Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
AGRN	375790	broad.mit.edu	37	1	985343	985343	+	Missense_Mutation	SNP	C	A	A			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:985343C>A	uc001ack.1	+	27	4855	c.4805C>A	c.(4804-4806)CCC>CAC	p.P1602H		NM_198576	NP_940978	O00468	AGRIN_HUMAN	agrin precursor	1602	EGF-like 3.				axon guidance|clustering of voltage-gated sodium channels|muscarinic acetylcholine receptor signaling pathway|receptor clustering	basal lamina	laminin binding|structural constituent of cytoskeleton			central_nervous_system(2)|breast(1)	3	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		UCEC - Uterine corpus endometrioid carcinoma (11;0.00462)|Epithelial(90;5.98e-38)|OV - Ovarian serous cystadenocarcinoma(86;5.43e-23)|Colorectal(212;5.97e-05)|COAD - Colon adenocarcinoma(227;0.000201)|Kidney(185;0.0024)|BRCA - Breast invasive adenocarcinoma(365;0.00246)|STAD - Stomach adenocarcinoma(132;0.00645)|KIRC - Kidney renal clear cell carcinoma(229;0.0354)|Lung(427;0.201)		GGGGCGGCGCCCTGCCGTGTG	0.711													8	14	---	---	---	---	PASS
PUM1	9698	broad.mit.edu	37	1	31532415	31532415	+	5'UTR	SNP	C	T	T			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:31532415C>T	uc001bsi.1	-	2					PUM1_uc001bsh.1_5'UTR|PUM1_uc001bsj.1_5'UTR|PUM1_uc010oga.1_5'UTR|PUM1_uc001bsk.1_Missense_Mutation_p.G36E|PUM1_uc010ogb.1_Missense_Mutation_p.G36E	NM_014676	NP_055491	Q14671	PUM1_HUMAN	pumilio 1 isoform 2						cellular membrane organization|post-Golgi vesicle-mediated transport|regulation of translation	cytosol	RNA binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3		Colorectal(325;0.0211)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|all_neural(195;0.0381)|Breast(348;0.0848)|Medulloblastoma(700;0.123)		STAD - Stomach adenocarcinoma(196;0.0232)|READ - Rectum adenocarcinoma(331;0.0681)		AACGCTCATTCCACCAACACC	0.403													30	65	---	---	---	---	PASS
DNALI1	7802	broad.mit.edu	37	1	38030777	38030777	+	3'UTR	SNP	G	A	A			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:38030777G>A	uc001cbj.2	+	6					DNALI1_uc010oie.1_RNA	NM_003462	NP_003453	O14645	IDLC_HUMAN	dynein, axonemal, light intermediate chain 1						cellular component movement|single fertilization	axonemal dynein complex	microtubule motor activity			large_intestine(1)|ovary(1)	2		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				TTTCCTGAGTGAACAAGCCAT	0.418													3	4	---	---	---	---	PASS
DNALI1	7802	broad.mit.edu	37	1	38032379	38032379	+	3'UTR	SNP	A	T	T			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:38032379A>T	uc001cbj.2	+	6					DNALI1_uc010oie.1_RNA	NM_003462	NP_003453	O14645	IDLC_HUMAN	dynein, axonemal, light intermediate chain 1						cellular component movement|single fertilization	axonemal dynein complex	microtubule motor activity			large_intestine(1)|ovary(1)	2		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				AGGGCCTTAGAAATGTCAATG	0.358													19	48	---	---	---	---	PASS
MACF1	23499	broad.mit.edu	37	1	39909151	39909151	+	Missense_Mutation	SNP	C	G	G			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39909151C>G	uc010oiu.1	+	44	14796	c.14665C>G	c.(14665-14667)CTC>GTC	p.L4889V	MACF1_uc010ois.1_Missense_Mutation_p.L4387V	NM_033044	NP_149033	Q9UPN3	MACF1_HUMAN	microfilament and actin filament cross-linker	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding			ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			TGAAGATTTCCTCTTGGAACT	0.413													20	83	---	---	---	---	PASS
PPAP2B	8613	broad.mit.edu	37	1	57044640	57044640	+	Missense_Mutation	SNP	C	G	G			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:57044640C>G	uc001cyj.1	-	2	551	c.50G>C	c.(49-51)GGC>GCC	p.G17A		NM_177414	NP_803133	O14495	LPP3_HUMAN	phosphatidic acid phosphatase type 2B	17	Cytoplasmic (Potential).				canonical Wnt receptor signaling pathway involved in positive regulation of cell-cell adhesion|canonical Wnt receptor signaling pathway involved in positive regulation of endothelial cell migration|canonical Wnt receptor signaling pathway involved in positive regulation of wound healing|germ cell migration|homotypic cell-cell adhesion|negative regulation of protein phosphorylation|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|sphingolipid metabolic process	adherens junction|Golgi apparatus|integral to membrane	phosphatidate phosphatase activity|phosphoprotein phosphatase activity|protein binding|sphingosine-1-phosphate phosphatase activity				0						CGGGCTGCCGCCGTTCTTGCT	0.652													6	35	---	---	---	---	PASS
EVI5	7813	broad.mit.edu	37	1	93163497	93163497	+	Missense_Mutation	SNP	C	T	T			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:93163497C>T	uc001dox.2	-	6	827	c.817G>A	c.(817-819)GAT>AAT	p.D273N	EVI5_uc010otf.1_Missense_Mutation_p.D273N	NM_005665	NP_005656	O60447	EVI5_HUMAN	ecotropic viral integration site 5	273	Dimerization.|Interaction with alpha-tubulin, gamma- tubulin, BIRC5 and FBXO5.|Rab-GAP TBC.				cell cycle|cell division|cell proliferation|multicellular organismal development	microtubule organizing center|nucleus|spindle	protein binding|Rab GTPase activator activity			ovary(1)|breast(1)	2		all_lung(203;0.00146)|Lung NSC(277;0.00565)|all_neural(321;0.185)|Melanoma(281;0.193)|Glioma(108;0.203)		Epithelial(280;8.09e-25)|OV - Ovarian serous cystadenocarcinoma(397;1.27e-22)|all cancers(265;1.74e-21)|GBM - Glioblastoma multiforme(16;0.00233)|BRCA - Breast invasive adenocarcinoma(282;0.211)		AGTCTATAATCTTGCATTAAT	0.323													26	88	---	---	---	---	PASS
CELSR2	1952	broad.mit.edu	37	1	109805009	109805009	+	Missense_Mutation	SNP	G	A	A			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109805009G>A	uc001dxa.3	+	6	4548	c.4487G>A	c.(4486-4488)GGA>GAA	p.G1496E		NM_001408	NP_001399	Q9HCU4	CELR2_HUMAN	cadherin EGF LAG seven-pass G-type receptor 2	1496	Extracellular (Potential).|Laminin G-like 1.				dendrite morphogenesis|homophilic cell adhesion|neural plate anterior/posterior regionalization|neuropeptide signaling pathway|regulation of cell-cell adhesion|regulation of transcription, DNA-dependent|Wnt receptor signaling pathway	cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein binding			ovary(4)|lung(3)|skin(1)	8		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0296)|Lung(183;0.067)|COAD - Colon adenocarcinoma(174;0.114)|Epithelial(280;0.193)|all cancers(265;0.219)		TTGCGCTTCGGATCTGTCCTG	0.632													11	41	---	---	---	---	PASS
KIRREL	55243	broad.mit.edu	37	1	158057581	158057581	+	Missense_Mutation	SNP	C	G	G			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158057581C>G	uc001frn.3	+	6	1102	c.698C>G	c.(697-699)ACG>AGG	p.T233R	KIRREL_uc010pib.1_Missense_Mutation_p.T133R|KIRREL_uc009wsq.2_Missense_Mutation_p.T69R|KIRREL_uc001fro.3_Missense_Mutation_p.T31R	NM_018240	NP_060710	Q96J84	KIRR1_HUMAN	kin of IRRE like precursor	233	Extracellular (Potential).|Ig-like C2-type 3.					integral to membrane				ovary(1)	1	all_hematologic(112;0.0378)					GAGCCACAGACGGTGCAGGAG	0.577											OREG0013906	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	5	23	---	---	---	---	PASS
CD1D	912	broad.mit.edu	37	1	158152008	158152008	+	Missense_Mutation	SNP	C	A	A			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158152008C>A	uc001frr.2	+	4	1014	c.515C>A	c.(514-516)ACG>AAG	p.T172K	CD1D_uc009wsr.1_Missense_Mutation_p.T172K|CD1D_uc009wss.2_Missense_Mutation_p.T172K|CD1D_uc009wst.1_Missense_Mutation_p.T68K	NM_001766	NP_001757	P15813	CD1D_HUMAN	CD1D antigen precursor	172	Extracellular (Potential).	Glycolipid.			antigen processing and presentation, endogenous lipid antigen via MHC class Ib|detection of bacterium|innate immune response|interspecies interaction between organisms|positive regulation of innate immune response|T cell selection	endosome membrane|integral to plasma membrane|lysosomal membrane	beta-2-microglobulin binding|exogenous lipid antigen binding|histone binding			ovary(1)	1	all_hematologic(112;0.0378)					GACAAGTGGACGAGGGAAACA	0.522													55	257	---	---	---	---	PASS
