95117700_95117701insT	uc001vlv.3	-						DCT_uc010afh.2_Intron	NM_001922	NP_001913	P40126	TYRP2_HUMAN	dopachrome tautomerase isoform 1						epidermis development|melanin biosynthetic process from tyrosine	cytosol|integral to membrane|melanosome membrane|microsome	copper ion binding|dopachrome isomerase activity|oxidoreductase activity			ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	5	all_neural(89;0.0684)|Medulloblastoma(90;0.163)	all_cancers(2;3.71e-42)|all_epithelial(2;3.76e-31)|all_lung(2;5.16e-14)|Lung NSC(4;1.33e-13)|Breast(118;0.0013)|Hepatocellular(115;0.00886)|Renal(2;0.00988)		COAD - Colon adenocarcinoma(199;7.07e-05)|GBM - Glioblastoma multiforme(99;0.000472)		TGATTTTGATATTTTTTTTTTA	0.252													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	107092135	107092136	+	IGR	DEL	TG	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:107092135_107092136delTG								DAOA (948753 upstream) : EFNB2 (49962 downstream)																							tgtgtgtgcatgtgtgtgtgtA	0.351													4	2	---	---	---	---	
RAB20	55647	broad.mit.edu	37	13	111179884	111179884	+	Intron	DEL	C	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:111179884delC	uc001vqy.2	-							NM_017817	NP_060287	Q9NX57	RAB20_HUMAN	RAB20, member RAS oncogene family						protein transport|small GTPase mediated signal transduction	Golgi apparatus	GTP binding				0	all_cancers(4;1.54e-11)|all_epithelial(4;1.22e-06)|all_lung(23;1e-05)|Lung NSC(43;0.000453)|Colorectal(4;0.00323)|Lung SC(71;0.0753)|all_neural(89;0.077)|Medulloblastoma(90;0.148)		BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.197)			CTGGGAAAAGCCAGCCTGGGA	0.582													4	2	---	---	---	---	
RASA3	22821	broad.mit.edu	37	13	114767971	114767972	+	Intron	INS	-	G	G			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:114767971_114767972insG	uc001vui.2	-						RASA3_uc010tkk.1_Intron|RASA3_uc001vuj.2_Intron	NM_007368	NP_031394	Q14644	RASA3_HUMAN	RAS p21 protein activator 3						intracellular signal transduction|negative regulation of Ras protein signal transduction	cytoplasm|intrinsic to internal side of plasma membrane	calcium-release channel activity|metal ion binding|Ras GTPase activator activity			lung(3)|skin(1)	4	Lung NSC(43;0.00814)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.016)|all_epithelial(44;0.00577)|all_lung(25;0.0173)|Lung NSC(25;0.0634)|Breast(118;0.188)	BRCA - Breast invasive adenocarcinoma(86;0.128)			AGACGGGGGTTGGGGGGGGACT	0.619													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	21451939	21451939	+	IGR	DEL	A	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21451939delA								RNASE2 (27345 upstream) : METT11D1 (6026 downstream)																							cggtctgctgaaacacctcca	0.040													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	36663730	36663730	+	IGR	DEL	T	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:36663730delT								BRMS1L (322562 upstream) : MBIP (104034 downstream)																							CGCTAGACCATTTTTTTTAAA	0.353													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	44010305	44010305	+	IGR	DEL	T	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:44010305delT								None (None upstream) : FSCB (963050 downstream)																							GATACTCCTGTTCTGCAATCC	0.597													4	2	---	---	---	---	
PRPF39	55015	broad.mit.edu	37	14	45577336	45577336	+	Intron	DEL	C	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:45577336delC	uc001wvz.3	+						PRPF39_uc001wvy.3_Intron|PRPF39_uc010and.2_Intron|PRPF39_uc001wwa.1_5'Flank|SNORD127_uc010ane.2_5'Flank	NM_017922	NP_060392	Q86UA1	PRP39_HUMAN	PRP39 pre-mRNA processing factor 39 homolog						mRNA processing|RNA splicing	nucleus	binding			ovary(1)|breast(1)	2						CTACAAGACACCCCAAAAAAA	0.318													4	2	---	---	---	---	
MDGA2	161357	broad.mit.edu	37	14	47456721	47456721	+	Intron	DEL	G	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:47456721delG	uc001wwj.3	-						MDGA2_uc001wwi.3_Intron|MDGA2_uc010ani.2_Intron	NM_001113498	NP_001106970	Q7Z553	MDGA2_HUMAN	MAM domain containing 1 isoform 1						spinal cord motor neuron differentiation	anchored to membrane|plasma membrane				ovary(4)|large_intestine(1)|pancreas(1)	6						GAGTTTTTCTGAAGTCAGATG	0.418													4	2	---	---	---	---	
SAMD4A	23034	broad.mit.edu	37	14	55178579	55178579	+	Intron	DEL	A	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:55178579delA	uc001xbb.2	+						SAMD4A_uc001xbc.2_Intron|SAMD4A_uc001xbf.1_Intron	NM_015589	NP_056404	Q9UPU9	SMAG1_HUMAN	sterile alpha motif domain containing 4 isoform						positive regulation of translation	cell junction|cytoplasm|dendrite|synapse|synaptosome	translation repressor activity				0						CTGCTACGGGAAAAAAACCTC	0.473													5	3	---	---	---	---	
DAAM1	23002	broad.mit.edu	37	14	59662603	59662603	+	Intron	DEL	T	-	-	rs34193768		TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:59662603delT	uc001xdz.1	+						DAAM1_uc001xea.1_Intron|DAAM1_uc001xeb.1_Intron|DAAM1_uc001xdy.2_Intron	NM_014992	NP_055807	Q9Y4D1	DAAM1_HUMAN	dishevelled-associated activator of						actin cytoskeleton organization	cytoplasm|plasma membrane	actin binding|Rho GTPase binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(108;0.165)		TTTCTGTATCTTTTTTTTTTT	0.189													3	3	---	---	---	---	
C14orf135	64430	broad.mit.edu	37	14	60588303	60588303	+	Intron	DEL	T	-	-	rs111393873		TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:60588303delT	uc001xer.3	+						C14orf135_uc001xeq.2_Intron|C14orf135_uc010apm.2_Intron	NM_022495	NP_071940	Q63HM2	CN135_HUMAN	hepatitis C virus F protein-binding protein 2							integral to membrane				ovary(2)	2		Myeloproliferative disorder(585;0.163)		OV - Ovarian serous cystadenocarcinoma(108;0.127)		GAATCAGTAATTTTTTTTTAA	0.224													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	62157877	62157877	+	IGR	DEL	T	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:62157877delT								PRKCH (140182 upstream) : HIF1A (4242 downstream)																							agtcctatgattagggctcaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	66543439	66543440	+	IGR	INS	-	C	C	rs144686144	by1000genomes	TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:66543439_66543440insC								FUT8 (333478 upstream) : C14orf53 (409669 downstream)																							GCCCTCCTGCACCCTGTTTAGC	0.490													3	4	---	---	---	---	
SFRS5	6430	broad.mit.edu	37	14	70219815	70219815	+	Intron	DEL	T	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:70219815delT	uc001xll.2	+							NM_006925	NP_008856	Q13243	SRSF5_HUMAN	splicing factor, arginine/serine-rich 5						mRNA 3'-end processing|mRNA export from nucleus|mRNA splice site selection|termination of RNA polymerase II transcription	nuclear speck	nucleotide binding|protein binding|RNA binding				0				all cancers(60;0.00144)|BRCA - Breast invasive adenocarcinoma(234;0.0132)|OV - Ovarian serous cystadenocarcinoma(108;0.0154)		GCTTTTTCCCTTTAGAGAGAA	0.413													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	76990851	76990852	+	IGR	INS	-	A	A			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:76990851_76990852insA								ESRRB (22673 upstream) : VASH1 (237383 downstream)																							tttaTAATTAGAAAAAAAgtgt	0.099													4	2	---	---	---	---	
C14orf166B	145497	broad.mit.edu	37	14	77318963	77318964	+	Intron	DEL	TT	-	-	rs144622635		TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:77318963_77318964delTT	uc001xsx.2	+						C14orf166B_uc010asn.1_Intron|C14orf166B_uc001xsw.2_Intron|C14orf166B_uc010tvg.1_Intron|C14orf166B_uc010tvh.1_Intron	NM_194287	NP_919263	Q0VAA2	CN16B_HUMAN	hypothetical protein LOC145497												0			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0306)		CTGGATGCACtttttttttttt	0.228													5	3	---	---	---	---	
