Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
ALPL	249	broad.mit.edu	37	1	21903878	21903878	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:21903878C>T	uc001bet.2	+	12	1569	c.1312C>T	c.(1312-1314)CAC>TAC	p.H438Y	ALPL_uc010odn.1_Missense_Mutation_p.H386Y|ALPL_uc010odo.1_Missense_Mutation_p.H383Y|ALPL_uc010odp.1_Missense_Mutation_p.H361Y|ALPL_uc001beu.3_Missense_Mutation_p.H438Y	NM_000478	NP_000469	P05186	PPBT_HUMAN	tissue-nonspecific alkaline phosphatase	438					response to vitamin D|skeletal system development	anchored to membrane|cytoplasm|integral to membrane|plasma membrane	alkaline phosphatase activity|metal ion binding			ovary(2)|central_nervous_system(2)|skin(1)	5		all_lung(284;2.19e-05)|Lung NSC(340;2.22e-05)|Colorectal(325;3.46e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0192)|OV - Ovarian serous cystadenocarcinoma(117;8.7e-28)|COAD - Colon adenocarcinoma(152;1.57e-05)|GBM - Glioblastoma multiforme(114;2.66e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000177)|STAD - Stomach adenocarcinoma(196;0.00645)|KIRC - Kidney renal clear cell carcinoma(1967;0.00856)|READ - Rectum adenocarcinoma(331;0.0623)|Lung(427;0.146)	Amifostine(DB01143)	GCCCACAGCTCACAACAACTA	0.582													18	98	---	---	---	---	PASS
BSND	7809	broad.mit.edu	37	1	55474113	55474113	+	Missense_Mutation	SNP	T	A	A			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:55474113T>A	uc001cye.2	+	4	1018	c.775T>A	c.(775-777)TGG>AGG	p.W259R		NM_057176	NP_476517	Q8WZ55	BSND_HUMAN	barttin	259	Cytoplasmic (Potential).					basolateral plasma membrane|cytoplasm|integral to plasma membrane|protein complex				ovary(1)|skin(1)	2						GGGGCAGCAGTGGGAAATAGC	0.597													9	47	---	---	---	---	PASS
HFM1	164045	broad.mit.edu	37	1	91846537	91846537	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:91846537C>T	uc001doa.3	-	7	905	c.805G>A	c.(805-807)GCA>ACA	p.A269T	HFM1_uc010osu.1_Intron|HFM1_uc010osv.1_Intron|HFM1_uc001doc.1_Missense_Mutation_p.A269T	NM_001017975	NP_001017975	A2PYH4	HFM1_HUMAN	HFM1 protein	269							ATP binding|ATP-dependent helicase activity|nucleic acid binding				0		all_lung(203;0.00961)|Lung NSC(277;0.0351)		all cancers(265;0.000481)|Epithelial(280;0.00863)|OV - Ovarian serous cystadenocarcinoma(397;0.126)|KIRC - Kidney renal clear cell carcinoma(1967;0.171)		CTAAATTTTGCCGCTTACAAT	0.209													5	175	---	---	---	---	PASS
CLCC1	23155	broad.mit.edu	37	1	109477333	109477333	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109477333C>T	uc001dwe.1	-	11	1707	c.1615G>A	c.(1615-1617)GGA>AGA	p.G539R	AKNAD1_uc010ovb.1_Intron|CLCC1_uc001dwf.1_Missense_Mutation_p.G539R|CLCC1_uc001dwg.1_Missense_Mutation_p.G489R|CLCC1_uc009wes.1_Missense_Mutation_p.G418R|CLCC1_uc009wet.1_Missense_Mutation_p.G354R	NM_001048210	NP_001041675	Q96S66	CLCC1_HUMAN	Mid-1-related chloride channel 1 isoform 1	539						endoplasmic reticulum|Golgi apparatus|integral to membrane|nucleus				liver(1)	1		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)		Colorectal(144;0.0314)|Lung(183;0.0924)|COAD - Colon adenocarcinoma(174;0.119)|Epithelial(280;0.231)		CCACGTGGTCCAGCCACACCT	0.577													29	101	---	---	---	---	PASS
DENND4B	9909	broad.mit.edu	37	1	153916542	153916542	+	Silent	SNP	A	T	T			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153916542A>T	uc001fdd.1	-	2	710	c.309T>A	c.(307-309)GTT>GTA	p.V103V		NM_014856	NP_055671	O75064	DEN4B_HUMAN	DENN/MADD domain containing 4B	103	MABP.									ovary(1)	1	all_lung(78;2.89e-32)|Lung NSC(65;2.27e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			ACCCCAGCTCAACGAGGGGGG	0.632													7	47	---	---	---	---	PASS
IQGAP3	128239	broad.mit.edu	37	1	156498730	156498730	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156498730C>T	uc001fpf.2	-	35	4624	c.4549G>A	c.(4549-4551)GAC>AAC	p.D1517N		NM_178229	NP_839943	Q86VI3	IQGA3_HUMAN	IQ motif containing GTPase activating protein 3	1517					small GTPase mediated signal transduction	intracellular	calmodulin binding|Ras GTPase activator activity			ovary(5)|skin(1)	6	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					GCCAGGTGGTCCAGGCAGGCC	0.577													21	94	---	---	---	---	PASS
FMO2	2327	broad.mit.edu	37	1	171173043	171173043	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:171173043C>A	uc001ghk.1	+	6	784	c.667C>A	c.(667-669)CGT>AGT	p.R223S	FMO2_uc010pmd.1_Missense_Mutation_p.R3S	NM_001460	NP_001451	Q99518	FMO2_HUMAN	flavin containing monooxygenase 2	223					drug metabolic process|NADPH oxidation|organic acid metabolic process|toxin metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|host cell microsome|integral to membrane|microsome	flavin adenine dinucleotide binding|flavin-containing monooxygenase activity|NADP binding			skin(1)	1	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					GGTCATGAGCCGTATCTCTGA	0.473													20	94	---	---	---	---	PASS
THADA	63892	broad.mit.edu	37	2	43571338	43571338	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:43571338G>C	uc002rsw.3	-	30	4618	c.4266C>G	c.(4264-4266)CAC>CAG	p.H1422Q	THADA_uc010far.2_Missense_Mutation_p.H617Q|THADA_uc002rsx.3_Missense_Mutation_p.H1422Q|THADA_uc002rsy.3_RNA|THADA_uc010fas.1_RNA|THADA_uc002rsz.2_Missense_Mutation_p.H1131Q	NM_001083953	NP_001077422	Q6YHU6	THADA_HUMAN	thyroid adenoma associated	1422							binding			ovary(2)|skin(1)	3		Acute lymphoblastic leukemia(82;0.00361)|all_hematologic(82;0.00837)				AATTCGTTCCGTGTTTGGAGT	0.403													3	34	---	---	---	---	PASS
TTC7A	57217	broad.mit.edu	37	2	47221561	47221561	+	Silent	SNP	C	A	A			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:47221561C>A	uc002rvo.2	+	7	1277	c.909C>A	c.(907-909)CCC>CCA	p.P303P	TTC7A_uc002rvm.2_Silent_p.P269P|TTC7A_uc002rvn.1_Silent_p.P184P|TTC7A_uc010fbb.2_Silent_p.P303P|TTC7A_uc010fbc.2_Intron|TTC7A_uc002rvp.2_Silent_p.P184P|TTC7A_uc002rvq.2_Silent_p.P43P|TTC7A_uc002rvr.2_5'UTR	NM_020458	NP_065191	Q9ULT0	TTC7A_HUMAN	tetratricopeptide repeat domain 7A	303							binding			breast(1)|skin(1)	2		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.18)	Lung(47;0.0792)|LUSC - Lung squamous cell carcinoma(58;0.114)			ACTGGAGCCCCCTGTCCCACC	0.612													55	132	---	---	---	---	PASS
SUCLG1	8802	broad.mit.edu	37	2	84652566	84652566	+	Silent	SNP	A	G	G			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:84652566A>G	uc002son.2	-	8	1180	c.987T>C	c.(985-987)CCT>CCC	p.P329P		NM_003849	NP_003840	P53597	SUCA_HUMAN	succinate-CoA ligase, GDP-forming alpha subunit	329					tricarboxylic acid cycle		ATP citrate synthase activity|GTP binding|succinate-CoA ligase (GDP-forming) activity				0					Succinic acid(DB00139)	CCAGCTGTGCAGGAGACATAC	0.542													32	141	---	---	---	---	PASS
SLC4A10	57282	broad.mit.edu	37	2	162815017	162815017	+	Silent	SNP	A	G	G			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:162815017A>G	uc002ubx.3	+	21	2998	c.2814A>G	c.(2812-2814)CTA>CTG	p.L938L	SLC4A10_uc002uby.3_Silent_p.L908L|SLC4A10_uc010zcs.1_Silent_p.L919L	NM_022058	NP_071341	Q6U841	S4A10_HUMAN	solute carrier family 4, sodium bicarbonate	938	Helical; (Potential).				bicarbonate transport|chloride transport|sodium ion transport	integral to membrane|plasma membrane	inorganic anion exchanger activity|symporter activity			ovary(2)|lung(2)|pancreas(1)	5						TGCCAGTGCTATATGGAGTGT	0.353													10	65	---	---	---	---	PASS
RFTN2	130132	broad.mit.edu	37	2	198508984	198508984	+	Silent	SNP	C	T	T			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:198508984C>T	uc002uuo.3	-	3	738	c.336G>A	c.(334-336)TCG>TCA	p.S112S		NM_144629	NP_653230	Q52LD8	RFTN2_HUMAN	raftlin family member 2	112						plasma membrane					0						TGGGTGCTGCCGAATTCTTTG	0.453													25	96	---	---	---	---	PASS
SAG	6295	broad.mit.edu	37	2	234237149	234237149	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234237149A>G	uc002vuh.2	+	8	926	c.538A>G	c.(538-540)AAA>GAA	p.K180E	SAG_uc010zmq.1_Missense_Mutation_p.K46E	NM_000541	NP_000532	P10523	ARRS_HUMAN	S-arrestin	180				K -> S (in Ref. 1; CAA30984).	rhodopsin mediated phototransduction|rhodopsin mediated signaling pathway		protein phosphatase inhibitor activity			ovary(1)	1		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.018)|Acute lymphoblastic leukemia(138;0.0327)|Lung NSC(271;0.054)		Epithelial(121;2.86e-17)|BRCA - Breast invasive adenocarcinoma(100;0.00037)|LUSC - Lung squamous cell carcinoma(224;0.00608)|Lung(119;0.00714)|GBM - Glioblastoma multiforme(43;0.207)		ACTGATCCGCAAAGTACAGCA	0.602													30	118	---	---	---	---	PASS
ATG7	10533	broad.mit.edu	37	3	11348441	11348441	+	Nonsense_Mutation	SNP	C	A	A			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:11348441C>A	uc003bwc.2	+	4	357	c.240C>A	c.(238-240)TGC>TGA	p.C80*	ATG7_uc003bwd.2_Nonsense_Mutation_p.C80*|ATG7_uc011aum.1_Nonsense_Mutation_p.C80*	NM_006395	NP_006386	O95352	ATG7_HUMAN	APG7 autophagy 7-like isoform a	80					autophagy|cellular membrane fusion|positive regulation of protein modification process|protein lipidation|protein transport	cytoplasm	APG12 activating enzyme activity|protein homodimerization activity|ubiquitin activating enzyme activity			central_nervous_system(1)	1						CAGCCCGTTGCTGCCCAGCTA	0.502													63	151	---	---	---	---	PASS
FBLN2	2199	broad.mit.edu	37	3	13659663	13659663	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:13659663A>T	uc011avb.1	+	6	1942	c.1817A>T	c.(1816-1818)GAT>GTT	p.D606V	FBLN2_uc011auz.1_Missense_Mutation_p.D632V|FBLN2_uc011ava.1_Missense_Mutation_p.D606V|FBLN2_uc011avc.1_Missense_Mutation_p.D606V	NM_001998	NP_001989	P98095	FBLN2_HUMAN	fibulin 2 isoform b precursor	606	EGF-like 1; calcium-binding.					proteinaceous extracellular matrix	calcium ion binding|extracellular matrix structural constituent			ovary(1)	1			UCEC - Uterine corpus endometrioid carcinoma (1;0.00416)			GATGACCAGGATGAGTGCCTT	0.612													32	105	---	---	---	---	PASS
PBRM1	55193	broad.mit.edu	37	3	52643768	52643768	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52643768G>A	uc003des.2	-	16	2140	c.2128C>T	c.(2128-2130)CGA>TGA	p.R710*	PBRM1_uc003dex.2_RNA|PBRM1_uc003deq.2_Nonsense_Mutation_p.R710*|PBRM1_uc003der.2_Nonsense_Mutation_p.R678*|PBRM1_uc003det.2_Nonsense_Mutation_p.R725*|PBRM1_uc003deu.2_Nonsense_Mutation_p.R725*|PBRM1_uc003dev.2_RNA|PBRM1_uc003dew.2_Nonsense_Mutation_p.R710*|PBRM1_uc010hmk.1_Nonsense_Mutation_p.R710*|PBRM1_uc003dey.2_Nonsense_Mutation_p.R710*|PBRM1_uc003dez.1_Nonsense_Mutation_p.R710*|PBRM1_uc003dfb.1_Nonsense_Mutation_p.R623*|PBRM1_uc003dfa.1_Nonsense_Mutation_p.R56*|PBRM1_uc003dfc.2_Nonsense_Mutation_p.R77*	NM_181042	NP_060635	Q86U86	PB1_HUMAN	polybromo 1 isoform 4	710	Bromo 5.				chromatin remodeling|mitosis|negative regulation of cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear chromosome	chromatin binding|DNA binding|protein binding	p.R710fs*13(1)		kidney(136)|breast(4)	140				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		ATGTGACTTCGAATTTTTTCC	0.438			Mis|N|F|S|D|O		clear cell renal carcinoma|breast								56	151	---	---	---	---	PASS
LOC285359	285359	broad.mit.edu	37	3	101432120	101432120	+	RNA	SNP	C	G	G			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:101432120C>G	uc003dvj.2	+	1		c.843C>G				NR_002941				Homo sapiens cDNA FLJ12205 fis, clone MAMMA1000931.												0						ATGAATCCTTCTGGTTTTTAG	0.299													2	7	---	---	---	---	PASS
MUC4	4585	broad.mit.edu	37	3	195505876	195505876	+	Missense_Mutation	SNP	G	C	C			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195505876G>C	uc011bto.1	-	3	12651	c.12191C>G	c.(12190-12192)CCT>CGT	p.P4064R	MUC4_uc003fva.2_5'Flank|MUC4_uc003fvb.2_5'Flank|MUC4_uc003fvc.2_5'Flank|MUC4_uc003fvd.2_5'Flank|MUC4_uc003fve.2_5'Flank|MUC4_uc010hzr.2_5'Flank|MUC4_uc011btf.1_Intron|MUC4_uc011btg.1_Intron|MUC4_uc011bth.1_Intron|MUC4_uc011bti.1_Intron|MUC4_uc011btj.1_Intron|MUC4_uc011btk.1_Intron|MUC4_uc011btl.1_Intron|MUC4_uc011btm.1_Intron|MUC4_uc011btn.1_Intron|MUC4_uc003fvo.2_Intron|MUC4_uc003fvp.2_Intron|MUC4_uc010hzu.1_Intron	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a	955	Ser-rich.				cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GACAGGAAGAGGGGTGGTGTC	0.597													2	5	---	---	---	---	PASS
CCKAR	886	broad.mit.edu	37	4	26487295	26487295	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:26487295C>T	uc003gse.1	-	3	743	c.590G>A	c.(589-591)CGC>CAC	p.R197H		NM_000730	NP_000721	P32238	CCKAR_HUMAN	cholecystokinin A receptor	197	Extracellular (Potential).				activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|elevation of cytosolic calcium ion concentration|response to nutrient	integral to plasma membrane	cholecystokinin receptor activity			lung(3)|pancreas(1)	4		Breast(46;0.0503)			Ceruletide(DB00403)	CAGTAGAAAGCGGCACATATT	0.393													20	123	---	---	---	---	PASS
FAM114A1	92689	broad.mit.edu	37	4	38945294	38945294	+	3'UTR	SNP	A	T	T			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:38945294A>T	uc003gtn.2	+	15					FAM114A1_uc011byh.1_3'UTR|FAM114A1_uc010ifi.2_3'UTR	NM_138389	NP_612398	Q8IWE2	NXP20_HUMAN	hypothetical protein LOC92689							cytoplasm				ovary(1)	1						AGGACACTACAAGCAATTTTG	0.383													5	17	---	---	---	---	PASS
