Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
MTOR	2475	broad.mit.edu	37	1	11217230	11217230	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11217230C>A	uc001asd.2	-	30	4569	c.4448G>T	c.(4447-4449)TGC>TTC	p.C1483F		NM_004958	NP_004949	P42345	MTOR_HUMAN	FK506 binding protein 12-rapamycin associated	1483	FAT.				cell growth|cellular response to hypoxia|insulin receptor signaling pathway|nerve growth factor receptor signaling pathway|peptidyl-serine phosphorylation|phosphatidylinositol-mediated signaling|protein autophosphorylation|protein catabolic process|response to amino acid stimulus|response to nutrient|T cell costimulation|TOR signaling cascade	endoplasmic reticulum membrane|Golgi membrane|lysosome|mitochondrial outer membrane|phosphatidylinositol 3-kinase complex|PML body|TORC1 complex|TORC2 complex	ATP binding|phosphoprotein binding|protein serine/threonine kinase activity			central_nervous_system(7)|lung(6)|ovary(6)|skin(3)|kidney(3)|large_intestine(2)|breast(2)	29						GGCCTCGAGGCAGCGCATGCG	0.527													9	279	---	---	---	---	PASS
CLCNKB	1188	broad.mit.edu	37	1	16372093	16372093	+	Silent	SNP	C	T	T			TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16372093C>T	uc001axw.3	+	3	221	c.141C>T	c.(139-141)GGC>GGT	p.G47G	FAM131C_uc010obz.1_Intron|CLCNKB_uc001axx.3_Silent_p.G47G	NM_000085	NP_000076	P51801	CLCKB_HUMAN	chloride channel Kb isoform 1	47	Cytoplasmic (Potential).				excretion	chloride channel complex|integral to plasma membrane	voltage-gated chloride channel activity			skin(1)	1		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Colorectal(212;8.04e-08)|COAD - Colon adenocarcinoma(227;5.46e-06)|BRCA - Breast invasive adenocarcinoma(304;9.02e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.00655)|READ - Rectum adenocarcinoma(331;0.0649)		TCCGCCTGGGCGAGGACTGGT	0.642													6	72	---	---	---	---	PASS
IGSF21	84966	broad.mit.edu	37	1	18688657	18688657	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:18688657T>C	uc001bau.1	+	5	856	c.473T>C	c.(472-474)TTC>TCC	p.F158S	IGSF21_uc001bav.1_5'UTR	NM_032880	NP_116269	Q96ID5	IGS21_HUMAN	immunoglobin superfamily, member 21 precursor	158						extracellular region				ovary(2)|large_intestine(1)|skin(1)	4		Colorectal(325;0.000147)|Renal(390;0.00145)|all_lung(284;0.00366)|Lung NSC(340;0.00376)|Breast(348;0.00387)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0121)|BRCA - Breast invasive adenocarcinoma(304;5.52e-05)|Kidney(64;0.00103)|KIRC - Kidney renal clear cell carcinoma(64;0.0102)|STAD - Stomach adenocarcinoma(196;0.0118)|READ - Rectum adenocarcinoma(331;0.157)		CCAGCCCCCTTCAGCCGCTAC	0.582													5	8	---	---	---	---	PASS
GPN2	54707	broad.mit.edu	37	1	27216524	27216524	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:27216524T>C	uc001bnd.1	-	1	346	c.64A>G	c.(64-66)AAG>GAG	p.K22E		NM_018066	NP_060536	Q9H9Y4	GPN2_HUMAN	ATP binding domain 1 family, member B	22	GTP (Potential).						GTP binding				0						TACGTGGTCTTCCCTGAGCCC	0.731													5	8	---	---	---	---	PASS
FAAH	2166	broad.mit.edu	37	1	46871335	46871335	+	Silent	SNP	A	T	T			TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:46871335A>T	uc001cpu.2	+	5	736	c.654A>T	c.(652-654)TCA>TCT	p.S218S	FAAH_uc001cpv.2_RNA	NM_001441	NP_001432	O00519	FAAH1_HUMAN	fatty acid amide hydrolase	218	Cytoplasmic (By similarity).				fatty acid catabolic process	cytoplasm|cytoskeleton|endomembrane system|integral to membrane|organelle membrane	carbon-nitrogen ligase activity, with glutamine as amido-N-donor|fatty acid amide hydrolase activity			ovary(1)|breast(1)	2	Acute lymphoblastic leukemia(166;0.155)				Propofol(DB00818)|Thiopental(DB00599)	GGGGCTCCTCAGGGGGTGAAG	0.622													13	212	---	---	---	---	PASS
MYSM1	114803	broad.mit.edu	37	1	59125681	59125681	+	Missense_Mutation	SNP	T	A	A			TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:59125681T>A	uc009wab.1	-	20	2498	c.2475A>T	c.(2473-2475)GAA>GAT	p.E825D	uc001cza.2_5'Flank|MYSM1_uc009waa.1_Missense_Mutation_p.E231D|MYSM1_uc001czc.2_RNA	NM_001085487	NP_001078956	Q5VVJ2	MYSM1_HUMAN	Myb-like, SWIRM and MPN domains 1	825					histone deubiquitination|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromatin remodeling complex	DNA binding|histone binding|metal ion binding|metallopeptidase activity|transcription coactivator activity|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			skin(1)	1	all_cancers(7;9.36e-06)					ACATTAACAATTCCTTTGTAC	0.299													41	75	---	---	---	---	PASS
GALNT13	114805	broad.mit.edu	37	2	155307077	155307077	+	3'UTR	SNP	C	A	A			TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:155307077C>A	uc002tyr.3	+	13					GALNT13_uc002tyt.3_3'UTR|GALNT13_uc010fod.2_3'UTR|uc002tyu.1_Intron	NM_052917	NP_443149	Q8IUC8	GLT13_HUMAN	UDP-N-acetyl-alpha-D-galactosamine:polypeptide							Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			ovary(2)|pancreas(2)|central_nervous_system(1)|skin(1)	6						TCATGTCCTCCAAGCCATGAA	0.393													5	11	---	---	---	---	PASS
STAB1	23166	broad.mit.edu	37	3	52547770	52547770	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52547770A>G	uc003dej.2	+	31	3382	c.3308A>G	c.(3307-3309)GAC>GGC	p.D1103G		NM_015136	NP_055951	Q9NY15	STAB1_HUMAN	stabilin 1 precursor	1103	FAS1 3.|Extracellular (Potential).				cell adhesion|cell-cell signaling|defense response to bacterium|inflammatory response|negative regulation of angiogenesis|receptor-mediated endocytosis	integral to plasma membrane	bacterial cell surface binding|hyaluronic acid binding|low-density lipoprotein receptor activity|protein disulfide oxidoreductase activity|scavenger receptor activity			large_intestine(3)|upper_aerodigestive_tract(2)|central_nervous_system(1)|breast(1)|skin(1)|pancreas(1)	9				BRCA - Breast invasive adenocarcinoma(193;1.73e-05)|Kidney(197;0.00182)|KIRC - Kidney renal clear cell carcinoma(197;0.00205)|OV - Ovarian serous cystadenocarcinoma(275;0.0482)		GATGTGGCTGACCTCCTTGCC	0.587													4	18	---	---	---	---	PASS
HAPLN1	1404	broad.mit.edu	37	5	82948369	82948369	+	Silent	SNP	G	T	T			TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:82948369G>T	uc003kim.2	-	2	446	c.375C>A	c.(373-375)GTC>GTA	p.V125V	HAPLN1_uc003kin.2_Silent_p.V125V	NM_001884	NP_001875	P10915	HPLN1_HUMAN	hyaluronan and proteoglycan link protein 1	125	Ig-like V-type.				cell adhesion	proteinaceous extracellular matrix	hyaluronic acid binding			large_intestine(3)|ovary(1)|skin(1)	5		Lung NSC(167;0.0484)|all_lung(232;0.0522)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;7.82e-42)|Epithelial(54;5.88e-35)|all cancers(79;1.14e-29)		GGTCTGTGATGACCAGAGAAG	0.433													80	228	---	---	---	---	PASS
SLC17A4	10050	broad.mit.edu	37	6	25770630	25770630	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:25770630C>G	uc003nfe.2	+	5	669	c.550C>G	c.(550-552)CAG>GAG	p.Q184E	SLC17A4_uc011djx.1_Intron|SLC17A4_uc003nff.1_Intron|SLC17A4_uc003nfg.2_Missense_Mutation_p.Q121E	NM_005495	NP_005486	Q9Y2C5	S17A4_HUMAN	solute carrier family 17 (sodium phosphate),	184	Helical; (Potential).				phosphate metabolic process	integral to plasma membrane|membrane fraction	sodium:phosphate symporter activity			skin(1)	1						ATTAACTGGTCAGTATTCAAT	0.438													92	199	---	---	---	---	PASS
NCF1C	654817	broad.mit.edu	37	7	74573755	74573755	+	Nonsense_Mutation	SNP	G	T	T			TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:74573755G>T	uc003ubv.2	-	9	832	c.750C>A	c.(748-750)TAC>TAA	p.Y250*		NR_003187				RecName: Full=Putative neutrophil cytosol factor 1C;          Short=NCF-1C; AltName: Full=Putative SH3 and PX domain-containing protein 1C;												0						TGGACGGAAAGTAGCCTGTGA	0.652													4	29	---	---	---	---	PASS
AKR1B15	441282	broad.mit.edu	37	7	134254201	134254201	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:134254201A>C	uc011kpr.1	+	5	654	c.355A>C	c.(355-357)AAA>CAA	p.K119Q	AKR1B15_uc003vrt.2_Missense_Mutation_p.K91Q|AKR1B15_uc011kps.1_Missense_Mutation_p.K91Q	NM_001080538	NP_001074007	C9JRZ8	AK1BF_HUMAN	aldo-keto reductase family 1, member B15	119							oxidoreductase activity			ovary(1)	1						CCTTGTGAGGAAAGCCTTTGA	0.473													49	107	---	---	---	---	PASS
ZNF623	9831	broad.mit.edu	37	8	144732593	144732593	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144732593G>A	uc003yzd.2	+	1	640	c.551G>A	c.(550-552)TGT>TAT	p.C184Y	ZNF623_uc011lkp.1_Missense_Mutation_p.C144Y|ZNF623_uc003yzc.2_Missense_Mutation_p.C144Y	NM_014789	NP_055604	O75123	ZN623_HUMAN	zinc finger protein 623 isoform 1	184	C2H2-type 3.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;5.28e-40)|all cancers(56;5.23e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.146)			TGTAATGTGTGTGGGAAAGAC	0.483													6	106	---	---	---	---	PASS
DOLPP1	57171	broad.mit.edu	37	9	131851258	131851258	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131851258A>C	uc004bxc.2	+	8	717	c.689A>C	c.(688-690)CAA>CCA	p.Q230P	DOLPP1_uc004bxd.2_Missense_Mutation_p.Q187P|DOLPP1_uc004bxe.2_RNA|DOLPP1_uc004bxf.2_Missense_Mutation_p.Q109P	NM_020438	NP_065171	Q86YN1	DOPP1_HUMAN	dolichyl pyrophosphate phosphatase 1 isoform a	230					dolichyl diphosphate biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine	integral to endoplasmic reticulum membrane	dolichyldiphosphatase activity			skin(1)	1						AGGAACAGACAACGCAAGCTG	0.582													11	54	---	---	---	---	PASS