FOXN3	1112	broad.mit.edu	37	14	89647297	89647298	+	Intron	INS	-	AC	AC	rs148989169	by1000genomes	TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:89647297_89647298insAC	uc001xxo.3	-						FOXN3_uc001xxn.3_Intron|FOXN3_uc010atk.2_Intron	NM_001085471	NP_001078940	O00409	FOXN3_HUMAN	checkpoint suppressor 1 isoform 1						DNA damage checkpoint|embryo development|G2 phase of mitotic cell cycle|negative regulation of transcription, DNA-dependent|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|protein C-terminus binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			skin(2)|ovary(1)	3						cacgtgcacatacacacacaca	0.079													3	3	---	---	---	---	
SLC24A4	123041	broad.mit.edu	37	14	92915666	92915666	+	Intron	DEL	A	-	-	rs75047154	by1000genomes	TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92915666delA	uc001yak.2	+						SLC24A4_uc001yai.2_Intron|SLC24A4_uc010twm.1_Intron|SLC24A4_uc001yaj.2_Intron|SLC24A4_uc010auj.2_Intron|SLC24A4_uc010twn.1_Intron|uc001yal.1_5'Flank|uc001yam.1_RNA	NM_153646	NP_705932	Q8NFF2	NCKX4_HUMAN	solute carrier family 24 member 4 isoform 1							integral to membrane|plasma membrane	calcium, potassium:sodium antiporter activity|symporter activity			breast(2)|ovary(1)	3		all_cancers(154;0.0347)|all_epithelial(191;0.163)		Colorectal(1;0.00242)|COAD - Colon adenocarcinoma(157;0.047)|Epithelial(152;0.0781)|READ - Rectum adenocarcinoma(1;0.176)|all cancers(159;0.182)		acacacacacacCCTCTCACA	0.413													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	98299782	98299782	+	IGR	DEL	A	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:98299782delA								VRK1 (951832 upstream) : C14orf64 (92165 downstream)																							ACTTGATATTAATCCATCCCT	0.473													4	2	---	---	---	---	
OR4N4	283694	broad.mit.edu	37	15	22333592	22333594	+	Intron	DEL	ATG	-	-	rs111877525		TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22333592_22333594delATG	uc001yuc.1	+						LOC727924_uc001ytz.1_Intron|LOC727924_uc001yua.2_Intron|LOC727924_uc001yub.1_Intron	NM_001005241	NP_001005241	Q8N0Y3	OR4N4_HUMAN	olfactory receptor, family 4, subfamily N,						sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(4)|skin(1)	5		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)		CTGGCCACAAATGATAACAAGCA	0.296													3	3	---	---	---	---	
OTUD7A	161725	broad.mit.edu	37	15	32134826	32134827	+	Intron	DEL	AA	-	-	rs139948322		TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:32134826_32134827delAA	uc001zfr.2	-						OTUD7A_uc001zfs.1_Intron|OTUD7A_uc010baa.1_Intron	NM_130901	NP_570971	Q8TE49	OTU7A_HUMAN	OTU domain containing 7A							cytoplasm|nucleus	cysteine-type peptidase activity|DNA binding|zinc ion binding			pancreas(1)|skin(1)	2		all_lung(180;1.6e-09)		all cancers(64;2.44e-19)|Epithelial(43;6.82e-14)|GBM - Glioblastoma multiforme(186;1.49e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00189)|Lung(196;0.208)		GCTATTTAACAATATCACAAAC	0.450													2	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	45902861	45902861	+	IGR	DEL	A	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:45902861delA								PLDN (953 upstream) : SQRDL (20485 downstream)																							Ctattttattaaaaaaaaaaa	0.338													9	5	---	---	---	---	
SEMA6D	80031	broad.mit.edu	37	15	47735681	47735681	+	Intron	DEL	C	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:47735681delC	uc001zvw.2	+							NM_020858	NP_065909	Q8NFY4	SEM6D_HUMAN	semaphorin 6D isoform 1 precursor						axon guidance	cytoplasm|integral to membrane|plasma membrane	receptor activity			skin(3)|breast(1)	4		all_lung(180;0.000635)|Myeloproliferative disorder(241;0.116)|Melanoma(134;0.18)		all cancers(107;1.2e-11)|GBM - Glioblastoma multiforme(94;1.2e-06)		cagagccatgcccaggcatct	0.000													4	2	---	---	---	---	
SEMA6D	80031	broad.mit.edu	37	15	48054739	48054739	+	Intron	DEL	A	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:48054739delA	uc010bek.2	+						SEMA6D_uc001zvw.2_Intron|SEMA6D_uc001zvx.1_Intron|SEMA6D_uc001zvy.2_Intron|SEMA6D_uc001zvz.2_Intron|SEMA6D_uc001zwa.2_Intron|SEMA6D_uc001zwb.2_Intron|SEMA6D_uc001zwc.2_Intron	NM_153618	NP_705871	Q8NFY4	SEM6D_HUMAN	semaphorin 6D isoform 4 precursor						axon guidance	cytoplasm|integral to membrane|plasma membrane	receptor activity			skin(3)|breast(1)	4		all_lung(180;0.000635)|Myeloproliferative disorder(241;0.116)|Melanoma(134;0.18)		all cancers(107;1.2e-11)|GBM - Glioblastoma multiforme(94;1.2e-06)		AGGTGACCTCAAAAAAAAAAG	0.418													6	3	---	---	---	---	
MYO5A	4644	broad.mit.edu	37	15	52758631	52758632	+	Intron	DEL	TA	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:52758631_52758632delTA	uc002aby.2	-						MYO5A_uc002abx.3_Intron|MYO5A_uc010uge.1_Intron	NM_000259	NP_000250	Q9Y4I1	MYO5A_HUMAN	myosin VA isoform 1						actin filament-based movement|transport	cytoplasm|growth cone|myosin complex|ruffle	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(3)|central_nervous_system(1)	4				all cancers(107;0.0085)|Colorectal(133;0.077)|READ - Rectum adenocarcinoma(133;0.196)		CAGTGACTCCTATAGCCCAAGA	0.267													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	63759393	63759394	+	IGR	INS	-	T	T	rs79331684	by1000genomes	TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:63759393_63759394insT								CA12 (85318 upstream) : USP3 (37416 downstream)																							gctctccttacccagcacccac	0.153											OREG0023175	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	75611505	75611505	+	IGR	DEL	T	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:75611505delT								GOLGA6D (23359 upstream) : COMMD4 (16869 downstream)																							aagttaaacattttttcctgt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	88811771	88811774	+	IGR	DEL	AAAA	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:88811771_88811774delAAAA								NTRK3 (12110 upstream) : MRPL46 (190934 downstream)																							AGTGGAAATGAAAAAAAAAAAAAA	0.480													4	2	---	---	---	---	
CHD2	1106	broad.mit.edu	37	15	93552346	93552347	+	Intron	DEL	TA	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:93552346_93552347delTA	uc002bsp.2	+						CHD2_uc002bso.1_Intron	NM_001271	NP_001262	O14647	CHD2_HUMAN	chromodomain helicase DNA binding protein 2						regulation of transcription from RNA polymerase II promoter	nucleus	ATP binding|ATP-dependent DNA helicase activity|DNA binding			ovary(1)|skin(1)	2	Lung NSC(78;0.00976)|all_lung(78;0.016)		BRCA - Breast invasive adenocarcinoma(143;0.0282)|OV - Ovarian serous cystadenocarcinoma(32;0.0814)			GCAGATTGTTTATGTCTTTACT	0.446													108	69	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	98661645	98661645	+	IGR	DEL	T	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:98661645delT								ARRDC4 (144578 upstream) : FAM169B (318746 downstream)																							ctttgagcccttttttttttc	0.104													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	101372116	101372116	+	IGR	DEL	A	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:101372116delA								ASB7 (180214 upstream) : ALDH1A3 (47893 downstream)																							AAGCCAAGTGAAAAAGGCATC	0.478													4	2	---	---	---	---	
