Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
MST1P2	11209	broad.mit.edu	37	1	16974745	16974745	+	RNA	SNP	G	A	A	rs28526603	by1000genomes	TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16974745G>A	uc010och.1	+	7		c.1205G>A			MST1P2_uc001azk.2_RNA|MST1P2_uc001azl.3_RNA|MST1P2_uc009vox.2_RNA|MST1P2_uc001azm.3_RNA	NR_027504				Homo sapiens cDNA FLJ43241 fis, clone HEART1000010, weakly  similar to Hepatocyte growth factor-like protein precursor.												0						CCTGGAACCGGAGGGCCGGGG	0.711													4	17	---	---	---	---	PASS
KIAA0467	23334	broad.mit.edu	37	1	43885949	43885949	+	5'Flank	SNP	C	T	T			TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43885949C>T	uc001cjk.1	+						KIAA0467_uc009vws.1_Missense_Mutation_p.R406W	NM_015284	NP_056099	Q5T011	SZT2_HUMAN	hypothetical protein LOC23334							peroxisome					0	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				TGTGTCCGTACGGCTTCGAGA	0.567													4	22	---	---	---	---	PASS
CHIA	27159	broad.mit.edu	37	1	111860638	111860638	+	Silent	SNP	C	T	T	rs148384495	byFrequency	TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:111860638C>T	uc001eas.2	+	8	739	c.636C>T	c.(634-636)TAC>TAT	p.Y212Y	CHIA_uc001ear.2_Silent_p.Y104Y|CHIA_uc001eaq.2_Silent_p.Y104Y|CHIA_uc009wgc.2_Silent_p.Y104Y|CHIA_uc001eat.2_Silent_p.Y51Y|CHIA_uc001eav.2_Silent_p.Y51Y|CHIA_uc001eau.2_Silent_p.Y51Y|CHIA_uc009wgd.2_Silent_p.Y51Y	NM_201653	NP_970615	Q9BZP6	CHIA_HUMAN	acidic chitinase isoform c	212	Chitooligosaccharide binding (Probable).				apoptosis|cell wall chitin metabolic process|chitin catabolic process|digestion|immune response|positive regulation of chemokine secretion|production of molecular mediator involved in inflammatory response|response to acid|response to fungus	cytoplasm|extracellular space	cation binding|chitin binding|chitinase activity|kinase binding|lysozyme activity|sugar binding			ovary(1)	1		all_cancers(81;3.23e-05)|all_epithelial(167;1.2e-05)|all_lung(203;0.000154)|Lung NSC(277;0.000304)		Colorectal(144;0.0115)|Lung(183;0.0292)|COAD - Colon adenocarcinoma(174;0.0314)|all cancers(265;0.0477)|Epithelial(280;0.0918)|LUSC - Lung squamous cell carcinoma(189;0.154)		TCATGACCTACGACCTCCATG	0.542													26	76	---	---	---	---	PASS
KCNJ10	3766	broad.mit.edu	37	1	160011200	160011200	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160011200G>A	uc001fuw.1	-	2	1273	c.1123C>T	c.(1123-1125)CGC>TGC	p.R375C		NM_002241	NP_002232	P78508	IRK10_HUMAN	potassium inwardly-rectifying channel, subfamily	375	Cytoplasmic (By similarity).					integral to plasma membrane	ATP binding|ATP-activated inward rectifier potassium channel activity			ovary(1)	1	all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			TTGCTGATGCGCACACTAAGG	0.532													3	34	---	---	---	---	PASS
DPP4	1803	broad.mit.edu	37	2	162849740	162849740	+	3'UTR	SNP	T	G	G			TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:162849740T>G	uc002ubz.2	-	26					DPP4_uc010fpb.2_3'UTR	NM_001935	NP_001926	P27487	DPP4_HUMAN	dipeptidylpeptidase IV						cell adhesion|endothelial cell migration|negative regulation of extracellular matrix disassembly|positive regulation of cell proliferation|proteolysis|regulation of cell-cell adhesion mediated by integrin|response to hypoxia|T cell activation|T cell costimulation	apical plasma membrane|cell surface|endocytic vesicle|extracellular region|integral to membrane|invadopodium membrane|lamellipodium membrane|membrane raft	aminopeptidase activity|dipeptidyl-peptidase activity|protease binding|protein homodimerization activity|receptor activity|receptor binding|serine-type endopeptidase activity			ovary(3)	3					Sitagliptin(DB01261)	TTTGAGATAATGAAAACAAAA	0.318													4	82	---	---	---	---	PASS
COL6A3	1293	broad.mit.edu	37	2	238249678	238249678	+	Silent	SNP	A	C	C			TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:238249678A>C	uc002vwl.2	-	38	8166	c.7881T>G	c.(7879-7881)GCT>GCG	p.A2627A	COL6A3_uc002vwo.2_Silent_p.A2421A|COL6A3_uc010znj.1_Silent_p.A2020A|COL6A3_uc002vwj.2_Silent_p.A8A	NM_004369	NP_004360	P12111	CO6A3_HUMAN	alpha 3 type VI collagen isoform 1 precursor	2627	VWFA 12.|Nonhelical region.				axon guidance|cell adhesion|muscle organ development	collagen type VI|extracellular space	serine-type endopeptidase inhibitor activity			ovary(8)|central_nervous_system(6)|skin(2)|upper_aerodigestive_tract(1)|pancreas(1)	18		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		TGGTGGTCTCAGCGCTGTCTA	0.547													66	181	---	---	---	---	PASS
VHL	7428	broad.mit.edu	37	3	10183752	10183752	+	Missense_Mutation	SNP	T	A	A	rs5030803		TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10183752T>A	uc003bvc.2	+	1	434	c.221T>A	c.(220-222)GTC>GAC	p.V74D	VHL_uc003bvd.2_Missense_Mutation_p.V74D	NM_000551	NP_000542	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor isoform 1	74					anti-apoptosis|cell morphogenesis|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of cell differentiation|positive regulation of transcription, DNA-dependent|protein stabilization|protein ubiquitination|proteolysis	cytosol|endoplasmic reticulum|membrane|mitochondrion|nucleus	protein binding|transcription factor binding	p.V74D(4)|p.V74fs*85(2)|p.V74A(1)|p.S72_V87>L(1)|p.P71fs*84(1)|p.R60fs*35(1)|p.N67_V74del(1)|p.V74fs*58(1)|p.V74fs*77(1)|p.V74fs*82(1)|p.V74fs*51(1)		kidney(1273)|soft_tissue(24)|adrenal_gland(15)|large_intestine(13)|pancreas(5)|endometrium(4)|thyroid(3)|upper_aerodigestive_tract(3)|central_nervous_system(2)|lung(2)|pleura(1)|paratesticular_tissues(1)	1346				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		CCCTCCCAGGTCATCTTCTGC	0.721		1	D|Mis|N|F|S		renal|hemangioma|pheochromocytoma	renal|hemangioma|pheochromocytoma			von_Hippel-Lindau_disease|Chuvash_Polycythemia_|Pheochromocytoma_(Adrenal)_Familial				4	3	---	---	---	---	PASS
LOC285359	285359	broad.mit.edu	37	3	101431291	101431291	+	RNA	SNP	C	T	T			TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:101431291C>T	uc003dvj.2	+	1		c.14C>T				NR_002941				Homo sapiens cDNA FLJ12205 fis, clone MAMMA1000931.												0						GCACAGCTGGCTTGAGCAACT	0.289													4	24	---	---	---	---	PASS
ZFYVE28	57732	broad.mit.edu	37	4	2306052	2306052	+	Missense_Mutation	SNP	G	A	A	rs117669252	byFrequency	TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:2306052G>A	uc003gex.1	-	8	2334	c.2015C>T	c.(2014-2016)CCG>CTG	p.P672L	ZFYVE28_uc011bvk.1_Missense_Mutation_p.S602L|ZFYVE28_uc011bvl.1_Missense_Mutation_p.S642L|ZFYVE28_uc003gew.1_Missense_Mutation_p.S558L	NM_020972	NP_066023	Q9HCC9	LST2_HUMAN	zinc finger, FYVE domain containing 28	672					negative regulation of epidermal growth factor receptor activity	cytosol|early endosome membrane	metal ion binding|phosphatidylinositol-3-phosphate binding|protein binding			skin(2)|ovary(1)	3						CTCGTGAGCCGAGGGGCTCCC	0.667													35	60	---	---	---	---	PASS
CBR4	84869	broad.mit.edu	37	4	169923170	169923170	+	Intron	SNP	C	T	T			TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:169923170C>T	uc003iry.2	-						CBR4_uc011cjy.1_Intron|CBR4_uc003irz.1_3'UTR	NM_032783	NP_116172	Q8N4T8	CBR4_HUMAN	carbonic reductase 4						fatty acid biosynthetic process|protein homotetramerization	mitochondrial matrix	NADPH binding|NADPH dehydrogenase (quinone) activity|protein binding|quinone binding				0		Prostate(90;0.00263)|Renal(120;0.0183)|Melanoma(52;0.123)		GBM - Glioblastoma multiforme(119;0.0321)		ATAATGGCTTCCCTATAAAAC	0.299													6	31	---	---	---	---	PASS
