Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
WASH7P	653635	broad.mit.edu	37	1	14976	14976	+	RNA	SNP	G	A	A			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:14976G>A	uc009vis.2	-	3		c.369C>T			WASH7P_uc009vit.2_RNA|WASH7P_uc001aae.3_RNA|WASH7P_uc009viu.2_RNA|WASH7P_uc001aab.3_RNA|WASH7P_uc001aah.3_RNA|WASH7P_uc009vir.2_RNA|WASH7P_uc009viq.2_Intron|WASH7P_uc001aac.3_RNA|WASH7P_uc009viv.2_RNA|WASH7P_uc009viw.2_RNA					Homo sapiens cDNA FLJ31670 fis, clone NT2RI2004984.												0						CTACCCTTGCGCCTCATGACC	0.582													7	80	---	---	---	---	PASS
CLCNKA	1187	broad.mit.edu	37	1	16360323	16360323	+	3'UTR	SNP	G	T	T	rs61772372		TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16360323G>T	uc001axu.2	+	20					CLCNKA_uc001axt.2_RNA|CLCNKA_uc001axv.2_3'UTR|CLCNKA_uc010obw.1_3'UTR|CLCNKB_uc001axw.3_Intron	NM_004070	NP_004061	P51800	CLCKA_HUMAN	chloride channel Ka isoform 1						excretion	chloride channel complex|integral to plasma membrane	voltage-gated chloride channel activity			ovary(1)	1		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Colorectal(212;8.04e-08)|COAD - Colon adenocarcinoma(227;5.46e-06)|BRCA - Breast invasive adenocarcinoma(304;9.02e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.00655)|READ - Rectum adenocarcinoma(331;0.0649)	Niflumic Acid(DB04552)	CTCATCCTGGGTGGGACGATG	0.552													10	54	---	---	---	---	PASS
CROCCL1	84809	broad.mit.edu	37	1	16969277	16969277	+	Intron	SNP	G	T	T			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16969277G>T	uc001azg.1	-						CROCCL1_uc001azi.1_Intron|uc001azj.1_RNA|MST1P2_uc009vow.2_5'Flank|MST1P2_uc010ocg.1_5'Flank|MST1P2_uc010och.1_5'Flank					Homo sapiens mRNA for FLJ00313 protein.												0						GGTGGCTGCTGGGGGTGCATG	0.597													25	218	---	---	---	---	PASS
CROCCL1	84809	broad.mit.edu	37	1	16973606	16973606	+	5'Flank	SNP	G	T	T	rs76859932	by1000genomes	TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16973606G>T	uc001azg.1	-						CROCCL1_uc001azi.1_5'Flank|MST1P2_uc009vow.2_RNA|MST1P2_uc010ocg.1_RNA|MST1P2_uc010och.1_RNA|MST1P2_uc010oci.1_RNA|MST1P2_uc001azk.2_RNA|MST1P2_uc001azl.3_RNA|MST1P2_uc009vox.2_5'Flank|MST1P2_uc001azm.3_5'Flank					Homo sapiens mRNA for FLJ00313 protein.												0						AAATCCTGCCGGGTGGGTAAG	0.642													40	268	---	---	---	---	PASS
CELA3B	23436	broad.mit.edu	37	1	22332319	22332319	+	3'UTR	SNP	G	A	A	rs76548941	by1000genomes	TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22332319G>A	uc009vqf.2	+	4					CELA3A_uc001bfl.2_Intron			P08861	CEL3B_HUMAN	SubName: Full=Elastase 3A, pancreatic;						cholesterol metabolic process|proteolysis	extracellular region	serine-type endopeptidase activity			ovary(1)	1						TGGAACCCAGGGGCTCCTCTA	0.493													19	236	---	---	---	---	PASS
ZMYM4	9202	broad.mit.edu	37	1	35853066	35853066	+	Silent	SNP	T	C	C			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:35853066T>C	uc001byt.2	+	13	2204	c.2124T>C	c.(2122-2124)TTT>TTC	p.F708F	ZMYM4_uc009vuu.2_Silent_p.F676F|ZMYM4_uc001byu.2_Silent_p.F384F|ZMYM4_uc009vuv.2_Silent_p.F447F	NM_005095	NP_005086	Q5VZL5	ZMYM4_HUMAN	zinc finger protein 262	708	MYM-type 7.				multicellular organismal development		DNA binding|zinc ion binding			large_intestine(2)|ovary(1)|kidney(1)|skin(1)	5		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				GCAAAATGTTTCAGTTCTGTG	0.294													3	8	---	---	---	---	PASS
CLDN19	149461	broad.mit.edu	37	1	43200962	43200962	+	Intron	SNP	G	A	A			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43200962G>A	uc001cht.1	-						CLDN19_uc001chu.2_3'UTR|CLDN19_uc010ojv.1_3'UTR	NM_148960	NP_683763	Q8N6F1	CLD19_HUMAN	claudin 19 isoform a						calcium-independent cell-cell adhesion|response to stimulus|visual perception	basolateral plasma membrane|integral to membrane|tight junction	identical protein binding				0	Ovarian(52;0.00744)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				GGGCAGGGGCGCCATGGTCCG	0.662													12	36	---	---	---	---	PASS
SLC6A17	388662	broad.mit.edu	37	1	110709686	110709686	+	Silent	SNP	C	T	T			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:110709686C>T	uc009wfq.2	+	2	596	c.135C>T	c.(133-135)GGC>GGT	p.G45G		NM_001010898	NP_001010898	Q9H1V8	S6A17_HUMAN	solute carrier family 6, member 17	45	Cytoplasmic (Potential).				alanine transport|glycine transport|leucine transport|proline transport	cell junction|integral to plasma membrane|synaptic vesicle membrane	neurotransmitter:sodium symporter activity			ovary(1)|pancreas(1)	2		all_cancers(81;9.9e-06)|all_epithelial(167;3.24e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)		Lung(183;0.0282)|Epithelial(280;0.0372)|all cancers(265;0.0378)|Colorectal(144;0.0438)|LUSC - Lung squamous cell carcinoma(189;0.151)|COAD - Colon adenocarcinoma(174;0.151)		GTGAGGCAGGCGGCAAGCAGA	0.607													15	57	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	1	142806254	142806254	+	Intron	SNP	A	G	G	rs114813183	by1000genomes	TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142806254A>G	uc001eiw.1	+						uc001ejb.2_Intron|uc001ejd.1_Intron|uc001ejc.2_RNA					Homo sapiens PNAS-130 mRNA, complete cds.																		CATTTTGCATAAACTGTGTGT	0.353													6	36	---	---	---	---	PASS
NBPF10	100132406	broad.mit.edu	37	1	145301802	145301802	+	Silent	SNP	C	G	G	rs6690575		TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145301802C>G	uc001end.3	+	7	1106	c.1071C>G	c.(1069-1071)CTC>CTG	p.L357L	NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|NBPF10_uc001emp.3_Silent_p.L357L|NBPF10_uc010oyi.1_5'Flank|NBPF10_uc001emq.1_Silent_p.L86L	NM_001039703	NP_001034792	A6NDV3	A6NDV3_HUMAN	hypothetical protein LOC100132406	357											0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		CAGAGCAGCTCAAGCAAGCTG	0.522													14	24	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	1	148891643	148891643	+	RNA	SNP	A	G	G			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148891643A>G	uc009wkv.1	+	9		c.945A>G								Homo sapiens cDNA, FLJ17483.																		CCAAAACTGAAATTGAAGATT	0.423													66	512	---	---	---	---	PASS
LOC645166	645166	broad.mit.edu	37	1	148932843	148932843	+	RNA	SNP	G	A	A	rs71418366	by1000genomes	TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148932843G>A	uc010pbc.1	+	2		c.158G>A			LOC645166_uc010pbd.1_RNA|LOC645166_uc009wkw.1_RNA	NR_027355				Homo sapiens cDNA, FLJ18771.												0						GCCCAGCATGGCTGCATCCAG	0.607													18	299	---	---	---	---	PASS
FCGR1A	2209	broad.mit.edu	37	1	149763191	149763191	+	3'UTR	SNP	G	A	A			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149763191G>A	uc001esp.3	+	6					HIST2H2BF_uc010pbj.1_Intron|FCGR1A_uc009wlg.2_RNA	NM_000566	NP_000557	P12314	FCGR1_HUMAN	Fc fragment of IgG, high affinity Ia, receptor						interferon-gamma-mediated signaling pathway|phagocytosis, engulfment	integral to membrane|plasma membrane	IgG binding|receptor activity|receptor signaling protein activity			ovary(1)	1	Breast(34;0.0124)|all_hematologic(923;0.127)				Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Immune globulin(DB00028)|Methyl aminolevulinate(DB00992)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Porfimer(DB00707)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)	CTCATGGTATGTAACTCTTAA	0.438													9	62	---	---	---	---	PASS
TMOD4	29765	broad.mit.edu	37	1	151143403	151143403	+	Missense_Mutation	SNP	T	C	C			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151143403T>C	uc001exc.3	-	8	1053	c.863A>G	c.(862-864)GAC>GGC	p.D288G	TMOD4_uc001exb.2_Missense_Mutation_p.D116G|TMOD4_uc001exd.2_RNA|TMOD4_uc010pct.1_Missense_Mutation_p.D219G	NM_013353	NP_037485	Q9NZQ9	TMOD4_HUMAN	tropomodulin 4 (muscle)	288					muscle contraction	cytoplasm|cytoskeleton	actin binding|tropomyosin binding			ovary(1)	1	Lung SC(34;0.00471)|Ovarian(49;0.0147)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			GACCTGATTGTCTACACGGAG	0.502													5	74	---	---	---	---	PASS
BCAN	63827	broad.mit.edu	37	1	156622274	156622274	+	Missense_Mutation	SNP	C	G	G			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156622274C>G	uc001fpp.2	+	8	1868	c.1532C>G	c.(1531-1533)GCA>GGA	p.A511G	BCAN_uc001fpo.2_Missense_Mutation_p.A511G	NM_021948	NP_068767	Q96GW7	PGCB_HUMAN	brevican isoform 1	511					cell adhesion	anchored to membrane|proteinaceous extracellular matrix	hyaluronic acid binding|sugar binding			ovary(1)|pancreas(1)	2	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					CAGGCGCCAGCAAGGGCAGTC	0.647													12	36	---	---	---	---	PASS
RPS6KC1	26750	broad.mit.edu	37	1	213415458	213415458	+	Missense_Mutation	SNP	A	G	G			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:213415458A>G	uc010ptr.1	+	11	2798	c.2639A>G	c.(2638-2640)AAG>AGG	p.K880R	RPS6KC1_uc001hkd.2_Missense_Mutation_p.K868R|RPS6KC1_uc010pts.1_Missense_Mutation_p.K668R|RPS6KC1_uc010ptt.1_Missense_Mutation_p.K668R|RPS6KC1_uc010ptu.1_Missense_Mutation_p.K699R|RPS6KC1_uc010ptv.1_Missense_Mutation_p.K415R|RPS6KC1_uc001hke.2_Missense_Mutation_p.K699R	NM_012424	NP_036556	Q96S38	KS6C1_HUMAN	ribosomal protein S6 kinase, 52kDa, polypeptide	880	Protein kinase 2.				cell communication|signal transduction	early endosome|membrane	ATP binding|phosphatidylinositol binding|protein binding|protein serine/threonine kinase activity			lung(4)|ovary(3)|breast(1)	8				OV - Ovarian serous cystadenocarcinoma(81;0.00705)|all cancers(67;0.016)|GBM - Glioblastoma multiforme(131;0.0663)|Epithelial(68;0.145)		GAAGGAGACAAGGAAATACAT	0.418													3	12	---	---	---	---	PASS
PTPN14	5784	broad.mit.edu	37	1	214656164	214656164	+	Intron	SNP	A	G	G	rs58782956		TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:214656164A>G	uc001hkk.1	-						PTPN14_uc010pty.1_Intron|uc010ptz.1_RNA	NM_005401	NP_005392	Q15678	PTN14_HUMAN	protein tyrosine phosphatase, non-receptor type						lymphangiogenesis	cytoplasm|cytoskeleton	protein tyrosine phosphatase activity|receptor tyrosine kinase binding			breast(2)|ovary(1)|kidney(1)|skin(1)	5				OV - Ovarian serous cystadenocarcinoma(81;0.00181)|all cancers(67;0.00194)|Epithelial(68;0.0157)|GBM - Glioblastoma multiforme(131;0.155)		TTAAAAGAGGACAGGTTTGGC	0.388													7	159	---	---	---	---	PASS
ACTN2	88	broad.mit.edu	37	1	236911030	236911030	+	Missense_Mutation	SNP	G	T	T			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236911030G>T	uc001hyf.2	+	13	1674	c.1470G>T	c.(1468-1470)TGG>TGT	p.W490C	ACTN2_uc001hyg.2_Missense_Mutation_p.W282C|ACTN2_uc009xgi.1_Missense_Mutation_p.W490C|ACTN2_uc010pxu.1_Missense_Mutation_p.W179C|ACTN2_uc001hyh.2_Missense_Mutation_p.W178C	NM_001103	NP_001094	P35609	ACTN2_HUMAN	actinin, alpha 2	490	Spectrin 2.				focal adhesion assembly|microspike assembly|muscle filament sliding|platelet activation|platelet degranulation|protein homotetramerization|regulation of apoptosis|synaptic transmission	actin filament|cytosol|dendritic spine|extracellular region|filopodium|focal adhesion|nucleolus|platelet alpha granule lumen|pseudopodium|Z disc	actin binding|calcium ion binding|FATZ 1 binding|identical protein binding|integrin binding|protein dimerization activity|structural constituent of muscle|titin binding|titin Z domain binding|ZASP binding			ovary(4)|skin(1)	5	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;0.00661)|Acute lymphoblastic leukemia(190;0.109)|Prostate(94;0.174)	OV - Ovarian serous cystadenocarcinoma(106;0.00168)			GTGACCAGTGGGACCGACTGG	0.398													5	44	---	---	---	---	PASS
OR2W5	441932	broad.mit.edu	37	1	247655272	247655272	+	Silent	SNP	T	C	C			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247655272T>C	uc001icz.1	+	1	843	c.843T>C	c.(841-843)CGT>CGC	p.R281R		NM_001004698	NP_001004698	A6NFC9	OR2W5_HUMAN	olfactory receptor, family 2, subfamily W,	281					sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|breast(1)|skin(1)	3	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.222)	OV - Ovarian serous cystadenocarcinoma(106;0.0188)			TACACCATCGTCATTCCCAGC	0.527													4	48	---	---	---	---	PASS
RHOQ	23433	broad.mit.edu	37	2	46803262	46803262	+	Missense_Mutation	SNP	A	G	G			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:46803262A>G	uc002rva.2	+	3	557	c.238A>G	c.(238-240)ATG>GTG	p.M80V	uc002rvb.2_Intron	NM_012249	NP_036381	P17081	RHOQ_HUMAN	ras-like protein TC10 precursor	80					cortical actin cytoskeleton organization|insulin receptor signaling pathway|negative regulation of establishment of protein localization in plasma membrane|positive regulation of filopodium assembly|positive regulation of glucose import|positive regulation of transcription from RNA polymerase II promoter|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	actin filament|cytosol|plasma membrane	GBD domain binding|GTP binding|GTPase activity|profilin binding			skin(2)	2		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	LUSC - Lung squamous cell carcinoma(58;0.114)			ATCTTACCCAATGACCGATGT	0.393													5	11	---	---	---	---	PASS
OTX1	5013	broad.mit.edu	37	2	63283088	63283088	+	Silent	SNP	C	A	A			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:63283088C>A	uc002scd.2	+	5	950	c.702C>A	c.(700-702)GGC>GGA	p.G234G	OTX1_uc010ypt.1_Silent_p.G168G	NM_014562	NP_055377	P32242	OTX1_HUMAN	orthodenticle homeobox 1	234						nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			pancreas(2)	2	Lung NSC(7;0.121)|all_lung(7;0.211)					ACGGCCAAGGCTACCCTACGC	0.647													12	56	---	---	---	---	PASS
FLJ40330	645784	broad.mit.edu	37	2	89100619	89100619	+	RNA	SNP	C	T	T	rs75347118		TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:89100619C>T	uc010fhg.2	+	13		c.1059C>T			FLJ40330_uc010fhh.2_RNA|FLJ40330_uc010fhi.1_RNA	NR_015424				Homo sapiens mRNA; cDNA DKFZp434J1630 (from clone DKFZp434J1630).												0						TCAACAGCAACTGGATGATGC	0.303													5	11	---	---	---	---	PASS
RGPD3	653489	broad.mit.edu	37	2	107021599	107021599	+	3'UTR	SNP	C	T	T			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:107021599C>T	uc010ywi.1	-	23						NM_001144013	NP_001137485	A6NKT7	RGPD3_HUMAN	RANBP2-like and GRIP domain containing 3						intracellular transport		binding			ovary(1)	1						TTAATAAAAACATTCCTTCCA	0.323													7	29	---	---	---	---	PASS
CCDC74A	90557	broad.mit.edu	37	2	132285695	132285695	+	Missense_Mutation	SNP	T	G	G			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:132285695T>G	uc002tta.2	+	1	204	c.152T>G	c.(151-153)CTG>CGG	p.L51R	CCDC74A_uc010fnb.1_Missense_Mutation_p.L51R|CCDC74A_uc002ttb.2_Missense_Mutation_p.L51R	NM_138770	NP_620125	Q96AQ1	CC74A_HUMAN	coiled-coil domain containing 74A	51	Potential.									skin(1)	1						AAACGGAACCTGGACCTGGAG	0.652													60	161	---	---	---	---	PASS
CYP20A1	57404	broad.mit.edu	37	2	204161707	204161707	+	3'UTR	SNP	T	C	C			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:204161707T>C	uc002uzv.3	+	13					CYP20A1_uc002uzx.3_3'UTR|CYP20A1_uc010zif.1_3'UTR|CYP20A1_uc002uzy.3_3'UTR|CYP20A1_uc002uzw.3_RNA|CYP20A1_uc010ftw.2_3'UTR	NM_177538	NP_803882	Q6UW02	CP20A_HUMAN	cytochrome P450, family 20, subfamily A,							integral to membrane	electron carrier activity|heme binding|monooxygenase activity|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen				0						GTTGAATCCTTTTATAAACCA	0.214													8	13	---	---	---	---	PASS
IRS1	3667	broad.mit.edu	37	2	227660037	227660037	+	Missense_Mutation	SNP	G	A	A			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:227660037G>A	uc002voh.3	-	1	3470	c.3418C>T	c.(3418-3420)CGC>TGC	p.R1140C		NM_005544	NP_005535	P35568	IRS1_HUMAN	insulin receptor substrate 1	1140					fibroblast growth factor receptor signaling pathway|glucose homeostasis|insulin receptor signaling pathway|negative regulation of insulin receptor signaling pathway|negative regulation of insulin secretion|nerve growth factor receptor signaling pathway|phosphatidylinositol 3-kinase cascade|phosphatidylinositol-mediated signaling|positive regulation of fatty acid beta-oxidation|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of insulin receptor signaling pathway|positive regulation of phosphatidylinositol 3-kinase activity	caveola|cytosol|insulin receptor complex|microsome|nucleus	insulin receptor binding|insulin-like growth factor receptor binding|phosphatidylinositol 3-kinase binding|protein kinase C binding|SH2 domain binding|transmembrane receptor protein tyrosine kinase adaptor activity	p.R1140H(1)		lung(5)|central_nervous_system(4)|ovary(2)|pancreas(1)	12		Renal(207;0.023)|all_lung(227;0.0994)|all_hematologic(139;0.118)|Esophageal squamous(248;0.23)		Epithelial(121;3.03e-11)|all cancers(144;2.42e-08)|Lung(261;0.00712)|LUSC - Lung squamous cell carcinoma(224;0.0137)		GAGCTGTGGCGTTTCACATCC	0.647													5	55	---	---	---	---	PASS
PER2	8864	broad.mit.edu	37	2	239186456	239186456	+	Missense_Mutation	SNP	T	C	C			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:239186456T>C	uc002vyc.2	-	2	359	c.122A>G	c.(121-123)CAT>CGT	p.H41R	PER2_uc010znv.1_Missense_Mutation_p.H41R|PER2_uc010znw.1_Missense_Mutation_p.H41R|PER2_uc010fyx.1_Missense_Mutation_p.H41R	NM_022817	NP_073728	O15055	PER2_HUMAN	period 2	41					circadian rhythm|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	protein binding|signal transducer activity			upper_aerodigestive_tract(1)|breast(1)	2		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0423)|all_lung(227;0.114)|all_hematologic(139;0.158)|Melanoma(123;0.203)|Lung NSC(271;0.223)|Hepatocellular(293;0.244)		Epithelial(121;6.84e-24)|OV - Ovarian serous cystadenocarcinoma(60;9.73e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.5e-08)|BRCA - Breast invasive adenocarcinoma(100;6.77e-05)|Lung(119;0.00941)|LUSC - Lung squamous cell carcinoma(224;0.0161)		GTTGGTCTCATGTCCACTGGA	0.652													54	150	---	---	---	---	PASS
VHL	7428	broad.mit.edu	37	3	10188200	10188200	+	Missense_Mutation	SNP	C	A	A	rs5030811		TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10188200C>A	uc003bvc.2	+	2	556	c.343C>A	c.(343-345)CAC>AAC	p.H115N	VHL_uc003bvd.2_Intron	NM_000551	NP_000542	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor isoform 1	115	Involved in binding to CCT complex.		H -> Q (in VHLD; type II).		anti-apoptosis|cell morphogenesis|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of cell differentiation|positive regulation of transcription, DNA-dependent|protein stabilization|protein ubiquitination|proteolysis	cytosol|endoplasmic reticulum|membrane|mitochondrion|nucleus	protein binding|transcription factor binding	p.H115N(5)|p.?(3)|p.H115Y(3)|p.H115fs*44(3)|p.H115D(1)|p.H115fs*41(1)|p.H115fs*42(1)|p.H115P(1)		kidney(1273)|soft_tissue(24)|adrenal_gland(15)|large_intestine(13)|pancreas(5)|endometrium(4)|thyroid(3)|upper_aerodigestive_tract(3)|central_nervous_system(2)|lung(2)|pleura(1)|paratesticular_tissues(1)	1346				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		CCCGATAGGTCACCTTTGGCT	0.333		1	D|Mis|N|F|S		renal|hemangioma|pheochromocytoma	renal|hemangioma|pheochromocytoma			von_Hippel-Lindau_disease|Chuvash_Polycythemia_|Pheochromocytoma_(Adrenal)_Familial				48	112	---	---	---	---	PASS
RUVBL1	8607	broad.mit.edu	37	3	127816145	127816145	+	Silent	SNP	G	T	T			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:127816145G>T	uc003ekh.2	-	8	1118	c.1014C>A	c.(1012-1014)ATC>ATA	p.I338I	RUVBL1_uc003eke.2_Silent_p.I79I|RUVBL1_uc003ekf.2_Silent_p.I278I|RUVBL1_uc010hss.2_Silent_p.I338I	NM_003707	NP_003698	Q9Y265	RUVB1_HUMAN	RuvB-like 1	338					cell division|CenH3-containing nucleosome assembly at centromere|DNA recombination|DNA repair|histone H2A acetylation|histone H4 acetylation|mitosis|regulation of growth|regulation of transcription from RNA polymerase II promoter|spermatogenesis|transcription, DNA-dependent	Golgi apparatus|Ino80 complex|membrane|microtubule organizing center|MLL1 complex|NuA4 histone acetyltransferase complex|nuclear matrix	ATP binding|DNA helicase activity|protein binding			skin(1)	1				GBM - Glioblastoma multiforme(114;0.181)		CATCCTACCTGATGACACAGT	0.537													16	46	---	---	---	---	PASS
PLCH1	23007	broad.mit.edu	37	3	155199834	155199834	+	Silent	SNP	A	G	G			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:155199834A>G	uc011bok.1	-	23	4282	c.4005T>C	c.(4003-4005)TCT>TCC	p.S1335S	PLCH1_uc011boj.1_3'UTR|PLCH1_uc011bol.1_Silent_p.S1297S	NM_001130960	NP_001124432	Q4KWH8	PLCH1_HUMAN	phospholipase C eta 1 isoform a	1335					lipid catabolic process|phosphatidylinositol-mediated signaling	membrane	calcium ion binding|calcium-dependent phospholipase C activity|phosphatidylinositol phospholipase C activity|signal transducer activity			skin(3)|ovary(1)	4			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)			AATCAGGGGAAGAGGCAGGGC	0.498													3	13	---	---	---	---	PASS
KLHL6	89857	broad.mit.edu	37	3	183217550	183217550	+	Silent	SNP	G	T	T			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183217550G>T	uc003flr.2	-	4	1033	c.975C>A	c.(973-975)GGC>GGA	p.G325G	KLHL6_uc003fls.1_RNA|KLHL6_uc003flt.1_Intron	NM_130446	NP_569713	Q8WZ60	KLHL6_HUMAN	kelch-like 6	325	Kelch 1.									haematopoietic_and_lymphoid_tissue(2)|ovary(1)	3	all_cancers(143;9.2e-12)|Ovarian(172;0.0172)		all cancers(12;1.29e-44)|Epithelial(37;1.24e-38)|LUSC - Lung squamous cell carcinoma(7;2.58e-24)|Lung(8;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(80;2.32e-22)			TCGTGCAGCCGCCAATGATCA	0.577													26	69	---	---	---	---	PASS
TMEM14B	81853	broad.mit.edu	37	6	10756854	10756854	+	3'UTR	SNP	C	T	T			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:10756854C>T	uc003mzk.3	+	6					SYCP2L_uc011dim.1_Intron|TMEM14B_uc010jor.2_3'UTR|TMEM14B_uc010jos.1_Intron	NM_030969	NP_112231	Q9NUH8	TM14B_HUMAN	transmembrane protein 14B isoform a							integral to membrane					0	Ovarian(93;0.107)|Breast(50;0.137)	all_hematologic(90;0.135)				TTGCATCTGACATTTTACCTA	0.373													10	12	---	---	---	---	PASS
ATF6B	1388	broad.mit.edu	37	6	32083400	32083400	+	3'UTR	SNP	C	A	A			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32083400C>A	uc003nzn.2	-	18					TNXB_uc010jts.1_Intron|ATF6B_uc003nzm.1_Intron|ATF6B_uc003nzo.2_3'UTR	NM_004381	NP_004372	Q99941	ATF6B_HUMAN	activating transcription factor 6 beta isoform						response to unfolded protein|signal transduction	endoplasmic reticulum membrane|integral to membrane|nucleus	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0						AACCCCCACACCTGCTCTTTC	0.532													11	48	---	---	---	---	PASS
AVL9	23080	broad.mit.edu	37	7	32615623	32615623	+	Missense_Mutation	SNP	A	G	G			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:32615623A>G	uc003tcv.1	+	13	1773	c.1627A>G	c.(1627-1629)ACT>GCT	p.T543A	AVL9_uc011kai.1_Intron|AVL9_uc010kwj.1_Intron	NM_015060	NP_055875	Q8NBF6	AVL9_HUMAN	AVL9 homolog (S. cerevisiase)	543						integral to membrane					0						ATGGAAGAATACTCACAACTA	0.403													3	33	---	---	---	---	PASS
NCF1B	654816	broad.mit.edu	37	7	72639986	72639986	+	Missense_Mutation	SNP	G	A	A			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:72639986G>A	uc011kes.1	+	3	221	c.217G>A	c.(217-219)GGC>AGC	p.G73S	FKBP6_uc003twz.2_Intron|NCF1B_uc011ker.1_Missense_Mutation_p.G75S	NM_000265	NP_000256			neutrophil cytosolic factor 1												0						CGAGTACTGCGGCACGCTCAT	0.622													7	108	---	---	---	---	PASS
PTCD1	26024	broad.mit.edu	37	7	99022964	99022964	+	Silent	SNP	C	T	T			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99022964C>T	uc003uqh.2	-	6	1322	c.1191G>A	c.(1189-1191)GGG>GGA	p.G397G	PTCD1_uc011kiw.1_Silent_p.G446G	NM_015545	NP_056360	O75127	PTCD1_HUMAN	pentatricopeptide repeat domain 1	397										ovary(1)	1	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)		STAD - Stomach adenocarcinoma(171;0.215)			GCTCTGGAGGCCCAAGTGCCT	0.642													41	132	---	---	---	---	PASS
AZGP1	563	broad.mit.edu	37	7	99573669	99573669	+	5'UTR	SNP	A	C	C			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99573669A>C	uc003ush.2	-	1						NM_001185	NP_001176	P25311	ZA2G_HUMAN	alpha-2-glycoprotein 1, zinc						antigen processing and presentation|cell adhesion|immune response|lipid catabolic process|negative regulation of cell proliferation	extracellular region|MHC class I protein complex	fatty acid binding|protein transmembrane transporter activity|ribonuclease activity			ovary(1)|central_nervous_system(1)	2	Esophageal squamous(72;0.0166)|Lung NSC(181;0.0211)|all_lung(186;0.0323)					GGTTCTGGGCAGGAGGCACAG	0.582													5	71	---	---	---	---	PASS
ARMC10	83787	broad.mit.edu	37	7	102716238	102716238	+	Missense_Mutation	SNP	G	T	T			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:102716238G>T	uc003vaw.1	+	2	546	c.154G>T	c.(154-156)GGG>TGG	p.G52W	FBXL13_uc003vaq.2_5'Flank|FBXL13_uc010lir.1_5'Flank|FBXL13_uc003var.2_5'Flank|FBXL13_uc003vas.2_5'Flank|FBXL13_uc003vav.2_5'Flank|ARMC10_uc003vay.1_Missense_Mutation_p.G52W|ARMC10_uc003vax.1_Intron|ARMC10_uc003vbb.1_Intron|ARMC10_uc011kli.1_Intron|ARMC10_uc010lis.1_Intron|ARMC10_uc003vba.1_RNA|ARMC10_uc003vaz.1_Intron	NM_031905	NP_114111	Q8N2F6	ARM10_HUMAN	SVH protein isoform a	52					regulation of growth	endoplasmic reticulum membrane|integral to membrane	binding			ovary(1)	1						CCTGGAAGAAGGGACGTCAGA	0.602													62	194	---	---	---	---	PASS
KCND2	3751	broad.mit.edu	37	7	119915314	119915314	+	Missense_Mutation	SNP	G	A	A			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:119915314G>A	uc003vjj.1	+	1	1593	c.628G>A	c.(628-630)GGA>AGA	p.G210R		NM_012281	NP_036413	Q9NZV8	KCND2_HUMAN	potassium voltage-gated channel, Shal-related	210					regulation of action potential|synaptic transmission	cell surface|dendritic spine	metal ion binding			ovary(2)|central_nervous_system(2)|skin(1)	5	all_neural(327;0.117)					AGTGCCGTGCGGATCAAGCCC	0.547													67	164	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	142206990	142206990	+	Intron	SNP	C	T	T			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142206990C>T	uc011kro.1	+						uc011krp.1_Intron|uc011krr.1_Intron|uc011krx.1_Intron|uc011ksa.1_Intron|uc011ksc.1_5'Flank|uc003vyj.2_5'UTR					SubName: Full=V_segment translation product; Flags: Fragment;																		CTTGTGTCTCCCAGCCCTGCT	0.547													25	86	---	---	---	---	PASS
PCMTD1	115294	broad.mit.edu	37	8	52733037	52733037	+	Silent	SNP	C	T	T	rs116127165	by1000genomes	TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:52733037C>T	uc003xqx.3	-	6	1289	c.948G>A	c.(946-948)GAG>GAA	p.E316E	PCMTD1_uc011ldm.1_Silent_p.E186E|PCMTD1_uc003xqw.3_Silent_p.E316E|PCMTD1_uc011ldn.1_Silent_p.E128E|PCMTD1_uc010lya.2_Silent_p.E240E	NM_052937	NP_443169	Q96MG8	PCMD1_HUMAN	protein-L-isoaspartate (D-aspartate)	316						cytoplasm	protein-L-isoaspartate (D-aspartate) O-methyltransferase activity				0		Lung NSC(129;0.0795)|all_lung(136;0.144)				GAtctttttcctcctcttctt	0.303													8	25	---	---	---	---	PASS
C9orf11	54586	broad.mit.edu	37	9	27296984	27296984	+	Missense_Mutation	SNP	T	C	C			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:27296984T>C	uc003zql.2	-	1	154	c.70A>G	c.(70-72)ATT>GTT	p.I24V	C9orf11_uc011lnq.1_Missense_Mutation_p.I24V|C9orf11_uc003zqm.2_Missense_Mutation_p.I24V	NM_020641	NP_065692	Q9NQ60	AFAF_HUMAN	Acr formation associated factor isoform 1	24	Vesicular (Potential).					acrosomal membrane|integral to membrane				ovary(1)|central_nervous_system(1)	2				OV - Ovarian serous cystadenocarcinoma(39;7.39e-08)|Lung(218;1.26e-05)|LUSC - Lung squamous cell carcinoma(38;0.000106)		TCACCTTCAATAGTAGGCTTC	0.308													28	67	---	---	---	---	PASS