AXIN1	8312	broad.mit.edu	37	16	357375	357375	+	Intron	DEL	A	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:357375delA	uc002cgp.1	-						AXIN1_uc002cgq.1_Intron	NM_003502	NP_003493	O15169	AXIN1_HUMAN	axin 1 isoform a						activation of JUN kinase activity|activation of protein kinase activity|apoptosis|axial mesoderm formation|canonical Wnt receptor signaling pathway involved in neural plate anterior/posterior pattern formation|cellular protein complex assembly|cellular response to organic cyclic compound|cytoplasmic microtubule organization|determination of left/right symmetry|dorsal/ventral axis specification|embryonic eye morphogenesis|embryonic skeletal joint morphogenesis|forebrain anterior/posterior pattern formation|muscle cell development|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of fat cell differentiation|olfactory placode formation|optic placode formation|positive regulation of JNK cascade|positive regulation of peptidyl-serine phosphorylation|positive regulation of peptidyl-threonine phosphorylation|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of transcription, DNA-dependent|positive regulation of ubiquitin-protein ligase activity|regulation of catenin import into nucleus|tail morphogenesis|Wnt receptor signaling pathway involved in forebrain neuron fate commitment|Wnt receptor signaling pathway involved in somitogenesis	APC-Axin-1-beta-catenin complex|Axin-APC-beta-catenin-GSK3B complex|beta-catenin destruction complex|cell cortex|cytoplasmic membrane-bounded vesicle|cytoplasmic microtubule|cytosol|lateral plasma membrane|nucleus|perinuclear region of cytoplasm|postsynaptic density	armadillo repeat domain binding|beta-catenin binding|GTPase activator activity|I-SMAD binding|p53 binding|protein complex scaffold|protein homodimerization activity|protein kinase binding|signal transducer activity|ubiquitin protein ligase binding			breast(1)|liver(1)	2		all_cancers(16;2.75e-07)|all_epithelial(16;1.6e-06)|Hepatocellular(16;0.000105)|Lung NSC(18;0.00774)|all_lung(18;0.0187)				AGAGGAACAGAAAAAAATATC	0.453													4	2	---	---	---	---	
SNX29	92017	broad.mit.edu	37	16	12657064	12657065	+	Intron	INS	-	TC	TC	rs10676403		TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:12657064_12657065insTC	uc002dby.3	+							NM_001080530	NP_001073999	Q8TEQ0	SNX29_HUMAN	sorting nexin 29						cell communication		phosphatidylinositol binding			ovary(1)	1						CATGCTGGGATTGAGGCTCATA	0.584													1	5	---	---	---	---	
SULT1A3	6818	broad.mit.edu	37	16	30211957	30211958	+	Intron	INS	-	A	A			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30211957_30211958insA	uc002dxd.2	+						uc002dtf.2_Intron|SULT1A3_uc002dxf.2_Intron|SULT1A3_uc002dxi.2_Intron|SULT1A3_uc002dxj.2_Intron|SULT1A3_uc010vek.1_Intron|SULT1A3_uc002dxk.2_Intron|SULT1A3_uc010bzt.2_5'Flank	NM_177552	NP_808220	P50224	ST1A3_HUMAN	sulfotransferase family, cytosolic, 1A,						3'-phosphoadenosine 5'-phosphosulfate metabolic process|catecholamine metabolic process|flavonoid metabolic process|steroid metabolic process|sulfation|xenobiotic metabolic process	cytosol	aryl sulfotransferase activity				0						gactccatctcaaaaaaaaaaa	0.218													7	4	---	---	---	---	
ITGAX	3687	broad.mit.edu	37	16	31364634	31364635	+	5'Flank	INS	-	G	G			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31364634_31364635insG	uc002ebu.1	+						ITGAX_uc010cao.1_5'Flank|ITGAX_uc002ebt.2_5'Flank	NM_000887	NP_000878	P20702	ITAX_HUMAN	integrin alpha X precursor						blood coagulation|cell adhesion|integrin-mediated signaling pathway|leukocyte migration|organ morphogenesis	integrin complex	protein binding|receptor activity			ovary(2)|central_nervous_system(1)|pancreas(1)	4						cagcaacaacagggggtgtgga	0.193													4	2	---	---	---	---	
N4BP1	9683	broad.mit.edu	37	16	48602719	48602719	+	Intron	DEL	T	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:48602719delT	uc002efp.2	-							NM_153029	NP_694574	O75113	N4BP1_HUMAN	Nedd4 binding protein 1						negative regulation of proteasomal ubiquitin-dependent protein catabolic process|negative regulation of protein ubiquitination	nucleolus|PML body					0		all_cancers(37;0.179)|all_lung(18;0.11)				ctctggatgcttgcatgattt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	51399722	51399722	+	IGR	DEL	T	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:51399722delT								SALL1 (214539 upstream) : None (None downstream)																							ggTCAGTATGTTGTGCAATTC	0.169													4	2	---	---	---	---	
SLC12A3	6559	broad.mit.edu	37	16	56904156	56904157	+	Intron	DEL	GG	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:56904156_56904157delGG	uc010ccm.2	+						SLC12A3_uc002ekd.3_Intron|SLC12A3_uc010ccn.2_Intron	NM_001126108	NP_001119580	P55017	S12A3_HUMAN	solute carrier family 12, member 3 isoform 3						sodium ion transmembrane transport	apical plasma membrane|integral to plasma membrane|membrane fraction	sodium:chloride symporter activity			ovary(2)|breast(1)	3					Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Chlorothiazide(DB00880)|Diazoxide(DB01119)|Hydrochlorothiazide(DB00999)|Metolazone(DB00524)|Polythiazide(DB01324)|Quinethazone(DB01325)	AGGTGAGGCCGGGGGGCTGGAC	0.663													21	12	---	---	---	---	
VPS4A	27183	broad.mit.edu	37	16	69355230	69355230	+	Intron	DEL	T	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:69355230delT	uc002eww.2	+							NM_013245	NP_037377	Q9UN37	VPS4A_HUMAN	vacuolar protein sorting factor 4A						cell cycle|cellular membrane organization|cytokinesis|endosome transport|protein transport	cytosol|late endosome membrane|midbody|perinuclear region of cytoplasm	ATP binding|ATPase activity, coupled|protein C-terminus binding|protein domain specific binding				0		Ovarian(137;0.101)				GGATGTTCGGTTTTTTTTTTC	0.592													4	4	---	---	---	---	
AARS	16	broad.mit.edu	37	16	70287045	70287045	+	Intron	DEL	G	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70287045delG	uc002eyn.1	-						EXOSC6_uc002eym.1_5'Flank|AARS_uc010vlu.1_Intron	NM_001605	NP_001596	P49588	SYAC_HUMAN	alanyl-tRNA synthetase						alanyl-tRNA aminoacylation|tRNA processing	cytosol|soluble fraction	alanine-tRNA ligase activity|ATP binding|metal ion binding|tRNA binding			pancreas(1)	1		Ovarian(137;0.0365)		BRCA - Breast invasive adenocarcinoma(221;0.161)	L-Alanine(DB00160)	GCCTGGGTAAGGGGTACTGGC	0.552											OREG0023912	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	14	10	---	---	---	---	
KIAA0182	23199	broad.mit.edu	37	16	85701572	85701573	+	Intron	INS	-	CGCTGGGTC	CGCTGGGTC	rs11268657		TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:85701572_85701573insCGCTGGGTC	uc002fix.2	+						KIAA0182_uc002fiw.2_Intron|KIAA0182_uc002fiy.2_Intron|KIAA0182_uc002fiz.2_Intron|KIAA0182_uc010cho.2_Intron	NM_014615	NP_055430	Q14687	GSE1_HUMAN	genetic suppressor element 1 isoform 1								protein binding			large_intestine(3)|ovary(1)|skin(1)	5						GGACTTTCTCAAGTGGCCCAGA	0.545													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	86177635	86177635	+	IGR	DEL	G	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:86177635delG								IRF8 (221426 upstream) : LOC732275 (187821 downstream)																							agtgggagttggcaggaaaat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	86290437	86290445	+	IGR	DEL	CCACCAATA	-	-	rs111676691		TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:86290437_86290445delCCACCAATA								IRF8 (334228 upstream) : LOC732275 (75011 downstream)																							gccactcagcccaccaataccaccccaac	0.000													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	86499188	86499189	+	IGR	INS	-	G	G	rs144562244	by1000genomes	TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:86499188_86499189insG								LOC732275 (119903 upstream) : FOXF1 (44944 downstream)																							aatgggtggatggtgggtgagt	0.109													4	3	---	---	---	---	
SLC16A11	162515	broad.mit.edu	37	17	6946682	6946682	+	Frame_Shift_Del	DEL	G	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:6946682delG	uc002gei.1	-	1	561	c.223delC	c.(223-225)CAGfs	p.Q75fs		NM_153357	NP_699188	Q8NCK7	MOT11_HUMAN	solute carrier family 16, member 11	75	Cytoplasmic (Potential).					integral to membrane|plasma membrane	symporter activity			ovary(1)	1						GCAGTGTCCTGGGCGCTTCGG	0.701													4	2	---	---	---	---	