GPR98	84059	broad.mit.edu	37	5	90025457	90025457	+	Splice_Site	SNP	A	C	C			TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:90025457A>C	uc003kju.2	+	50	10523	c.10427_splice	c.e50-2	p.G3476_splice	GPR98_uc003kjt.2_Splice_Site_p.G1182_splice|GPR98_uc003kjv.2_Splice_Site_p.G1076_splice	NM_032119	NP_115495	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98 precursor						cell communication|cell-cell adhesion|maintenance of organ identity|neuropeptide signaling pathway|photoreceptor cell maintenance	cell surface|cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(11)|central_nervous_system(3)|pancreas(2)	16		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		TCATTATTGCAGGAGATCAGA	0.289													9	19	---	---	---	---	PASS
KIF13A	63971	broad.mit.edu	37	6	17828563	17828563	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:17828563G>C	uc003ncg.3	-	14	1545	c.1440C>G	c.(1438-1440)ATC>ATG	p.I480M	KIF13A_uc003ncf.2_Missense_Mutation_p.I480M|KIF13A_uc003nch.3_Missense_Mutation_p.I480M|KIF13A_uc003nci.3_Missense_Mutation_p.I480M|KIF13A_uc003ncj.2_Missense_Mutation_p.I156M	NM_022113	NP_071396	Q9H1H9	KI13A_HUMAN	kinesin family member 13A isoform a	480	FHA.				cargo loading into vesicle|cell cycle|cytokinesis|endosome to lysosome transport|Golgi to plasma membrane protein transport|melanosome organization|plus-end-directed vesicle transport along microtubule	centrosome|endosome membrane|microtubule|midbody|trans-Golgi network membrane	ATP binding|microtubule motor activity|protein binding			large_intestine(2)|ovary(2)	4	Breast(50;0.0107)|Ovarian(93;0.016)	all_hematologic(90;0.125)	all cancers(50;0.0865)|Epithelial(50;0.0974)			CAAAAAGCTGGATATCTTGAG	0.398													8	27	---	---	---	---	PASS
SKIV2L	6499	broad.mit.edu	37	6	31932019	31932019	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31932019T>C	uc003nyn.1	+	17	2260	c.1871T>C	c.(1870-1872)ATG>ACG	p.M624T	SKIV2L_uc011dou.1_Missense_Mutation_p.M466T|SKIV2L_uc011dov.1_Missense_Mutation_p.M431T	NM_006929	NP_008860	Q15477	SKIV2_HUMAN	superkiller viralicidic activity 2-like homolog	624	Helicase C-terminal.					nucleus	ATP binding|ATP-dependent RNA helicase activity|protein binding|RNA binding			ovary(1)|large_intestine(1)|breast(1)|central_nervous_system(1)	4						GTCCTGCACATGTCAGAGCTC	0.567													12	31	---	---	---	---	PASS
NOX3	50508	broad.mit.edu	37	6	155776182	155776182	+	Nonsense_Mutation	SNP	G	A	A	rs143358981	byFrequency	TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:155776182G>A	uc003qqm.2	-	2	233	c.130C>T	c.(130-132)CGA>TGA	p.R44*		NM_015718	NP_056533	Q9HBY0	NOX3_HUMAN	NADPH oxidase 3	44	Extracellular (Potential).						electron carrier activity|flavin adenine dinucleotide binding|iron ion binding			ovary(1)	1		Breast(66;0.0183)		OV - Ovarian serous cystadenocarcinoma(155;2.18e-12)|BRCA - Breast invasive adenocarcinoma(81;0.00815)		AAAATAACTCGTGTGTAATGG	0.343													20	46	---	---	---	---	PASS
C7orf27	221927	broad.mit.edu	37	7	2577862	2577862	+	Silent	SNP	A	G	G			TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2577862A>G	uc003smi.2	-	14	2349	c.2307T>C	c.(2305-2307)CCT>CCC	p.P769P	C7orf27_uc003smh.3_Silent_p.P201P	NM_152743	NP_689956	Q6PJG6	BRAT1_HUMAN	hypothetical protein LOC221927 precursor	769					response to ionizing radiation	nucleus	protein binding				0		Ovarian(82;0.0779)		OV - Ovarian serous cystadenocarcinoma(56;2.91e-14)		GCACAGCCTCAGGCTCCTGGT	0.716													3	28	---	---	---	---	PASS
ACTR3C	653857	broad.mit.edu	37	7	149990455	149990455	+	Silent	SNP	T	C	C	rs146995367	by1000genomes	TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:149990455T>C	uc003wgu.1	-	3	289	c.99A>G	c.(97-99)ACA>ACG	p.T33T		NM_001040135	NP_001035225	Q9C0K3	ARP3C_HUMAN	actin-related protein 3-beta isoform 2	33					regulation of actin filament polymerization	cytoskeleton	actin binding|ATP binding				0						TCCCCGTTAATGTACGTTCAC	0.468													3	33	---	---	---	---	PASS
ODF2	4957	broad.mit.edu	37	9	131256884	131256884	+	Silent	SNP	A	G	G			TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131256884A>G	uc011mbd.1	+	17	2159	c.1848A>G	c.(1846-1848)CAA>CAG	p.Q616Q	ODF2_uc011maz.1_Silent_p.Q616Q|ODF2_uc011mbc.1_Silent_p.Q535Q|ODF2_uc004bva.2_Silent_p.Q569Q|ODF2_uc004bvb.2_Silent_p.Q592Q|ODF2_uc011mbe.1_Silent_p.Q611Q|ODF2_uc004bvc.2_Silent_p.Q592Q|ODF2_uc011mbf.1_Silent_p.Q597Q|ODF2_uc004bvd.3_Silent_p.Q616Q|ODF2_uc004bve.2_Silent_p.Q597Q|ODF2_uc004bvh.2_5'Flank	NM_002540	NP_002531	Q5BJF6	ODFP2_HUMAN	outer dense fiber of sperm tails 2 isoform 1	616	Potential.				cell differentiation|G2/M transition of mitotic cell cycle|multicellular organismal development|spermatogenesis	centriole|cilium|cytosol|microtubule|spindle pole	protein binding|structural molecule activity			ovary(1)	1						GCCAAGACCAACTGCAGGGCT	0.587													23	76	---	---	---	---	PASS
CKAP5	9793	broad.mit.edu	37	11	46782199	46782199	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:46782199G>A	uc001ndi.1	-	33	4467	c.4357C>T	c.(4357-4359)CGC>TGC	p.R1453C	CKAP5_uc009ylg.1_Missense_Mutation_p.R1339C|CKAP5_uc001ndj.1_Missense_Mutation_p.R1453C|CKAP5_uc001ndh.1_Missense_Mutation_p.R382C	NM_001008938	NP_001008938	Q14008	CKAP5_HUMAN	colonic and hepatic tumor over-expressed protein	1453					cell division|centrosome organization|establishment or maintenance of microtubule cytoskeleton polarity|G2/M transition of mitotic cell cycle|mitotic prometaphase|RNA transport|spindle organization	centrosome|cytosol	protein binding|protein binding			ovary(1)|skin(1)	2						GGTCCCTTGCGTAACATGTTG	0.483													22	91	---	---	---	---	PASS
P2RX3	5024	broad.mit.edu	37	11	57118271	57118271	+	Silent	SNP	C	T	T			TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57118271C>T	uc001nju.2	+	8	817	c.741C>T	c.(739-741)TGC>TGT	p.C247C		NM_002559	NP_002550	P56373	P2RX3_HUMAN	purinergic receptor P2X3	247	Extracellular (Potential).				positive regulation of calcium ion transport into cytosol|positive regulation of calcium-mediated signaling	integral to plasma membrane	ATP binding|extracellular ATP-gated cation channel activity|purinergic nucleotide receptor activity				0						GCTGGGTGTGCGACTTGGACA	0.597													12	42	---	---	---	---	PASS
DDI1	414301	broad.mit.edu	37	11	103908554	103908554	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:103908554T>C	uc001phr.2	+	1	1247	c.1004T>C	c.(1003-1005)CTC>CCC	p.L335P	PDGFD_uc001php.2_Intron|PDGFD_uc001phq.2_Intron	NM_001001711	NP_001001711	Q8WTU0	DDI1_HUMAN	DDI1, DNA-damage inducible 1, homolog 1	335					proteolysis		aspartic-type endopeptidase activity			large_intestine(3)|upper_aerodigestive_tract(1)|pancreas(1)	5		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.00648)|Melanoma(852;0.055)|all_neural(303;0.164)		BRCA - Breast invasive adenocarcinoma(274;0.00128)|Epithelial(105;0.0631)|all cancers(92;0.169)		CTAGATATGCTCCGGAGACAT	0.443													68	158	---	---	---	---	PASS
CASP5	838	broad.mit.edu	37	11	104877972	104877972	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:104877972C>T	uc010rva.1	-	3	303	c.271G>A	c.(271-273)GAT>AAT	p.D91N	CASP5_uc010ruz.1_Missense_Mutation_p.D104N|CASP5_uc010rvb.1_Missense_Mutation_p.D33N|CASP5_uc010rvc.1_Intron|CASP5_uc009yxh.2_5'UTR|CASP5_uc010rvd.1_Intron	NM_004347	NP_004338	P51878	CASP5_HUMAN	caspase 5 isoform a precursor	91	CARD.				apoptosis|cellular response to mechanical stimulus|proteolysis|regulation of apoptosis	intracellular	cysteine-type endopeptidase activity|protein binding			ovary(2)|lung(1)	3		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Melanoma(852;0.0047)		BRCA - Breast invasive adenocarcinoma(274;0.000943)|Epithelial(105;0.0104)|all cancers(92;0.042)		GTCAGAACATCGTGTTTTGCC	0.353													6	187	---	---	---	---	PASS