CLTA	1211	broad.mit.edu	37	9	36191051	36191051	+	5'UTR	SNP	G	A	A			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:36191051G>A	uc003zzc.2	+	1					CLTA_uc003zzd.2_5'UTR|CLTA_uc003zze.2_5'UTR|CLTA_uc011lpk.1_5'UTR|CLTA_uc003zzf.1_RNA	NM_007096	NP_009027	P09496	CLCA_HUMAN	clathrin, light polypeptide A isoform b						axon guidance|epidermal growth factor receptor signaling pathway|intracellular protein transport|negative regulation of epidermal growth factor receptor signaling pathway|nerve growth factor receptor signaling pathway|post-Golgi vesicle-mediated transport	clathrin coat of coated pit|clathrin coat of trans-Golgi network vesicle|cytosol	structural molecule activity			central_nervous_system(1)	1			STAD - Stomach adenocarcinoma(86;0.228)			TCAGTTGCCCGCCATGGCTGA	0.711													54	146	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	9	68413586	68413586	+	RNA	SNP	G	A	A			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68413586G>A	uc004aex.2	+	1		c.141G>A								Homo sapiens mRNA; cDNA DKFZp564N0763 (from clone DKFZp564N0763).																		TCTAGGAAAGGTTGTGCCTTT	0.597													7	87	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	9	68413654	68413654	+	RNA	SNP	G	A	A			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68413654G>A	uc004aex.2	+	1		c.209G>A								Homo sapiens mRNA; cDNA DKFZp564N0763 (from clone DKFZp564N0763).																		GAGTGCAGACGAGAGCCCCGG	0.642													9	60	---	---	---	---	PASS
KIAA0368	23392	broad.mit.edu	37	9	114145539	114145539	+	Missense_Mutation	SNP	A	G	G			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:114145539A>G	uc004bfe.1	-	36	4289	c.4289T>C	c.(4288-4290)CTT>CCT	p.L1430P		NM_001080398	NP_001073867			KIAA0368 protein												0						TTTGTCCAGAAGGCAAGGCAG	0.498													4	37	---	---	---	---	PASS
OR10A5	144124	broad.mit.edu	37	11	6867462	6867462	+	Silent	SNP	G	A	A			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6867462G>A	uc001met.1	+	1	549	c.549G>A	c.(547-549)CCG>CCA	p.P183P		NM_178168	NP_835462	Q9H207	O10A5_HUMAN	olfactory receptor, family 10, subfamily A,	183	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)	3		Medulloblastoma(188;0.0523)|all_neural(188;0.236)		Epithelial(150;4.68e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		GTGACAGCCCGCCTGTGCTGA	0.527													4	30	---	---	---	---	PASS
HPS5	11234	broad.mit.edu	37	11	18327003	18327003	+	Nonsense_Mutation	SNP	G	A	A			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:18327003G>A	uc001mod.1	-	8	1140	c.862C>T	c.(862-864)CAG>TAG	p.Q288*	HPS5_uc001moe.1_Nonsense_Mutation_p.Q174*|HPS5_uc001mof.1_Nonsense_Mutation_p.Q174*	NM_181507	NP_852608	Q9UPZ3	HPS5_HUMAN	Hermansky-Pudlak syndrome 5 isoform a	288						cytosol				ovary(1)|pancreas(1)|skin(1)	3						GACAAAGACTGGGAGGATCCA	0.338									Hermansky-Pudlak_syndrome				4	26	---	---	---	---	PASS
LUZP2	338645	broad.mit.edu	37	11	25100121	25100121	+	Missense_Mutation	SNP	T	G	G			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:25100121T>G	uc001mqs.2	+	12	1192	c.958T>G	c.(958-960)TCT>GCT	p.S320A	LUZP2_uc009yif.2_Missense_Mutation_p.S234A|LUZP2_uc009yig.2_Missense_Mutation_p.S278A	NM_001009909	NP_001009909	Q86TE4	LUZP2_HUMAN	leucine zipper protein 2 precursor	320						extracellular region				ovary(1)|skin(1)	2						GCCTCCTTGCTCTGAATGTGA	0.333													4	14	---	---	---	---	PASS
TTC12	54970	broad.mit.edu	37	11	113205696	113205696	+	Missense_Mutation	SNP	A	C	C			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:113205696A>C	uc001pnu.2	+	8	618	c.513A>C	c.(511-513)GAA>GAC	p.E171D	TTC12_uc001pnv.2_Missense_Mutation_p.E177D|TTC12_uc001pnw.2_RNA|TTC12_uc001pnx.2_Missense_Mutation_p.E21D	NM_017868	NP_060338	Q9H892	TTC12_HUMAN	tetratricopeptide repeat domain 12	171	TPR 2.						binding			pancreas(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	4		all_cancers(61;2.73e-16)|all_epithelial(67;8.64e-10)|Melanoma(852;1.46e-05)|all_hematologic(158;0.00014)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Prostate(24;0.183)|Renal(330;0.187)		BRCA - Breast invasive adenocarcinoma(274;5.3e-06)|Epithelial(105;8.37e-05)|all cancers(92;0.000694)		AGTGTGATGAAAAATGCACAA	0.388													5	17	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	12	92116	92116	+	Missense_Mutation	SNP	C	T	T			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:92116C>T	uc010sdi.1	-	2	222	c.194G>A	c.(193-195)TGC>TAC	p.C65Y	uc010sdj.1_RNA					SubName: Full=DEAD/H box polypeptide 11 like 11;																		CAGCGCCAGGCAGTGGTGCAG	0.597													10	39	---	---	---	---	PASS
EPS8	2059	broad.mit.edu	37	12	15803929	15803929	+	Missense_Mutation	SNP	G	A	A			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:15803929G>A	uc009zif.2	-	14	1356	c.1262C>T	c.(1261-1263)CCA>CTA	p.P421L	EPS8_uc001rdb.2_Missense_Mutation_p.P421L|EPS8_uc009zig.2_Missense_Mutation_p.P161L|EPS8_uc010shv.1_Missense_Mutation_p.P161L	NM_004447	NP_004438	Q12929	EPS8_HUMAN	epidermal growth factor receptor pathway	421	Pro-rich.				cell proliferation|epidermal growth factor receptor signaling pathway		SH3/SH2 adaptor activity			ovary(2)|upper_aerodigestive_tract(1)|skin(1)	4		all_epithelial(100;1.87e-05)|Breast(259;0.000286)|Hepatocellular(102;0.244)		BRCA - Breast invasive adenocarcinoma(232;4.29e-05)|GBM - Glioblastoma multiforme(207;0.0264)		CTGTTCTTTTGGCCACTCTGC	0.433													3	5	---	---	---	---	PASS
PRIM1	5557	broad.mit.edu	37	12	57137816	57137816	+	Intron	SNP	A	G	G			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57137816A>G	uc001smd.2	-						PRIM1_uc001sme.1_Intron|PRIM1_uc009zoz.1_Intron|PRIM1_uc001smf.2_3'UTR	NM_000946	NP_000937	P49642	PRI1_HUMAN	DNA primase polypeptide 1						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	DNA primase activity|metal ion binding				0						TAAATCAGACACCTTAAAGTG	0.323													6	24	---	---	---	---	PASS
XPOT	11260	broad.mit.edu	37	12	64812710	64812710	+	Missense_Mutation	SNP	T	C	C			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:64812710T>C	uc001ssb.2	+	6	751	c.325T>C	c.(325-327)TTC>CTC	p.F109L	XPOT_uc009zqm.1_Missense_Mutation_p.F19L	NM_007235	NP_009166	O43592	XPOT_HUMAN	tRNA exportin	109	Necessary for interaction with Ran, nuclear localization and nuclear import.				intracellular protein transport|tRNA export from nucleus	cytoplasm|nucleoplasm	protein transporter activity|tRNA binding			ovary(2)	2				GBM - Glioblastoma multiforme(28;0.0404)		CGCCCAAGTCTTCGCCTTGCT	0.388													4	38	---	---	---	---	PASS
XPOT	11260	broad.mit.edu	37	12	64812728	64812728	+	Missense_Mutation	SNP	A	G	G			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:64812728A>G	uc001ssb.2	+	6	769	c.343A>G	c.(343-345)ACA>GCA	p.T115A	XPOT_uc009zqm.1_Missense_Mutation_p.T25A	NM_007235	NP_009166	O43592	XPOT_HUMAN	tRNA exportin	115	Necessary for interaction with Ran, nuclear localization and nuclear import.				intracellular protein transport|tRNA export from nucleus	cytoplasm|nucleoplasm	protein transporter activity|tRNA binding			ovary(2)	2				GBM - Glioblastoma multiforme(28;0.0404)		GCTTTTTGTTACAGAGTATCT	0.433													4	36	---	---	---	---	PASS
XPOT	11260	broad.mit.edu	37	12	64812808	64812808	+	Silent	SNP	C	G	G			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:64812808C>G	uc001ssb.2	+	6	849	c.423C>G	c.(421-423)CTC>CTG	p.L141L	XPOT_uc009zqm.1_Silent_p.L51L	NM_007235	NP_009166	O43592	XPOT_HUMAN	tRNA exportin	141	Necessary for interaction with Ran, nuclear localization and nuclear import.				intracellular protein transport|tRNA export from nucleus	cytoplasm|nucleoplasm	protein transporter activity|tRNA binding			ovary(2)	2				GBM - Glioblastoma multiforme(28;0.0404)		GAGTAGATCTCTACCTGCGAA	0.398													7	24	---	---	---	---	PASS
LOC374491	374491	broad.mit.edu	37	13	25161438	25161438	+	RNA	SNP	T	A	A	rs3869320	by1000genomes	TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:25161438T>A	uc001upm.2	+	8		c.962T>A			LOC374491_uc001upn.2_RNA|LOC374491_uc001upo.2_RNA					Homo sapiens mRNA; cDNA DKFZp434J0717 (from clone DKFZp434J0717).												0						CTCTTTATAATAAGATTCATT	0.378													7	19	---	---	---	---	PASS
EBPL	84650	broad.mit.edu	37	13	50235160	50235160	+	Missense_Mutation	SNP	G	C	C			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:50235160G>C	uc001vdg.2	-	4	628	c.565C>G	c.(565-567)CTA>GTA	p.L189V	EBPL_uc001vdh.2_RNA|EBPL_uc001vdi.2_3'UTR	NM_032565	NP_115954	Q9BY08	EBPL_HUMAN	emopamil binding related protein, delta8-delta7	189					sterol metabolic process	endoplasmic reticulum membrane|integral to membrane	cholestenol delta-isomerase activity				0		Lung NSC(96;0.000468)|Breast(56;0.0011)|Prostate(109;0.00243)|Hepatocellular(98;0.0556)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(99;2.06e-09)		TTGAGTTCTAGCCATGACTGC	0.418													6	56	---	---	---	---	PASS
TBC1D4	9882	broad.mit.edu	37	13	75936707	75936707	+	Nonsense_Mutation	SNP	T	A	A			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:75936707T>A	uc001vjl.1	-	2	882	c.535A>T	c.(535-537)AAA>TAA	p.K179*	TBC1D4_uc010aer.2_Nonsense_Mutation_p.K179*|TBC1D4_uc010aes.2_Nonsense_Mutation_p.K179*	NM_014832	NP_055647	O60343	TBCD4_HUMAN	TBC1 domain family, member 4	179	PID 1.					cytoplasm	Rab GTPase activator activity			ovary(4)|central_nervous_system(1)|skin(1)	6		Prostate(6;0.014)|Breast(118;0.0982)		GBM - Glioblastoma multiforme(99;0.0116)		ATGGCCGCTTTAGATAATTGC	0.408													76	206	---	---	---	---	PASS
TMCO3	55002	broad.mit.edu	37	13	114149939	114149939	+	Missense_Mutation	SNP	G	A	A	rs139520979	by1000genomes	TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:114149939G>A	uc001vtu.3	+	2	404	c.43G>A	c.(43-45)GTC>ATC	p.V15I	TMCO3_uc001vtt.3_Missense_Mutation_p.V15I	NM_017905	NP_060375	Q6UWJ1	TMCO3_HUMAN	transmembrane and coiled-coil domains 3	15						integral to membrane	solute:hydrogen antiporter activity				0	Lung NSC(43;0.0161)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0145)|all_epithelial(44;0.00286)|all_lung(25;0.0273)|Breast(118;0.0411)|Lung NSC(25;0.0983)	all cancers(43;0.0317)			GCTGTTTCCCGTCCTTCCCTG	0.642													51	173	---	---	---	---	PASS
C14orf4	64207	broad.mit.edu	37	14	77491962	77491962	+	Missense_Mutation	SNP	G	A	A			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:77491962G>A	uc001xsy.2	-	1	3073	c.2174C>T	c.(2173-2175)ACG>ATG	p.T725M		NM_024496	NP_078772	Q9H1B7	I2BPL_HUMAN	chromosome 14 open reading frame 4	725	Cys-rich.					nucleus					0			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.00347)|KIRC - Kidney renal clear cell carcinoma(182;0.0878)		AACGAAATGCGTATCCTCCAA	0.582													43	105	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	106539313	106539313	+	RNA	SNP	G	A	A			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106539313G>A	uc010tyt.1	-	1519		c.31380C>T								Parts of antibodies, mostly variable regions.												0						CCTTGCAGGAGACCTTCACTG	0.547													4	16	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	106539361	106539361	+	RNA	SNP	C	A	A			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106539361C>A	uc010tyt.1	-	1519		c.31332G>T								Parts of antibodies, mostly variable regions.												0						CAGACTGCACCAGCTGCACCT	0.532													4	15	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	106539367	106539367	+	RNA	SNP	C	G	G			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106539367C>G	uc010tyt.1	-	1519		c.31326G>C								Parts of antibodies, mostly variable regions.												0						GCACCAGCTGCACCTGGGAGT	0.527													4	15	---	---	---	---	PASS
CYFIP1	23191	broad.mit.edu	37	15	22928512	22928512	+	Splice_Site	SNP	T	C	C			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22928512T>C	uc001yus.2	+	5	491	c.387_splice	c.e5+2	p.Q129_splice	CYFIP1_uc001yut.2_Splice_Site_p.Q129_splice|CYFIP1_uc010aya.1_Splice_Site_p.Q157_splice	NM_014608	NP_055423	Q7L576	CYFP1_HUMAN	cytoplasmic FMR1 interacting protein 1 isoform						axon extension|lamellipodium assembly|regulation of cell shape|ruffle organization	cell junction|lamellipodium|mRNA cap binding complex|perinuclear region of cytoplasm|ruffle|synapse|synaptosome	actin filament binding|Rac GTPase binding			ovary(4)|pancreas(3)|liver(1)|skin(1)	9		all_cancers(20;2.26e-25)|all_epithelial(15;2.1e-22)|Lung NSC(15;3.36e-17)|all_lung(15;1.04e-16)|Breast(32;0.000776)|Colorectal(260;0.0488)		all cancers(64;2.22e-06)|Epithelial(43;1.49e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00101)		TACTTCCAGGTAAAATGGCAA	0.493													60	191	---	---	---	---	PASS
JMJD7-PLA2G4B	8681	broad.mit.edu	37	15	42132809	42132809	+	Missense_Mutation	SNP	G	C	C			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:42132809G>C	uc010bco.2	+	3	271	c.170G>C	c.(169-171)AGC>ACC	p.S57T	JMJD7-PLA2G4B_uc001zoo.3_Missense_Mutation_p.S288T|JMJD7-PLA2G4B_uc010bcn.2_Missense_Mutation_p.S288T|JMJD7-PLA2G4B_uc001zoq.3_5'UTR|JMJD7-PLA2G4B_uc001zor.1_5'Flank	NM_001114633	NP_001108105	P0C869	PA24B_HUMAN	phospholipase A2, group IVB	57	C2.				arachidonic acid metabolic process|calcium-mediated signaling|glycerophospholipid catabolic process|inflammatory response|parturition	cytosol|early endosome membrane|extracellular region|mitochondrial membrane	calcium ion binding|calcium-dependent phospholipase A2 activity|calcium-dependent phospholipid binding|lysophospholipase activity			large_intestine(1)	1						AACAGCAGTAGCCCTGTCTGG	0.617													32	75	---	---	---	---	PASS
ITGA11	22801	broad.mit.edu	37	15	68595444	68595444	+	Missense_Mutation	SNP	G	C	C			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:68595444G>C	uc002ari.2	-	30	3607	c.3520C>G	c.(3520-3522)CGC>GGC	p.R1174G	ITGA11_uc010bib.2_Missense_Mutation_p.R1175G	NM_001004439	NP_001004439	Q9UKX5	ITA11_HUMAN	integrin, alpha 11 precursor	1174	Poly-Arg.|Cytoplasmic (Potential).				cell-matrix adhesion|integrin-mediated signaling pathway|muscle organ development	integrin complex	collagen binding|receptor activity			kidney(2)|pancreas(1)	3					Tirofiban(DB00775)	TCCCTCCTGCGCCTGGCACTT	0.617													12	95	---	---	---	---	PASS
GOLGA6L10	647042	broad.mit.edu	37	15	83014106	83014106	+	Silent	SNP	T	C	C			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:83014106T>C	uc010uny.1	-	6	539	c.441A>G	c.(439-441)GTA>GTG	p.V147V	GOLGA6L10_uc010unt.1_RNA|uc002bhl.2_Intron|uc002bhm.2_Intron|GOLGA6L10_uc002bia.1_5'Flank	NM_198181	NP_937824	A6NI86	GG6LA_HUMAN	golgi autoantigen, golgin subfamily a, 6D-like	159	Potential.										0						GTAGCTGCTCTACCTTAGATG	0.498													8	48	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	15	84945393	84945393	+	RNA	SNP	C	T	T	rs437422	by1000genomes	TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:84945393C>T	uc002bke.1	-	1		c.1825G>A								Homo sapiens cDNA FLJ34196 fis, clone FCBBF3019437.																		TCCAACTCCTCCTCTCTGCAT	0.532													27	94	---	---	---	---	PASS
GOLGA6L5	374650	broad.mit.edu	37	15	85056047	85056047	+	RNA	SNP	C	G	G			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85056047C>G	uc002bkm.2	-	6		c.513G>C				NR_003246				Homo sapiens cDNA FLJ33459 fis, clone BRAMY2000585.												0						GCTGGGGGCTCTGGGGCCAGG	0.527													4	46	---	---	---	---	PASS
ZNF434	54925	broad.mit.edu	37	16	3432991	3432991	+	Missense_Mutation	SNP	C	T	T			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3432991C>T	uc002cuz.2	-	6	2121	c.1319G>A	c.(1318-1320)CGA>CAA	p.R440Q	ZNF434_uc002cux.3_Missense_Mutation_p.R651Q|ZNF434_uc010uwx.1_Missense_Mutation_p.R363Q|ZNF434_uc002cuy.3_Missense_Mutation_p.R363Q	NM_017810	NP_060280	Q9NX65	ZN434_HUMAN	zinc finger protein 434	440	C2H2-type 5.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2						GTGGGTTTTTCGGTGGGCACT	0.512													4	41	---	---	---	---	PASS
PDXDC1	23042	broad.mit.edu	37	16	15224576	15224576	+	Intron	SNP	T	C	C			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15224576T>C	uc002ddc.2	+						uc010uzs.1_RNA|uc002ddh.2_Missense_Mutation_p.H102R|uc002ddi.2_5'UTR|uc010uzt.1_Missense_Mutation_p.H102R	NM_015027	NP_055842	Q6P996	PDXD1_HUMAN	pyridoxal-dependent decarboxylase domain						carboxylic acid metabolic process		carboxy-lyase activity|protein binding|pyridoxal phosphate binding			skin(1)	1					Pyridoxal Phosphate(DB00114)	CGAGCAGTTGTGCTCATTGGG	0.672													6	56	---	---	---	---	PASS
SLC6A10P	386757	broad.mit.edu	37	16	32890622	32890622	+	Missense_Mutation	SNP	T	G	G			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32890622T>G	uc002edh.1	-	5	440	c.264A>C	c.(262-264)AAA>AAC	p.K88N	SLC6A10P_uc002edi.1_RNA					RecName: Full=Transporter;												0						CGTTGGTGTTTTTGTAGACCA	0.512													5	55	---	---	---	---	PASS
MYLK3	91807	broad.mit.edu	37	16	46766320	46766320	+	Missense_Mutation	SNP	C	G	G			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46766320C>G	uc002eei.3	-	4	1378	c.1262G>C	c.(1261-1263)GGG>GCG	p.G421A	MYLK3_uc010vge.1_Missense_Mutation_p.G80A|MYLK3_uc002eej.1_Missense_Mutation_p.G80A	NM_182493	NP_872299	Q32MK0	MYLK3_HUMAN	myosin light chain kinase 3	421					cardiac myofibril assembly|cellular response to interleukin-1|positive regulation of sarcomere organization|regulation of vascular permeability involved in acute inflammatory response|sarcomere organization|sarcomerogenesis	cytosol	ATP binding|calmodulin-dependent protein kinase activity|myosin light chain kinase activity			stomach(2)|skin(2)|large_intestine(1)|ovary(1)|central_nervous_system(1)	7		all_cancers(37;0.00023)|all_epithelial(9;0.000543)|all_lung(18;0.00585)|Lung NSC(13;0.0496)|Breast(268;0.116)				AGGCTCGGCCCCAGCCCTTTG	0.677													28	135	---	---	---	---	PASS
WWP2	11060	broad.mit.edu	37	16	69971060	69971060	+	Silent	SNP	G	A	A			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:69971060G>A	uc002exu.1	+	21	2246	c.2157G>A	c.(2155-2157)GAG>GAA	p.E719E	WWP2_uc002exv.1_Silent_p.E719E|WWP2_uc010vlm.1_Silent_p.E603E|WWP2_uc010vln.1_Silent_p.E337E|WWP2_uc002exw.1_Silent_p.E280E	NM_007014	NP_008945	O00308	WWP2_HUMAN	WW domain containing E3 ubiquitin protein ligase	719	HECT.				entry of virus into host cell|negative regulation of protein transport|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transporter activity|proteasomal ubiquitin-dependent protein catabolic process|protein K63-linked ubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus|ubiquitin ligase complex	RNA polymerase II transcription factor binding|ubiquitin-protein ligase activity			lung(3)|ovary(1)|breast(1)|skin(1)	6						GCGTGGAAGAGCAGACCAAAG	0.607													16	191	---	---	---	---	PASS
LOC283922	283922	broad.mit.edu	37	16	74372644	74372644	+	Silent	SNP	A	G	G			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74372644A>G	uc002fcr.2	-	9	1661	c.315T>C	c.(313-315)CCT>CCC	p.P105P	LOC283922_uc010vms.1_RNA					Homo sapiens cDNA FLJ39449 fis, clone PROST2008360, highly similar to Homo sapiens pyruvate dehydrogenase phosphatase regulatory subunit (PDPR), mRNA.												0						TACCCTTGTCAGGGGGAACAA	0.443													10	81	---	---	---	---	PASS
LOC283922	283922	broad.mit.edu	37	16	74394745	74394745	+	5'UTR	SNP	A	G	G	rs71391080	by1000genomes	TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74394745A>G	uc002fcr.2	-	2					LOC283922_uc010vms.1_RNA					Homo sapiens cDNA FLJ39449 fis, clone PROST2008360, highly similar to Homo sapiens pyruvate dehydrogenase phosphatase regulatory subunit (PDPR), mRNA.												0						GACAGCAACCAGTAGAACATC	0.483													20	123	---	---	---	---	PASS
ZNF286B	729288	broad.mit.edu	37	17	18584142	18584142	+	Missense_Mutation	SNP	A	G	G	rs116808485	by1000genomes	TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18584142A>G	uc010vyd.1	-	3	289	c.38T>C	c.(37-39)GTT>GCT	p.V13A		NM_001145045	NP_001138517	P0CG31	Z286B_HUMAN	zinc finger protein 286B	13					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						GGAAGACAGAACTAACGACAA	0.473													11	106	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	17	21730916	21730916	+	Missense_Mutation	SNP	G	T	T	rs111245273	by1000genomes	TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21730916G>T	uc002gyy.3	+	2	343	c.218G>T	c.(217-219)CGG>CTG	p.R73L						SubName: Full=cDNA FLJ51326, highly similar to Homo sapiens ubiquitin B (UBB), mRNA;																		GTCCTGCGTCGGAGAGGTGGT	0.552													7	122	---	---	---	---	PASS
UNC119	9094	broad.mit.edu	37	17	26875651	26875651	+	Missense_Mutation	SNP	G	A	A			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26875651G>A	uc002hbk.2	-	2	364	c.293C>T	c.(292-294)TCA>TTA	p.S98L	UNC119_uc002hbm.2_Missense_Mutation_p.S98L|UNC119_uc002hbl.1_5'Flank	NM_005148	NP_005139	Q13432	U119A_HUMAN	unc119 (C.elegans) homolog isoform a	98					phototransduction|synaptic transmission|visual perception	cytosol|soluble fraction					0	Lung NSC(42;0.00431)					GACAGTGCCTGAGTCCATGTC	0.547											OREG0024277	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	58	156	---	---	---	---	PASS
GPR179	440435	broad.mit.edu	37	17	36482951	36482951	+	Missense_Mutation	SNP	T	G	G			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:36482951T>G	uc002hpz.2	-	11	6522	c.6501A>C	c.(6499-6501)GAA>GAC	p.E2167D		NM_001004334	NP_001004334	Q6PRD1	GP179_HUMAN	GPR158-like 1 precursor	2167	Cytoplasmic (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(3)	3	Breast(7;2.97e-12)	Breast(25;0.0101)|Ovarian(249;0.15)				TTGAGAAGTGTTCTTCCGTCC	0.597													25	61	---	---	---	---	PASS
ERBB2	2064	broad.mit.edu	37	17	37873629	37873629	+	Silent	SNP	C	T	T			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37873629C>T	uc002hso.2	+	15	2032	c.1794C>T	c.(1792-1794)GCC>GCT	p.A598A	ERBB2_uc002hsm.2_Silent_p.A568A|ERBB2_uc010cwa.2_Silent_p.A583A|ERBB2_uc002hsp.2_Silent_p.A401A|ERBB2_uc010cwb.2_Silent_p.A598A|ERBB2_uc010wek.1_Silent_p.A322A|ERBB2_uc002hsl.2_Silent_p.A568A	NM_004448	NP_004439	P04626	ERBB2_HUMAN	erbB-2 isoform a	598	Extracellular (Potential).				cell proliferation|heart development|phosphatidylinositol 3-kinase cascade|phosphatidylinositol-mediated signaling|positive regulation of cell adhesion|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|protein autophosphorylation|regulation of angiogenesis|regulation of microtubule-based process|regulation of transcription, DNA-dependent|transcription, DNA-dependent|wound healing	integral to membrane|nucleus|perinuclear region of cytoplasm|receptor complex	ATP binding|DNA binding|epidermal growth factor receptor activity|ErbB-3 class receptor binding|identical protein binding|protein C-terminus binding|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity			lung(73)|central_nervous_system(16)|ovary(16)|stomach(14)|breast(9)|upper_aerodigestive_tract(5)|large_intestine(3)|liver(3)|endometrium(2)|skin(1)|pancreas(1)	143	all_cancers(6;1.06e-93)|all_epithelial(6;2.33e-113)|Breast(7;9.37e-100)|Lung NSC(9;9.76e-10)|all_lung(9;5.34e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)	Ovarian(249;0.0547)|Colorectal(1115;0.234)	UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Epithelial(3;9.42e-64)|all cancers(3;5.61e-57)|BRCA - Breast invasive adenocarcinoma(8;2.5e-45)|STAD - Stomach adenocarcinoma(3;9.03e-13)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|OV - Ovarian serous cystadenocarcinoma(8;0.0917)|LUSC - Lung squamous cell carcinoma(15;0.171)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0767)	Lapatinib(DB01259)|Letrozole(DB01006)|Trastuzumab(DB00072)	TCTGCGTGGCCCGCTGCCCCA	0.622		1	A|Mis|O		breast|ovarian|other tumour types|NSCLC|gastric					TCGA GBM(5;<1E-08)			27	87	---	---	---	---	PASS
BRCA1	672	broad.mit.edu	37	17	41234582	41234582	+	Missense_Mutation	SNP	G	C	C	rs80357649		TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41234582G>C	uc002icq.2	-	12	4428	c.4196C>G	c.(4195-4197)ACC>AGC	p.T1399S	BRCA1_uc010whp.1_Missense_Mutation_p.T249S|BRCA1_uc010whl.1_Missense_Mutation_p.T296S|BRCA1_uc010whm.1_Intron|BRCA1_uc002icp.3_Missense_Mutation_p.T1328S|BRCA1_uc002icu.2_Missense_Mutation_p.T296S|BRCA1_uc010cyx.2_Missense_Mutation_p.T1352S|BRCA1_uc002ict.2_Missense_Mutation_p.T1399S|BRCA1_uc010whn.1_Intron|BRCA1_uc010who.1_Intron|BRCA1_uc010whq.1_Missense_Mutation_p.T128S|BRCA1_uc002idc.1_Missense_Mutation_p.T295S|BRCA1_uc010whr.1_Missense_Mutation_p.T249S	NM_007294	NP_009225	P38398	BRCA1_HUMAN	breast cancer 1, early onset isoform 1	1399	Interaction with PALB2.				androgen receptor signaling pathway|apoptosis|cellular response to indole-3-methanol|chromosome segregation|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|DNA damage response, signal transduction resulting in induction of apoptosis|double-strand break repair via homologous recombination|fatty acid biosynthetic process|G2/M transition DNA damage checkpoint|negative regulation of centriole replication|negative regulation of fatty acid biosynthetic process|negative regulation of histone H3-K9 methylation|negative regulation of transcription, DNA-dependent|positive regulation of cell cycle arrest|positive regulation of DNA repair|positive regulation of histone acetylation|positive regulation of histone H3-K4 methylation|positive regulation of histone H4-K20 methylation|positive regulation of protein ubiquitination|positive regulation of transcription from RNA polymerase II promoter|postreplication repair|protein autoubiquitination|protein K6-linked ubiquitination|regulation of cell motility|regulation of cell proliferation|regulation of transcription from RNA polymerase III promoter|response to estrogen stimulus|response to ionizing radiation|substrate adhesion-dependent cell spreading	BRCA1-A complex|BRCA1-BARD1 complex|gamma-tubulin ring complex|nucleoplasm|plasma membrane|ribonucleoprotein complex|ruffle	androgen receptor binding|identical protein binding|protein binding|RNA binding|transcription coactivator activity|transcription regulatory region DNA binding|tubulin binding|ubiquitin protein ligase binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(24)|breast(21)|lung(4)|central_nervous_system(1)|endometrium(1)|urinary_tract(1)	52		Breast(137;0.000717)		BRCA - Breast invasive adenocarcinoma(366;0.126)		ATGTTGCATGGTATCCCTCTG	0.383			D|Mis|N|F|S		ovarian	breast|ovarian		Homologous_recombination	Hereditary_Breast-Ovarian_Cancer_BRCA1_type	TCGA Ovarian(2;0.000030)			8	20	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	17	43625348	43625348	+	Missense_Mutation	SNP	C	T	T			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43625348C>T	uc002ijh.2	-	1	777	c.656G>A	c.(655-657)CGA>CAA	p.R219Q	uc010wjv.1_Intron					Homo sapiens cDNA FLJ45049 fis, clone BRAWH3022347.																		AGTCAGGCTTCGATGCAGACT	0.498													4	27	---	---	---	---	PASS
LRRC46	90506	broad.mit.edu	37	17	45914323	45914323	+	Missense_Mutation	SNP	C	T	T			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45914323C>T	uc002ima.2	+	8	1059	c.803C>T	c.(802-804)CCC>CTC	p.P268L	LRRC46_uc002imb.2_Missense_Mutation_p.P221L	NM_033413	NP_219481	Q96FV0	LRC46_HUMAN	leucine rich repeat containing 46	268										ovary(1)	1						GTCTCCTCACCCCAGGCCTCC	0.657													31	89	---	---	---	---	PASS
GH2	2689	broad.mit.edu	37	17	61958132	61958132	+	Missense_Mutation	SNP	C	G	G			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61958132C>G	uc002jco.1	-	4	518	c.456G>C	c.(454-456)TGG>TGC	p.W152C	GH2_uc002jcj.2_Intron|CSH2_uc002jck.2_Intron|GH2_uc002jcl.1_Missense_Mutation_p.W152C|GH2_uc002jcm.1_Intron|GH2_uc002jcn.1_Missense_Mutation_p.W137C	NM_002059	NP_002050	P01242	SOM2_HUMAN	growth hormone 2 isoform 1	152						extracellular region	hormone activity			upper_aerodigestive_tract(2)|pancreas(1)	3						CCACCCTCACCCACATCAGCG	0.602													34	118	---	---	---	---	PASS
CDH7	1005	broad.mit.edu	37	18	63430106	63430106	+	Missense_Mutation	SNP	C	G	G			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:63430106C>G	uc002ljz.2	+	2	353	c.28C>G	c.(28-30)CAT>GAT	p.H10D	CDH7_uc002lka.2_Missense_Mutation_p.H10D|CDH7_uc002lkb.2_Missense_Mutation_p.H10D	NM_033646	NP_387450	Q9ULB5	CADH7_HUMAN	cadherin 7, type 2 preproprotein	10					adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)|pancreas(1)|skin(1)	4		Esophageal squamous(42;0.129)				GGAGTTCTGCCATTTTCTGCA	0.413													3	13	---	---	---	---	PASS