DNAH2	146754	broad.mit.edu	37	17	7660677	7660677	+	Intron	DEL	A	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7660677delA	uc002giu.1	+							NM_020877	NP_065928	Q9P225	DYH2_HUMAN	dynein heavy chain domain 3						ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(6)|skin(6)|central_nervous_system(1)	13		all_cancers(10;4.66e-07)|Prostate(122;0.081)				TTTCCATCTCAAAAAAAAAAA	0.383													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	11011379	11011379	+	IGR	DEL	T	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:11011379delT								PIRT (269961 upstream) : SHISA6 (133361 downstream)																							ccttcataacttttcagagaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	21406523	21406524	+	IGR	DEL	GT	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21406523_21406524delGT								KCNJ12 (83344 upstream) : C17orf51 (25048 downstream)																							TGTTGACTCCgtgtgtgtgtgt	0.416													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	29242119	29242120	+	IGR	INS	-	A	A	rs150623514	by1000genomes	TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:29242119_29242120insA								C17orf42 (8833 upstream) : ADAP2 (6634 downstream)														p.?(1)									caaaacaagttaaaaaaaaaca	0.005													6	4	---	---	---	---	
MYO1D	4642	broad.mit.edu	37	17	30932495	30932496	+	Intron	INS	-	CC	CC	rs145878488	by1000genomes	TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:30932495_30932496insCC	uc002hho.1	-						MYO1D_uc002hhp.1_Intron	NM_015194	NP_056009	O94832	MYO1D_HUMAN	myosin ID							myosin complex	actin binding|ATP binding|calmodulin binding			large_intestine(1)|ovary(1)|central_nervous_system(1)	3			BRCA - Breast invasive adenocarcinoma(9;0.0362)			TTGCTCAGTGACCCCCTGACTT	0.144													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	34295168	34295168	+	IGR	DEL	T	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34295168delT								LYZL6 (24497 upstream) : CCL16 (8368 downstream)																							tctttctttcttttttttttc	0.030													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	35236081	35236082	+	IGR	DEL	CT	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:35236081_35236082delCT								MRM1 (270675 upstream) : LHX1 (58417 downstream)																							ccctccctccctctctctctct	0.416													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	39228470	39228498	+	IGR	DEL	CTGCTGCCACCCTTCTGCTGCACTTCTAG	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39228470_39228498delCTGCTGCCACCCTTCTGCTGCACTTCTAG								KRTAP2-4 (6339 upstream) : KRTAP4-7 (11961 downstream)																							ACCAGCCCTCCTGCTGCCACCCTTCTGCTGCACTTCTAGCTGCTGCCAC	0.585													3	3	---	---	---	---	
C17orf53	78995	broad.mit.edu	37	17	42224412	42224413	+	Intron	INS	-	GA	GA			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42224412_42224413insGA	uc002ifi.1	+						C17orf53_uc010czq.1_Intron|C17orf53_uc002ifj.1_Intron|C17orf53_uc002ifk.1_5'Flank	NM_024032	NP_076937	Q8N3J3	CQ053_HUMAN	hypothetical protein LOC78995												0		Breast(137;0.0364)|Prostate(33;0.0376)		BRCA - Breast invasive adenocarcinoma(366;0.114)		tgtgtgtgtgtgtgtgagagag	0.361													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	48011682	48011682	+	IGR	DEL	G	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48011682delG								TAC4 (86303 upstream) : DLX4 (34880 downstream)																							CTCTCCTCCAGCCACACTTCC	0.567													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	55216821	55216821	+	IGR	DEL	A	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:55216821delA								AKAP1 (18112 upstream) : MSI2 (116391 downstream)																							TTGCAAACTTAAAAAAAAAAG	0.403													4	2	---	---	---	---	
RGS9	8787	broad.mit.edu	37	17	63186049	63186049	+	Intron	DEL	T	-	-	rs112552969		TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:63186049delT	uc002jfe.2	+						RGS9_uc010dem.2_Intron|RGS9_uc002jfd.2_Intron|RGS9_uc002jff.2_Intron|RGS9_uc002jfg.2_Intron	NM_003835	NP_003826	O75916	RGS9_HUMAN	regulator of G-protein signaling 9 isoform 1						intracellular signal transduction|negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway|visual perception	cytoplasm|heterotrimeric G-protein complex	GTPase activator activity|signal transducer activity			ovary(2)|skin(2)	4						TCCTTAGAACTTTTTTTTTTT	0.483													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	63320299	63320299	+	IGR	DEL	A	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:63320299delA								RGS9 (96480 upstream) : AXIN2 (204386 downstream)																							actccatctcaaaaaaaaaaa	0.000													7	5	---	---	---	---	
PRPSAP1	5635	broad.mit.edu	37	17	74340933	74340933	+	Intron	DEL	C	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74340933delC	uc010wta.1	-						PRPSAP1_uc010wtb.1_Intron	NM_002766	NP_002757	Q14558	KPRA_HUMAN	phosphoribosyl pyrophosphate						nucleotide biosynthetic process		enzyme inhibitor activity|identical protein binding|magnesium ion binding|ribose phosphate diphosphokinase activity			ovary(1)	1						gtaatcctagcactttaggag	0.090													24	24	---	---	---	---	
SEPT9	10801	broad.mit.edu	37	17	75306680	75306680	+	Intron	DEL	T	-	-	rs35964300		TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:75306680delT	uc002jts.3	+						SEPT9_uc010wtk.1_Intron|SEPT9_uc002jtt.3_Intron	NM_001113491	NP_001106963	Q9UHD8	SEPT9_HUMAN	septin 9 isoform a						cell cycle|cell division|protein heterooligomerization	microtubule|perinuclear region of cytoplasm|stress fiber	GTP binding|GTPase activity|protein binding|protein binding			breast(2)|ovary(1)	3			BRCA - Breast invasive adenocarcinoma(99;0.153)			CCCAGGTGGATTTGGCTGGGC	0.582													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	77912981	77912981	+	5'Flank	DEL	C	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:77912981delC	uc002jxg.1	-											Homo sapiens cDNA FLJ20748 fis, clone HEP05772.																		GGATGAGAAGCCCACCCCATT	0.577													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	79000350	79000350	+	IGR	DEL	A	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79000350delA								CHMP6 (26418 upstream) : FLJ90757 (2583 downstream)																							GTTAGGGTCTAAGGTGGAAGA	0.552													4	2	---	---	---	---	
SLC38A10	124565	broad.mit.edu	37	17	79227674	79227675	+	Intron	INS	-	CAC	CAC			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79227674_79227675insCAC	uc002jzz.1	-						SLC38A10_uc002jzy.1_Intron|SLC38A10_uc002kab.2_Intron	NM_001037984	NP_001033073	Q9HBR0	S38AA_HUMAN	solute carrier family 38, member 10 isoform a						amino acid transport|sodium ion transport	integral to membrane				pancreas(1)|skin(1)	2	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0272)|OV - Ovarian serous cystadenocarcinoma(97;0.117)			accatcaccatcatcatcacca	0.040													4	2	---	---	---	---	
LAMA3	3909	broad.mit.edu	37	18	21525884	21525884	+	Intron	DEL	T	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:21525884delT	uc002kuq.2	+						LAMA3_uc002kur.2_Intron|LAMA3_uc002kus.3_Intron|LAMA3_uc002kut.3_Intron	NM_198129	NP_937762	Q16787	LAMA3_HUMAN	laminin alpha 3 subunit isoform 1						cell adhesion|epidermis development|hemidesmosome assembly|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	receptor binding|structural molecule activity			ovary(8)|skin(2)|central_nervous_system(1)	11	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)				Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	CTAAGCAACCTTTTTTTTTCA	0.383													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	22167198	22167198	+	IGR	DEL	G	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:22167198delG								HRH4 (107278 upstream) : ZNF521 (474690 downstream)																							TGGAAGCTGAGGGGGTAGGAC	0.428													4	2	---	---	---	---	
FHOD3	80206	broad.mit.edu	37	18	33910801	33910802	+	Intron	INS	-	TGAG	TGAG	rs145976944	by1000genomes	TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:33910801_33910802insTGAG	uc002kzt.1	+						FHOD3_uc002kzr.1_Intron|FHOD3_uc002kzs.1_Intron	NM_025135	NP_079411	Q2V2M9	FHOD3_HUMAN	formin homology 2 domain containing 3						actin cytoskeleton organization	cytoplasm|cytoskeleton	actin binding			skin(3)|large_intestine(2)|breast(2)|ovary(1)	8		all_epithelial(2;0.0181)|Colorectal(2;0.0195)				TCTTTTTCTGAtgagtgagtga	0.436													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	58294400	58294400	+	IGR	DEL	T	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:58294400delT								MC4R (254399 upstream) : CDH20 (706588 downstream)																							TTTGGCCGTATTTTTTTTTCA	0.388													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	61404517	61404517	+	IGR	DEL	T	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:61404517delT								SERPINB11 (10853 upstream) : SERPINB7 (15760 downstream)																							ATCTGTCATCTTTTTTTTTTC	0.408													4	2	---	---	---	---	