MEPE	56955	broad.mit.edu	37	4	88755860	88755860	+	5'UTR	SNP	C	T	T			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:88755860C>T	uc003hqy.2	+	2					MEPE_uc010ikn.2_5'UTR	NM_020203	NP_064588	Q9NQ76	MEPE_HUMAN	matrix, extracellular phosphoglycoprotein with						skeletal system development	proteinaceous extracellular matrix	extracellular matrix structural constituent|protein binding			ovary(1)|lung(1)|skin(1)	3		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000432)		TACAGAGATTCTCAAAGATGC	0.358													19	146	---	---	---	---	PASS
C4orf41	60684	broad.mit.edu	37	4	184629723	184629723	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:184629723T>C	uc003ivx.2	+	29	3529	c.3353T>C	c.(3352-3354)GTC>GCC	p.V1118A	C4orf41_uc003ivw.2_Silent_p.C1078C|C4orf41_uc010isc.2_Silent_p.C422C|C4orf41_uc003ivy.2_Missense_Mutation_p.V724A	NM_021942	NP_068761	Q7Z392	CD041_HUMAN	hypothetical protein LOC60684 isoform a	1118											0		all_lung(41;4.4e-14)|Lung NSC(41;1.03e-13)|Colorectal(36;0.00139)|all_hematologic(60;0.00756)|Hepatocellular(41;0.00826)|Renal(120;0.00988)|Prostate(90;0.0235)|all_neural(102;0.202)		all cancers(43;1.39e-26)|Epithelial(43;2.42e-22)|OV - Ovarian serous cystadenocarcinoma(60;6.85e-10)|GBM - Glioblastoma multiforme(59;6.71e-06)|Colorectal(24;9.67e-06)|STAD - Stomach adenocarcinoma(60;2.36e-05)|COAD - Colon adenocarcinoma(29;7.07e-05)|LUSC - Lung squamous cell carcinoma(40;0.00984)|READ - Rectum adenocarcinoma(43;0.171)		AGTATTTTTGTCAAGGTAAAG	0.363													8	74	---	---	---	---	PASS
PPIC	5480	broad.mit.edu	37	5	122359616	122359616	+	Missense_Mutation	SNP	T	A	A			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:122359616T>A	uc003kth.2	-	5	698	c.593A>T	c.(592-594)AAG>ATG	p.K198M		NM_000943	NP_000934	P45877	PPIC_HUMAN	peptidylprolyl isomerase C	198	PPIase cyclophilin-type.				protein folding|signal transduction	cytoplasm	cyclosporin A binding|peptidyl-prolyl cis-trans isomerase activity|unfolded protein binding			ovary(1)	1		all_cancers(142;0.0168)|Prostate(80;0.0322)|Lung NSC(810;0.102)|all_lung(232;0.163)	KIRC - Kidney renal clear cell carcinoma(527;0.0897)|Kidney(363;0.137)	OV - Ovarian serous cystadenocarcinoma(64;0.000331)|Epithelial(69;0.000553)|all cancers(49;0.00505)	L-Proline(DB00172)	CACGTCTATCTTGCCACTGTT	0.453													92	229	---	---	---	---	PASS
SIL1	64374	broad.mit.edu	37	5	138378410	138378410	+	Splice_Site	SNP	T	A	A			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:138378410T>A	uc003ldm.2	-	4	371	c.354_splice	c.e4-1	p.R118_splice	SIL1_uc003ldn.2_Splice_Site_p.R117_splice|SIL1_uc003ldo.2_Splice_Site_p.R118_splice|SIL1_uc003ldp.2_Splice_Site_p.R118_splice|SIL1_uc003ldq.1_Splice_Site	NM_022464	NP_071909	Q9H173	SIL1_HUMAN	SIL1 protein precursor						intracellular protein transport|protein folding|transmembrane transport	endoplasmic reticulum lumen	unfolded protein binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			ATATCCAGCCTGTCCAAAGAA	0.313									Marinesco-Sj_gren_syndrome				69	197	---	---	---	---	PASS
SLU7	10569	broad.mit.edu	37	5	159835383	159835383	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:159835383T>C	uc003lyg.2	-	8	927	c.772A>G	c.(772-774)AGA>GGA	p.R258G		NM_006425	NP_006416	O95391	SLU7_HUMAN	step II splicing factor SLU7	258					alternative nuclear mRNA splicing, via spliceosome|nuclear mRNA 3'-splice site recognition	catalytic step 2 spliceosome|cytoplasm|nuclear speck|small nuclear ribonucleoprotein complex	pre-mRNA 3'-splice site binding|second spliceosomal transesterification activity|zinc ion binding			ovary(1)	1	Renal(175;0.00196)	Medulloblastoma(196;0.0354)|all_neural(177;0.116)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			GTAATTCGTCTCTTGGAGTCA	0.368													18	163	---	---	---	---	PASS
UNC5A	90249	broad.mit.edu	37	5	176295140	176295140	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176295140C>A	uc003mey.2	+	3	494	c.302C>A	c.(301-303)ACC>AAC	p.T101N	UNC5A_uc003mex.1_Missense_Mutation_p.T101N|UNC5A_uc010jkg.1_Missense_Mutation_p.T61N	NM_133369	NP_588610	Q6ZN44	UNC5A_HUMAN	netrin receptor Unc5h1 precursor	101	Ig-like.|Extracellular (Potential).				apoptosis|axon guidance|regulation of apoptosis	integral to membrane|plasma membrane				skin(1)	1	all_cancers(89;0.000119)|Renal(175;0.000269)|Lung NSC(126;0.00696)|all_lung(126;0.0115)	Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GGGCTGCCCACCATGGAGGTC	0.652													56	144	---	---	---	---	PASS
HLA-E	3133	broad.mit.edu	37	6	30457321	30457321	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30457321A>G	uc003nqg.2	+	1	51	c.13A>G	c.(13-15)ACC>GCC	p.T5A	HLA-E_uc011dmg.1_RNA|HLA-E_uc011dmh.1_Silent_p.E2E	NM_005516	NP_005507	P13747	HLAE_HUMAN	major histocompatibility complex, class I, E	5					antigen processing and presentation of peptide antigen via MHC class I|interferon-gamma-mediated signaling pathway|regulation of immune response|type I interferon-mediated signaling pathway	integral to membrane|MHC class I protein complex	MHC class I receptor activity			central_nervous_system(4)|ovary(1)	5						GGTAGATGGAACCCTCCTTTT	0.577													15	96	---	---	---	---	PASS
LY6G6F	259215	broad.mit.edu	37	6	31675484	31675484	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31675484C>T	uc003nwa.1	+	2	302	c.302C>T	c.(301-303)GCC>GTC	p.A101V	BAT5_uc011dnz.1_Intron|LY6G6F_uc003nwb.1_Missense_Mutation_p.A101V	NM_001003693	NP_001003693	Q5SQ64	LY66F_HUMAN	G6f protein precursor	101	Extracellular (Potential).|Ig-like V-type.					integral to membrane|plasma membrane				breast(1)|central_nervous_system(1)	2						GAGGAAGATGCCGGGCGGTAC	0.582													3	51	---	---	---	---	PASS
GRM4	2914	broad.mit.edu	37	6	34100855	34100855	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:34100855C>T	uc003oir.3	-	1	589	c.419G>A	c.(418-420)GGC>GAC	p.G140D	GRM4_uc011dsn.1_Missense_Mutation_p.G140D|GRM4_uc010jvh.2_Missense_Mutation_p.G140D|GRM4_uc010jvi.2_5'UTR|GRM4_uc010jvk.1_Missense_Mutation_p.G59D	NM_000841	NP_000832	Q14833	GRM4_HUMAN	glutamate receptor, metabotropic 4 precursor	140	Extracellular (Potential).				activation of MAPK activity|inhibition of adenylate cyclase activity by metabotropic glutamate receptor signaling pathway|neuroprotection|neurotransmitter secretion|positive regulation of MAPKKK cascade	cytoplasmic vesicle|integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity			lung(3)|upper_aerodigestive_tract(1)|ovary(1)|skin(1)	6					L-Glutamic Acid(DB00142)	GATGGGTGGGCCGCCACTGCC	0.612													3	28	---	---	---	---	PASS
DSE	29940	broad.mit.edu	37	6	116752301	116752301	+	Missense_Mutation	SNP	T	A	A			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:116752301T>A	uc003pws.2	+	4	1049	c.855T>A	c.(853-855)TTT>TTA	p.F285L	DSE_uc011ebg.1_Missense_Mutation_p.F304L|DSE_uc003pwt.2_Missense_Mutation_p.F285L|DSE_uc003pwu.2_5'Flank	NM_001080976	NP_001074445	Q9UL01	DSE_HUMAN	dermatan sulfate epimerase precursor	285					dermatan sulfate biosynthetic process	endoplasmic reticulum|Golgi apparatus|integral to membrane	chondroitin-glucuronate 5-epimerase activity			ovary(1)	1		all_cancers(87;0.00019)|all_epithelial(87;0.000416)|Ovarian(999;0.133)|Colorectal(196;0.234)		Epithelial(106;0.00915)|OV - Ovarian serous cystadenocarcinoma(136;0.0149)|GBM - Glioblastoma multiforme(226;0.0189)|all cancers(137;0.0262)		TCAACCACTTTGGCCATCCGT	0.428													32	111	---	---	---	---	PASS
MLLT4	4301	broad.mit.edu	37	6	168325728	168325728	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:168325728T>C	uc003qwd.2	+	22	3174	c.3032T>C	c.(3031-3033)CTA>CCA	p.L1011P	MLLT4_uc003qwb.1_Missense_Mutation_p.L996P|MLLT4_uc003qwc.1_Missense_Mutation_p.L1012P|MLLT4_uc003qwg.1_Missense_Mutation_p.L321P	NM_001040001	NP_001035090	P55196	AFAD_HUMAN	myeloid/lymphoid or mixed-lineage leukemia	1012	PDZ.				adherens junction organization|cell adhesion|cell junction assembly|cell-cell signaling|signal transduction	adherens junction|cell-cell junction|cytosol|nucleus	protein C-terminus binding			ovary(2)|lung(1)|kidney(1)|central_nervous_system(1)	5		Breast(66;1.07e-05)|Ovarian(120;0.024)		Epithelial(4;2.38e-32)|OV - Ovarian serous cystadenocarcinoma(33;9.99e-23)|BRCA - Breast invasive adenocarcinoma(4;1.2e-11)|GBM - Glioblastoma multiforme(31;0.00117)		ACTGTGACCCTAAAAAAGCAG	0.423			T	MLL	AL								3	119	---	---	---	---	PASS
CARD11	84433	broad.mit.edu	37	7	2976856	2976856	+	Silent	SNP	G	T	T			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2976856G>T	uc003smv.2	-	9	1560	c.1156C>A	c.(1156-1158)CGA>AGA	p.R386R		NM_032415	NP_115791	Q9BXL7	CAR11_HUMAN	caspase recruitment domain family, member 11	386	Potential.				positive regulation of cytokine production|positive regulation of NF-kappaB transcription factor activity|regulation of apoptosis|T cell costimulation|T cell receptor signaling pathway	cytosol|membrane raft|plasma membrane	CARD domain binding|guanylate kinase activity			haematopoietic_and_lymphoid_tissue(43)|ovary(2)|kidney(2)|skin(2)|central_nervous_system(1)	50		Ovarian(82;0.0115)		OV - Ovarian serous cystadenocarcinoma(56;8.44e-14)		GCTTCATCTCGGGAGTGGAAG	0.577			Mis		DLBCL								4	127	---	---	---	---	PASS
POR	5447	broad.mit.edu	37	7	75611556	75611556	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:75611556A>G	uc003udy.2	+	8	828	c.746A>G	c.(745-747)GAG>GGG	p.E249G	POR_uc011kgc.1_Missense_Mutation_p.E57G|POR_uc011kgd.1_Missense_Mutation_p.E148G|POR_uc011kge.1_5'UTR	NM_000941	NP_000932	P16435	NCPR_HUMAN	cytochrome P450 reductase	246					cellular organofluorine metabolic process|positive regulation of monooxygenase activity	endoplasmic reticulum membrane	iron ion binding|NADPH-hemoprotein reductase activity			central_nervous_system(1)	1					Benzphetamine(DB00865)|Daunorubicin(DB00694)|Lipoic Acid(DB00166)|Menadione(DB00170)|Methoxyflurane(DB01028)|Mitomycin(DB00305)|Nilutamide(DB00665)	CGCCAGTACGAGCTTGTGGTC	0.632													7	11	---	---	---	---	PASS
KIAA1324L	222223	broad.mit.edu	37	7	86537054	86537054	+	Silent	SNP	G	A	A			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:86537054G>A	uc011kha.1	-	18	2675	c.2490C>T	c.(2488-2490)GGC>GGT	p.G830G	KIAA1324L_uc003uif.1_Silent_p.G590G|KIAA1324L_uc011kgz.1_Silent_p.G716G|KIAA1324L_uc003uie.2_Silent_p.G663G	NM_001142749	NP_001136221	A8MWY0	K132L_HUMAN	hypothetical protein LOC222223 isoform 1	830	Extracellular (Potential).					integral to membrane				ovary(6)|skin(1)	7	Esophageal squamous(14;0.0058)					CAGTTGATCGGCCATTAATAC	0.348													4	177	---	---	---	---	PASS
AKAP9	10142	broad.mit.edu	37	7	91739549	91739549	+	3'UTR	SNP	G	T	T			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:91739549G>T	uc003ulg.2	+	50					AKAP9_uc003ulf.2_3'UTR|AKAP9_uc003uli.2_3'UTR|AKAP9_uc003ull.2_3'UTR	NM_005751	NP_005742	Q99996	AKAP9_HUMAN	A-kinase anchor protein 9 isoform 2						G2/M transition of mitotic cell cycle|signal transduction|synaptic transmission|transport	centrosome|cytosol|Golgi apparatus	receptor binding			breast(7)|ovary(6)|lung(5)|skin(3)|large_intestine(2)|prostate(2)|central_nervous_system(1)	26	all_cancers(62;2.46e-09)|all_epithelial(64;4.42e-08)|Breast(17;0.00206)|all_lung(186;0.185)|all_hematologic(106;0.215)|Lung NSC(181;0.249)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			TTGTGCTTTTGTATTGTGAAT	0.308			T	BRAF	papillary thyroid								5	15	---	---	---	---	PASS
MCM7	4176	broad.mit.edu	37	7	99697218	99697218	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99697218C>A	uc003usw.1	-	3	780	c.270G>T	c.(268-270)GAG>GAT	p.E90D	MCM7_uc003usv.1_5'UTR|MCM7_uc003usx.1_5'UTR|AP4M1_uc011kjg.1_5'Flank|AP4M1_uc010lgl.1_5'Flank|AP4M1_uc003utb.3_5'Flank|AP4M1_uc003utc.3_5'Flank|AP4M1_uc010lgm.2_5'Flank|AP4M1_uc003utd.2_5'Flank|AP4M1_uc011kjh.1_5'Flank|AP4M1_uc003ute.3_5'Flank|AP4M1_uc003utf.3_5'Flank	NM_005916	NP_005907	P33993	MCM7_HUMAN	minichromosome maintenance complex component 7	90					cell cycle checkpoint|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|regulation of phosphorylation|response to DNA damage stimulus|S phase of mitotic cell cycle	chromatin|MCM complex	ATP binding|protein binding				0	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)				Atorvastatin(DB01076)	TCACTTCCCTCTCCTTGTACT	0.512													34	163	---	---	---	---	PASS
ZAN	7455	broad.mit.edu	37	7	100361679	100361679	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100361679C>T	uc003uwj.2	+	22	4292	c.4127C>T	c.(4126-4128)TCC>TTC	p.S1376F	ZAN_uc003uwk.2_Missense_Mutation_p.S1376F|ZAN_uc003uwl.2_RNA|ZAN_uc010lhh.2_RNA|ZAN_uc010lhi.2_RNA|ZAN_uc011kkd.1_Intron	NM_003386	NP_003377	Q9Y493	ZAN_HUMAN	zonadhesin isoform 3	1376	Extracellular (Potential).				binding of sperm to zona pellucida|cell-cell adhesion	integral to membrane|plasma membrane				ovary(4)|large_intestine(3)|central_nervous_system(2)|pancreas(2)	11	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			AAGGCCGCTTCCTTCTTCGAC	0.602													5	86	---	---	---	---	PASS