RUFY2	55680	broad.mit.edu	37	10	70140991	70140991	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:70140991G>A	uc001job.2	-	11	1537	c.1210C>T	c.(1210-1212)CAG>TAG	p.Q404*	RUFY2_uc001jnz.1_RNA|RUFY2_uc001joc.2_Nonsense_Mutation_p.Q335*|RUFY2_uc010qiw.1_Nonsense_Mutation_p.Q311*|RUFY2_uc001jod.1_Nonsense_Mutation_p.Q369*	NM_017987	NP_060457	Q8WXA3	RUFY2_HUMAN	RUN and FYVE domain-containing 2 isoform a	418	Potential.					nucleus	metal ion binding			ovary(1)	1						ATCCTTACCTGCAACTTTTGA	0.318													35	127	---	---	---	---	PASS
C10orf118	55088	broad.mit.edu	37	10	115885644	115885644	+	Splice_Site	SNP	C	A	A			TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:115885644C>A	uc001lbb.1	-	15	3265	c.2613_splice	c.e15+1	p.K871_splice	C10orf118_uc009xyd.1_Intron|C10orf118_uc001lbc.1_Splice_Site_p.K871_splice|C10orf118_uc009xye.1_Splice_Site	NM_018017	NP_060487	Q7Z3E2	CJ118_HUMAN	CTCL tumor antigen L14-2											ovary(2)	2		Colorectal(252;0.172)|Breast(234;0.188)		Epithelial(162;0.0161)|all cancers(201;0.0397)		AACACAAATACCTTCAAAGTA	0.388													24	68	---	---	---	---	PASS
DCHS1	8642	broad.mit.edu	37	11	6648210	6648210	+	Silent	SNP	G	A	A			TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6648210G>A	uc001mem.1	-	14	6470	c.6060C>T	c.(6058-6060)ATC>ATT	p.I2020I		NM_003737	NP_003728	Q96JQ0	PCD16_HUMAN	dachsous 1 precursor	2020	Cadherin 19.|Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(3)|large_intestine(1)|pancreas(1)	5		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GGGCCACGCGGATTTCACCAG	0.587													3	35	---	---	---	---	PASS
OVCH2	341277	broad.mit.edu	37	11	7722880	7722880	+	Silent	SNP	G	A	A			TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:7722880G>A	uc010rbf.1	-	6	702	c.702C>T	c.(700-702)GAC>GAT	p.D234D		NM_198185	NP_937828			ovochymase 2 precursor												0				Epithelial(150;7.9e-08)|BRCA - Breast invasive adenocarcinoma(625;0.197)		CCTGACATGCGTCTCTCCCTC	0.483													3	36	---	---	---	---	PASS
MS4A12	54860	broad.mit.edu	37	11	60265014	60265014	+	Missense_Mutation	SNP	C	G	G	rs146116909		TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60265014C>G	uc001npr.2	+	2	280	c.223C>G	c.(223-225)CCA>GCA	p.P75A	MS4A12_uc009ynb.2_Missense_Mutation_p.P75A	NM_017716	NP_060186	Q9NXJ0	M4A12_HUMAN	membrane-spanning 4-domains, subfamily A, member	75	Cytoplasmic (Potential).					integral to membrane	receptor activity				0						AATGATAAATCCAAGTGTGGG	0.438													29	67	---	---	---	---	PASS
DAGLA	747	broad.mit.edu	37	11	61495757	61495757	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61495757G>A	uc001nsa.2	+	7	880	c.769G>A	c.(769-771)GAG>AAG	p.E257K		NM_006133	NP_006124	Q9Y4D2	DGLA_HUMAN	neural stem cell-derived dendrite regulator	257	Cytoplasmic (Potential).				cell death|lipid catabolic process|platelet activation	integral to membrane|plasma membrane	acylglycerol lipase activity|metal ion binding|triglyceride lipase activity			ovary(2)|central_nervous_system(1)	3				READ - Rectum adenocarcinoma(4;0.219)		CGTGCTGGACGAGGTGAGCAC	0.662													23	37	---	---	---	---	PASS
ZNF384	171017	broad.mit.edu	37	12	6776846	6776846	+	3'UTR	SNP	T	A	A	rs142697690	by1000genomes	TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6776846T>A	uc010sfh.1	-	11					ZNF384_uc001qpz.2_3'UTR|ZNF384_uc001qqa.2_3'UTR|ZNF384_uc001qqb.2_3'UTR|ZNF384_uc001qqc.2_3'UTR|ZNF384_uc001qqd.2_3'UTR|ZNF384_uc001qqe.2_3'UTR	NM_001135734	NP_001129206	Q8TF68	ZN384_HUMAN	nuclear matrix transcription factor 4 isoform d						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding		EWSR1/ZNF384(4)	haematopoietic_and_lymphoid_tissue(4)|central_nervous_system(3)|kidney(1)	8						CAGGACTACTTCTTCCTCTTC	0.542			T	EWSR1|TAF15 	ALL								80	142	---	---	---	---	PASS
CLECL1	160365	broad.mit.edu	37	12	9875113	9875113	+	3'UTR	SNP	C	A	A			TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9875113C>A	uc001qwj.2	-	2					CLECL1_uc001qwi.2_Intron	NM_172004	NP_742001	Q8IZS7	CLCL1_HUMAN	type II transmembrane protein DCAL1							integral to membrane|plasma membrane	sugar binding				0						ATTCATTCAACTAATATTTGT	0.343													3	32	---	---	---	---	PASS
HOXC8	3224	broad.mit.edu	37	12	54403161	54403161	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54403161C>A	uc001ser.2	+	1	272	c.93C>A	c.(91-93)AGC>AGA	p.S31R		NM_022658	NP_073149	P31273	HXC8_HUMAN	homeobox C8	31						nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1						TCCCTCAGAGCGTGGGCAGGA	0.632													48	115	---	---	---	---	PASS
VEZT	55591	broad.mit.edu	37	12	95645766	95645766	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:95645766A>T	uc001tdz.2	+	2	192	c.87A>T	c.(85-87)GAA>GAT	p.E29D	VEZT_uc009zsy.1_5'UTR|VEZT_uc001tdr.2_5'UTR|VEZT_uc001tds.2_5'UTR|VEZT_uc001tdt.2_5'UTR|VEZT_uc009zsz.1_Missense_Mutation_p.E29D|VEZT_uc001tdv.2_5'UTR|VEZT_uc001tdw.1_5'UTR|VEZT_uc009zta.1_5'UTR	NM_017599	NP_060069	Q9HBM0	VEZA_HUMAN	vezatin, adherens junctions transmembrane	29						acrosomal vesicle|adherens junction|integral to membrane|nucleus				ovary(1)	1						CAGACTTTGAAATATGTTCTT	0.358													44	91	---	---	---	---	PASS
GPC5	2262	broad.mit.edu	37	13	92345764	92345764	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:92345764A>T	uc010tif.1	+	3	1015	c.649A>T	c.(649-651)AGG>TGG	p.R217W		NM_004466	NP_004457	P78333	GPC5_HUMAN	glypican 5 precursor	217						anchored to membrane|extracellular space|integral to plasma membrane|proteinaceous extracellular matrix	heparan sulfate proteoglycan binding			ovary(2)|skin(2)|upper_aerodigestive_tract(1)	5	all_cancers(3;1.43e-07)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)	Lung NSC(4;0.00454)				ACAGATGGGGAGGTCCCTGCT	0.522													19	40	---	---	---	---	PASS
FAM179B	23116	broad.mit.edu	37	14	45537687	45537687	+	Silent	SNP	C	T	T			TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:45537687C>T	uc001wvv.2	+	17	4860	c.4651C>T	c.(4651-4653)CTG>TTG	p.L1551L	FAM179B_uc001wvw.2_Silent_p.L1604L|FAM179B_uc010anc.2_RNA	NM_015091	NP_055906	Q9Y4F4	F179B_HUMAN	hypothetical protein LOC23116	1551	HEAT 5.						binding			skin(2)|upper_aerodigestive_tract(1)	3						TCTGGTGGCTCTGGAAACAAT	0.299													34	58	---	---	---	---	PASS
HERC2P2	400322	broad.mit.edu	37	15	23312250	23312250	+	Missense_Mutation	SNP	A	G	G	rs139598302	by1000genomes	TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:23312250A>G	uc001yvr.2	-	19	2872	c.2672T>C	c.(2671-2673)GTG>GCG	p.V891A	HERC2P2_uc001yvq.2_5'Flank|HERC2P2_uc001yvo.3_5'Flank|HERC2P2_uc001yvp.3_Splice_Site					RecName: Full=Putative HERC2-like protein 3;												0						CATGTCCCTCACCCTTTCGGT	0.458													3	36	---	---	---	---	PASS
WDR72	256764	broad.mit.edu	37	15	53908347	53908347	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:53908347G>C	uc002acj.2	-	15	2098	c.2056C>G	c.(2056-2058)CTG>GTG	p.L686V	WDR72_uc010bfi.1_Missense_Mutation_p.L686V	NM_182758	NP_877435	Q3MJ13	WDR72_HUMAN	WD repeat domain 72	686										lung(1)|skin(1)	2				all cancers(107;0.0511)		AGGTTTTCCAGATCAAATAGA	0.423													21	91	---	---	---	---	PASS
HERC1	8925	broad.mit.edu	37	15	63955350	63955350	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:63955350T>C	uc002amp.2	-	44	8882	c.8734A>G	c.(8734-8736)ATA>GTA	p.I2912V		NM_003922	NP_003913	Q15751	HERC1_HUMAN	hect domain and RCC1-like domain 1	2912					protein modification process|transport	cytosol|Golgi apparatus|membrane	acid-amino acid ligase activity|ARF guanyl-nucleotide exchange factor activity			ovary(6)|breast(6)|lung(5)|central_nervous_system(2)	19						TGCAAAGATATTCCTTCTCTC	0.408													14	297	---	---	---	---	PASS
GOLGA6L5	374650	broad.mit.edu	37	15	85056021	85056021	+	RNA	SNP	T	C	C	rs1062001		TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85056021T>C	uc002bkm.2	-	6		c.539A>G				NR_003246				Homo sapiens cDNA FLJ33459 fis, clone BRAMY2000585.												0						GTAGCTGCTCTACCTTAGATG	0.502													4	10	---	---	---	---	PASS
IFT140	9742	broad.mit.edu	37	16	1639724	1639724	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1639724C>T	uc002cmb.2	-	7	1054	c.692G>A	c.(691-693)AGC>AAC	p.S231N		NM_014714	NP_055529	Q96RY7	IF140_HUMAN	intraflagellar transport 140	231										ovary(3)|pancreas(1)|skin(1)	5		Hepatocellular(780;0.219)				CTGAATCGTGCTGTCTGCGGA	0.572													34	68	---	---	---	---	PASS
TBC1D10B	26000	broad.mit.edu	37	16	30380671	30380671	+	Silent	SNP	C	T	T			TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30380671C>T	uc002dxu.2	-	1	852	c.834G>A	c.(832-834)GGG>GGA	p.G278G		NM_015527	NP_056342	Q4KMP7	TB10B_HUMAN	TBC1 domain family, member 10B	278						cytoplasm	Rab GTPase activator activity				0			Colorectal(24;0.193)			ACTCCAAGGTCCCAGACATGA	0.617													4	9	---	---	---	---	PASS
MT1G	4495	broad.mit.edu	37	16	56701946	56701946	+	5'UTR	SNP	A	G	G			TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:56701946A>G	uc002eju.1	-	1					MT1G_uc002ejv.1_RNA|MT1H_uc002ejw.2_5'Flank	NM_005950	NP_005941	P13640	MT1G_HUMAN	metallothionein 1G								metal ion binding|protein binding				0						GCGAGAAGGGAAGAGGCAGTG	0.652													32	49	---	---	---	---	PASS
KIF19	124602	broad.mit.edu	37	17	72340956	72340956	+	Silent	SNP	C	A	A			TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72340956C>A	uc002jkm.3	+	7	777	c.639C>A	c.(637-639)GCC>GCA	p.A213A	KIF19_uc002jkj.2_Silent_p.A213A|KIF19_uc002jkk.2_Silent_p.A171A|KIF19_uc002jkl.2_Silent_p.A171A	NM_153209	NP_694941	Q2TAC6	KIF19_HUMAN	kinesin family member 19	213	Kinesin-motor.				microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity				0						CCACGGCCGCCAACCAGACGT	0.672													23	33	---	---	---	---	PASS