MADCAM1	8174	broad.mit.edu	37	19	501762	501762	+	Missense_Mutation	SNP	A	C	C			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:501762A>C	uc002los.2	+	4	771	c.761A>C	c.(760-762)CAG>CCG	p.Q254P	MADCAM1_uc002lot.2_Intron|MADCAM1_uc010drq.2_Intron	NM_130760	NP_570116	Q13477	MADCA_HUMAN	mucosal vascular addressin cell adhesion	254	Mucin-like.|Extracellular (Potential).|5.5 X 8 AA tandem repeats of [PS]-P-D-T- T-S-[QP]-E.|4.			Q -> P (in Ref. 1; AAC13661).	cell adhesion|immune response|regulation of immune response|signal transduction	integral to membrane|membrane fraction|plasma membrane					0		all_cancers(10;4.25e-36)|all_epithelial(18;1.46e-23)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.1e-06)|all_lung(49;1.55e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		ACCACCTCCCAGGAGCCTCCC	0.721													12	69	---	---	---	---	PASS
TICAM1	148022	broad.mit.edu	37	19	4817211	4817211	+	Missense_Mutation	SNP	T	A	A			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4817211T>A	uc002mbi.2	-	2	1430	c.1179A>T	c.(1177-1179)AAA>AAT	p.K393N		NM_182919	NP_891549	Q8IUC6	TCAM1_HUMAN	toll-like receptor adaptor molecule 1	393	TIR.				apoptosis|I-kappaB kinase/NF-kappaB cascade|inflammatory response|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|endosome membrane|plasma membrane	protein kinase binding|signal transducer activity			breast(1)	1				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0139)		AGTTATAGAATTTCTGTTCCG	0.517													49	112	---	---	---	---	PASS
PTPRS	5802	broad.mit.edu	37	19	5214437	5214437	+	Nonsense_Mutation	SNP	G	A	A			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5214437G>A	uc002mbv.2	-	30	4783	c.4549C>T	c.(4549-4551)CAG>TAG	p.Q1517*	PTPRS_uc002mbu.1_Nonsense_Mutation_p.Q1086*|PTPRS_uc010xin.1_Nonsense_Mutation_p.Q1059*|PTPRS_uc002mbw.2_Nonsense_Mutation_p.Q1479*|PTPRS_uc002mbx.2_Nonsense_Mutation_p.Q1074*|PTPRS_uc002mby.2_Nonsense_Mutation_p.Q1070*	NM_002850	NP_002841	Q13332	PTPRS_HUMAN	protein tyrosine phosphatase, receptor type,	1517	Cytoplasmic (Potential).|Tyrosine-protein phosphatase 1.				cell adhesion	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			large_intestine(2)|ovary(1)|central_nervous_system(1)	4				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0321)|Lung(535;0.182)		AACGTGACCTGGATGAAGCCG	0.587													89	276	---	---	---	---	PASS
ZNF430	80264	broad.mit.edu	37	19	21203558	21203558	+	5'UTR	SNP	T	G	G			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:21203558T>G	uc002npj.2	+	1					ZNF430_uc002npk.2_5'UTR	NM_025189	NP_079465	Q9H8G1	ZN430_HUMAN	zinc finger protein 430						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(2)	2						GACCCGCAGGTATTGGGAGAT	0.607													42	162	---	---	---	---	PASS
UQCRFS1	7386	broad.mit.edu	37	19	29699033	29699033	+	Missense_Mutation	SNP	T	C	C			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:29699033T>C	uc002nsd.2	-	2	358	c.247A>G	c.(247-249)ATC>GTC	p.I83V		NM_006003	NP_005994	P47985	UCRI_HUMAN	ubiquinol-cytochrome c reductase, Rieske	83					respiratory electron transport chain	integral to membrane|mitochondrial respiratory chain complex III	2 iron, 2 sulfur cluster binding|metal ion binding|ubiquinol-cytochrome-c reductase activity				0	Breast(6;0.0545)|Esophageal squamous(110;0.239)		Lung(7;0.092)			GGCACCTTGATGTCTGTGTGG	0.423													9	7	---	---	---	---	PASS
RASGRP4	115727	broad.mit.edu	37	19	38904046	38904046	+	Nonsense_Mutation	SNP	A	T	T			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38904046A>T	uc002oir.2	-	10	1513	c.1299T>A	c.(1297-1299)TGT>TGA	p.C433*	RASGRP4_uc010efz.1_RNA|RASGRP4_uc010ega.1_RNA|RASGRP4_uc010xua.1_Nonsense_Mutation_p.C364*|RASGRP4_uc010xub.1_Nonsense_Mutation_p.C399*|RASGRP4_uc010xuc.1_Nonsense_Mutation_p.C341*|RASGRP4_uc010xud.1_Nonsense_Mutation_p.C336*|RASGRP4_uc010xue.1_Nonsense_Mutation_p.C244*|RASGRP4_uc010egb.2_Nonsense_Mutation_p.C419*	NM_170604	NP_733749	Q8TDF6	GRP4_HUMAN	RAS guanyl releasing protein 4 isoform a	433					activation of phospholipase C activity|cell growth|cell proliferation|myeloid cell differentiation|positive regulation of Ras protein signal transduction|regulation of G-protein coupled receptor protein signaling pathway|response to extracellular stimulus|small GTPase mediated signal transduction|transmembrane receptor protein tyrosine kinase signaling pathway	cytoplasm|membrane fraction|plasma membrane|soluble fraction	diacylglycerol binding|GTP-dependent protein binding|metal ion binding|Ras guanyl-nucleotide exchange factor activity			pancreas(1)|lung(1)|skin(1)	3	all_cancers(60;4.21e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			GGCTCTTGGGACAACGCGGCT	0.592													66	153	---	---	---	---	PASS
ARHGEF1	9138	broad.mit.edu	37	19	42408211	42408211	+	Missense_Mutation	SNP	T	G	G			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42408211T>G	uc002orx.2	+	21	2051	c.1942T>G	c.(1942-1944)TTG>GTG	p.L648V	ARHGEF1_uc002ory.2_Missense_Mutation_p.L615V|ARHGEF1_uc002orz.2_Missense_Mutation_p.L486V|ARHGEF1_uc002osa.2_Missense_Mutation_p.L663V|ARHGEF1_uc002osb.2_Missense_Mutation_p.L630V|ARHGEF1_uc002osc.2_Missense_Mutation_p.L402V|ARHGEF1_uc002osd.2_Missense_Mutation_p.L307V|ARHGEF1_uc002ose.2_Missense_Mutation_p.L92V	NM_004706	NP_004697	Q92888	ARHG1_HUMAN	Rho guanine nucleotide exchange factor 1 isoform	648	PH.				cell proliferation|negative regulation of axonogenesis|nerve growth factor receptor signaling pathway|positive regulation of axonogenesis|regulation of Rho protein signal transduction|Rho protein signal transduction	cytosol|plasma membrane	GTPase activator activity|protein binding|Rho guanyl-nucleotide exchange factor activity			ovary(3)|large_intestine(1)	4		Renal(1328;0.000518)|Hepatocellular(1079;0.0046)|Medulloblastoma(540;0.0425)		Epithelial(262;5.89e-46)|GBM - Glioblastoma multiforme(1328;2.49e-12)|STAD - Stomach adenocarcinoma(1328;0.00644)		CAAGAAGAAATTGGTCCACGA	0.622													124	367	---	---	---	---	PASS
ZNF610	162963	broad.mit.edu	37	19	52857566	52857566	+	Silent	SNP	C	T	T			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52857566C>T	uc002pyx.3	+	5	659	c.253C>T	c.(253-255)CTG>TTG	p.L85L	ZNF610_uc002pyy.3_Silent_p.L85L|ZNF610_uc002pyz.3_Intron|ZNF610_uc002pza.2_Silent_p.L85L	NM_001161426	NP_001154898	Q8N9Z0	ZN610_HUMAN	zinc finger protein 610 isoform a	85	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)|upper_aerodigestive_tract(1)	3				OV - Ovarian serous cystadenocarcinoma(262;0.00396)|GBM - Glioblastoma multiforme(134;0.00434)		GCCCTTGATTCTGCAAAGTCA	0.413													14	53	---	---	---	---	PASS
LAIR1	3903	broad.mit.edu	37	19	54872809	54872809	+	Silent	SNP	C	T	T			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54872809C>T	uc002qfk.1	-	3	388	c.78G>A	c.(76-78)CTG>CTA	p.L26L	LAIR1_uc002qfl.1_Silent_p.L26L|LAIR1_uc002qfm.1_Silent_p.L25L|LAIR1_uc002qfn.1_Silent_p.L25L|LAIR1_uc010yex.1_Silent_p.L19L|LAIR1_uc002qfo.2_Silent_p.L8L	NM_002287	NP_002278	Q6GTX8	LAIR1_HUMAN	leukocyte-associated immunoglobulin-like	26	Extracellular (Potential).					integral to membrane|plasma membrane	protein binding|receptor activity			ovary(4)	4	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.0573)		AGGGTCTGGGCAGATCTTCTA	0.463													32	94	---	---	---	---	PASS
NLRP5	126206	broad.mit.edu	37	19	56515289	56515289	+	Silent	SNP	A	G	G			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56515289A>G	uc002qmj.2	+	2	270	c.270A>G	c.(268-270)GAA>GAG	p.E90E	NLRP5_uc002qmi.2_Silent_p.E90E	NM_153447	NP_703148	P59047	NALP5_HUMAN	NACHT, LRR and PYD containing protein 5	90	DAPIN.					mitochondrion|nucleolus	ATP binding			ovary(3)|skin(2)|kidney(1)|central_nervous_system(1)	7		Colorectal(82;3.46e-05)|Ovarian(87;0.0481)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0326)		AATCTTCAGAATCGACCACAT	0.458													4	40	---	---	---	---	PASS
FRG1B	284802	broad.mit.edu	37	20	29623217	29623217	+	5'Flank	SNP	C	T	T			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29623217C>T	uc010ztl.1	+						FRG1B_uc002wvm.1_RNA|FRG1B_uc010ztj.1_RNA|FRG1B_uc010gdr.1_RNA|FRG1B_uc010ztk.1_Intron					Homo sapiens cDNA FLJ32537 fis, clone SMINT2000400, highly similar to Homo sapiens FRG1 mRNA.												0						ATGCACTCGACAATGGTCTTT	0.403													26	53	---	---	---	---	PASS
ZSWIM3	140831	broad.mit.edu	37	20	44506358	44506358	+	Silent	SNP	G	A	A	rs149497744		TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44506358G>A	uc002xqd.2	+	2	1364	c.1161G>A	c.(1159-1161)GCG>GCA	p.A387A	ZSWIM3_uc010zxg.1_Silent_p.A381A	NM_080752	NP_542790	Q96MP5	ZSWM3_HUMAN	zinc finger, SWIM domain containing 3	387							zinc ion binding			ovary(2)	2		Myeloproliferative disorder(115;0.0122)				GCCTGCTTGCGTGTAACACCT	0.547													18	54	---	---	---	---	PASS
TRIOBP	11078	broad.mit.edu	37	22	38120006	38120006	+	Silent	SNP	T	C	C			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38120006T>C	uc003atr.2	+	7	1714	c.1443T>C	c.(1441-1443)TGT>TGC	p.C481C	TRIOBP_uc003atu.2_Silent_p.C309C|TRIOBP_uc003atq.1_Silent_p.C481C|TRIOBP_uc003ats.1_Silent_p.C309C	NM_001039141	NP_001034230	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein isoform 6	481					actin modification|barbed-end actin filament capping	actin cytoskeleton|cytoplasm|nucleus	actin binding|GTP-Rho binding|myosin II binding|protein binding|ubiquitin protein ligase binding			central_nervous_system(1)	1	Melanoma(58;0.0574)					GAACATCCTGTGCCCAGCGGG	0.592													18	311	---	---	---	---	PASS
VCX3B	425054	broad.mit.edu	37	X	8434522	8434522	+	3'UTR	SNP	T	A	A	rs112774168		TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:8434522T>A	uc010ndo.2	+	4						NM_001001888	NP_001001888	Q9H321	VCX3B_HUMAN	variable charge, X-linked 3B							nucleolus					0						GCCATTCTGATGATAATAAAA	0.398													20	178	---	---	---	---	PASS
WNK3	65267	broad.mit.edu	37	X	54319687	54319687	+	Nonsense_Mutation	SNP	A	T	T			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:54319687A>T	uc004dtd.1	-	9	2206	c.1767T>A	c.(1765-1767)TAT>TAA	p.Y589*	WNK3_uc004dtc.1_Nonsense_Mutation_p.Y589*	NM_001002838	NP_001002838	Q9BYP7	WNK3_HUMAN	WNK lysine deficient protein kinase 3 isoform 2	589					intracellular protein kinase cascade|positive regulation of establishment of protein localization in plasma membrane|positive regulation of peptidyl-threonine phosphorylation|positive regulation of rubidium ion transmembrane transporter activity|positive regulation of rubidium ion transport|positive regulation of sodium ion transmembrane transporter activity|positive regulation of sodium ion transport|protein autophosphorylation	adherens junction|tight junction	ATP binding|protein binding|protein serine/threonine kinase activity|rubidium ion transmembrane transporter activity|sodium ion transmembrane transporter activity			lung(4)|ovary(3)|kidney(2)|central_nervous_system(2)	11						GATTTGAGGAATAGGCTACAC	0.403													20	72	---	---	---	---	PASS
USP51	158880	broad.mit.edu	37	X	55513642	55513642	+	Missense_Mutation	SNP	C	A	A			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:55513642C>A	uc004dun.1	-	2	1810	c.1731G>T	c.(1729-1731)CAG>CAT	p.Q577H	USP51_uc011moo.1_Missense_Mutation_p.Q281H	NM_201286	NP_958443	Q70EK9	UBP51_HUMAN	ubiquitin specific protease 51	577					ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|ubiquitin thiolesterase activity|zinc ion binding			ovary(1)|lung(1)|breast(1)	3						TAGTAGACTCCTGGTAGCTTT	0.433													25	73	---	---	---	---	PASS
TEX13B	56156	broad.mit.edu	37	X	107224252	107224252	+	3'UTR	SNP	T	C	C			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:107224252T>C	uc004enn.1	-	3						NM_031273	NP_112563	Q9BXU2	TX13B_HUMAN	testis expressed 13B											ovary(1)	1						CTCTCCTGTCTCTTGGGGGCT	0.547													39	151	---	---	---	---	PASS
SEPT6	23157	broad.mit.edu	37	X	118767424	118767424	+	Missense_Mutation	SNP	C	T	T			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:118767424C>T	uc004erv.2	-	8	1253	c.988G>A	c.(988-990)GAG>AAG	p.E330K	SEPT6_uc010nqk.2_Intron|SEPT6_uc004ers.2_Missense_Mutation_p.E330K|SEPT6_uc004ert.2_Missense_Mutation_p.E330K|SEPT6_uc004eru.2_Missense_Mutation_p.E330K|SEPT6_uc004erw.2_Missense_Mutation_p.E272K|SEPT6_uc011mtv.1_Missense_Mutation_p.E272K|SEPT6_uc011mtw.1_Missense_Mutation_p.E360K	NM_015129	NP_055944	Q14141	SEPT6_HUMAN	septin 6 isoform B	330	Potential.				cell cycle|cytokinesis|interspecies interaction between organisms	cleavage furrow|condensed chromosome kinetochore|midbody|septin complex|spindle	GTP binding|protein binding			lung(1)|ovary(1)|prostate(1)|kidney(1)	4						CCTAGGAACTCGTTCCTTTTG	0.443													9	265	---	---	---	---	PASS
CNGA2	1260	broad.mit.edu	37	X	150912325	150912325	+	Silent	SNP	G	A	A			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:150912325G>A	uc004fey.1	+	7	1574	c.1350G>A	c.(1348-1350)AAG>AAA	p.K450K		NM_005140	NP_005131	Q16280	CNGA2_HUMAN	cyclic nucleotide gated channel alpha 2	450	Extracellular (Potential).				response to stimulus|sensory perception of smell	intracellular cyclic nucleotide activated cation channel complex	cAMP binding|intracellular cAMP activated cation channel activity			breast(3)	3	Acute lymphoblastic leukemia(192;6.56e-05)					CCACACTCAAGAAAGTGCGCA	0.438													6	22	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	1	2892405	2892405	+	IGR	DEL	A	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:2892405delA								MMEL1 (327924 upstream) : ACTRT2 (45641 downstream)																							GGGCCCTCTTAAAAAAATGAC	0.507													4	2	---	---	---	---	
KIAA2013	90231	broad.mit.edu	37	1	11980221	11980246	+	3'UTR	DEL	GGTGTATCCACACTCACTTCTGCGTC	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11980221_11980246delGGTGTATCCACACTCACTTCTGCGTC	uc001atk.2	-	3						NM_138346	NP_612355	Q8IYS2	K2013_HUMAN	hypothetical protein LOC90231 precursor							integral to membrane				ovary(1)	1	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00149)|all_lung(284;0.00189)|Breast(348;0.00586)|Colorectal(325;0.0062)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0556)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;4.88e-06)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|Kidney(185;0.000722)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		TGCAAACTCTGGTGTATCCACACTCACTTCTGCGTCACCGGTTTCC	0.522													22	15	---	---	---	---	
ZNF643	65243	broad.mit.edu	37	1	40922615	40922616	+	Splice_Site	DEL	AG	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:40922615_40922616delAG	uc001cfn.1	+	3	511	c.214_splice	c.e3-1	p.E72_splice	ZNF643_uc001cfl.1_Splice_Site|ZNF643_uc001cfm.1_Splice_Site	NM_023070	NP_075558	Q9UJL9	ZN643_HUMAN	zinc finger protein 643						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2	Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	OV - Ovarian serous cystadenocarcinoma(33;5.25e-18)			TTGATGTTCTAGGAACTGTTAA	0.485													4	2	---	---	---	---	
HIVEP3	59269	broad.mit.edu	37	1	42141099	42141099	+	Intron	DEL	C	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:42141099delC	uc001cgz.3	-						HIVEP3_uc001cha.3_Intron	NM_024503	NP_078779	Q5T1R4	ZEP3_HUMAN	human immunodeficiency virus type I enhancer						positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	zinc ion binding			ovary(4)|large_intestine(1)|central_nervous_system(1)	6	Ovarian(52;0.00769)|all_hematologic(146;0.109)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0367)				gggaagccctcccctgccccc	0.000													4	2	---	---	---	---	
ERI3	79033	broad.mit.edu	37	1	44730823	44730824	+	Intron	INS	-	GAGA	GAGA	rs140486114	by1000genomes	TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:44730823_44730824insGAGA	uc001clt.2	-						ERI3_uc010okv.1_Intron|ERI3_uc009vxg.2_Intron|ERI3_uc010okw.1_Intron|ERI3_uc001clu.2_Intron	NM_024066	NP_076971	O43414	ERI3_HUMAN	prion protein interacting protein							intracellular	exonuclease activity|metal ion binding|nucleic acid binding			ovary(2)|large_intestine(1)	3						GAAGCGGGAAGGAGAACAAGTG	0.550													3	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	50865017	50865017	+	IGR	DEL	T	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:50865017delT								ELAVL4 (197477 upstream) : DMRTA2 (18212 downstream)																							CACTGAGCACttttttttttc	0.204													5	3	---	---	---	---	
OSBPL9	114883	broad.mit.edu	37	1	52179530	52179531	+	Intron	DEL	AA	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:52179530_52179531delAA	uc001cst.2	+						OSBPL9_uc001css.2_Intron|OSBPL9_uc001csx.2_Intron|OSBPL9_uc009vza.2_Intron|OSBPL9_uc001csu.2_Intron|OSBPL9_uc001csv.2_Intron|OSBPL9_uc001csw.2_Intron	NM_024586	NP_078862	Q96SU4	OSBL9_HUMAN	oxysterol binding protein-like 9 isoform e						lipid transport		lipid binding			central_nervous_system(1)	1						AAAAAATATTAATAGATCAAGC	0.208													4	2	---	---	---	---	
LPHN2	23266	broad.mit.edu	37	1	82242835	82242835	+	Intron	DEL	G	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:82242835delG	uc001dit.3	+						LPHN2_uc001dis.2_Intron	NM_012302	NP_036434	O95490	LPHN2_HUMAN	latrophilin 2 precursor						neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity|latrotoxin receptor activity|sugar binding			ovary(3)|lung(3)|breast(2)|central_nervous_system(1)	9				all cancers(265;0.00142)|Epithelial(280;0.00829)|OV - Ovarian serous cystadenocarcinoma(397;0.077)|STAD - Stomach adenocarcinoma(256;0.248)		tatatcttctgtaaaataata	0.000													4	2	---	---	---	---	
SPATA1	64173	broad.mit.edu	37	1	85014690	85014691	+	Intron	DEL	CA	-	-	rs114084680	by1000genomes	TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:85014690_85014691delCA	uc001djz.1	+						SPATA1_uc001djy.1_Intron	NM_001081472	NP_001074941			spermatogenesis associated 1											central_nervous_system(1)	1				Epithelial(280;4.36e-10)|all cancers(265;7.1e-09)|BRCA - Breast invasive adenocarcinoma(282;8.45e-09)|OV - Ovarian serous cystadenocarcinoma(397;0.00286)|KIRC - Kidney renal clear cell carcinoma(1967;0.0111)		AAGTTCTGTTCAAAACACATGC	0.366													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	86882121	86882122	+	IGR	INS	-	CT	CT	rs140629778	by1000genomes	TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:86882121_86882122insCT								ODF2L (20118 upstream) : CLCA2 (7647 downstream)																							acatggctttactctctctctc	0.005													25	26	---	---	---	---	
TRIM33	51592	broad.mit.edu	37	1	114976219	114976219	+	Intron	DEL	T	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:114976219delT	uc001eew.2	-						TRIM33_uc010ows.1_Intron|TRIM33_uc001eex.2_Intron	NM_015906	NP_056990	Q9UPN9	TRI33_HUMAN	tripartite motif-containing 33 protein isoform						negative regulation of BMP signaling pathway|negative regulation of transcription, DNA-dependent|protein ubiquitination|regulation of transforming growth factor beta receptor signaling pathway|transcription, DNA-dependent	nucleus	co-SMAD binding|DNA binding|ligase activity|R-SMAD binding|zinc ion binding			lung(4)|central_nervous_system(3)|large_intestine(1)|breast(1)|skin(1)|ovary(1)	11	all_epithelial(7;0.000132)|all_lung(7;0.00106)|Lung SC(450;0.184)	all_cancers(81;3.03e-08)|all_epithelial(167;3.24e-08)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		AAAATTATGGTTTTAAGGCAA	0.333			T	RET	papillary thyroid								20	11	---	---	---	---	
NBPF10	100132406	broad.mit.edu	37	1	145828981	145828981	+	Intron	DEL	G	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145828981delG	uc001emp.3	+						GPR89A_uc010ozb.1_5'Flank|GPR89A_uc001eos.2_5'Flank|GPR89A_uc001eot.2_5'Flank|GPR89A_uc010ozc.1_5'Flank|GPR89A_uc010ozd.1_5'Flank|GPR89A_uc010oze.1_5'Flank	NM_017940	NP_060410	A6NDV3	A6NDV3_HUMAN	hypothetical protein LOC55672												0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		TGCTGGTGGTGGACTCTGACA	0.443													12	29	---	---	---	---	
LOC200030	200030	broad.mit.edu	37	1	148004916	148004917	+	Intron	INS	-	A	A	rs67866638		TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148004916_148004917insA	uc001eqf.2	-						LOC200030_uc010ozz.1_Intron|LOC200030_uc001eqe.2_Intron|LOC200030_uc001eqg.2_Intron|FLJ39739_uc001eqo.1_Intron|NBPF14_uc010pab.1_Intron|NBPF14_uc010pac.1_Intron|NBPF14_uc001eqq.2_Intron	NM_017940	NP_060410	Q86T75	NBPFB_HUMAN	hypothetical protein LOC55672							cytoplasm					0						ATTAATGAGGTAAAAAAAAAAT	0.297													4	2	---	---	---	---	
XPR1	9213	broad.mit.edu	37	1	180763548	180763548	+	Intron	DEL	T	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:180763548delT	uc001goi.2	+						XPR1_uc009wxm.2_Intron|XPR1_uc009wxn.2_Intron	NM_004736	NP_004727	Q9UBH6	XPR1_HUMAN	xenotropic and polytropic retrovirus receptor							integral to plasma membrane	G-protein coupled receptor activity				0						atcacaggcattttttaaaaa	0.060													4	2	---	---	---	---	
LAMC2	3918	broad.mit.edu	37	1	183187793	183187794	+	Intron	DEL	AC	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:183187793_183187794delAC	uc001gqa.2	+						LAMC2_uc001gpz.3_Intron|LAMC2_uc010poa.1_Intron	NM_005562	NP_005553	Q13753	LAMC2_HUMAN	laminin, gamma 2 isoform a precursor						cell adhesion|epidermis development|hemidesmosome assembly		heparin binding			skin(2)|ovary(1)	3						AACAGCAAAAACACACACACAC	0.455													4	2	---	---	---	---	
CACNA1S	779	broad.mit.edu	37	1	201019881	201019881	+	Intron	DEL	A	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201019881delA	uc001gvv.2	-							NM_000069	NP_000060	Q13698	CAC1S_HUMAN	calcium channel, voltage-dependent, L type,						axon guidance	I band|T-tubule|voltage-gated calcium channel complex	high voltage-gated calcium channel activity			ovary(3)|central_nervous_system(1)|skin(1)	5					Magnesium Sulfate(DB00653)|Verapamil(DB00661)	TAACCAAAACAAAAAAAAAAA	0.289													6	5	---	---	---	---	
IPO9	55705	broad.mit.edu	37	1	201827865	201827865	+	Intron	DEL	A	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201827865delA	uc001gwz.2	+							NM_018085	NP_060555	Q96P70	IPO9_HUMAN	importin 9						protein import into nucleus	cytoplasm|nucleus	histone binding|protein transporter activity			ovary(2)	2						GGCTTAAGGTAAATGACTCTT	0.303													4	2	---	---	---	---	
AGT	183	broad.mit.edu	37	1	230846729	230846729	+	Intron	DEL	A	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:230846729delA	uc001hty.3	-						AGT_uc009xfe.2_5'Flank|AGT_uc009xff.2_Intron	NM_000029	NP_000020	P01019	ANGT_HUMAN	angiotensinogen preproprotein						activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|blood vessel remodeling|cell-cell signaling|cellular lipid metabolic process|G-protein signaling, coupled to cGMP nucleotide second messenger|kidney development|low-density lipoprotein particle remodeling|negative regulation of nerve growth factor receptor signaling pathway|nitric oxide mediated signal transduction|positive regulation of activation of JAK2 kinase activity|positive regulation of apoptosis|positive regulation of branching involved in ureteric bud morphogenesis|positive regulation of cardiac muscle hypertrophy|positive regulation of cholesterol esterification|positive regulation of cytokine production|positive regulation of endothelial cell migration|positive regulation of epidermal growth factor receptor signaling pathway|positive regulation of fibroblast proliferation|positive regulation of inflammatory response|positive regulation of NAD(P)H oxidase activity|positive regulation of NF-kappaB transcription factor activity|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of protein tyrosine kinase activity|positive regulation of reactive oxygen species metabolic process|positive regulation of transcription, DNA-dependent|regulation of proteolysis|regulation of renal output by angiotensin|regulation of renal sodium excretion|regulation of vasoconstriction|renin-angiotensin regulation of aldosterone production|response to muscle activity involved in regulation of muscle adaptation	extracellular space|soluble fraction	acetyltransferase activator activity|growth factor activity|hormone activity|serine-type endopeptidase inhibitor activity|type 1 angiotensin receptor binding|type 2 angiotensin receptor binding				0	Breast(184;0.0735)|Ovarian(103;0.183)	all_cancers(173;4.64e-23)|all_epithelial(177;3.61e-18)|Breast(1374;0.00093)|all_neural(198;0.0604)|Prostate(94;0.167)		GBM - Glioblastoma multiforme(131;4.4e-06)|Colorectal(1306;5.46e-06)|COAD - Colon adenocarcinoma(196;0.000256)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)	Aliskiren(DB01258)|Atorvastatin(DB01076)|Cilazapril(DB01340)|Irbesartan(DB01029)|Lisinopril(DB00722)|Ouabain(DB01092)|Simvastatin(DB00641)	TCATGTCTACAAAAAAAAGAA	0.303													4	2	---	---	---	---	
CMPK2	129607	broad.mit.edu	37	2	7001234	7001235	+	Intron	DEL	CG	-	-	rs3085147		TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:7001234_7001235delCG	uc002qyo.2	-						CMPK2_uc010yis.1_Intron|CMPK2_uc010ewv.2_Intron	NM_207315	NP_997198	Q5EBM0	CMPK2_HUMAN	UMP-CMP kinase 2 precursor						dTDP biosynthetic process	mitochondrion	ATP binding|cytidylate kinase activity|thymidylate kinase activity|UMP kinase activity				0	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					Tacacacacacgcacacacaca	0.198													3	4	---	---	---	---	
PUS10	150962	broad.mit.edu	37	2	61189740	61189741	+	Intron	INS	-	A	A	rs10195112	by1000genomes	TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:61189740_61189741insA	uc010fci.2	-						PUS10_uc002sao.2_Intron|PUS10_uc010ypk.1_Intron	NM_144709	NP_653310	Q3MIT2	PUS10_HUMAN	pseudouridylate synthase 10						pseudouridine synthesis|tRNA processing		pseudouridine synthase activity|RNA binding			ovary(2)|large_intestine(1)|kidney(1)	4			LUSC - Lung squamous cell carcinoma(5;1.56e-06)|Lung(5;2.48e-05)|Epithelial(17;0.113)			AAGTATTTTTTAAAAAAAAAAG	0.035													4	2	---	---	---	---	
PPP3R1	5534	broad.mit.edu	37	2	68444204	68444205	+	Intron	DEL	GT	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:68444204_68444205delGT	uc002sei.1	-							NM_000945	NP_000936	P63098	CANB1_HUMAN	protein phosphatase 3, regulatory subunit B,						activation of pro-apoptotic gene products|induction of apoptosis by intracellular signals	calcineurin complex|cytosol	calcium ion binding|calcium-dependent protein serine/threonine phosphatase activity|calmodulin binding				0					Pimecrolimus(DB00337)	GTAACTTTTGGTAACAAGAATA	0.297													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	69545823	69545823	+	IGR	DEL	A	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:69545823delA								ANTXR1 (69366 upstream) : GFPT1 (1082 downstream)																							AAAAAAAAACAAaaaaaacca	0.005													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	82187986	82187987	+	IGR	DEL	TG	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:82187986_82187987delTG								None (None upstream) : None (None downstream)																							GGAGTCAGCTTGTGAAAAACTA	0.292													4	2	---	---	---	---	
RMND5A	64795	broad.mit.edu	37	2	87069713	87069714	+	Intron	INS	-	T	T	rs149970450	by1000genomes	TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:87069713_87069714insT	uc002srs.3	+						CD8B_uc002srw.2_Intron|CD8B_uc002srx.2_Intron|CD8B_uc002sry.2_Intron|CD8B_uc010fgt.2_Intron|CD8B_uc002srz.2_Intron|CD8B_uc002ssa.2_Intron			Q9H871	RMD5A_HUMAN	SubName: Full=cDNA FLJ10361 fis, clone NT2RM2001256, highly similar to Anaphase-promoting complex subunit 1;											ovary(1)|skin(1)	2						atctaagagaatcacaaattta	0.020													4	6	---	---	---	---	