IFRD1	3475	broad.mit.edu	37	7	112098980	112098980	+	Silent	SNP	T	C	C			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:112098980T>C	uc003vgh.2	+	6	917	c.474T>C	c.(472-474)CCT>CCC	p.P158P	IFRD1_uc011kmn.1_Silent_p.P108P|IFRD1_uc003vgj.2_Silent_p.P158P|IFRD1_uc011kmo.1_Intron|IFRD1_uc011kmp.1_Silent_p.P108P	NM_001007245	NP_001007246	O00458	IFRD1_HUMAN	interferon-related developmental regulator 1	158					multicellular organismal development|myoblast cell fate determination		binding			kidney(1)|central_nervous_system(1)	2						AGCTGGGCCCTGGAATTGAAA	0.423													3	115	---	---	---	---	PASS
CCDC136	64753	broad.mit.edu	37	7	128432343	128432343	+	5'UTR	SNP	C	A	A			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128432343C>A	uc003vnv.1	+	1					CCDC136_uc003vnu.1_Intron|CCDC136_uc003vnw.1_5'UTR	NM_022742	NP_073579	Q96JN2	CC136_HUMAN	coiled-coil domain containing 136							integral to membrane	protein binding			ovary(2)	2						AGCCCCCCACCCCCCAGCCCC	0.627													4	5	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	142032050	142032050	+	Intron	SNP	G	C	C			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142032050G>C	uc011kro.1	+						uc011krp.1_Intron|uc011krr.1_Intron|uc011krs.1_Missense_Mutation_p.R4S					SubName: Full=V_segment translation product; Flags: Fragment;																		TGGGCACAAGGCTCCTCTGCT	0.483													3	39	---	---	---	---	PASS
ZNF398	57541	broad.mit.edu	37	7	148877021	148877021	+	3'UTR	SNP	T	C	C			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:148877021T>C	uc003wfl.2	+	6					ZNF398_uc011kul.1_3'UTR|ZNF398_uc011kum.1_3'UTR	NM_170686	NP_733787	Q8TD17	ZN398_HUMAN	zinc finger 398 isoform a						positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00143)			TTTGGGGTCCTATACACTTGA	0.438													2	6	---	---	---	---	PASS
DPP6	1804	broad.mit.edu	37	7	154598713	154598713	+	Silent	SNP	G	T	T			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:154598713G>T	uc003wlk.2	+	16	1686	c.1557G>T	c.(1555-1557)ACG>ACT	p.T519T	DPP6_uc003wli.2_Silent_p.T455T|DPP6_uc003wlm.2_Silent_p.T457T|DPP6_uc011kvq.1_Silent_p.T412T	NM_130797	NP_570629	P42658	DPP6_HUMAN	dipeptidyl-peptidase 6 isoform 1	519	Extracellular (Potential).				cell death|proteolysis	integral to membrane	dipeptidyl-peptidase activity|serine-type peptidase activity			pancreas(3)|breast(1)	4	all_neural(206;0.181)	all_hematologic(28;0.0044)|all_lung(21;0.0176)|Lung NSC(21;0.0204)	OV - Ovarian serous cystadenocarcinoma(82;0.0562)			GTGCCAACACGGTGGGCAACT	0.592													3	109	---	---	---	---	PASS
ASPH	444	broad.mit.edu	37	8	62492299	62492299	+	Intron	SNP	T	C	C			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:62492299T>C	uc011leg.1	-						ASPH_uc003xuj.2_Intron|ASPH_uc003xuo.2_Intron|uc003xuk.2_3'UTR	NM_004318	NP_004309	Q12797	ASPH_HUMAN	aspartate beta-hydroxylase isoform a						muscle contraction	integral to endoplasmic reticulum membrane	calcium ion binding|electron carrier activity|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|peptide-aspartate beta-dioxygenase activity|structural constituent of muscle			ovary(3)	3	Lung SC(2;0.153)	Lung NSC(129;0.0358)|all_lung(136;0.0654)|all_epithelial(80;0.101)			L-Aspartic Acid(DB00128)|Succinic acid(DB00139)	GAGGCCACTATTCAGGGTAGC	0.637													5	24	---	---	---	---	PASS
ZHX1	11244	broad.mit.edu	37	8	124267206	124267206	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:124267206C>A	uc003yqe.2	-	3	1411	c.981G>T	c.(979-981)CAG>CAT	p.Q327H	C8orf76_uc003yqd.2_Intron|ZHX1_uc003yqf.2_Missense_Mutation_p.Q327H|ZHX1_uc003yqg.2_Intron|ZHX1_uc010mdi.2_Missense_Mutation_p.Q327H	NM_007222	NP_009153	Q9UKY1	ZHX1_HUMAN	zinc fingers and homeoboxes 1	327	Required for dimerization.|Homeobox 1.|Required for interaction with NFYA.				negative regulation of transcription, DNA-dependent	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1	Lung NSC(37;1.25e-09)|Ovarian(258;0.0154)		STAD - Stomach adenocarcinoma(47;0.00527)			ATATCTTGATCTGTTCCTCTG	0.398													7	458	---	---	---	---	PASS
LINGO2	158038	broad.mit.edu	37	9	27948759	27948759	+	3'UTR	SNP	G	A	A	rs140204731	by1000genomes	TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:27948759G>A	uc003zqu.1	-	2					LINGO2_uc010mjf.1_3'UTR|LINGO2_uc003zqv.1_3'UTR	NM_152570	NP_689783	Q7L985	LIGO2_HUMAN	leucine rich repeat and Ig domain containing 2							integral to membrane				upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	3	Melanoma(11;0.242)	all_neural(11;2.78e-09)		UCEC - Uterine corpus endometrioid carcinoma (5;0.0818)|GBM - Glioblastoma multiforme(2;1.31e-34)|all cancers(2;2.37e-25)|Lung(2;7.48e-08)|LUSC - Lung squamous cell carcinoma(38;5.09e-07)|KIRC - Kidney renal clear cell carcinoma(2;0.0465)|Kidney(2;0.0604)		AGCTGCACATGGCTGCCTCTT	0.478													31	96	---	---	---	---	PASS
ACO1	48	broad.mit.edu	37	9	32434667	32434667	+	Silent	SNP	C	T	T			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:32434667C>T	uc003zqw.3	+	17	2222	c.2067C>T	c.(2065-2067)AAC>AAT	p.N689N	ACO1_uc010mjh.1_Silent_p.N523N|ACO1_uc003zqx.3_Silent_p.N689N|ACO1_uc003zqy.3_RNA	NM_002197	NP_002188	P21399	ACOC_HUMAN	aconitase 1	689					citrate metabolic process|response to iron(II) ion|tricarboxylic acid cycle	cytosol|endoplasmic reticulum|Golgi apparatus	4 iron, 4 sulfur cluster binding|aconitate hydratase activity|citrate hydro-lyase (cis-aconitate-forming) activity|iron-responsive element binding|isocitrate hydro-lyase (cis-aconitate-forming) activity|metal ion binding|protein binding				0			LUSC - Lung squamous cell carcinoma(29;0.00813)	GBM - Glioblastoma multiforme(74;3.94e-06)		TTGCAAGAAACAGTCCTGCTG	0.448													38	147	---	---	---	---	PASS
S1PR3	1903	broad.mit.edu	37	9	91616543	91616543	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:91616543T>C	uc004aqe.2	+	2	824	c.428T>C	c.(427-429)ATG>ACG	p.M143T		NM_005226	NP_005217	Q99500	S1PR3_HUMAN	sphingosine-1-phosphate receptor 3	143	Cytoplasmic (By similarity).				anatomical structure morphogenesis|elevation of cytosolic calcium ion concentration|inflammatory response|positive regulation of cell proliferation	integral to plasma membrane	lipid binding|lysosphingolipid and lysophosphatidic acid receptor activity			ovary(2)|lung(1)|central_nervous_system(1)|skin(1)	5						ATGATCAAAATGAGGCCTTAC	0.607											OREG0019291	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	21	72	---	---	---	---	PASS
SUSD3	203328	broad.mit.edu	37	9	95847078	95847078	+	3'UTR	SNP	A	C	C			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:95847078A>C	uc004atb.2	+	5					SUSD3_uc004atc.2_3'UTR	NM_145006	NP_659443	Q96L08	SUSD3_HUMAN	sushi domain containing 3							integral to membrane				breast(2)|skin(2)|ovary(1)|lung(1)	6						GGCCAGGCTGACCCCACCAGC	0.612													6	11	---	---	---	---	PASS
TEX10	54881	broad.mit.edu	37	9	103109629	103109629	+	Silent	SNP	T	G	G			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:103109629T>G	uc004bas.2	-	3	455	c.240A>C	c.(238-240)GGA>GGC	p.G80G	TEX10_uc011lvf.1_Silent_p.G15G|TEX10_uc011lvg.1_Silent_p.G83G|TEX10_uc011lvh.1_Silent_p.G15G|TEX10_uc004bat.2_Silent_p.G80G	NM_017746	NP_060216	Q9NXF1	TEX10_HUMAN	testis expressed 10 isoform 1	80						integral to membrane|MLL1 complex|nuclear membrane|nucleolus	binding			ovary(1)|skin(1)	2		Acute lymphoblastic leukemia(62;0.0527)		OV - Ovarian serous cystadenocarcinoma(323;0.157)		GGTCTTTAAGTCCAAGAAGAG	0.323													72	283	---	---	---	---	PASS
GPR158	57512	broad.mit.edu	37	10	25887644	25887644	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:25887644C>G	uc001isj.2	+	11	3149	c.3089C>G	c.(3088-3090)TCT>TGT	p.S1030C	GPR158_uc001isk.2_Missense_Mutation_p.S405C	NM_020752	NP_065803	Q5T848	GP158_HUMAN	G protein-coupled receptor 158 precursor	1030	Cytoplasmic (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(4)|large_intestine(2)|pancreas(1)|skin(1)	8						AAGCACGTATCTATTGTGGCT	0.453													34	114	---	---	---	---	PASS
LOC642826	642826	broad.mit.edu	37	10	47207813	47207813	+	RNA	SNP	T	C	C			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:47207813T>C	uc001jei.2	-	12		c.1586A>G			uc009xnf.2_Missense_Mutation_p.H132R					Homo sapiens cDNA, FLJ99065.												0						TTTACTTACATGGTTTGTACA	0.294													4	57	---	---	---	---	PASS
CTNNA3	29119	broad.mit.edu	37	10	68139003	68139003	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:68139003C>G	uc009xpn.1	-	12	1762	c.1639G>C	c.(1639-1641)GTT>CTT	p.V547L	CTNNA3_uc001jmw.2_Missense_Mutation_p.V547L	NM_001127384	NP_001120856	Q9UI47	CTNA3_HUMAN	catenin, alpha 3	547					cell-cell adhesion	actin cytoskeleton|cytoplasm|fascia adherens	cadherin binding|structural molecule activity			skin(3)|ovary(2)|pancreas(1)|lung(1)|central_nervous_system(1)	8						ATGTGAGCAACTCTTGCTGCC	0.473													21	161	---	---	---	---	PASS
CCNJ	54619	broad.mit.edu	37	10	97816869	97816869	+	Intron	SNP	C	T	T			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:97816869C>T	uc001klm.2	+						uc001klg.1_Intron|uc001klj.1_Intron|uc009xvb.1_Intron|CCNJ_uc010qoq.1_Missense_Mutation_p.P202L|CCNJ_uc001kln.2_Intron	NM_019084	NP_061957	Q5T5M9	CCNJ_HUMAN	cyclin J isoform 2							nucleus				ovary(1)	1				Epithelial(162;6.1e-08)|all cancers(201;2.32e-06)		AATTATGCACCTTCTTTAGTA	0.423													67	199	---	---	---	---	PASS
PRMT3	10196	broad.mit.edu	37	11	20486044	20486044	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:20486044A>C	uc001mqb.2	+	13	1516	c.1299A>C	c.(1297-1299)GAA>GAC	p.E433D	PRMT3_uc001mqc.2_Missense_Mutation_p.E356D|PRMT3_uc010rdn.1_Missense_Mutation_p.E371D	NM_005788	NP_005779	O60678	ANM3_HUMAN	protein arginine methyltransferase 3 isoform 1	433							zinc ion binding				0						CAGATTTGGAATTTTCATCAG	0.333													23	145	---	---	---	---	PASS
PRMT3	10196	broad.mit.edu	37	11	20486049	20486049	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:20486049C>T	uc001mqb.2	+	13	1521	c.1304C>T	c.(1303-1305)TCA>TTA	p.S435L	PRMT3_uc001mqc.2_Missense_Mutation_p.S358L|PRMT3_uc010rdn.1_Missense_Mutation_p.S373L	NM_005788	NP_005779	O60678	ANM3_HUMAN	protein arginine methyltransferase 3 isoform 1	435							zinc ion binding				0						TTGGAATTTTCATCAGATTTT	0.353													26	139	---	---	---	---	PASS
CTNND1	1500	broad.mit.edu	37	11	57573353	57573353	+	Splice_Site	SNP	G	A	A			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57573353G>A	uc001nmc.3	+	10	2294	c.1723_splice	c.e10-1	p.L575_splice	CTNND1_uc001nlh.1_Splice_Site_p.L575_splice|CTNND1_uc001nlu.3_Splice_Site_p.L474_splice|CTNND1_uc001nlt.3_Splice_Site_p.L474_splice|CTNND1_uc001nls.3_Splice_Site_p.L474_splice|CTNND1_uc001nlw.3_Splice_Site_p.L474_splice|CTNND1_uc001nmf.3_Splice_Site_p.L575_splice|CTNND1_uc001nmd.3_Splice_Site_p.L521_splice|CTNND1_uc001nlk.3_Splice_Site_p.L521_splice|CTNND1_uc001nme.3_Splice_Site_p.L575_splice|CTNND1_uc001nll.3_Splice_Site_p.L521_splice|CTNND1_uc001nmg.3_Splice_Site_p.L521_splice|CTNND1_uc001nlj.3_Splice_Site_p.L521_splice|CTNND1_uc001nlr.3_Splice_Site_p.L521_splice|CTNND1_uc001nlp.3_Splice_Site_p.L521_splice|CTNND1_uc001nlx.3_Splice_Site_p.L252_splice|CTNND1_uc001nlz.3_Splice_Site_p.L252_splice|CTNND1_uc009ymn.2_Splice_Site_p.L252_splice|CTNND1_uc001nlm.3_Splice_Site_p.L575_splice|CTNND1_uc001nly.3_Splice_Site_p.L252_splice|CTNND1_uc001nmb.3_Splice_Site_p.L252_splice|CTNND1_uc001nma.3_Splice_Site_p.L252_splice|CTNND1_uc001nmi.3_Splice_Site_p.L474_splice|CTNND1_uc001nmh.3_Splice_Site_p.L575_splice|CTNND1_uc001nlq.3_Splice_Site_p.L474_splice|CTNND1_uc001nln.3_Splice_Site_p.L575_splice|CTNND1_uc001nli.3_Splice_Site_p.L575_splice|CTNND1_uc001nlo.3_Splice_Site_p.L474_splice|CTNND1_uc001nlv.3_Splice_Site_p.L474_splice	NM_001085458	NP_001078927	O60716	CTND1_HUMAN	catenin, delta 1 isoform 1ABC						adherens junction organization|cell junction assembly|negative regulation of canonical Wnt receptor signaling pathway|regulation of transcription, DNA-dependent|transcription, DNA-dependent|Wnt receptor signaling pathway	cytosol|midbody|nucleus	cadherin binding|protein binding|receptor binding			breast(4)|ovary(1)|kidney(1)	6		all_epithelial(135;0.155)				ATGTCCCTAAGCTTGTAGAGA	0.423													10	50	---	---	---	---	PASS
CCDC88B	283234	broad.mit.edu	37	11	64124422	64124422	+	Intron	SNP	T	G	G			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64124422T>G	uc001nzy.2	+						CCDC88B_uc001oaa.2_Intron|CCDC88B_uc001oab.1_3'UTR|CCDC88B_uc001oac.2_Intron|RPS6KA4_uc001oad.2_5'Flank|RPS6KA4_uc001oae.2_5'Flank|RPS6KA4_uc010rnl.1_5'Flank|RPS6KA4_uc001oaf.2_5'Flank|RPS6KA4_uc009ypp.2_5'Flank	NM_032251	NP_115627	A6NC98	CC88B_HUMAN	coiled-coil domain containing 88						microtubule cytoskeleton organization	cytoplasm	microtubule binding			ovary(3)|skin(1)	4						AGGTCGGGGGTGGGCAGAAGG	0.502													6	12	---	---	---	---	PASS
MAML2	84441	broad.mit.edu	37	11	95825502	95825502	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:95825502C>T	uc001pfw.1	-	2	2978	c.1693G>A	c.(1693-1695)GAT>AAT	p.D565N		NM_032427	NP_115803	Q8IZL2	MAML2_HUMAN	mastermind-like 2	565					Notch signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nuclear speck	transcription coactivator activity		CRTC1/MAML2(516)|CRTC3/MAML2(26)	salivary_gland(500)|lung(36)|thyroid(4)|breast(3)|skin(2)|ovary(1)	546		Acute lymphoblastic leukemia(157;2.63e-05)|all_hematologic(158;0.00837)				TTCGCTTGATCTGAGTTAAAA	0.423			T	MECT1|CRTC3	salivary gland mucoepidermoid								5	18	---	---	---	---	PASS