CASP1	834	broad.mit.edu	37	11	104905316	104905316	+	Intron	SNP	A	G	G	rs536909	by1000genomes	TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:104905316A>G	uc010rve.1	-						CASP1_uc001pig.2_Intron|CASP1_uc001pik.2_5'UTR|CASP1_uc010rvf.1_Intron|CASP1_uc010rvg.1_Intron|CASP1_uc010rvh.1_Intron|CASP1_uc010rvi.1_Intron|CASP1_uc001pim.3_Intron|CASP1_uc009yxi.2_Intron|CASP1_uc010rvj.1_Intron|CASP1_uc009yxj.2_Intron|CASP1_uc010rvk.1_Intron|CASP1_uc010rvl.1_Intron	NM_033292	NP_150634	P29466	CASP1_HUMAN	caspase 1 isoform alpha precursor						cellular response to mechanical stimulus|cellular response to organic substance|positive regulation of I-kappaB kinase/NF-kappaB cascade|proteolysis|signal transduction	cytosol	caspase activator activity|cysteine-type endopeptidase activity|protein binding			ovary(2)	2		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Melanoma(852;0.0047)		BRCA - Breast invasive adenocarcinoma(274;0.000525)|Epithelial(105;0.0128)|all cancers(92;0.0482)	Minocycline(DB01017)|Penicillamine(DB00859)	CCCTCCTCACAGTTGGGTAAT	0.413													4	91	---	---	---	---	PASS
VWA5A	4013	broad.mit.edu	37	11	123995002	123995002	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123995002G>A	uc001pzu.2	+	11	1432	c.1223G>A	c.(1222-1224)AGG>AAG	p.R408K	VWA5A_uc001pzr.2_Missense_Mutation_p.R408K|VWA5A_uc001pzs.2_Missense_Mutation_p.R408K|VWA5A_uc010sae.1_Missense_Mutation_p.R424K|VWA5A_uc001pzt.2_Missense_Mutation_p.R408K	NM_001130142	NP_001123614	O00534	VMA5A_HUMAN	BCSC-1 isoform 1	408	VWFA.									upper_aerodigestive_tract(1)|ovary(1)	2						AAAGAAGTTAGGATCAACAGA	0.388													17	62	---	---	---	---	PASS
H2AFJ	55766	broad.mit.edu	37	12	14927791	14927791	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:14927791A>T	uc009zia.2	+	1	522	c.387A>T	c.(385-387)AAA>AAT	p.K129N	H2AFJ_uc001rch.3_RNA	NM_177925	NP_808760	Q9BTM1	H2AJ_HUMAN	H2A histone family, member J	129					nucleosome assembly	nucleosome|nucleus	DNA binding			ovary(1)	1						CGAAGAGCAAATGACCCTGAC	0.607													20	43	---	---	---	---	PASS
C13orf18	80183	broad.mit.edu	37	13	46935677	46935677	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:46935677C>G	uc010acl.2	-	8	1623	c.1018G>C	c.(1018-1020)GAA>CAA	p.E340Q	C13orf18_uc001vbf.3_Missense_Mutation_p.E273Q|C13orf18_uc001vbg.3_Missense_Mutation_p.E68Q|C13orf18_uc010tfz.1_Missense_Mutation_p.E183Q|C13orf18_uc010acm.2_Missense_Mutation_p.E205Q|C13orf18_uc010acn.2_Missense_Mutation_p.E125Q|C13orf18_uc001vbe.3_Missense_Mutation_p.E340Q|C13orf18_uc001vbh.3_Missense_Mutation_p.E340Q|C13orf18_uc001vbi.3_Missense_Mutation_p.E183Q|C13orf18_uc010aco.1_Missense_Mutation_p.E340Q	NM_025113	NP_079389	Q9H714	CM018_HUMAN	hypothetical protein LOC80183	340											0		Lung NSC(96;2.31e-05)|Breast(56;8.04e-05)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;2.19e-05)		GCTAATAGTTCTGCAGAATTG	0.453													5	19	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	15	20644873	20644873	+	Silent	SNP	C	T	T			TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20644873C>T	uc001ytg.2	-	21	3094	c.2385G>A	c.(2383-2385)CCG>CCA	p.P795P	uc010tyx.1_RNA|uc001yth.3_Silent_p.P795P|uc010tyy.1_Silent_p.P795P					RecName: Full=Putative HERC2-like protein 3;																		TGTCCCATGACGGAAGGACTG	0.428													5	88	---	---	---	---	PASS
HAGH	3029	broad.mit.edu	37	16	1866933	1866933	+	Silent	SNP	G	A	A			TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1866933G>A	uc002cna.2	-	7	1115	c.708C>T	c.(706-708)CCC>CCT	p.P236P	HAGH_uc002cmz.2_Silent_p.P188P|HAGH_uc010uvp.1_Missense_Mutation_p.P200L|HAGH_uc002cnb.1_Silent_p.P188P	NM_005326	NP_005317	Q16775	GLO2_HUMAN	hydroxyacylglutathione hydrolase isoform 1	236					glutathione biosynthetic process	cytoplasm|mitochondrial matrix|mitochondrial matrix	hydroxyacylglutathione hydrolase activity|zinc ion binding			ovary(1)	1		Hepatocellular(780;0.00335)			Glutathione(DB00143)	CGGCATTGCCGGGCTCCACGT	0.627													10	24	---	---	---	---	PASS
PLEKHG4	25894	broad.mit.edu	37	16	67318759	67318759	+	Silent	SNP	G	A	A			TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67318759G>A	uc002eso.3	+	12	4371	c.1836G>A	c.(1834-1836)CTG>CTA	p.L612L	PLEKHG4_uc002esp.3_Silent_p.L419L|PLEKHG4_uc002esq.3_Silent_p.L612L|PLEKHG4_uc010cef.2_Silent_p.L612L|PLEKHG4_uc002ess.3_Silent_p.L612L|PLEKHG4_uc010ceg.2_Silent_p.L531L	NM_015432	NP_056247	Q58EX7	PKHG4_HUMAN	pleckstrin homology domain containing, family G	612					regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity			skin(1)|pancreas(1)	2				OV - Ovarian serous cystadenocarcinoma(108;0.00376)|Epithelial(162;0.0173)|all cancers(182;0.116)|Kidney(780;0.119)		TGTGGGCTCTGGCCACGGGGC	0.672													5	39	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	16	70268080	70268080	+	RNA	SNP	T	C	C	rs149244259	by1000genomes	TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70268080T>C	uc010cfp.1	-	3		c.335A>G								Homo sapiens cDNA, FLJ98908.																		GTCTTACTGTTGGCTAAAAGG	0.373													4	16	---	---	---	---	PASS
C21orf99	149992	broad.mit.edu	37	21	14417489	14417489	+	RNA	SNP	C	G	G			TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:14417489C>G	uc002yiy.3	+	3		c.2764C>G			C21orf99_uc002yja.3_RNA					Homo sapiens C21orf99 protein (C21orf99) mRNA, complete cds.												0						TACAGGCTGGCCACACACCAC	0.299													4	19	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	1	40830820	40830821	+	IGR	INS	-	GAGAGCACCGTGGGC	GAGAGCACCGTGGGC	rs148571058	by1000genomes	TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:40830820_40830821insGAGAGCACCGTGGGC								COL9A2 (47760 upstream) : SMAP2 (8907 downstream)																							CTTTATATACTGAGAGCACCGT	0.317													9	5	---	---	---	---	
HIVEP3	59269	broad.mit.edu	37	1	42011235	42011237	+	Intron	DEL	CAC	-	-	rs150183501		TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:42011235_42011237delCAC	uc001cgz.3	-						HIVEP3_uc001cha.3_Intron|HIVEP3_uc001cgy.2_Intron	NM_024503	NP_078779	Q5T1R4	ZEP3_HUMAN	human immunodeficiency virus type I enhancer						positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	zinc ion binding			ovary(4)|large_intestine(1)|central_nervous_system(1)	6	Ovarian(52;0.00769)|all_hematologic(146;0.109)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0367)				tcactaccatcaccaccaccacc	0.000													4	2	---	---	---	---	
C1orf177	163747	broad.mit.edu	37	1	55285782	55285793	+	Intron	DEL	TCTCTCTTTCTT	-	-	rs141652617	by1000genomes	TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:55285782_55285793delTCTCTCTTTCTT	uc001cyb.3	+						C1orf177_uc001cya.3_Intron	NM_001110533	NP_001104003	Q3ZCV2	CA177_HUMAN	hypothetical protein LOC163747 isoform 2												0						tctttctctctctctctttctttctttctttc	0.066													4	2	---	---	---	---	
DAB1	1600	broad.mit.edu	37	1	58571754	58571757	+	Intron	DEL	TTCC	-	-	rs111873085		TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:58571754_58571757delTTCC	uc001cys.1	-						DAB1_uc001cyt.1_Intron	NM_021080	NP_066566	O75553	DAB1_HUMAN	disabled homolog 1						cell differentiation|nervous system development					skin(2)|ovary(1)	3						gttttttgttttccttccttcctt	0.069													4	6	---	---	---	---	
LEPR	3953	broad.mit.edu	37	1	65915368	65915368	+	Intron	DEL	T	-	-			TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:65915368delT	uc001dci.2	+						LEPR_uc001dcg.2_Intron|LEPR_uc001dch.2_Intron|LEPR_uc009waq.2_Intron	NM_002303	NP_002294	P48357	LEPR_HUMAN	leptin receptor isoform 1						energy reserve metabolic process|multicellular organismal development	extracellular region|integral to membrane|plasma membrane	cytokine receptor activity			skin(1)	1				OV - Ovarian serous cystadenocarcinoma(397;0.00722)|KIRC - Kidney renal clear cell carcinoma(1967;0.094)		cctatttatcttttttttttt	0.224													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	120112549	120112550	+	IGR	INS	-	GAAGGAAG	GAAGGAAG	rs142830746	by1000genomes	TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120112549_120112550insGAAGGAAG								HSD3B1 (54868 upstream) : ZNF697 (49450 downstream)																							aaggaaggaaagaaggaaggaa	0.069													5	3	---	---	---	---	