RMND5A	64795	broad.mit.edu	37	2	87576930	87576930	+	Intron	DEL	T	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:87576930delT	uc002srs.3	+									Q9H871	RMD5A_HUMAN	SubName: Full=cDNA FLJ10361 fis, clone NT2RM2001256, highly similar to Anaphase-promoting complex subunit 1;											ovary(1)|skin(1)	2						cggtttcgggttgagggcgct	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	89924052	89924053	+	Intron	INS	-	C	C			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:89924052_89924053insC	uc010fhm.2	+											Parts of antibodies, mostly variable regions.																		CATAACATAAACCCCCCAAGGA	0.510													20	17	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	91766729	91766730	+	IGR	INS	-	AG	AG	rs141003417		TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91766729_91766730insAG								None (None upstream) : LOC654342 (38462 downstream)																							GGAGCTGTAACACTATTTGTGA	0.317													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	96606783	96606784	+	Intron	INS	-	TAT	TAT			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:96606783_96606784insTAT	uc002sva.1	-						uc010yug.1_Intron					Homo sapiens cDNA FLJ41632 fis, clone FCBBF1000297, highly  similar to Human protein immuno-reactive with anti-PTH polyclonal antibodies mRNA.																		ttcaaaaattatattaaaGCAT	0.163													13	8	---	---	---	---	
MYO7B	4648	broad.mit.edu	37	2	128341532	128341533	+	Intron	DEL	GT	-	-	rs150669299		TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128341532_128341533delGT	uc002top.2	+							NM_001080527	NP_001073996	Q6PIF6	MYO7B_HUMAN	myosin VIIB							apical plasma membrane|myosin complex	actin binding|ATP binding|motor activity			ovary(1)|pancreas(1)	2	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0753)		AGGAGAGAGAGTGTGCAGGAAT	0.515													7	11	---	---	---	---	
MYO3B	140469	broad.mit.edu	37	2	171258313	171258313	+	Intron	DEL	T	-	-	rs146922053		TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:171258313delT	uc002ufy.2	+						MYO3B_uc002ufv.2_Intron|MYO3B_uc010fqb.1_Intron|MYO3B_uc002ufz.2_Intron|MYO3B_uc002ufw.2_Intron|MYO3B_uc002ufx.2_Intron|MYO3B_uc002ugb.2_Intron	NM_138995	NP_620482	Q8WXR4	MYO3B_HUMAN	myosin IIIB isoform 2						response to stimulus|visual perception	cytoplasm|myosin complex	actin binding|ATP binding|motor activity|protein serine/threonine kinase activity			lung(8)|ovary(6)|skin(4)|central_nervous_system(1)	19						tttctttttcttttttttttt	0.229													11	5	---	---	---	---	
TLK1	9874	broad.mit.edu	37	2	171939401	171939401	+	Intron	DEL	T	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:171939401delT	uc002ugn.2	-						TLK1_uc002ugo.2_Intron|TLK1_uc002ugp.2_Intron|TLK1_uc002ugq.2_Intron	NM_012290	NP_036422	Q9UKI8	TLK1_HUMAN	tousled-like kinase 1 isoform 1						cell cycle|chromatin modification|intracellular protein transport|intracellular signal transduction|regulation of chromatin assembly or disassembly|response to DNA damage stimulus	nucleus	ATP binding|protein binding|protein serine/threonine kinase activity			central_nervous_system(1)	1						TTAGGAGTAATTTTTTTAAAG	0.279													4	2	---	---	---	---	
OSGEPL1	64172	broad.mit.edu	37	2	190615176	190615177	+	Intron	DEL	AG	-	-	rs141100904	by1000genomes	TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:190615176_190615177delAG	uc002uqz.1	-						OSGEPL1_uc002ura.1_Intron	NM_022353	NP_071748	Q9H4B0	OSGP2_HUMAN	O-sialoglycoprotein endopeptidase-like 1						proteolysis|tRNA processing		metalloendopeptidase activity				0			OV - Ovarian serous cystadenocarcinoma(117;0.00156)|Epithelial(96;0.0293)|all cancers(119;0.0831)			AACATCAAATAGaaaaaaaaaa	0.188													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	196332846	196332846	+	IGR	DEL	T	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:196332846delT								None (None upstream) : SLC39A10 (188686 downstream)																							GTCCTTTTAGTTTCTTTTTTT	0.373													4	2	---	---	---	---	
NOP58	51602	broad.mit.edu	37	2	203162850	203162850	+	Intron	DEL	T	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:203162850delT	uc002uzb.2	+							NM_015934	NP_057018	Q9Y2X3	NOP58_HUMAN	NOP58 ribonucleoprotein homolog						cell growth|rRNA processing|snRNP protein import into nucleus	box C/D snoRNP complex|Cajal body|cytoplasm|pre-snoRNP complex	protein binding|snoRNA binding				0						tcttatgtactttttttgtgg	0.020													4	2	---	---	---	---	
ICA1L	130026	broad.mit.edu	37	2	203644494	203644495	+	Intron	INS	-	TAATC	TAATC			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:203644494_203644495insTAATC	uc002uzh.1	-						ICA1L_uc002uzi.1_Intron	NM_138468	NP_612477	Q8NDH6	ICA1L_HUMAN	islet cell autoantigen 1,69kDa-like isoform 1												0						ATAACTGACAATAATCTATCAA	0.168													9	5	---	---	---	---	
SLC16A14	151473	broad.mit.edu	37	2	230902299	230902300	+	Intron	DEL	GT	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:230902299_230902300delGT	uc002vqd.1	-						FBXO36_uc010fxi.1_Intron	NM_152527	NP_689740	Q7RTX9	MOT14_HUMAN	solute carrier family 16 (monocarboxylic acid							integral to membrane|plasma membrane	symporter activity			ovary(4)|skin(2)	6		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.149)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;7.31e-13)|all cancers(144;5.1e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00948)		TACAATGAAAGTGAAGAACATG	0.297													4	2	---	---	---	---	
COPS7B	64708	broad.mit.edu	37	2	232653144	232653144	+	Intron	DEL	C	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:232653144delC	uc002vsg.1	+						COPS7B_uc010fxy.1_Intron|COPS7B_uc002vsh.1_Intron|COPS7B_uc002vsi.1_Intron|COPS7B_uc002vsj.1_5'Flank	NM_022730	NP_073567	Q9H9Q2	CSN7B_HUMAN	COP9 constitutive photomorphogenic homolog						cullin deneddylation	cytoplasm|signalosome				ovary(1)|liver(1)|skin(1)	3		all_hematologic(139;0.0123)|Acute lymphoblastic leukemia(138;0.0182)|Renal(207;0.025)		Epithelial(121;1.36e-12)|BRCA - Breast invasive adenocarcinoma(100;0.00136)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.0142)		ctgcacttgtccTGTTTTTTC	0.169													4	2	---	---	---	---	
AGAP1	116987	broad.mit.edu	37	2	236791845	236791846	+	Intron	INS	-	G	G			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:236791845_236791846insG	uc002vvs.2	+						AGAP1_uc002vvt.2_Intron	NM_001037131	NP_001032208	Q9UPQ3	AGAP1_HUMAN	centaurin, gamma 2 isoform 1						protein transport|regulation of ARF GTPase activity|small GTPase mediated signal transduction	cytoplasm	ARF GTPase activator activity|GTP binding|zinc ion binding			ovary(2)|skin(1)	3						TGTTGAACTAATGGCATATCTT	0.371													5	3	---	---	---	---	
PER2	8864	broad.mit.edu	37	2	239186719	239186720	+	Intron	INS	-	TCTCTCTG	TCTCTCTG	rs149341285	by1000genomes	TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:239186719_239186720insTCTCTCTG	uc002vyc.2	-						PER2_uc010znv.1_Intron|PER2_uc010znw.1_Intron|PER2_uc010fyx.1_5'Flank	NM_022817	NP_073728	O15055	PER2_HUMAN	period 2						circadian rhythm|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	protein binding|signal transducer activity			upper_aerodigestive_tract(1)|breast(1)	2		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0423)|all_lung(227;0.114)|all_hematologic(139;0.158)|Melanoma(123;0.203)|Lung NSC(271;0.223)|Hepatocellular(293;0.244)		Epithelial(121;6.84e-24)|OV - Ovarian serous cystadenocarcinoma(60;9.73e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.5e-08)|BRCA - Breast invasive adenocarcinoma(100;6.77e-05)|Lung(119;0.00941)|LUSC - Lung squamous cell carcinoma(224;0.0161)		TCTTTCTTTCTTCTCTCTGTCT	0.272													19	9	---	---	---	---	
FARP2	9855	broad.mit.edu	37	2	242431162	242431164	+	Intron	DEL	GAG	-	-	rs41266963		TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242431162_242431164delGAG	uc002wbi.1	+							NM_014808	NP_055623	O94887	FARP2_HUMAN	FERM, RhoGEF and pleckstrin domain protein 2						axon guidance|neuron remodeling|Rac protein signal transduction|regulation of Rho protein signal transduction	cytoskeleton|cytosol|extrinsic to membrane	cytoskeletal protein binding|Rho guanyl-nucleotide exchange factor activity			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3		all_cancers(19;4.88e-34)|all_epithelial(40;4.81e-14)|Breast(86;0.000141)|Renal(207;0.0143)|all_lung(227;0.0344)|Lung NSC(271;0.0886)|Ovarian(221;0.0905)|Esophageal squamous(248;0.131)|all_hematologic(139;0.182)|Melanoma(123;0.238)		Epithelial(32;1.81e-33)|all cancers(36;1.61e-30)|OV - Ovarian serous cystadenocarcinoma(60;6.83e-15)|Kidney(56;1.19e-08)|KIRC - Kidney renal clear cell carcinoma(57;8.98e-08)|BRCA - Breast invasive adenocarcinoma(100;1.49e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00125)|Colorectal(34;0.0199)|COAD - Colon adenocarcinoma(134;0.121)		CTTGGCTGCTGAGGAGGGGACCT	0.596													31	23	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	45201257	45201257	+	IGR	DEL	G	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:45201257delG								CDCP1 (13343 upstream) : TMEM158 (64700 downstream)																							GAACATCATTGCAGCACCTTT	0.358													4	2	---	---	---	---	
LIMD1	8994	broad.mit.edu	37	3	45677639	45677639	+	Intron	DEL	A	-	-	rs5848762		TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:45677639delA	uc003coq.2	+							NM_014240	NP_055055	Q9UGP4	LIMD1_HUMAN	LIM domains containing 1						cytoplasmic mRNA processing body assembly|gene silencing by miRNA|multicellular organismal development|negative regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	cytoplasmic mRNA processing body|nucleus|RNA-induced silencing complex	protein binding|zinc ion binding			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.011)|KIRC - Kidney renal clear cell carcinoma(197;0.0264)|Kidney(197;0.0315)		CTTGTCCTGCAAGGAGCCTGT	0.517													38	20	---	---	---	---	
CACNA2D3	55799	broad.mit.edu	37	3	54905806	54905807	+	Intron	INS	-	TTT	TTT	rs146585375	by1000genomes	TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:54905806_54905807insTTT	uc003dhf.2	+						CACNA2D3_uc011beu.1_Intron|CACNA2D3_uc003dhg.1_Intron|CACNA2D3_uc003dhh.1_Intron|CACNA2D3_uc010hmv.1_Intron	NM_018398	NP_060868	Q8IZS8	CA2D3_HUMAN	calcium channel, voltage-dependent, alpha							integral to membrane	calcium channel activity|metal ion binding|voltage-gated ion channel activity			large_intestine(3)|ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	7				KIRC - Kidney renal clear cell carcinoma(284;0.00287)|Kidney(284;0.00327)		CATGTGTGGAGTTTTATAACTC	0.589													6	5	---	---	---	---	
CACNA2D3	55799	broad.mit.edu	37	3	54952349	54952349	+	Intron	DEL	T	-	-	rs72173538		TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:54952349delT	uc003dhf.2	+						CACNA2D3_uc003dhg.1_Intron|CACNA2D3_uc003dhh.1_Intron	NM_018398	NP_060868	Q8IZS8	CA2D3_HUMAN	calcium channel, voltage-dependent, alpha							integral to membrane	calcium channel activity|metal ion binding|voltage-gated ion channel activity			large_intestine(3)|ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	7				KIRC - Kidney renal clear cell carcinoma(284;0.00287)|Kidney(284;0.00327)		CAGACACATCttttttttttc	0.299													8	10	---	---	---	---	
ROBO2	6092	broad.mit.edu	37	3	77693838	77693838	+	Intron	DEL	T	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:77693838delT	uc003dpy.3	+						ROBO2_uc003dpz.2_Intron|ROBO2_uc011bgj.1_Intron|ROBO2_uc011bgk.1_Intron	NM_002942	NP_002933	Q9HCK4	ROBO2_HUMAN	roundabout, axon guidance receptor, homolog 2						apoptosis involved in luteolysis|axon midline choice point recognition|cellular response to hormone stimulus|homophilic cell adhesion|metanephros development|negative regulation of negative chemotaxis|negative regulation of synaptogenesis|olfactory bulb interneuron development|positive regulation of axonogenesis|retinal ganglion cell axon guidance|ureteric bud development	axolemma|cell surface|integral to membrane	axon guidance receptor activity|identical protein binding			lung(5)|skin(3)|ovary(1)|large_intestine(1)|liver(1)	11				Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)		AGCCTTTGGGTTTTTTTTCTT	0.408													4	2	---	---	---	---	
MINA	84864	broad.mit.edu	37	3	97664021	97664021	+	3'UTR	DEL	A	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:97664021delA	uc003drz.1	-	10					MINA_uc003dry.1_3'UTR|MINA_uc003dsa.1_3'UTR|MINA_uc003dsb.1_3'UTR|MINA_uc003dsc.1_3'UTR	NM_001042533	NP_001035998	Q8IUF8	MINA_HUMAN	MYC induced nuclear antigen isoform a						ribosome biogenesis	cytoplasm|nucleolus				ovary(1)	1						TTGATTCTGCAAAGGCACTAG	0.378													4	2	---	---	---	---	
PLCXD2	257068	broad.mit.edu	37	3	111413538	111413539	+	Intron	DEL	CC	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:111413538_111413539delCC	uc003dya.2	+						PLCXD2_uc003dyb.2_Intron|PLCXD2_uc003dxz.2_Intron	NM_001134478	NP_001127950	Q0VAA5	PLCX2_HUMAN	phosphatidylinositol-specific phospholipase C, X						intracellular signal transduction|lipid catabolic process		phospholipase C activity|signal transducer activity			skin(1)	1						GGAAGATGTTCCACAGGGAAGT	0.579													4	2	---	---	---	---	
NAA50	80218	broad.mit.edu	37	3	113441706	113441707	+	Intron	DEL	GC	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113441706_113441707delGC	uc003ean.1	-						NAA50_uc010hqm.1_Intron|NAA50_uc011bij.1_Intron	NM_025146	NP_079422	Q9GZZ1	NAA50_HUMAN	N-acetyltransferase 13						N-terminal protein amino acid acetylation	cytoplasm	N-acetyltransferase activity|protein binding				0						GATTTCTCCTGCCAATTAAACC	0.302													4	2	---	---	---	---	
SLC9A9	285195	broad.mit.edu	37	3	143108504	143108504	+	Intron	DEL	A	-	-	rs114977970	by1000genomes	TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:143108504delA	uc003evn.2	-							NM_173653	NP_775924	Q8IVB4	SL9A9_HUMAN	solute carrier family 9 (sodium/hydrogen						regulation of pH	integral to membrane|late endosome membrane|recycling endosome	sodium:hydrogen antiporter activity			ovary(2)|skin(1)	3						TCAACTCAAGAAAAATAGCAA	0.383													4	2	---	---	---	---	
CPA3	1359	broad.mit.edu	37	3	148596214	148596214	+	Intron	DEL	C	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:148596214delC	uc003ewm.2	+							NM_001870	NP_001861	P15088	CBPA3_HUMAN	carboxypeptidase A3 precursor						proteolysis	stored secretory granule|transport vesicle	metallocarboxypeptidase activity|zinc ion binding			breast(1)|skin(1)	2			LUSC - Lung squamous cell carcinoma(72;0.0934)|Lung(72;0.115)			TTTTATCATTCCCCTGTCAAA	0.338													4	2	---	---	---	---	
AADAC	13	broad.mit.edu	37	3	151537919	151537920	+	Intron	INS	-	AAAGGCAA	AAAGGCAA	rs138562455	by1000genomes	TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:151537919_151537920insAAAGGCAA	uc003eze.2	+							NM_001086	NP_001077	P22760	AAAD_HUMAN	arylacetamide deacetylase						positive regulation of triglyceride catabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	carboxylesterase activity|deacetylase activity|serine hydrolase activity|triglyceride lipase activity			skin(2)	2		Myeloproliferative disorder(1037;0.0255)|all_neural(597;0.112)	LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0813)			ACAGAAGGATCAATGGCAAAAT	0.401													3	3	---	---	---	---	
USP13	8975	broad.mit.edu	37	3	179438162	179438162	+	Intron	DEL	A	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:179438162delA	uc003fkh.2	+						USP13_uc003fkf.2_Intron	NM_003940	NP_003931	Q92995	UBP13_HUMAN	ubiquitin thiolesterase 13						ubiquitin-dependent protein catabolic process		cysteine-type endopeptidase activity|omega peptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity|zinc ion binding			ovary(1)	1	all_cancers(143;7.79e-15)|Ovarian(172;0.0338)|Breast(254;0.148)		OV - Ovarian serous cystadenocarcinoma(80;1e-25)|GBM - Glioblastoma multiforme(14;0.0169)			GATGACCTTTAAAATTATCTG	0.398													4	2	---	---	---	---	
OPA1	4976	broad.mit.edu	37	3	193360459	193360460	+	Intron	DEL	GC	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:193360459_193360460delGC	uc003ftm.2	+						OPA1_uc003ftg.2_Intron|OPA1_uc003fth.2_Intron|OPA1_uc003fti.2_Intron|OPA1_uc003ftj.2_Intron|OPA1_uc003ftk.2_Intron|OPA1_uc003ftl.2_Intron|OPA1_uc003ftn.2_Intron	NM_015560	NP_056375	O60313	OPA1_HUMAN	optic atrophy 1 isoform 1						apoptosis|axon transport of mitochondrion|inner mitochondrial membrane organization|mitochondrial fission|mitochondrial fusion|positive regulation of anti-apoptosis|response to stimulus|visual perception	dendrite|integral to membrane|mitochondrial crista|mitochondrial intermembrane space|mitochondrial outer membrane	GTP binding|GTPase activity|magnesium ion binding|protein binding				0	all_cancers(143;9.56e-09)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;9.19e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;0.000162)		TTGGATTTGTGCAATGCAGTAG	0.411													4	2	---	---	---	---	
ACAP2	23527	broad.mit.edu	37	3	195029738	195029739	+	Intron	INS	-	AAAGT	AAAGT	rs10636354		TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195029738_195029739insAAAGT	uc003fun.3	-							NM_012287	NP_036419	Q15057	ACAP2_HUMAN	centaurin, beta 2						regulation of ARF GTPase activity		ARF GTPase activator activity|zinc ion binding			large_intestine(1)|ovary(1)	2						GAAAACTACTGAAAGAACAAAC	0.282													6	5	---	---	---	---	
HTT	3064	broad.mit.edu	37	4	3176133	3176133	+	Intron	DEL	C	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3176133delC	uc011bvq.1	+							NM_002111	NP_002102	P42858	HD_HUMAN	huntingtin						establishment of mitotic spindle orientation|Golgi organization|retrograde vesicle-mediated transport, Golgi to ER|vesicle transport along microtubule	autophagic vacuole|axon|cytoplasmic vesicle membrane|cytosol|dendrite|endoplasmic reticulum|Golgi apparatus|late endosome|membrane fraction|nucleus|protein complex	beta-tubulin binding|dynactin binding|dynein intermediate chain binding|p53 binding|transcription factor binding			skin(2)|ovary(1)|lung(1)	4		all_epithelial(65;0.18)		UCEC - Uterine corpus endometrioid carcinoma (64;0.187)		AAATGACCTTCACCTTTCTCT	0.363													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	9273621	9273622	+	IGR	DEL	AC	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:9273621_9273622delAC								LOC650293 (321495 upstream) : USP17 (86487 downstream)																							CCCAGcacaaacacacacacac	0.233													4	2	---	---	---	---	
PROM1	8842	broad.mit.edu	37	4	15987514	15987515	+	Intron	INS	-	GT	GT	rs55689632		TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:15987514_15987515insGT	uc003goo.2	-						PROM1_uc003gor.2_Intron|PROM1_uc003gos.2_Intron|PROM1_uc003got.2_Intron|PROM1_uc003gou.2_Intron|PROM1_uc003gop.2_Intron|PROM1_uc003goq.3_Intron	NM_006017	NP_006008	O43490	PROM1_HUMAN	prominin 1 isoform 1						camera-type eye photoreceptor cell differentiation|photoreceptor cell maintenance|retina layer formation	apical plasma membrane|cell surface|integral to plasma membrane|microvillus membrane|photoreceptor outer segment membrane|plasma membrane	beta-actinin binding|cadherin binding			ovary(3)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)|central_nervous_system(1)	7						AAACATTATAAATATTTAATCT	0.312													15	8	---	---	---	---	
PROM1	8842	broad.mit.edu	37	4	15987515	15987516	+	Intron	INS	-	TGCT	TGCT	rs55689632		TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:15987515_15987516insTGCT	uc003goo.2	-						PROM1_uc003gor.2_Intron|PROM1_uc003gos.2_Intron|PROM1_uc003got.2_Intron|PROM1_uc003gou.2_Intron|PROM1_uc003gop.2_Intron|PROM1_uc003goq.3_Intron	NM_006017	NP_006008	O43490	PROM1_HUMAN	prominin 1 isoform 1						camera-type eye photoreceptor cell differentiation|photoreceptor cell maintenance|retina layer formation	apical plasma membrane|cell surface|integral to plasma membrane|microvillus membrane|photoreceptor outer segment membrane|plasma membrane	beta-actinin binding|cadherin binding			ovary(3)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)|central_nervous_system(1)	7						AACATTATAAATATTTAATCTG	0.317													14	8	---	---	---	---	
QDPR	5860	broad.mit.edu	37	4	17513499	17513499	+	Intron	DEL	C	-	-	rs112530867		TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:17513499delC	uc003gpd.2	-						QDPR_uc003gpe.2_Intron|QDPR_uc003gpf.2_Intron	NM_000320	NP_000311	P09417	DHPR_HUMAN	quinoid dihydropteridine reductase						dihydrobiopterin metabolic process|L-phenylalanine catabolic process|tetrahydrobiopterin biosynthetic process	cytosol	6,7-dihydropteridine reductase activity|binding|electron carrier activity			ovary(1)	1					NADH(DB00157)	CTCTAGACTGCCCCCCGCCGG	0.677													15	11	---	---	---	---	
N4BP2	55728	broad.mit.edu	37	4	40121716	40121716	+	Frame_Shift_Del	DEL	G	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:40121716delG	uc003guy.3	+	9	2323	c.1985delG	c.(1984-1986)AGAfs	p.R662fs	N4BP2_uc010ifq.2_Frame_Shift_Del_p.R582fs|N4BP2_uc010ifr.2_Frame_Shift_Del_p.R582fs	NM_018177	NP_060647	Q86UW6	N4BP2_HUMAN	Nedd4 binding protein 2	662						cytoplasm	ATP binding|ATP-dependent polydeoxyribonucleotide 5'-hydroxyl-kinase activity|endonuclease activity|protein binding			lung(3)|breast(2)|kidney(2)|ovary(1)	8						AACAAAAGAAGAAAAGAAATA	0.338													4	2	---	---	---	---	
SHISA3	152573	broad.mit.edu	37	4	42402749	42402749	+	Intron	DEL	T	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:42402749delT	uc003gwp.2	+							NM_001080505	NP_001073974	A0PJX4	SHSA3_HUMAN	shisa homolog 3 precursor						multicellular organismal development	endoplasmic reticulum membrane|integral to membrane				ovary(1)|skin(1)	2						ACAGATTCCGTTTTTTTTTTC	0.403													5	5	---	---	---	---	
ANTXR2	118429	broad.mit.edu	37	4	80993003	80993003	+	Intron	DEL	A	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:80993003delA	uc003hlz.3	-						ANTXR2_uc003hly.3_Intron|ANTXR2_uc003hlx.1_5'Flank|ANTXR2_uc010ijn.2_Intron	NM_001145794	NP_001139266	P58335	ANTR2_HUMAN	anthrax toxin receptor 2 isoform 2							endoplasmic reticulum membrane|extracellular region|integral to membrane|plasma membrane	metal ion binding|protein binding|receptor activity			ovary(1)	1						AGACTCCGTCAAAAAAAAAAA	0.443									Juvenile_Hyaline_Fibromatosis				8	4	---	---	---	---	
QRFPR	84109	broad.mit.edu	37	4	122301334	122301334	+	Intron	DEL	C	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:122301334delC	uc010inj.1	-						QRFPR_uc010ink.1_Intron|QRFPR_uc003ids.2_Intron|QRFPR_uc010inl.1_Intron	NM_198179	NP_937822	Q96P65	QRFPR_HUMAN	G protein-coupled receptor 103							plasma membrane	neuropeptide Y receptor activity				0						gacagacagacgagagaggag	0.244													9	4	---	---	---	---	
QRFPR	84109	broad.mit.edu	37	4	122301341	122301341	+	Intron	DEL	G	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:122301341delG	uc010inj.1	-						QRFPR_uc010ink.1_Intron|QRFPR_uc003ids.2_Intron|QRFPR_uc010inl.1_Intron	NM_198179	NP_937822	Q96P65	QRFPR_HUMAN	G protein-coupled receptor 103							plasma membrane	neuropeptide Y receptor activity				0						agacgagagaggagagagaga	0.249													12	6	---	---	---	---	
KIAA1109	84162	broad.mit.edu	37	4	123150068	123150069	+	Intron	DEL	TA	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:123150068_123150069delTA	uc003ieh.2	+						KIAA1109_uc003iei.1_Intron|KIAA1109_uc010ins.1_Intron	NM_015312	NP_056127	Q2LD37	K1109_HUMAN	fragile site-associated protein						regulation of cell growth|regulation of epithelial cell differentiation	integral to membrane|nucleus				ovary(8)|skin(2)|pancreas(1)|central_nervous_system(1)	12						GGTGCATGCTTACTTATTGTTT	0.277													4	2	---	---	---	---	
TRIM2	23321	broad.mit.edu	37	4	154243998	154243998	+	Intron	DEL	T	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:154243998delT	uc003ing.2	+						TRIM2_uc003inh.2_Intron	NM_001130067	NP_001123539	Q9C040	TRIM2_HUMAN	tripartite motif-containing 2 isoform 2							cytoplasm	zinc ion binding			central_nervous_system(1)	1	all_hematologic(180;0.093)	Medulloblastoma(177;0.00225)		GBM - Glioblastoma multiforme(119;0.0102)|LUSC - Lung squamous cell carcinoma(193;0.0703)		GTAAACCCCCTTTTTTATGCT	0.468													4	2	---	---	---	---	
FNIP2	57600	broad.mit.edu	37	4	159791267	159791268	+	Intron	INS	-	T	T			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:159791267_159791268insT	uc003iqe.3	+							NM_020840	NP_065891	Q9P278	FNIP2_HUMAN	folliculin interacting protein 2						DNA damage response, signal transduction resulting in induction of apoptosis|protein phosphorylation|regulation of protein phosphorylation	cytoplasm	protein binding				0	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.00936)		GCCATGGATAGTTTTTTTTTCT	0.411													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	184812837	184812837	+	IGR	DEL	A	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:184812837delA								C4orf41 (178093 upstream) : STOX2 (13672 downstream)																							cagatgcaccaaaatctcaca	0.030													4	2	---	---	---	---	
ZFR	51663	broad.mit.edu	37	5	32355672	32355672	+	3'UTR	DEL	T	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:32355672delT	uc003jhr.1	-	20					ZFR_uc010ium.1_3'UTR|ZFR_uc011cny.1_RNA	NM_016107	NP_057191	Q96KR1	ZFR_HUMAN	zinc finger RNA binding protein						multicellular organismal development	chromosome|cytoplasm|nucleus	DNA binding|RNA binding|zinc ion binding				0				STAD - Stomach adenocarcinoma(35;0.19)		TCGGAGCACATTTTTTTTTTT	0.328													3	3	---	---	---	---	
SKIV2L2	23517	broad.mit.edu	37	5	54603687	54603687	+	5'UTR	DEL	A	-	-	rs77094835		TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:54603687delA	uc003jpy.3	+	1					SKIV2L2_uc011cqi.1_5'UTR|DHX29_uc003jpx.2_5'Flank|DHX29_uc010ivw.2_5'Flank	NM_015360	NP_056175	P42285	SK2L2_HUMAN	superkiller viralicidic activity 2-like 2						maturation of 5.8S rRNA	catalytic step 2 spliceosome|nucleolus	ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding			ovary(1)|skin(1)	2		Lung NSC(810;0.000744)|Breast(144;0.181)|Prostate(74;0.194)				gaaaagcaggaaaaaaaaaaa	0.473													16	14	---	---	---	---	
ATG10	83734	broad.mit.edu	37	5	81314394	81314394	+	Intron	DEL	T	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:81314394delT	uc003khs.2	+						ATG10_uc003khq.2_Intron|ATG10_uc003khr.2_Intron|ATG10_uc010jas.2_Intron	NM_001131028	NP_001124500	Q9H0Y0	ATG10_HUMAN	APG10 autophagy 10-like						autophagy in response to ER overload|positive regulation of protein modification process|protein lipidation|protein modification by small protein conjugation|protein transport	cytoplasm	Atg12 ligase activity|protein binding				0		Lung NSC(167;0.0258)|all_lung(232;0.0294)|Ovarian(174;0.135)		OV - Ovarian serous cystadenocarcinoma(54;9.94e-41)|Epithelial(54;6.3e-36)|all cancers(79;2.31e-30)		tcacctcctatttttctttct	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	95966655	95966655	+	IGR	DEL	A	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:95966655delA								PCSK1 (197703 upstream) : CAST (31122 downstream)																							aaatttttttaaataatCTCT	0.249													4	2	---	---	---	---	
WWC1	23286	broad.mit.edu	37	5	167848817	167848818	+	Intron	DEL	AT	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:167848817_167848818delAT	uc003lzu.2	+						WWC1_uc003lzv.2_Intron|WWC1_uc011den.1_Intron|WWC1_uc003lzw.2_Intron	NM_015238	NP_056053	Q8IX03	KIBRA_HUMAN	WW and C2 domain containing 1 isoform 3						cell migration|positive regulation of MAPKKK cascade|regulation of hippo signaling cascade|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus|perinuclear region of cytoplasm|ruffle membrane	protein binding|transcription coactivator activity			ovary(2)|skin(2)|breast(1)	5	Renal(175;0.000212)|Lung NSC(126;0.0875)|all_lung(126;0.166)	Medulloblastoma(196;0.0399)|all_neural(177;0.0577)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0364)|Epithelial(171;0.0765)|OV - Ovarian serous cystadenocarcinoma(192;0.0918)		agagtgcctgatatataTATAT	0.188													4	2	---	---	---	---	