GRIN2B	2904	broad.mit.edu	37	12	13716451	13716451	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:13716451G>A	uc001rbt.2	-	13	3900	c.3721C>T	c.(3721-3723)CGG>TGG	p.R1241W		NM_000834	NP_000825	Q13224	NMDE2_HUMAN	N-methyl-D-aspartate receptor subunit 2B	1241	Cytoplasmic (Potential).				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	glycine binding|N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding			central_nervous_system(4)|ovary(3)|skin(3)|lung(2)	12					Felbamate(DB00949)|Haloperidol(DB00502)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)	GCCTCACACCGGATGCACGCC	0.632													5	118	---	---	---	---	PASS
ADAMTS20	80070	broad.mit.edu	37	12	43862444	43862444	+	Silent	SNP	T	G	G			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:43862444T>G	uc010skx.1	-	8	1182	c.1182A>C	c.(1180-1182)GGA>GGC	p.G394G		NM_025003	NP_079279	P59510	ATS20_HUMAN	a disintegrin-like and metalloprotease with	394	Peptidase M12B.					proteinaceous extracellular matrix	zinc ion binding			central_nervous_system(5)|ovary(4)|lung(3)|large_intestine(2)|skin(2)|urinary_tract(1)|kidney(1)|pancreas(1)	19	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		CAGAAATGAGTCCTTTTTCTT	0.348													22	92	---	---	---	---	PASS
KCNMB4	27345	broad.mit.edu	37	12	70794112	70794112	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:70794112C>T	uc001svx.2	+	2	913	c.460C>T	c.(460-462)CAA>TAA	p.Q154*		NM_014505	NP_055320	Q86W47	KCMB4_HUMAN	calcium-activated potassium channel beta 4	154	Extracellular (Potential).				detection of calcium ion|platelet activation|regulation of action potential in neuron|regulation of neurotransmitter secretion|regulation of vasoconstriction|synaptic transmission	voltage-gated potassium channel complex	calcium-activated potassium channel activity|protein binding				0	Renal(347;0.236)		Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00243)|STAD - Stomach adenocarcinoma(21;0.0118)			TAATCAACATCAAAGGTAAGT	0.368													8	308	---	---	---	---	PASS
BBS10	79738	broad.mit.edu	37	12	76741471	76741471	+	Silent	SNP	A	G	G			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:76741471A>G	uc001syd.1	-	2	378	c.294T>C	c.(292-294)CAT>CAC	p.H98H		NM_024685	NP_078961	Q8TAM1	BBS10_HUMAN	Bardet-Biedl syndrome 10	98					cellular protein metabolic process|nonmotile primary cilium assembly|photoreceptor cell maintenance|response to stimulus|retina homeostasis	cilium	ATP binding			ovary(1)|skin(1)	2						CTGTGATTGCATGAAGTCCTC	0.383									Bardet-Biedl_syndrome				40	167	---	---	---	---	PASS
KIAA1033	23325	broad.mit.edu	37	12	105537004	105537004	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:105537004A>G	uc001tld.2	+	20	2080	c.1993A>G	c.(1993-1995)ATG>GTG	p.M665V	KIAA1033_uc010swr.1_Missense_Mutation_p.M666V|KIAA1033_uc010sws.1_Missense_Mutation_p.M477V	NM_015275	NP_056090	Q2M389	WAHS7_HUMAN	hypothetical protein LOC23325	665					endosome transport	WASH complex				kidney(1)|central_nervous_system(1)	2						CAAGGAAATTATGGAAATTTT	0.358													6	55	---	---	---	---	PASS
N4BP2L2	10443	broad.mit.edu	37	13	33110645	33110645	+	Missense_Mutation	SNP	G	T	T			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:33110645G>T	uc001uuk.3	-	2	698	c.520C>A	c.(520-522)CAG>AAG	p.Q174K	N4BP2L2_uc010abe.1_Intron|N4BP2L2_uc010tdz.1_Intron|N4BP2L2_uc001uul.1_Missense_Mutation_p.Q174K|N4BP2L2_uc001uum.2_5'Flank	NM_014887	NP_055702	Q92802	N42L2_HUMAN	phosphonoformate immuno-associated protein 5	174	Potential.										0		Lung SC(185;0.0262)		all cancers(112;9.5e-07)|Epithelial(112;5.07e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00196)|BRCA - Breast invasive adenocarcinoma(63;0.00438)|GBM - Glioblastoma multiforme(144;0.243)		TTGTAAAACTGGAATAATTCA	0.318													33	174	---	---	---	---	PASS
KIAA0564	23078	broad.mit.edu	37	13	42385389	42385389	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:42385389T>C	uc001uyj.2	-	17	2105	c.2035A>G	c.(2035-2037)AGT>GGT	p.S679G	KIAA0564_uc001uyk.2_Missense_Mutation_p.S679G	NM_015058	NP_055873	A3KMH1	K0564_HUMAN	hypothetical protein LOC23078 isoform a	679						extracellular region	ATP binding|ATPase activity			ovary(3)|upper_aerodigestive_tract(1)|kidney(1)|skin(1)	6		Lung NSC(96;4.61e-06)|Prostate(109;0.0167)|Lung SC(185;0.0262)|Breast(139;0.0854)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;0.000368)|GBM - Glioblastoma multiforme(144;0.0033)|BRCA - Breast invasive adenocarcinoma(63;0.0969)		GTAACAGCACTGTGAAGATTT	0.388													4	121	---	---	---	---	PASS
TGDS	23483	broad.mit.edu	37	13	95243124	95243124	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:95243124G>A	uc001vlw.2	-	4	417	c.296C>T	c.(295-297)GCC>GTC	p.A99V	TGDS_uc001vlx.2_Intron	NM_014305	NP_055120	O95455	TGDS_HUMAN	TDP-glucose 4,6-dehydratase	99					cellular metabolic process		coenzyme binding|dTDP-glucose 4,6-dehydratase activity|protein binding				0	all_neural(89;0.0684)|Medulloblastoma(90;0.163)					TGTTTGTGCGGCAAAATGTAG	0.378													5	227	---	---	---	---	PASS
RPL10L	140801	broad.mit.edu	37	14	47120879	47120879	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:47120879G>A	uc001wwg.2	-	1	150	c.61C>T	c.(61-63)CGT>TGT	p.R21C		NM_080746	NP_542784	Q96L21	RL10L_HUMAN	ribosomal protein L10-like protein	21					spermatogenesis|translation	cytosolic large ribosomal subunit|nucleus	structural constituent of ribosome			ovary(1)	1						CGGCAGAAACGAGATTTTGGG	0.547													4	175	---	---	---	---	PASS
MPP5	64398	broad.mit.edu	37	14	67779288	67779288	+	Silent	SNP	T	C	C			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:67779288T>C	uc001xjc.2	+	9	1552	c.1086T>C	c.(1084-1086)CCT>CCC	p.P362P	MPP5_uc001xjd.2_Silent_p.P328P|ATP6V1D_uc001xje.2_Intron	NM_022474	NP_071919	Q8N3R9	MPP5_HUMAN	membrane protein, palmitoylated 5	362	SH3.				tight junction assembly	cytoplasm|endomembrane system|tight junction	protein domain specific binding			ovary(1)	1				all cancers(60;0.000388)|OV - Ovarian serous cystadenocarcinoma(108;0.00762)|BRCA - Breast invasive adenocarcinoma(234;0.0106)		CAGATGACCCTTATGTTCCAT	0.373													27	117	---	---	---	---	PASS
SMEK1	55671	broad.mit.edu	37	14	91925215	91925215	+	Intron	SNP	T	A	A			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:91925215T>A	uc001xzn.2	-						SMEK1_uc001xzm.2_Intron|SMEK1_uc001xzo.2_Intron|SMEK1_uc010atz.2_Intron	NM_032560	NP_115949	Q6IN85	P4R3A_HUMAN	SMEK homolog 1, suppressor of mek1							microtubule organizing center|nucleus	protein binding				0		all_cancers(154;0.0691)|all_epithelial(191;0.219)		COAD - Colon adenocarcinoma(157;0.221)		GAGGCCTCCCTGTTAAGAAAT	0.244													13	44	---	---	---	---	PASS
THBS1	7057	broad.mit.edu	37	15	39885311	39885311	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:39885311T>C	uc001zkh.2	+	18	3057	c.2878T>C	c.(2878-2880)TTC>CTC	p.F960L	THBS1_uc010bbi.2_Missense_Mutation_p.F432L	NM_003246	NP_003237	P07996	TSP1_HUMAN	thrombospondin 1 precursor	960	TSP C-terminal.				activation of MAPK activity|anti-apoptosis|apoptosis|cell adhesion|cell cycle arrest|cell migration|cellular response to heat|chronic inflammatory response|engulfment of apoptotic cell|immune response|induction of apoptosis|negative regulation of angiogenesis|negative regulation of antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|negative regulation of blood vessel endothelial cell migration|negative regulation of caspase activity|negative regulation of cGMP-mediated signaling|negative regulation of dendritic cell antigen processing and presentation|negative regulation of endothelial cell proliferation|negative regulation of fibrinolysis|negative regulation of fibroblast growth factor receptor signaling pathway|negative regulation of focal adhesion assembly|negative regulation of interleukin-12 production|negative regulation of nitric oxide mediated signal transduction|negative regulation of plasma membrane long-chain fatty acid transport|negative regulation of plasminogen activation|peptide cross-linking|platelet activation|platelet degranulation|positive regulation of angiogenesis|positive regulation of blood vessel endothelial cell migration|positive regulation of fibroblast migration|positive regulation of macrophage activation|positive regulation of macrophage chemotaxis|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|positive regulation of reactive oxygen species metabolic process|positive regulation of transforming growth factor beta receptor signaling pathway|positive regulation of transforming growth factor-beta1 production|positive regulation of translation|positive regulation of tumor necrosis factor biosynthetic process|response to calcium ion|response to drug|response to glucose stimulus|response to hypoxia|response to magnesium ion|response to progesterone stimulus|sprouting angiogenesis	external side of plasma membrane|extracellular matrix|fibrinogen complex|platelet alpha granule lumen	calcium ion binding|collagen V binding|eukaryotic cell surface binding|fibrinogen binding|fibroblast growth factor 2 binding|fibronectin binding|heparin binding|identical protein binding|integrin binding|laminin binding|low-density lipoprotein particle binding|phosphatidylserine binding|proteoglycan binding|structural molecule activity|transforming growth factor beta binding			ovary(3)|central_nervous_system(3)	6		all_cancers(109;1.35e-17)|all_epithelial(112;2.07e-15)|Lung NSC(122;4.44e-11)|all_lung(180;1.11e-09)|Melanoma(134;0.0574)|Colorectal(260;0.117)|Ovarian(310;0.223)		GBM - Glioblastoma multiforme(113;2.77e-06)|BRCA - Breast invasive adenocarcinoma(123;0.105)	Becaplermin(DB00102)	TTTCCGCCGATTCCAGATGAT	0.488													16	92	---	---	---	---	PASS
TMOD2	29767	broad.mit.edu	37	15	52065996	52065996	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:52065996C>A	uc002abk.2	+	4	592	c.371C>A	c.(370-372)GCC>GAC	p.A124D	TMOD2_uc002abl.3_Missense_Mutation_p.A124D|TMOD2_uc010bfb.2_Missense_Mutation_p.A80D	NM_014548	NP_055363	Q9NZR1	TMOD2_HUMAN	neuronal tropomodulin isoform a	124					nervous system development	cytoplasm|cytoskeleton	actin binding|tropomyosin binding			ovary(2)	2				all cancers(107;0.00435)		GAAGCTTTGGCCAGTGCCTCT	0.468													50	218	---	---	---	---	PASS
TMOD2	29767	broad.mit.edu	37	15	52066002	52066002	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:52066002C>T	uc002abk.2	+	4	598	c.377C>T	c.(376-378)GCC>GTC	p.A126V	TMOD2_uc002abl.3_Missense_Mutation_p.A126V|TMOD2_uc010bfb.2_Missense_Mutation_p.A82V	NM_014548	NP_055363	Q9NZR1	TMOD2_HUMAN	neuronal tropomodulin isoform a	126					nervous system development	cytoplasm|cytoskeleton	actin binding|tropomyosin binding			ovary(2)	2				all cancers(107;0.00435)		TTGGCCAGTGCCTCTGACACC	0.473													54	222	---	---	---	---	PASS
MAPK6	5597	broad.mit.edu	37	15	52356958	52356958	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:52356958G>A	uc002abp.2	+	6	2721	c.1927G>A	c.(1927-1929)GAA>AAA	p.E643K		NM_002748	NP_002739	Q16659	MK06_HUMAN	mitogen-activated protein kinase 6	643					cell cycle		ATP binding|MAP kinase activity			lung(3)|ovary(1)	4				all cancers(107;0.0028)		TGAAATGCTAGAAACTGAGCC	0.438													5	113	---	---	---	---	PASS
TLN2	83660	broad.mit.edu	37	15	63014585	63014585	+	Missense_Mutation	SNP	G	A	A	rs113672570		TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:63014585G>A	uc002alb.3	+	23	3025	c.3025G>A	c.(3025-3027)GCA>ACA	p.A1009T		NM_015059	NP_055874	Q9Y4G6	TLN2_HUMAN	talin 2	1009	Ala-rich.				cell adhesion|cell-cell junction assembly|cytoskeletal anchoring at plasma membrane	actin cytoskeleton|cytoplasm|focal adhesion|ruffle|synapse	actin binding|insulin receptor binding|structural constituent of cytoskeleton			ovary(5)|upper_aerodigestive_tract(2)|lung(2)|breast(2)	11						TGCCAAAGCCGCAGTGCCCAC	0.582													3	59	---	---	---	---	PASS
C15orf44	81556	broad.mit.edu	37	15	65871813	65871813	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65871813G>A	uc002apd.2	-	12	1826	c.1490C>T	c.(1489-1491)GCC>GTC	p.A497V	C15orf44_uc010uix.1_Missense_Mutation_p.A533V|C15orf44_uc010uiz.1_Missense_Mutation_p.A461V|C15orf44_uc010uja.1_Missense_Mutation_p.A447V|C15orf44_uc010ujb.1_Missense_Mutation_p.A418V|C15orf44_uc002ape.3_Missense_Mutation_p.A497V|C15orf44_uc010uiy.1_Missense_Mutation_p.A418V	NM_030800	NP_110427	Q96SY0	CO044_HUMAN	hypothetical protein LOC81556 isoform 2	497										ovary(1)	1						GTCATAAGCGGCATACTCAGA	0.522													4	190	---	---	---	---	PASS
PPL	5493	broad.mit.edu	37	16	4953981	4953981	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4953981C>G	uc002cyd.1	-	3	313	c.223G>C	c.(223-225)GTG>CTG	p.V75L		NM_002705	NP_002696	O60437	PEPL_HUMAN	periplakin	75	Potential.				keratinization	cytoskeleton|desmosome|mitochondrion|nucleus	protein binding|structural constituent of cytoskeleton			ovary(4)|central_nervous_system(1)|skin(1)	6						GAGTCCAACACCTTCTGCAGG	0.612													10	50	---	---	---	---	PASS