CNDP2	55748	broad.mit.edu	37	18	72168311	72168311	+	Intron	DEL	T	-	-	rs149708461	by1000genomes	TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:72168311delT	uc002llm.1	+						CNDP2_uc002lln.1_Intron|CNDP2_uc002llo.2_Intron	NM_018235	NP_060705	Q96KP4	CNDP2_HUMAN	CNDP dipeptidase 2							cytoplasm	carboxypeptidase activity|metal ion binding|metallopeptidase activity|protein binding|tripeptidase activity			ovary(2)|skin(1)	3		Esophageal squamous(42;0.131)|Prostate(75;0.173)		BRCA - Breast invasive adenocarcinoma(31;0.22)		cacttccttgttttttttttg	0.040													4	4	---	---	---	---	
MED16	10025	broad.mit.edu	37	19	882346	882346	+	Intron	DEL	A	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:882346delA	uc002lqd.1	-						MED16_uc010drw.1_Intron|MED16_uc002lqe.2_Intron|MED16_uc002lqf.2_Intron|MED16_uc010xfv.1_Intron|MED16_uc010xfw.1_Intron|MED16_uc010xfx.1_Intron|MED16_uc010xfy.1_Intron	NM_005481	NP_005472	Q9Y2X0	MED16_HUMAN	mediator complex subunit 16						androgen receptor signaling pathway|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	receptor activity|thyroid hormone receptor binding|thyroid hormone receptor coactivator activity|vitamin D receptor binding				0		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;6.59e-06)|all_lung(49;9.97e-06)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		cattctctacaaaaaaaacac	0.000													4	2	---	---	---	---	
SBNO2	22904	broad.mit.edu	37	19	1136018	1136018	+	Intron	DEL	A	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1136018delA	uc002lrk.3	-						SBNO2_uc010dse.2_Intron	NM_014963	NP_055778	Q9Y2G9	SBNO2_HUMAN	strawberry notch homolog 2 isoform 1						macrophage activation involved in immune response|negative regulation of transcription, DNA-dependent|regulation of inflammatory response|transcription, DNA-dependent						0		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		gtgagtggttaaaaaaaaaaa	0.000													4	3	---	---	---	---	
SGTA	6449	broad.mit.edu	37	19	2763394	2763394	+	Intron	DEL	C	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2763394delC	uc002lwi.1	-							NM_003021	NP_003012	O43765	SGTA_HUMAN	small glutamine-rich tetratricopeptide						interspecies interaction between organisms	cytoplasm	protein binding			ovary(1)	1		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		gccatgggaaccccaggtgac	0.050													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	3769049	3769049	+	IGR	DEL	T	-	-	rs8102902	by1000genomes	TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3769049delT								MRPL54 (1487 upstream) : RAX2 (47 downstream)																							actttcctggtttttttttct	0.005													4	2	---	---	---	---	
EEF2	1938	broad.mit.edu	37	19	3979128	3979128	+	Intron	DEL	A	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3979128delA	uc002lze.2	-							NM_001961	NP_001952	P13639	EF2_HUMAN	eukaryotic translation elongation factor 2							cytosol|ribonucleoprotein complex	GTP binding|GTPase activity|protein binding|translation elongation factor activity				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00461)|GBM - Glioblastoma multiforme(1328;0.0223)|STAD - Stomach adenocarcinoma(1328;0.18)		agactatctcaaaaaaaacaa	0.184													4	2	---	---	---	---	
PEX11G	92960	broad.mit.edu	37	19	7551023	7551023	+	Intron	DEL	T	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7551023delT	uc002mgk.1	-						PEX11G_uc002mgl.1_Intron	NM_080662	NP_542393	Q96HA9	PX11C_HUMAN	peroxisomal biogenesis factor 11 gamma							integral to membrane|peroxisomal membrane					0						GAAGAttctcttttttttttg	0.294													12	6	---	---	---	---	
ELAVL1	1994	broad.mit.edu	37	19	8062661	8062661	+	Intron	DEL	A	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8062661delA	uc002mjb.2	-							NM_001419	NP_001410	Q15717	ELAV1_HUMAN	ELAV-like 1						3'-UTR-mediated mRNA stabilization|multicellular organismal development	cytoplasm|nucleoplasm	identical protein binding|mRNA binding|nucleotide binding				0						ccatcattacaaaaaaaaaaa	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	12896111	12896112	+	IGR	DEL	CA	-	-	rs112239571		TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12896111_12896112delCA								HOOK2 (9677 upstream) : JUNB (6174 downstream)																							acctctttttcacacacacaca	0.064													3	4	---	---	---	---	
IL12RB1	3594	broad.mit.edu	37	19	18193320	18193320	+	Intron	DEL	T	-	-	rs17884870		TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18193320delT	uc002nhw.1	-						IL12RB1_uc010xqb.1_Intron|IL12RB1_uc002nhx.1_Intron|IL12RB1_uc002nhy.2_Intron	NM_005535	NP_005526	P42701	I12R1_HUMAN	interleukin 12 receptor, beta 1 isoform 1						cellular response to interferon-gamma|interleukin-12-mediated signaling pathway|positive regulation of activated T cell proliferation|positive regulation of defense response to virus by host|positive regulation of interferon-gamma production|positive regulation of memory T cell differentiation|positive regulation of T cell mediated cytotoxicity|positive regulation of T-helper 1 type immune response|positive regulation of T-helper 17 cell lineage commitment|positive regulation of T-helper 17 type immune response	interleukin-12 receptor complex|interleukin-23 receptor complex	cytokine receptor activity			pancreas(1)	1						tcctctggtgtttttttttgg	0.075													4	2	---	---	---	---	
SSBP4	170463	broad.mit.edu	37	19	18542001	18542024	+	Intron	DEL	GTCCTGGTGACCACTGGTGCCTGA	-	-	rs2891673		TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18542001_18542024delGTCCTGGTGACCACTGGTGCCTGA	uc002niy.2	+						SSBP4_uc010ebp.2_Intron|SSBP4_uc002niz.2_Intron	NM_032627	NP_116016	Q9BWG4	SSBP4_HUMAN	single stranded DNA binding protein 4 isoform a							nucleus	single-stranded DNA binding				0						AGCCACAGTGGTCCTGGTGACCACTGGTGCCTGAGTCCTGCCCT	0.656													16	11	---	---	---	---	
CRTC1	23373	broad.mit.edu	37	19	18858139	18858139	+	Intron	DEL	A	-	-	rs76215850	byFrequency	TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18858139delA	uc002nkb.3	+						CRTC1_uc010ebv.2_Intron|CRTC1_uc010ebw.2_Intron|CRTC1_uc002nkc.3_Intron	NM_015321	NP_056136	Q6UUV9	CRTC1_HUMAN	mucoepidermoid carcinoma translocated 1 isoform						interspecies interaction between organisms|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|nucleus|plasma membrane	cAMP response element binding protein binding|protein binding		CRTC1/MAML2(516)	salivary_gland(474)|lung(35)|thyroid(4)|breast(3)|skin(2)|ovary(1)	519						CACTTATGACAAAAAAAAAGA	0.259													5	3	---	---	---	---	
ZNF681	148213	broad.mit.edu	37	19	23928252	23928252	+	Intron	DEL	T	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:23928252delT	uc002nrk.3	-						ZNF681_uc002nrl.3_Intron|ZNF681_uc002nrj.3_Intron	NM_138286	NP_612143	Q96N22	ZN681_HUMAN	zinc finger protein 681						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_lung(12;0.11)|Lung NSC(12;0.163)|all_epithelial(12;0.206)				AAGGCCCTAAttttttttttt	0.154													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	28336624	28336624	+	IGR	DEL	G	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:28336624delG								LOC148189 (51776 upstream) : None (None downstream)																							gagtggtggaggggggtgttt	0.000													2	4	---	---	---	---	
ZNF536	9745	broad.mit.edu	37	19	31019832	31019834	+	Intron	DEL	AAA	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:31019832_31019834delAAA	uc002nsu.1	+						ZNF536_uc010edd.1_Intron	NM_014717	NP_055532	O15090	ZN536_HUMAN	zinc finger protein 536						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(7)|large_intestine(2)|skin(2)	11	Esophageal squamous(110;0.0834)					ATGAGAGGCCAAAAAAAAAAAAA	0.522													4	3	---	---	---	---	