CASQ1	844	broad.mit.edu	37	1	160167357	160167357	+	Splice_Site	SNP	A	G	G			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160167357A>G	uc010pja.1	+	7	1040	c.783_splice	c.e7-2	p.R261_splice		NM_001231	NP_001222	P31415	CASQ1_HUMAN	calsequestrin 1							mitochondrial matrix|sarcoplasmic reticulum lumen|smooth endoplasmic reticulum	calcium ion binding			central_nervous_system(1)	1	all_cancers(52;2.56e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			TGTCTCTTCTAGATCAACCCT	0.567													26	65	---	---	---	---	PASS
KIF14	9928	broad.mit.edu	37	1	200587653	200587653	+	Missense_Mutation	SNP	A	T	T			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:200587653A>T	uc010ppk.1	-	2	638	c.199T>A	c.(199-201)TAT>AAT	p.Y67N	KIF14_uc010ppj.1_5'UTR	NM_014875	NP_055690	Q15058	KIF14_HUMAN	kinesin family member 14	67	Required for PRC1-binding.				microtubule-based movement	cytoplasm|microtubule|nucleus|spindle	ATP binding|microtubule motor activity|protein binding			breast(3)|ovary(2)|skin(2)	7						GAAATAACATAAGTTCTATTT	0.398													22	61	---	---	---	---	PASS
TP53BP2	7159	broad.mit.edu	37	1	223983955	223983955	+	Silent	SNP	C	T	T			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:223983955C>T	uc010pvb.1	-	13	2578	c.2286G>A	c.(2284-2286)AGG>AGA	p.R762R	TP53BP2_uc001hod.2_Silent_p.R633R|TP53BP2_uc010puz.1_5'UTR|TP53BP2_uc010pva.1_Silent_p.R401R	NM_001031685	NP_001026855	Q13625	ASPP2_HUMAN	tumor protein p53 binding protein, 2 isoform 1	756					apoptosis|cell cycle|induction of apoptosis|negative regulation of cell cycle|signal transduction	nucleus|perinuclear region of cytoplasm	NF-kappaB binding|protein binding|SH3 domain binding|SH3/SH2 adaptor activity			ovary(2)|lung(1)	3				GBM - Glioblastoma multiforme(131;0.0958)		CTATGGTGGTCCTCTGATATA	0.473													41	128	---	---	---	---	PASS
CHRM3	1131	broad.mit.edu	37	1	240071728	240071728	+	Missense_Mutation	SNP	A	G	G			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:240071728A>G	uc001hyp.2	+	5	1756	c.977A>G	c.(976-978)CAG>CGG	p.Q326R		NM_000740	NP_000731	P20309	ACM3_HUMAN	cholinergic receptor, muscarinic 3	326	Cytoplasmic (By similarity).				cell proliferation|energy reserve metabolic process|nervous system development|protein modification process|regulation of insulin secretion	basolateral plasma membrane|cell junction|integral to plasma membrane|postsynaptic membrane	muscarinic acetylcholine receptor activity|phosphatidylinositol phospholipase C activity			ovary(4)|skin(1)	5	Ovarian(103;0.127)	all_cancers(173;0.00567)|all_neural(198;0.203)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)		Anisotropine Methylbromide(DB00517)|Atropine(DB00572)|Benzquinamide(DB00767)|Cevimeline(DB00185)|Cryptenamine(DB00785)|Cyclizine(DB01176)|Darifenacin(DB00496)|Diphemanil Methylsulfate(DB00729)|Diphenidol(DB01231)|Homatropine Methylbromide(DB00725)|Methotrimeprazine(DB01403)|Metixene(DB00340)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Solifenacin(DB01591)|Thiethylperazine(DB00372)|Tiotropium(DB01409)|Tolterodine(DB01036)|Tridihexethyl(DB00505)	AGCTCCGAGCAGATGGACCAA	0.552													6	36	---	---	---	---	PASS
BRE	9577	broad.mit.edu	37	2	28467670	28467670	+	Missense_Mutation	SNP	A	C	C			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:28467670A>C	uc002rlr.2	+	11	1193	c.875A>C	c.(874-876)GAA>GCA	p.E292A	BRE_uc002rlp.1_Missense_Mutation_p.E292A|BRE_uc002rlq.2_Missense_Mutation_p.E292A|BRE_uc002rls.2_Missense_Mutation_p.E292A|BRE_uc002rlt.2_Missense_Mutation_p.E292A|BRE_uc002rlu.2_Missense_Mutation_p.E292A|BRE_uc002rlv.2_Missense_Mutation_p.E154A	NM_199194	NP_954664	Q9NXR7	BRE_HUMAN	brain and reproductive organ-expressed (TNFRSF1A	292	UEV-like 2.				apoptosis|chromatin modification|double-strand break repair|G2/M transition DNA damage checkpoint|positive regulation of anti-apoptosis|positive regulation of DNA repair|response to ionizing radiation|signal transduction	BRCA1-A complex|BRISC complex|cytoplasm|nuclear ubiquitin ligase complex	peroxisome targeting sequence binding|polyubiquitin binding|tumor necrosis factor receptor binding			lung(1)|kidney(1)|skin(1)	3	Acute lymphoblastic leukemia(172;0.155)					TATGATGCAGAAGGCTTTACA	0.333													20	95	---	---	---	---	PASS
LTBP1	4052	broad.mit.edu	37	2	33413692	33413692	+	Missense_Mutation	SNP	A	C	C			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:33413692A>C	uc002ros.2	+	7	1475	c.1475A>C	c.(1474-1476)GAA>GCA	p.E492A	LTBP1_uc002rot.2_Missense_Mutation_p.E166A|LTBP1_uc002rou.2_Missense_Mutation_p.E166A|LTBP1_uc002rov.2_Missense_Mutation_p.E166A|LTBP1_uc010ymz.1_Missense_Mutation_p.E166A|LTBP1_uc010yna.1_Missense_Mutation_p.E166A	NM_206943	NP_996826	Q14766	LTBP1_HUMAN	latent transforming growth factor beta binding	492					negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta	proteinaceous extracellular matrix	calcium ion binding|growth factor binding|transforming growth factor beta receptor activity			ovary(3)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|central_nervous_system(1)	8	all_hematologic(175;0.115)	Medulloblastoma(90;0.215)				CATCCTCCTGAAGCTTCCGTC	0.438													28	97	---	---	---	---	PASS
REG3G	130120	broad.mit.edu	37	2	79255386	79255386	+	Missense_Mutation	SNP	G	T	T			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:79255386G>T	uc002snw.2	+	6	597	c.512G>T	c.(511-513)TGC>TTC	p.C171F	REG3G_uc002snx.2_Missense_Mutation_p.C171F|REG3G_uc010ffu.2_Missense_Mutation_p.C125F	NM_198448	NP_940850	Q6UW15	REG3G_HUMAN	regenerating islet-derived 3 gamma precursor	171	C-type lectin.				acute-phase response	extracellular region	sugar binding				0						CCCTATGTCTGCAAGTTCAAG	0.493													10	49	---	---	---	---	PASS
TMEM182	130827	broad.mit.edu	37	2	103431455	103431455	+	3'UTR	SNP	G	A	A			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:103431455G>A	uc010fjb.2	+	5					TMEM182_uc002tcc.3_3'UTR|TMEM182_uc002tcd.3_3'UTR|TMEM182_uc010ywe.1_RNA	NM_144632	NP_653233	Q6ZP80	TM182_HUMAN	transmembrane protein 182 precursor							integral to membrane					0						GTATTTTCTTGAGAGATTTTA	0.299													17	39	---	---	---	---	PASS
RANBP2	5903	broad.mit.edu	37	2	109357073	109357073	+	Missense_Mutation	SNP	G	A	A			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:109357073G>A	uc002tem.3	+	7	1037	c.911G>A	c.(910-912)AGT>AAT	p.S304N		NM_006267	NP_006258	P49792	RBP2_HUMAN	RAN binding protein 2	304					carbohydrate metabolic process|glucose transport|mitotic prometaphase|mRNA transport|protein folding|protein import into nucleus|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|nuclear pore	peptidyl-prolyl cis-trans isomerase activity|Ran GTPase binding|zinc ion binding		RANBP2/ALK(16)	soft_tissue(16)|lung(1)|pancreas(1)	18						GGTCAGCATAGTAGTAATGTT	0.413													105	274	---	---	---	---	PASS
LIMS2	55679	broad.mit.edu	37	2	128414990	128414990	+	Missense_Mutation	SNP	C	G	G			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128414990C>G	uc002tpa.2	-	2	324	c.158G>C	c.(157-159)GGG>GCG	p.G53A	LIMS2_uc002tox.2_Missense_Mutation_p.G77A|LIMS2_uc010fmb.2_5'UTR|LIMS2_uc002toy.2_Missense_Mutation_p.G48A|LIMS2_uc010yzm.1_Missense_Mutation_p.G75A|LIMS2_uc002toz.2_Missense_Mutation_p.G48A|LIMS2_uc002tpb.2_Missense_Mutation_p.G48A	NM_001161403	NP_001154875	Q7Z4I7	LIMS2_HUMAN	LIM and senescent cell antigen-like domains 2	53	LIM zinc-binding 1.				cell junction assembly	cytosol|focal adhesion|nucleus	zinc ion binding				0	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0681)		ATAGAAGAGCCCCTCGGGGAA	0.637													12	70	---	---	---	---	PASS
FAM123C	205147	broad.mit.edu	37	2	131520963	131520963	+	Missense_Mutation	SNP	G	A	A			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:131520963G>A	uc002trw.2	+	2	1508	c.1318G>A	c.(1318-1320)GAT>AAT	p.D440N	FAM123C_uc010fmv.2_Missense_Mutation_p.D440N|FAM123C_uc010fms.1_Missense_Mutation_p.D440N|FAM123C_uc010fmt.1_Missense_Mutation_p.D440N|FAM123C_uc010fmu.1_Missense_Mutation_p.D440N	NM_152698	NP_689911	Q8N944	F123C_HUMAN	hypothetical protein LOC205147	440										pancreas(2)|ovary(1)	3	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.13)		CAGCCCAGATGATGACCTGTG	0.662													13	47	---	---	---	---	PASS