LMAN1	3998	broad.mit.edu	37	18	57026429	57026429	+	Silent	SNP	C	T	T			TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:57026429C>T	uc002lhz.2	-	1	80	c.48G>A	c.(46-48)CTG>CTA	p.L16L	LMAN1_uc010xek.1_Silent_p.L16L	NM_005570	NP_005561	P49257	LMAN1_HUMAN	lectin, mannose-binding, 1 precursor	16					blood coagulation|ER to Golgi vesicle-mediated transport|post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine|protein transport	endoplasmic reticulum membrane|ER to Golgi transport vesicle membrane|ER-Golgi intermediate compartment membrane|Golgi membrane|integral to membrane	mannose binding|metal ion binding|unfolded protein binding			skin(1)	1		Colorectal(73;0.0946)			Antihemophilic Factor(DB00025)	AGGCGCAGAACAGCGGCCGAA	0.672													33	50	---	---	---	---	PASS
C19orf26	255057	broad.mit.edu	37	19	1234610	1234610	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1234610T>C	uc002lrm.2	-	6	844	c.569A>G	c.(568-570)CAC>CGC	p.H190R		NM_152769	NP_689982	Q8N350	DOS_HUMAN	downstream of Stk11	216						integral to membrane					0		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGTGGCCGGGTGGGGCGTGGT	0.682										HNSCC(14;0.022)			5	2	---	---	---	---	PASS
DOT1L	84444	broad.mit.edu	37	19	2223398	2223398	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2223398G>A	uc002lvb.3	+	25	3545	c.3509G>A	c.(3508-3510)CGG>CAG	p.R1170Q	DOT1L_uc002lvc.1_Missense_Mutation_p.R464Q	NM_032482	NP_115871	Q8TEK3	DOT1L_HUMAN	DOT1-like, histone H3 methyltransferase	1170						nucleus	DNA binding|histone-lysine N-methyltransferase activity|protein binding			pancreas(2)|upper_aerodigestive_tract(1)|lung(1)	4		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		AAGAAGGAGCGGCCTCTGAGC	0.657													25	71	---	---	---	---	PASS
ZNF100	163227	broad.mit.edu	37	19	21909595	21909595	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:21909595G>T	uc002nqi.2	-	5	1718	c.1519C>A	c.(1519-1521)CAT>AAT	p.H507N	ZNF100_uc002nqh.2_Missense_Mutation_p.H443N	NM_173531	NP_775802	Q8IYN0	ZN100_HUMAN	zinc finger protein 100	507	C2H2-type 12.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						TCTCCAGTATGAGTTATCTTA	0.373													57	112	---	---	---	---	PASS
STRN4	29888	broad.mit.edu	37	19	47226196	47226196	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47226196G>A	uc002pfl.2	-	14	1810	c.1777C>T	c.(1777-1779)CCC>TCC	p.P593S	STRN4_uc002pfm.2_Missense_Mutation_p.P600S|STRN4_uc010xyf.1_RNA	NM_013403	NP_037535	Q9NRL3	STRN4_HUMAN	zinedin isoform 1	593	WD 4.					cytoplasm|membrane	armadillo repeat domain binding|calmodulin binding|protein complex binding|protein phosphatase 2A binding				0		Ovarian(192;0.0129)|all_neural(266;0.0459)|Breast(70;0.212)		OV - Ovarian serous cystadenocarcinoma(262;0.000563)|all cancers(93;0.00138)|Epithelial(262;0.0217)|GBM - Glioblastoma multiforme(486;0.035)		ACTGAGGTGGGGACCCCGTGC	0.662													4	62	---	---	---	---	PASS
MYH7B	57644	broad.mit.edu	37	20	33590051	33590051	+	3'UTR	SNP	A	C	C			TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33590051A>C	uc002xbi.1	+	43						NM_020884	NP_065935	A7E2Y1	MYH7B_HUMAN	myosin, heavy polypeptide 7B, cardiac muscle,							membrane|myosin filament	actin binding|ATP binding|motor activity			ovary(1)|breast(1)	2			BRCA - Breast invasive adenocarcinoma(18;0.00691)			GGCTGAGGCCACCTGCCCCGA	0.567											OREG0025884	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	9	29	---	---	---	---	PASS
SFRS15	57466	broad.mit.edu	37	21	33066569	33066569	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:33066569C>T	uc002ypd.2	-	11	1696	c.1270G>A	c.(1270-1272)GTT>ATT	p.V424I	SFRS15_uc002ype.2_Missense_Mutation_p.V424I|SFRS15_uc010glu.2_Missense_Mutation_p.V409I|SFRS15_uc002ypf.1_Missense_Mutation_p.V98I	NM_020706	NP_065757	O95104	SFR15_HUMAN	splicing factor, arginine/serine-rich 15 isoform	424						nucleus	nucleotide binding|RNA binding				0						TGTCGCTTAACCTCTTGAATA	0.318													18	54	---	---	---	---	PASS
NHSL2	340527	broad.mit.edu	37	X	71264802	71264802	+	Intron	SNP	T	C	C			TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:71264802T>C	uc011mqa.1	+						RPS26P11_uc004eai.2_RNA	NM_001013627	NP_001013649	Q5HYW2	NHSL2_HUMAN	NHS-like 2												0	Renal(35;0.156)					AAAATGGAAATTGTACTTAAA	0.453													3	7	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	1	32888257	32888257	+	IGR	DEL	A	-	-			TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32888257delA								BSDC1 (28195 upstream) : ZBTB8A (42401 downstream)																							tccatctcagaaaaaaaaaaa	0.139													3	3	---	---	---	---	
DEPDC1	55635	broad.mit.edu	37	1	68955440	68955440	+	Intron	DEL	C	-	-			TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:68955440delC	uc001dem.3	-						DEPDC1_uc001dek.3_Intron|DEPDC1_uc001del.3_Intron	NM_001114120	NP_001107592	Q5TB30	DEP1A_HUMAN	DEP domain containing 1 isoform a						intracellular signal transduction|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	transcriptional repressor complex	GTPase activator activity|protein binding				0				OV - Ovarian serous cystadenocarcinoma(397;7.21e-36)		TCCCATTAAACCTTTAAAAAA	0.249													4	2	---	---	---	---	
SLC44A5	204962	broad.mit.edu	37	1	76084764	76084765	+	Intron	INS	-	G	G	rs141643516	by1000genomes	TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:76084764_76084765insG	uc010oqz.1	-						SLC44A5_uc010orb.1_Intron	NM_001130058	NP_001123530	Q8NCS7	CTL5_HUMAN	solute carrier family 44, member 5 isoform B							integral to membrane|plasma membrane	choline transmembrane transporter activity			ovary(2)|skin(2)	4						tcaaaaaaaaagggggggggga	0.000													5	7	---	---	---	---	
TRIM45	80263	broad.mit.edu	37	1	117659023	117659023	+	Intron	DEL	T	-	-			TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:117659023delT	uc001egz.2	-						TRIM45_uc009whe.2_Intron|TRIM45_uc001eha.2_Intron	NM_025188	NP_079464	Q9H8W5	TRI45_HUMAN	tripartite motif-containing 45 isoform 1							cytoplasm|nucleus	zinc ion binding			central_nervous_system(1)	1	Lung SC(450;0.225)	all_cancers(81;0.000979)|all_lung(203;7.65e-05)|all_epithelial(167;0.000134)|Lung NSC(69;0.000389)		Lung(183;0.0537)|Colorectal(144;0.172)|LUSC - Lung squamous cell carcinoma(189;0.187)		tcccggctaattttttttttt	0.000													4	2	---	---	---	---	
NBPF9	400818	broad.mit.edu	37	1	145109975	145109976	+	Intron	INS	-	C	C	rs11458983		TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145109975_145109976insC	uc010oye.1	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|SEC22B_uc001eml.1_Intron			Q3BBV1	NBPFK_HUMAN	RecName: Full=Neuroblastoma breakpoint family member 8;							cytoplasm					0						CAGGAACTTTGCTAAAGATCTA	0.386													5	3	---	---	---	---	
BCAN	63827	broad.mit.edu	37	1	156616443	156616449	+	Intron	DEL	CCCTGGC	-	-	rs113490499		TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156616443_156616449delCCCTGGC	uc001fpp.2	+						BCAN_uc001fpo.2_Intron	NM_021948	NP_068767	Q96GW7	PGCB_HUMAN	brevican isoform 1						cell adhesion	anchored to membrane|proteinaceous extracellular matrix	hyaluronic acid binding|sugar binding			ovary(1)|pancreas(1)	2	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					GGCTGCAGGAccctggcccctggcccc	0.575													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	26893724	26893725	+	IGR	INS	-	AAGGAAGGAAAAGGA	AAGGAAGGAAAAGGA	rs150984923	by1000genomes	TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:26893724_26893725insAAGGAAGGAAAAGGA								CIB4 (29513 upstream) : KCNK3 (21856 downstream)																							aggaaggaaggaaggaaggaag	0.035													7	4	---	---	---	---	
SUPT7L	9913	broad.mit.edu	37	2	27880496	27880497	+	Frame_Shift_Del	DEL	AG	-	-			TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27880496_27880497delAG	uc002rlh.1	-	4	802_803	c.459_460delCT	c.(457-462)TCCTGTfs	p.S153fs	SUPT7L_uc002rli.1_Frame_Shift_Del_p.S153fs|SUPT7L_uc010ymf.1_Frame_Shift_Del_p.S18fs|SUPT7L_uc002rlj.1_Frame_Shift_Del_p.S151fs|SUPT7L_uc010ezh.1_Frame_Shift_Del_p.S151fs	NM_014860	NP_055675	O94864	ST65G_HUMAN	SPTF-associated factor 65 gamma	153_154					histone H3 acetylation|maintenance of protein location in nucleus|regulation of transcription, DNA-dependent|transcription, DNA-dependent	STAGA complex	transcription coactivator activity			skin(2)	2	Acute lymphoblastic leukemia(172;0.155)					AGCTGCCGACAGGAGTGCCAGC	0.550													35	16	---	---	---	---	
C2orf61	285051	broad.mit.edu	37	2	47307648	47307648	+	Intron	DEL	T	-	-	rs11297773		TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:47307648delT	uc010fbd.2	-									Q8N801	CB061_HUMAN	Homo sapiens cDNA FLJ40172 fis, clone TESTI2016896.												0		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)	Lung(47;0.0792)|LUSC - Lung squamous cell carcinoma(58;0.114)			ttctttcttcttttttttttt	0.035													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	90447339	90447342	+	Intron	DEL	TCTA	-	-			TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:90447339_90447342delTCTA	uc010fhm.2	+											Parts of antibodies, mostly variable regions.																		GTTTGTTACCTCTATCTACTGTCT	0.353													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	106105740	106105741	+	IGR	INS	-	A	A			TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:106105740_106105741insA								FHL2 (50510 upstream) : NCK2 (255613 downstream)																							aggaaggaaggaaggaaggaag	0.000													4	2	---	---	---	---	