CTSK	1513	broad.mit.edu	37	1	150778115	150778119	+	Intron	DEL	AAAAA	-	-			TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150778115_150778119delAAAAA	uc001evp.1	-						CTSK_uc001evq.1_Intron	NM_000396	NP_000387	P43235	CATK_HUMAN	cathepsin K preproprotein						proteolysis	lysosome	cysteine-type endopeptidase activity|protein binding			skin(1)	1	all_cancers(9;2.32e-51)|all_epithelial(9;3.89e-42)|all_lung(15;4.59e-35)|Lung NSC(24;1.7e-31)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Colorectal(459;0.171)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0485)|BRCA - Breast invasive adenocarcinoma(12;0.00606)|LUSC - Lung squamous cell carcinoma(543;0.211)			actctatctcaaaaaaaaaaaaaaa	0.049													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	189960110	189960110	+	IGR	DEL	T	-	-			TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:189960110delT								None (None upstream) : FAM5C (106687 downstream)																							GTGAGACACATTAGTAAAAAG	0.378													6	5	---	---	---	---	
WDR64	128025	broad.mit.edu	37	1	241850623	241850624	+	Intron	INS	-	G	G	rs144056780		TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:241850623_241850624insG	uc001hze.1	+						WDR64_uc001hzf.1_Intron			B1ANS9	WDR64_HUMAN	RecName: Full=WD repeat-containing protein 64;											skin(1)	1	Ovarian(103;0.103)	all_cancers(173;0.0121)	OV - Ovarian serous cystadenocarcinoma(106;0.0116)			aaaaaaaaaaaGGTGTTATAAT	0.163													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	92031435	92031436	+	IGR	INS	-	C	C			TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:92031435_92031436insC								GGT8P (61282 upstream) : FKSG73 (97723 downstream)																							CCACCAGCCCTCCTGTGGTAGG	0.653													6	3	---	---	---	---	
NDUFS1	4719	broad.mit.edu	37	2	207006523	207006523	+	Intron	DEL	A	-	-			TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:207006523delA	uc002vbe.2	-						NDUFS1_uc010ziq.1_Intron|NDUFS1_uc010zir.1_Intron|NDUFS1_uc010zis.1_Intron|NDUFS1_uc010zit.1_Intron|NDUFS1_uc010ziu.1_Intron	NM_005006	NP_004997	P28331	NDUS1_HUMAN	NADH dehydrogenase (ubiquinone) Fe-S protein 1,						apoptosis|ATP metabolic process|mitochondrial electron transport, NADH to ubiquinone|reactive oxygen species metabolic process|regulation of mitochondrial membrane potential|transport	mitochondrial intermembrane space|mitochondrial respiratory chain complex I	2 iron, 2 sulfur cluster binding|4 iron, 4 sulfur cluster binding|electron carrier activity|metal ion binding|NADH dehydrogenase (ubiquinone) activity|protein binding			ovary(1)	1					NADH(DB00157)	ccgtcccaccaaaaaaaaaaa	0.124													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	222985966	222985969	+	IGR	DEL	AGGA	-	-	rs35188312		TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:222985966_222985969delAGGA								EPHA4 (547044 upstream) : PAX3 (78638 downstream)																							gaatggatggaggaaggaaggaag	0.054													4	2	---	---	---	---	
DOCK10	55619	broad.mit.edu	37	2	225664783	225664785	+	Intron	DEL	AAA	-	-			TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:225664783_225664785delAAA	uc010fwz.1	-						DOCK10_uc002vob.2_Intron|DOCK10_uc002voa.2_Intron|DOCK10_uc002voc.2_Intron	NM_014689	NP_055504	Q96BY6	DOC10_HUMAN	dedicator of cytokinesis 10								GTP binding			ovary(2)	2		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)		ATAAATAATTAAAAAAAACCATG	0.281													6	3	---	---	---	---	
MYRIP	25924	broad.mit.edu	37	3	39911594	39911595	+	Intron	INS	-	GG	GG			TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:39911594_39911595insGG	uc003cka.2	+						MYRIP_uc010hhu.2_Intron|MYRIP_uc010hhv.2_Intron|MYRIP_uc010hhw.2_Intron|MYRIP_uc010hhx.1_Intron	NM_015460	NP_056275	Q8NFW9	MYRIP_HUMAN	myosin VIIA and Rab interacting protein						intracellular protein transport		actin binding|zinc ion binding			ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	5				KIRC - Kidney renal clear cell carcinoma(284;0.174)|Kidney(284;0.206)		ATCCAGGGCAAGGGCAAGGGCA	0.545													5	4	---	---	---	---	
KIF15	56992	broad.mit.edu	37	3	44887009	44887009	+	Intron	DEL	A	-	-			TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:44887009delA	uc003cnx.3	+						KIF15_uc010hiq.2_Intron|KIF15_uc010hir.2_Intron	NM_020242	NP_064627	Q9NS87	KIF15_HUMAN	kinesin family member 15						blood coagulation|cell proliferation|microtubule-based movement|mitosis	centrosome|cytosol|microtubule|plus-end kinesin complex|spindle	ATP binding|DNA binding|microtubule motor activity			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.0099)|KIRC - Kidney renal clear cell carcinoma(197;0.0564)|Kidney(197;0.0707)		TCTGGCACCTAAAAAAAAAAG	0.378													5	3	---	---	---	---	
PBRM1	55193	broad.mit.edu	37	3	52621433	52621434	+	Frame_Shift_Del	DEL	CT	-	-			TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52621433_52621434delCT	uc003des.2	-	19	3070_3071	c.3058_3059delAG	c.(3058-3060)AGTfs	p.S1020fs	PBRM1_uc003dex.2_RNA|PBRM1_uc003deq.2_Frame_Shift_Del_p.S1020fs|PBRM1_uc003der.2_Frame_Shift_Del_p.S988fs|PBRM1_uc003det.2_Frame_Shift_Del_p.S1035fs|PBRM1_uc003deu.2_Frame_Shift_Del_p.S1035fs|PBRM1_uc003dev.2_RNA|PBRM1_uc003dew.2_Frame_Shift_Del_p.S1020fs|PBRM1_uc010hmk.1_Frame_Shift_Del_p.S995fs|PBRM1_uc003dey.2_Frame_Shift_Del_p.S995fs|PBRM1_uc003dez.1_Frame_Shift_Del_p.S1019fs|PBRM1_uc003dfb.1_Frame_Shift_Del_p.S932fs|PBRM1_uc003dfa.1_Frame_Shift_Del_p.S366fs	NM_181042	NP_060635	Q86U86	PB1_HUMAN	polybromo 1 isoform 4	1020	BAH 1.				chromatin remodeling|mitosis|negative regulation of cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear chromosome	chromatin binding|DNA binding|protein binding			kidney(136)|breast(4)	140				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		GTAATAGTCACTCTTAAAAACT	0.351			Mis|N|F|S|D|O		clear cell renal carcinoma|breast								52	48	---	---	---	---	
AFAP1	60312	broad.mit.edu	37	4	7849931	7849938	+	Intron	DEL	AGGGAGGG	-	-	rs28479993		TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:7849931_7849938delAGGGAGGG	uc003gkg.1	-						AFAP1_uc011bwk.1_Intron	NM_198595	NP_940997	Q8N556	AFAP1_HUMAN	actin filament associated protein 1							actin cytoskeleton|cytoplasm|focal adhesion	actin binding				0						gaaggaagcaagggagggagggagggag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	34373434	34373435	+	IGR	DEL	TG	-	-	rs34289687		TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:34373434_34373435delTG								None (None upstream) : None (None downstream)																							GAtgtgtttttgtgtgtgtgtg	0.431													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	38387897	38387900	+	IGR	DEL	AAGC	-	-	rs6812640	by1000genomes	TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:38387897_38387900delAAGC								TBC1D1 (247104 upstream) : FLJ13197 (226422 downstream)																							ggaaggaaggaagcaaggaaggaa	0.123													3	3	---	---	---	---	
ANK2	287	broad.mit.edu	37	4	114135124	114135124	+	Intron	DEL	A	-	-	rs140341344	by1000genomes	TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:114135124delA	uc003ibe.3	+						ANK2_uc003ibd.3_Intron|ANK2_uc003ibf.3_Intron|ANK2_uc003ibc.2_Intron|ANK2_uc011cgb.1_Intron	NM_001148	NP_001139	Q01484	ANK2_HUMAN	ankyrin 2 isoform 1						axon guidance|signal transduction	apical plasma membrane|basolateral plasma membrane|cytoskeleton|cytosol|sarcomere	protein binding|protein binding			central_nervous_system(7)|ovary(3)|large_intestine(2)|breast(1)|skin(1)	14		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		ttttttttttatttttttttt	0.214													3	4	---	---	---	---	