LCT	3938	broad.mit.edu	37	2	136545987	136545987	+	Silent	SNP	G	T	T			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:136545987G>T	uc002tuu.1	-	17	5702	c.5691C>A	c.(5689-5691)GGC>GGA	p.G1897G		NM_002299	NP_002290	P09848	LPH_HUMAN	lactase-phlorizin hydrolase preproprotein	1897	Helical; (Potential).				carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|integral to plasma membrane|membrane fraction	cation binding|glycosylceramidase activity|lactase activity			ovary(7)|central_nervous_system(2)|skin(2)|pancreas(1)|lung(1)	13				BRCA - Breast invasive adenocarcinoma(221;0.169)		GAAATGCCAAGCCACAGACTC	0.493													9	302	---	---	---	---	PASS
NMI	9111	broad.mit.edu	37	2	152135293	152135293	+	Intron	SNP	G	C	C			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:152135293G>C	uc002txi.2	-						NMI_uc010zbx.1_Intron|NMI_uc002txj.2_Nonsense_Mutation_p.S98*	NM_004688	NP_004679	Q13287	NMI_HUMAN	N-myc and STAT interactor						inflammatory response|JAK-STAT cascade|transcription from RNA polymerase II promoter	cytoplasm|nucleus	nucleotide binding|protein binding|transcription cofactor activity				0				BRCA - Breast invasive adenocarcinoma(221;0.0571)		AAATGTCTATGAAAGTGCTTT	0.199													7	23	---	---	---	---	PASS
XIRP2	129446	broad.mit.edu	37	2	168104885	168104885	+	Missense_Mutation	SNP	C	T	T			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:168104885C>T	uc002udx.2	+	8	7001	c.6983C>T	c.(6982-6984)TCA>TTA	p.S2328L	XIRP2_uc010fpn.2_Intron|XIRP2_uc010fpo.2_Intron|XIRP2_uc010fpp.2_Intron|XIRP2_uc002udy.2_Missense_Mutation_p.S2153L|XIRP2_uc010fpq.2_Missense_Mutation_p.S2106L|XIRP2_uc010fpr.2_Intron|XIRP2_uc010fps.1_Intron	NM_152381	NP_689594	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2 isoform 1	2153	Pro-rich.				actin cytoskeleton organization	cell junction	actin binding			skin(7)|ovary(6)|pancreas(1)	14						TTTCTTCCCTCACTGTCCACA	0.438													63	169	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179425394	179425394	+	Missense_Mutation	SNP	C	G	G			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179425394C>G	uc010zfg.1	-	275	77985	c.77761G>C	c.(77761-77763)GAA>CAA	p.E25921Q	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.E19616Q|TTN_uc010zfi.1_Missense_Mutation_p.E19549Q|TTN_uc010zfj.1_Missense_Mutation_p.E19424Q	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	26848							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCACGTTTTTCTACGATGTAA	0.423													9	38	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179426804	179426804	+	Missense_Mutation	SNP	A	T	T			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179426804A>T	uc010zfg.1	-	275	76575	c.76351T>A	c.(76351-76353)TCA>ACA	p.S25451T	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.S19146T|TTN_uc010zfi.1_Missense_Mutation_p.S19079T|TTN_uc010zfj.1_Missense_Mutation_p.S18954T	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	26378							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ATAGATAGTGATGTTACAGTC	0.353													11	36	---	---	---	---	PASS
HECW2	57520	broad.mit.edu	37	2	197184155	197184155	+	Missense_Mutation	SNP	C	T	T			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:197184155C>T	uc002utm.1	-	9	1642	c.1459G>A	c.(1459-1461)GGC>AGC	p.G487S	HECW2_uc002utl.1_Missense_Mutation_p.G131S	NM_020760	NP_065811	Q9P2P5	HECW2_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin	487					protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm	ubiquitin-protein ligase activity			skin(5)|ovary(5)|lung(4)|pancreas(2)|central_nervous_system(1)|kidney(1)	18						ATGATCAGGCCTCCCTCCTCC	0.498													9	29	---	---	---	---	PASS
ERBB4	2066	broad.mit.edu	37	2	212252692	212252692	+	Missense_Mutation	SNP	G	T	T			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:212252692G>T	uc002veg.1	-	26	3259	c.3161C>A	c.(3160-3162)CCT>CAT	p.P1054H	ERBB4_uc002veh.1_Intron|ERBB4_uc010zji.1_Missense_Mutation_p.P1044H|ERBB4_uc010zjj.1_Intron	NM_005235	NP_005226	Q15303	ERBB4_HUMAN	v-erb-a erythroblastic leukemia viral oncogene	1054	PPxY motif 2.|Cytoplasmic (Potential).				cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent|transmembrane receptor protein tyrosine kinase signaling pathway	basolateral plasma membrane|cytoplasm|integral to membrane|nucleus	ATP binding|protein binding|receptor signaling protein tyrosine kinase activity|transmembrane receptor protein tyrosine kinase activity			lung(21)|skin(5)|stomach(2)|breast(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	33		Renal(323;0.06)|Lung NSC(271;0.197)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;5.86e-06)|all cancers(144;2.95e-05)|Lung(261;0.00244)|LUSC - Lung squamous cell carcinoma(224;0.00266)		GGTGTAGGCAGGAGGAGGGCT	0.373										TSP Lung(8;0.080)			37	112	---	---	---	---	PASS
DNAJB2	3300	broad.mit.edu	37	2	220146894	220146894	+	Intron	SNP	G	T	T			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220146894G>T	uc002vkx.1	+						DNAJB2_uc010zla.1_Nonsense_Mutation_p.G155*|DNAJB2_uc002vkw.1_Intron|DNAJB2_uc002vky.2_5'Flank|DNAJB2_uc010zlb.1_5'Flank	NM_006736	NP_006727	P25686	DNJB2_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 2						ER-associated protein catabolic process|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of inclusion body assembly|negative regulation of protein deubiquitination|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein ubiquitination|protein folding|response to unfolded protein	inclusion body	heat shock protein binding|Hsp70 protein binding|polyubiquitin binding|proteasome binding|protein binding|unfolded protein binding				0		Renal(207;0.0474)		Epithelial(149;1.97e-06)|all cancers(144;0.00028)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GGAATGCCACGGACAGAAGAT	0.587													8	7	---	---	---	---	PASS
PBRM1	55193	broad.mit.edu	37	3	52682459	52682459	+	Splice_Site	SNP	C	T	T			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52682459C>T	uc003des.2	-	7	727	c.715_splice	c.e7-1	p.N239_splice	PBRM1_uc003dex.2_Splice_Site|PBRM1_uc003deq.2_Splice_Site_p.N239_splice|PBRM1_uc003der.2_Splice_Site_p.N239_splice|PBRM1_uc003det.2_Splice_Site_p.N239_splice|PBRM1_uc003deu.2_Splice_Site_p.N239_splice|PBRM1_uc003dev.2_Splice_Site|PBRM1_uc003dew.2_Splice_Site_p.N239_splice|PBRM1_uc010hmk.1_Splice_Site_p.N239_splice|PBRM1_uc003dey.2_Splice_Site_p.N239_splice|PBRM1_uc003dez.1_Splice_Site_p.N239_splice|PBRM1_uc003dfb.1_Splice_Site_p.N137_splice	NM_181042	NP_060635	Q86U86	PB1_HUMAN	polybromo 1 isoform 4						chromatin remodeling|mitosis|negative regulation of cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear chromosome	chromatin binding|DNA binding|protein binding			kidney(136)|breast(4)	140				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		AGCTTCCATTCTACAATAAAC	0.338			Mis|N|F|S|D|O		clear cell renal carcinoma|breast								26	51	---	---	---	---	PASS
ROBO2	6092	broad.mit.edu	37	3	77147239	77147239	+	Missense_Mutation	SNP	G	A	A			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:77147239G>A	uc003dpy.3	+	2	779	c.136G>A	c.(136-138)GAG>AAG	p.E46K	ROBO2_uc003dpz.2_Missense_Mutation_p.E46K|ROBO2_uc011bgj.1_RNA|ROBO2_uc011bgk.1_Missense_Mutation_p.E46K	NM_002942	NP_002933	Q9HCK4	ROBO2_HUMAN	roundabout, axon guidance receptor, homolog 2	46	Ig-like C2-type 1.|Extracellular (Potential).				apoptosis involved in luteolysis|axon midline choice point recognition|cellular response to hormone stimulus|homophilic cell adhesion|metanephros development|negative regulation of negative chemotaxis|negative regulation of synaptogenesis|olfactory bulb interneuron development|positive regulation of axonogenesis|retinal ganglion cell axon guidance|ureteric bud development	axolemma|cell surface|integral to membrane	axon guidance receptor activity|identical protein binding			lung(5)|skin(3)|ovary(1)|large_intestine(1)|liver(1)	11				Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)		CTCTAAGGGCGAGCCCACGAC	0.577													3	34	---	---	---	---	PASS