NPHS1	4868	broad.mit.edu	37	19	36345668	36345668	+	5'Flank	DEL	C	-	-	rs76587412		TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36345668delC	uc002oby.2	-						KIRREL2_uc002obz.3_5'Flank|KIRREL2_uc002ocb.3_5'Flank|KIRREL2_uc002oca.3_5'Flank|KIRREL2_uc002occ.3_5'Flank|KIRREL2_uc002ocd.3_5'Flank	NM_004646	NP_004637	O60500	NPHN_HUMAN	nephrin precursor						cell adhesion|excretion|muscle organ development	integral to plasma membrane				ovary(4)|skin(1)	5	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			tctgttctcacctctgtcgct	0.229													0	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	42154169	42154169	+	IGR	DEL	A	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42154169delA								CEACAM4 (20727 upstream) : CEACAM7 (23066 downstream)																							ttataaaaacaaaaaaaaaga	0.000													6	4	---	---	---	---	
FCAR	2204	broad.mit.edu	37	19	55401331	55401331	+	3'UTR	DEL	T	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55401331delT	uc002qhr.1	+	5					FCAR_uc002qhs.1_RNA|FCAR_uc002qht.1_3'UTR|FCAR_uc010esi.1_3'UTR|FCAR_uc002qhu.1_3'UTR|FCAR_uc002qhv.1_3'UTR|FCAR_uc002qhw.1_3'UTR|FCAR_uc002qhx.1_3'UTR|FCAR_uc002qhy.1_3'UTR|FCAR_uc002qhz.1_3'UTR|FCAR_uc002qia.1_3'UTR	NM_002000	NP_001991	P24071	FCAR_HUMAN	Fc alpha receptor isoform a precursor						immune response	extracellular region|integral to plasma membrane	IgA binding|receptor activity			ovary(1)|skin(1)	2				GBM - Glioblastoma multiforme(193;0.0443)		TTGAATCTACttttttttttt	0.249													8	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	570951	570952	+	IGR	INS	-	AT	AT			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:570951_570952insAT								CSNK2A1 (46469 upstream) : TCF15 (13687 downstream)																							CAATAacacacacacacacaca	0.074													4	2	---	---	---	---	
MACROD2	140733	broad.mit.edu	37	20	14906809	14906810	+	Intron	INS	-	GTTT	GTTT	rs149086064	by1000genomes	TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:14906809_14906810insGTTT	uc002wou.2	+						MACROD2_uc002wot.2_Intron|uc002woy.2_Intron	NM_080676	NP_542407	A1Z1Q3	MACD2_HUMAN	MACRO domain containing 2 isoform 1												0		all_neural(2;0.0381)|Acute lymphoblastic leukemia(2;0.175)				CTAAATGCAGAgtttgtttgtt	0.322													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	36038920	36038920	+	IGR	DEL	T	-	-	rs72268950		TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:36038920delT								SRC (5101 upstream) : BLCAP (106900 downstream)																							gtttgtttggttttttttttt	0.149													4	2	---	---	---	---	
COL20A1	57642	broad.mit.edu	37	20	61956557	61956557	+	Intron	DEL	A	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61956557delA	uc011aau.1	+						COL20A1_uc011aav.1_Intron	NM_020882	NP_065933	Q9P218	COKA1_HUMAN	collagen, type XX, alpha 1						cell adhesion	collagen|extracellular space	structural molecule activity			central_nervous_system(1)	1	all_cancers(38;1.39e-10)					TGTGACCCAGAGGGGCCACAG	0.662													4	5	---	---	---	---	
PRIC285	85441	broad.mit.edu	37	20	62190971	62190974	+	Intron	DEL	AGTC	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62190971_62190974delAGTC	uc002yfm.2	-						PRIC285_uc002yfl.1_Intron	NM_001037335	NP_001032412	Q9BYK8	PR285_HUMAN	PPAR-alpha interacting complex protein 285						cellular lipid metabolic process|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleoplasm	ATP binding|DNA binding|helicase activity|ribonuclease activity|RNA binding|transcription coactivator activity|zinc ion binding			central_nervous_system(2)	2	all_cancers(38;2.51e-11)|all_epithelial(29;8.27e-13)		Epithelial(9;1.27e-08)|all cancers(9;7.32e-08)|BRCA - Breast invasive adenocarcinoma(10;5.15e-06)			gtcagatgggagtcagtcagagtc	0.000													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	9860099	9860100	+	IGR	INS	-	A	A			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:9860099_9860100insA								None (None upstream) : None (None downstream)																							AAGAGATTGACAGAGCTACaga	0.079													5	3	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11061894	11061894	+	Intron	DEL	G	-	-	rs56157850		TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11061894delG	uc002yit.1	-						BAGE_uc002yiw.1_5'Flank|BAGE_uc002yix.2_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		TAAAGGAAAAGTTATGTATAT	0.124													5	3	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11068846	11068846	+	Intron	DEL	G	-	-	rs148294839		TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11068846delG	uc002yit.1	-						BAGE_uc002yix.2_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		gaatgatgctggaactgccaa	0.000													5	4	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11071749	11071750	+	Intron	INS	-	ACTT	ACTT	rs148241564		TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11071749_11071750insACTT	uc002yit.1	-						BAGE_uc002yix.2_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		gctcagtgataacttaaccacc	0.000													4	2	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11094184	11094184	+	Intron	DEL	G	-	-	rs2775396		TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11094184delG	uc002yit.1	-						BAGE_uc002yix.2_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		GTTTTATAAAGATAACTACCT	0.393													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	21966215	21966216	+	IGR	DEL	TG	-	-	rs71798841		TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:21966215_21966216delTG								None (None upstream) : C21orf131 (148698 downstream)																							GAGATGACTCtgtgtgtgtgtg	0.272													4	2	---	---	---	---	
APP	351	broad.mit.edu	37	21	27277068	27277068	+	Intron	DEL	A	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:27277068delA	uc002ylz.2	-						APP_uc011acg.1_Intron|APP_uc010glk.2_Intron|APP_uc002yma.2_Intron|APP_uc011ach.1_Intron|APP_uc002ymb.2_Intron|APP_uc010glj.2_Intron|APP_uc011aci.1_Intron	NM_000484	NP_000475	P05067	A4_HUMAN	amyloid beta A4 protein isoform a precursor						adult locomotory behavior|axon cargo transport|axon midline choice point recognition|cell adhesion|cellular copper ion homeostasis|collateral sprouting in absence of injury|dendrite development|endocytosis|extracellular matrix organization|G2 phase of mitotic cell cycle|innate immune response|ionotropic glutamate receptor signaling pathway|mating behavior|mRNA polyadenylation|neuron apoptosis|neuron remodeling|Notch signaling pathway|platelet activation|platelet degranulation|positive regulation of mitotic cell cycle|protein phosphorylation|regulation of epidermal growth factor receptor activity|regulation of multicellular organism growth|regulation of synapse structure and activity|regulation of translation|visual learning	axon|cell surface|coated pit|dendritic shaft|dendritic spine|extracellular region|Golgi apparatus|integral to plasma membrane|platelet alpha granule lumen	acetylcholine receptor binding|DNA binding|heparin binding|identical protein binding|metal ion binding|protein binding|protein binding|PTB domain binding|serine-type endopeptidase inhibitor activity			ovary(1)	1		Breast(209;0.00295)				AAGAAAAAAGAAAAAAAAAAA	0.343													4	2	---	---	---	---	
RIPK4	54101	broad.mit.edu	37	21	43174388	43174388	+	Intron	DEL	G	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:43174388delG	uc002yzn.1	-							NM_020639	NP_065690	P57078	RIPK4_HUMAN	ankyrin repeat domain 3							cytoplasm|nucleus	ATP binding|protein serine/threonine kinase activity			ovary(2)|central_nervous_system(2)|large_intestine(1)|lung(1)|skin(1)	7						TTCGTCTTCAGGAACAAAGGC	0.473													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	45426680	45426680	+	IGR	DEL	A	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45426680delA								AGPAT3 (19206 upstream) : TRAPPC10 (5526 downstream)																							TCCCAAGTGGAAAAAAAAAAT	0.438													4	2	---	---	---	---	