SLC12A7	10723	broad.mit.edu	37	5	1093609	1093610	+	Intron	INS	-	GGGCGGGGACT	GGGCGGGGACT	rs138268307	by1000genomes	TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1093609_1093610insGGGCGGGGACT	uc003jbu.2	-							NM_006598	NP_006589	Q9Y666	S12A7_HUMAN	solute carrier family 12 (potassium/chloride						potassium ion transport|sodium ion transport	integral to plasma membrane	potassium:chloride symporter activity			skin(2)|large_intestine(1)|ovary(1)	4	Lung NSC(6;2.47e-13)|all_lung(6;1.67e-12)|all_epithelial(6;5.44e-09)		Epithelial(17;0.000497)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|all cancers(22;0.00241)|Lung(60;0.165)		Potassium Chloride(DB00761)	CGGGACACACGGGGCGGGGACT	0.668													3	3	---	---	---	---	
ZFR	51663	broad.mit.edu	37	5	32387978	32387978	+	Intron	DEL	A	-	-			TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:32387978delA	uc003jhr.1	-						ZFR_uc011cny.1_Intron	NM_016107	NP_057191	Q96KR1	ZFR_HUMAN	zinc finger RNA binding protein						multicellular organismal development	chromosome|cytoplasm|nucleus	DNA binding|RNA binding|zinc ion binding				0				STAD - Stomach adenocarcinoma(35;0.19)		CAATGTGGataaaaaaaaaaa	0.294													4	2	---	---	---	---	
C5orf33	133686	broad.mit.edu	37	5	36207548	36207549	+	Intron	INS	-	A	A	rs34974252		TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:36207548_36207549insA	uc003jkf.3	-						C5orf33_uc003jke.3_Intron|C5orf33_uc010iux.2_Intron|C5orf33_uc003jkg.3_Intron|C5orf33_uc011cov.1_Intron	NM_001085411	NP_001078880	Q4G0N4	NAKD1_HUMAN	hypothetical protein LOC133686 isoform 1								NAD+ kinase activity				0	all_lung(31;5.63e-05)		Epithelial(62;0.0254)|all cancers(62;0.0805)|Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			TAGAAGAAATTAAAAAAAAAAA	0.302													3	3	---	---	---	---	
BDP1	55814	broad.mit.edu	37	5	70808891	70808892	+	Intron	DEL	AA	-	-	rs34252624		TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:70808891_70808892delAA	uc003kbp.1	+						BDP1_uc003kbo.2_Intron	NM_018429	NP_060899	A6H8Y1	BDP1_HUMAN	transcription factor-like nuclear regulator						regulation of transcription, DNA-dependent|transcription from RNA polymerase III promoter	nucleoplasm	DNA binding			skin(2)	2		Lung NSC(167;0.000422)|Prostate(74;0.00815)|Ovarian(174;0.0176)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;5.28e-56)|Epithelial(20;2.31e-50)		ccctgtctccaaaaaaaaaaaa	0.168													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	77965253	77965256	+	IGR	DEL	AAGG	-	-			TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:77965253_77965256delAAGG								LHFPL2 (20605 upstream) : ARSB (107783 downstream)																							gacAGACagaaaggaaggaaggaa	0.010													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	124187225	124187228	+	IGR	DEL	CTTT	-	-	rs111256114		TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:124187225_124187228delCTTT								ZNF608 (102725 upstream) : None (None downstream)																							tccttccttcctttcttccttcct	0.029													4	2	---	---	---	---	
GCNT2	2651	broad.mit.edu	37	6	10570181	10570184	+	Intron	DEL	CTTC	-	-	rs56218492		TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:10570181_10570184delCTTC	uc010joo.2	+						GCNT2_uc010jol.2_Intron|GCNT2_uc010jom.2_Intron|GCNT2_uc010jop.2_Intron|GCNT2_uc003mza.2_Intron|GCNT2_uc003mzc.3_Intron|GCNT2_uc003mzd.2_Intron	NM_145649	NP_663624	Q8N0V5	GNT2A_HUMAN	glucosaminyl (N-acetyl) transferase 2,							Golgi membrane|integral to membrane	N-acetyllactosaminide beta-1,6-N-acetylglucosaminyltransferase activity			ovary(2)	2	Ovarian(93;0.107)|Breast(50;0.148)	all_hematologic(90;0.107)		KIRC - Kidney renal clear cell carcinoma(1;0.099)|Kidney(1;0.119)		ttccttccttcttccttccttcct	0.000													4	2	---	---	---	---	
HLA-DRB5	3127	broad.mit.edu	37	6	32523362	32523363	+	Intron	INS	-	GATA	GATA	rs142676080	by1000genomes	TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32523362_32523363insGATA	uc003obk.3	-						HLA-DRB1_uc011dqa.1_Intron|HLA-DRB6_uc003obm.1_Intron|HLA-DRB6_uc003obn.1_Intron|HLA-DRB6_uc003obo.1_Intron	NM_002125	NP_002116	Q30154	DRB5_HUMAN	major histocompatibility complex, class II, DR						antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|immune response	endoplasmic reticulum membrane|Golgi apparatus|integral to membrane|late endosome membrane|lysosomal membrane|MHC class II protein complex					0						AAAGCAATGTGGATAAAGGGAC	0.431													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	49540187	49540188	+	IGR	INS	-	TCCTTCCTTCCTTCCTTCCT	TCCTTCCTTCCTTCCTTCCT			TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:49540187_49540188insTCCTTCCTTCCTTCCTTCCT								C6orf141 (10562 upstream) : RHAG (32705 downstream)																							TATcttccttctccttccttcc	0.109													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	70294172	70294179	+	IGR	DEL	GGAGGGAG	-	-	rs56170729	by1000genomes	TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:70294172_70294179delGGAGGGAG								BAI3 (194770 upstream) : LMBRD1 (91572 downstream)																							aaggaaggaaggagggagggagggaggg	0.120													5	3	---	---	---	---	
CD109	135228	broad.mit.edu	37	6	74466589	74466590	+	Intron	INS	-	A	A	rs138812608	by1000genomes	TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:74466589_74466590insA	uc003php.2	+						CD109_uc010kaz.2_Intron|CD109_uc003phq.2_Intron|CD109_uc010kba.2_Intron	NM_133493	NP_598000	Q6YHK3	CD109_HUMAN	CD109 antigen isoform 1 precursor							anchored to membrane|extracellular space|plasma membrane	serine-type endopeptidase inhibitor activity			large_intestine(2)|ovary(2)	4						TCATTATACAGAAAAAAGTAGA	0.248													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	115632571	115632571	+	IGR	DEL	T	-	-			TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:115632571delT								HS3ST5 (969031 upstream) : FRK (630122 downstream)																							ttctttctcctttccttcctt	0.050													4	2	---	---	---	---	
IFNGR1	3459	broad.mit.edu	37	6	137518967	137518967	+	3'UTR	DEL	A	-	-	rs75851921		TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:137518967delA	uc003qho.2	-	7					IFNGR1_uc011edm.1_3'UTR	NM_000416	NP_000407	P15260	INGR1_HUMAN	interferon gamma receptor 1 precursor						regulation of interferon-gamma-mediated signaling pathway|response to virus	integral to plasma membrane	interferon-gamma receptor activity			upper_aerodigestive_tract(1)	1	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000829)|OV - Ovarian serous cystadenocarcinoma(155;0.00389)	Interferon gamma-1b(DB00033)	TTTTTTGTTTAAAAAAAAAAA	0.373													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	155949000	155949003	+	IGR	DEL	GGAC	-	-	rs151325978	by1000genomes	TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:155949000_155949003delGGAC								NOX3 (171963 upstream) : MIR1202 (318928 downstream)																							aaggaaggaaggacggaaagaagg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	156315948	156315969	+	IGR	DEL	AAAGAAAGAAAGAAAGAAAGAA	-	-	rs68083121		TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:156315948_156315969delAAAGAAAGAAAGAAAGAAAGAA								MIR1202 (47935 upstream) : ARID1B (783117 downstream)																							agaaagaaagaaagaaagaaagaaagaaagaaagaaagagaa	0.144													1	5	---	---	---	---	
C7orf28B	221960	broad.mit.edu	37	7	6840334	6840334	+	Intron	DEL	T	-	-			TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6840334delT	uc003sqx.1	-						C7orf28B_uc011jxd.1_Intron	NM_198097	NP_932765	P86791	CCZ1_HUMAN	hypothetical protein LOC221960							lysosomal membrane					0		Ovarian(82;0.232)		UCEC - Uterine corpus endometrioid carcinoma (126;0.175)		TATAAAGTCATTTTTTTTTTT	0.204													5	3	---	---	---	---	
C7orf30	115416	broad.mit.edu	37	7	23340876	23340877	+	Intron	INS	-	T	T			TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:23340876_23340877insT	uc003swd.1	+							NM_138446	NP_612455	Q96EH3	CG030_HUMAN	hypothetical protein LOC115416							mitochondrion					0			GBM - Glioblastoma multiforme(13;0.154)			CGCAAGGAAGAttttttttttt	0.173													4	2	---	---	---	---	