RNF130	55819	broad.mit.edu	37	5	179400216	179400216	+	Intron	DEL	C	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179400216delC	uc003mll.1	-						RNF130_uc003mlm.1_Intron	NM_018434	NP_060904	Q86XS8	GOLI_HUMAN	ring finger protein 130 precursor						apoptosis	cytoplasm|integral to membrane|nucleus	ubiquitin-protein ligase activity|zinc ion binding			lung(2)|ovary(1)	3	all_cancers(89;5.49e-05)|all_epithelial(37;1.94e-05)|Renal(175;0.000159)|Lung NSC(126;0.00118)|all_lung(126;0.00212)	all_cancers(40;0.0294)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GTCTCAAATTCCCATGGCACA	0.552													4	2	---	---	---	---	
RNF130	55819	broad.mit.edu	37	5	179442607	179442607	+	Intron	DEL	G	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179442607delG	uc003mll.1	-						RNF130_uc003mlm.1_Intron|MIR340_hsa-mir-340|MI0000802_5'Flank|uc003mln.2_5'Flank	NM_018434	NP_060904	Q86XS8	GOLI_HUMAN	ring finger protein 130 precursor						apoptosis	cytoplasm|integral to membrane|nucleus	ubiquitin-protein ligase activity|zinc ion binding			lung(2)|ovary(1)	3	all_cancers(89;5.49e-05)|all_epithelial(37;1.94e-05)|Renal(175;0.000159)|Lung NSC(126;0.00118)|all_lung(126;0.00212)	all_cancers(40;0.0294)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			gaaaggagtagggaaaggagt	0.000													4	2	---	---	---	---	
FAM8A1	51439	broad.mit.edu	37	6	17602638	17602638	+	Intron	DEL	G	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:17602638delG	uc003ncc.2	+							NM_016255	NP_057339	Q9UBU6	FA8A1_HUMAN	family with sequence similarity 8, member A1							integral to membrane					0	Breast(50;0.0259)|Ovarian(93;0.0584)	all_hematologic(90;0.143)	all cancers(50;0.176)|Epithelial(50;0.204)			TGGATTCTCTGTTACTCTATT	0.254													12	8	---	---	---	---	
BTN2A3	54718	broad.mit.edu	37	6	26422627	26422628	+	Intron	INS	-	A	A	rs147936124	by1000genomes	TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26422627_26422628insA	uc011dkl.1	+						BTN2A3_uc011dkm.1_Intron					RecName: Full=Butyrophilin subfamily 2 member A3; Flags: Precursor;												0						gcaaattttccaaaaaaattaa	0.054													9	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	33307400	33307401	+	IGR	INS	-	G	G	rs116146176	byFrequency	TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33307400_33307401insG								DAXX (16607 upstream) : LYPLA2P1 (25114 downstream)																							TTTTTTTTTTTATGTATTTATT	0.347													4	2	---	---	---	---	
CYP39A1	51302	broad.mit.edu	37	6	46593292	46593292	+	Intron	DEL	G	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:46593292delG	uc003oyf.1	-						CYP39A1_uc011dwa.1_Intron|CYP39A1_uc010jzd.1_Intron	NM_016593	NP_057677	Q9NYL5	CP39A_HUMAN	cytochrome P450, family 39, subfamily A,						bile acid biosynthetic process|bile acid catabolic process|digestion|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	24-hydroxycholesterol 7alpha-hydroxylase activity|electron carrier activity|heme binding|oxysterol 7-alpha-hydroxylase activity			ovary(1)	1						CTTTGAAGGTGAACAAAAGCA	0.294													4	2	---	---	---	---	
ASCC3	10973	broad.mit.edu	37	6	100966004	100966005	+	Frame_Shift_Del	DEL	CA	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:100966004_100966005delCA	uc003pqk.2	-	38	6118_6119	c.5789_5790delTG	c.(5788-5790)GTGfs	p.V1930fs		NM_006828	NP_006819	Q8N3C0	HELC1_HUMAN	activating signal cointegrator 1 complex subunit	1930	SEC63 2.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|microtubule cytoskeleton	ATP binding|ATP-dependent helicase activity|nucleic acid binding			ovary(5)|skin(1)	6		all_cancers(76;1.45e-07)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(87;0.00149)|Hepatocellular(1;0.0893)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0539)|all cancers(137;0.103)|GBM - Glioblastoma multiforme(226;0.199)		GGTTTGCAGCCACGTCCAGCAT	0.465													4	2	---	---	---	---	
ADAP1	11033	broad.mit.edu	37	7	944936	944937	+	Intron	DEL	AG	-	-	rs56919223	by1000genomes	TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:944936_944937delAG	uc003sjo.3	-						ADAP1_uc003sjm.3_5'Flank|ADAP1_uc011jvs.1_Intron|ADAP1_uc003sjn.3_Intron|ADAP1_uc010ksc.2_Intron	NM_006869	NP_006860	O75689	ADAP1_HUMAN	centaurin, alpha 1						cell surface receptor linked signaling pathway|regulation of ARF GTPase activity	cytoplasm|nucleus|plasma membrane	ARF GTPase activator activity|inositol 1,3,4,5 tetrakisphosphate binding|protein binding|zinc ion binding			upper_aerodigestive_tract(1)	1						GGACACGGACAGGGGGAGACGG	0.490													13	7	---	---	---	---	
ADAP1	11033	broad.mit.edu	37	7	944947	944948	+	Intron	INS	-	GAC	GAC	rs10261233	by1000genomes	TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:944947_944948insGAC	uc003sjo.3	-						ADAP1_uc003sjm.3_5'Flank|ADAP1_uc011jvs.1_Intron|ADAP1_uc003sjn.3_Intron|ADAP1_uc010ksc.2_Intron	NM_006869	NP_006860	O75689	ADAP1_HUMAN	centaurin, alpha 1						cell surface receptor linked signaling pathway|regulation of ARF GTPase activity	cytoplasm|nucleus|plasma membrane	ARF GTPase activator activity|inositol 1,3,4,5 tetrakisphosphate binding|protein binding|zinc ion binding			upper_aerodigestive_tract(1)	1						GGGGGAGACGGACGGGGAGAGG	0.460													12	6	---	---	---	---	
ADAP1	11033	broad.mit.edu	37	7	944951	944952	+	Intron	INS	-	GT	GT			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:944951_944952insGT	uc003sjo.3	-						ADAP1_uc003sjm.3_5'Flank|ADAP1_uc011jvs.1_Intron|ADAP1_uc003sjn.3_Intron|ADAP1_uc010ksc.2_Intron	NM_006869	NP_006860	O75689	ADAP1_HUMAN	centaurin, alpha 1						cell surface receptor linked signaling pathway|regulation of ARF GTPase activity	cytoplasm|nucleus|plasma membrane	ARF GTPase activator activity|inositol 1,3,4,5 tetrakisphosphate binding|protein binding|zinc ion binding			upper_aerodigestive_tract(1)	1						GAGACGGACGGGGAGAGGGGAC	0.446													12	6	---	---	---	---	
EIF3B	8662	broad.mit.edu	37	7	2403895	2403895	+	Intron	DEL	A	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2403895delA	uc003slx.2	+						EIF3B_uc003sly.2_Intron|EIF3B_uc003slz.1_Intron|EIF3B_uc003sma.2_Intron	NM_003751	NP_003742	P55884	EIF3B_HUMAN	eukaryotic translation initiation factor 3,						regulation of translational initiation	cytosol|eukaryotic translation initiation factor 3 complex	nucleotide binding|protein complex scaffold|translation initiation factor activity				0		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0833)|OV - Ovarian serous cystadenocarcinoma(56;7.76e-14)		actccgtctcaaaaaaaaaaa	0.169													21	13	---	---	---	---	
VWDE	221806	broad.mit.edu	37	7	12414410	12414410	+	Intron	DEL	G	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:12414410delG	uc003ssj.2	-						VWDE_uc011jxl.1_Intron|VWDE_uc011jxm.1_Intron	NM_001135924	NP_001129396	Q8N2E2	VWDE_HUMAN	von Willebrand factor D and EGF domains							extracellular region					0						AGATATTTTTGGTAAATATTA	0.254													4	2	---	---	---	---	
BZW2	28969	broad.mit.edu	37	7	16729334	16729335	+	Intron	INS	-	T	T			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:16729334_16729335insT	uc003stl.2	+						BZW2_uc011jxx.1_Intron|BZW2_uc003stm.2_Intron|BZW2_uc003stj.2_Intron|BZW2_uc003stk.2_Intron|BZW2_uc003sto.1_Intron|BZW2_uc003stp.2_Intron|BZW2_uc010kua.2_Intron	NM_001159767	NP_001153239	Q9Y6E2	BZW2_HUMAN	basic leucine zipper and W2 domains 2						cell differentiation|nervous system development|RNA metabolic process		protein binding			ovary(2)	2	Lung NSC(10;0.0367)|all_lung(11;0.0837)			UCEC - Uterine corpus endometrioid carcinoma (126;0.199)		TAGTTATTTACACATTTCAGGA	0.356													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	57659819	57659819	+	IGR	DEL	C	-	-	rs112809527		TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57659819delC								ZNF716 (126554 upstream) : None (None downstream)																							CTTGTCTTTGCTTTTGATGAT	0.338													4	3	---	---	---	---	
WBSCR22	114049	broad.mit.edu	37	7	73111776	73111776	+	Intron	DEL	A	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:73111776delA	uc003tyt.2	+						WBSCR22_uc003tyu.2_Intron|WBSCR22_uc003tyv.2_Intron|WBSCR22_uc003tyw.1_Intron	NM_017528	NP_059998	O43709	WBS22_HUMAN	Williams Beuren syndrome chromosome region 22							nucleus	methyltransferase activity				0		Lung NSC(55;0.0908)|all_lung(88;0.198)				GGGTGTCCAGAGCGGGGAATT	0.582													10	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	74016919	74016919	+	IGR	DEL	A	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:74016919delA								GTF2IRD1 (1 upstream) : GTF2I (55111 downstream)																							GTAAAAAAAGAAAAAAAAAAA	0.373													11	5	---	---	---	---	
SEMA3A	10371	broad.mit.edu	37	7	83690005	83690005	+	Intron	DEL	T	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:83690005delT	uc003uhz.2	-							NM_006080	NP_006071	Q14563	SEM3A_HUMAN	semaphorin 3A precursor						axon guidance	extracellular region|membrane	receptor activity			ovary(2)|breast(1)|kidney(1)	4						TTTGTTCAAATTTTTGAGATG	0.284													4	2	---	---	---	---	
PTCD1	26024	broad.mit.edu	37	7	99040299	99040299	+	Intron	DEL	C	-	-	rs60524957		TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99040299delC	uc011kiw.1	-						CPSF4_uc003uqi.2_Intron|CPSF4_uc003uqj.2_Intron|CPSF4_uc003uqk.2_Intron|CPSF4_uc011kix.1_Intron	NM_015545	NP_056360	O75127	PTCD1_HUMAN	pentatricopeptide repeat domain 1											ovary(1)	1	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)		STAD - Stomach adenocarcinoma(171;0.215)			aaaaaaaaaacaaaaaacaaG	0.179													4	2	---	---	---	---	
NRCAM	4897	broad.mit.edu	37	7	107878094	107878095	+	Intron	DEL	CA	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:107878094_107878095delCA	uc003vfb.2	-						NRCAM_uc003vfc.2_Intron|NRCAM_uc011kmk.1_Intron|NRCAM_uc003vfd.2_Intron|NRCAM_uc003vfe.2_Intron	NM_001037132	NP_001032209	Q92823	NRCAM_HUMAN	neuronal cell adhesion molecule isoform A						angiogenesis|axon guidance|axonal fasciculation|cell-cell adhesion|central nervous system development|clustering of voltage-gated sodium channels|neuron migration|positive regulation of neuron differentiation|regulation of axon extension|synapse assembly	external side of plasma membrane|integral to plasma membrane	ankyrin binding			ovary(3)|breast(2)	5						AGACAAAGGTCACAAAACATGA	0.312													4	2	---	---	---	---	
ZNF800	168850	broad.mit.edu	37	7	127014450	127014450	+	Frame_Shift_Del	DEL	T	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:127014450delT	uc003vlx.1	-	5	1203	c.940delA	c.(940-942)AGGfs	p.R314fs	ZNF800_uc003vlw.1_Frame_Shift_Del_p.R217fs|ZNF800_uc003vly.1_Frame_Shift_Del_p.R314fs|ZNF800_uc010lla.2_Frame_Shift_Del_p.R314fs	NM_176814	NP_789784	Q2TB10	ZN800_HUMAN	zinc finger protein 800	314					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						GAATCCCTCCTTAGTCCTCTA	0.363													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	131719876	131719876	+	IGR	DEL	A	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:131719876delA								PODXL (478500 upstream) : PLXNA4 (88216 downstream)																							TTGGAAAGGGAAGCAGAGGAA	0.517													4	2	---	---	---	---	
SVOPL	136306	broad.mit.edu	37	7	138356664	138356665	+	Intron	INS	-	A	A	rs77651439		TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:138356664_138356665insA	uc011kqh.1	-							NM_001139456	NP_001132928	Q8N434	SVOPL_HUMAN	SVOP-like isoform 1							integral to membrane	transmembrane transporter activity				0						CCAACAGTGGCAGTGGTGAGAC	0.515													5	4	---	---	---	---	
LOC100124692	100124692	broad.mit.edu	37	7	141895981	141895982	+	RNA	INS	-	G	G			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:141895981_141895982insG	uc003vxa.2	+	11		c.1294_1295insG				NR_003717				Homo sapiens cDNA FLJ16351 fis, clone TESTI2039060, moderately similar to Maltase-glucoamylase, intestinal.												0						CAGGACAGCGAGGGGTCATCAT	0.535													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	142013595	142013596	+	Intron	INS	-	G	G	rs138947755	by1000genomes	TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142013595_142013596insG	uc011kro.1	+						uc011krp.1_Intron					SubName: Full=V_segment translation product; Flags: Fragment;																		CCAAGAGCCCCGAAGAAGCTTC	0.530													10	7	---	---	---	---	
SSPO	23145	broad.mit.edu	37	7	149478294	149478294	+	Intron	DEL	C	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:149478294delC	uc010lpk.2	+						SSPO_uc010lpl.1_Intron	NM_198455	NP_940857	A2VEC9	SSPO_HUMAN	SCO-spondin precursor						cell adhesion	extracellular space	peptidase inhibitor activity				0	Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			TCCTGTCTCTCACAGATGGGA	0.532													5	3	---	---	---	---	
RBM33	155435	broad.mit.edu	37	7	155473566	155473567	+	Frame_Shift_Del	DEL	AG	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:155473566_155473567delAG	uc010lqk.1	+	5	899_900	c.531_532delAG	c.(529-534)TTAGACfs	p.L177fs	RBM33_uc003wme.2_Frame_Shift_Del_p.L177fs	NM_053043	NP_444271	Q96EV2	RBM33_HUMAN	RNA binding motif protein 33	177_178	Glu-rich.						nucleotide binding|RNA binding			ovary(1)	1	all_neural(206;0.101)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.011)	UCEC - Uterine corpus endometrioid carcinoma (81;0.2)		ATGAAGTGTTAGACATCGAGAT	0.431													4	2	---	---	---	---	
RNF32	140545	broad.mit.edu	37	7	156436282	156436282	+	Intron	DEL	G	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:156436282delG	uc003wmo.2	+						C7orf13_uc003wmm.2_5'Flank|RNF32_uc010lql.1_Intron|RNF32_uc010lqm.2_Intron|RNF32_uc003wmp.2_Intron|RNF32_uc003wmq.2_Intron|RNF32_uc003wmr.2_Intron|RNF32_uc003wms.2_5'Flank|RNF32_uc003wmu.2_5'Flank|RNF32_uc003wmt.2_5'Flank	NM_030936	NP_112198	Q9H0A6	RNF32_HUMAN	ring finger protein 32							aggresome|endosome	protein binding|zinc ion binding				0	Ovarian(565;0.218)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.00291)	UCEC - Uterine corpus endometrioid carcinoma (81;0.169)		CAGGAGCTCAGGGGTGAACTA	0.403													4	2	---	---	---	---	
DEFB104A	140596	broad.mit.edu	37	8	7694282	7694283	+	Intron	INS	-	A	A			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:7694282_7694283insA	uc003wrv.2	+							NM_080389	NP_525128	Q8WTQ1	D104A_HUMAN	defensin, beta 104A precursor						defense response to bacterium	extracellular region					0				COAD - Colon adenocarcinoma(149;0.0162)|READ - Rectum adenocarcinoma(644;0.236)		GCTCAAGGAGGAAAAAAGAAAC	0.470													4	2	---	---	---	---	
MSRA	4482	broad.mit.edu	37	8	10285487	10285487	+	Intron	DEL	C	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:10285487delC	uc003wsx.2	+						MSRA_uc011kwx.1_Intron|MSRA_uc003wsz.2_Intron|MSRA_uc003wsy.2_Intron	NM_012331	NP_036463	Q9UJ68	MSRA_HUMAN	methionine sulfoxide reductase A isoform a						methionine metabolic process|protein modification process|response to oxidative stress	mitochondrion|nucleus	peptide-methionine-(S)-S-oxide reductase activity				0		Myeloproliferative disorder(644;0.178)			L-Methionine(DB00134)	CAAGGTAAGTCCCTGCCCAGC	0.557													4	2	---	---	---	---	
ADAM28	10863	broad.mit.edu	37	8	24157838	24157838	+	Intron	DEL	C	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:24157838delC	uc003xdy.2	+						ADAM28_uc003xdx.2_Intron|ADAM28_uc011kzz.1_Intron|ADAM28_uc011laa.1_Intron	NM_014265	NP_055080	Q9UKQ2	ADA28_HUMAN	ADAM metallopeptidase domain 28 isoform 1						proteolysis|spermatogenesis	extracellular region|integral to membrane|plasma membrane	metalloendopeptidase activity|zinc ion binding			skin(3)|lung(1)|central_nervous_system(1)	5		Prostate(55;0.0959)		Colorectal(74;0.0129)|COAD - Colon adenocarcinoma(73;0.0434)|BRCA - Breast invasive adenocarcinoma(99;0.175)		ttcactataacccaaagttat	0.109													4	2	---	---	---	---	
RAB11FIP1	80223	broad.mit.edu	37	8	37720766	37720767	+	Intron	INS	-	A	A			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:37720766_37720767insA	uc003xkm.1	-						RAB11FIP1_uc010lvz.1_Intron|RAB11FIP1_uc003xkn.1_Intron|RAB11FIP1_uc003xkl.1_Intron	NM_001002814	NP_001002814	Q6WKZ4	RFIP1_HUMAN	RAB11 family interacting protein 1 isoform 3						protein transport	centrosome|phagocytic vesicle membrane|recycling endosome	protein binding			ovary(1)|central_nervous_system(1)|skin(1)	3		Lung NSC(58;0.118)|all_lung(54;0.195)	LUSC - Lung squamous cell carcinoma(8;3.62e-11)			ctttctttctttctttctttct	0.153													4	2	---	---	---	---	
RAB11FIP1	80223	broad.mit.edu	37	8	37720768	37720769	+	Intron	INS	-	G	G	rs72317182		TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:37720768_37720769insG	uc003xkm.1	-						RAB11FIP1_uc010lvz.1_Intron|RAB11FIP1_uc003xkn.1_Intron|RAB11FIP1_uc003xkl.1_Intron	NM_001002814	NP_001002814	Q6WKZ4	RFIP1_HUMAN	RAB11 family interacting protein 1 isoform 3						protein transport	centrosome|phagocytic vesicle membrane|recycling endosome	protein binding			ovary(1)|central_nervous_system(1)|skin(1)	3		Lung NSC(58;0.118)|all_lung(54;0.195)	LUSC - Lung squamous cell carcinoma(8;3.62e-11)			ttctttctttctttctttcttt	0.153													4	2	---	---	---	---	
WHSC1L1	54904	broad.mit.edu	37	8	38176311	38176311	+	Intron	DEL	C	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38176311delC	uc003xli.2	-						WHSC1L1_uc011lbm.1_Intron|WHSC1L1_uc010lwe.2_Intron|WHSC1L1_uc003xlj.2_Intron	NM_023034	NP_075447	Q9BZ95	NSD3_HUMAN	WHSC1L1 protein isoform long						cell differentiation|cell growth|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome	histone-lysine N-methyltransferase activity|zinc ion binding			breast(1)	1	Colorectal(12;0.000442)|Esophageal squamous(3;0.0725)	all_lung(54;0.00787)|Lung NSC(58;0.0295)|Hepatocellular(245;0.065)	Epithelial(3;3.12e-43)|all cancers(3;1.72e-38)|BRCA - Breast invasive adenocarcinoma(5;2.84e-27)|LUSC - Lung squamous cell carcinoma(2;2.79e-25)|Lung(2;5.03e-23)|COAD - Colon adenocarcinoma(9;0.0511)			TGAAGAGCAACAACGATTTAC	0.333			T	NUP98	AML								4	2	---	---	---	---	
ADAM2	2515	broad.mit.edu	37	8	39618479	39618480	+	Intron	DEL	TG	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:39618479_39618480delTG	uc003xnj.2	-						ADAM2_uc003xnk.2_Intron|ADAM2_uc011lck.1_Intron|ADAM2_uc003xnl.2_Intron	NM_001464	NP_001455	Q99965	ADAM2_HUMAN	ADAM metallopeptidase domain 2 proprotein						cell adhesion|fusion of sperm to egg plasma membrane|proteolysis	integral to plasma membrane	integrin binding|metalloendopeptidase activity|zinc ion binding			ovary(1)|lung(1)	2		all_cancers(7;2.38e-28)|all_epithelial(6;8.85e-21)|all_lung(54;1.24e-07)|Lung NSC(58;1.94e-07)|Hepatocellular(245;0.00745)|Breast(189;0.00908)|Renal(179;0.0183)|Colorectal(162;0.246)	LUSC - Lung squamous cell carcinoma(45;0.000149)	READ - Rectum adenocarcinoma(644;0.0689)|Kidney(114;0.162)		GGGTAATTAATGTACCTGTATG	0.208													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	49586771	49586772	+	IGR	DEL	AT	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:49586771_49586772delAT								UBE2V2 (612319 upstream) : EFCAB1 (36579 downstream)																							CCTGCAGGCCATGTGTGTGTCT	0.505											OREG0018761	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
PCMTD1	115294	broad.mit.edu	37	8	52732819	52732822	+	3'UTR	DEL	GAAA	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:52732819_52732822delGAAA	uc003xqx.3	-	6					PCMTD1_uc011ldm.1_3'UTR|PCMTD1_uc003xqw.3_3'UTR|PCMTD1_uc011ldn.1_3'UTR|PCMTD1_uc010lya.2_3'UTR	NM_052937	NP_443169	Q96MG8	PCMD1_HUMAN	protein-L-isoaspartate (D-aspartate)							cytoplasm	protein-L-isoaspartate (D-aspartate) O-methyltransferase activity				0		Lung NSC(129;0.0795)|all_lung(136;0.144)				TTGCTCTGATGAAAGAAATAATTC	0.275													2	5	---	---	---	---	
PCMTD1	115294	broad.mit.edu	37	8	52732831	52732834	+	3'UTR	DEL	TCTC	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:52732831_52732834delTCTC	uc003xqx.3	-	6					PCMTD1_uc011ldm.1_3'UTR|PCMTD1_uc003xqw.3_3'UTR|PCMTD1_uc011ldn.1_3'UTR|PCMTD1_uc010lya.2_3'UTR	NM_052937	NP_443169	Q96MG8	PCMD1_HUMAN	protein-L-isoaspartate (D-aspartate)							cytoplasm	protein-L-isoaspartate (D-aspartate) O-methyltransferase activity				0		Lung NSC(129;0.0795)|all_lung(136;0.144)				AAGAAATAATTCTCTCTTTTAACT	0.279													2	6	---	---	---	---	
PCMTD1	115294	broad.mit.edu	37	8	52732893	52732894	+	3'UTR	INS	-	C	C	rs138060787	by1000genomes	TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:52732893_52732894insC	uc003xqx.3	-	6					PCMTD1_uc011ldm.1_3'UTR|PCMTD1_uc003xqw.3_3'UTR|PCMTD1_uc011ldn.1_3'UTR|PCMTD1_uc010lya.2_3'UTR	NM_052937	NP_443169	Q96MG8	PCMD1_HUMAN	protein-L-isoaspartate (D-aspartate)							cytoplasm	protein-L-isoaspartate (D-aspartate) O-methyltransferase activity				0		Lung NSC(129;0.0795)|all_lung(136;0.144)				CAGTAGGCATTTTTCTTCTTGA	0.302													16	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	77128239	77128239	+	IGR	DEL	A	-	-	rs34799394		TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:77128239delA								HNF4G (649180 upstream) : LOC100192378 (394876 downstream)																							AACTCCTTGCAAAAAAAAAAA	0.244													5	4	---	---	---	---	
RGS22	26166	broad.mit.edu	37	8	100999589	100999589	+	Intron	DEL	T	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:100999589delT	uc003yjb.1	-						RGS22_uc003yja.1_Intron|RGS22_uc003yjc.1_Intron	NM_015668	NP_056483	Q8NE09	RGS22_HUMAN	regulator of G-protein signaling 22						negative regulation of signal transduction	cytoplasm|plasma membrane	GTPase activator activity|signal transducer activity			ovary(3)|skin(2)|breast(1)|central_nervous_system(1)	7			Epithelial(11;6.71e-08)|all cancers(13;4.19e-06)|OV - Ovarian serous cystadenocarcinoma(57;0.000469)|STAD - Stomach adenocarcinoma(118;0.169)			TTGGGATATCTTATACAAATC	0.299													4	3	---	---	---	---	
DSCC1	79075	broad.mit.edu	37	8	120855207	120855207	+	Intron	DEL	A	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:120855207delA	uc003yov.2	-							NM_024094	NP_076999	Q9BVC3	DCC1_HUMAN	defective in sister chromatid cohesion 1						DNA replication|maintenance of mitotic sister chromatid cohesion|post-translational protein acetylation|regulation of DNA replication	chromatin|chromosome, centromeric region|nucleoplasm	DNA binding|protein binding			pancreas(1)	1	Lung NSC(37;9.35e-07)|Ovarian(258;0.011)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00185)			atattattttatttaaattaG	0.159													4	2	---	---	---	---	
COL22A1	169044	broad.mit.edu	37	8	139658944	139658944	+	Intron	DEL	A	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139658944delA	uc003yvd.2	-						COL22A1_uc011ljo.1_Intron	NM_152888	NP_690848	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1						cell adhesion	collagen|cytoplasm	structural molecule activity			ovary(11)|pancreas(1)|skin(1)	13	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			GGGATACAAGAAAAAAAAAGA	0.517										HNSCC(7;0.00092)			11	5	---	---	---	---	
GBA2	57704	broad.mit.edu	37	9	35749945	35749946	+	5'Flank	INS	-	CC	CC			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35749945_35749946insCC	uc003zxw.2	-						GBA2_uc011lpb.1_5'Flank|GBA2_uc011lpc.1_5'Flank|GBA2_uc011lpd.1_5'UTR|RGP1_uc011lpe.1_Intron|RGP1_uc011lpf.1_Intron	NM_020944	NP_065995	Q9HCG7	GBA2_HUMAN	bile acid beta-glucosidase						bile acid metabolic process|glucosylceramide catabolic process|O-glycoside catabolic process	integral to membrane|microsome|plasma membrane|smooth endoplasmic reticulum	beta-glucosidase activity|glucosylceramidase activity			ovary(3)|skin(1)	4	all_epithelial(49;0.167)		Lung(28;0.00416)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			GCAGAGCTCAGGTTGTCCTGTA	0.554													51	23	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	76213802	76213802	+	IGR	DEL	A	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:76213802delA								ANXA1 (428495 upstream) : RORB (898450 downstream)																							ACAAGTAGGTAAAAAAAAAGA	0.279													4	2	---	---	---	---	
C9orf95	54981	broad.mit.edu	37	9	77681901	77681902	+	Intron	DEL	TT	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:77681901_77681902delTT	uc004aju.2	-						C9orf95_uc004ajs.3_Intron|C9orf95_uc004ajr.3_Intron|C9orf95_uc004ajt.3_Intron	NM_017881	NP_060351	Q9NWW6	NRK1_HUMAN	nicotinamide riboside kinase 1 isoform 1						pyridine nucleotide biosynthetic process		ATP binding|metal ion binding|ribosylnicotinamide kinase activity				0						TTAATAGTGATTAAAGAAAGAA	0.307													4	2	---	---	---	---	
GKAP1	80318	broad.mit.edu	37	9	86413869	86413869	+	Intron	DEL	A	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:86413869delA	uc004amy.2	-						GKAP1_uc004amz.2_Intron|GKAP1_uc011lsu.1_Intron	NM_025211	NP_079487	Q5VSY0	GKAP1_HUMAN	G kinase anchoring protein 1 isoform a						signal transduction	Golgi apparatus					0						GATGATTTTTAAAACCACAAA	0.313													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	110859912	110859912	+	IGR	DEL	G	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:110859912delG								KLF4 (607865 upstream) : ACTL7B (756959 downstream)																							GGTGGAAGCAGGAAAAGGCTG	0.532													4	2	---	---	---	---	
SVEP1	79987	broad.mit.edu	37	9	113197669	113197669	+	Intron	DEL	T	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:113197669delT	uc010mtz.2	-							NM_153366	NP_699197	Q4LDE5	SVEP1_HUMAN	polydom						cell adhesion	cytoplasm|extracellular region|membrane	calcium ion binding			ovary(7)	7						ACACTTTAGATAAGCCTTACT	0.403													4	2	---	---	---	---	
SCAI	286205	broad.mit.edu	37	9	127731224	127731224	+	Intron	DEL	A	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:127731224delA	uc004bpe.2	-						SCAI_uc004bpd.2_Intron|SCAI_uc010mwu.2_Intron	NM_001144877	NP_001138349	Q8N9R8	SCAI_HUMAN	suppressor of cancer cell invasion isoform 2						negative regulation of cell migration|negative regulation of Rho protein signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|integral to membrane|nucleus	protein binding|transcription corepressor activity			ovary(2)|breast(2)|central_nervous_system(1)	5						tattttttggaaaaaaaaaaa	0.080													8	4	---	---	---	---	
PPP6C	5537	broad.mit.edu	37	9	127933227	127933228	+	Intron	DEL	CA	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:127933227_127933228delCA	uc004bpg.3	-						PPP6C_uc010mwv.2_Intron|PPP6C_uc010mww.2_Intron|PPP6C_uc011lzr.1_Intron	NM_002721	NP_002712	O00743	PPP6_HUMAN	protein phosphatase 6, catalytic subunit isoform						G1/S transition of mitotic cell cycle|protein dephosphorylation	cytosol	metal ion binding|protein binding|protein serine/threonine phosphatase activity			ovary(1)|skin(1)	2						TCATTTGTGTCACAGAGACTGA	0.361													4	2	---	---	---	---	
ODF2	4957	broad.mit.edu	37	9	131246564	131246565	+	Intron	INS	-	C	C			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131246564_131246565insC	uc011mbd.1	+						ODF2_uc011maz.1_Intron|ODF2_uc010myb.2_Intron|ODF2_uc011mbb.1_Intron|ODF2_uc011mbc.1_Intron|ODF2_uc004bva.2_Intron|ODF2_uc004bvb.2_Intron|ODF2_uc011mbe.1_Intron|ODF2_uc004bvc.2_Intron|ODF2_uc010myc.2_Intron|ODF2_uc011mbf.1_Intron|ODF2_uc004bvd.3_Intron|ODF2_uc004bve.2_Intron|uc004bvg.2_5'Flank	NM_002540	NP_002531	Q5BJF6	ODFP2_HUMAN	outer dense fiber of sperm tails 2 isoform 1						cell differentiation|G2/M transition of mitotic cell cycle|multicellular organismal development|spermatogenesis	centriole|cilium|cytosol|microtubule|spindle pole	protein binding|structural molecule activity			ovary(1)	1						tgcgtgccatgccccccaggcc	0.178													4	2	---	---	---	---	