CD200	4345	broad.mit.edu	37	3	112059811	112059811	+	Silent	SNP	G	C	C			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:112059811G>C	uc003dyw.2	+	3	294	c.150G>C	c.(148-150)GTG>GTC	p.V50V	CD200_uc010hqd.1_5'UTR|CD200_uc003dyx.2_Silent_p.V25V|CD200_uc003dyy.2_Intron|CD200_uc003dyz.2_Intron	NM_001004196	NP_001004196	P41217	OX2G_HUMAN	CD200 antigen isoform b	25					regulation of immune response	integral to plasma membrane					0		Acute lymphoblastic leukemia(4;1.7e-08)|all_hematologic(4;8.82e-05)				TGGCAGCAGTGGTGCTGTGCA	0.488													6	47	---	---	---	---	PASS
H1FX	8971	broad.mit.edu	37	3	129034182	129034182	+	Missense_Mutation	SNP	C	G	G			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:129034182C>G	uc003elx.2	-	1	939	c.564G>C	c.(562-564)AAG>AAC	p.K188N	C3orf47_uc011bkv.1_5'Flank	NM_006026	NP_006017	Q92522	H1X_HUMAN	H1 histone family, member X	188					nucleosome assembly	nucleosome|nucleus	DNA binding				0						CGGCCGCCGTCTTCTTGGCCT	0.652													12	20	---	---	---	---	PASS
XRN1	54464	broad.mit.edu	37	3	142031463	142031463	+	Missense_Mutation	SNP	G	A	A			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:142031463G>A	uc003eus.2	-	41	4862	c.4795C>T	c.(4795-4797)CAC>TAC	p.H1599Y	XRN1_uc010huu.2_Missense_Mutation_p.H1053Y|XRN1_uc003eut.2_Missense_Mutation_p.H1586Y|XRN1_uc003euu.2_Missense_Mutation_p.H1587Y	NM_019001	NP_061874	Q8IZH2	XRN1_HUMAN	5'-3' exoribonuclease 1 isoform a	1599					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay|histone mRNA catabolic process|nuclear mRNA surveillance|rRNA catabolic process	cytosol|Golgi apparatus|intermediate filament cytoskeleton|plasma membrane	5'-3' exonuclease activity|DNA binding|protein binding|RNA binding			ovary(3)	3						AACTGATTGTGCACACCCCCT	0.388													30	80	---	---	---	---	PASS
PLS1	5357	broad.mit.edu	37	3	142430381	142430381	+	Missense_Mutation	SNP	A	T	T			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:142430381A>T	uc010huv.2	+	15	1827	c.1668A>T	c.(1666-1668)TTA>TTT	p.L556F	PLS1_uc003euz.2_Missense_Mutation_p.L556F|PLS1_uc003eva.2_Missense_Mutation_p.L556F	NM_001145319	NP_001138791	Q14651	PLSI_HUMAN	plastin 1	556	CH 4.|Actin-binding 2.					cytoplasm	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(1)	1						TCCTAGATTTAATAGATGCCA	0.333													22	45	---	---	---	---	PASS
C3orf57	165679	broad.mit.edu	37	3	161064028	161064028	+	Silent	SNP	G	T	T			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:161064028G>T	uc003fee.2	-	3	858	c.84C>A	c.(82-84)CCC>CCA	p.P28P		NM_001040100	NP_001035189	Q8NFR3	SSPTB_HUMAN	ADMP	28	Helical; (Potential).				sphingolipid biosynthetic process	integral to membrane|serine C-palmitoyltransferase complex	protein binding				0			Lung(72;0.00111)|LUSC - Lung squamous cell carcinoma(72;0.00156)			ATCGCTCCCAGGGCTCTAAAA	0.443													25	72	---	---	---	---	PASS
CLCN2	1181	broad.mit.edu	37	3	184079226	184079226	+	Silent	SNP	C	G	G			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184079226C>G	uc003foi.2	-	1	166	c.42G>C	c.(40-42)GCG>GCC	p.A14A	CLCN2_uc010hya.1_Silent_p.A14A|CLCN2_uc011brl.1_Silent_p.A14A|CLCN2_uc011brm.1_Silent_p.A14A|CLCN2_uc011brn.1_Silent_p.A14A|POLR2H_uc003foj.1_5'Flank|POLR2H_uc003fok.1_5'Flank	NM_004366	NP_004357	P51788	CLCN2_HUMAN	chloride channel 2	14	Cytoplasmic (By similarity).					chloride channel complex	voltage-gated chloride channel activity				0	all_cancers(143;6.66e-11)|Ovarian(172;0.0339)		Epithelial(37;2.22e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)		Lubiprostone(DB01046)	CGTACTGCAGCGCCCGTGGCT	0.701													14	52	---	---	---	---	PASS
DHX15	1665	broad.mit.edu	37	4	24534564	24534564	+	Missense_Mutation	SNP	G	A	A			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:24534564G>A	uc003gqx.2	-	12	2191	c.2023C>T	c.(2023-2025)CGT>TGT	p.R675C	DHX15_uc003gqv.2_Missense_Mutation_p.R81C|DHX15_uc003gqw.2_Missense_Mutation_p.R98C	NM_001358	NP_001349	O43143	DHX15_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 15	675					mRNA processing	U12-type spliceosomal complex	ATP binding|ATP-dependent helicase activity|nucleic acid binding|RNA helicase activity			ovary(1)	1		Breast(46;0.0503)				GTACTTCGACGAGGCAAATTA	0.383													23	289	---	---	---	---	PASS
ADH1A	124	broad.mit.edu	37	4	100208074	100208074	+	Silent	SNP	C	A	A			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:100208074C>A	uc003hur.1	-	3	263	c.192G>T	c.(190-192)GTG>GTT	p.V64V	uc003hum.1_RNA|ADH1A_uc011ceg.1_Silent_p.V64V|ADH1A_uc010ilf.1_5'Flank|ADH1A_uc010ilg.1_Silent_p.V64V	NM_000667	NP_000658	P07327	ADH1A_HUMAN	class I alcohol dehydrogenase, alpha subunit	64					ethanol oxidation|transcription, DNA-dependent|xenobiotic metabolic process	cytosol	alcohol dehydrogenase activity, zinc-dependent|protein binding|zinc ion binding			large_intestine(1)|ovary(1)	2				OV - Ovarian serous cystadenocarcinoma(123;9.56e-08)	Fomepizole(DB01213)|NADH(DB00157)	GGCCTAAAATCACAGGAAGTG	0.483													4	180	---	---	---	---	PASS
OSMR	9180	broad.mit.edu	37	5	38886351	38886351	+	Intron	SNP	T	C	C			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:38886351T>C	uc003jln.1	+						OSMR_uc003jlm.1_3'UTR	NM_003999	NP_003990	Q99650	OSMR_HUMAN	oncostatin M receptor precursor						cell proliferation|positive regulation of cell proliferation	oncostatin-M receptor complex	growth factor binding|oncostatin-M receptor activity			ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5	all_lung(31;0.000365)					TTTCACAGACTGTGTGATCAA	0.443													18	36	---	---	---	---	PASS
ZNF131	7690	broad.mit.edu	37	5	43161423	43161423	+	Silent	SNP	A	G	G			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:43161423A>G	uc011cpw.1	+	5	480	c.444A>G	c.(442-444)GCA>GCG	p.A148A	ZNF131_uc010ivl.1_Silent_p.A148A|ZNF131_uc003jnj.3_5'UTR|ZNF131_uc003jnk.2_Silent_p.A148A|ZNF131_uc003jnn.3_5'UTR|ZNF131_uc003jnl.1_Intron|ZNF131_uc010ivm.1_Intron	NM_003432	NP_003423	P52739	ZN131_HUMAN	zinc finger protein 131	148				AETS -> CSKA (in Ref. 5; AAC50251).		nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0						GGAAGATTGCAGAAACTTCAA	0.388													32	75	---	---	---	---	PASS
SNX18	112574	broad.mit.edu	37	5	53839239	53839239	+	Missense_Mutation	SNP	C	A	A			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:53839239C>A	uc003jpi.3	+	2	2042	c.1852C>A	c.(1852-1854)CTT>ATT	p.L618I	SNX18_uc011cqg.1_3'UTR	NM_001102575	NP_001096045	Q96RF0	SNX18_HUMAN	sorting nexin 18 isoform a	Error:Variant_position_missing_in_Q96RF0_after_alignment					cell communication|endocytosis|positive regulation of GTPase activity|protein transport	endomembrane system|endosome membrane|extrinsic to internal side of plasma membrane	phosphatidylinositol binding|protein binding				0		Lung NSC(810;3.46e-05)|Breast(144;0.102)				GGAAGAAGCTCTTCACAAATA	0.343													23	57	---	---	---	---	PASS
CCDC125	202243	broad.mit.edu	37	5	68590723	68590723	+	Missense_Mutation	SNP	G	A	A			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:68590723G>A	uc003jvv.1	-	8	864	c.821C>T	c.(820-822)GCG>GTG	p.A274V	CCDC125_uc003jvx.1_Missense_Mutation_p.A273V|CCDC125_uc003jvy.1_RNA|CCDC125_uc003jvw.2_Missense_Mutation_p.A149V	NM_176816	NP_789786	Q86Z20	CC125_HUMAN	coiled-coil domain containing 125	274						cytoplasm					0		Lung NSC(167;7.26e-05)|Prostate(74;0.0143)|Ovarian(174;0.0448)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;2.2e-56)|Epithelial(20;2.31e-52)|all cancers(19;5.85e-48)|Lung(70;0.0183)		TCCGAGGACCGCAAGCTTTAA	0.488													4	148	---	---	---	---	PASS
LOC100133050	100133050	broad.mit.edu	37	5	99715528	99715528	+	RNA	SNP	C	T	T			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:99715528C>T	uc011cuw.1	-	4		c.382G>A				NR_027503				Homo sapiens glucuronidase, beta pseudogene (LOC100133050), non-coding RNA.												0						AGCGGACAGTCGAAGCCCTTC	0.607													3	15	---	---	---	---	PASS
CDC25C	995	broad.mit.edu	37	5	137621758	137621758	+	Silent	SNP	G	A	A			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137621758G>A	uc003lcp.1	-	13	1496	c.1225C>T	c.(1225-1227)CTA>TTA	p.L409L	CDC25C_uc003lcq.1_Silent_p.L336L|CDC25C_uc003lcr.1_Silent_p.L409L|CDC25C_uc011cyp.1_Silent_p.L426L|CDC25C_uc003lcs.1_Silent_p.L487L	NM_001790	NP_001781	P30307	MPIP3_HUMAN	cell division cycle 25C isoform a	409	Rhodanese.				cell cycle checkpoint|cell division|cell proliferation|DNA replication|G2/M transition of mitotic cell cycle|interspecies interaction between organisms|mitosis|regulation of cyclin-dependent protein kinase activity|regulation of mitosis|traversing start control point of mitotic cell cycle	cytosol|nucleoplasm	protein tyrosine phosphatase activity|WW domain binding			lung(3)	3			KIRC - Kidney renal clear cell carcinoma(527;0.004)|Kidney(363;0.00592)			AGGATATATAGCTCTGGGTAG	0.507													44	102	---	---	---	---	PASS