LOC729156	729156	broad.mit.edu	37	7	66304730	66304731	+	Intron	INS	-	T	T			TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:66304730_66304731insT	uc003tvj.1	-							NR_003934				Homo sapiens cDNA FLJ36054 fis, clone TESTI2018290.												0						TTTTCTTTCCCttttttttttt	0.436													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	56442718	56442718	+	IGR	DEL	G	-	-			TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:56442718delG								XKR4 (4010 upstream) : TMEM68 (208602 downstream)																							aaggaaggaaggaaggaagga	0.139													6	3	---	---	---	---	
CSPP1	79848	broad.mit.edu	37	8	68072192	68072193	+	Intron	INS	-	T	T	rs113132721		TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:68072192_68072193insT	uc003xxi.2	+						CSPP1_uc003xxj.2_Intron|CSPP1_uc003xxk.2_Intron	NM_001077204	NP_001070672	Q1MSJ5	CSPP1_HUMAN	centrosome spindle pole associated protein 1							centrosome|microtubule|spindle				ovary(3)|breast(2)	5	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.00145)|OV - Ovarian serous cystadenocarcinoma(28;0.00589)|all cancers(69;0.0069)|BRCA - Breast invasive adenocarcinoma(89;0.153)			ttccttccttctttcttttctt	0.000													6	4	---	---	---	---	
FREM1	158326	broad.mit.edu	37	9	14824710	14824711	+	Intron	DEL	TA	-	-			TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:14824710_14824711delTA	uc003zlm.2	-						FREM1_uc010mic.2_Intron	NM_144966	NP_659403	Q5H8C1	FREM1_HUMAN	FRAS1 related extracellular matrix 1 precursor						cell communication|multicellular organismal development	basement membrane|integral to membrane	metal ion binding|sugar binding			ovary(2)|breast(2)|pancreas(1)	5				GBM - Glioblastoma multiforme(50;3.53e-06)		ACCACAGTACTATATATATATA	0.356													5	4	---	---	---	---	
SH3GL2	6456	broad.mit.edu	37	9	17666544	17666545	+	Intron	DEL	GT	-	-			TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:17666544_17666545delGT	uc003zna.2	+							NM_003026	NP_003017	Q99962	SH3G2_HUMAN	SH3-domain GRB2-like 2						axon guidance|central nervous system development|endocytosis|epidermal growth factor receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway|nerve growth factor receptor signaling pathway|post-Golgi vesicle-mediated transport	cytosol|Golgi membrane|plasma membrane	identical protein binding|lipid binding			skin(1)	1				GBM - Glioblastoma multiforme(50;2.71e-10)|Lung(42;0.203)		caaaggtaacgtgtgtgtgtgt	0.000													4	2	---	---	---	---	
FAM129B	64855	broad.mit.edu	37	9	130340946	130340947	+	Intron	INS	-	A	A			TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130340946_130340947insA	uc004bri.2	-							NM_001035534	NP_001030611	Q96TA1	NIBL1_HUMAN	hypothetical protein LOC64855 isoform 2								protein binding				0						aaactccgcctaaaaaaaaaaa	0.124													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	4106863	4106866	+	Intron	DEL	GAAA	-	-	rs12775479	by1000genomes	TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:4106863_4106866delGAAA	uc001ihc.1	+											Homo sapiens cDNA FLJ31241 fis, clone KIDNE2004985.																		aggaaggaaggaaagaaagagaga	0.039													4	4	---	---	---	---	
LOC100133308	100133308	broad.mit.edu	37	10	45634765	45634765	+	Intron	DEL	A	-	-			TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:45634765delA	uc001jbz.2	-						LOC100133308_uc009xmq.1_Intron					Homo sapiens cDNA FLJ32851 fis, clone TESTI2003432.												0						TGGTGAAATGAAAAAAAAAAA	0.179													5	5	---	---	---	---	
SPOCK2	9806	broad.mit.edu	37	10	73822296	73822297	+	3'UTR	DEL	CA	-	-	rs111643095		TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:73822296_73822297delCA	uc001jso.1	-	11					SPOCK2_uc001jsp.2_3'UTR|uc001jsq.1_RNA	NM_014767	NP_055582	Q92563	TICN2_HUMAN	sparc/osteonectin, cwcv and kazal-like domains						extracellular matrix organization|regulation of cell differentiation|signal transduction|synapse assembly	proteinaceous extracellular matrix	calcium ion binding				0						CAGCGCATGCcacacacacaca	0.426													5	3	---	---	---	---	
FAM149B1	317662	broad.mit.edu	37	10	74948492	74948492	+	Intron	DEL	A	-	-			TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:74948492delA	uc009xqz.2	+						FAM149B1_uc010qkf.1_Intron|FAM149B1_uc001jtq.2_Intron	NM_173348	NP_775483	Q96BN6	F149B_HUMAN	hypothetical protein LOC317662												0						cagaaaaaagaaaaaaaaaaa	0.000													2	4	---	---	---	---	
C11orf36	283303	broad.mit.edu	37	11	3238092	3238093	+	5'Flank	INS	-	TCTTTCTT	TCTTTCTT	rs117112327		TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:3238092_3238093insTCTTTCTT	uc001lxo.2	+						C11orf36_uc001lxn.2_5'Flank	NR_027138				RecName: Full=Uncharacterized protein C11orf36;												0						ctcttctcttctctttctttct	0.059													5	4	---	---	---	---	
SPON1	10418	broad.mit.edu	37	11	14252331	14252334	+	Intron	DEL	TTCA	-	-	rs62745561		TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:14252331_14252334delTTCA	uc001mle.2	+							NM_006108	NP_006099	Q9HCB6	SPON1_HUMAN	spondin 1, extracellular matrix protein						cell adhesion	extracellular space|proteinaceous extracellular matrix	protein binding				0				Epithelial(150;0.00898)		ccttccttccttcattttttcGTG	0.142													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	45609370	45609371	+	IGR	DEL	GA	-	-			TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:45609370_45609371delGA								SYT13 (301486 upstream) : CHST1 (61056 downstream)																							gggagggagggagagagagaga	0.094													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	89591834	89591834	+	IGR	DEL	C	-	-			TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:89591834delC								TRIM53 (7692 upstream) : TRIM49L (52747 downstream)																							CCATCCCCCACCCCCATGTAG	0.353													3	3	---	---	---	---	
IQSEC3	440073	broad.mit.edu	37	12	271386	271387	+	Intron	INS	-	T	T	rs145585126		TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:271386_271387insT	uc001qhw.1	+						IQSEC3_uc001qhu.1_Intron	NM_015232	NP_056047	Q9UPP2	IQEC3_HUMAN	IQ motif and Sec7 domain 3						regulation of ARF protein signal transduction	cytoplasm	ARF guanyl-nucleotide exchange factor activity			central_nervous_system(2)|large_intestine(1)|skin(1)	4	all_cancers(10;0.016)|all_lung(10;0.0222)|all_epithelial(11;0.0262)|Lung NSC(10;0.031)		OV - Ovarian serous cystadenocarcinoma(31;0.00456)	LUAD - Lung adenocarcinoma(1;0.172)|Lung(1;0.179)		cactgCATCTCTTTTTTTTTTT	0.193													4	2	---	---	---	---	
PPHLN1	51535	broad.mit.edu	37	12	42692995	42692996	+	Intron	INS	-	A	A	rs5797787		TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:42692995_42692996insA	uc001rmy.2	+							NM_201439	NP_958847	Q8NEY8	PPHLN_HUMAN	periphilin 1 isoform 3						keratinization	cytoplasm|nucleus				ovary(1)|breast(1)	2	all_cancers(12;0.00049)|Breast(8;0.165)	Lung NSC(34;0.123)		GBM - Glioblastoma multiforme(48;0.0875)		aagactctgtcaaaaaaaaaaa	0.000													4	4	---	---	---	---	
TMPO	7112	broad.mit.edu	37	12	98914085	98914088	+	Intron	DEL	TTCT	-	-	rs113936216		TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:98914085_98914088delTTCT	uc001tfj.2	+						TMPO_uc001tfi.1_Intron|TMPO_uc001tfk.2_Intron|TMPO_uc001tfl.2_Intron|TMPO_uc001tfh.1_Intron	NM_001032283	NP_001027454	P42167	LAP2B_HUMAN	thymopoietin isoform beta							integral to membrane|nuclear inner membrane	DNA binding|lamin binding			ovary(2)	2						ccttccttccttcTGTGTGTGTGA	0.039													3	8	---	---	---	---	