MERTK	10461	broad.mit.edu	37	2	112660343	112660344	+	Intron	INS	-	TTCCTTCC	TTCCTTCC			TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:112660343_112660344insTTCCTTCC	uc002thk.1	+						MERTK_uc002thl.1_Intron	NM_006343	NP_006334	Q12866	MERTK_HUMAN	MER receptor tyrosine kinase precursor						cell surface receptor linked signaling pathway|cell-cell signaling|leukocyte migration	integral to plasma membrane|soluble fraction	ATP binding|transmembrane receptor protein tyrosine kinase activity			lung(6)|upper_aerodigestive_tract(1)|stomach(1)|kidney(1)	9						aacctgaTCAGttccttccttc	0.045													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	134765658	134765658	+	IGR	DEL	G	-	-			TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:134765658delG								NCKAP5 (439627 upstream) : MGAT5 (246172 downstream)																							gagggagggaggaaggaagga	0.090													4	2	---	---	---	---	
ZRANB3	84083	broad.mit.edu	37	2	136220176	136220176	+	Intron	DEL	T	-	-			TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:136220176delT	uc002tum.2	-						ZRANB3_uc002tuk.2_Intron|ZRANB3_uc002tul.2_Intron|ZRANB3_uc002tun.1_Intron	NM_032143	NP_115519	Q5FWF4	ZRAB3_HUMAN	zinc finger, RAN-binding domain containing 3							intracellular	ATP binding|DNA binding|endonuclease activity|helicase activity|zinc ion binding			lung(2)	2				BRCA - Breast invasive adenocarcinoma(221;0.135)		tttctttttcttttttttttt	0.060													4	2	---	---	---	---	
OSBPL6	114880	broad.mit.edu	37	2	179156451	179156451	+	Intron	DEL	C	-	-			TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179156451delC	uc002ulx.2	+						OSBPL6_uc002ulw.2_Intron|OSBPL6_uc002uly.2_Intron|OSBPL6_uc010zfe.1_Intron|OSBPL6_uc002ulz.2_Intron	NM_032523	NP_115912	Q9BZF3	OSBL6_HUMAN	oxysterol-binding protein-like protein 6 isoform						lipid transport		lipid binding			pancreas(1)	1			OV - Ovarian serous cystadenocarcinoma(117;0.00578)|Epithelial(96;0.00847)|all cancers(119;0.0335)			ctccctccctccctccttcct	0.070													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	241579535	241579536	+	IGR	INS	-	CCTT	CCTT	rs13010339		TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241579535_241579536insCCTT								GPR35 (8860 upstream) : AQP12B (36300 downstream)																							tccctgacctaccttccttcct	0.015													4	2	---	---	---	---	
ING5	84289	broad.mit.edu	37	2	242657739	242657742	+	Intron	DEL	CCTC	-	-	rs112407089		TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242657739_242657742delCCTC	uc002wcd.2	+						ING5_uc002wcc.1_Intron	NM_032329	NP_115705	Q8WYH8	ING5_HUMAN	inhibitor of growth family, member 5						DNA replication|histone H3 acetylation|negative regulation of cell proliferation|negative regulation of growth|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	MOZ/MORF histone acetyltransferase complex	protein binding|zinc ion binding				0		all_cancers(19;1.09e-40)|all_epithelial(40;2.03e-18)|Breast(86;1.53e-05)|all_lung(227;0.00338)|Renal(207;0.00502)|Ovarian(221;0.00716)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|Melanoma(123;0.144)|all_hematologic(139;0.158)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;2.16e-33)|all cancers(36;4.99e-31)|OV - Ovarian serous cystadenocarcinoma(60;3.6e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.65e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0839)		ttcctcccttcctccctccctccc	0.000													3	6	---	---	---	---	
YEATS2	55689	broad.mit.edu	37	3	183476487	183476488	+	Intron	INS	-	AG	AG	rs138766151	by1000genomes	TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183476487_183476488insAG	uc003fly.2	+							NM_018023	NP_060493	Q9ULM3	YETS2_HUMAN	YEATS domain containing 2						histone H3 acetylation|negative regulation of transcription from RNA polymerase II promoter	Ada2/Gcn5/Ada3 transcription activator complex	TBP-class protein binding			ovary(3)|large_intestine(1)	4	all_cancers(143;6.55e-10)|Ovarian(172;0.0303)		all cancers(12;2.38e-42)|Epithelial(37;1.9e-36)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)			GGATGGGTCCTTAAGGGTTTTT	0.391													4	5	---	---	---	---	
TPRG1	285386	broad.mit.edu	37	3	188923801	188923802	+	Intron	INS	-	TTCCTTCCTTCCTTCCTTCCTTCCTTCC	TTCCTTCCTTCCTTCCTTCCTTCCTTCC	rs149478955	by1000genomes	TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:188923801_188923802insTTCCTTCCTTCCTTCCTTCCTTCCTTCC	uc003frv.1	+						TPRG1_uc003frw.1_Intron	NM_198485	NP_940887	Q6ZUI0	TPRG1_HUMAN	tumor protein p63 regulated 1												0	all_cancers(143;6.12e-12)|all_hematologic(3;0.0359)|Ovarian(172;0.0925)	all_lung(153;8.23e-09)|Lung NSC(153;3.55e-06)|all_neural(597;0.0019)|Myeloproliferative disorder(1037;0.0255)	Lung(62;6.93e-06)	GBM - Glioblastoma multiforme(93;4.77e-14)		TGCAGGTACAtttccttccttc	0.094													4	2	---	---	---	---	
SHROOM3	57619	broad.mit.edu	37	4	77439725	77439728	+	Intron	DEL	TGCT	-	-	rs71659329		TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:77439725_77439728delTGCT	uc011cbx.1	+							NM_020859	NP_065910	Q8TF72	SHRM3_HUMAN	shroom family member 3 protein						apical protein localization|cell morphogenesis|cellular pigment accumulation|pattern specification process|regulation of cell shape	adherens junction|apical junction complex|apical plasma membrane|cytoplasm|microtubule	actin binding			skin(2)|ovary(1)	3			Lung(101;0.0903)			ccttcTtgcctgcttgcctgcctg	0.127													3	3	---	---	---	---	
GAB1	2549	broad.mit.edu	37	4	144378748	144378748	+	Intron	DEL	C	-	-			TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:144378748delC	uc003ije.2	+						GAB1_uc003ijd.2_Intron|GAB1_uc011chq.1_Intron	NM_002039	NP_002030	Q13480	GAB1_HUMAN	GRB2-associated binding protein 1 isoform b						cell proliferation|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway	cytosol	SH3/SH2 adaptor activity			breast(2)|lung(1)|skin(1)	4	all_hematologic(180;0.158)					GGCTCTGTTGCtttttttttt	0.279													4	2	---	---	---	---	
ERAP1	51752	broad.mit.edu	37	5	96117713	96117715	+	Intron	DEL	TTT	-	-	rs142478570		TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:96117713_96117715delTTT	uc003kmm.2	-						ERAP1_uc003kml.2_Intron|ERAP1_uc010jbm.1_Intron|ERAP1_uc003kmn.2_Intron	NM_001040458	NP_001035548	Q9NZ08	ERAP1_HUMAN	type 1 tumor necrosis factor receptor shedding						angiogenesis|antigen processing and presentation of endogenous peptide antigen via MHC class I|fat cell differentiation|membrane protein ectodomain proteolysis|regulation of blood pressure|regulation of innate immune response|response to bacterium	cytosol|endoplasmic reticulum lumen|endoplasmic reticulum membrane|extracellular region|integral to membrane	aminopeptidase activity|interleukin-1, Type II receptor binding|interleukin-6 receptor binding|metalloexopeptidase activity|zinc ion binding			ovary(1)|pancreas(1)	2		all_cancers(142;1.75e-06)|all_epithelial(76;3.08e-09)|all_lung(232;0.000435)|Lung NSC(167;0.000601)|Ovarian(225;0.024)|Colorectal(57;0.0432)|Breast(839;0.244)		all cancers(79;7.26e-15)|COAD - Colon adenocarcinoma(37;0.071)		TCAGTTACAAttttttttttttt	0.187													4	2	---	---	---	---	
HSPA9	3313	broad.mit.edu	37	5	137911069	137911070	+	5'UTR	INS	-	T	T			TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137911069_137911070insT	uc003ldf.2	-	1					HSPA9_uc011cyw.1_5'UTR	NM_004134	NP_004125	P38646	GRP75_HUMAN	heat shock 70kDa protein 9 precursor						anti-apoptosis|protein folding	cell surface|mitochondrial nucleoid	ATP binding|unfolded protein binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			GAGCTGCGCGATGCGGTGGCGG	0.663													11	9	---	---	---	---	
MATR3	9782	broad.mit.edu	37	5	138665246	138665246	+	3'UTR	DEL	A	-	-			TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:138665246delA	uc003ldu.2	+	18					MATR3_uc003ldt.2_3'UTR|MATR3_uc003ldw.2_3'UTR|MATR3_uc003ldx.2_3'UTR|MATR3_uc010jfc.2_3'UTR|MATR3_uc011czb.1_3'UTR|MATR3_uc003ldz.2_3'UTR|MATR3_uc003lea.2_3'UTR|MATR3_uc003leb.2_3'UTR|MATR3_uc003lec.2_3'UTR	NM_199189	NP_954659	P43243	MATR3_HUMAN	matrin 3							nuclear inner membrane|nuclear matrix	nucleotide binding|protein binding|RNA binding|structural molecule activity|zinc ion binding			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			GTGTTATAGCAAAAAAAATAC	0.279													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	32210220	32210227	+	IGR	DEL	TTCTTTCC	-	-	rs41286494		TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32210220_32210227delTTCTTTCC								NOTCH4 (18376 upstream) : C6orf10 (46076 downstream)																							CTTTCTttctttctttccttccttcctt	0.216													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	42521030	42521033	+	IGR	DEL	GAAG	-	-			TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:42521030_42521033delGAAG								TRERF1 (101165 upstream) : UBR2 (11025 downstream)																							aagaaaaaaCgaaggaaggaagga	0.010													4	2	---	---	---	---	