CDH1	999	broad.mit.edu	37	16	68862158	68862158	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:68862158G>A	uc002ewg.1	+	14	2370	c.2246G>A	c.(2245-2247)CGG>CAG	p.R749Q	CDH1_uc010vlj.1_RNA|CDH1_uc010cfg.1_Missense_Mutation_p.R688Q	NM_004360	NP_004351	P12830	CADH1_HUMAN	cadherin 1, type 1 preproprotein	749	Cytoplasmic (Potential).				adherens junction organization|cellular component disassembly involved in apoptosis|cellular response to indole-3-methanol|cellular response to lithium ion|homophilic cell adhesion|negative regulation of cell-cell adhesion|positive regulation of transcription factor import into nucleus|positive regulation of transcription, DNA-dependent|regulation of immune response	actin cytoskeleton|aggresome|apical junction complex|catenin complex|cell-cell adherens junction|endosome|focal adhesion|Golgi apparatus|integral to membrane|internal side of plasma membrane|lateral plasma membrane|perinuclear region of cytoplasm	cell adhesion molecule binding|gamma-catenin binding			breast(148)|stomach(71)|biliary_tract(8)|endometrium(3)|soft_tissue(2)|large_intestine(2)|urinary_tract(2)|oesophagus(2)|ovary(2)|thyroid(1)|central_nervous_system(1)|lung(1)	243		all_neural(199;0.0189)|Ovarian(137;0.0563)		Epithelial(162;8.44e-05)|all cancers(182;0.000404)|OV - Ovarian serous cystadenocarcinoma(108;0.000426)|BRCA - Breast invasive adenocarcinoma(181;0.0261)		GATGACACCCGGGACAACGTT	0.517			Mis|N|F|S		lobular breast|gastric	gastric			Hereditary_Diffuse_Gastric_Cancer				4	232	---	---	---	---	PASS
C17orf97	400566	broad.mit.edu	37	17	263636	263636	+	Silent	SNP	C	A	A			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:263636C>A	uc002frh.2	+	3	1048	c.1032C>A	c.(1030-1032)GGC>GGA	p.G344G	C17orf97_uc010vpz.1_RNA	NM_001013672	NP_001013694	Q6ZQX7	CQ097_HUMAN	hypothetical protein LOC400566	364	17.|20 X 10 AA approximative tandem repeat of A-L-K-G-F-H-P-D-P-E.									ovary(1)	1						CCCTCAAGGGCTTCCACCCCG	0.697													3	47	---	---	---	---	PASS
C17orf97	400566	broad.mit.edu	37	17	263666	263666	+	Silent	SNP	C	A	A	rs111388956		TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:263666C>A	uc002frh.2	+	3	1078	c.1062C>A	c.(1060-1062)GGC>GGA	p.G354G	C17orf97_uc010vpz.1_RNA	NM_001013672	NP_001013694	Q6ZQX7	CQ097_HUMAN	hypothetical protein LOC400566	374	18.|20 X 10 AA approximative tandem repeat of A-L-K-G-F-H-P-D-P-E.									ovary(1)	1						CCCTCAAGGGCTTCCACCCCG	0.687													6	61	---	---	---	---	PASS
PFN1	5216	broad.mit.edu	37	17	4849140	4849140	+	3'UTR	SNP	G	T	T			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4849140G>T	uc002gaa.2	-	3					PFN1_uc002fzz.2_3'UTR	NM_005022	NP_005013	P07737	PROF1_HUMAN	profilin 1						actin cytoskeleton organization|platelet activation|platelet degranulation	actin cytoskeleton|cytoplasm	actin binding|proline-rich region binding				0						GTGTGTATGGGGAGGAAAGGG	0.542													9	48	---	---	---	---	PASS
RCVRN	5957	broad.mit.edu	37	17	9801384	9801384	+	3'UTR	SNP	T	G	G			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:9801384T>G	uc002gme.1	-	3						NM_002903	NP_002894	P35243	RECO_HUMAN	recoverin						visual perception		calcium ion binding|calcium sensitive guanylate cyclase activator activity				0						GAGTGGTAGGTGGAGGGAGGA	0.398													21	108	---	---	---	---	PASS
SAMD14	201191	broad.mit.edu	37	17	48191587	48191587	+	Silent	SNP	A	G	G			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48191587A>G	uc002iqg.2	-	8	1205	c.906T>C	c.(904-906)TCT>TCC	p.S302S	SAMD14_uc002iqd.2_Silent_p.S85S|SAMD14_uc002iqe.2_Silent_p.S85S|SAMD14_uc002iqf.2_Silent_p.S330S	NM_174920	NP_777580	Q8IZD0	SAM14_HUMAN	sterile alpha motif domain containing 14	302											0						GGTAGGGGTAAGAACATTTGG	0.592													10	69	---	---	---	---	PASS
SPAG9	9043	broad.mit.edu	37	17	49057150	49057150	+	Missense_Mutation	SNP	A	C	C			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:49057150A>C	uc002itc.2	-	26	3575	c.3366T>G	c.(3364-3366)CAT>CAG	p.H1122Q	SPAG9_uc002itb.2_Missense_Mutation_p.H1108Q|SPAG9_uc002itd.2_Missense_Mutation_p.H1112Q|SPAG9_uc002ita.2_Missense_Mutation_p.H965Q	NM_001130528	NP_001124000	O60271	JIP4_HUMAN	sperm associated antigen 9 isoform 1	1122					positive regulation of cell migration|positive regulation of muscle cell differentiation|retrograde transport, endosome to Golgi|spermatogenesis	acrosomal vesicle|integral to membrane|perinuclear region of cytoplasm				lung(4)|breast(1)	5			BRCA - Breast invasive adenocarcinoma(22;4.24e-07)			CATCCTGTAGATGTTGATAAG	0.458													28	151	---	---	---	---	PASS
COX11	1353	broad.mit.edu	37	17	53040153	53040153	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:53040153A>G	uc010wng.1	-	4	829	c.772T>C	c.(772-774)TCT>CCT	p.S258P	COX11_uc010wne.1_Intron|COX11_uc010wnf.1_Intron|COX11_uc002iue.2_RNA	NM_004375	NP_004366	Q9Y6N1	COX11_HUMAN	COX11 homolog, cytochrome c oxidase assembly	258	Mitochondrial intermembrane (Potential).|Mitochondrial matrix (Potential).				respiratory chain complex IV assembly|respiratory gaseous exchange	integral to membrane|mitochondrial inner membrane	copper ion binding|cytochrome-c oxidase activity|electron carrier activity			ovary(1)	1						AAAGTGTAAGAAAGAGTGATA	0.373													42	117	---	---	---	---	PASS
DCAF7	10238	broad.mit.edu	37	17	61655901	61655901	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61655901C>A	uc002jbc.2	+	2	426	c.209C>A	c.(208-210)CCC>CAC	p.P70H	DCAF7_uc002jbb.2_RNA|DCAF7_uc010wpn.1_Intron	NM_005828	NP_005819	P61962	DCAF7_HUMAN	WD-repeat protein	70	WD 1.				multicellular organismal development	CUL4 RING ubiquitin ligase complex|cytoplasm|nucleus	protein binding			ovary(1)	1						CACCCATACCCCACCACAAAG	0.483													4	207	---	---	---	---	PASS
GAA	2548	broad.mit.edu	37	17	78090863	78090863	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78090863A>T	uc002jxo.2	+	17	2468	c.2286A>T	c.(2284-2286)GAA>GAT	p.E762D	GAA_uc002jxp.2_Missense_Mutation_p.E762D|GAA_uc002jxq.2_Missense_Mutation_p.E762D	NM_001079803	NP_001073271	P10253	LYAG_HUMAN	acid alpha-glucosidase preproprotein	762					cardiac muscle contraction|diaphragm contraction|glycogen catabolic process|lysosome organization|tongue morphogenesis|vacuolar sequestering|ventricular cardiac muscle tissue morphogenesis	lysosomal membrane	carbohydrate binding|maltose alpha-glucosidase activity			ovary(1)	1	all_neural(118;0.117)		OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.139)		Acarbose(DB00284)	GGAAGGCCGAAGTGACTGGCT	0.652													12	45	---	---	---	---	PASS
LAMA1	284217	broad.mit.edu	37	18	6942033	6942033	+	3'UTR	SNP	C	A	A			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:6942033C>A	uc002knm.2	-	63					LAMA1_uc002knk.2_3'UTR|LAMA1_uc002knl.2_3'UTR|LAMA1_uc010wzj.1_3'UTR	NM_005559	NP_005550	P25391	LAMA1_HUMAN	laminin, alpha 1 precursor						axon guidance|cell adhesion|cell surface receptor linked signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	extracellular space|laminin-1 complex|laminin-3 complex	extracellular matrix structural constituent|receptor binding			ovary(8)|large_intestine(4)|upper_aerodigestive_tract(2)|breast(2)|skin(2)|pancreas(2)|central_nervous_system(1)	21		Colorectal(10;0.172)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	TACACTTCTCCTCAAAATATT	0.413													4	193	---	---	---	---	PASS
CEP76	79959	broad.mit.edu	37	18	12701062	12701062	+	Silent	SNP	T	C	C			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:12701062T>C	uc002kri.2	-	2	270	c.114A>G	c.(112-114)GAA>GAG	p.E38E	PSMG2_uc002krg.2_Intron|PSMG2_uc002krj.1_5'Flank|PSMG2_uc002krk.2_5'Flank|CEP76_uc002krh.3_5'UTR|CEP76_uc010wzz.1_Silent_p.E38E|CEP76_uc010xaa.1_5'Flank|CEP76_uc010xab.1_Silent_p.E38E	NM_024899	NP_079175	Q8TAP6	CEP76_HUMAN	centrosomal protein 76kDa	38					G2/M transition of mitotic cell cycle|regulation of centriole replication	centriole|cytosol	protein binding				0						GTGCCAATTCTTCCCGTATAG	0.358													38	125	---	---	---	---	PASS
KIAA0427	9811	broad.mit.edu	37	18	46287836	46287836	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:46287836C>T	uc002ldc.2	+	9	1432	c.1147C>T	c.(1147-1149)CGG>TGG	p.R383W	KIAA0427_uc002ldd.2_Missense_Mutation_p.R385W|KIAA0427_uc002lde.3_Missense_Mutation_p.R12W	NM_014772	NP_055587	O43310	CTIF_HUMAN	hypothetical protein LOC9811 isoform 1	383	MIF4G.				nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of translational initiation	perinuclear region of cytoplasm	protein binding				0						GAACAGCATGCGGAACAACAG	0.577													4	94	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9076643	9076643	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9076643C>G	uc002mkp.2	-	3	11007	c.10803G>C	c.(10801-10803)TTG>TTC	p.L3601F		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	3602	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						TTGCAACTTTCAAGTTTGAAG	0.478													3	166	---	---	---	---	PASS
ZNF257	113835	broad.mit.edu	37	19	22271280	22271280	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22271280A>G	uc010ecx.2	+	4	897	c.728A>G	c.(727-729)CAC>CGC	p.H243R	ZNF257_uc010ecy.2_Missense_Mutation_p.H211R	NM_033468	NP_258429	Q9Y2Q1	ZN257_HUMAN	zinc finger protein 257	243	C2H2-type 3.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_lung(12;0.0961)|Lung NSC(12;0.103)				CGGTCTTCACACCTTACTCAA	0.403													16	65	---	---	---	---	PASS
MARK4	57787	broad.mit.edu	37	19	45800968	45800968	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45800968T>C	uc002pbb.1	+	15	1638	c.1633T>C	c.(1633-1635)TCC>CCC	p.S545P	MARK4_uc002pba.1_Missense_Mutation_p.S545P			Q96L34	MARK4_HUMAN	RecName: Full=MAP/microtubule affinity-regulating kinase 4;          EC=2.7.11.1; AltName: Full=MAP/microtubule affinity-regulating kinase-like 1;	545					microtubule bundle formation|nervous system development|positive regulation of programmed cell death	centrosome|neuron projection	ATP binding|gamma-tubulin binding|microtubule binding|protein serine/threonine kinase activity|tau-protein kinase activity|ubiquitin binding			central_nervous_system(2)|large_intestine(1)	3		all_neural(266;0.224)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.0102)		TGCCTCCCCCTCCAGTCACAG	0.697													3	18	---	---	---	---	PASS
CRX	1406	broad.mit.edu	37	19	48342846	48342846	+	Silent	SNP	G	A	A			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48342846G>A	uc002phq.3	+	4	726	c.522G>A	c.(520-522)GCG>GCA	p.A174A		NM_000554	NP_000545	O43186	CRX_HUMAN	cone-rod homeobox protein	174					organ morphogenesis|response to stimulus|visual perception		leucine zipper domain binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			breast(1)|central_nervous_system(1)	2		all_cancers(25;2.76e-09)|all_epithelial(76;7.01e-07)|all_lung(116;2.48e-06)|Lung NSC(112;5.15e-06)|Ovarian(192;0.0139)|all_neural(266;0.0146)|Breast(70;0.133)		OV - Ovarian serous cystadenocarcinoma(262;0.000266)|all cancers(93;0.000788)|Epithelial(262;0.0226)|GBM - Glioblastoma multiforme(486;0.0521)		TGCCTGAGGCGCAGCGGGCTG	0.697													4	122	---	---	---	---	PASS
KLK14	43847	broad.mit.edu	37	19	51582708	51582708	+	Missense_Mutation	SNP	A	T	T			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51582708A>T	uc002pvs.1	-	5	731	c.512T>A	c.(511-513)ATC>AAC	p.I171N		NM_022046	NP_071329	Q9P0G3	KLK14_HUMAN	kallikrein 14 preproprotein	171	Peptidase S1.				epidermis morphogenesis|fertilization|negative regulation of G-protein coupled receptor protein signaling pathway|positive regulation of G-protein coupled receptor protein signaling pathway|proteolysis|seminal clot liquefaction	extracellular space	serine-type endopeptidase activity			skin(1)	1		all_neural(266;0.0199)		OV - Ovarian serous cystadenocarcinoma(262;0.00328)|GBM - Glioblastoma multiforme(134;0.00422)		GTCCTCACCGATGGGGCTGGA	0.368													9	24	---	---	---	---	PASS
NLRP2	55655	broad.mit.edu	37	19	55497591	55497591	+	Silent	SNP	G	T	T	rs144434448	byFrequency	TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55497591G>T	uc002qij.2	+	8	2360	c.2274G>T	c.(2272-2274)ACG>ACT	p.T758T	NLRP2_uc010yfp.1_Silent_p.T735T|NLRP2_uc010esn.2_Silent_p.T734T|NLRP2_uc010eso.2_Silent_p.T755T|NLRP2_uc010esp.2_Silent_p.T736T	NM_017852	NP_060322	Q9NX02	NALP2_HUMAN	NLR family, pyrin domain containing 2	758					apoptosis|positive regulation of caspase activity|positive regulation of interleukin-1 beta secretion	cytoplasm	ATP binding|Pyrin domain binding			ovary(1)|skin(1)	2			BRCA - Breast invasive adenocarcinoma(297;0.163)	GBM - Glioblastoma multiforme(193;0.028)		AGACTGTAACGTATCTGACCC	0.458													28	106	---	---	---	---	PASS
TNNT1	7138	broad.mit.edu	37	19	55645276	55645276	+	Missense_Mutation	SNP	C	T	T			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55645276C>T	uc002qjb.3	-	13	859	c.770G>A	c.(769-771)CGC>CAC	p.R257H	TNNT1_uc002qiz.3_Missense_Mutation_p.R171H|TNNT1_uc002qja.3_Missense_Mutation_p.R171H|TNNT1_uc002qjc.3_Missense_Mutation_p.R241H|TNNT1_uc002qje.3_Missense_Mutation_p.R230H|TNNT1_uc002qjd.3_Missense_Mutation_p.R230H	NM_003283	NP_003274	P13805	TNNT1_HUMAN	troponin T1, skeletal, slow isoform a	257					muscle filament sliding|negative regulation of muscle contraction	cytosol|troponin complex	tropomyosin binding			ovary(1)	1			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.047)		GTGGCTGATGCGGTTGTACAG	0.627													3	59	---	---	---	---	PASS