ATXN2	6311	broad.mit.edu	37	12	111894232	111894232	+	Intron	DEL	A	-	-	rs10708872		TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:111894232delA	uc001tsj.2	-						ATXN2_uc001tsh.2_Intron|ATXN2_uc001tsi.2_Intron|ATXN2_uc001tsk.2_Intron|ATXN2_uc001tsg.2_Intron|ATXN2_uc001tsl.1_Intron	NM_002973	NP_002964	Q99700	ATX2_HUMAN	ataxin 2						cell death|cytoplasmic mRNA processing body assembly|regulation of translation|RNA metabolic process|RNA transport|stress granule assembly	nucleus|perinuclear region of cytoplasm|polysome|stress granule|trans-Golgi network	protein C-terminus binding|RNA binding			ovary(1)|breast(1)	2						CCATCTGGACAACTCCTTTCT	0.483													4	2	---	---	---	---	
KSR2	283455	broad.mit.edu	37	12	117965106	117965107	+	Intron	DEL	AG	-	-	rs68177299		TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:117965106_117965107delAG	uc001two.2	-							NM_173598	NP_775869	Q6VAB6	KSR2_HUMAN	kinase suppressor of ras 2						intracellular signal transduction	cytoplasm|membrane	ATP binding|metal ion binding|protein serine/threonine kinase activity			lung(10)|central_nervous_system(2)|stomach(1)|large_intestine(1)|breast(1)	15	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					acacacacacagacacacacac	0.223													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	82705701	82705704	+	IGR	DEL	ACAC	-	-	rs112756632		TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:82705701_82705704delACAC								None (None upstream) : None (None downstream)																							acacacacagacacacacacacac	0.245													3	4	---	---	---	---	
LRFN5	145581	broad.mit.edu	37	14	42112915	42112916	+	Intron	DEL	CA	-	-			TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:42112915_42112916delCA	uc001wvm.2	+							NM_152447	NP_689660	Q96NI6	LRFN5_HUMAN	leucine rich repeat and fibronectin type III							integral to membrane				ovary(5)|pancreas(2)|central_nervous_system(1)	8			LUAD - Lung adenocarcinoma(50;0.0223)|Lung(238;0.0728)	GBM - Glioblastoma multiforme(112;0.00847)		ataaacacaccacacacacaca	0.302										HNSCC(30;0.082)			3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	98480495	98480496	+	IGR	DEL	TT	-	-	rs36031643		TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:98480495_98480496delTT								C14orf64 (36034 upstream) : C14orf177 (697454 downstream)																							tctttctttctttttctttctt	0.030													4	3	---	---	---	---	
HERC1	8925	broad.mit.edu	37	15	63908449	63908450	+	Intron	INS	-	TCTA	TCTA	rs144336374	by1000genomes	TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:63908449_63908450insTCTA	uc002amp.2	-							NM_003922	NP_003913	Q15751	HERC1_HUMAN	hect domain and RCC1-like domain 1						protein modification process|transport	cytosol|Golgi apparatus|membrane	acid-amino acid ligase activity|ARF guanyl-nucleotide exchange factor activity			ovary(6)|breast(6)|lung(5)|central_nervous_system(2)	19						CAGGAGCCTGCTCTATTAGAAG	0.485													4	3	---	---	---	---	
TRIP4	9325	broad.mit.edu	37	15	64678818	64678819	+	5'Flank	INS	-	GT	GT	rs139577997	by1000genomes	TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:64678818_64678819insGT	uc002anm.2	+							NM_016213	NP_057297	Q15650	TRIP4_HUMAN	thyroid hormone receptor interactor 4						positive regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	cytoplasm|nucleus	ligand-dependent nuclear receptor binding|transcription coactivator activity|zinc ion binding			ovary(1)|kidney(1)|skin(1)	3						caccacgcccAgtgtgtgtgtg	0.025													3	3	---	---	---	---	
HIGD2B	123346	broad.mit.edu	37	15	72971706	72971707	+	Intron	INS	-	A	A	rs34872871		TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:72971706_72971707insA	uc002ava.2	-							NR_002780				Homo sapiens HIG1 domain family, member 2B pseudogene, mRNA (cDNA clone IMAGE:5742106).												0						aactgtgtctcaaaaaaaaaaa	0.005													7	5	---	---	---	---	
SCAPER	49855	broad.mit.edu	37	15	76763441	76763442	+	Intron	INS	-	C	C	rs34088021		TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:76763441_76763442insC	uc002bby.2	-						SCAPER_uc010bkr.2_Intron|SCAPER_uc002bbx.2_Intron|SCAPER_uc002bbz.1_Intron	NM_020843	NP_065894	Q9BY12	SCAPE_HUMAN	S-phase cyclin A-associated protein in the ER							endoplasmic reticulum|nucleus	zinc ion binding			large_intestine(1)|lung(1)|ovary(1)	3						ttcttcttcttttttttttttt	0.257													17	8	---	---	---	---	
ACSBG1	23205	broad.mit.edu	37	15	78472185	78472186	+	Intron	DEL	AT	-	-	rs58848105	by1000genomes	TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:78472185_78472186delAT	uc002bdh.2	-						ACSBG1_uc010umw.1_Intron|ACSBG1_uc010umx.1_Intron	NM_015162	NP_055977	Q96GR2	ACBG1_HUMAN	lipidosin						long-chain fatty acid metabolic process|myelination|very long-chain fatty acid metabolic process	cytoplasmic membrane-bounded vesicle|endoplasmic reticulum|microsome	ATP binding|long-chain fatty acid-CoA ligase activity|very long-chain fatty acid-CoA ligase activity			ovary(1)	1						acacacacacatacacacaTTA	0.401													9	4	---	---	---	---	
PCSK6	5046	broad.mit.edu	37	15	101933619	101933619	+	Frame_Shift_Del	DEL	C	-	-			TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:101933619delC	uc002bwy.2	-	9	1321	c.1007delG	c.(1006-1008)GGCfs	p.G336fs	PCSK6_uc010bpd.2_Frame_Shift_Del_p.G206fs|PCSK6_uc010bpe.2_Frame_Shift_Del_p.G336fs|PCSK6_uc002bxa.2_Frame_Shift_Del_p.G336fs|PCSK6_uc002bxb.2_Frame_Shift_Del_p.G336fs|PCSK6_uc002bxc.1_Frame_Shift_Del_p.G336fs|PCSK6_uc002bxd.1_Frame_Shift_Del_p.G336fs|PCSK6_uc002bxe.2_Frame_Shift_Del_p.G336fs|PCSK6_uc002bxg.1_Frame_Shift_Del_p.G336fs	NM_002570	NP_002561	P29122	PCSK6_HUMAN	paired basic amino acid cleaving system 4	336	Catalytic.				glycoprotein metabolic process|nerve growth factor processing|nerve growth factor production|nerve growth factor receptor signaling pathway|regulation of BMP signaling pathway|secretion by cell	cell surface|endomembrane system|endoplasmic reticulum|extracellular matrix|extracellular space|Golgi lumen|membrane|soluble fraction	eukaryotic cell surface binding|heparin binding|nerve growth factor binding|serine-type endopeptidase activity			pancreas(2)	2	Lung NSC(78;0.00102)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.000803)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			GGAGCCCAGGCCCTGCCGGCC	0.612													31	19	---	---	---	---	
SOLH	6650	broad.mit.edu	37	16	601007	601007	+	Intron	DEL	T	-	-	rs76921944		TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:601007delT	uc002chi.2	+						SOLH_uc002chj.2_5'Flank	NM_005632	NP_005623	O75808	CAN15_HUMAN	small optic lobes						proteolysis	intracellular	calcium-dependent cysteine-type endopeptidase activity|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|breast(1)	2		Hepatocellular(780;0.00335)				TCGGTGAGGGTCCCCTGTCGG	0.736													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	3010024	3010035	+	IGR	DEL	ACCTACCTACCT	-	-	rs111260640		TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3010024_3010035delACCTACCTACCT								FLYWCH1 (8816 upstream) : KREMEN2 (4182 downstream)																							caaccaaccaacctacctacctacctacctac	0.009													4	2	---	---	---	---	
PDXDC1	23042	broad.mit.edu	37	16	15132211	15132212	+	Intron	INS	-	AAAGTTG	AAAGTTG	rs147448533	by1000genomes	TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15132211_15132212insAAAGTTG	uc002ddc.2	+						NTAN1_uc002ddd.2_Intron|NTAN1_uc010uzo.1_Intron	NM_015027	NP_055842	Q6P996	PDXD1_HUMAN	pyridoxal-dependent decarboxylase domain						carboxylic acid metabolic process		carboxy-lyase activity|protein binding|pyridoxal phosphate binding			skin(1)	1					Pyridoxal Phosphate(DB00114)	TTAGTAAGAAAAAAGTTGATTG	0.361													4	3	---	---	---	---	
TMC7	79905	broad.mit.edu	37	16	19051438	19051438	+	Intron	DEL	A	-	-			TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:19051438delA	uc002dfq.2	+						TMC7_uc010vao.1_Intron|TMC7_uc002dfp.2_Intron|TMC7_uc010vap.1_Intron	NM_024847	NP_079123	Q7Z402	TMC7_HUMAN	transmembrane channel-like 7 isoform a							integral to membrane				skin(2)|ovary(1)	3						actccatctcaaaaaaaaaaa	0.060													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	7262561	7262562	+	IGR	INS	-	T	T			TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7262561_7262562insT								TMEM95 (2023 upstream) : TNK1 (21803 downstream)																							ctttctttctattttttttttt	0.084													4	2	---	---	---	---	