UBE2L3	7332	broad.mit.edu	37	22	21956362	21956363	+	Intron	INS	-	G	G			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:21956362_21956363insG	uc002zva.1	+						UBE2L3_uc011aig.1_Intron|UBE2L3_uc002zuz.1_Intron|UBE2L3_uc010gti.1_Intron	NM_003347	NP_003338	P68036	UB2L3_HUMAN	ubiquitin-conjugating enzyme E2L 3						cell proliferation|cellular response to glucocorticoid stimulus|protein K11-linked ubiquitination|regulation of S phase of mitotic cell cycle|regulation of transcription, DNA-dependent|transcription, DNA-dependent|ubiquitin-dependent protein catabolic process	cytoplasm|nucleus|ubiquitin ligase complex	ATP binding|transcription coactivator activity|ubiquitin protein ligase binding|ubiquitin-protein ligase activity				0	Colorectal(54;0.105)					AGGGATAGGCAGCCCACAGGGC	0.520													4	2	---	---	---	---	
KIAA1671	85379	broad.mit.edu	37	22	25575161	25575162	+	Intron	INS	-	GGGGGC	GGGGGC			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:25575161_25575162insGGGGGC	uc003abn.2	+						KIAA1671_uc003abl.2_Intron	NM_001145206	NP_001138678	Q9BY89	K1671_HUMAN	hypothetical protein LOC85379											lung(1)	1						AGCATGAAGCTGGGGGCGGGGG	0.634													6	4	---	---	---	---	
SEZ6L	23544	broad.mit.edu	37	22	26586458	26586458	+	Intron	DEL	C	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26586458delC	uc003acb.2	+						SEZ6L_uc003acc.2_Intron|SEZ6L_uc011akc.1_Intron|SEZ6L_uc003acd.2_Intron|SEZ6L_uc011akd.1_Intron|SEZ6L_uc003ace.2_Intron	NM_021115	NP_066938	Q9BYH1	SE6L1_HUMAN	seizure related 6 homolog (mouse)-like							endoplasmic reticulum membrane|integral to membrane				ovary(4)|central_nervous_system(1)|pancreas(1)	6						gagttcaaatcccatctctgc	0.080													4	2	---	---	---	---	
KREMEN1	83999	broad.mit.edu	37	22	29521778	29521778	+	Intron	DEL	T	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29521778delT	uc011akm.1	+						KREMEN1_uc003ael.2_Intron|KREMEN1_uc011akn.1_Intron	NM_032045	NP_114434	Q96MU8	KREM1_HUMAN	kringle-containing transmembrane protein 1						cell communication|regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	integral to membrane|membrane fraction	protein binding			ovary(3)|lung(2)	5						CTTTTGACTGTTTTTTTTTTA	0.333													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	31386765	31386765	+	IGR	DEL	G	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:31386765delG								TUG1 (11388 upstream) : SMTN (90540 downstream)																							TCCATGTTTTGAACATCCTCA	0.453													4	2	---	---	---	---	
EIF4ENIF1	56478	broad.mit.edu	37	22	31837560	31837560	+	Intron	DEL	G	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:31837560delG	uc003akz.1	-						EIF4ENIF1_uc003akx.1_Intron|EIF4ENIF1_uc003aky.1_Intron|EIF4ENIF1_uc003ala.1_Intron|EIF4ENIF1_uc003alb.1_Intron|EIF4ENIF1_uc003akw.1_Intron	NM_019843	NP_062817	Q9NRA8	4ET_HUMAN	eukaryotic translation initiation factor 4E							nucleus	protein binding|protein transporter activity			ovary(1)	1						aaaaaaaaaaGAATCTTCAAG	0.224													4	3	---	---	---	---	
DEPDC5	9681	broad.mit.edu	37	22	32257604	32257611	+	Intron	DEL	AAGAGGTT	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32257604_32257611delAAGAGGTT	uc003als.2	+						DEPDC5_uc011als.1_Intron|DEPDC5_uc011alu.1_Intron|DEPDC5_uc011alv.1_Intron|DEPDC5_uc003alt.2_Intron|DEPDC5_uc003alu.2_Intron|DEPDC5_uc003alv.2_Intron|DEPDC5_uc011alw.1_Intron|DEPDC5_uc003alw.2_Intron|DEPDC5_uc011alx.1_Intron|DEPDC5_uc010gwk.2_Intron|DEPDC5_uc011aly.1_Intron	NM_014662	NP_055477	O75140	DEPD5_HUMAN	DEP domain containing 5 isoform 1						intracellular signal transduction					ovary(4)|central_nervous_system(3)|pancreas(1)	8						GGGGGGATGGAAGAGGTTAATGTAGAAG	0.438													6	4	---	---	---	---	
SYN3	8224	broad.mit.edu	37	22	33173149	33173149	+	Intron	DEL	A	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:33173149delA	uc003amx.2	-						SYN3_uc003amy.2_Intron|SYN3_uc003amz.2_Intron	NM_003490	NP_003481	O14994	SYN3_HUMAN	synapsin III isoform IIIa						neurotransmitter secretion	cell junction|synaptic vesicle membrane	ATP binding|ligase activity			skin(1)	1						ttccacagagaaggagacagg	0.318													4	2	---	---	---	---	
DMC1	11144	broad.mit.edu	37	22	38965962	38965962	+	Intron	DEL	A	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38965962delA	uc003avz.1	-						DMC1_uc011anv.1_5'Flank|DMC1_uc003awa.1_Intron	NM_007068	NP_008999	Q14565	DMC1_HUMAN	DMC1 dosage suppressor of mck1 homolog						reciprocal meiotic recombination	condensed nuclear chromosome	ATP binding|DNA binding|DNA-dependent ATPase activity|protein binding			ovary(1)	1	Melanoma(58;0.0286)					CAGGGACCCCAAAAAAGGAGC	0.532								Homologous_recombination					4	2	---	---	---	---	
TTLL1	25809	broad.mit.edu	37	22	43483041	43483041	+	Intron	DEL	C	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:43483041delC	uc003bdi.2	-						TTLL1_uc003bdj.2_Intron|TTLL1_uc003bdh.2_Intron	NM_012263	NP_036395	O95922	TTLL1_HUMAN	tubulin tyrosine ligase-like family, member 1						protein polyglutamylation	cytoplasm|microtubule	ATP binding|tubulin-glutamic acid ligase activity|tubulin-tyrosine ligase activity			skin(1)	1		Ovarian(80;0.0694)		BRCA - Breast invasive adenocarcinoma(115;0.00461)		tctttcagctcctgacacccc	0.000													4	2	---	---	---	---	
MCAT	27349	broad.mit.edu	37	22	43528217	43528217	+	3'UTR	DEL	G	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:43528217delG	uc003bdl.1	-	4					MCAT_uc003bdm.1_3'UTR	NM_173467	NP_775738	Q8IVS2	FABD_HUMAN	mitochondrial malonyltransferase isoform a						fatty acid biosynthetic process	mitochondrion	[acyl-carrier-protein] S-malonyltransferase activity|binding			ovary(1)	1		Ovarian(80;0.0694)				CAAGCAGCTTGGAATGTCTCA	0.483													4	2	---	---	---	---	
PNPLA3	80339	broad.mit.edu	37	22	44335671	44335672	+	Intron	DEL	GG	-	-	rs35514853		TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:44335671_44335672delGG	uc003bei.1	+						PNPLA3_uc010gzm.1_Intron	NM_025225	NP_079501	Q9NST1	PLPL3_HUMAN	patatin-like phospholipase domain containing 3						triglyceride biosynthetic process|triglyceride catabolic process	integral to membrane	diolein transacylation activity|mono-olein transacylation activity|phospholipase A2 activity|triglyceride lipase activity				0		Ovarian(80;0.024)|all_neural(38;0.0416)				actccagcctgggggcaacaag	0.178													5	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	49213098	49213099	+	IGR	INS	-	T	T			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:49213098_49213099insT								FAM19A5 (65356 upstream) : C22orf34 (595077 downstream)																							TTATCCTTGCATTTTTTTTAAA	0.361													4	2	---	---	---	---	
CD99	4267	broad.mit.edu	37	X	2655905	2655905	+	Intron	DEL	T	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:2655905delT	uc004cqm.2	+						CD99_uc010nda.2_Intron|CD99_uc004cqn.2_Intron|CD99_uc004cqo.2_Intron	NM_002414	NP_002405	P14209	CD99_HUMAN	CD99 antigen isoform a precursor						cell adhesion	cytoplasm|integral to plasma membrane				skin(1)	1						ATGCACGTACTTTTTTTTTTT	0.303													5	4	---	---	---	---	
ARSD	414	broad.mit.edu	37	X	2840278	2840279	+	Intron	DEL	CA	-	-	rs113934022		TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:2840278_2840279delCA	uc004cqy.2	-						ARSD_uc004cqz.1_Intron|ARSD_uc004cra.1_Intron|ARSD_uc004crb.3_Intron	NM_001669	NP_001660	P51689	ARSD_HUMAN	arylsulfatase D isoform a precursor							lysosome	arylsulfatase activity|metal ion binding				0		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				ctctctctctcacacacacaca	0.079													6	3	---	---	---	---	