MDN1	23195	broad.mit.edu	37	6	90489787	90489788	+	Intron	INS	-	A	A			TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:90489787_90489788insA	uc003pnn.1	-						MDN1_uc003pno.1_Intron	NM_014611	NP_055426	Q9NU22	MDN1_HUMAN	MDN1, midasin homolog						protein complex assembly|regulation of protein complex assembly	nucleus	ATP binding|ATPase activity|unfolded protein binding			ovary(8)|skin(2)	10		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		gacttcgtctcaaaaaaaaaaa	0.129													3	3	---	---	---	---	
ECT2L	345930	broad.mit.edu	37	6	139170711	139170711	+	Intron	DEL	T	-	-	rs72395106		TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:139170711delT	uc003qif.1	+						ECT2L_uc011edq.1_Intron	NM_001077706	NP_001071174	Q008S8	ECT2L_HUMAN	epithelial cell transforming sequence 2						regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity				0						AAAGCGAAGCttttttttttt	0.229													5	3	---	---	---	---	
ULBP2	80328	broad.mit.edu	37	6	150267343	150267344	+	Intron	DEL	AA	-	-			TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:150267343_150267344delAA	uc003qno.2	+						ULBP2_uc011eeh.1_Intron|ULBP2_uc010kij.2_Intron	NM_025217	NP_079493	Q9BZM5	N2DL2_HUMAN	UL16 binding protein 2 precursor						antigen processing and presentation|immune response|natural killer cell activation|regulation of immune response	anchored to membrane|cell surface|extracellular space|MHC class I protein complex	MHC class I receptor activity				0		Ovarian(120;0.0907)	BRCA - Breast invasive adenocarcinoma(37;0.193)	OV - Ovarian serous cystadenocarcinoma(155;2.58e-12)		accctttctcaaaaaaaaaaaa	0.193													8	4	---	---	---	---	
RADIL	55698	broad.mit.edu	37	7	4845039	4845040	+	Intron	DEL	GC	-	-	rs148730991	by1000genomes	TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:4845039_4845040delGC	uc003snj.1	-						RADIL_uc003sng.1_Intron|RADIL_uc003sni.1_Intron|RADIL_uc011jwc.1_Intron|RADIL_uc011jwd.1_Intron|RADIL_uc003snh.1_5'Flank	NM_018059	NP_060529	Q96JH8	RADIL_HUMAN	Rap GTPase interactor						cell adhesion|multicellular organismal development|signal transduction		protein binding			lung(2)|central_nervous_system(2)|pancreas(2)|breast(1)	7		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0986)|OV - Ovarian serous cystadenocarcinoma(56;7.41e-15)		ATGGGGCGGGGCGGGGGGGTCC	0.673													4	5	---	---	---	---	
ISPD	729920	broad.mit.edu	37	7	16248899	16248899	+	Intron	DEL	T	-	-	rs34795937		TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:16248899delT	uc010ktx.2	-						ISPD_uc010kty.2_Intron|uc003stf.2_5'Flank	NM_001101426	NP_001094896	A4D126	ISPD_HUMAN	notch1-induced protein isoform a						isoprenoid biosynthetic process		nucleotidyltransferase activity			ovary(1)	1						TCTAAGTGTCttttttttttt	0.214										Multiple Myeloma(15;0.18)			4	2	---	---	---	---	
MGAM	8972	broad.mit.edu	37	7	141765743	141765744	+	Intron	INS	-	T	T	rs4276596		TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:141765743_141765744insT	uc003vwy.2	+							NM_004668	NP_004659	O43451	MGA_HUMAN	maltase-glucoamylase						polysaccharide digestion|starch catabolic process	apical plasma membrane|integral to membrane	carbohydrate binding|glucan 1,4-alpha-glucosidase activity|maltose alpha-glucosidase activity			ovary(2)	2	Melanoma(164;0.0272)				Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	AAAAAAAGGtgtttttttttgt	0.183													4	3	---	---	---	---	
VDAC3	7419	broad.mit.edu	37	8	42262241	42262242	+	Intron	DEL	AA	-	-	rs72239232		TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:42262241_42262242delAA	uc011lct.1	+						VDAC3_uc003xpc.2_Intron	NM_005662	NP_005653	Q9Y277	VDAC3_HUMAN	voltage-dependent anion channel 3 isoform b						adenine transport	mitochondrial outer membrane|pore complex	nucleotide binding|porin activity|protein binding|voltage-gated anion channel activity			upper_aerodigestive_tract(1)	1	all_cancers(6;3.86e-23)|all_lung(13;6.47e-12)|Lung NSC(13;1.08e-10)|Ovarian(28;0.00769)|Prostate(17;0.0119)|Lung SC(25;0.211)	all_lung(54;0.00671)|Lung NSC(58;0.0184)|Esophageal squamous(32;0.131)|Hepatocellular(245;0.133)|Renal(179;0.151)	BRCA - Breast invasive adenocarcinoma(8;3.48e-10)|OV - Ovarian serous cystadenocarcinoma(14;0.00266)|Lung(22;0.00849)|LUSC - Lung squamous cell carcinoma(45;0.024)		Dihydroxyaluminium(DB01375)	acttcatctcaaaaaaaaaaaa	0.163													4	2	---	---	---	---	
ASAP1	50807	broad.mit.edu	37	8	131199667	131199667	+	Intron	DEL	T	-	-			TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:131199667delT	uc003yta.1	-						ASAP1_uc011liw.1_Intron	NM_018482	NP_060952	Q9ULH1	ASAP1_HUMAN	development and differentiation enhancing factor						cilium morphogenesis|filopodium assembly|regulation of ARF GTPase activity|signal transduction	cytoplasm|membrane	ARF GTPase activator activity|cytoskeletal adaptor activity|SH3 domain binding|zinc ion binding			ovary(4)	4						CGTTACACCAttttttttttt	0.159													10	8	---	---	---	---	
CNTLN	54875	broad.mit.edu	37	9	17308967	17308970	+	Intron	DEL	TATG	-	-	rs143654666	by1000genomes	TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:17308967_17308970delTATG	uc003zmz.2	+						CNTLN_uc003zmy.2_Intron|CNTLN_uc010mio.2_Intron	NM_017738	NP_060208	Q9NXG0	CNTLN_HUMAN	centlein isoform 1							centriole|membrane	two-component sensor activity			pancreas(1)	1				GBM - Glioblastoma multiforme(50;6.14e-10)		ATACAGTTCATATGTATATATaca	0.176													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	45362789	45362791	+	IGR	DEL	TTC	-	-			TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:45362789_45362791delTTC								FAM27C (371298 upstream) : FAM27A (364238 downstream)																							CTTCAGCCTGTTCTTCTTCAGTC	0.468													4	2	---	---	---	---	
VPS13A	23230	broad.mit.edu	37	9	79875268	79875274	+	Intron	DEL	TTTTTTT	-	-			TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:79875268_79875274delTTTTTTT	uc004akr.2	+						VPS13A_uc004akp.3_Intron|VPS13A_uc004akq.3_Intron|VPS13A_uc004aks.2_Intron	NM_033305	NP_150648	Q96RL7	VP13A_HUMAN	vacuolar protein sorting 13A isoform A						Golgi to endosome transport|protein transport	intracellular	protein binding			pancreas(3)|skin(3)|ovary(2)|large_intestine(1)|central_nervous_system(1)	10						AGAAAATTACttttttttttttttttt	0.121													11	5	---	---	---	---	
NCS1	23413	broad.mit.edu	37	9	132985262	132985262	+	Intron	DEL	C	-	-	rs34826568		TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:132985262delC	uc004bzi.2	+						NCS1_uc010myz.1_Intron	NM_014286	NP_055101	P62166	NCS1_HUMAN	frequenin homolog isoform 1						negative regulation of calcium ion transport via voltage-gated calcium channel activity|regulation of neuron projection development	cell junction|Golgi cisterna membrane|perinuclear region of cytoplasm|postsynaptic density|postsynaptic membrane	calcium ion binding|protein binding				0						AGGGGGGCGGCCCTCATCTGG	0.662													4	2	---	---	---	---	
KIAA1217	56243	broad.mit.edu	37	10	24722235	24722241	+	Intron	DEL	TTTTTTG	-	-	rs10582246		TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:24722235_24722241delTTTTTTG	uc001iru.3	+						KIAA1217_uc001irs.2_Intron|KIAA1217_uc001irt.3_Intron|KIAA1217_uc010qcy.1_Intron|KIAA1217_uc010qcz.1_Intron|KIAA1217_uc001irv.1_Intron|KIAA1217_uc010qda.1_Intron	NM_019590	NP_062536	Q5T5P2	SKT_HUMAN	sickle tail isoform 1						embryonic skeletal system development	cytoplasm				ovary(5)|skin(2)	7						TTTAGAGTGtttttttgttttttgttt	0.246													4	2	---	---	---	---	
IFIT3	3437	broad.mit.edu	37	10	91099779	91099779	+	Frame_Shift_Del	DEL	T	-	-			TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:91099779delT	uc001kgf.2	+	2	1596	c.1367delT	c.(1366-1368)ATTfs	p.I456fs	LIPA_uc001kgb.3_Intron|LIPA_uc001kgc.3_Intron|uc001kgd.2_Intron|IFIT3_uc001kgg.2_Frame_Shift_Del_p.I456fs	NM_001549	NP_001540	O14879	IFIT3_HUMAN	interferon-induced protein with	456	TPR 8.				type I interferon-mediated signaling pathway		protein binding			central_nervous_system(1)	1						ATAGGCAGTATTTTCCTGTCA	0.517													85	43	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	94985788	94985789	+	IGR	INS	-	T	T	rs140557797	by1000genomes	TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:94985788_94985789insT								CYP26A1 (148147 upstream) : MYOF (80398 downstream)																							cccagagggagtgttacagtgc	0.000													1	7	---	---	---	---	
PI4K2A	55361	broad.mit.edu	37	10	99402622	99402623	+	Intron	INS	-	TC	TC	rs10688390		TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:99402622_99402623insTC	uc001kog.1	+						PI4K2A_uc010qoy.1_Intron	NM_018425	NP_060895	Q9BTU6	P4K2A_HUMAN	phosphatidylinositol 4-kinase type 2 alpha						phosphatidylinositol biosynthetic process	cytoplasm|integral to plasma membrane|membrane raft	1-phosphatidylinositol 4-kinase activity|ATP binding|magnesium ion binding			lung(1)|skin(1)	2		Colorectal(252;0.162)		Epithelial(162;1.24e-10)|all cancers(201;1.2e-08)		ctttctttctttttctttcttt	0.084													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	102432126	102432127	+	IGR	INS	-	CTTC	CTTC	rs5787394		TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:102432126_102432127insCTTC								HIF1AN (118446 upstream) : PAX2 (73341 downstream)																							ctttcttctttcttccttcctt	0.099													4	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	128409926	128409929	+	IGR	DEL	AAAG	-	-	rs11245114		TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:128409926_128409929delAAAG								C10orf90 (50847 upstream) : DOCK1 (184094 downstream)																							agaaagaaaaaaagaaagaaagaa	0.000													4	2	---	---	---	---	