WDR55	54853	broad.mit.edu	37	5	140049085	140049085	+	Missense_Mutation	SNP	A	C	C			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140049085A>C	uc003lgr.3	+	7	1112	c.998A>C	c.(997-999)GAT>GCT	p.D333A	WDR55_uc011czl.1_Silent_p.G157G	NM_017706	NP_060176	Q9H6Y2	WDR55_HUMAN	WD repeat domain 55	333					rRNA processing	cytoplasm|nucleolus				ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTGGTGGTGGATGACTACCGT	0.607													6	15	---	---	---	---	PASS
BRD2	6046	broad.mit.edu	37	6	32942463	32942463	+	Missense_Mutation	SNP	T	C	C			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32942463T>C	uc003ocn.3	+	3	1955	c.254T>C	c.(253-255)GTA>GCA	p.V85A	BRD2_uc003oco.2_RNA|BRD2_uc003ocq.3_Missense_Mutation_p.V85A|BRD2_uc003ocp.3_5'UTR|BRD2_uc010juh.2_Missense_Mutation_p.V85A	NM_005104	NP_005095	P25440	BRD2_HUMAN	bromodomain containing 2	85					spermatogenesis	nucleus	protein serine/threonine kinase activity			central_nervous_system(3)|stomach(2)	5						CTACACAAGGTAGTGATGAAG	0.547													16	59	---	---	---	---	PASS
MAPK13	5603	broad.mit.edu	37	6	36103575	36103575	+	Missense_Mutation	SNP	G	T	T			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:36103575G>T	uc003ols.2	+	4	452	c.354G>T	c.(352-354)ATG>ATT	p.M118I	MAPK13_uc003olt.2_RNA	NM_002754	NP_002745	O15264	MK13_HUMAN	mitogen-activated protein kinase 13	118	Protein kinase.				cell cycle|intracellular protein kinase cascade|nerve growth factor receptor signaling pathway|positive regulation of interleukin-6 production|Ras protein signal transduction|response to stress		ATP binding|MAP kinase activity|protein binding			breast(2)|central_nervous_system(1)	3						AGAAGATCATGGGGATGGAGT	0.582													17	53	---	---	---	---	PASS
CUL7	9820	broad.mit.edu	37	6	43013037	43013037	+	Missense_Mutation	SNP	T	C	C			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43013037T>C	uc003otq.2	-	15	3269	c.2966A>G	c.(2965-2967)TAC>TGC	p.Y989C	CUL7_uc010jyg.2_Missense_Mutation_p.Y268C|CUL7_uc011dvb.1_Missense_Mutation_p.Y1073C|CUL7_uc010jyh.2_Intron|KLC4_uc003otr.1_Intron	NM_014780	NP_055595	Q14999	CUL7_HUMAN	cullin 7	989	DOC.				interspecies interaction between organisms|ubiquitin-dependent protein catabolic process|vasculogenesis	anaphase-promoting complex|mitochondrion	ubiquitin protein ligase binding			ovary(3)|kidney(1)	4			all cancers(41;0.00231)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|OV - Ovarian serous cystadenocarcinoma(102;0.0442)|KIRC - Kidney renal clear cell carcinoma(15;0.133)|Kidney(15;0.188)			CCGAACCATGTAGAAGAGGCG	0.597													17	46	---	---	---	---	PASS
MAP3K4	4216	broad.mit.edu	37	6	161470927	161470927	+	Missense_Mutation	SNP	G	T	T			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:161470927G>T	uc003qtn.2	+	3	1765	c.1623G>T	c.(1621-1623)AAG>AAT	p.K541N	MAP3K4_uc010kkc.1_Missense_Mutation_p.K541N|MAP3K4_uc003qto.2_Missense_Mutation_p.K541N|MAP3K4_uc011efz.1_RNA|MAP3K4_uc011ega.1_5'UTR	NM_005922	NP_005913	Q9Y6R4	M3K4_HUMAN	mitogen-activated protein kinase kinase kinase 4	541					activation of MAPKK activity|JNK cascade|positive regulation of JUN kinase activity	perinuclear region of cytoplasm	ATP binding|MAP kinase kinase kinase activity|metal ion binding|protein binding			ovary(3)|lung(3)|skin(2)|stomach(1)	9		Breast(66;0.000776)|Ovarian(120;0.0367)|Prostate(117;0.0771)		OV - Ovarian serous cystadenocarcinoma(65;1.85e-18)|BRCA - Breast invasive adenocarcinoma(81;3.04e-05)		GGTTAAGAAAGTTAATTTTAA	0.428													22	71	---	---	---	---	PASS
MAP3K4	4216	broad.mit.edu	37	6	161507426	161507426	+	Silent	SNP	G	A	A			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:161507426G>A	uc003qtn.2	+	8	2530	c.2388G>A	c.(2386-2388)GAG>GAA	p.E796E	MAP3K4_uc010kkc.1_Silent_p.E796E|MAP3K4_uc003qto.2_Silent_p.E796E|MAP3K4_uc011efz.1_RNA|MAP3K4_uc011ega.1_Silent_p.E249E	NM_005922	NP_005913	Q9Y6R4	M3K4_HUMAN	mitogen-activated protein kinase kinase kinase 4	796					activation of MAPKK activity|JNK cascade|positive regulation of JUN kinase activity	perinuclear region of cytoplasm	ATP binding|MAP kinase kinase kinase activity|metal ion binding|protein binding			ovary(3)|lung(3)|skin(2)|stomach(1)	9		Breast(66;0.000776)|Ovarian(120;0.0367)|Prostate(117;0.0771)		OV - Ovarian serous cystadenocarcinoma(65;1.85e-18)|BRCA - Breast invasive adenocarcinoma(81;3.04e-05)		CTGTTATAGAGATCAGTCGAG	0.438													7	36	---	---	---	---	PASS
MAP3K4	4216	broad.mit.edu	37	6	161507427	161507427	+	Missense_Mutation	SNP	A	T	T			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:161507427A>T	uc003qtn.2	+	8	2531	c.2389A>T	c.(2389-2391)ATC>TTC	p.I797F	MAP3K4_uc010kkc.1_Missense_Mutation_p.I797F|MAP3K4_uc003qto.2_Missense_Mutation_p.I797F|MAP3K4_uc011efz.1_RNA|MAP3K4_uc011ega.1_Missense_Mutation_p.I250F	NM_005922	NP_005913	Q9Y6R4	M3K4_HUMAN	mitogen-activated protein kinase kinase kinase 4	797					activation of MAPKK activity|JNK cascade|positive regulation of JUN kinase activity	perinuclear region of cytoplasm	ATP binding|MAP kinase kinase kinase activity|metal ion binding|protein binding			ovary(3)|lung(3)|skin(2)|stomach(1)	9		Breast(66;0.000776)|Ovarian(120;0.0367)|Prostate(117;0.0771)		OV - Ovarian serous cystadenocarcinoma(65;1.85e-18)|BRCA - Breast invasive adenocarcinoma(81;3.04e-05)		TGTTATAGAGATCAGTCGAGC	0.443													8	37	---	---	---	---	PASS
QKI	9444	broad.mit.edu	37	6	163991840	163991840	+	3'UTR	SNP	G	T	T			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:163991840G>T	uc003qui.2	+	8					QKI_uc003quj.2_3'UTR	NM_006775	NP_006766	Q96PU8	QKI_HUMAN	quaking homolog, KH domain RNA binding isoform						mRNA processing|mRNA transport|regulation of translation|RNA splicing	cytoplasm|nucleus|plasma membrane	RNA binding|SH3 domain binding			large_intestine(1)|ovary(1)	2		Breast(66;5e-05)|Prostate(117;0.0235)|all_neural(5;0.0416)|Ovarian(120;0.0448)|Glioma(2;0.203)		all cancers(1;4.4e-46)|OV - Ovarian serous cystadenocarcinoma(33;6.91e-23)|GBM - Glioblastoma multiforme(1;2.94e-19)|BRCA - Breast invasive adenocarcinoma(81;1.49e-06)|Kidney(3;0.000199)|KIRC - Kidney renal clear cell carcinoma(3;0.000234)		CTTGCCTGTCGTCAGTGCAGC	0.448													4	215	---	---	---	---	PASS
SDK1	221935	broad.mit.edu	37	7	4198097	4198097	+	Missense_Mutation	SNP	C	A	A			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:4198097C>A	uc003smx.2	+	31	4782	c.4643C>A	c.(4642-4644)TCC>TAC	p.S1548Y	SDK1_uc010kso.2_Missense_Mutation_p.S824Y|SDK1_uc003smy.2_Missense_Mutation_p.S35Y	NM_152744	NP_689957	Q7Z5N4	SDK1_HUMAN	sidekick 1 precursor	1548	Fibronectin type-III 9.				cell adhesion	integral to membrane				large_intestine(3)|ovary(2)|skin(1)	6		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		CCCTTCACCTCCTACAAGCTG	0.612													17	38	---	---	---	---	PASS
MEOX2	4223	broad.mit.edu	37	7	15652143	15652143	+	Missense_Mutation	SNP	C	T	T			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:15652143C>T	uc003stc.2	-	3	1065	c.784G>A	c.(784-786)GTG>ATG	p.V262M	MEOX2_uc011jxw.1_Missense_Mutation_p.V262M	NM_005924	NP_005915	P50222	MEOX2_HUMAN	mesenchyme homeobox 2	262					blood circulation|multicellular organismal development	cytoplasm|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)|central_nervous_system(1)	2				UCEC - Uterine corpus endometrioid carcinoma (126;0.0822)		CCCTTTTTCACATTCACCAGT	0.517													6	196	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	65157752	65157752	+	Intron	SNP	T	C	C			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:65157752T>C	uc003tud.1	-						INTS4L2_uc003tue.2_RNA					Homo sapiens hypothetical LOC441242, mRNA (cDNA clone MGC:87648 IMAGE:5267764), complete cds.																		GCGAGCATTGTTCTCAGATCA	0.413													3	102	---	---	---	---	PASS