PHKA2	5256	broad.mit.edu	37	X	18919965	18919965	+	Intron	DEL	T	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:18919965delT	uc004cyv.3	-						PHKA2_uc004cyu.3_Intron|PHKA2_uc010nfe.1_Intron|PHKA2_uc010nff.1_Intron	NM_000292	NP_000283	P46019	KPB2_HUMAN	phosphorylase kinase, alpha 2 (liver)						glucose metabolic process|glycogen catabolic process	cytosol|phosphorylase kinase complex|plasma membrane	calmodulin binding|glucan 1,4-alpha-glucosidase activity|phosphorylase kinase activity			ovary(1)|central_nervous_system(1)	2	Hepatocellular(33;0.183)					GTGAGATATGttttttttttt	0.244													7	6	---	---	---	---	
IL1RAPL1	11141	broad.mit.edu	37	X	29061228	29061228	+	Intron	DEL	A	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:29061228delA	uc004dby.2	+							NM_014271	NP_055086	Q9NZN1	IRPL1_HUMAN	interleukin 1 receptor accessory protein-like 1						innate immune response|negative regulation of calcium ion transport via voltage-gated calcium channel activity|negative regulation of exocytosis|regulation of neuron projection development	cytoplasm|integral to membrane|plasma membrane	protein binding|transmembrane receptor activity			ovary(3)|lung(1)|pancreas(1)	5						GCATGATATTAAAAGGAATCA	0.403													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	35051255	35051255	+	IGR	DEL	T	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:35051255delT								FAM47B (88221 upstream) : MAGEB16 (765204 downstream)																							acattagggataacctcaagt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	38828521	38828521	+	IGR	DEL	G	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:38828521delG								MID1IP1 (162740 upstream) : None (None downstream)																							TTGCTAAGGTGGAATGAGTTT	0.388													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	41934689	41934689	+	IGR	DEL	T	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:41934689delT								CASK (152402 upstream) : PPP1R2P9 (701930 downstream)																							aaggcattggtttttgtggga	0.070													4	2	---	---	---	---	
WDR13	64743	broad.mit.edu	37	X	48456721	48456721	+	Intron	DEL	T	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48456721delT	uc004dkh.1	+						WDR13_uc010nif.1_Intron|WDR13_uc004dki.1_Intron|WDR13_uc004dkj.1_Intron|WDR13_uc004dkk.1_Intron|WDR13_uc004dkl.3_5'UTR|WDR13_uc011mme.1_5'Flank	NM_017883	NP_060353	Q9H1Z4	WDR13_HUMAN	WD repeat domain 13 protein							cytoplasm|nucleus				ovary(2)	2						TCCCCTAGACTTTTTTTTTTT	0.517													9	4	---	---	---	---	
PFKFB1	5207	broad.mit.edu	37	X	54975858	54975859	+	Intron	DEL	AG	-	-	rs151303090		TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:54975858_54975859delAG	uc004dty.1	-						PFKFB1_uc010nkd.1_Intron|PFKFB1_uc011mol.1_Intron	NM_002625	NP_002616	P16118	F261_HUMAN	6-phosphofructo-2-kinase/fructose-2,						energy reserve metabolic process|fructose 2,6-bisphosphate metabolic process|gluconeogenesis|glycolysis|intracellular protein kinase cascade	6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 1 complex	6-phosphofructo-2-kinase activity|ATP binding|fructose-2,6-bisphosphate 2-phosphatase activity|identical protein binding			ovary(1)	1						AGAGCATGACagagagagagag	0.307													1	6	---	---	---	---	
EDA	1896	broad.mit.edu	37	X	68896147	68896147	+	Intron	DEL	A	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:68896147delA	uc004dxs.2	+						EDA_uc004dxr.2_Intron|EDA_uc011mpj.1_Intron|EDA_uc004dxn.1_Intron|EDA_uc004dxm.1_Intron|EDA_uc004dxp.1_Intron|EDA_uc004dxq.1_Intron	NM_001399	NP_001390	Q92838	EDA_HUMAN	ectodysplasin A isoform EDA-A1						cell differentiation|ectoderm development|immune response|positive regulation of NF-kappaB transcription factor activity|signal transduction	collagen|cytoskeleton|membrane fraction	tumor necrosis factor receptor binding			ovary(2)|large_intestine(1)	3						ggaagtaagtaagggggctat	0.000													4	2	---	---	---	---	
MORC4	79710	broad.mit.edu	37	X	106142752	106142752	+	Intron	DEL	G	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:106142752delG	uc004emp.3	-						CLDN2_uc004emq.1_5'Flank			Q8TE76	MORC4_HUMAN	SubName: Full=cDNA FLJ59044, highly similar to LINE-1 reverse transcriptase homolog;								ATP binding|zinc ion binding			ovary(1)	1						AAAAAAAAAAGATAAGCCCAA	0.214													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	114942072	114942072	+	IGR	DEL	A	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:114942072delA								PLS3 (57082 upstream) : AGTR2 (359886 downstream)																							TCATTCCTAGAAAAAAAaaat	0.274													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	119866316	119866317	+	IGR	DEL	TG	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:119866316_119866317delTG								C1GALT1C1 (102375 upstream) : CT47B1 (140137 downstream)																							cgtgtgtgtttgtgtgtgtgtg	0.000													4	2	---	---	---	---	
SAGE1	55511	broad.mit.edu	37	X	134973112	134973112	+	5'Flank	DEL	A	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:134973112delA	uc004ezh.2	+						CT45A5_uc011mvu.1_5'Flank|CT45A6_uc004ezf.2_5'Flank|SAGE1_uc010nry.1_5'Flank|SAGE1_uc011mvv.1_5'Flank	NM_018666	NP_061136	Q9NXZ1	SAGE1_HUMAN	sarcoma antigen 1											ovary(2)|skin(1)	3	Acute lymphoblastic leukemia(192;0.000127)					agggcagaggacacagaggcc	0.000													4	2	---	---	---	---	
VGLL1	51442	broad.mit.edu	37	X	135633392	135633392	+	Intron	DEL	T	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:135633392delT	uc004ezy.2	+							NM_016267	NP_057351	Q99990	VGLL1_HUMAN	vestigial like 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	transcription coactivator activity				0	Acute lymphoblastic leukemia(192;0.000127)					TATTTATTTCTTTTTTTTTAA	0.368													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	139808281	139808281	+	IGR	DEL	A	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:139808281delA								RP1-177G6.2 (11294 upstream) : CDR1 (57144 downstream)																							ACACACAAATAAAAAAAAACC	0.408													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	145323002	145323002	+	IGR	DEL	C	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:145323002delC								MIR891A (213612 upstream) : CXorf51 (568300 downstream)																							ttatccctctcccccagaagt	0.000													4	2	---	---	---	---	
HSFX2	100130086	broad.mit.edu	37	X	148731302	148731302	+	Intron	DEL	A	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:148731302delA	uc004fdl.2	-						HSFX1_uc004fdm.2_Intron	NM_016153	NP_057237	Q9UBD0	HSFX1_HUMAN	heat shock transcription factor family, X linked							cytoplasm|nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0						CCTTCATGTCAAAAAAAAAAA	0.453													6	4	---	---	---	---	
LOC100272228	100272228	broad.mit.edu	37	X	149380343	149380346	+	Intron	DEL	TCAT	-	-	rs67296890		TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:149380343_149380346delTCAT	uc004fea.2	+											Homo sapiens cDNA FLJ30251 fis, clone BRACE2002394.												0						acacactcactcattcattcattc	0.059													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	152044072	152044072	+	IGR	DEL	A	-	-	rs11352303		TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:152044072delA								NSDHL (6165 upstream) : ZNF185 (38925 downstream)																							CAGGAGGATGAAAAAAATGGG	0.463													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	9945244	9945244	+	IGR	DEL	A	-	-			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:9945244delA								TTTY22 (294390 upstream) : None (None downstream)																							agattgaaataaaaagaataa	0.000													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	13445900	13445900	+	IGR	DEL	C	-	-	rs149511831		TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:13445900delC								None (None upstream) : None (None downstream)																							AAAGTCCCAACAAACTTCTCA	0.244													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	58979593	58979594	+	IGR	INS	-	CCATT	CCATT			TCGA-B0-4710-01A-01D-1501-10	TCGA-B0-4710-11A-02D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:58979593_58979594insCCATT								None (None upstream) : None (None downstream)																							atttcatttcaccattccattc	0.005													4	3	---	---	---	---	