TCERG1L	256536	broad.mit.edu	37	10	133055211	133055212	+	Intron	INS	-	GAAGGAAGGAAGGAAGGAAG	GAAGGAAGGAAGGAAGGAAG	rs141999228		TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:133055211_133055212insGAAGGAAGGAAGGAAGGAAG	uc001lkp.2	-						TCERG1L_uc009yax.1_Intron	NM_174937	NP_777597	Q5VWI1	TCRGL_HUMAN	transcription elongation regulator 1-like											large_intestine(2)|ovary(2)	4		all_cancers(35;1.22e-10)|all_epithelial(44;2.65e-09)|Lung NSC(174;0.00188)|all_lung(145;0.00307)|Melanoma(40;0.0179)|all_neural(114;0.0424)|Breast(234;0.0743)|Colorectal(57;0.09)		all cancers(32;0.000899)|OV - Ovarian serous cystadenocarcinoma(35;0.0021)|Epithelial(32;0.00276)		aggaagagaaagaaggaaggaa	0.000													6	3	---	---	---	---	
METT5D1	196074	broad.mit.edu	37	11	28349476	28349480	+	Intron	DEL	GTTAT	-	-	rs10604663		TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:28349476_28349480delGTTAT	uc001msh.2	+						METT5D1_uc001msg.2_Intron|METT5D1_uc001mse.2_Intron|METT5D1_uc001msi.2_Intron	NM_001113528	NP_001107000	A6NJ78	MET15_HUMAN	methyltransferase 5 domain containing 1 isoform								methyltransferase activity				0						AAGTTAAGCAGTTATGTTGAACCAT	0.244													4	4	---	---	---	---	
PVRL1	5818	broad.mit.edu	37	11	119519005	119519006	+	Intron	INS	-	TGA	TGA			TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:119519005_119519006insTGA	uc001pwu.1	-							NM_203285	NP_976030	Q15223	PVRL1_HUMAN	poliovirus receptor-related 1 isoform 2						adherens junction organization|cell junction assembly|entry of virus into host cell|heterophilic cell-cell adhesion|homophilic cell adhesion|immune response	cell-cell adherens junction|extracellular region|integral to membrane	cell adhesion molecule binding|coreceptor activity|protein homodimerization activity				0		Breast(348;0.037)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.29e-05)		ggtgatggtggtggtggtggtg	0.000													4	2	---	---	---	---	
IFFO1	25900	broad.mit.edu	37	12	6658357	6658357	+	Intron	DEL	A	-	-	rs72489368		TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6658357delA	uc001qpd.1	-						IFFO1_uc001qoy.2_Intron|IFFO1_uc001qpa.1_5'Flank|IFFO1_uc001qpb.1_Intron|IFFO1_uc001qpe.1_Intron|IFFO1_uc010sfe.1_Intron|IFFO1_uc001qpf.1_Intron|IFFO1_uc001qoz.1_5'Flank|IFFO1_uc001qpc.1_Intron|IFFO1_uc001qpg.2_5'Flank	NM_080730	NP_542768	Q0D2I5	IFFO1_HUMAN	intermediate filament family orphan isoform 2							intermediate filament					0						TGACTCAACTAAAAAAAAAAA	0.428													4	2	---	---	---	---	
SOAT2	8435	broad.mit.edu	37	12	53514403	53514403	+	Intron	DEL	A	-	-	rs71868498		TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53514403delA	uc001sbv.2	+						SOAT2_uc009zms.2_Intron	NM_003578	NP_003569	O75908	SOAT2_HUMAN	acyl-CoA:cholesterol acyltransferase 2						cholesterol efflux|cholesterol esterification|cholesterol homeostasis|cholesterol metabolic process|macrophage derived foam cell differentiation|very-low-density lipoprotein particle assembly	brush border|endoplasmic reticulum membrane|integral to membrane|microsome	cholesterol binding|cholesterol O-acyltransferase activity|fatty-acyl-CoA binding			ovary(1)	1						agcctgtctcaaaaaaaaaaa	0.194													9	5	---	---	---	---	
OS9	10956	broad.mit.edu	37	12	58110062	58110062	+	Intron	DEL	T	-	-	rs141328077	by1000genomes	TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:58110062delT	uc001spj.2	+						OS9_uc010srx.1_Intron|OS9_uc001spk.2_Intron|OS9_uc001spl.2_Intron|OS9_uc001spm.2_Intron|OS9_uc001spn.2_Intron|OS9_uc010sry.1_Intron|OS9_uc010srz.1_Intron	NM_006812	NP_006803	Q13438	OS9_HUMAN	osteosarcoma amplified 9, endoplasmic reticulum						ER-associated protein catabolic process|protein retention in ER lumen|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|response to endoplasmic reticulum stress	endoplasmic reticulum lumen|Hrd1p ubiquitin ligase complex	glycoprotein binding|protein binding|sugar binding			ovary(1)	1	all_neural(12;0.00548)|Glioma(12;0.0126)|Melanoma(17;0.122)		BRCA - Breast invasive adenocarcinoma(9;0.109)			ACTGGTGGGGTGGGGGGGGGT	0.557													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	68881564	68881564	+	IGR	DEL	C	-	-			TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:68881564delC								MDM1 (155403 upstream) : RAP1B (123088 downstream)																							TCATTGTCATCATGTCCTCCT	0.597													4	2	---	---	---	---	
E2F7	144455	broad.mit.edu	37	12	77458263	77458264	+	Intron	INS	-	T	T			TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:77458263_77458264insT	uc001sym.3	-						E2F7_uc001syn.2_Intron	NM_203394	NP_976328	Q96AV8	E2F7_HUMAN	E2F transcription factor 7						cell cycle	transcription factor complex	DNA binding|identical protein binding			upper_aerodigestive_tract(1)|ovary(1)|kidney(1)	3						GGAACACTTAATTGAATTCAAC	0.282													47	24	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	80372689	80372700	+	IGR	DEL	CCTTCCTTCCTT	-	-			TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:80372689_80372700delCCTTCCTTCCTT								PPP1R12A (43454 upstream) : PTPRQ (465426 downstream)																							Cccttccttcccttccttccttccttccttcc	0.156													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	80372744	80372745	+	IGR	INS	-	C	C			TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:80372744_80372745insC								PPP1R12A (43509 upstream) : PTPRQ (465381 downstream)																							cttccttccttccttccttcgt	0.079													4	4	---	---	---	---	
PLXNC1	10154	broad.mit.edu	37	12	94653676	94653676	+	Intron	DEL	A	-	-	rs67260160		TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:94653676delA	uc001tdc.2	+						PLXNC1_uc010sut.1_Intron|PLXNC1_uc009zsv.2_5'Flank	NM_005761	NP_005752	O60486	PLXC1_HUMAN	plexin C1 precursor						axon guidance|cell adhesion	integral to membrane|intracellular|plasma membrane	receptor activity|receptor binding			ovary(2)|central_nervous_system(1)	3						ttgtctctacaaaaaaaaaaa	0.159													6	3	---	---	---	---	
TXNRD1	7296	broad.mit.edu	37	12	104661478	104661483	+	Intron	DEL	TCTCTC	-	-	rs71890882		TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104661478_104661483delTCTCTC	uc010swk.1	+							NM_001093771	NP_001087240	Q16881	TRXR1_HUMAN	thioredoxin reductase 1 isoform 3						cell redox homeostasis|cellular lipid metabolic process|electron transport chain|nucleobase, nucleoside and nucleotide interconversion|signal transduction|transport	cytosol|nucleolus	electron carrier activity|flavin adenine dinucleotide binding|NADP binding|protein disulfide oxidoreductase activity|thioredoxin-disulfide reductase activity				0						tttctttctttctctctttctttctt	0.087													4	2	---	---	---	---	
TCP11L2	255394	broad.mit.edu	37	12	106711971	106711973	+	Intron	DEL	CAA	-	-	rs34594208		TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:106711971_106711973delCAA	uc001tln.2	+						TCP11L2_uc001tll.2_Intron|TCP11L2_uc001tlm.2_Intron	NM_152772	NP_689985	Q8N4U5	T11L2_HUMAN	t-complex 11 (mouse) like 2											ovary(3)	3						ATAATGCATTCAACAAGAAAAAT	0.177													0	6	---	---	---	---	
KIAA1704	55425	broad.mit.edu	37	13	45601782	45601782	+	Intron	DEL	A	-	-			TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:45601782delA	uc001uzq.2	+						KIAA1704_uc001uzr.1_Intron|KIAA1704_uc001uzs.2_Intron|KIAA1704_uc001uzt.2_Intron	NM_018559	NP_061029	Q8IXQ4	K1704_HUMAN	hypothetical protein LOC55425											pancreas(1)|skin(1)	2		Lung NSC(96;0.00143)|Prostate(109;0.0137)|Breast(139;0.0192)|Lung SC(185;0.0367)|Hepatocellular(98;0.133)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000313)|BRCA - Breast invasive adenocarcinoma(63;0.126)		TTGGATTTGGAAAAAAAAAAA	0.313													4	5	---	---	---	---	
UGGT2	55757	broad.mit.edu	37	13	96579725	96579725	+	Intron	DEL	T	-	-			TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:96579725delT	uc001vmt.2	-							NM_020121	NP_064506	Q9NYU1	UGGG2_HUMAN	UDP-glucose ceramide glucosyltransferase-like 2						post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine	endoplasmic reticulum lumen|ER-Golgi intermediate compartment	UDP-glucose:glycoprotein glucosyltransferase activity			ovary(2)|central_nervous_system(1)	3						Attttctttcttttttttttt	0.259													4	2	---	---	---	---	
DHRS4	10901	broad.mit.edu	37	14	24473479	24473479	+	Intron	DEL	A	-	-			TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24473479delA	uc001wlc.3	+						DHRS4L2_uc001wld.3_Intron|DHRS4L2_uc001wle.3_Intron|DHRS4L2_uc001wlg.3_Intron|DHRS4L2_uc001wlh.3_Intron|DHRS4L2_uc010tnt.1_Intron|DHRS4L2_uc001wli.3_Intron|DHRS4L2_uc010alb.2_Intron	NM_021004	NP_066284	Q9BTZ2	DHRS4_HUMAN	peroxisomal short-chain alcohol dehydrogenase							mitochondrion|nuclear membrane|peroxisome	binding|carbonyl reductase (NADPH) activity			ovary(1)	1				GBM - Glioblastoma multiforme(265;0.00962)	Vitamin A(DB00162)	ctccgtctctaaaaaaaaaaa	0.134													4	2	---	---	---	---	
KHNYN	23351	broad.mit.edu	37	14	24905801	24905801	+	Intron	DEL	T	-	-			TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24905801delT	uc001wph.3	+						KHNYN_uc010tpc.1_Intron|KHNYN_uc010alw.2_Intron	NM_015299	NP_056114	O15037	KHNYN_HUMAN	hypothetical protein LOC23351											ovary(2)|liver(1)	3						GCCAGCTTAATTTTGCAGTGG	0.547											OREG0022628	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	4	---	---	---	---	