MIR593	693178	broad.mit.edu	37	7	127721977	127721977	+	RNA	SNP	A	G	G			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:127721977A>G	hsa-mir-593|MI0003605	+			c.65A>G			SND1_uc003vmi.2_Intron|SND1_uc010lle.2_Intron																	0						GGGAGCAAGGAGTGGTGCTGG	0.562													23	114	---	---	---	---	PASS
PODXL	5420	broad.mit.edu	37	7	131191353	131191353	+	Missense_Mutation	SNP	C	G	G			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:131191353C>G	uc003vqw.3	-	6	1492	c.1234G>C	c.(1234-1236)GAA>CAA	p.E412Q	PODXL_uc003vqx.3_Missense_Mutation_p.E380Q	NM_001018111	NP_001018121	O00592	PODXL_HUMAN	podocalyxin-like isoform 1 precursor	412	Extracellular (Potential).				cell adhesion|epithelial tube formation|negative regulation of cell-cell adhesion|positive regulation of cell migration|positive regulation of cell-cell adhesion mediated by integrin|regulation of microvillus assembly	actin cytoskeleton|apical plasma membrane|centrosome|filopodium|integral to plasma membrane|lamellipodium|membrane raft|microvillus membrane|nucleolus|ruffle				breast(2)|pancreas(1)	3	Melanoma(18;0.162)					ATAGTGATTTCTTTGACGACC	0.582											OREG0018320	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	49	160	---	---	---	---	PASS
DENND2A	27147	broad.mit.edu	37	7	140301525	140301525	+	Missense_Mutation	SNP	T	C	C			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:140301525T>C	uc010lnj.2	-	1	818	c.673A>G	c.(673-675)AGG>GGG	p.R225G	DENND2A_uc011kre.1_RNA|DENND2A_uc010lnk.2_Missense_Mutation_p.R225G|DENND2A_uc003vvw.2_Missense_Mutation_p.R225G|DENND2A_uc003vvx.2_Missense_Mutation_p.R225G	NM_015689	NP_056504	Q9ULE3	DEN2A_HUMAN	DENN/MADD domain containing 2A	225										ovary(3)|breast(1)	4	Melanoma(164;0.00956)					GTGGGCTCCCTGCCTTCCAGG	0.637													60	186	---	---	---	---	PASS
ZYX	7791	broad.mit.edu	37	7	143079761	143079761	+	Missense_Mutation	SNP	G	A	A			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:143079761G>A	uc003wcw.2	+	4	639	c.484G>A	c.(484-486)GAT>AAT	p.D162N	ZYX_uc011ktd.1_Missense_Mutation_p.D5N|ZYX_uc003wcx.2_Missense_Mutation_p.D162N|ZYX_uc011kte.1_Intron|ZYX_uc011ktf.1_Missense_Mutation_p.D5N	NM_001010972	NP_001010972	Q15942	ZYX_HUMAN	zyxin	162					cell adhesion|cell-cell signaling|interspecies interaction between organisms|signal transduction	cell-cell adherens junction|cytoplasm|focal adhesion|integral to plasma membrane|nucleus|stress fiber	protein binding|zinc ion binding				0	Melanoma(164;0.205)					GACCAAGAATGATCCTTTCAA	0.542													46	229	---	---	---	---	PASS
GIMAP8	155038	broad.mit.edu	37	7	150174244	150174244	+	Silent	SNP	C	T	T			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150174244C>T	uc003whj.2	+	5	1704	c.1374C>T	c.(1372-1374)ATC>ATT	p.I458I		NM_175571	NP_783161	Q8ND71	GIMA8_HUMAN	GTPase, IMAP family member 8	458						endoplasmic reticulum|Golgi apparatus|mitochondrion	GTP binding			skin(3)|ovary(2)|breast(1)|central_nervous_system(1)	7			OV - Ovarian serous cystadenocarcinoma(82;0.0218)	UCEC - Uterine corpus endometrioid carcinoma (81;0.17)		GGAACTCTATCCTGGGGAGCC	0.592													51	79	---	---	---	---	PASS
NOM1	64434	broad.mit.edu	37	7	156752790	156752790	+	Silent	SNP	T	G	G			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:156752790T>G	uc003wmy.2	+	4	1569	c.1554T>G	c.(1552-1554)GCT>GCG	p.A518A	NOM1_uc010lqp.1_5'Flank	NM_138400	NP_612409	Q5C9Z4	NOM1_HUMAN	nucleolar protein with MIF4G domain 1	518	MIF4G.				RNA metabolic process	nucleolus	protein binding				0	Ovarian(565;0.218)	all_hematologic(28;0.0749)	OV - Ovarian serous cystadenocarcinoma(82;0.00301)	UCEC - Uterine corpus endometrioid carcinoma (81;0.169)		AAGATGATGCTTTATCACTTA	0.438													31	127	---	---	---	---	PASS
BIN3	55909	broad.mit.edu	37	8	22479026	22479026	+	Missense_Mutation	SNP	T	G	G			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:22479026T>G	uc003xcl.2	-	9	768	c.671A>C	c.(670-672)GAC>GCC	p.D224A	BIN3_uc003xck.2_Missense_Mutation_p.D176A|BIN3_uc010ltw.2_Missense_Mutation_p.D170A	NM_018688	NP_061158	Q9NQY0	BIN3_HUMAN	bridging integrator 3	224	BAR.				actin filament organization|barrier septum formation|cell cycle|protein localization|unidimensional cell growth	cytoplasm|cytoskeleton	cytoskeletal adaptor activity				0		Prostate(55;0.0424)|Breast(100;0.102)|all_epithelial(46;0.143)		BRCA - Breast invasive adenocarcinoma(99;0.00664)|Colorectal(74;0.0189)|COAD - Colon adenocarcinoma(73;0.0727)		GCCTGGCTGGTCAAGCTGATG	0.612													6	52	---	---	---	---	PASS
DOCK5	80005	broad.mit.edu	37	8	25167958	25167958	+	Missense_Mutation	SNP	C	A	A			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:25167958C>A	uc003xeg.2	+	13	1365	c.1228C>A	c.(1228-1230)CTC>ATC	p.L410I	DOCK5_uc010luf.1_RNA|DOCK5_uc003xeh.1_Missense_Mutation_p.L124I|DOCK5_uc003xei.2_5'UTR	NM_024940	NP_079216	Q9H7D0	DOCK5_HUMAN	dedicator of cytokinesis 5	410						cytoplasm	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			ovary(3)	3		all_cancers(63;0.0361)|Ovarian(32;0.000711)|all_epithelial(46;0.0153)|Hepatocellular(4;0.115)|Prostate(55;0.13)|Breast(100;0.143)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0267)|Epithelial(17;1.07e-11)|Colorectal(74;0.0276)|COAD - Colon adenocarcinoma(73;0.0828)		GCCCGGTGACCTCACCCAGGT	0.413													4	72	---	---	---	---	PASS
PLEKHA2	59339	broad.mit.edu	37	8	38827144	38827144	+	Nonsense_Mutation	SNP	C	A	A			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38827144C>A	uc003xmi.3	+	12	1355	c.1121C>A	c.(1120-1122)TCA>TAA	p.S374*	PLEKHA2_uc011lce.1_Nonsense_Mutation_p.S324*	NM_021623	NP_067636	Q9HB19	PKHA2_HUMAN	pleckstrin homology domain containing, family A	374					positive regulation of cell-matrix adhesion	cytoplasm|nucleus|plasma membrane|protein complex	fibronectin binding|laminin binding				0		all_lung(54;0.0413)|Lung NSC(58;0.115)|Hepatocellular(245;0.152)	LUSC - Lung squamous cell carcinoma(45;4.68e-08)|COAD - Colon adenocarcinoma(9;0.235)			GGAGACACTTCAGAGGACTCC	0.652													4	5	---	---	---	---	PASS
SNAI2	6591	broad.mit.edu	37	8	49832751	49832751	+	Missense_Mutation	SNP	T	A	A			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:49832751T>A	uc003xqp.2	-	2	493	c.329A>T	c.(328-330)GAG>GTG	p.E110V		NM_003068	NP_003059	O43623	SNAI2_HUMAN	snail 2	110					canonical Wnt receptor signaling pathway|ectoderm and mesoderm interaction|multicellular organismal development|negative regulation of transcription from RNA polymerase II promoter|osteoblast differentiation|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2		all_cancers(86;0.0368)|all_epithelial(80;0.000624)|Lung NSC(129;0.0019)|all_lung(136;0.00502)				TAGTCTTTCCTCTTCATCACT	0.488													72	171	---	---	---	---	PASS
LAPTM4B	55353	broad.mit.edu	37	8	98787866	98787866	+	5'UTR	SNP	G	T	T			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:98787866G>T	uc003yia.2	+	1					LAPTM4B_uc010mbg.2_5'UTR	NM_018407	NP_060877	Q86VI4	LAP4B_HUMAN	lysosomal associated transmembrane protein 4						transport	endomembrane system|integral to membrane	protein binding			skin(1)	1	Breast(36;1.59e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.149)			GGAAGGCCCGGACCTCCACTC	0.547													7	8	---	---	---	---	PASS
FAM166B	730112	broad.mit.edu	37	9	35562911	35562911	+	Missense_Mutation	SNP	C	A	A			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35562911C>A	uc010mkr.2	-	3	524	c.453G>T	c.(451-453)GAG>GAT	p.E151D	FAM166B_uc011lov.1_Missense_Mutation_p.E151D|FAM166B_uc011low.1_Missense_Mutation_p.E151D|FAM166B_uc003zwy.2_Missense_Mutation_p.E151D	NM_001164310	NP_001157782	A8MTA8	F166B_HUMAN	hypothetical protein LOC730112 isoform 1	151											0						CCAGCTGCCCCTCCGGCTCTG	0.567													26	61	---	---	---	---	PASS
POLR1E	64425	broad.mit.edu	37	9	37500907	37500907	+	Silent	SNP	C	T	T			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:37500907C>T	uc003zzz.1	+	9	1431	c.1143C>T	c.(1141-1143)TAC>TAT	p.Y381Y	POLR1E_uc003zzy.1_Silent_p.Y319Y|POLR1E_uc011lqk.1_Silent_p.Y248Y	NM_022490	NP_071935	Q9GZS1	RPA49_HUMAN	RNA polymerase I associated factor 53	381					rRNA transcription	cell junction|cytoplasm|nucleolus	DNA binding|DNA-directed RNA polymerase activity|protein binding				0				GBM - Glioblastoma multiforme(29;0.00851)|Lung(182;0.229)		GCTTGACCTACAACAATGGCA	0.493													22	35	---	---	---	---	PASS