TGM6	343641	broad.mit.edu	37	20	2381082	2381082	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:2381082C>G	uc002wfy.1	+	7	1042	c.981C>G	c.(979-981)GAC>GAG	p.D327E	TGM6_uc010gal.1_Missense_Mutation_p.D327E	NM_198994	NP_945345	O95932	TGM3L_HUMAN	transglutaminase 6	327			D -> G (in SCA35).		cell death|peptide cross-linking		acyltransferase activity|metal ion binding|protein-glutamine gamma-glutamyltransferase activity			ovary(3)|skin(1)	4					L-Glutamine(DB00130)	TGACAGAAGACAGCATGTGGT	0.607													15	89	---	---	---	---	PASS
MYLK2	85366	broad.mit.edu	37	20	30418874	30418874	+	Nonsense_Mutation	SNP	G	T	T			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30418874G>T	uc002wwq.2	+	10	1456	c.1354G>T	c.(1354-1356)GAG>TAG	p.E452*	MYLK2_uc002wws.2_Nonsense_Mutation_p.E69*|MYLK2_uc010gdw.1_RNA	NM_033118	NP_149109	Q9H1R3	MYLK2_HUMAN	skeletal myosin light chain kinase	452	Protein kinase.				cardiac muscle tissue morphogenesis|regulation of muscle filament sliding		ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity|myosin light chain kinase activity			lung(2)|skin(2)|ovary(1)|central_nervous_system(1)	6			Colorectal(19;0.00306)|COAD - Colon adenocarcinoma(19;0.0347)			CCTGTCACCTGAGGTGGTGAA	0.542													4	123	---	---	---	---	PASS
PLUNC	51297	broad.mit.edu	37	20	31828171	31828171	+	Silent	SNP	G	A	A			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31828171G>A	uc002wyv.2	+	5	631	c.561G>A	c.(559-561)CTG>CTA	p.L187L	PLUNC_uc002wyt.3_Silent_p.L187L|PLUNC_uc002wyu.3_Silent_p.L187L	NM_130852	NP_570913	Q9NP55	PLUNC_HUMAN	palate, lung and nasal epithelium associated	187					innate immune response	extracellular region	lipid binding				0						CTGGAAGCCTGCAAATTTCTC	0.522													5	290	---	---	---	---	PASS
CDH4	1002	broad.mit.edu	37	20	60499490	60499490	+	Missense_Mutation	SNP	C	G	G			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60499490C>G	uc002ybn.1	+	11	1741	c.1727C>G	c.(1726-1728)ACC>AGC	p.T576S	CDH4_uc002ybp.1_Missense_Mutation_p.T502S	NM_001794	NP_001785	P55283	CADH4_HUMAN	cadherin 4, type 1 preproprotein	576	Cadherin 4.|Extracellular (Potential).				adherens junction organization|cell junction assembly		calcium ion binding			lung(3)|ovary(2)|skin(1)	6			BRCA - Breast invasive adenocarcinoma(19;2.36e-08)			TCCCTCTACACCAAAAACAAC	0.617													16	74	---	---	---	---	PASS
SGSM1	129049	broad.mit.edu	37	22	25251635	25251635	+	Silent	SNP	T	A	A			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:25251635T>A	uc003abg.2	+	8	946	c.789T>A	c.(787-789)GTT>GTA	p.V263V	SGSM1_uc003abh.2_Silent_p.V263V|SGSM1_uc010guu.1_Silent_p.V263V|SGSM1_uc003abj.2_Silent_p.V263V|SGSM1_uc003abi.1_Silent_p.V238V|SGSM1_uc003abf.2_Silent_p.V263V	NM_001039948	NP_001035037	Q2NKQ1	SGSM1_HUMAN	RUN and TBC1 domain containing 2 isoform 1	263						Golgi apparatus	Rab GTPase activator activity			ovary(2)|central_nervous_system(2)|pancreas(1)	5						AAAACAACGTTCTTGTTCAGC	0.547													10	50	---	---	---	---	PASS
SSTR3	6753	broad.mit.edu	37	22	37603580	37603580	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:37603580A>G	uc003ara.2	-	2	325	c.263T>C	c.(262-264)CTG>CCG	p.L88P	SSTR3_uc003arb.2_Missense_Mutation_p.L88P	NM_001051	NP_001042	P32745	SSR3_HUMAN	somatostatin receptor 3	88	Helical; Name=2; (Potential).				G-protein signaling, coupled to cyclic nucleotide second messenger|induction of apoptosis by hormones|negative regulation of cell proliferation	integral to plasma membrane|nonmotile primary cilium	somatostatin receptor activity			lung(1)	1						CTCGTCGGCCAGCGCCAGGTT	0.652													16	84	---	---	---	---	PASS
SHROOM2	357	broad.mit.edu	37	X	9862573	9862573	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:9862573G>A	uc004csu.1	+	4	715	c.625G>A	c.(625-627)GCC>ACC	p.A209T		NM_001649	NP_001640	Q13796	SHRM2_HUMAN	apical protein of Xenopus-like	209					apical protein localization|brain development|cell migration|cell morphogenesis|cellular pigment accumulation|ear development|establishment of melanosome localization|eye pigment granule organization|lens morphogenesis in camera-type eye|melanosome organization	apical plasma membrane|cell-cell adherens junction|microtubule|tight junction	actin filament binding|beta-catenin binding|ligand-gated sodium channel activity			ovary(3)|skin(3)|upper_aerodigestive_tract(1)|breast(1)	8		Hepatocellular(5;0.000888)				GCGCGACTCGGCCTACGGCTC	0.632													3	37	---	---	---	---	PASS
HDAC6	10013	broad.mit.edu	37	X	48674573	48674573	+	Missense_Mutation	SNP	A	G	G			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48674573A>G	uc011mmi.1	+	18	1614	c.1519A>G	c.(1519-1521)ATC>GTC	p.I507V	HDAC6_uc004dks.1_Missense_Mutation_p.I507V|HDAC6_uc010nig.1_Missense_Mutation_p.I355V|HDAC6_uc004dkt.1_Missense_Mutation_p.I507V|HDAC6_uc011mmk.1_Missense_Mutation_p.I488V|HDAC6_uc004dkv.1_Missense_Mutation_p.I155V|HDAC6_uc004dkw.1_Missense_Mutation_p.I155V	NM_006044	NP_006035	Q9UBN7	HDAC6_HUMAN	histone deacetylase 6	507	Histone deacetylase 2.				aggresome assembly|cellular response to hydrogen peroxide|Hsp90 deacetylation|lysosome localization|macroautophagy|misfolded or incompletely synthesized protein catabolic process|negative regulation of proteolysis|negative regulation of transcription, DNA-dependent|peptidyl-lysine deacetylation|polyubiquitinated misfolded protein transport|positive regulation of apoptosis|positive regulation of cellular chaperone-mediated protein complex assembly|positive regulation of epithelial cell migration|positive regulation of receptor biosynthetic process|positive regulation of signal transduction|regulation of androgen receptor signaling pathway|regulation of receptor activity|response to growth factor stimulus|response to toxin|transcription, DNA-dependent|tubulin deacetylation	aggresome|caveola|cell leading edge|cytosol|histone deacetylase complex|microtubule associated complex|perinuclear region of cytoplasm	actin binding|alpha-tubulin binding|beta-catenin binding|dynein complex binding|histone deacetylase activity (H3-K16 specific)|histone deacetylase binding|Hsp90 protein binding|microtubule binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|polyubiquitin binding|tau protein binding|tubulin deacetylase activity|zinc ion binding			ovary(3)|upper_aerodigestive_tract(1)	4					Vorinostat(DB02546)	ACCCCAGCGCATCTTGCGGAT	0.652													26	53	---	---	---	---	PASS
SPIN2A	54466	broad.mit.edu	37	X	57162317	57162317	+	Silent	SNP	C	T	T			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:57162317C>T	uc004dvb.2	-	2	1085	c.714G>A	c.(712-714)GTG>GTA	p.V238V		NM_019003	NP_061876	Q99865	SPI2A_HUMAN	spindlin family, member 2	238					cell cycle|gamete generation						0						TGATGAAATACACAGAGGGTT	0.388													52	54	---	---	---	---	PASS
LPAR4	2846	broad.mit.edu	37	X	78011275	78011275	+	Missense_Mutation	SNP	C	A	A			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:78011275C>A	uc010nme.2	+	2	1314	c.909C>A	c.(907-909)AAC>AAA	p.N303K		NM_005296	NP_005287	Q99677	LPAR4_HUMAN	lysophosphatidic acid receptor 4	303	Helical; Name=7; (Potential).					integral to plasma membrane	lipid binding|purinergic nucleotide receptor activity, G-protein coupled			ovary(3)	3						CAACTCTGAACTGTTGTTTTG	0.423													3	114	---	---	---	---	PASS
ACTRT1	139741	broad.mit.edu	37	X	127184949	127184949	+	3'UTR	SNP	G	A	A			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:127184949G>A	uc004eum.2	-	1						NM_138289	NP_612146	Q8TDG2	ACTT1_HUMAN	actin-related protein T1							cytoplasm|cytoskeleton				ovary(2)|central_nervous_system(2)|skin(1)	5						ACTTGAAATGGCAAAACTTTT	0.393													3	61	---	---	---	---	PASS
SLITRK2	84631	broad.mit.edu	37	X	144905975	144905975	+	Missense_Mutation	SNP	G	A	A			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:144905975G>A	uc004fcd.2	+	5	3022	c.2032G>A	c.(2032-2034)GAT>AAT	p.D678N	SLITRK2_uc010nsp.2_Missense_Mutation_p.D678N|SLITRK2_uc010nso.2_Missense_Mutation_p.D678N|SLITRK2_uc011mwq.1_Missense_Mutation_p.D678N|SLITRK2_uc011mwr.1_Missense_Mutation_p.D678N|SLITRK2_uc011mws.1_Missense_Mutation_p.D678N|SLITRK2_uc004fcg.2_Missense_Mutation_p.D678N|SLITRK2_uc011mwt.1_Missense_Mutation_p.D678N|CXorf1_uc004fch.2_5'Flank	NM_032539	NP_115928	Q9H156	SLIK2_HUMAN	SLIT and NTRK-like family, member 2 precursor	678	Cytoplasmic (Potential).					integral to membrane				ovary(5)|central_nervous_system(1)|pancreas(1)	7	Acute lymphoblastic leukemia(192;6.56e-05)					TGAGACTCACGATAAAACAGA	0.493													36	55	---	---	---	---	PASS
RENBP	5973	broad.mit.edu	37	X	153209149	153209149	+	Missense_Mutation	SNP	T	C	C			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153209149T>C	uc004fjo.1	-	5	481	c.311A>G	c.(310-312)TAT>TGT	p.Y104C	RENBP_uc011mzh.1_Missense_Mutation_p.Y104C	NM_002910	NP_002901	P51606	RENBP_HUMAN	renin binding protein	104					mannose metabolic process|regulation of blood pressure		endopeptidase inhibitor activity|mannose-6-phosphate isomerase activity|N-acylglucosamine 2-epimerase activity			ovary(1)|pancreas(1)	2	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)				N-Acetyl-D-glucosamine(DB00141)	CACCCGGGCATACCGCAGCAA	0.627													21	38	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	4092	4092	+	RNA	SNP	G	A	A			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:4092G>A	uc004cos.3	+	2		c.2385G>A			uc011mfh.1_5'Flank					Homo sapiens mRNA expressed only in placental villi, clone SMAP47.																		TTTGTCACCAAGACCCTACTT	0.418													13	3	---	---	---	---	PASS
CLCNKB	1188	broad.mit.edu	37	1	16372283	16372283	+	Intron	DEL	T	-	-	rs67016480		TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16372283delT	uc001axw.3	+						FAM131C_uc010obz.1_Intron|CLCNKB_uc001axx.3_Intron	NM_000085	NP_000076	P51801	CLCKB_HUMAN	chloride channel Kb isoform 1						excretion	chloride channel complex|integral to plasma membrane	voltage-gated chloride channel activity			skin(1)	1		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Colorectal(212;8.04e-08)|COAD - Colon adenocarcinoma(227;5.46e-06)|BRCA - Breast invasive adenocarcinoma(304;9.02e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.00655)|READ - Rectum adenocarcinoma(331;0.0649)		TTGGGGGGGGTGCTCTGGGTG	0.358													9	5	---	---	---	---	
ANKRD13C	81573	broad.mit.edu	37	1	70779211	70779211	+	Intron	DEL	A	-	-			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:70779211delA	uc001dex.3	-						ANKRD13C_uc009wbk.2_Intron	NM_030816	NP_110443	Q8N6S4	AN13C_HUMAN	ankyrin repeat domain 13C						protein retention in ER lumen|regulation of anoikis|regulation of receptor biosynthetic process	endoplasmic reticulum membrane|perinuclear region of cytoplasm	receptor binding				0						aacttgtctcaaaaaaaaaaa	0.104													6	3	---	---	---	---	
HMCN1	83872	broad.mit.edu	37	1	186115161	186115162	+	Intron	INS	-	A	A			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186115161_186115162insA	uc001grq.1	+						HMCN1_uc001grs.1_Intron	NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN	hemicentin 1 precursor						response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)|skin(1)	23						GGTGGAATTAGAAAAAAAAAAA	0.317													4	3	---	---	---	---	
MARS2	92935	broad.mit.edu	37	2	198572076	198572077	+	3'UTR	INS	-	TTC	TTC	rs150680100	by1000genomes	TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:198572076_198572077insTTC	uc002uuq.2	+	1					uc002uup.2_Intron	NM_138395	NP_612404	Q96GW9	SYMM_HUMAN	methionine-tRNA synthetase 2 precursor						methionyl-tRNA aminoacylation	mitochondrial matrix	ATP binding|methionine-tRNA ligase activity			ovary(1)|central_nervous_system(1)|skin(1)	3					L-Methionine(DB00134)	GCCTGCTCCTATTCATTTCTCT	0.416													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	206813725	206813725	+	IGR	DEL	A	-	-			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:206813725delA								NRP2 (150869 upstream) : INO80D (44721 downstream)																							accctatctcaaaaaaaaaaG	0.234													4	3	---	---	---	---	
PDCD6IP	10015	broad.mit.edu	37	3	33868211	33868211	+	Intron	DEL	T	-	-	rs35254856		TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:33868211delT	uc003cfx.2	+						PDCD6IP_uc011axv.1_3'UTR|PDCD6IP_uc003cfy.2_Intron|PDCD6IP_uc011axw.1_5'Flank	NM_013374	NP_037506	Q8WUM4	PDC6I_HUMAN	programmed cell death 6 interacting protein						apoptosis|cell cycle|cell division|interspecies interaction between organisms|protein transport	cytosol|melanosome|microtubule organizing center	calcium-dependent protein binding			ovary(1)|skin(1)	2						GTAGAAATAGttttttttttt	0.249													3	3	---	---	---	---	
FAM114A1	92689	broad.mit.edu	37	4	38880181	38880182	+	Intron	INS	-	TGTGT	TGTGT	rs142950595	by1000genomes	TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:38880181_38880182insTGTGT	uc003gtn.2	+						FAM114A1_uc011byh.1_Intron	NM_138389	NP_612398	Q8IWE2	NXP20_HUMAN	hypothetical protein LOC92689							cytoplasm				ovary(1)	1						GTCATCAGAAATGTGTAGTGAG	0.307													6	5	---	---	---	---	