PRIMA1	145270	broad.mit.edu	37	14	94223545	94223546	+	Intron	INS	-	AAGG	AAGG	rs138250213	by1000genomes	TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94223545_94223546insAAGG	uc001ybw.1	-						PRIMA1_uc001ybx.1_Intron	NM_178013	NP_821092	Q86XR5	PRIMA_HUMAN	proline rich membrane anchor 1 precursor						neurotransmitter catabolic process	cell junction|integral to membrane|synapse				large_intestine(1)|skin(1)	2		all_cancers(154;0.127)		Epithelial(152;0.138)|COAD - Colon adenocarcinoma(157;0.229)		GGGTTTAAAAAaaggaaggaag	0.366													4	3	---	---	---	---	
ADAM6	8755	broad.mit.edu	37	14	106956821	106956822	+	Intron	INS	-	CTTC	CTTC	rs142145681	by1000genomes	TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106956821_106956822insCTTC	uc010tyt.1	-											Parts of antibodies, mostly variable regions.												0						taaaattttatcttccttcctt	0.000													4	2	---	---	---	---	
IDH2	3418	broad.mit.edu	37	15	90634995	90634995	+	Intron	DEL	C	-	-	rs34936041		TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90634995delC	uc002box.2	-						IDH2_uc010uqb.1_Intron|IDH2_uc010uqc.1_Intron|IDH2_uc010bnu.2_Intron	NM_002168	NP_002159	P48735	IDHP_HUMAN	isocitrate dehydrogenase 2 (NADP+),						2-oxoglutarate metabolic process|glyoxylate cycle|isocitrate metabolic process|tricarboxylic acid cycle	mitochondrial matrix	isocitrate dehydrogenase (NADP+) activity|magnesium ion binding|NAD binding			haematopoietic_and_lymphoid_tissue(621)|central_nervous_system(80)|bone(7)|skin(3)	711	Melanoma(11;0.00551)|Lung NSC(78;0.0196)|all_lung(78;0.04)		BRCA - Breast invasive adenocarcinoma(143;0.0146)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.106)			GCTCCAGCTGCCCGGTGTCCA	0.542			M		GBM								11	5	---	---	---	---	
SLCO3A1	28232	broad.mit.edu	37	15	92638333	92638333	+	Intron	DEL	T	-	-	rs67561474		TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:92638333delT	uc002bqx.2	+						SLCO3A1_uc002bqy.2_Intron|SLCO3A1_uc010boc.1_Intron|SLCO3A1_uc002bqz.1_Intron	NM_013272	NP_037404	Q9UIG8	SO3A1_HUMAN	solute carrier organic anion transporter family,						sodium-independent organic anion transport	integral to membrane|plasma membrane	sodium-independent organic anion transmembrane transporter activity			skin(1)	1	Lung NSC(78;0.0158)|all_lung(78;0.0255)		BRCA - Breast invasive adenocarcinoma(143;0.0841)			CCTGCCTCTGTAGCTGGGGCT	0.328													6	6	---	---	---	---	
NKD1	85407	broad.mit.edu	37	16	50657637	50657638	+	Intron	DEL	TG	-	-	rs72055599		TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:50657637_50657638delTG	uc002egg.1	+							NM_033119	NP_149110	Q969G9	NKD1_HUMAN	naked cuticle homolog 1						Wnt receptor signaling pathway	cytoplasm|plasma membrane	calcium ion binding|protein binding				0		all_cancers(37;0.229)		GBM - Glioblastoma multiforme(240;0.243)		AGGTAAGTGCtgtgtgtgtgtg	0.262													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	51462090	51462090	+	IGR	DEL	T	-	-			TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:51462090delT								SALL1 (276907 upstream) : None (None downstream)																							ccttccttcctttccttcttt	0.000													4	2	---	---	---	---	
CNOT1	23019	broad.mit.edu	37	16	58614725	58614726	+	Intron	INS	-	AA	AA			TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:58614725_58614726insAA	uc002env.2	-						CNOT1_uc002enw.2_Intron|CNOT1_uc002enu.3_Intron|CNOT1_uc002enx.2_Intron|CNOT1_uc002enz.1_Intron	NM_016284	NP_057368	A5YKK6	CNOT1_HUMAN	CCR4-NOT transcription complex, subunit 1						nuclear-transcribed mRNA poly(A) tail shortening|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasmic mRNA processing body|cytosol				ovary(4)|central_nervous_system(2)	6				Kidney(780;0.0722)|OV - Ovarian serous cystadenocarcinoma(108;0.173)|Epithelial(162;0.239)		AAATCTGAAATGTTTTCACTAG	0.327													15	7	---	---	---	---	
SERPINF1	5176	broad.mit.edu	37	17	1674545	1674545	+	Intron	DEL	T	-	-	rs71375537		TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1674545delT	uc002ftl.2	+						SERPINF1_uc010cjw.2_Intron	NM_002615	NP_002606	P36955	PEDF_HUMAN	serine (or cysteine) proteinase inhibitor, clade						cell proliferation|negative regulation of angiogenesis|positive regulation of neurogenesis|regulation of proteolysis	extracellular space|melanosome	serine-type endopeptidase inhibitor activity			ovary(1)	1						TGGGGGGGTCttttttttttt	0.303													9	4	---	---	---	---	
NUP88	4927	broad.mit.edu	37	17	5320153	5320153	+	Intron	DEL	T	-	-	rs67911360		TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:5320153delT	uc002gbo.1	-						NUP88_uc010vsx.1_Intron|NUP88_uc010cle.1_Intron|NUP88_uc010vsy.1_Intron|RPAIN_uc010vsz.1_5'Flank|RPAIN_uc002gbp.1_5'Flank|RPAIN_uc010vta.1_5'Flank|RPAIN_uc002gbq.2_5'Flank|RPAIN_uc010vtb.1_5'Flank|RPAIN_uc002gbs.2_5'Flank|RPAIN_uc002gbt.2_5'Flank|RPAIN_uc002gbu.2_5'Flank|RPAIN_uc002gbv.2_5'Flank|RPAIN_uc002gbr.2_5'Flank|RPAIN_uc002gbw.2_5'Flank	NM_002532	NP_002523	Q99567	NUP88_HUMAN	nucleoporin 88kDa						carbohydrate metabolic process|glucose transport|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|nuclear pore	transporter activity			kidney(1)	1						AACTCACAAAttttttttttt	0.159													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	20978234	20978237	+	IGR	DEL	CCTC	-	-	rs75278704		TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:20978234_20978237delCCTC								USP22 (31161 upstream) : DHRS7B (52021 downstream)																							ttccttctttcctccctccctccc	0.015													4	2	---	---	---	---	
POLDIP2	26073	broad.mit.edu	37	17	26684390	26684391	+	Splice_Site	INS	-	C	C	rs148075904	by1000genomes	TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26684390_26684391insC	uc002haz.2	-	3	211	c.79_splice	c.e3+0	p.P27_splice	POLDIP2_uc010wag.1_RNA|TMEM199_uc002hba.2_5'Flank|SARM1_uc010wah.1_5'Flank	NM_015584	NP_056399	Q9Y2S7	PDIP2_HUMAN	DNA polymerase delta interacting protein 2							mitochondrial nucleoid|nucleus					0	all_lung(13;0.000354)|Lung NSC(42;0.00115)			UCEC - Uterine corpus endometrioid carcinoma (53;0.154)		GCACAGAGCGGCTTTGCCACCG	0.762													4	2	---	---	---	---	
UTP6	55813	broad.mit.edu	37	17	30207444	30207445	+	Intron	INS	-	A	A			TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:30207444_30207445insA	uc002hgr.2	-						UTP6_uc002hgq.2_Intron|UTP6_uc010cst.2_Intron|UTP6_uc010wbw.1_3'UTR	NM_018428	NP_060898	Q9NYH9	UTP6_HUMAN	hepatocellular carcinoma-associated antigen 66						rRNA processing	nucleolus	binding			ovary(1)	1		all_hematologic(16;0.0149)|Ovarian(249;0.021)|Myeloproliferative disorder(56;0.0255)|Acute lymphoblastic leukemia(14;0.0257)|Breast(31;0.231)				tgcctcccaataaaaaaaaaaa	0.178													5	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	51991222	51991223	+	IGR	DEL	TT	-	-			TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:51991222_51991223delTT								KIF2B (88649 upstream) : TOM1L1 (986829 downstream)																							tttttctttctttttttttttT	0.114													6	4	---	---	---	---	
RECQL5	9400	broad.mit.edu	37	17	73626918	73626919	+	Splice_Site	INS	-	TG	TG	rs142406301	by1000genomes	TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73626918_73626919insTG	uc010dgl.2	-	12	1742	c.1586_splice	c.e12-1	p.D529_splice	RECQL5_uc010dgk.2_Splice_Site_p.D502_splice|RECQL5_uc002jot.3_5'Flank|LOC643008_uc002jow.2_5'Flank	NM_004259	NP_004250	O94762	RECQ5_HUMAN	RecQ protein-like 5 isoform 1						DNA recombination|DNA repair	cytoplasm|nuclear membrane|nucleolus|nucleoplasm	ATP binding|ATP-dependent helicase activity|DNA helicase activity|nucleic acid binding			kidney(3)	3	all_cancers(13;2.73e-08)|Breast(9;6.04e-09)|all_epithelial(9;6.79e-09)		all cancers(21;1.15e-06)|Epithelial(20;2.19e-06)|Lung(188;0.101)|LUSC - Lung squamous cell carcinoma(166;0.112)			CAGTTCTCATCTGTGGGGGGGG	0.644								Other_identified_genes_with_known_or_suspected_DNA_repair_function					2	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	78228070	78228070	+	IGR	DEL	T	-	-			TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78228070delT								SLC26A11 (773 upstream) : RNF213 (85656 downstream)																							cttcccttcctttccttcctt	0.189													7	4	---	---	---	---	
FN3KRP	79672	broad.mit.edu	37	17	80674840	80674840	+	Intron	DEL	G	-	-	rs76609961		TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80674840delG	uc002kfu.2	+						FN3KRP_uc010wvr.1_Intron	NM_024619	NP_078895	Q9HA64	KT3K_HUMAN	fructosamine 3 kinase related protein								kinase activity				0	Breast(20;0.000523)|all_neural(118;0.0952)		BRCA - Breast invasive adenocarcinoma(99;0.0344)|OV - Ovarian serous cystadenocarcinoma(97;0.061)			GCCTCGGCGCGGGGCGCGGCC	0.756													9	9	---	---	---	---	
RTTN	25914	broad.mit.edu	37	18	67715076	67715076	+	Intron	DEL	T	-	-			TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:67715076delT	uc002lkp.2	-						RTTN_uc002lko.2_Intron|RTTN_uc010xfb.1_Intron|RTTN_uc010dqp.2_Intron	NM_173630	NP_775901	Q86VV8	RTTN_HUMAN	rotatin								binding			ovary(3)|pancreas(2)|skin(1)|breast(1)|central_nervous_system(1)	8		Esophageal squamous(42;0.129)				TTTTGTATCATTTAAACAGTC	0.229													2	5	---	---	---	---	