RABGAP1	23637	broad.mit.edu	37	9	125752248	125752248	+	Intron	SNP	C	T	T			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:125752248C>T	uc011lzh.1	+						RABGAP1_uc004bnl.3_Intron|RABGAP1_uc004bnm.1_3'UTR	NM_012197	NP_036329	Q9Y3P9	RBGP1_HUMAN	RAB GTPase activating protein 1						cell cycle	centrosome|cytosol|microtubule associated complex	Rab GTPase activator activity|tubulin binding			ovary(3)|kidney(2)	5						ATAATTATTGCCCTCCAAAGT	0.348													3	36	---	---	---	---	PASS
DENND1A	57706	broad.mit.edu	37	9	126144388	126144388	+	Missense_Mutation	SNP	G	A	A			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:126144388G>A	uc004bnz.1	-	22	2586	c.2353C>T	c.(2353-2355)CTC>TTC	p.L785F	DENND1A_uc011lzl.1_Missense_Mutation_p.L603F|DENND1A_uc004bny.1_Missense_Mutation_p.L567F|DENND1A_uc011lzm.1_Missense_Mutation_p.L796F|DENND1A_uc010mwh.1_Missense_Mutation_p.L206F	NM_020946	NP_065997	Q8TEH3	DEN1A_HUMAN	DENN/MADD domain containing 1A isoform 1	785	Pro-rich.					cell junction|clathrin coated vesicle membrane|presynaptic membrane	guanyl-nucleotide exchange factor activity			ovary(2)	2						GGGTCCAGGAGGGCGAGCAGG	0.697													3	9	---	---	---	---	PASS
EXD3	54932	broad.mit.edu	37	9	140249170	140249170	+	Nonsense_Mutation	SNP	G	T	T			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140249170G>T	uc004cmp.2	-	9	1009	c.813C>A	c.(811-813)TGC>TGA	p.C271*	C9orf167_uc011mew.1_Intron|EXD3_uc010ncf.1_5'UTR|EXD3_uc004cmq.1_Intron|EXD3_uc010ncg.1_Nonsense_Mutation_p.C210*	NM_017820	NP_060290	Q8N9H8	MUT7_HUMAN	exonuclease 3'-5' domain containing 3	271					nucleobase, nucleoside, nucleotide and nucleic acid metabolic process	intracellular	3'-5' exonuclease activity|nucleic acid binding				0						ACCGCTTGTGGCACAGGTGCC	0.667													10	17	---	---	---	---	PASS
TUBBP5	643224	broad.mit.edu	37	9	141071110	141071110	+	Silent	SNP	A	G	G			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:141071110A>G	uc004com.2	+	4	774	c.513A>G	c.(511-513)CCA>CCG	p.P171P	TUBBP5_uc010ncq.2_3'UTR					RecName: Full=Putative tubulin beta-4q chain;												0						TGCGCTTCCCAGGCCAGCTGA	0.597													3	48	---	---	---	---	PASS
KIAA1217	56243	broad.mit.edu	37	10	24669919	24669919	+	Missense_Mutation	SNP	C	T	T			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:24669919C>T	uc001iru.3	+	3	879	c.476C>T	c.(475-477)CCT>CTT	p.P159L	KIAA1217_uc001irs.2_Missense_Mutation_p.P79L|KIAA1217_uc001irt.3_Missense_Mutation_p.P159L|KIAA1217_uc010qcy.1_Missense_Mutation_p.P159L|KIAA1217_uc010qcz.1_Missense_Mutation_p.P159L|KIAA1217_uc001irv.1_Missense_Mutation_p.P9L|KIAA1217_uc010qda.1_RNA	NM_019590	NP_062536	Q5T5P2	SKT_HUMAN	sickle tail isoform 1	159					embryonic skeletal system development	cytoplasm				ovary(5)|skin(2)	7						GCTCCAACCCCTTTTTCCAGA	0.542													24	63	---	---	---	---	PASS
ANK3	288	broad.mit.edu	37	10	62039296	62039296	+	Missense_Mutation	SNP	C	G	G			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:62039296C>G	uc001jky.2	-	2	408	c.216G>C	c.(214-216)CAG>CAC	p.Q72H	ANK3_uc010qih.1_Missense_Mutation_p.Q55H|ANK3_uc001jkz.3_Missense_Mutation_p.Q66H|ANK3_uc001jlb.1_5'UTR	NM_020987	NP_066267	Q12955	ANK3_HUMAN	ankyrin 3 isoform 1	72					establishment of protein localization|signal transduction	basolateral plasma membrane|cytoplasm|cytoskeleton	protein binding			skin(9)|ovary(6)|pancreas(2)|central_nervous_system(2)	19						TCCAGCTAACCTGATTGCAAA	0.363													33	128	---	---	---	---	PASS
DNAJC12	56521	broad.mit.edu	37	10	69565360	69565360	+	Silent	SNP	C	T	T			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:69565360C>T	uc001jnb.2	-	4	651	c.483G>A	c.(481-483)CCG>CCA	p.P161P		NM_021800	NP_068572	Q9UKB3	DJC12_HUMAN	J domain containing protein 1 isoform a	161					protein folding		heat shock protein binding|unfolded protein binding			breast(1)	1						CTGAATTTTGCGGGGAGACTG	0.388													6	584	---	---	---	---	PASS
AP3M1	26985	broad.mit.edu	37	10	75884279	75884279	+	Silent	SNP	G	A	A			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75884279G>A	uc001jwf.2	-	8	1445	c.1015C>T	c.(1015-1017)CTA>TTA	p.L339L	AP3M1_uc001jwg.2_Silent_p.L339L|AP3M1_uc001jwh.2_Silent_p.L339L|AP3M1_uc010qla.1_Silent_p.L285L	NM_207012	NP_996895	Q9Y2T2	AP3M1_HUMAN	adaptor-related protein complex 3, mu 1 subunit	339	MHD.				protein targeting to lysosome|vesicle-mediated transport	clathrin adaptor complex|Golgi apparatus|lysosome	protein binding				0	Prostate(51;0.0112)					TCCCATGTTAGTACCTTAAAA	0.348													19	34	---	---	---	---	PASS
ZFYVE27	118813	broad.mit.edu	37	10	99509236	99509236	+	Missense_Mutation	SNP	A	G	G			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:99509236A>G	uc001koo.2	+	6	757	c.557A>G	c.(556-558)TAT>TGT	p.Y186C	ZFYVE27_uc001kon.2_Missense_Mutation_p.Y186C|ZFYVE27_uc001koq.2_Missense_Mutation_p.Y100C|ZFYVE27_uc010qpa.1_Missense_Mutation_p.Y68C|ZFYVE27_uc001kop.2_Missense_Mutation_p.Y186C|ZFYVE27_uc010qpb.1_Missense_Mutation_p.Y88C|ZFYVE27_uc010qpc.1_RNA|ZFYVE27_uc010qpd.1_Missense_Mutation_p.Y154C|ZFYVE27_uc001kok.1_RNA|ZFYVE27_uc001kol.1_Missense_Mutation_p.Y186C|ZFYVE27_uc001kom.1_Missense_Mutation_p.Y186C	NM_144588	NP_653189	Q5T4F4	ZFY27_HUMAN	zinc finger, FYVE domain containing 27 isoform	186	Cytoplasmic (Potential).				cell death|nerve growth factor receptor signaling pathway|neuron projection development|protein localization in plasma membrane	axon|dendrite|endoplasmic reticulum membrane|growth cone membrane|integral to membrane|recycling endosome membrane	metal ion binding|protein binding			ovary(1)	1		Colorectal(252;0.0846)		Epithelial(162;7.08e-10)|all cancers(201;5.18e-08)		TCCAGGTTCTATGGGGCTCTT	0.522													20	73	---	---	---	---	PASS
SORCS3	22986	broad.mit.edu	37	10	107016626	107016626	+	Missense_Mutation	SNP	G	A	A			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:107016626G>A	uc001kyi.1	+	25	3614	c.3387G>A	c.(3385-3387)ATG>ATA	p.M1129I		NM_014978	NP_055793	Q9UPU3	SORC3_HUMAN	VPS10 domain receptor protein SORCS 3 precursor	1129	Helical; (Potential).					integral to membrane	neuropeptide receptor activity			ovary(6)|skin(3)|central_nervous_system(1)	10		Colorectal(252;0.134)|Breast(234;0.142)|Lung NSC(174;0.191)		Epithelial(162;1.58e-07)|all cancers(201;1.02e-05)|BRCA - Breast invasive adenocarcinoma(275;0.0628)		CCATGCTTATGCTATTATCAG	0.433													15	26	---	---	---	---	PASS
NRAP	4892	broad.mit.edu	37	10	115391645	115391645	+	Missense_Mutation	SNP	C	T	T			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:115391645C>T	uc001laj.2	-	17	1875	c.1711G>A	c.(1711-1713)GCC>ACC	p.A571T	NRAP_uc009xyb.2_5'Flank|NRAP_uc001lak.2_Missense_Mutation_p.A536T|NRAP_uc001lal.3_Missense_Mutation_p.A571T	NM_198060	NP_932326	Q86VF7	NRAP_HUMAN	nebulin-related anchoring protein isoform S	571	Nebulin 13.					fascia adherens|muscle tendon junction	actin binding|muscle alpha-actinin binding|zinc ion binding			ovary(6)|central_nervous_system(3)|upper_aerodigestive_tract(1)	10		Colorectal(252;0.0233)|Breast(234;0.188)		Epithelial(162;0.00392)|all cancers(201;0.00569)		GAGGCTTTGGCGGCCAGCAGA	0.453													4	130	---	---	---	---	PASS
PIK3C2A	5286	broad.mit.edu	37	11	17118795	17118795	+	Silent	SNP	A	G	G			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:17118795A>G	uc001mmq.3	-	26	4201	c.4135T>C	c.(4135-4137)TTG>CTG	p.L1379L	PIK3C2A_uc009ygu.1_Silent_p.V23V|PIK3C2A_uc010rcw.1_Silent_p.L999L|PIK3C2A_uc001mmr.3_Intron	NM_002645	NP_002636	O00443	P3C2A_HUMAN	phosphoinositide-3-kinase, class 2 alpha	1379	PI3K/PI4K.				cell communication|phosphatidylinositol biosynthetic process|phosphatidylinositol-mediated signaling	clathrin-coated vesicle|Golgi apparatus|nucleus|phosphatidylinositol 3-kinase complex|plasma membrane	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol binding|phosphatidylinositol-4-phosphate 3-kinase activity			lung(4)|central_nervous_system(4)|stomach(1)|ovary(1)	10					Phosphatidylserine(DB00144)	ATGCTTCCCAAACTTGATTCA	0.338													15	45	---	---	---	---	PASS