PRLR	5618	broad.mit.edu	37	5	35066375	35066375	+	Intron	DEL	T	-	-	rs77557478		TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:35066375delT	uc003jjm.2	-						PRLR_uc003jjg.1_Intron|PRLR_uc003jjh.1_Intron|PRLR_uc003jji.1_Intron|PRLR_uc003jjj.1_Intron|PRLR_uc003jjk.1_Intron|PRLR_uc003jjl.3_Intron	NM_000949	NP_000940	P16471	PRLR_HUMAN	prolactin receptor precursor						activation of JAK2 kinase activity|activation of transmembrane receptor protein tyrosine kinase activity|anti-apoptosis|embryo implantation|lactation|steroid biosynthetic process|T cell activation	cell surface|extracellular region|integral to membrane	metal ion binding|ornithine decarboxylase activator activity|peptide hormone binding|prolactin receptor activity|protein homodimerization activity			ovary(2)|skin(1)	3	all_lung(31;3.83e-05)		COAD - Colon adenocarcinoma(61;0.174)|Colorectal(62;0.229)		Dromostanolone(DB00858)|Fluoxymesterone(DB01185)|Pegvisomant(DB00082)|Somatropin recombinant(DB00052)	attcagcagattttttttttt	0.109													4	2	---	---	---	---	
RASGRF2	5924	broad.mit.edu	37	5	80508485	80508486	+	Intron	INS	-	GCC	GCC			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:80508485_80508486insGCC	uc003kha.1	+						RNU5E_uc011cto.1_Intron|RASGRF2_uc011ctn.1_Intron	NM_006909	NP_008840	O14827	RGRF2_HUMAN	Ras protein-specific guanine						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|synaptic transmission	cytosol|endoplasmic reticulum membrane|plasma membrane	protein binding|Rho guanyl-nucleotide exchange factor activity			breast(5)|ovary(3)|large_intestine(2)|central_nervous_system(1)|skin(1)	12		Lung NSC(167;0.00498)|all_lung(232;0.00531)|Ovarian(174;0.0357)		OV - Ovarian serous cystadenocarcinoma(54;4.22e-42)|Epithelial(54;4.04e-35)|all cancers(79;2.52e-29)		AACTGAAATGAGCCGCTCAGTT	0.426													8	4	---	---	---	---	
IK	3550	broad.mit.edu	37	5	140028327	140028327	+	Intron	DEL	T	-	-	rs113938710		TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140028327delT	uc003lgq.2	+						NDUFA2_uc003lgp.2_5'Flank|IK_uc011czk.1_Intron	NM_006083	NP_006074	Q13123	RED_HUMAN	RED protein						cell-cell signaling|immune response	extracellular space|nucleus|soluble fraction				large_intestine(1)	1		all_hematologic(541;4.8e-07)|all_lung(500;0.000434)|Lung NSC(810;0.00161)|Breast(839;0.128)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGGTGTTAAGTTTTTTTTTTT	0.338													5	4	---	---	---	---	
HLA-G	3135	broad.mit.edu	37	6	29865448	29865448	+	Intron	DEL	G	-	-	rs9278416		TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29865448delG	uc011dmb.1	+						HCG2P7_uc003nof.2_5'Flank	NM_002127	NP_002118	P17693	HLAG_HUMAN	major histocompatibility complex, class I, G						antigen processing and presentation of peptide antigen via MHC class I|cellular defense response|interferon-gamma-mediated signaling pathway|regulation of immune response|type I interferon-mediated signaling pathway	integral to membrane|MHC class I protein complex	MHC class I receptor activity			ovary(3)|central_nervous_system(1)	4						GGGGAGCACAGCCACCCCAAA	0.512													3	3	---	---	---	---	
HLA-DRB5	3127	broad.mit.edu	37	6	32497712	32497713	+	Intron	INS	-	A	A	rs146725750	by1000genomes	TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32497712_32497713insA	uc003obj.2	-						HLA-DRB1_uc011dqa.1_Intron|HLA-DRB5_uc003obk.3_Intron	NM_002125	NP_002116	Q30154	DRB5_HUMAN	major histocompatibility complex, class II, DR						antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|immune response	endoplasmic reticulum membrane|Golgi apparatus|integral to membrane|late endosome membrane|lysosomal membrane|MHC class II protein complex					0						GCCCCTTACACAGTCTCATGGA	0.411													7	5	---	---	---	---	
CYP39A1	51302	broad.mit.edu	37	6	46607082	46607082	+	Intron	DEL	T	-	-	rs145394714		TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:46607082delT	uc003oyf.1	-						CYP39A1_uc011dwa.1_Intron|CYP39A1_uc010jzd.1_Intron	NM_016593	NP_057677	Q9NYL5	CP39A_HUMAN	cytochrome P450, family 39, subfamily A,						bile acid biosynthetic process|bile acid catabolic process|digestion|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	24-hydroxycholesterol 7alpha-hydroxylase activity|electron carrier activity|heme binding|oxysterol 7-alpha-hydroxylase activity			ovary(1)	1						caaaaaaaaaTAATTTAAAAG	0.219													6	6	---	---	---	---	
SEC63	11231	broad.mit.edu	37	6	108225614	108225614	+	Intron	DEL	A	-	-			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:108225614delA	uc003psc.3	-						SEC63_uc003psb.3_Intron	NM_007214	NP_009145	Q9UGP8	SEC63_HUMAN	SEC63-like protein						protein folding|protein targeting to membrane	endoplasmic reticulum membrane|integral to membrane	heat shock protein binding|receptor activity|unfolded protein binding			ovary(1)|skin(1)	2		all_cancers(87;5.35e-06)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.00225)|Colorectal(196;0.0294)		BRCA - Breast invasive adenocarcinoma(108;0.0079)|Epithelial(106;0.0356)|all cancers(137;0.0525)|OV - Ovarian serous cystadenocarcinoma(136;0.054)		actccatctcaaaaaaaaaaa	0.104													4	2	---	---	---	---	
GTF2H5	404672	broad.mit.edu	37	6	158613375	158613375	+	3'UTR	DEL	A	-	-	rs3841147		TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:158613375delA	uc003qrd.2	+	3						NM_207118	NP_997001	Q6ZYL4	TF2H5_HUMAN	general transcription factor IIH, polypeptide 5						nucleotide-excision repair|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding				0		Breast(66;0.00519)|Ovarian(120;0.123)|Prostate(117;0.178)		OV - Ovarian serous cystadenocarcinoma(65;5.98e-18)|BRCA - Breast invasive adenocarcinoma(81;2.83e-05)		CATAGAATTTAAAAAAAAAAA	0.333								Direct_reversal_of_damage|NER					5	3	---	---	---	---	
ABCB5	340273	broad.mit.edu	37	7	20697951	20697951	+	Intron	DEL	T	-	-	rs34847636		TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:20697951delT	uc003suw.3	+						ABCB5_uc010kuh.2_Intron|ABCB5_uc003suv.3_Intron|ABCB5_uc011jyi.1_Intron	NM_178559	NP_848654	Q2M3G0	ABCB5_HUMAN	ATP-binding cassette, sub-family B, member 5						regulation of membrane potential	apical plasma membrane|Golgi membrane|integral to plasma membrane|intercellular canaliculus	ATP binding|ATPase activity, coupled to transmembrane movement of substances|efflux transmembrane transporter activity			skin(2)|large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)|ovary(1)|pancreas(1)	6						CTTTGGGCTCTTTTTTTTTTT	0.284													6	3	---	---	---	---	
PDAP1	11333	broad.mit.edu	37	7	98994127	98994127	+	3'UTR	DEL	C	-	-	rs113663373		TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:98994127delC	uc003uqe.2	-	6						NM_014891	NP_055706	Q13442	HAP28_HUMAN	PDGFA associated protein 1						cell proliferation|signal transduction						0	all_cancers(62;3.49e-09)|all_epithelial(64;2.57e-10)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)		STAD - Stomach adenocarcinoma(171;0.215)		Becaplermin(DB00102)	CTCCCCCAGTCCCCCCCCCCA	0.542													6	3	---	---	---	---	
MLL5	55904	broad.mit.edu	37	7	104681592	104681592	+	Intron	DEL	A	-	-			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:104681592delA	uc003vcm.2	+						MLL5_uc010lja.1_Intron|MLL5_uc010ljb.1_Intron|MLL5_uc003vcl.2_Intron|MLL5_uc010ljc.2_Intron	NM_182931	NP_891847	Q8IZD2	MLL5_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 5						cell cycle arrest|cellular response to retinoic acid|DNA methylation|erythrocyte differentiation|neutrophil activation|neutrophil mediated immunity|positive regulation of granulocyte differentiation|positive regulation of transcription, DNA-dependent|retinoic acid receptor signaling pathway|transcription, DNA-dependent	MLL5-L complex|nuclear speck	enzyme binding|histone methyltransferase activity (H3-K4 specific)|transcription coactivator activity|zinc ion binding			ovary(2)|pancreas(1)	3						TTTTTAAAGTAAAAAAAAAAA	0.274													6	3	---	---	---	---	
FOXP2	93986	broad.mit.edu	37	7	114330185	114330186	+	3'UTR	DEL	TT	-	-	rs143759073		TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:114330185_114330186delTT	uc003vhb.2	+	17					FOXP2_uc003vgu.2_RNA|FOXP2_uc003vgz.2_3'UTR|FOXP2_uc003vha.2_3'UTR|FOXP2_uc011kmu.1_3'UTR|FOXP2_uc011kmv.1_3'UTR|FOXP2_uc010ljz.1_3'UTR	NM_014491	NP_055306	O15409	FOXP2_HUMAN	forkhead box P2 isoform I						camera-type eye development|caudate nucleus development|cerebellum development|cerebral cortex development|embryo development|growth|lung alveolus development|negative regulation of transcription, DNA-dependent|pattern specification process|positive regulation of epithelial cell proliferation involved in lung morphogenesis|positive regulation of mesenchymal cell proliferation|post-embryonic development|putamen development|regulation of sequence-specific DNA binding transcription factor activity|righting reflex|skeletal muscle tissue development|smooth muscle tissue development|vocal learning	cytoplasm|transcription factor complex	chromatin binding|DNA bending activity|double-stranded DNA binding|promoter binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding|zinc ion binding			ovary(4)|pancreas(1)|lung(1)|breast(1)|skin(1)	8						cttcttcttctttttttttttt	0.292													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	41041781	41041781	+	IGR	DEL	A	-	-			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:41041781delA								ZMAT4 (286438 upstream) : SFRP1 (77698 downstream)																							actctgtctcaaaaaaaaaaa	0.000													5	3	---	---	---	---	
PTPRD	5789	broad.mit.edu	37	9	8331407	8331416	+	Intron	DEL	TTATTTTCAC	-	-	rs10976963		TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:8331407_8331416delTTATTTTCAC	uc003zkk.2	-						PTPRD_uc003zkp.2_Intron|PTPRD_uc003zkq.2_Intron|PTPRD_uc003zkr.2_Intron|PTPRD_uc003zks.2_Intron|PTPRD_uc003zkl.2_Intron|PTPRD_uc003zkm.2_Intron|PTPRD_uc003zkn.2_Intron|PTPRD_uc003zko.2_Intron	NM_002839	NP_002830	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D						transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(14)|large_intestine(3)|ovary(2)|breast(2)|urinary_tract(1)	22		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)		TTTCCTCTGATTATTTTCACTTATTTTCAC	0.276										TSP Lung(15;0.13)			2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	93513725	93513727	+	IGR	DEL	AAC	-	-	rs34140480		TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:93513725_93513727delAAC								DIRAS2 (108617 upstream) : SYK (50285 downstream)																							AAAATAAGCAAACAACTGCCAGG	0.478													4	2	---	---	---	---	
RNF20	56254	broad.mit.edu	37	9	104297516	104297517	+	Intron	DEL	TT	-	-	rs76960510		TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:104297516_104297517delTT	uc004bbn.2	+							NM_019592	NP_062538	Q5VTR2	BRE1A_HUMAN	ring finger protein 20						histone H2B ubiquitination|histone monoubiquitination|negative regulation of cell migration|positive regulation of transcription, DNA-dependent|protein polyubiquitination|ubiquitin-dependent protein catabolic process	nucleolus|ubiquitin ligase complex	histone binding|p53 binding|transcription coactivator activity|ubiquitin protein ligase binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(4)|lung(1)|breast(1)|kidney(1)|skin(1)	8		all_hematologic(171;8.99e-06)|Acute lymphoblastic leukemia(62;0.000365)|Myeloproliferative disorder(762;0.0255)		OV - Ovarian serous cystadenocarcinoma(323;2.88e-19)|STAD - Stomach adenocarcinoma(157;0.00311)		TACaatttaatttttttttttt	0.213													4	2	---	---	---	---	
TXN	7295	broad.mit.edu	37	9	113007320	113007322	+	Intron	DEL	GAA	-	-	rs144802558		TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:113007320_113007322delGAA	uc004bep.1	-						TXN_uc004beq.1_Intron	NM_003329	NP_003320	P10599	THIO_HUMAN	thioredoxin						cell proliferation|cell-cell signaling|cellular component movement|electron transport chain|glycerol ether metabolic process|nucleobase, nucleoside and nucleotide interconversion|positive regulation of DNA binding|regulation of protein import into nucleus, translocation|response to radiation|signal transduction|transcription, DNA-dependent|transport	cytosol|extracellular region|nucleoplasm	electron carrier activity|protein binding|protein disulfide oxidoreductase activity				0				OV - Ovarian serous cystadenocarcinoma(323;7.36e-07)		TATTCTCAATGAAGAAGTTTTAT	0.345													4	2	---	---	---	---	
TRUB2	26995	broad.mit.edu	37	9	131075834	131075834	+	Intron	DEL	G	-	-			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131075834delG	uc004buq.1	-							NM_015679	NP_056494	O95900	TRUB2_HUMAN	TruB pseudouridine (psi) synthase homolog 2						pseudouridine synthesis|tRNA processing		pseudouridine synthase activity|RNA binding			ovary(1)	1						aaaaaaaaaagaaaagaaaaG	0.209													9	4	---	---	---	---	