GNG7	2788	broad.mit.edu	37	19	2585102	2585125	+	Intron	DEL	GAAGGAAGGAAAGAAGGTAGGAAT	-	-			TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2585102_2585125delGAAGGAAGGAAAGAAGGTAGGAAT	uc002lwd.2	-							NM_052847	NP_443079	O60262	GBG7_HUMAN	guanine nucleotide binding protein (G protein),						cellular response to glucagon stimulus|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|regulation of G-protein coupled receptor protein signaling pathway|synaptic transmission	heterotrimeric G-protein complex	signal transducer activity				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		aagaaggaaggaaggaaggaaagaaggtaggaatgaaggaagga	0.000													8	5	---	---	---	---	
KANK3	256949	broad.mit.edu	37	19	8398950	8398961	+	In_Frame_Del	DEL	TCGCTGTCGCCA	-	-	rs111751275		TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8398950_8398961delTCGCTGTCGCCA	uc010dwa.2	-	5	1533_1544	c.1467_1478delTGGCGACAGCGA	c.(1465-1479)GATGGCGACAGCGAG>GAG	p.DGDS489del	KANK3_uc002mjp.1_In_Frame_Del_p.MATA1del	NM_198471	NP_940873	Q6NY19	KANK3_HUMAN	ankyrin repeat domain 47	489_492											0						GCCACCGTTCTCGCTGTCGCCATCGCTGTCGC	0.693													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	10187388	10187389	+	IGR	INS	-	AG	AG			TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10187388_10187389insAG								C3P1 (2577 upstream) : C19orf66 (9417 downstream)																							aagagaagagaagaaggaggag	0.000													4	2	---	---	---	---	
CARD8	22900	broad.mit.edu	37	19	48724209	48724209	+	Intron	DEL	G	-	-	rs113441226		TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48724209delG	uc002pie.3	-						CARD8_uc002pii.3_Intron|CARD8_uc002pid.1_5'Flank|CARD8_uc010xzi.1_Intron|CARD8_uc010els.2_Intron|CARD8_uc010xzj.1_Intron|CARD8_uc010xzk.1_Intron|CARD8_uc002pif.3_Intron|CARD8_uc002pig.3_Intron|CARD8_uc002pih.3_Intron|CARD8_uc010xzl.1_Intron|CARD8_uc010xzm.1_Intron	NM_014959	NP_055774	Q9Y2G2	CARD8_HUMAN	caspase recruitment domain family, member 8						negative regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interleukin-1 beta secretion	cytoplasm|nucleus	caspase activator activity|NACHT domain binding|protein homodimerization activity				0		all_lung(116;0.000112)|Lung NSC(112;0.000192)|all_epithelial(76;0.000349)|all_neural(266;0.0228)|Ovarian(192;0.113)|Prostate(7;0.184)		OV - Ovarian serous cystadenocarcinoma(262;0.000112)|all cancers(93;0.000293)|Epithelial(262;0.0129)|GBM - Glioblastoma multiforme(486;0.0336)		agaaaggaaaggaaaggaagg	0.000													3	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	49715837	49715838	+	IGR	INS	-	CTTC	CTTC	rs76677262		TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49715837_49715838insCTTC								TRPM4 (746 upstream) : SLC6A16 (77056 downstream)																							AATGTAACCTActtccttcctt	0.035													5	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	19831702	19831705	+	IGR	DEL	AAGG	-	-	rs145309073	by1000genomes	TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:19831702_19831705delAAGG								SLC24A3 (128162 upstream) : RIN2 (38505 downstream)																							aggagaaagaaaggaaggaaggaa	0.098													4	2	---	---	---	---	
PARD6B	84612	broad.mit.edu	37	20	49366663	49366664	+	Frame_Shift_Del	DEL	AA	-	-			TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:49366663_49366664delAA	uc002xvo.2	+	3	1000_1001	c.757_758delAA	c.(757-759)AATfs	p.N253fs		NM_032521	NP_115910	Q9BYG5	PAR6B_HUMAN	PAR-6 beta	253	Interaction with PARD3 and CDC42 (By similarity).				axonogenesis|cell cycle|cell division|establishment or maintenance of cell polarity|protein complex assembly|regulation of cell migration|tight junction assembly	cytosol|tight junction	protein binding			kidney(1)	1						AAACCAGAGGAATAATGTTGTG	0.465													140	80	---	---	---	---	
TSHZ2	128553	broad.mit.edu	37	20	52086301	52086312	+	Intron	DEL	GAGGGAGGAAGG	-	-	rs36223642	by1000genomes	TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:52086301_52086312delGAGGGAGGAAGG	uc002xwo.2	+						uc002xwp.1_Intron	NM_173485	NP_775756	Q9NRE2	TSH2_HUMAN	teashirt zinc finger homeobox 2						multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|haematopoietic_and_lymphoid_tissue(1)	6			STAD - Stomach adenocarcinoma(23;0.1)			gaaagatagagagggaggaagggagggaggga	0.000													5	3	---	---	---	---	
CHODL	140578	broad.mit.edu	37	21	19400594	19400595	+	Intron	DEL	CC	-	-			TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:19400594_19400595delCC	uc002ykt.2	+						CHODL_uc002ykr.2_Intron|CHODL_uc002yks.2_Intron|CHODL_uc002yku.2_Intron			Q9H9P2	CHODL_HUMAN	RecName: Full=Chondrolectin; AltName: Full=Transmembrane protein MT75; Flags: Precursor;						muscle organ development	integral to membrane|perinuclear region of cytoplasm	sugar binding			upper_aerodigestive_tract(1)	1		all_epithelial(11;0.21)		Epithelial(23;0.000191)|all cancers(11;0.000827)|LUSC - Lung squamous cell carcinoma(23;0.00646)|Lung(58;0.0129)|OV - Ovarian serous cystadenocarcinoma(11;0.017)|COAD - Colon adenocarcinoma(22;0.03)|Colorectal(24;0.0917)		TTTTccttttccccttccttcc	0.074													5	5	---	---	---	---	
TTC3	7267	broad.mit.edu	37	21	38536643	38536643	+	Intron	DEL	T	-	-			TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:38536643delT	uc002yvz.2	+						TTC3_uc011aee.1_Intron|TTC3_uc002ywa.2_Intron|TTC3_uc002ywb.2_Intron|TTC3_uc010gnf.2_Intron|TTC3_uc002ywc.2_Intron|TTC3_uc002ywd.1_Intron	NM_001001894	NP_001001894	P53804	TTC3_HUMAN	tetratricopeptide repeat domain 3						protein K48-linked ubiquitination|ubiquitin-dependent protein catabolic process	nucleus	protein binding|ubiquitin-protein ligase activity|zinc ion binding			skin(3)|ovary(2)|lung(2)|breast(2)	9		Myeloproliferative disorder(46;0.0412)				TAATTTAGGAttttttttttt	0.144													4	3	---	---	---	---	
FAM19A5	25817	broad.mit.edu	37	22	49103825	49103837	+	Intron	DEL	TCCTGACCATCTG	-	-	rs141710021		TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:49103825_49103837delTCCTGACCATCTG	uc003bim.3	+						FAM19A5_uc003bio.3_Intron	NM_001082967	NP_001076436	Q7Z5A7	F19A5_HUMAN	family with sequence similarity 19 (chemokine							extracellular region|integral to membrane				large_intestine(1)	1		all_cancers(38;2.95e-11)|all_epithelial(38;3.07e-10)|all_lung(38;2.89e-05)|Breast(42;0.000396)|Lung NSC(38;0.000471)|Ovarian(80;0.00934)|Lung SC(80;0.195)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0227)|BRCA - Breast invasive adenocarcinoma(115;0.119)		GGTGCTAAATTCCTGACCATCTGTCCTGGGGCA	0.620													9	4	---	---	---	---	
ARSH	347527	broad.mit.edu	37	X	2942330	2942330	+	Intron	DEL	A	-	-			TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:2942330delA	uc011mhj.1	+							NM_001011719	NP_001011719	Q5FYA8	ARSH_HUMAN	arylsulfatase family, member H							integral to membrane	arylsulfatase activity|metal ion binding			lung(1)	1		all_cancers(21;9e-05)|all_epithelial(21;6.22e-06)|all_lung(23;0.000597)|Lung NSC(23;0.00901)|Lung SC(21;0.186)				AGCTAGACCGAAAAAAAAAAA	0.373													4	2	---	---	---	---	
BMX	660	broad.mit.edu	37	X	15554697	15554697	+	Intron	DEL	A	-	-			TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:15554697delA	uc004cww.2	+						BMX_uc004cwx.3_Intron|BMX_uc004cwy.3_Intron	NM_203281	NP_975010	P51813	BMX_HUMAN	BMX non-receptor tyrosine kinase						cellular component disassembly involved in apoptosis|intracellular signal transduction|mesoderm development	cytosol	ATP binding|metal ion binding|non-membrane spanning protein tyrosine kinase activity|protein binding|signal transducer activity			lung(3)|ovary(2)	5	Hepatocellular(33;0.183)					GATTTTCTTTAAAAAAAAAAA	0.313													3	3	---	---	---	---	
WDR13	64743	broad.mit.edu	37	X	48457035	48457035	+	Intron	DEL	C	-	-			TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48457035delC	uc004dkh.1	+						WDR13_uc010nif.1_Intron|WDR13_uc004dki.1_Intron|WDR13_uc004dkj.1_Intron|WDR13_uc004dkk.1_Intron|WDR13_uc004dkl.3_5'UTR|WDR13_uc011mme.1_5'Flank	NM_017883	NP_060353	Q9H1Z4	WDR13_HUMAN	WD repeat domain 13 protein							cytoplasm|nucleus				ovary(2)	2						TCCTGCCGTACCCCCCCCCCC	0.602													5	3	---	---	---	---	
HEPH	9843	broad.mit.edu	37	X	65426921	65426921	+	Intron	DEL	T	-	-			TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:65426921delT	uc011moz.1	+						HEPH_uc004dwn.2_Intron|HEPH_uc004dwo.2_Intron|HEPH_uc010nkr.2_Intron|HEPH_uc011mpa.1_Intron|HEPH_uc010nks.2_Intron	NM_138737	NP_620074	Q9BQS7	HEPH_HUMAN	hephaestin isoform a						cellular iron ion homeostasis|copper ion transport|transmembrane transport	integral to membrane|plasma membrane	copper ion binding|oxidoreductase activity			lung(5)|ovary(4)	9						GTCCCCCCCCTTTTTTTTTTC	0.259													7	4	---	---	---	---	
MCF2	4168	broad.mit.edu	37	X	138700009	138700010	+	Intron	INS	-	A	A	rs145233249		TCGA-BP-5007-01A-01D-1462-08	TCGA-BP-5007-11A-01D-1462-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:138700009_138700010insA	uc004fau.2	-						MCF2_uc004fav.2_Intron|MCF2_uc011mwl.1_Intron|MCF2_uc010nsh.1_Intron|MCF2_uc011mwm.1_Intron|MCF2_uc011mwn.1_Intron|MCF2_uc004faw.2_Intron|MCF2_uc011mwo.1_Intron	NM_005369	NP_005360	P10911	MCF2_HUMAN	MCF.2 cell line derived transforming sequence						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytoskeleton|cytosol|membrane|membrane fraction	protein binding|Rho guanyl-nucleotide exchange factor activity			lung(1)|pleura(1)	2	Acute lymphoblastic leukemia(192;0.000127)					CTTCAGGCTGCAAAAAAAAAAA	0.267													4	3	---	---	---	---	