LAMC3	10319	broad.mit.edu	37	9	133963949	133963949	+	Intron	DEL	T	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:133963949delT	uc004caa.1	+						LAMC3_uc010mze.1_Intron	NM_006059	NP_006050	Q9Y6N6	LAMC3_HUMAN	laminin, gamma 3 precursor						cell adhesion	basement membrane|membrane	structural molecule activity			ovary(2)|pancreas(1)	3	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.06e-05)|Epithelial(140;0.000551)		ACAGCATGTAtttttttcaaa	0.279													4	2	---	---	---	---	
COBRA1	25920	broad.mit.edu	37	9	140161635	140161639	+	Intron	DEL	GGGCT	-	-	rs3936177	by1000genomes	TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140161635_140161639delGGGCT	uc004cmm.3	+							NM_015456	NP_056271	Q8WX92	NELFB_HUMAN	cofactor of BRCA1						negative regulation of transcription, DNA-dependent|positive regulation of viral transcription|transcription elongation from RNA polymerase II promoter|viral reproduction	cytoplasm|nucleoplasm	protein binding				0	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.137)	OV - Ovarian serous cystadenocarcinoma(145;9.42e-05)|Epithelial(140;0.000766)		GGTCGGTgtggggctgaggtggggc	0.551													39	22	---	---	---	---	
COBRA1	25920	broad.mit.edu	37	9	140161642	140161647	+	Intron	DEL	GGTGGG	-	-	rs115604241	by1000genomes	TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140161642_140161647delGGTGGG	uc004cmm.3	+							NM_015456	NP_056271	Q8WX92	NELFB_HUMAN	cofactor of BRCA1						negative regulation of transcription, DNA-dependent|positive regulation of viral transcription|transcription elongation from RNA polymerase II promoter|viral reproduction	cytoplasm|nucleoplasm	protein binding				0	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.137)	OV - Ovarian serous cystadenocarcinoma(145;9.42e-05)|Epithelial(140;0.000766)		gtggggctgaggtggggctgaggtgg	0.563													37	23	---	---	---	---	
ITIH5	80760	broad.mit.edu	37	10	7667728	7667728	+	Intron	DEL	A	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:7667728delA	uc001ijq.2	-						ITIH5_uc001ijr.1_Intron	NM_030569	NP_085046	Q86UX2	ITIH5_HUMAN	inter-alpha trypsin inhibitor heavy chain						hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity			ovary(2)|central_nervous_system(2)	4						attctgtctcaaaaaaaaaaa	0.015													3	3	---	---	---	---	
KIAA0913	23053	broad.mit.edu	37	10	75544695	75544695	+	5'Flank	DEL	T	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75544695delT	uc009xrl.2	+						KIAA0913_uc009xrk.1_5'Flank|KIAA0913_uc001jve.2_5'Flank|KIAA0913_uc001jvf.2_5'Flank|uc009xrm.1_5'Flank	NM_015037	NP_055852	A7E2V4	K0913_HUMAN	hypothetical protein LOC23053								zinc ion binding			breast(1)	1	Prostate(51;0.0112)					aatgtgtaaataaaggagcac	0.000													4	2	---	---	---	---	
KIAA0913	23053	broad.mit.edu	37	10	75544697	75544699	+	5'Flank	DEL	AAG	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75544697_75544699delAAG	uc009xrl.2	+						KIAA0913_uc009xrk.1_5'Flank|KIAA0913_uc001jve.2_5'Flank|KIAA0913_uc001jvf.2_5'Flank|uc009xrm.1_5'Flank	NM_015037	NP_055852	A7E2V4	K0913_HUMAN	hypothetical protein LOC23053								zinc ion binding			breast(1)	1	Prostate(51;0.0112)					tgtgtaaataaaggagcactatt	0.000													4	2	---	---	---	---	
LDB3	11155	broad.mit.edu	37	10	88451425	88451425	+	Intron	DEL	C	-	-	rs11312118		TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:88451425delC	uc001kdv.2	+						LDB3_uc010qml.1_Intron|LDB3_uc010qmm.1_Intron|LDB3_uc001kdu.2_Intron|LDB3_uc009xsz.2_Intron|LDB3_uc001kdr.2_Intron|LDB3_uc009xsy.2_Intron|LDB3_uc001kds.2_Intron|LDB3_uc001kdt.2_Intron	NM_007078	NP_009009	O75112	LDB3_HUMAN	LIM domain binding 3 isoform 1							cytoskeleton|perinuclear region of cytoplasm|pseudopodium	zinc ion binding			ovary(1)	1						CCTGAGGGATCTGAGCCTCCT	0.562													5	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	108152960	108152960	+	IGR	DEL	C	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:108152960delC								None (None upstream) : SORCS1 (180462 downstream)																							cttcaccactccactccctac	0.000													4	2	---	---	---	---	
PDCD4	27250	broad.mit.edu	37	10	112653998	112653998	+	Intron	DEL	C	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:112653998delC	uc001kzh.2	+						PDCD4_uc001kzg.2_Intron|PDCD4_uc010qre.1_Intron	NM_014456	NP_055271	Q53EL6	PDCD4_HUMAN	programmed cell death 4 isoform 1						apoptosis|cell aging|negative regulation of cell cycle|negative regulation of JUN kinase activity|negative regulation of transcription, DNA-dependent	cytosol|nucleus	protein binding|RNA binding			ovary(1)|breast(1)|skin(1)	3		Breast(234;0.0848)|Lung NSC(174;0.238)		Epithelial(162;0.000526)|all cancers(201;0.00794)|BRCA - Breast invasive adenocarcinoma(275;0.125)		ATTAAGTGTTCCTTTTTGTAC	0.328													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	115705222	115705223	+	IGR	DEL	AC	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:115705222_115705223delAC								NHLRC2 (36770 upstream) : ADRB1 (98583 downstream)																							AATGTGCCTTACACTGTCCCCA	0.495													4	2	---	---	---	---	
CTBP2	1488	broad.mit.edu	37	10	126714530	126714531	+	Intron	INS	-	GT	GT	rs150788520	by1000genomes	TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:126714530_126714531insGT	uc009yak.2	-						CTBP2_uc009yal.2_Intron|CTBP2_uc001lif.3_Intron|CTBP2_uc001lih.3_Intron|CTBP2_uc001lie.3_Intron	NM_001329	NP_001320	P56545	CTBP2_HUMAN	C-terminal binding protein 2 isoform 1						negative regulation of cell proliferation|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent|viral genome replication|white fat cell differentiation	cell junction|synapse|transcriptional repressor complex	NAD binding|oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor|protein binding				0		all_lung(145;0.0132)|Lung NSC(174;0.0193)|all_neural(114;0.116)|Colorectal(57;0.173)		Colorectal(40;0.00572)|COAD - Colon adenocarcinoma(40;0.0127)|GBM - Glioblastoma multiforme(135;0.147)		CTTGTTTGGTGGTGTGTGTGTG	0.574													7	6	---	---	---	---	
ODF3	113746	broad.mit.edu	37	11	194850	194851	+	5'Flank	INS	-	CACT	CACT	rs143036825		TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:194850_194851insCACT	uc001lob.2	+						ODF3_uc010qvk.1_5'Flank|ODF3_uc001loc.2_5'Flank	NM_053280	NP_444510	Q96PU9	ODF3A_HUMAN	outer dense fiber of sperm tails 3						cell differentiation|multicellular organismal development|spermatogenesis	cytoplasm				ovary(1)	1		all_cancers(49;9.23e-07)|all_epithelial(84;0.000315)|Breast(177;0.00122)|Ovarian(85;0.0202)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;3.95e-27)|Epithelial(43;2.66e-26)|OV - Ovarian serous cystadenocarcinoma(40;5.55e-21)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.105)|LUSC - Lung squamous cell carcinoma(625;0.122)		CATCAGGAACACAGGGCCACAG	0.545													8	5	---	---	---	---	
DEAF1	10522	broad.mit.edu	37	11	693971	693971	+	Intron	DEL	T	-	-	rs35573497		TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:693971delT	uc001lqq.1	-						TMEM80_uc001lqr.2_5'Flank|TMEM80_uc001lqs.2_5'Flank|TMEM80_uc010qwi.1_5'Flank	NM_021008	NP_066288	O75398	DEAF1_HUMAN	deformed epidermal autoregulatory factor 1						embryonic skeletal system development|germ cell development|neural tube closure|regulation of mammary gland epithelial cell proliferation|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	cytoplasm|cytoplasm|extracellular region|nucleus	protein binding|zinc ion binding				0		all_cancers(49;1.24e-08)|all_epithelial(84;1.87e-05)|Breast(177;0.000286)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.106)|all_lung(207;0.136)		all cancers(45;1.76e-27)|Epithelial(43;8.42e-27)|OV - Ovarian serous cystadenocarcinoma(40;6.55e-21)|BRCA - Breast invasive adenocarcinoma(625;4.83e-05)|Lung(200;0.0259)|LUSC - Lung squamous cell carcinoma(625;0.075)		GCAGCCCCCCTGGGCCACCAC	0.667													22	19	---	---	---	---	
PGAP2	27315	broad.mit.edu	37	11	3829297	3829299	+	5'Flank	DEL	CGG	-	-	rs75108073		TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:3829297_3829299delCGG	uc001lys.2	+						PGAP2_uc001lyl.2_Intron|PGAP2_uc010qxw.1_Intron|PGAP2_uc010qxx.1_Intron|PGAP2_uc001lyp.3_Intron|PGAP2_uc010qxy.1_Intron|PGAP2_uc010qxz.1_Intron|PGAP2_uc001lyn.3_Intron|PGAP2_uc010qya.1_Intron|PGAP2_uc001lyr.2_5'UTR|PGAP2_uc010qyb.1_5'UTR|PGAP2_uc001lyt.2_5'Flank	NM_014489	NP_055304	Q9UHJ9	PGAP2_HUMAN	FGF receptor activating protein 1 isoform 1						GPI anchor biosynthetic process	endoplasmic reticulum membrane|Golgi membrane|integral to membrane	protein transporter activity				0						TGTGCCTCACCGGGTCTCACTGC	0.596											OREG0020702	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	6	4	---	---	---	---	
ANO5	203859	broad.mit.edu	37	11	22294102	22294102	+	Intron	DEL	A	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:22294102delA	uc001mqi.2	+						ANO5_uc001mqj.2_Intron	NM_213599	NP_998764	Q75V66	ANO5_HUMAN	anoctamin 5 isoform a							chloride channel complex|endoplasmic reticulum membrane	chloride channel activity			central_nervous_system(3)|ovary(1)	4						aaggaagagcaaagaaagaac	0.129													4	2	---	---	---	---	
HIPK3	10114	broad.mit.edu	37	11	33358523	33358524	+	Intron	INS	-	A	A			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:33358523_33358524insA	uc001mul.1	+						HIPK3_uc001mum.1_Intron|HIPK3_uc009yjv.1_Intron|HIPK3_uc009yjw.1_Intron	NM_005734	NP_005725	Q9H422	HIPK3_HUMAN	homeodomain interacting protein kinase 3 isoform						anti-apoptosis|apoptosis|negative regulation of JUN kinase activity|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm	ATP binding|protein serine/threonine kinase activity			large_intestine(1)|skin(1)|stomach(1)|ovary(1)|pancreas(1)	5						catagactatgtattttcatac	0.040													9	6	---	---	---	---	
LRP4	4038	broad.mit.edu	37	11	46912172	46912172	+	Intron	DEL	T	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:46912172delT	uc001ndn.3	-							NM_002334	NP_002325	O75096	LRP4_HUMAN	low density lipoprotein receptor-related protein						endocytosis|negative regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	integral to membrane	calcium ion binding|receptor activity			skin(2)|upper_aerodigestive_tract(1)|ovary(1)	4				Lung(87;0.159)		ACAGAATGAAtttttttttta	0.229													3	3	---	---	---	---	
C2CD3	26005	broad.mit.edu	37	11	73765441	73765441	+	Intron	DEL	A	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:73765441delA	uc001ouu.2	-						C2CD3_uc001out.2_Intron	NM_015531	NP_056346	Q4AC94	C2CD3_HUMAN	C2 calcium-dependent domain containing 3							centrosome				ovary(4)|pancreas(2)|skin(1)	7	Breast(11;4.16e-06)					gatcttgttcaaaaaaaaaaa	0.199													5	4	---	---	---	---	
RSF1	51773	broad.mit.edu	37	11	77394584	77394584	+	Intron	DEL	A	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:77394584delA	uc001oyn.2	-						RSF1_uc001oym.2_Intron	NM_016578	NP_057662	Q96T23	RSF1_HUMAN	remodeling and spacing factor 1						CenH3-containing nucleosome assembly at centromere|negative regulation of DNA binding|negative regulation of transcription, DNA-dependent|nucleosome positioning|positive regulation of transcription, DNA-dependent|positive regulation of viral transcription|transcription initiation, DNA-dependent	RSF complex	histone binding|protein binding|zinc ion binding			ovary(2)|central_nervous_system(2)	4	all_cancers(14;1.54e-17)|all_epithelial(13;4.06e-20)|Ovarian(111;0.152)		Epithelial(5;3e-50)|all cancers(3;6.37e-47)|BRCA - Breast invasive adenocarcinoma(5;9.82e-31)			actcagtctcaaaaaaaaaag	0.114													10	6	---	---	---	---	
TMEM126A	84233	broad.mit.edu	37	11	85361164	85361164	+	Intron	DEL	T	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:85361164delT	uc001par.2	+							NM_032273	NP_115649	Q9H061	T126A_HUMAN	transmembrane protein 126A							integral to membrane|mitochondrion				ovary(2)	2		Acute lymphoblastic leukemia(157;4.88e-06)|all_hematologic(158;0.00572)				ttcacttagattttttttTAA	0.100													4	2	---	---	---	---	
YAP1	10413	broad.mit.edu	37	11	102076600	102076601	+	Intron	INS	-	T	T			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:102076600_102076601insT	uc001pgt.2	+						YAP1_uc001pgs.2_Intron|YAP1_uc001pgu.2_Intron|YAP1_uc001pgv.2_Intron|YAP1_uc010ruo.1_Intron|YAP1_uc001pgw.2_Intron|YAP1_uc010rup.1_Intron	NM_001130145	NP_001123617	P46937	YAP1_HUMAN	Yes-associated protein 1, 65kDa isoform 1						cell proliferation|cellular response to gamma radiation|contact inhibition|hippo signaling cascade|regulation of transcription, DNA-dependent|response to DNA damage stimulus|transcription, DNA-dependent	cytoplasm|nucleus	protein binding|transcription coactivator activity|transcription corepressor activity|transcription regulatory region DNA binding			ovary(1)|lung(1)|central_nervous_system(1)	3	all_cancers(8;0.000575)|all_epithelial(12;0.00564)	Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.00936)	Lung(13;0.245)	BRCA - Breast invasive adenocarcinoma(274;0.0189)		TTTAGGACAGATTTTTTTTTTC	0.337													6	4	---	---	---	---	
APOA4	337	broad.mit.edu	37	11	116691512	116691515	+	3'UTR	DEL	GACA	-	-	rs35211609		TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:116691512_116691515delGACA	uc001pps.1	-	3						NM_000482	NP_000473			apolipoprotein A-IV precursor												0	all_hematologic(175;0.0487)	Breast(348;0.0126)|Medulloblastoma(222;0.0425)|all_hematologic(158;0.0564)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;8.54e-06)|Epithelial(105;1.62e-05)|all cancers(92;0.000165)|OV - Ovarian serous cystadenocarcinoma(223;0.148)		ACTTCTTTGGGACAGACAGACAGA	0.554													21	22	---	---	---	---	
CCND2	894	broad.mit.edu	37	12	4398350	4398350	+	Intron	DEL	G	-	-	rs78692066		TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:4398350delG	uc001qmo.2	+							NM_001759	NP_001750	P30279	CCND2_HUMAN	cyclin D2						cell division|positive regulation of cyclin-dependent protein kinase activity|positive regulation of protein phosphorylation	cyclin-dependent protein kinase holoenzyme complex|cytoplasm|membrane|nucleus	protein kinase binding			haematopoietic_and_lymphoid_tissue(1)|breast(1)|kidney(1)	3			all cancers(3;4.15e-10)|GBM - Glioblastoma multiforme(3;6.34e-05)|Colorectal(7;0.00245)|OV - Ovarian serous cystadenocarcinoma(31;0.00301)|COAD - Colon adenocarcinoma(12;0.0264)|STAD - Stomach adenocarcinoma(119;0.206)			GGGAAAATACGGAAGAAAACT	0.498			T	IGL@	NHL,CLL								4	2	---	---	---	---	
CD163L1	283316	broad.mit.edu	37	12	7521258	7521259	+	Intron	DEL	TC	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7521258_7521259delTC	uc001qsy.2	-						CD163L1_uc010sge.1_Intron	NM_174941	NP_777601	Q9NR16	C163B_HUMAN	scavenger receptor cysteine-rich type 1							extracellular region|integral to membrane|plasma membrane	scavenger receptor activity			ovary(8)|skin(2)|central_nervous_system(1)	11						TTTCTGCCAGTCTCATAAAGAA	0.223													4	2	---	---	---	---	
CD163	9332	broad.mit.edu	37	12	7632615	7632616	+	Intron	INS	-	G	G			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7632615_7632616insG	uc001qsz.3	-						CD163_uc001qta.3_Intron|CD163_uc009zfw.2_Intron	NM_004244	NP_004235	Q86VB7	C163A_HUMAN	CD163 antigen isoform a						acute-phase response	extracellular region|integral to plasma membrane	protein binding|scavenger receptor activity			ovary(6)|pancreas(1)|skin(1)	8						AAATAATTACTGGGAAATAAAC	0.391													4	2	---	---	---	---	
DDX12	440081	broad.mit.edu	37	12	9586446	9586460	+	Intron	DEL	CTCCCCAGGAGAGGA	-	-	rs68134972		TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9586446_9586460delCTCCCCAGGAGAGGA	uc010sgs.1	-						DDX12_uc009zgq.1_Intron	NM_004400	NP_004391			DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 12												0						CAGGAAAGGTCTCCCCAGGAGAGGACTCCCCAGGC	0.642													22	13	---	---	---	---	
PDE6H	5149	broad.mit.edu	37	12	15131921	15131922	+	Intron	INS	-	T	T			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:15131921_15131922insT	uc001rcr.2	+							NM_006205	NP_006196	Q13956	CNCG_HUMAN	phosphodiesterase 6H						visual perception		3',5'-cyclic-GMP phosphodiesterase activity|cGMP binding|enzyme inhibitor activity			ovary(1)|skin(1)	2						ATATCTCTCCAGTGGGATACAC	0.381													4	3	---	---	---	---	
CCDC91	55297	broad.mit.edu	37	12	28701981	28701981	+	Intron	DEL	A	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:28701981delA	uc001riq.2	+						CCDC91_uc001rio.2_Intron|CCDC91_uc009zjk.2_Intron|CCDC91_uc001rir.2_Intron|CCDC91_uc009zjl.2_Intron	NM_018318	NP_060788	Q7Z6B0	CCD91_HUMAN	GGA binding partner						protein transport	Golgi apparatus|membrane				central_nervous_system(1)	1	Acute lymphoblastic leukemia(23;0.00718)|all_hematologic(23;0.0113)|Lung SC(9;0.184)					CTCTCTCTTTAAAAAAATTAA	0.363													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	37877677	37877677	+	IGR	DEL	A	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:37877677delA								None (None upstream) : ALG10B (832880 downstream)																							TTTATCAAACAAAAAGTGTAa	0.080													15	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	42305174	42305175	+	IGR	INS	-	G	G			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:42305174_42305175insG								PDZRN4 (336790 upstream) : GXYLT1 (170475 downstream)																							TTGAGGATGCTGGGGGGAAGCA	0.505													4	2	---	---	---	---	
SFRS2IP	9169	broad.mit.edu	37	12	46345540	46345540	+	Intron	DEL	A	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:46345540delA	uc001rox.2	-						SFRS2IP_uc001roy.1_Intron|SFRS2IP_uc009zki.1_Intron	NM_004719	NP_004710	Q99590	SCAFB_HUMAN	splicing factor, arginine/serine-rich 2,						spliceosome assembly	nucleus	protein binding|zinc ion binding				0	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.209)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.1)		TTATATCTTTACAAATGTTTC	0.239													4	2	---	---	---	---	
ATF1	466	broad.mit.edu	37	12	51213515	51213515	+	Frame_Shift_Del	DEL	G	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51213515delG	uc001rww.3	+	7	1047	c.769delG	c.(769-771)GAAfs	p.E257fs	ATF1_uc010smu.1_Frame_Shift_Del_p.E122fs	NM_005171	NP_005162	P18846	ATF1_HUMAN	activating transcription factor 1	257	Leucine-zipper.				innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway				EWSR1/ATF1(323)|FUS/ATF1(4)	soft_tissue(321)|ovary(2)|NS(2)|bone(2)|skin(2)	329						AACTCTAATAGAAGAGTTAAA	0.318			T	EWSR1|FUS	malignant melanoma of soft parts |angiomatoid fibrous histiocytoma 								4	2	---	---	---	---	
SMARCC2	6601	broad.mit.edu	37	12	56565988	56565989	+	Intron	INS	-	A	A			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56565988_56565989insA	uc001skb.2	-						SMARCC2_uc001skd.2_Intron|SMARCC2_uc001ska.2_Intron|SMARCC2_uc001skc.2_Intron|SMARCC2_uc010sqf.1_Intron	NM_003075	NP_003066	Q8TAQ2	SMRC2_HUMAN	SWI/SNF-related matrix-associated						chromatin remodeling|negative regulation of transcription, DNA-dependent|nervous system development|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nBAF complex|npBAF complex|nucleoplasm|SWI/SNF complex	DNA binding|protein binding|transcription coactivator activity			lung(2)|central_nervous_system(2)|ovary(1)|skin(1)	6			OV - Ovarian serous cystadenocarcinoma(18;0.123)			acttagcctcctgagtagctgg	0.119													4	2	---	---	---	---	
SHMT2	6472	broad.mit.edu	37	12	57625004	57625007	+	Intron	DEL	CCTT	-	-	rs72159442		TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57625004_57625007delCCTT	uc001snf.1	+						SHMT2_uc001sng.1_Intron|SHMT2_uc001snh.1_Intron|SHMT2_uc009zpk.1_Intron|SHMT2_uc001sni.1_Intron|SHMT2_uc010srg.1_Intron|SHMT2_uc001snj.1_Intron|SHMT2_uc010srh.1_Intron|SHMT2_uc001snk.1_Intron|SHMT2_uc010sri.1_Intron|SHMT2_uc001snl.2_Intron|SHMT2_uc010srj.1_5'Flank	NM_005412	NP_005403	P34897	GLYM_HUMAN	serine hydroxymethyltransferase 2							microtubule cytoskeleton|mitochondrial nucleoid	glycine hydroxymethyltransferase activity|methyltransferase activity			ovary(1)|central_nervous_system(1)	2					Glycine(DB00145)|Pyridoxal Phosphate(DB00114)|Tetrahydrofolic acid(DB00116)	TCATCTGATCCCTTCCTTCCTTCC	0.515													5	6	---	---	---	---	
RAB3IP	117177	broad.mit.edu	37	12	70133945	70133945	+	Intron	DEL	T	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:70133945delT	uc001svp.2	+						uc001svj.1_5'Flank|uc001svk.2_5'Flank|RAB3IP_uc001svl.1_Intron|RAB3IP_uc001svm.2_Intron|RAB3IP_uc001svn.2_Intron|RAB3IP_uc001svo.2_Intron|RAB3IP_uc001svq.2_Intron|RAB3IP_uc001svr.2_Intron|RAB3IP_uc001svs.2_Intron	NM_175623	NP_783322	Q96QF0	RAB3I_HUMAN	RAB3A interacting protein isoform alpha 2						cilium assembly|Golgi to plasma membrane transport|protein localization to organelle|protein transport	actin cortical patch|centrosome|cytosol|lamellipodium|microtubule basal body|nucleus	guanyl-nucleotide exchange factor activity|protein binding			ovary(1)	1	Esophageal squamous(21;0.187)		Lung(24;0.000381)|OV - Ovarian serous cystadenocarcinoma(12;0.00168)|STAD - Stomach adenocarcinoma(21;0.00694)			TTCATGAAGGTTTTTTTTTCT	0.338													4	3	---	---	---	---	
LIN7A	8825	broad.mit.edu	37	12	81329259	81329259	+	Intron	DEL	G	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:81329259delG	uc001szj.1	-						LIN7A_uc001szk.1_Intron	NM_004664	NP_004655	O14910	LIN7A_HUMAN	lin-7 homolog A						exocytosis|protein complex assembly|protein transport	basolateral plasma membrane|postsynaptic density|postsynaptic membrane|synaptosome|tight junction	L27 domain binding			ovary(1)|skin(1)	2						agaggctgatgtatgcagagt	0.100													4	2	---	---	---	---	
MYBPC1	4604	broad.mit.edu	37	12	101988705	101988705	+	5'Flank	DEL	G	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:101988705delG	uc001tii.2	+						MYBPC1_uc001tif.1_5'Flank|MYBPC1_uc001tig.2_5'Flank|MYBPC1_uc010svq.1_5'Flank|MYBPC1_uc001tih.2_5'Flank|MYBPC1_uc001tij.2_5'Flank|MYBPC1_uc010svr.1_5'Flank|MYBPC1_uc010svs.1_5'Flank|MYBPC1_uc010svt.1_5'Flank|MYBPC1_uc010svu.1_5'Flank|MYBPC1_uc001tik.2_5'Flank	NM_206820	NP_996556	Q00872	MYPC1_HUMAN	myosin binding protein C, slow type isoform 3						cell adhesion|muscle filament sliding	cytosol|myofibril|myosin filament	actin binding|structural constituent of muscle|titin binding			ovary(2)|liver(1)|skin(1)	4						CATGATTGATGTTCAGAGGCA	0.512													4	2	---	---	---	---	
HCFC2	29915	broad.mit.edu	37	12	104489130	104489131	+	Intron	DEL	TA	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104489130_104489131delTA	uc001tkj.3	+						HCFC2_uc009zul.2_Intron	NM_013320	NP_037452	Q9Y5Z7	HCFC2_HUMAN	host cell factor C2						regulation of transcription from RNA polymerase II promoter|viral reproduction	cytoplasm|nucleus	transcription coactivator activity			ovary(2)|central_nervous_system(1)	3						TTTTCCCTTTTATTTTAGGTCC	0.337													4	2	---	---	---	---	
DTX1	1840	broad.mit.edu	37	12	113533453	113533453	+	Intron	DEL	A	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:113533453delA	uc001tuk.1	+							NM_004416	NP_004407	Q86Y01	DTX1_HUMAN	deltex homolog 1						negative regulation of neuron differentiation|Notch signaling pathway|regulation of Notch signaling pathway|transcription from RNA polymerase II promoter	cytoplasm|nucleus	Notch binding|SH3 domain binding|transcription coactivator activity|ubiquitin protein ligase binding|zinc ion binding			lung(2)|ovary(1)|central_nervous_system(1)	4						aaggcttcagaaagggcaagt	0.124													4	2	---	---	---	---	
MTIF3	219402	broad.mit.edu	37	13	28011056	28011059	+	Intron	DEL	TTTT	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:28011056_28011059delTTTT	uc001urh.2	-						MTIF3_uc001uri.2_Intron|MTIF3_uc001urj.2_Intron|MTIF3_uc001urk.2_Intron	NM_152912	NP_690876	Q9H2K0	IF3M_HUMAN	mitochondrial translational initiation factor 3						regulation of translational initiation|ribosome disassembly	mitochondrion	ribosomal small subunit binding|translation initiation factor activity			ovary(1)|skin(1)	2		Lung SC(185;0.0161)	Colorectal(13;0.00042)|READ - Rectum adenocarcinoma(15;0.105)	all cancers(112;0.108)|OV - Ovarian serous cystadenocarcinoma(117;0.157)		gcctggctaattttttgtattttt	0.000													6	3	---	---	---	---	
RFC3	5983	broad.mit.edu	37	13	34410153	34410154	+	Intron	DEL	AA	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:34410153_34410154delAA	uc001uuz.2	+						RFC3_uc001uva.2_Intron	NM_002915	NP_002906	P40938	RFC3_HUMAN	replication factor C 3 isoform 1						cell cycle checkpoint|DNA strand elongation involved in DNA replication|DNA synthesis involved in DNA repair|nucleotide-excision repair, DNA gap filling|response to organophosphorus|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	DNA replication factor C complex|nucleoplasm	ATP binding|DNA clamp loader activity|protein binding				0		Hepatocellular(188;0.0191)|Lung SC(185;0.0548)		all cancers(112;5.09e-06)|Epithelial(112;6.52e-05)|BRCA - Breast invasive adenocarcinoma(63;0.00107)|OV - Ovarian serous cystadenocarcinoma(117;0.0285)|GBM - Glioblastoma multiforme(144;0.123)		GAGTATGTTTAACTTTAGTCTT	0.297													4	2	---	---	---	---	
COG3	83548	broad.mit.edu	37	13	46060467	46060467	+	Intron	DEL	C	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:46060467delC	uc001vak.2	+						COG3_uc010tfu.1_Intron|COG3_uc001vai.2_Intron|COG3_uc001vaj.1_Intron|COG3_uc010tfv.1_Intron|COG3_uc010aci.2_Intron	NM_031431	NP_113619	Q96JB2	COG3_HUMAN	component of golgi transport complex 3						ER to Golgi vesicle-mediated transport|intra-Golgi vesicle-mediated transport|intracellular protein transport|protein glycosylation|protein localization to organelle|protein stabilization|retrograde vesicle-mediated transport, Golgi to ER	cis-Golgi network|Golgi cisterna membrane|Golgi transport complex	protein binding|protein transporter activity			breast(1)|skin(1)	2		Lung NSC(96;0.000145)|Breast(56;0.000596)|Prostate(109;0.00438)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000124)		agacgggagacgggagacggg	0.149													24	16	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	47033457	47033458	+	IGR	INS	-	T	T	rs145501666		TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:47033457_47033458insT								C13orf18 (21132 upstream) : LRCH1 (93838 downstream)																							GTTGCAACACAGTTGTCAAGAG	0.282													8	7	---	---	---	---	
RB1	5925	broad.mit.edu	37	13	49033658	49033658	+	Intron	DEL	C	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:49033658delC	uc001vcb.2	+							NM_000321	NP_000312	P06400	RB_HUMAN	retinoblastoma 1						androgen receptor signaling pathway|cell cycle arrest|chromatin remodeling|G1 phase of mitotic cell cycle|interspecies interaction between organisms|maintenance of mitotic sister chromatid cohesion|mitotic cell cycle G1/S transition checkpoint|myoblast differentiation|negative regulation of cell growth|negative regulation of protein kinase activity|negative regulation of S phase of mitotic cell cycle|negative regulation of sequence-specific DNA binding transcription factor activity|positive regulation of mitotic metaphase/anaphase transition|protein localization to chromosome, centromeric region|Ras protein signal transduction|regulation of centromere complex assembly|regulation of cohesin localization to chromatin|regulation of lipid kinase activity|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle|sister chromatid biorientation	chromatin|PML body|Rb-E2F complex|SWI/SNF complex	androgen receptor binding|DNA binding|kinase binding|phosphoprotein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription factor binding|ubiquitin protein ligase binding	p.?(6)		lung(94)|eye(89)|central_nervous_system(47)|bone(22)|breast(21)|urinary_tract(17)|haematopoietic_and_lymphoid_tissue(14)|ovary(10)|prostate(9)|soft_tissue(8)|skin(7)|endometrium(5)|cervix(3)|liver(3)|salivary_gland(2)|stomach(2)|oesophagus(1)|adrenal_gland(1)|kidney(1)|gastrointestinal_tract_(site_indeterminate)(1)|pituitary(1)	358		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	tcataataaaccagtaaacat	0.124		6	D|Mis|N|F|S		retinoblastoma|sarcoma|breast|small cell lung	retinoblastoma|sarcoma|breast|small cell lung			Hereditary_Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)			7	9	---	---	---	---	