C10orf68	79741	broad.mit.edu	37	10	32873104	32873105	+	Intron	DEL	AT	-	-			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:32873104_32873105delAT	uc001iwn.3	+						C10orf68_uc001iwl.1_Intron|C10orf68_uc001iwm.1_Intron	NM_024688	NP_078964	Q9H943	CJ068_HUMAN	chromosome 10 open reading frame 68											skin(2)|ovary(1)	3						ACCAGTCTTGATATATATATAT	0.267													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	71726870	71726870	+	IGR	DEL	C	-	-			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:71726870delC								COL13A1 (7967 upstream) : H2AFY2 (85487 downstream)																							CTATCTCCTGCCCCCCTGTGC	0.502													4	2	---	---	---	---	
FAR1	84188	broad.mit.edu	37	11	13722198	13722199	+	Intron	INS	-	TCT	TCT	rs137872059	by1000genomes	TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:13722198_13722199insTCT	uc001mld.2	+						FAR1_uc009ygp.2_Intron	NM_032228	NP_115604	Q8WVX9	FACR1_HUMAN	fatty acyl CoA reductase 1						ether lipid biosynthetic process	integral to membrane|peroxisomal matrix|peroxisomal membrane	protein binding			ovary(1)|skin(1)	2						TAAAAGAATTCTCTTCTTCTTC	0.317													6	3	---	---	---	---	
MYO7A	4647	broad.mit.edu	37	11	76892834	76892835	+	Intron	INS	-	G	G	rs11371875		TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:76892834_76892835insG	uc001oyb.2	+						MYO7A_uc010rsl.1_Intron|MYO7A_uc010rsm.1_Intron|MYO7A_uc001oyc.2_Intron|MYO7A_uc001oyd.2_Intron|MYO7A_uc009yus.1_Intron|MYO7A_uc009yut.1_Intron	NM_000260	NP_000251	Q13402	MYO7A_HUMAN	myosin VIIA isoform 1						actin filament-based movement|equilibrioception|lysosome organization|sensory perception of sound|visual perception	cytosol|lysosomal membrane|myosin complex|photoreceptor inner segment|photoreceptor outer segment|synapse	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(3)|breast(1)	4						tgtttttttttttttttttttt	0.243													8	5	---	---	---	---	
TRPC6	7225	broad.mit.edu	37	11	101362567	101362567	+	Intron	DEL	C	-	-	rs111367906		TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:101362567delC	uc001pgk.3	-						TRPC6_uc009ywy.2_Intron|TRPC6_uc009ywz.1_Intron	NM_004621	NP_004612	Q9Y210	TRPC6_HUMAN	transient receptor potential cation channel,						axon guidance|platelet activation|positive regulation of calcium ion transport via store-operated calcium channel activity	integral to membrane|plasma membrane	protein binding			skin(2)|ovary(1)|central_nervous_system(1)	4		Acute lymphoblastic leukemia(157;0.000918)|all_hematologic(158;0.0162)		BRCA - Breast invasive adenocarcinoma(274;0.0442)		GAGAAACAttctttttttttt	0.149													14	7	---	---	---	---	
C12orf5	57103	broad.mit.edu	37	12	4446457	4446458	+	Intron	INS	-	A	A	rs138211042	by1000genomes	TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:4446457_4446458insA	uc001qmp.2	+							NM_020375	NP_065108	Q9NQ88	TIGAR_HUMAN	TP53-induced glycolysis and apoptosis regulator							intracellular	fructose-2,6-bisphosphate 2-phosphatase activity			skin(1)	1			all cancers(3;1.15e-07)|Colorectal(7;0.00165)|OV - Ovarian serous cystadenocarcinoma(31;0.00596)|COAD - Colon adenocarcinoma(12;0.0229)|GBM - Glioblastoma multiforme(3;0.0266)|STAD - Stomach adenocarcinoma(119;0.206)			ctcagcctcccaatagctggga	0.000													5	3	---	---	---	---	
CLEC1A	51267	broad.mit.edu	37	12	10225700	10225701	+	Intron	DEL	AC	-	-			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:10225700_10225701delAC	uc001qxb.2	-						CLEC1A_uc009zhf.2_Intron|CLEC1A_uc001qxc.2_Intron|CLEC1A_uc001qxd.2_Intron|CLEC1A_uc010sgx.1_Intron	NM_016511	NP_057595	Q8NC01	CLC1A_HUMAN	C-type lectin-like receptor-1						cell surface receptor linked signaling pathway|defense response	integral to plasma membrane|intracellular	sugar binding|transmembrane receptor activity			ovary(1)|central_nervous_system(1)	2						AAACGAACAAACACACACACAC	0.223													4	2	---	---	---	---	
SLC17A8	246213	broad.mit.edu	37	12	100774908	100774915	+	Intron	DEL	CATCTCAG	-	-	rs68046331		TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:100774908_100774915delCATCTCAG	uc010svi.1	+						SLC17A8_uc009ztx.2_Intron	NM_139319	NP_647480	Q8NDX2	VGLU3_HUMAN	solute carrier family 17 (sodium-dependent						neurotransmitter transport|sensory perception of sound|sodium ion transport	cell junction|integral to membrane|synaptic vesicle membrane|synaptosome	L-glutamate transmembrane transporter activity|symporter activity			ovary(3)	3						TAGCTCCTCCcatctcagcatctcagca	0.221													3	3	---	---	---	---	
RNF17	56163	broad.mit.edu	37	13	25448552	25448553	+	Intron	INS	-	T	T	rs142376691		TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:25448552_25448553insT	uc001upr.2	+						RNF17_uc010aab.2_Intron|RNF17_uc010tde.1_Intron|RNF17_uc001ups.2_Intron|RNF17_uc010aac.2_Intron|RNF17_uc010aad.2_Intron	NM_031277	NP_112567	Q9BXT8	RNF17_HUMAN	ring finger protein 17						multicellular organismal development	cytoplasm|nucleus	hydrolase activity, acting on ester bonds|nucleic acid binding|zinc ion binding			ovary(1)|skin(1)	2		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0114)|OV - Ovarian serous cystadenocarcinoma(117;0.0311)|Epithelial(112;0.0524)		accattgtagcttttttttttt	0.074													3	3	---	---	---	---	
KLHL1	57626	broad.mit.edu	37	13	70293342	70293347	+	Intron	DEL	GAGAGA	-	-	rs71816977		TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:70293342_70293347delGAGAGA	uc001vip.2	-						KLHL1_uc010thm.1_Intron	NM_020866	NP_065917	Q9NR64	KLHL1_HUMAN	kelch-like 1 protein						actin cytoskeleton organization	cytoplasm|cytoskeleton	actin binding				0		Breast(118;0.000162)		COAD - Colon adenocarcinoma(199;0.000193)|GBM - Glioblastoma multiforme(99;0.000211)		gtgtgtgtgtgagagagagagagaga	0.223													7	4	---	---	---	---	
POU4F1	5457	broad.mit.edu	37	13	79176484	79176486	+	In_Frame_Del	DEL	TGG	-	-			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:79176484_79176486delTGG	uc001vkv.2	-	2	558_560	c.324_326delCCA	c.(322-327)CACCAG>CAG	p.H108del	uc001vku.1_Intron	NM_006237	NP_006228	Q01851	PO4F1_HUMAN	POU domain, class 4, transcription factor 1	108	Poly-His.				axonogenesis|regulation of transcription from RNA polymerase II promoter|synapse assembly	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1		Acute lymphoblastic leukemia(28;0.0279)|Breast(118;0.0848)		GBM - Glioblastoma multiforme(99;0.129)		TTCGAGCGCCtggtggtggtggt	0.473													4	2	---	---	---	---	
ATG2B	55102	broad.mit.edu	37	14	96762064	96762065	+	Intron	INS	-	CACACACACACACACA	CACACACACACACACA	rs148889627	by1000genomes	TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:96762064_96762065insCACACACACACACACA	uc001yfi.2	-							NM_018036	NP_060506	Q96BY7	ATG2B_HUMAN	ATG2 autophagy related 2 homolog B											ovary(1)|kidney(1)|skin(1)	3		all_cancers(154;0.0462)|all_epithelial(191;0.123)|Melanoma(154;0.155)		Epithelial(152;0.21)|COAD - Colon adenocarcinoma(157;0.244)		CTTCCCCCCACcacacacacac	0.238													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	86498174	86498175	+	IGR	INS	-	TGA	TGA			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:86498174_86498175insTGA								LOC732275 (118889 upstream) : FOXF1 (45958 downstream)																							ggtgatgatggtggtggtggtg	0.000													10	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	87256056	87256058	+	Intron	DEL	CAT	-	-			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:87256056_87256058delCAT	uc002fjt.1	-											Homo sapiens cDNA FLJ43761 fis, clone TESTI2048109.																		ccaccaccaccatcatcaccacc	0.000													5	3	---	---	---	---	
SLC43A2	124935	broad.mit.edu	37	17	1480157	1480157	+	Intron	DEL	G	-	-			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1480157delG	uc002fsv.2	-						SLC43A2_uc002fsu.2_Intron	NM_152346	NP_689559	Q8N370	LAT4_HUMAN	solute carrier family 43, member 2						cellular nitrogen compound metabolic process|ion transport	integral to membrane|plasma membrane					0				UCEC - Uterine corpus endometrioid carcinoma (25;0.0883)		GGGCAGttctgtttttttttt	0.318													6	3	---	---	---	---	
RICH2	9912	broad.mit.edu	37	17	12860184	12860189	+	Intron	DEL	ACACAC	-	-	rs71369354		TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:12860184_12860189delACACAC	uc002gnr.3	+						RICH2_uc010vvk.1_Intron|RICH2_uc010vvl.1_Intron|RICH2_uc002gns.3_Intron|RICH2_uc010vvm.1_Intron|RICH2_uc010vvn.1_Intron|RICH2_uc002gnt.1_Intron	NM_014859	NP_055674	Q17R89	RHG44_HUMAN	Rho GTPase-activating protein RICH2						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity				0						TCCCCTATAAacacacacacacacac	0.345													5	3	---	---	---	---	
MAP2K3	5606	broad.mit.edu	37	17	21217018	21217020	+	Intron	DEL	CCT	-	-	rs72412380		TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21217018_21217020delCCT	uc002gys.2	+						MAP2K3_uc002gyt.2_Intron|MAP2K3_uc002gyu.2_Intron	NM_145109	NP_659731	P46734	MP2K3_HUMAN	mitogen-activated protein kinase kinase 3						activation of MAPK activity|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of transcription, DNA-dependent|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|MAP kinase kinase activity|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity				0				COAD - Colon adenocarcinoma(3;0.0131)|Colorectal(15;0.0553)		TACCTGGCTCCCTCCTCCCTCCT	0.389													5	4	---	---	---	---	
MYO5B	4645	broad.mit.edu	37	18	47352665	47352666	+	3'UTR	INS	-	A	A	rs149289525	by1000genomes	TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:47352665_47352666insA	uc002leb.2	-	40					MYO5B_uc002ldz.2_3'UTR|MYO5B_uc002lea.2_3'UTR	NM_001080467	NP_001073936	Q9ULV0	MYO5B_HUMAN	myosin VB						protein transport	myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			ovary(2)|skin(2)|central_nervous_system(1)	5				READ - Rectum adenocarcinoma(32;0.103)		GCAGTAGGTACAAAAAATAATG	0.347													4	2	---	---	---	---	
LMNB2	84823	broad.mit.edu	37	19	2433666	2433666	+	Intron	DEL	C	-	-			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2433666delC	uc002lvy.2	-						LMNB2_uc002lwa.1_Intron	NM_032737	NP_116126	Q03252	LMNB2_HUMAN	lamin B2							nuclear inner membrane	structural molecule activity			large_intestine(1)|ovary(1)	2		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		ACCCTGATCACCCCCATCAGC	0.677													7	4	---	---	---	---	
MEGF8	1954	broad.mit.edu	37	19	42839063	42839066	+	Intron	DEL	TCTT	-	-			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42839063_42839066delTCTT	uc002otl.3	+						MEGF8_uc002otm.3_5'Flank	NM_001410	NP_001401	Q7Z7M0	MEGF8_HUMAN	multiple EGF-like-domains 8							integral to membrane	calcium ion binding|structural molecule activity			ovary(1)	1		Prostate(69;0.00682)				cctgtctgtctctttctctctccc	0.034													6	4	---	---	---	---	
ZNF766	90321	broad.mit.edu	37	19	52789441	52789442	+	Intron	INS	-	C	C	rs149933354	by1000genomes	TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52789441_52789442insC	uc002pyr.1	+						ZNF766_uc002pys.1_Intron|ZNF766_uc002pyt.1_Intron	NM_001010851	NP_001010851	Q5HY98	ZN766_HUMAN	zinc finger protein 766						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0				GBM - Glioblastoma multiforme(134;0.00236)|OV - Ovarian serous cystadenocarcinoma(262;0.00871)		AGTGGGCTTTTCCCCcctaatt	0.168													3	3	---	---	---	---	
TMEM50B	757	broad.mit.edu	37	21	34853826	34853827	+	5'Flank	INS	-	G	G	rs139799615	by1000genomes	TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:34853826_34853827insG	uc002yrt.1	-						TMEM50B_uc002yrs.1_5'Flank|TMEM50B_uc010gmb.1_5'Flank	NM_006134	NP_006125	P56557	TM50B_HUMAN	transmembrane protein 50B							endoplasmic reticulum|integral to membrane|plasma membrane				ovary(1)|skin(1)	2						TCACTTTTTTTGGGGGGGTGGG	0.317													2	4	---	---	---	---	
PCNT	5116	broad.mit.edu	37	21	47832992	47832993	+	Intron	INS	-	C	C	rs112290401		TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47832992_47832993insC	uc002zji.3	+						PCNT_uc002zjj.2_Intron	NM_006031	NP_006022	O95613	PCNT_HUMAN	pericentrin						cilium assembly|G2/M transition of mitotic cell cycle	cytosol|microtubule	calmodulin binding			ovary(4)|breast(2)|pancreas(2)	8	Breast(49;0.112)					AAGGCACGAGGCCCACCCGGGA	0.738													10	6	---	---	---	---	
LOC96610	96610	broad.mit.edu	37	22	23116953	23116953	+	Intron	DEL	C	-	-	rs35511743		TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:23116953delC	uc011aim.1	+											Parts of antibodies, mostly variable regions.												0						gacactcacacccccgcctgc	0.129													4	2	---	---	---	---	
SMS	6611	broad.mit.edu	37	X	22010764	22010764	+	Frame_Shift_Del	DEL	T	-	-			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:22010764delT	uc004dag.2	+	10	1096	c.995delT	c.(994-996)CTGfs	p.L332fs	SMS_uc010nfs.2_RNA|SMS_uc010nft.2_Intron	NM_004595	NP_004586	P52788	SPSY_HUMAN	spermine synthase	332					methionine metabolic process|spermine biosynthetic process	cytosol	spermidine synthase activity|spermine synthase activity			ovary(1)	1					Spermine(DB00127)	GAAGAACAGCTGGGGCGCCTG	0.463													43	32	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	10012841	10012842	+	IGR	INS	-	T	T			TCGA-BP-5187-01A-01D-1429-08	TCGA-BP-5187-11A-01D-1429-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:10012841_10012842insT								TTTY22 (361987 upstream) : None (None downstream)																							tcctcccttcctcccttcctcc	0.129													4	2	---	---	---	---	