CPD	1362	broad.mit.edu	37	17	28771163	28771163	+	Intron	DEL	A	-	-			TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:28771163delA	uc002hfb.1	+						CPD_uc010wbo.1_Intron|CPD_uc010wbp.1_Intron	NM_001304	NP_001295	O75976	CBPD_HUMAN	carboxypeptidase D precursor						proteolysis	integral to membrane	metallocarboxypeptidase activity|serine-type carboxypeptidase activity|zinc ion binding			liver(1)|skin(1)	2						AGAGTACACGAAAAAAAAAAA	0.378													6	3	---	---	---	---	
ACCN1	40	broad.mit.edu	37	17	32116484	32116487	+	Intron	DEL	CACA	-	-	rs36060792	by1000genomes	TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:32116484_32116487delCACA	uc002hhu.2	-							NM_001094	NP_001085	Q16515	ACCN1_HUMAN	amiloride-sensitive cation channel 1, neuronal						central nervous system development|peripheral nervous system development|synaptic transmission	integral to plasma membrane	ligand-gated sodium channel activity|protein binding			ovary(2)|large_intestine(1)|central_nervous_system(1)	4		Breast(31;0.042)|Ovarian(249;0.202)		UCEC - Uterine corpus endometrioid carcinoma (308;0.13)|BRCA - Breast invasive adenocarcinoma(366;0.215)	Amiloride(DB00594)	GAATCATGGTcacacacacacaca	0.108													4	2	---	---	---	---	
TBC1D3	729873	broad.mit.edu	37	17	36361522	36361522	+	Intron	DEL	A	-	-	rs67811849		TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:36361522delA	uc010wdn.1	-									Q8IZP1	TBC3A_HUMAN	Homo sapiens TBC1D3 mRNA for TBC1 domain family, member 3, complete cds.							intracellular	Rab GTPase activator activity				0	Breast(7;2.97e-12)	Breast(25;0.102)|Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		aactctacagaaaaaaaaaaa	0.035													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	53285927	53285938	+	IGR	DEL	GGAGGGAGGGAA	-	-	rs55796427	by1000genomes	TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:53285927_53285938delGGAGGGAGGGAA								STXBP4 (44478 upstream) : HLF (56383 downstream)																							aggaaggaagggagggagggaagaaggaagga	0.156													6	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	60200312	60200313	+	IGR	INS	-	GAAG	GAAG	rs5821351		TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:60200312_60200313insGAAG								MED13 (57669 upstream) : TBC1D3P2 (141756 downstream)																							gaaggagaaaagaaggaaggaa	0.000													4	2	---	---	---	---	
MRPL54	116541	broad.mit.edu	37	19	3765025	3765025	+	Intron	DEL	A	-	-			TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3765025delA	uc002lyq.3	+							NM_172251	NP_758455	Q6P161	RM54_HUMAN	mitochondrial ribosomal protein L54 precursor							mitochondrion|ribosome					0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00467)|STAD - Stomach adenocarcinoma(1328;0.18)		actccgtctcaaaaaaaaaaa	0.229													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	5413323	5413326	+	IGR	DEL	CCTT	-	-			TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5413323_5413326delCCTT								PTPRS (72509 upstream) : ZNRF4 (42100 downstream)																							TATTTCTTTCccttccttccttcc	0.034													3	3	---	---	---	---	
ARHGEF18	23370	broad.mit.edu	37	19	7515569	7515569	+	Intron	DEL	G	-	-	rs12974506		TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7515569delG	uc002mgi.2	+						ARHGEF18_uc010xjm.1_Intron|ARHGEF18_uc002mgh.2_Intron|ARHGEF18_uc002mgj.1_Intron	NM_001130955	NP_001124427	Q6ZSZ5	ARHGI_HUMAN	Rho/Rac guanine nucleotide exchange factor 18						actin cytoskeleton organization|apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of cell shape|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	Rho guanyl-nucleotide exchange factor activity			ovary(1)	1		Renal(5;0.0902)				ATGTTAATGCGGGATCTTGCT	0.433													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	21817582	21817583	+	IGR	DEL	GC	-	-	rs55707945		TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:21817582_21817583delGC								ZNF429 (78514 upstream) : ZNF100 (89261 downstream)																							tcttgcaactgcaaaaaaaaaa	0.064													4	2	---	---	---	---	
ZFP14	57677	broad.mit.edu	37	19	36862888	36862889	+	Intron	INS	-	GGAG	GGAG	rs139062759	by1000genomes	TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36862888_36862889insGGAG	uc010eex.1	-							NM_020917	NP_065968	Q9HCL3	ZFP14_HUMAN	zinc finger protein 14-like						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1	Esophageal squamous(110;0.162)					gaaggagggatggagggaggga	0.045													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	44209364	44209365	+	IGR	INS	-	CTCC	CTCC			TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44209364_44209365insCTCC								PLAUR (34862 upstream) : IRGC (10849 downstream)																							tctctctctctctccctccctc	0.005													2	5	---	---	---	---	
SLC27A5	10998	broad.mit.edu	37	19	59012385	59012388	+	Intron	DEL	TTAA	-	-	rs71677889		TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:59012385_59012388delTTAA	uc002qtc.2	-						SLC27A5_uc002qtb.2_5'Flank	NM_012254	NP_036386	Q9Y2P5	S27A5_HUMAN	solute carrier family 27 (fatty acid						bile acid and bile salt transport|bile acid biosynthetic process|very long-chain fatty acid metabolic process	endoplasmic reticulum membrane|integral to membrane	ATP binding|cholate-CoA ligase activity|long-chain fatty acid-CoA ligase activity				0		all_cancers(17;4.4e-22)|all_epithelial(17;2.15e-16)|Lung NSC(17;1.24e-06)|all_lung(17;5.41e-06)|Colorectal(82;3.46e-05)|Renal(17;0.00179)|all_neural(62;0.00607)|Ovarian(87;0.0443)|Breast(46;0.0928)|Medulloblastoma(540;0.184)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0168)|Lung(386;0.181)		AAATTTAATTttaattaattaatt	0.245													1	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	20229948	20229949	+	IGR	INS	-	A	A	rs139419884	by1000genomes	TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:20229948_20229949insA								TMPRSS15 (453978 upstream) : None (None downstream)																							aagatctgcataaaaaaacaag	0.099													1	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	37667354	37667354	+	IGR	DEL	A	-	-	rs71326671		TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:37667354delA								DOPEY2 (783 upstream) : MORC3 (25133 downstream)																							TTTCTTCtttaaaaaaaaaaa	0.289													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	16915280	16915281	+	IGR	INS	-	T	T	rs148711386		TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:16915280_16915281insT								OR11H1 (465476 upstream) : CCT8L2 (156367 downstream)																							CTCCCTCACCAttttttttttt	0.129													5	4	---	---	---	---	
XG	7499	broad.mit.edu	37	X	2683418	2683425	+	Intron	DEL	GGAAGGAA	-	-			TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:2683418_2683425delGGAAGGAA	uc011mhg.1	+						XG_uc010ndb.2_Intron|XG_uc004cqp.2_Intron	NM_175569	NP_780778	P55808	XG_HUMAN	XG glycoprotein isoform 1 precursor							integral to membrane|plasma membrane				ovary(1)	1		all_cancers(21;9e-05)|all_epithelial(21;6.22e-06)|all_lung(23;0.000597)|Lung NSC(23;0.00901)|Lung SC(21;0.186)				agggagggagggaaggaaggaaggaagg	0.135													5	5	---	---	---	---	
PAGE1	8712	broad.mit.edu	37	X	49458624	49458625	+	Intron	INS	-	ACAC	ACAC	rs34808373		TCGA-BP-4975-01A-01D-1462-08	TCGA-BP-4975-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:49458624_49458625insACAC	uc004dom.2	-							NM_003785	NP_003776	O75459	GAGB1_HUMAN	P antigen family, member 1						cellular defense response					skin(1)	1	Ovarian(276;0.236)					CAATGCATGAGacacacacaca	0.366													4	3	---	---	---	---	