LMO7	4008	broad.mit.edu	37	13	76430509	76430509	+	Intron	DEL	T	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:76430509delT	uc001vjv.2	+						LMO7_uc010thv.1_Intron|LMO7_uc010thw.1_Intron|LMO7_uc001vjx.1_5'Flank	NM_015842	NP_056667	Q8WWI1	LMO7_HUMAN	LIM domain only 7 isoform 2							cytoplasm|nucleus|ubiquitin ligase complex	ubiquitin-protein ligase activity|zinc ion binding			large_intestine(2)|ovary(1)|prostate(1)|skin(1)	5		Breast(118;0.0992)		GBM - Glioblastoma multiforme(99;0.0109)		TCTTTCGGCCTTTTTTTTTCT	0.403													4	2	---	---	---	---	
MYO16	23026	broad.mit.edu	37	13	109750765	109750765	+	Intron	DEL	A	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:109750765delA	uc001vqt.1	+						MYO16_uc010agk.1_Intron|MYO16_uc010tjh.1_Intron	NM_015011	NP_055826	Q9Y6X6	MYO16_HUMAN	myosin heavy chain Myr 8						cerebellum development|negative regulation of cell proliferation|negative regulation of S phase of mitotic cell cycle	myosin complex|nucleoplasm|perinuclear region of cytoplasm|plasma membrane	actin filament binding|ATP binding|motor activity			ovary(6)|large_intestine(1)|kidney(1)|breast(1)|central_nervous_system(1)	10	all_lung(23;0.000332)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00751)|Lung SC(71;0.104)		BRCA - Breast invasive adenocarcinoma(86;0.19)|all cancers(43;0.201)			ttttccctgcaaaaagttgtc	0.000													4	2	---	---	---	---	
RASA3	22821	broad.mit.edu	37	13	114763007	114763029	+	Intron	DEL	GGGACAGGGGTCCTGTGATTGGA	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:114763007_114763029delGGGACAGGGGTCCTGTGATTGGA	uc001vui.2	-						RASA3_uc010tkk.1_Intron|RASA3_uc001vuj.2_Intron	NM_007368	NP_031394	Q14644	RASA3_HUMAN	RAS p21 protein activator 3						intracellular signal transduction|negative regulation of Ras protein signal transduction	cytoplasm|intrinsic to internal side of plasma membrane	calcium-release channel activity|metal ion binding|Ras GTPase activator activity			lung(3)|skin(1)	4	Lung NSC(43;0.00814)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.016)|all_epithelial(44;0.00577)|all_lung(25;0.0173)|Lung NSC(25;0.0634)|Breast(118;0.188)	BRCA - Breast invasive adenocarcinoma(86;0.128)			TGGGGCAGGTGGGACAGGGGTCCTGTGATTGGAGGGACAGGTC	0.583													7	4	---	---	---	---	
AKAP6	9472	broad.mit.edu	37	14	33069814	33069814	+	Intron	DEL	T	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:33069814delT	uc001wrq.2	+						AKAP6_uc010aml.2_Intron	NM_004274	NP_004265	Q13023	AKAP6_HUMAN	A-kinase anchor protein 6						protein targeting	calcium channel complex|nuclear membrane|sarcoplasmic reticulum	protein kinase A binding|receptor binding			breast(6)|ovary(5)|lung(4)|skin(3)|large_intestine(2)|pancreas(1)	21	Breast(36;0.0388)|Prostate(35;0.15)		LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	GBM - Glioblastoma multiforme(265;0.019)		CAACTTCTGCTTTCCCCTCCT	0.378													4	3	---	---	---	---	
PPP2R5E	5529	broad.mit.edu	37	14	63860435	63860436	+	Intron	DEL	AC	-	-	rs11158489	by1000genomes	TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:63860435_63860436delAC	uc001xgd.1	-						PPP2R5E_uc010tsf.1_Intron|PPP2R5E_uc010tsg.1_Intron|PPP2R5E_uc001xge.2_Intron|PPP2R5E_uc010tsh.1_Intron|PPP2R5E_uc001xgf.1_Intron	NM_006246	NP_006237	Q16537	2A5E_HUMAN	epsilon isoform of regulatory subunit B56,						signal transduction	cytoplasm|intracellular membrane-bounded organelle|protein phosphatase type 2A complex	protein binding|protein phosphatase type 2A regulator activity			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(108;0.00197)|all cancers(60;0.0153)|BRCA - Breast invasive adenocarcinoma(234;0.128)		gtctcaaaaaacaaaaaccaaa	0.109													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	70691210	70691210	+	IGR	DEL	T	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:70691210delT								SLC8A3 (35423 upstream) : ADAM21P1 (21261 downstream)																							GTAAATAGGCTTTTTTTTTTC	0.338													12	6	---	---	---	---	
C14orf145	145508	broad.mit.edu	37	14	81399823	81399823	+	Intron	DEL	T	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:81399823delT	uc001xux.2	-						C14orf145_uc001xuz.2_Intron|C14orf145_uc001xva.1_Intron|C14orf145_uc010ata.1_Intron	NM_152446	NP_689659	Q6ZU80	CE128_HUMAN	hypothetical protein LOC145508							centriole|spindle pole					0				BRCA - Breast invasive adenocarcinoma(234;0.0586)		AGTCAGCAAATTTTTTTtctc	0.080													4	2	---	---	---	---	
SEL1L	6400	broad.mit.edu	37	14	81996790	81996790	+	Intron	DEL	A	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:81996790delA	uc010tvv.1	-						SEL1L_uc001xvo.3_Intron	NM_005065	NP_005056	Q9UBV2	SE1L1_HUMAN	sel-1 suppressor of lin-12-like precursor						Notch signaling pathway	endoplasmic reticulum membrane|integral to membrane	protein binding			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(234;0.0299)		aggaacgaccaaaacagtgAA	0.149													4	2	---	---	---	---	
DYNC1H1	1778	broad.mit.edu	37	14	102476889	102476889	+	Intron	DEL	A	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102476889delA	uc001yks.2	+							NM_001376	NP_001367	Q14204	DYHC1_HUMAN	cytoplasmic dynein 1 heavy chain 1						cytoplasmic mRNA processing body assembly|G2/M transition of mitotic cell cycle|microtubule-based movement|mitotic spindle organization|stress granule assembly|transport	centrosome|cytoplasmic dynein complex|cytosol|Golgi apparatus|microtubule	ATP binding|ATPase activity, coupled|microtubule motor activity|protein binding			ovary(7)|central_nervous_system(2)|pancreas(1)	10						TTCTTCTTGCAGTTCACATGT	0.413													9	4	---	---	---	---	
CDC42BPB	9578	broad.mit.edu	37	14	103486975	103486976	+	Intron	DEL	CA	-	-	rs34086660		TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:103486975_103486976delCA	uc001ymi.1	-							NM_006035	NP_006026	Q9Y5S2	MRCKB_HUMAN	CDC42-binding protein kinase beta						actin cytoskeleton reorganization|establishment or maintenance of cell polarity|intracellular signal transduction	cell leading edge|cell-cell junction|cytoplasm|cytoskeleton	ATP binding|magnesium ion binding|protein serine/threonine kinase activity|small GTPase regulator activity			large_intestine(3)|skin(3)|lung(2)|stomach(1)|breast(1)|ovary(1)	11		Melanoma(154;0.155)		Colorectal(3;0.0129)|READ - Rectum adenocarcinoma(2;0.0419)|Epithelial(152;0.0474)|all cancers(159;0.199)		GGAGTGCAGCCACAGTGGACGG	0.663													27	38	---	---	---	---	
ASPG	374569	broad.mit.edu	37	14	104559997	104559998	+	Intron	INS	-	C	C			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:104559997_104559998insC	uc001yoq.1	+						ASPG_uc001yoo.1_Intron|ASPG_uc001yop.1_Intron|ASPG_uc001yor.1_Intron	NM_001080464	NP_001073933	Q86U10	LPP60_HUMAN	60 kDa lysophospholipase						lipid catabolic process		1-alkyl-2-acetylglycerophosphocholine esterase activity|asparaginase activity|lysophospholipase activity				0						gctgaggtgtgtgggtggggct	0.124													36	16	---	---	---	---	
NUDT14	256281	broad.mit.edu	37	14	105639664	105639675	+	Intron	DEL	CCACCCTCCAAC	-	-	rs61097979		TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105639664_105639675delCCACCCTCCAAC	uc010tyn.1	-						NUDT14_uc001yqi.2_Intron	NM_177533	NP_803877	O95848	NUD14_HUMAN	nudix-type motif 14							cytoplasm	metal ion binding|protein binding|UDP-sugar diphosphatase activity			skin(1)	1		all_cancers(154;0.0336)|all_epithelial(191;0.0729)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.00989)|all cancers(16;0.0114)|Epithelial(46;0.0272)	Epithelial(152;0.047)|OV - Ovarian serous cystadenocarcinoma(161;0.148)|all cancers(159;0.208)		GGCCCTTCTACCACCCTCCAACCCACCCTCTC	0.453										HNSCC(42;0.11)			19	10	---	---	---	---	
ADAM6	8755	broad.mit.edu	37	14	106919168	106919168	+	RNA	DEL	C	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106919168delC	uc010tyt.1	-	245		c.10611delG			uc010tyu.1_Intron					Parts of antibodies, mostly variable regions.												0						ACGTTAACCTCCCCCTCACTG	0.557													20	24	---	---	---	---	
HERC2	8924	broad.mit.edu	37	15	28387836	28387836	+	Intron	DEL	T	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:28387836delT	uc001zbj.2	-							NM_004667	NP_004658	O95714	HERC2_HUMAN	hect domain and RLD 2						DNA repair|intracellular protein transport|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus	guanyl-nucleotide exchange factor activity|heme binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(4)|lung(4)|skin(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	13		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		TTTCTTGAGATTTTTTCATAT	0.428													11	10	---	---	---	---	
CYP19A1	1588	broad.mit.edu	37	15	51520230	51520230	+	Intron	DEL	G	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:51520230delG	uc001zyz.3	-						CYP19A1_uc001zza.3_Intron|CYP19A1_uc001zzb.2_Intron|CYP19A1_uc001zzd.2_Intron|CYP19A1_uc010bey.1_Intron	NM_031226	NP_112503	P11511	CP19A_HUMAN	cytochrome P450, family 19						estrogen biosynthetic process|xenobiotic metabolic process	endoplasmic reticulum membrane|membrane fraction	aromatase activity|electron carrier activity|heme binding|oxygen binding|steroid hydroxylase activity			skin(3)	3				all cancers(107;0.000372)|GBM - Glioblastoma multiforme(94;0.0128)	Aminoglutethimide(DB00357)|Anastrozole(DB01217)|Conjugated Estrogens(DB00286)|Danazol(DB01406)|Diethylstilbestrol(DB00255)|Exemestane(DB00990)|Letrozole(DB01006)|Testolactone(DB00894)|Testosterone(DB00624)	AATGCATGTTGCTCCAAATGC	0.413													4	2	---	---	---	---	
SCG3	29106	broad.mit.edu	37	15	51999668	51999668	+	Intron	DEL	G	-	-	rs77109818	byFrequency	TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:51999668delG	uc002abh.2	+						SCG3_uc010ufz.1_Intron	NM_013243	NP_037375	Q8WXD2	SCG3_HUMAN	secretogranin III isoform 1 precursor						platelet activation|platelet degranulation	extracellular region|stored secretory granule				ovary(1)	1				all cancers(107;0.00488)		GGGTCAGGAAGACCCAAGTAG	0.423													4	2	---	---	---	---	
RPLP1	6176	broad.mit.edu	37	15	69746382	69746383	+	Intron	INS	-	T	T			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:69746382_69746383insT	uc002asd.1	+						RPLP1_uc002ase.1_Intron	NM_001003	NP_000994	P05386	RLA1_HUMAN	ribosomal protein P1 isoform 1						endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosolic large ribosomal subunit	protein binding|RNA binding|structural constituent of ribosome				0						ttttctttttcttttttttttc	0.163													4	3	---	---	---	---	
IL16	3603	broad.mit.edu	37	15	81565264	81565266	+	Intron	DEL	TGT	-	-	rs67106640		TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:81565264_81565266delTGT	uc002bgh.3	+						IL16_uc002bgc.2_Intron|IL16_uc010blq.1_Intron|IL16_uc002bge.3_Intron|IL16_uc010unp.1_Intron|IL16_uc002bgg.2_Intron	NM_172217	NP_757366	Q14005	IL16_HUMAN	interleukin 16 isoform 2						immune response|interspecies interaction between organisms|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|extracellular space|nucleus|plasma membrane	cytokine activity			ovary(2)|lung(1)|skin(1)	4						ttgttgttggtgttgttgttgtt	0.453													4	2	---	---	---	---	
AKAP13	11214	broad.mit.edu	37	15	86261185	86261185	+	Intron	DEL	T	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:86261185delT	uc002blv.1	+						AKAP13_uc002blu.1_Intron|AKAP13_uc010bnf.1_Intron|AKAP13_uc002blw.1_Intron|AKAP13_uc002blx.1_Intron	NM_007200	NP_009131	Q12802	AKP13_HUMAN	A-kinase anchor protein 13 isoform 2						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|membrane|membrane fraction|nucleus	cAMP-dependent protein kinase activity|metal ion binding|protein binding|Rho guanyl-nucleotide exchange factor activity|signal transducer activity			central_nervous_system(3)|kidney(2)|urinary_tract(1)|liver(1)|skin(1)|ovary(1)	9						CAACATAGGCTTATTTTACAG	0.348													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	90289735	90289736	+	IGR	DEL	CA	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90289735_90289736delCA								WDR93 (2867 upstream) : MESP1 (3364 downstream)																							gccccgcctccacacacacaca	0.040													10	5	---	---	---	---	
TARSL2	123283	broad.mit.edu	37	15	102242194	102242194	+	Intron	DEL	T	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:102242194delT	uc002bxm.2	-						TARSL2_uc002bxl.2_Intron|TARSL2_uc010usi.1_Intron	NM_152334	NP_689547	A2RTX5	SYTC2_HUMAN	threonyl-tRNA synthetase-like 2						threonyl-tRNA aminoacylation	cytoplasm	ATP binding|threonine-tRNA ligase activity			ovary(2)	2	Lung NSC(78;0.000991)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.000268)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			AACAACTTTATTTTTTATCAT	0.149													4	2	---	---	---	---	
LUC7L	55692	broad.mit.edu	37	16	239633	239633	+	Intron	DEL	A	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:239633delA	uc002cgc.1	-						LUC7L_uc002cga.1_3'UTR|LUC7L_uc002cgd.1_Intron|LUC7L_uc002cge.1_Intron|LUC7L_uc002cgb.1_Intron	NM_201412	NP_958815	Q9NQ29	LUC7L_HUMAN	LUC7-like isoform b								metal ion binding			central_nervous_system(1)	1		all_cancers(16;1.1e-06)|all_epithelial(16;2.71e-06)|Hepatocellular(16;0.000105)|Lung NSC(18;0.0138)|all_lung(18;0.0306)				AACACAATGGAAAAAAAAATA	0.279													4	2	---	---	---	---	
MGRN1	23295	broad.mit.edu	37	16	4727318	4727318	+	Intron	DEL	A	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4727318delA	uc002cwz.2	+						MGRN1_uc002cxa.2_Intron|MGRN1_uc010btx.2_Intron|MGRN1_uc010btw.2_Intron|MGRN1_uc002cxb.2_Intron|MGRN1_uc010uxo.1_Intron|MGRN1_uc010uxp.1_Intron|MGRN1_uc010uxq.1_Intron	NM_001142290	NP_001135762	O60291	MGRN1_HUMAN	mahogunin, ring finger 1 isoform 3						endosome to lysosome transport|negative regulation of cAMP-mediated signaling|negative regulation of G-protein coupled receptor protein signaling pathway|protein monoubiquitination	cytosol|early endosome|nucleus|plasma membrane|plasma membrane	protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)|skin(1)	2						aaactaAAAGAAAAAAAAAAG	0.318													7	6	---	---	---	---	
CLEC16A	23274	broad.mit.edu	37	16	11064804	11064813	+	Intron	DEL	CTGTCCCTTT	-	-	rs111655489		TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:11064804_11064813delCTGTCCCTTT	uc002dao.2	+						CLEC16A_uc002dan.3_Intron	NM_015226	NP_056041	Q2KHT3	CL16A_HUMAN	C-type lectin domain family 16, member A											ovary(1)|central_nervous_system(1)	2						CTTTGCCTTCCTGTCCCTTTCTACATGCCC	0.290													6	4	---	---	---	---	
CLEC16A	23274	broad.mit.edu	37	16	11154578	11154579	+	Intron	DEL	TT	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:11154578_11154579delTT	uc002dao.2	+						CLEC16A_uc002dan.3_Intron	NM_015226	NP_056041	Q2KHT3	CL16A_HUMAN	C-type lectin domain family 16, member A											ovary(1)|central_nervous_system(1)	2						CCCCCTTTGATTTTTTTTTTTC	0.421													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	21902060	21902061	+	Intron	INS	-	AAA	AAA			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:21902060_21902061insAAA	uc002djs.3	-						uc010vbo.1_Intron|uc002dju.1_5'Flank					Homo sapiens cDNA FLJ45371 fis, clone BRHIP3017855, highly  similar to Homo sapiens nuclear pore complex interacting protein (NPIP).																		AAACAAAATAGAAAAAAAAAAA	0.361													4	2	---	---	---	---	
VWA3A	146177	broad.mit.edu	37	16	22163632	22163632	+	Intron	DEL	C	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:22163632delC	uc010vbq.1	+						VWA3A_uc010bxd.2_Intron|VWA3A_uc002dkg.3_Intron|VWA3A_uc010bxe.1_Intron	NM_173615	NP_775886	A6NCI4	VWA3A_HUMAN	von Willebrand factor A domain containing 3A							extracellular region				skin(1)	1				GBM - Glioblastoma multiforme(48;0.0439)		TTCCCTCAAGCAGCAGCAGTT	0.532													3	3	---	---	---	---	
NLRC5	84166	broad.mit.edu	37	16	57111993	57111994	+	Intron	INS	-	G	G	rs142860883	by1000genomes	TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57111993_57111994insG	uc002ekk.1	+						NLRC5_uc010ccr.1_Intron|NLRC5_uc010ccs.1_Intron|NLRC5_uc002eko.1_Intron|NLRC5_uc002ekq.1_Intron|NLRC5_uc002ekr.1_Intron	NM_032206	NP_115582	Q86WI3	NLRC5_HUMAN	nucleotide-binding oligomerization domains 27						defense response to virus|innate immune response|negative regulation of NF-kappaB transcription factor activity|negative regulation of type I interferon production|negative regulation of type I interferon-mediated signaling pathway|positive regulation of interferon-gamma-mediated signaling pathway|positive regulation of MHC class I biosynthetic process|positive regulation of transcription from RNA polymerase II promoter|positive regulation of type I interferon-mediated signaling pathway|regulation of kinase activity	cytosol|nucleus	ATP binding|protein binding|RNA polymerase II core promoter sequence-specific DNA binding			ovary(4)|skin(2)|breast(1)	7		all_neural(199;0.225)				TCGGGAGCAGTGGGGGGGTCCA	0.649													19	11	---	---	---	---	
GPR97	222487	broad.mit.edu	37	16	57722561	57722561	+	3'UTR	DEL	C	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57722561delC	uc002emh.2	+	12					GPR97_uc010vhv.1_3'UTR|GPR97_uc010cdd.2_RNA|GPR97_uc010cde.2_3'UTR	NM_170776	NP_740746	Q86Y34	GPR97_HUMAN	G protein-coupled receptor 97 precursor						neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(1)	1						GTCCAAGAGTCCACGTAAGCA	0.299													4	2	---	---	---	---	
LOC283867	283867	broad.mit.edu	37	16	65397216	65397217	+	Intron	INS	-	C	C			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:65397216_65397217insC	uc010cdo.1	-						LOC283867_uc010cdp.1_Intron|LOC283867_uc002eol.1_Intron					Homo sapiens cDNA clone IMAGE:5276218.												0				OV - Ovarian serous cystadenocarcinoma(108;0.17)		ACACCATTAGTTTTGTGCGAAG	0.361													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	66377387	66377387	+	IGR	DEL	G	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:66377387delG								LOC283867 (767184 upstream) : CDH5 (23138 downstream)																							CTCTGCCAGAGACCATGAATT	0.547													4	2	---	---	---	---	
TSNAXIP1	55815	broad.mit.edu	37	16	67854645	67854645	+	Intron	DEL	A	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67854645delA	uc002euj.2	+						TSNAXIP1_uc010cep.2_Intron|TSNAXIP1_uc010vjz.1_Intron|TSNAXIP1_uc002euf.3_Intron|TSNAXIP1_uc010vka.1_Intron|TSNAXIP1_uc010vkb.1_Intron|TSNAXIP1_uc002eug.3_Intron|TSNAXIP1_uc002euh.3_Intron|TSNAXIP1_uc002eui.3_Intron|TSNAXIP1_uc002euk.2_5'Flank	NM_018430	NP_060900	Q2TAA8	TXIP1_HUMAN	translin-associated factor X interacting protein						cell differentiation|multicellular organismal development|spermatogenesis	perinuclear region of cytoplasm					0		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00432)|Epithelial(162;0.0192)|all cancers(182;0.125)		agactgtctcaaaaaaaaaaa	0.254													7	5	---	---	---	---	
TERF2	7014	broad.mit.edu	37	16	69404722	69404723	+	Intron	DEL	TA	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:69404722_69404723delTA	uc002exd.2	-						TERF2_uc002exe.2_Intron	NM_005652	NP_005643	Q15554	TERF2_HUMAN	telomeric repeat binding factor 2						age-dependent telomere shortening|cell cycle|cellular senescence|negative regulation of telomere maintenance via semi-conservative replication|protection from non-homologous end joining at telomere|protein localization to chromosome, telomeric region|regulation of transcription, DNA-dependent|telomeric loop formation	Golgi apparatus|nuclear telomere cap complex|nucleoplasm	double-stranded telomeric DNA binding|protein C-terminus binding|protein homodimerization activity			lung(1)	1		Ovarian(137;0.101)				agtgggttactatgcagctata	0.149													4	2	---	---	---	---	
PHLPP2	23035	broad.mit.edu	37	16	71688953	71688953	+	Intron	DEL	C	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:71688953delC	uc002fax.2	-						PHLPP2_uc002fav.2_Intron|PHLPP2_uc010cgf.2_Intron	NM_015020	NP_055835	Q6ZVD8	PHLP2_HUMAN	PH domain and leucine rich repeat protein							cytoplasm|membrane|nucleus	metal ion binding|phosphoprotein phosphatase activity			ovary(1)|central_nervous_system(1)	2						AAACAGATGACCCCCACAGGC	0.284													4	2	---	---	---	---	
VAT1L	57687	broad.mit.edu	37	16	77850964	77850966	+	Intron	DEL	AAT	-	-	rs2966053	by1000genomes	TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:77850964_77850966delAAT	uc002ffg.1	+							NM_020927	NP_065978	Q9HCJ6	VAT1L_HUMAN	vesicle amine transport protein 1 homolog (T.								oxidoreductase activity|zinc ion binding			central_nervous_system(1)	1						TTTGGCTCTCAATTGAAGAGTAA	0.419													10	7	---	---	---	---	
OSGIN1	29948	broad.mit.edu	37	16	83984410	83984411	+	Intron	DEL	GT	-	-	rs72371417		TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:83984410_83984411delGT	uc002fha.2	+						OSGIN1_uc002fhb.2_Intron|OSGIN1_uc002fhc.2_5'Flank	NM_013370	NP_037502	Q9UJX0	OSGI1_HUMAN	oxidative stress induced growth inhibitor 1						cell differentiation|multicellular organismal development|negative regulation of cell growth		growth factor activity				0						actggcacacgtacacacatgc	0.030													5	7	---	---	---	---	
DOC2B	8447	broad.mit.edu	37	17	9669	9670	+	Intron	DEL	CA	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:9669_9670delCA	uc010vpx.1	-							NM_003585	NP_003576	Q14184	DOC2B_HUMAN	double C2-like domains, beta						calcium ion-dependent exocytosis of neurotransmitter|positive regulation of calcium ion-dependent exocytosis|positive regulation of insulin secretion|positive regulation of vesicle fusion|protein localization	plasma membrane|synaptic vesicle	calcium-dependent phospholipid binding|transporter activity				0						cacacacgagcacacacacaca	0.144													9	5	---	---	---	---	
STX8	9482	broad.mit.edu	37	17	9394345	9394345	+	Intron	DEL	T	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:9394345delT	uc002glx.2	-							NM_004853	NP_004844	Q9UNK0	STX8_HUMAN	syntaxin 8						transport	endoplasmic reticulum|integral to plasma membrane				central_nervous_system(1)	1						CTCCACGCTGTCACACGTCAC	0.438													4	2	---	---	---	---	
WDR16	146845	broad.mit.edu	37	17	9479808	9479808	+	5'Flank	DEL	A	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:9479808delA	uc002gly.2	+						STX8_uc002glx.2_5'Flank|WDR16_uc002glz.2_5'Flank|WDR16_uc010coc.2_5'Flank	NM_145054	NP_659491	Q8N1V2	WDR16_HUMAN	WD40-repeat protein upregulated in HCC isoform							cytoplasm|intracellular membrane-bounded organelle	protein binding			skin(2)|ovary(1)|central_nervous_system(1)	4						GAAATAGCACAAAAAAAAAGA	0.448													9	4	---	---	---	---	
LGALS9C	654346	broad.mit.edu	37	17	18387617	18387617	+	Intron	DEL	A	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18387617delA	uc002gtw.2	+						LGALS9C_uc010vyb.1_Intron	NM_001040078	NP_001035167	Q6DKI2	LEG9C_HUMAN	galectin 9 like								sugar binding			ovary(1)	1						tccgtttcccataactgctct	0.154													10	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	25268526	25268529	+	IGR	DEL	TGAG	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25268526_25268529delTGAG								None (None upstream) : WSB1 (352577 downstream)																							ACCAGTCAACTGAGTAATTCACTG	0.382													10	9	---	---	---	---	
SOST	50964	broad.mit.edu	37	17	41837506	41837508	+	5'Flank	DEL	TCC	-	-	rs138986602		TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41837506_41837508delTCC	uc002iec.1	-							NM_025237	NP_079513	Q9BQB4	SOST_HUMAN	sclerostin precursor						negative regulation of BMP signaling pathway|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of ossification|negative regulation of protein complex assembly|negative regulation of Wnt receptor signaling pathway involved in dorsal/ventral axis specification|Wnt receptor signaling pathway		heparin binding|protein binding				0		Breast(137;0.00725)		UCEC - Uterine corpus endometrioid carcinoma (308;0.177)|BRCA - Breast invasive adenocarcinoma(366;0.0741)		CAGCCGACTGTCCTCCTTTCCAT	0.547											OREG0024440	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	8	5	---	---	---	---	
ITGB3	3690	broad.mit.edu	37	17	45377704	45377705	+	Intron	INS	-	GT	GT	rs145406552		TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45377704_45377705insGT	uc002ilj.2	+						ITGB3_uc010wkr.1_Intron	NM_000212	NP_000203	P05106	ITB3_HUMAN	integrin beta chain, beta 3 precursor						activation of protein kinase activity|angiogenesis involved in wound healing|axon guidance|cell-matrix adhesion|integrin-mediated signaling pathway|interspecies interaction between organisms|leukocyte migration|negative regulation of lipid storage|negative regulation of lipid transport|negative regulation of lipoprotein metabolic process|negative regulation of low-density lipoprotein particle receptor biosynthetic process|negative regulation of macrophage derived foam cell differentiation|platelet activation|platelet degranulation|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of vascular endothelial growth factor receptor signaling pathway|regulation of bone resorption|smooth muscle cell migration|tube development	alphav-beta3 integrin-vitronectin complex|integrin complex|platelet alpha granule membrane	cell adhesion molecule binding|identical protein binding|platelet-derived growth factor receptor binding|receptor activity|vascular endothelial growth factor receptor 2 binding			central_nervous_system(5)|large_intestine(1)	6					Abciximab(DB00054)|Tirofiban(DB00775)	CTTACAGGCGCGCGCGCGCgtg	0.520													12	8	---	---	---	---	
SFRS1	6426	broad.mit.edu	37	17	56084225	56084225	+	Intron	DEL	T	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56084225delT	uc002ivi.2	-						SFRS1_uc002ivj.2_Intron	NM_006924	NP_008855	Q07955	SRSF1_HUMAN	splicing factor, arginine/serine-rich 1 isoform						mRNA 3'-end processing|mRNA export from nucleus|nuclear mRNA 5'-splice site recognition|termination of RNA polymerase II transcription	catalytic step 2 spliceosome|cytoplasm|nuclear speck	nucleotide binding|RNA binding				0		Colorectal(1115;0.0691)		LUAD - Lung adenocarcinoma(1115;0.247)		CGCTTCCCCGTTCTCTATGTT	0.597													46	49	---	---	---	---	
PPM1D	8493	broad.mit.edu	37	17	58733835	58733835	+	Intron	DEL	A	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:58733835delA	uc002iyt.1	+						PPM1D_uc010ddm.1_Intron	NM_003620	NP_003611	O15297	PPM1D_HUMAN	protein phosphatase 1D						negative regulation of cell proliferation|protein dephosphorylation|response to radiation	nucleus|protein serine/threonine phosphatase complex	metal ion binding|protein binding|protein serine/threonine phosphatase activity			upper_aerodigestive_tract(1)	1	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;6.75e-12)|all cancers(12;1.96e-10)			aagagaaaagaaaaaaaaaAA	0.174													4	2	---	---	---	---	
BCAS3	54828	broad.mit.edu	37	17	59446011	59446012	+	Intron	INS	-	G	G			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:59446011_59446012insG	uc002iyv.3	+						BCAS3_uc002iyu.3_Intron|BCAS3_uc002iyw.3_Intron|BCAS3_uc002iyy.3_Intron|BCAS3_uc002iyz.3_Intron|BCAS3_uc002iza.3_Intron|BCAS3_uc002izb.3_Intron|BCAS3_uc002izc.3_Intron|BCAS3_uc002izd.3_Intron	NM_001099432	NP_001092902	Q9H6U6	BCAS3_HUMAN	breast carcinoma amplified sequence 3 isoform 1							nucleus				ovary(2)|central_nervous_system(2)|skin(1)	5			BRCA - Breast invasive adenocarcinoma(1;3.11e-12)|Epithelial(12;8.2e-07)|all cancers(12;5.33e-06)			GCTCTGGTGTTGGGAAACCCTG	0.515													4	2	---	---	---	---	
CDK3	1018	broad.mit.edu	37	17	73987783	73987787	+	Intron	DEL	GGCTC	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73987783_73987787delGGCTC	uc002jqg.3	+						C17orf106_uc010dgs.1_Intron	NM_001258	NP_001249	Q00526	CDK3_HUMAN	cyclin-dependent kinase 3						cell division|cell proliferation|mitosis		ATP binding|cyclin-dependent protein kinase activity			central_nervous_system(1)	1						GTGAGAAATGGGCTCGTGACCCAAC	0.541													6	11	---	---	---	---	
SEC14L1	6397	broad.mit.edu	37	17	75187626	75187626	+	Intron	DEL	T	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:75187626delT	uc002jto.2	+						SEC14L1_uc010dhc.2_Intron|SEC14L1_uc010wth.1_Intron|SEC14L1_uc002jtm.2_Intron|SEC14L1_uc010wti.1_Intron	NM_003003	NP_002994	Q92503	S14L1_HUMAN	SEC14 (S. cerevisiae)-like 1 isoform a						transport	Golgi apparatus|integral to membrane	binding			ovary(2)	2						TTTGGttttgttttttttttc	0.239													3	3	---	---	---	---	
DNAH17	8632	broad.mit.edu	37	17	76456444	76456447	+	Intron	DEL	GCAC	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76456444_76456447delGCAC	uc010dhp.1	-						DNAH17_uc002jvs.2_Intron					SubName: Full=DNAH17 variant protein; Flags: Fragment;											ovary(6)|breast(2)|skin(1)	9			BRCA - Breast invasive adenocarcinoma(99;0.00294)|OV - Ovarian serous cystadenocarcinoma(97;0.0656)			gtgcatgtatgcacgtgcatgagt	0.196													41	23	---	---	---	---	
CD7	924	broad.mit.edu	37	17	80274162	80274162	+	Frame_Shift_Del	DEL	G	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80274162delG	uc002kel.1	-	3	630	c.521delC	c.(520-522)CCAfs	p.P174fs	CD7_uc010din.2_Frame_Shift_Del_p.P174fs|CD7_uc002kem.2_3'UTR|CD7_uc010wvk.1_3'UTR	NM_006137	NP_006128	P09564	CD7_HUMAN	CD7 antigen precursor	174	4.|Extracellular (Probable).|4 X 9 AA tandem repeats, potential spacer function.				immune response|T cell activation|transmembrane receptor protein tyrosine kinase signaling pathway	integral to membrane|membrane fraction|plasma membrane	receptor activity				0	Breast(20;0.000675)|all_neural(118;0.0804)|Lung NSC(278;0.128)|all_lung(278;0.145)|Ovarian(332;0.249)		OV - Ovarian serous cystadenocarcinoma(97;0.00463)|BRCA - Breast invasive adenocarcinoma(99;0.0667)			AGAGGCTGCTGGCGGGTCAGG	0.716													69	30	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	14668542	14668543	+	IGR	INS	-	T	T			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:14668542_14668543insT								POTEC (124943 upstream) : ANKRD30B (79696 downstream)																							ATTGAAGATGAGGACTCCTATG	0.436													4	2	---	---	---	---	
DSC1	1823	broad.mit.edu	37	18	28728328	28728328	+	Intron	DEL	A	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:28728328delA	uc002kwn.2	-						DSC1_uc002kwm.2_Intron	NM_024421	NP_077739	Q08554	DSC1_HUMAN	desmocollin 1 isoform Dsc1a preproprotein						homophilic cell adhesion	desmosome|gap junction|integral to membrane|membrane fraction	calcium ion binding			ovary(3)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(10;0.00778)			TCCTAATGGGAAAAAAAGTGT	0.264													4	2	---	---	---	---	
SETBP1	26040	broad.mit.edu	37	18	42399920	42399920	+	Intron	DEL	A	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:42399920delA	uc010dni.2	+						SETBP1_uc002lay.2_Intron	NM_015559	NP_056374	Q9Y6X0	SETBP_HUMAN	SET binding protein 1 isoform a							nucleus	DNA binding			upper_aerodigestive_tract(2)|large_intestine(1)	3				Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)		CATTCTTTACAAAAAAAAAAG	0.443									Schinzel-Giedion_syndrome				5	3	---	---	---	---	
PTBP1	5725	broad.mit.edu	37	19	810306	810307	+	Intron	INS	-	A	A	rs147256862	by1000genomes	TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:810306_810307insA	uc002lpr.2	+						PTBP1_uc002lpp.2_Intron|PTBP1_uc002lpq.2_Intron|PTBP1_uc002lps.2_Intron|PTBP1_uc002lpt.2_Intron|PTBP1_uc002lpu.1_Intron	NM_031991	NP_114368	P26599	PTBP1_HUMAN	polypyrimidine tract-binding protein 1 isoform						negative regulation of muscle cell differentiation|nuclear mRNA splicing, via spliceosome|regulation of alternative nuclear mRNA splicing, via spliceosome	heterogeneous nuclear ribonucleoprotein complex|nucleolus|nucleoplasm	mRNA binding|nucleotide binding|poly-pyrimidine tract binding|protein binding			kidney(1)|skin(1)	2		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;6.59e-06)|all_lung(49;9.97e-06)|Breast(49;0.000172)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		attccatctggaaaaaaaaaaG	0.208													4	2	---	---	---	---	
ANKRD24	170961	broad.mit.edu	37	19	4209930	4209932	+	Intron	DEL	GCT	-	-	rs66925038		TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4209930_4209932delGCT	uc010dtt.1	+						ANKRD24_uc002lzs.2_Intron|ANKRD24_uc002lzt.2_Intron	NM_133475	NP_597732	Q8TF21	ANR24_HUMAN	ankyrin repeat domain 24												0				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0233)|STAD - Stomach adenocarcinoma(1328;0.181)		GGAGGCAGGGGCTGCTGGTTCCA	0.586													31	15	---	---	---	---	
MUC16	94025	broad.mit.edu	37	19	9080321	9080322	+	Intron	INS	-	A	A			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9080321_9080322insA	uc002mkp.2	-							NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16						cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						aagaaagaaagaaagaaagaaa	0.059													9	4	---	---	---	---	
ZNF85	7639	broad.mit.edu	37	19	21131290	21131290	+	Intron	DEL	T	-	-	rs113433025		TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:21131290delT	uc002npg.3	+						ZNF85_uc010ecn.2_Intron|ZNF85_uc010eco.2_Intron|ZNF85_uc002npi.2_Intron	NM_003429	NP_003420	Q03923	ZNF85_HUMAN	zinc finger protein 85							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity|zinc ion binding			central_nervous_system(1)	1						TGTAACAAACTTTTTTTTTCC	0.353													3	3	---	---	---	---	
ZNF493	284443	broad.mit.edu	37	19	21607481	21607482	+	Frame_Shift_Del	DEL	AA	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:21607481_21607482delAA	uc002npx.2	+	2	1916_1917	c.1636_1637delAA	c.(1636-1638)AAAfs	p.K546fs	ZNF493_uc002npw.2_Frame_Shift_Del_p.K674fs|ZNF493_uc002npy.2_Frame_Shift_Del_p.K546fs	NM_175910	NP_787106	Q6ZR52	ZN493_HUMAN	zinc finger protein 493 isoform 1	546	C2H2-type 19.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						AACCCTTACTAAACATAAGATA	0.361													4	2	---	---	---	---	
DMKN	93099	broad.mit.edu	37	19	35993607	35993607	+	Intron	DEL	A	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35993607delA	uc002nzm.3	-						DMKN_uc002nzi.3_5'Flank|DMKN_uc002nzj.2_Intron|DMKN_uc002nzk.3_Intron|DMKN_uc002nzl.3_Intron|DMKN_uc002nzo.3_Intron|DMKN_uc002nzn.3_Intron|DMKN_uc002nzw.2_Intron|DMKN_uc002nzr.2_Intron|DMKN_uc002nzp.2_Intron|DMKN_uc002nzq.2_Intron|DMKN_uc002nzt.2_Intron|DMKN_uc002nzs.2_Intron|DMKN_uc002nzu.2_Intron|DMKN_uc002nzv.2_Intron|DMKN_uc010xsv.1_Intron|DMKN_uc010xsw.1_Intron	NM_033317	NP_201574	Q6E0U4	DMKN_HUMAN	dermokine isoform 2 precursor							extracellular region				large_intestine(1)|ovary(1)|skin(1)	3	all_lung(56;1.89e-08)|Lung NSC(56;2.9e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)			actctgtctcaaaaaaaaaaa	0.289													19	11	---	---	---	---	
CYP2F1	1572	broad.mit.edu	37	19	42027168	42027169	+	Intron	DEL	AG	-	-	rs10417174		TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42027168_42027169delAG	uc010xvw.1	+									P24903	CP2F1_HUMAN	SubName: Full=cDNA FLJ51986, highly similar to Homo sapiens cytochrome P450, family 2, subfamily F, polypeptide 1 (CYP2F1), mRNA;						naphthalene metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding|oxygen binding				0						TGTTAAAAAAAGAAAAAAAAGA	0.322													4	3	---	---	---	---	
DMRTC2	63946	broad.mit.edu	37	19	42354148	42354148	+	Intron	DEL	A	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42354148delA	uc002ors.2	+						DMRTC2_uc002orr.1_Intron|DMRTC2_uc010xwe.1_Intron	NM_001040283	NP_001035373	Q8IXT2	DMRTD_HUMAN	DMRT-like family C2						cell differentiation|sex differentiation	nucleus	DNA binding|metal ion binding|sequence-specific DNA binding transcription factor activity				0						agcctgtctcaaaaaaaaaaa	0.164													9	8	---	---	---	---	
MYH14	79784	broad.mit.edu	37	19	50752730	50752731	+	Intron	INS	-	GT	GT	rs146824061		TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50752730_50752731insGT	uc002prr.1	+						MYH14_uc010enu.1_Intron|MYH14_uc002prq.1_Intron	NM_024729	NP_079005	Q7Z406	MYH14_HUMAN	myosin, heavy chain 14 isoform 2						axon guidance|regulation of cell shape	myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			central_nervous_system(1)	1		all_neural(266;0.0571)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00389)|GBM - Glioblastoma multiforme(134;0.0195)		cctgtctctggctctgtcccct	0.000													11	16	---	---	---	---	
POLD1	5424	broad.mit.edu	37	19	50911948	50911948	+	Intron	DEL	T	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50911948delT	uc002psb.3	+						POLD1_uc002psc.3_Intron|POLD1_uc010enx.2_Intron|POLD1_uc010eny.2_Intron	NM_002691	NP_002682	P28340	DPOD1_HUMAN	DNA-directed DNA polymerase delta 1						base-excision repair, gap-filling|DNA replication proofreading|DNA replication, removal of RNA primer|DNA synthesis involved in DNA repair|nucleotide-excision repair, DNA gap filling|regulation of mitotic cell cycle|response to UV|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	delta DNA polymerase complex|nucleoplasm|nucleotide-excision repair complex	3'-5'-exodeoxyribonuclease activity|chromatin binding|DNA binding|DNA-directed DNA polymerase activity|metal ion binding|nucleotide binding|protein binding			upper_aerodigestive_tract(1)|central_nervous_system(1)	2		all_neural(266;0.0571)		OV - Ovarian serous cystadenocarcinoma(262;0.00794)|GBM - Glioblastoma multiforme(134;0.0195)		cAATGAATGATTTTTTTTTTT	0.313								DNA_polymerases_(catalytic_subunits)					23	10	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	53716504	53716505	+	IGR	DEL	AC	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53716504_53716505delAC								ZNF665 (19885 upstream) : ZNF677 (22133 downstream)																							GAGAAATCCTACAGATGTCATG	0.391													4	2	---	---	---	---	
NLRP2	55655	broad.mit.edu	37	19	55502269	55502269	+	Intron	DEL	T	-	-	rs66496541		TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55502269delT	uc002qij.2	+						NLRP2_uc010yfp.1_Intron|NLRP2_uc010esn.2_Intron|NLRP2_uc010eso.2_Intron|NLRP2_uc010esp.2_Intron	NM_017852	NP_060322	Q9NX02	NALP2_HUMAN	NLR family, pyrin domain containing 2						apoptosis|positive regulation of caspase activity|positive regulation of interleukin-1 beta secretion	cytoplasm	ATP binding|Pyrin domain binding			ovary(1)|skin(1)	2			BRCA - Breast invasive adenocarcinoma(297;0.163)	GBM - Glioblastoma multiforme(193;0.028)		GGTTTTCGGGttttttttttc	0.194													4	2	---	---	---	---	
ZNF471	57573	broad.mit.edu	37	19	57022721	57022721	+	Intron	DEL	A	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57022721delA	uc002qnh.2	+							NM_020813	NP_065864	Q9BX82	ZN471_HUMAN	zinc finger protein 471						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			large_intestine(1)|ovary(1)	2		Colorectal(82;5.46e-05)|Ovarian(87;0.0822)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0307)		CTCAAGCATGAAAAAAAAAAA	0.373													3	6	---	---	---	---	
ATRN	8455	broad.mit.edu	37	20	3592091	3592092	+	Intron	INS	-	A	A			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3592091_3592092insA	uc002wim.2	+						ATRN_uc002wil.2_Intron	NM_139321	NP_647537	O75882	ATRN_HUMAN	attractin isoform 1						inflammatory response	extracellular space|integral to plasma membrane	receptor activity|sugar binding			ovary(1)|breast(1)	2						tgatcggcatcaataaccatta	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	8917496	8917496	+	IGR	DEL	T	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:8917496delT								PLCB1 (51951 upstream) : PLCB4 (132205 downstream)																							TTTTCTTTTCTTTTTTTTTTT	0.388													10	5	---	---	---	---	
PLK1S1	55857	broad.mit.edu	37	20	21143767	21143767	+	Frame_Shift_Del	DEL	A	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:21143767delA	uc002wsb.2	+	6	1452	c.1319delA	c.(1318-1320)GAAfs	p.E440fs	PLK1S1_uc010zsh.1_Frame_Shift_Del_p.E337fs|PLK1S1_uc010zsi.1_Frame_Shift_Del_p.E307fs|PLK1S1_uc010zsj.1_RNA|uc002wsc.2_Intron|PLK1S1_uc002wsd.2_RNA	NM_018474	NP_060944	Q2M2Z5	KIZ_HUMAN	polo-like kinase 1 substrate 1 isoform 1	440					spindle organization	centrosome	protein kinase binding				0						CCTGATTCAGAAAAGGAATCC	0.368													4	2	---	---	---	---	
NINL	22981	broad.mit.edu	37	20	25436620	25436620	+	Intron	DEL	T	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25436620delT	uc002wux.1	-						NINL_uc010gdn.1_Intron|NINL_uc002wuw.1_Intron	NM_025176	NP_079452	Q9Y2I6	NINL_HUMAN	ninein-like						G2/M transition of mitotic cell cycle	cytosol|microtubule|microtubule organizing center	calcium ion binding			ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5						taatcccagctacttgggagg	0.000													7	7	---	---	---	---	
NINL	22981	broad.mit.edu	37	20	25436622	25436623	+	Intron	INS	-	T	T			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25436622_25436623insT	uc002wux.1	-						NINL_uc010gdn.1_Intron|NINL_uc002wuw.1_Intron	NM_025176	NP_079452	Q9Y2I6	NINL_HUMAN	ninein-like						G2/M transition of mitotic cell cycle	cytosol|microtubule|microtubule organizing center	calcium ion binding			ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5						atcccagctacttgggaggctg	0.000													8	6	---	---	---	---	
FAM182B	728882	broad.mit.edu	37	20	25829595	25829596	+	Intron	INS	-	GAA	GAA	rs143279219	by1000genomes	TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25829595_25829596insGAA	uc002wvd.1	-						FAM182B_uc002wve.2_Intron					Homo sapiens cDNA FLJ30282 fis, clone BRACE2002803.												0						ctagaaggaaggaagacaagac	0.000													7	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	31994060	31994060	+	IGR	DEL	A	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31994060delA								CDK5RAP1 (4723 upstream) : SNTA1 (1703 downstream)																							TCATTTTCACAAAGAAACAAT	0.333													4	2	---	---	---	---	
ZNF341	84905	broad.mit.edu	37	20	32362191	32362191	+	Intron	DEL	A	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:32362191delA	uc002wzy.2	+						ZNF341_uc002wzx.2_Intron|ZNF341_uc010geq.2_Intron|ZNF341_uc010ger.2_Intron	NM_032819	NP_116208	Q9BYN7	ZN341_HUMAN	zinc finger protein 341						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2						ACAATTTTGTAAAAACCCACA	0.284													4	2	---	---	---	---	
SPAG4	6676	broad.mit.edu	37	20	34207053	34207054	+	Intron	INS	-	C	C			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:34207053_34207054insC	uc002xdb.1	+						SPAG4_uc010zvi.1_Intron	NM_003116	NP_003107	Q9NPE6	SPAG4_HUMAN	sperm associated antigen 4						spermatogenesis	cilium|flagellar axoneme|integral to membrane	structural molecule activity				0	Lung NSC(9;0.0053)|all_lung(11;0.00785)		BRCA - Breast invasive adenocarcinoma(18;0.0127)			cagcccccgcgcccccgcgccc	0.406													31	16	---	---	---	---	
SRC	6714	broad.mit.edu	37	20	36025654	36025654	+	Intron	DEL	T	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:36025654delT	uc002xgx.2	+						SRC_uc002xgy.2_Intron	NM_005417	NP_005408	P12931	SRC_HUMAN	proto-oncogene tyrosine-protein kinase SRC						axon guidance|bone resorption|cell junction assembly|cellular membrane organization|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|interspecies interaction between organisms|intracellular protein kinase cascade|leukocyte migration|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of integrin activation|Ras protein signal transduction|regulation of bone resorption|regulation of vascular permeability|response to interleukin-1|signal complex assembly|T cell costimulation	caveola|cytosol|mitochondrial inner membrane	ATP binding|heme binding|integrin binding|ion channel binding|non-membrane spanning protein tyrosine kinase activity|SH2 domain binding|SH3/SH2 adaptor activity			large_intestine(10)|lung(1)|central_nervous_system(1)|endometrium(1)	13		Myeloproliferative disorder(115;0.00878)			Dasatinib(DB01254)	tcttccctacttaacccctca	0.000													4	2	---	---	---	---	
DNTTIP1	116092	broad.mit.edu	37	20	44430268	44430268	+	Intron	DEL	A	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44430268delA	uc002xpk.2	+							NM_052951	NP_443183	Q9H147	TDIF1_HUMAN	terminal deoxynucleotidyltransferase interacting							nucleus				ovary(1)|central_nervous_system(1)	2		Myeloproliferative disorder(115;0.0122)				tctctaaaataaaaaaaaaat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	46871944	46871944	+	IGR	DEL	T	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:46871944delT								SULF2 (456584 upstream) : LOC284749 (116710 downstream)																							TGGCAAATAATTTTTTTTTTG	0.403													11	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	62737127	62737151	+	IGR	DEL	ATGATGATGGGGGGTGATGATGGGC	-	-	rs111903824		TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62737127_62737151delATGATGATGGGGGGTGATGATGGGC								OPRL1 (5136 upstream) : NPBWR2 (33 downstream)																							gatgggcgtgatgatgatggggggtgatgatgggcatgatgatgg	0.249													29	18	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	30369860	30369860	+	IGR	DEL	T	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:30369860delT								RNF160 (4583 upstream) : RWDD2B (8222 downstream)																							TTAAGATGTATTTTTTTGGGG	0.269													4	2	---	---	---	---	
URB1	9875	broad.mit.edu	37	21	33756019	33756019	+	Intron	DEL	A	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:33756019delA	uc002ypn.2	-							NM_014825	NP_055640	O60287	NPA1P_HUMAN	URB1 ribosome biogenesis 1 homolog							nucleolus	protein binding				0						AAGGAAAAAGAAAAAAAAAAG	0.328													6	3	---	---	---	---	
CRYZL1	9946	broad.mit.edu	37	21	34975523	34975524	+	Intron	DEL	CA	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:34975523_34975524delCA	uc011adw.1	-						DONSON_uc002ysn.1_Intron|CRYZL1_uc002ysr.1_Intron|CRYZL1_uc002yss.1_Intron|CRYZL1_uc002yst.1_Intron	NM_145858	NP_665857	O95825	QORL1_HUMAN	crystallin, zeta-like 1						quinone cofactor metabolic process	cytosol	NADP binding|NADPH:quinone reductase activity|zinc ion binding				0						ATAAACTAATCACACTAAATCT	0.317													4	2	---	---	---	---	
TRPM2	7226	broad.mit.edu	37	21	45824752	45824753	+	Intron	INS	-	TGA	TGA			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45824752_45824753insTGA	uc002zet.1	+						TRPM2_uc002zeu.1_Intron|TRPM2_uc002zew.1_Intron|TRPM2_uc010gpt.1_Intron|TRPM2_uc002zex.1_Intron|TRPM2_uc002zey.1_Intron	NM_003307	NP_003298	O94759	TRPM2_HUMAN	transient receptor potential cation channel,							integral to plasma membrane	ADP-ribose diphosphatase activity|calcium channel activity|sodium channel activity			ovary(1)|central_nervous_system(1)|pancreas(1)	3						gacagtgactgtgatgatagtg	0.114													21	17	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	17349802	17349802	+	IGR	DEL	A	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:17349802delA								HSFYL1 (39577 upstream) : GAB4 (93027 downstream)																							TCTAGTAATGAAAAAAAAAAG	0.244													3	3	---	---	---	---	
HPS4	89781	broad.mit.edu	37	22	26861726	26861727	+	Intron	DEL	CC	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26861726_26861727delCC	uc003acl.2	-						HPS4_uc003aci.2_Intron|HPS4_uc003acj.2_Intron|HPS4_uc003ack.2_Intron|HPS4_uc003acn.2_Intron|HPS4_uc010gvd.1_Intron|HPS4_uc003ach.2_5'UTR	NM_022081	NP_071364	Q9NQG7	HPS4_HUMAN	light ear protein isoform a						lysosome organization|positive regulation of eye pigmentation|protein stabilization|protein targeting	lysosome|melanosome|membrane fraction|platelet dense granule	protein homodimerization activity				0						CAACATGACTCCCAGCTTTGGA	0.500									Hermansky-Pudlak_syndrome				4	2	---	---	---	---	
MICALL1	85377	broad.mit.edu	37	22	38308653	38308653	+	Intron	DEL	T	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38308653delT	uc003aui.2	+							NM_033386	NP_203744	Q8N3F8	MILK1_HUMAN	molecule interacting with Rab13							cytoplasm|cytoskeleton	protein binding|zinc ion binding			breast(1)	1	Melanoma(58;0.045)					gaaatatttcttttttttttt	0.154													5	3	---	---	---	---	
ARSA	410	broad.mit.edu	37	22	51067402	51067403	+	5'Flank	DEL	GT	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:51067402_51067403delGT	uc003bnb.3	-						ARSA_uc003bna.3_5'Flank|ARSA_uc003bnc.3_5'Flank|ARSA_uc003bnd.3_5'Flank|ARSA_uc003bmz.3_5'Flank|ARSA_uc010hbf.2_5'Flank	NM_001085426	NP_001078895	P15289	ARSA_HUMAN	arylsulfatase A isoform a precursor							lysosome	arylsulfatase activity|calcium ion binding|cerebroside-sulfatase activity			pancreas(1)|skin(1)	2		all_cancers(38;8.8e-15)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)	Micafungin(DB01141)	ggtggttgaggtgtgtgtgtgt	0.168													4	2	---	---	---	---	
PPP2R3B	28227	broad.mit.edu	37	X	299263	299264	+	Intron	INS	-	C	C			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:299263_299264insC	uc004cpg.2	-						PPP2R3B_uc004cpf.2_Intron	NM_013239	NP_037371	Q9Y5P8	P2R3B_HUMAN	protein phosphatase 2, regulatory subunit B'',						cell cycle arrest|protein dephosphorylation	nucleus|protein phosphatase type 2A complex	calcium ion binding|protein phosphatase type 2A regulator activity|protein serine/threonine phosphatase activity				0		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				acacccgtcctcccactcaccc	0.361													55	24	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	904242	904243	+	IGR	INS	-	CA	CA			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:904242_904243insCA								SHOX (284097 upstream) : CRLF2 (410644 downstream)																							ATTTGCTGGTCCACACACAAGC	0.322													3	4	---	---	---	---	
IL3RA	3563	broad.mit.edu	37	X	1467599	1467600	+	Intron	INS	-	TTTC	TTTC			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1467599_1467600insTTTC	uc004cps.2	+						IL3RA_uc011mhd.1_Intron	NM_002183	NP_002174	P26951	IL3RA_HUMAN	interleukin 3 receptor, alpha precursor							integral to membrane|plasma membrane	interleukin-3 receptor activity			skin(2)|lung(1)	3		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			Sargramostim(DB00020)	ctttctttctgtttctgtttct	0.045													9	6	---	---	---	---	
SMS	6611	broad.mit.edu	37	X	22012650	22012650	+	3'UTR	DEL	T	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:22012650delT	uc004dag.2	+	11					SMS_uc010nfs.2_RNA|SMS_uc010nft.2_3'UTR	NM_004595	NP_004586	P52788	SPSY_HUMAN	spermine synthase						methionine metabolic process|spermine biosynthetic process	cytosol	spermidine synthase activity|spermine synthase activity			ovary(1)	1					Spermine(DB00127)	GCTTAGGGTGTTTTTTTTTTG	0.318													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	37760551	37760552	+	IGR	INS	-	A	A			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:37760551_37760552insA								DYNLT3 (53662 upstream) : CXorf27 (89518 downstream)																							TCTTACCTCATAGAAGCTGTTG	0.515													4	2	---	---	---	---	
SYTL5	94122	broad.mit.edu	37	X	37935772	37935773	+	Intron	DEL	AA	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:37935772_37935773delAA	uc004ddu.2	+						SYTL5_uc004ddv.2_Intron|SYTL5_uc004ddx.2_Intron	NM_001163335	NP_001156807	Q8TDW5	SYTL5_HUMAN	synaptotagmin-like 5 isoform 1						intracellular protein transport	membrane	metal ion binding|Rab GTPase binding			skin(1)	1						TGATATTTTTAAATGCTTTCTT	0.312													4	2	---	---	---	---	
OPHN1	4983	broad.mit.edu	37	X	67432069	67432070	+	Intron	INS	-	A	A			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:67432069_67432070insA	uc004dww.3	-						OPHN1_uc011mpg.1_Intron|OPHN1_uc004dwx.2_Intron	NM_002547	NP_002538	O60890	OPHN1_HUMAN	oligophrenin 1						axon guidance|endocytosis|filopodium assembly|small GTPase mediated signal transduction|substrate-dependent cell migration, cell extension	axon|cell junction|cytosol|dendritic spine|synapse	cytoskeletal adaptor activity|Rho GTPase activator activity|SH3 domain binding			ovary(2)	2						GGAAAACATGTAAAAATAACTT	0.332													8	5	---	---	---	---	
TAF1	6872	broad.mit.edu	37	X	70639873	70639873	+	Intron	DEL	T	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:70639873delT	uc004dzu.3	+						BCYRN1_uc011mpt.1_Intron|TAF1_uc004dzt.3_Intron|TAF1_uc004dzv.3_Intron|TAF1_uc010nld.1_Intron|TAF1_uc010nle.1_Intron|TAF1_uc010nlf.1_Intron|TAF1_uc004dzx.2_Intron|TAF1_uc004dzy.2_Intron	NM_138923	NP_620278	P21675	TAF1_HUMAN	TBP-associated factor 1 isoform 2						G1 phase of mitotic cell cycle|interspecies interaction between organisms|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription initiation from RNA polymerase II promoter|protein autophosphorylation|regulation of transcription involved in G2/M-phase of mitotic cell cycle|RNA polymerase II transcriptional preinitiation complex assembly|transcription elongation from RNA polymerase II promoter|viral reproduction	MLL1 complex|transcription factor TFIID complex	ATP binding|histone acetyl-lysine binding|histone acetyltransferase activity|p53 binding|protein binding|protein serine/threonine kinase activity|sequence-specific DNA binding|TBP-class protein binding|transcription coactivator activity			ovary(7)|breast(4)|large_intestine(2)|central_nervous_system(2)|lung(1)|skin(1)	17	Renal(35;0.156)	all_lung(315;0.000321)				tttttaattcttttttttttt	0.234													12	8	---	---	---	---	
DACH2	117154	broad.mit.edu	37	X	85994945	85994945	+	Intron	DEL	G	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:85994945delG	uc004eew.2	+						DACH2_uc004eex.2_Intron|DACH2_uc010nmq.2_Intron|DACH2_uc011mra.1_Intron|DACH2_uc010nmr.2_Intron|DACH2_uc004eey.2_Intron|DACH2_uc004eez.2_Intron	NM_053281	NP_444511	Q96NX9	DACH2_HUMAN	dachshund 2 isoform a						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|nucleotide binding			ovary(4)|pancreas(1)	5						TTAGTTGTTAGGAAAAATAGA	0.358													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	99404775	99404776	+	IGR	DEL	TG	-	-			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:99404775_99404776delTG								LOC442459 (209934 upstream) : PCDH19 (141874 downstream)																							GACAAGTCTTTGTACTTAATCT	0.381													4	2	---	---	---	---	
ATP11C	286410	broad.mit.edu	37	X	138870533	138870534	+	Intron	INS	-	T	T			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:138870533_138870534insT	uc004faz.2	-						ATP11C_uc004fay.2_Intron|ATP11C_uc004fba.2_Intron	NM_173694	NP_775965	Q8NB49	AT11C_HUMAN	ATPase, class VI, type 11C isoform a						ATP biosynthetic process	integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(5)|large_intestine(3)	8	Acute lymphoblastic leukemia(192;0.000127)					AATGATTATTATTTTTAATTTG	0.342													4	2	---	---	---	---	
IL9R	3581	broad.mit.edu	37	X	155231280	155231281	+	Intron	INS	-	G	G			TCGA-CJ-4643-01A-02D-1386-10	TCGA-CJ-4643-11A-01D-1251-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:155231280_155231281insG	uc004fnv.1	+						IL9R_uc010nvn.2_Intron|IL9R_uc004fnu.1_Intron	NM_002186	NP_002177	Q01113	IL9R_HUMAN	interleukin 9 receptor precursor						cell proliferation	extracellular space|integral to plasma membrane	interleukin-9 receptor activity				0	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					TGCTGCCCATTGGTTTGTGCGG	0.525													21	72	---	---	---	---	