HPS5	11234	broad.mit.edu	37	11	18314494	18314494	+	Missense_Mutation	SNP	G	T	T			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:18314494G>T	uc001mod.1	-	15	2092	c.1814C>A	c.(1813-1815)CCA>CAA	p.P605Q	HPS5_uc001moe.1_Missense_Mutation_p.P491Q|HPS5_uc001mof.1_Missense_Mutation_p.P491Q	NM_181507	NP_852608	Q9UPZ3	HPS5_HUMAN	Hermansky-Pudlak syndrome 5 isoform a	605						cytosol				ovary(1)|pancreas(1)|skin(1)	3						GTCTTCTTCTGGAGGTGGACT	0.368									Hermansky-Pudlak_syndrome				43	117	---	---	---	---	PASS
SPRYD5	84767	broad.mit.edu	37	11	55653105	55653105	+	Missense_Mutation	SNP	C	A	A			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55653105C>A	uc010rip.1	+	2	293	c.201C>A	c.(199-201)GAC>GAA	p.D67E	SPRYD5_uc010riq.1_5'Flank	NM_032681	NP_116070	Q9BSJ1	SPRY5_HUMAN	SPRY domain containing 5	67						intracellular	zinc ion binding				0		all_epithelial(135;0.226)				TCAACACTGACATTTGTTTGA	0.488													5	28	---	---	---	---	PASS
SPRYD5	84767	broad.mit.edu	37	11	55658689	55658689	+	Missense_Mutation	SNP	G	T	T			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55658689G>T	uc010rip.1	+	7	1032	c.940G>T	c.(940-942)GAC>TAC	p.D314Y	SPRYD5_uc010riq.1_Missense_Mutation_p.D171Y	NM_032681	NP_116070	Q9BSJ1	SPRY5_HUMAN	SPRY domain containing 5	314	B30.2/SPRY.					intracellular	zinc ion binding				0		all_epithelial(135;0.226)				TGTTGGATGTGACCCTCAAGA	0.388													38	147	---	---	---	---	PASS
OR9G9	504191	broad.mit.edu	37	11	56468610	56468610	+	Missense_Mutation	SNP	A	C	C			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56468610A>C	uc010rjn.1	+	1	747	c.747A>C	c.(745-747)TTA>TTC	p.L249F		NM_001013358	NP_001013376	P0C7N8	OR9G9_HUMAN	olfactory receptor, family 9, subfamily G,	249	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						CTGTCACTTTATACTATGGCT	0.453													7	366	---	---	---	---	PASS
CYBASC3	220002	broad.mit.edu	37	11	61120499	61120499	+	Missense_Mutation	SNP	G	A	A			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61120499G>A	uc001nrf.3	-	3	682	c.506C>T	c.(505-507)GCA>GTA	p.A169V	CYBASC3_uc010rlh.1_Missense_Mutation_p.A186V|CYBASC3_uc001nrg.2_Missense_Mutation_p.A169V|CYBASC3_uc009ynn.2_RNA|CYBASC3_uc001nrh.2_Missense_Mutation_p.A169V|CYBASC3_uc001nri.2_RNA	NM_001161452	NP_001154924	Q8NBI2	CYAC3_HUMAN	cytochrome b, ascorbate dependent 3 isoform 2	169	Helical; Name=5; (Potential).|Cytochrome b561.				electron transport chain|transport	integral to membrane|late endosome membrane|lysosomal membrane	metal ion binding|oxidoreductase activity				0						AATGACGGATGCGATGGACAG	0.517													10	38	---	---	---	---	PASS
FAT3	120114	broad.mit.edu	37	11	92543049	92543049	+	Missense_Mutation	SNP	C	G	G			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:92543049C>G	uc001pdj.3	+	12	9305	c.9288C>G	c.(9286-9288)ATC>ATG	p.I3096M		NM_001008781	NP_001008781	Q8TDW7	FAT3_HUMAN	FAT tumor suppressor homolog 3	3096	Cadherin 28.|Extracellular (Potential).				homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|pancreas(1)	5		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				GGGAGAGGATCCCCGTGTACA	0.507										TCGA Ovarian(4;0.039)			15	40	---	---	---	---	PASS
MRE11A	4361	broad.mit.edu	37	11	94219122	94219122	+	Silent	SNP	G	T	T			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:94219122G>T	uc001peu.2	-	4	471	c.282C>A	c.(280-282)CTC>CTA	p.L94L	MRE11A_uc001pev.2_Silent_p.L94L|MRE11A_uc009ywj.2_Silent_p.L97L	NM_005591	NP_005582	P49959	MRE11_HUMAN	meiotic recombination 11 homolog A isoform 1	94					DNA duplex unwinding|double-strand break repair via homologous recombination|double-strand break repair via nonhomologous end joining|negative regulation of DNA endoreduplication|positive regulation of kinase activity|positive regulation of protein autophosphorylation|reciprocal meiotic recombination|regulation of mitotic recombination|sister chromatid cohesion|telomere maintenance via telomerase	Mre11 complex|nucleoplasm	3'-5' exonuclease activity|double-stranded DNA binding|manganese ion binding|protein C-terminus binding|single-stranded DNA specific endodeoxyribonuclease activity			breast(4)|lung(1)	5		Acute lymphoblastic leukemia(157;2.37e-05)|all_hematologic(158;0.00824)				ACTGATCACTGAGAATTTCAA	0.338								Homologous_recombination	Ataxia-Telangiectasia-Like_Disorder				14	47	---	---	---	---	PASS
RDX	5962	broad.mit.edu	37	11	110106930	110106930	+	Intron	SNP	T	C	C			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:110106930T>C	uc001pku.2	-						RDX_uc009yxx.1_Intron|RDX_uc009yxy.2_Intron|RDX_uc009yxz.2_Intron|RDX_uc009yya.2_Intron|RDX_uc001pks.2_Translation_Start_Site|RDX_uc001pkt.2_Intron|RDX_uc010rwe.1_Intron	NM_002906	NP_002897	P35241	RADI_HUMAN	radixin						actin filament capping	cleavage furrow|cytoskeleton|extrinsic to membrane|Golgi apparatus|nucleolus|plasma membrane	actin binding				0		all_cancers(61;7.18e-13)|all_epithelial(67;2.61e-07)|Melanoma(852;1.46e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;3.95e-05)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Breast(348;0.0544)		Epithelial(105;1.13e-06)|BRCA - Breast invasive adenocarcinoma(274;9.75e-06)|all cancers(92;5.9e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0248)		AAGTAAACAATATAATTCCAA	0.338													22	23	---	---	---	---	PASS
TECTA	7007	broad.mit.edu	37	11	120980198	120980198	+	Silent	SNP	C	T	T			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:120980198C>T	uc010rzo.1	+	3	477	c.477C>T	c.(475-477)AGC>AGT	p.S159S		NM_005422	NP_005413	O75443	TECTA_HUMAN	tectorin alpha precursor	159	NIDO.				cell-matrix adhesion|sensory perception of sound	anchored to membrane|plasma membrane|proteinaceous extracellular matrix				breast(6)|ovary(2)|skin(2)	10	all_hematologic(175;0.208)	Breast(109;0.000766)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;8.04e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.166)		GAGGCAGCAGCACCACACCTG	0.428													15	49	---	---	---	---	PASS
ZNF202	7753	broad.mit.edu	37	11	123598248	123598248	+	Nonsense_Mutation	SNP	C	T	T			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123598248C>T	uc001pzd.1	-	8	1288	c.888G>A	c.(886-888)TGG>TGA	p.W296*	ZNF202_uc001pzc.1_Nonsense_Mutation_p.W72*|ZNF202_uc001pze.1_Nonsense_Mutation_p.W296*|ZNF202_uc001pzf.1_Nonsense_Mutation_p.W296*	NM_003455	NP_003446	O95125	ZN202_HUMAN	zinc finger protein 202	296	KRAB.				lipid metabolic process|negative regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter|viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1		Breast(109;0.00204)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.03)		TATCTGGGACCCAAGGCTCTT	0.483													23	52	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	11	124135620	124135620	+	IGR	SNP	G	A	A			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124135620G>A								OR8G2 (39310 upstream) : OR8D1 (44117 downstream)																							GCCATCATCTGTCAGCTCCAT	0.502													38	98	---	---	---	---	PASS
MANSC1	54682	broad.mit.edu	37	12	12483626	12483626	+	Missense_Mutation	SNP	A	C	C			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:12483626A>C	uc001rai.1	-	4	889	c.631T>G	c.(631-633)TCT>GCT	p.S211A	MANSC1_uc010shm.1_Missense_Mutation_p.S145A|MANSC1_uc001raj.1_Missense_Mutation_p.S177A|MANSC1_uc009zht.1_Missense_Mutation_p.S130A	NM_018050	NP_060520	Q9H8J5	MANS1_HUMAN	MANSC domain containing 1 precursor	211	Extracellular (Potential).					integral to membrane					0		Prostate(47;0.0865)		BRCA - Breast invasive adenocarcinoma(232;0.185)		TCTTGATCAGAGGAAAATTGT	0.468													28	65	---	---	---	---	PASS
FMNL3	91010	broad.mit.edu	37	12	50050231	50050231	+	Missense_Mutation	SNP	C	T	T			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50050231C>T	uc001ruv.1	-	9	1075	c.841G>A	c.(841-843)GGA>AGA	p.G281R	FMNL3_uc001ruw.1_Missense_Mutation_p.G230R|FMNL3_uc001ruu.1_Missense_Mutation_p.G131R	NM_175736	NP_783863	Q8IVF7	FMNL3_HUMAN	formin-like 3 isoform 1	281	GBD/FH3.				actin cytoskeleton organization		actin binding|Rho GTPase binding			breast(2)|pancreas(2)	4						TCGTGACCTCCTCGCACCAAA	0.512													18	40	---	---	---	---	PASS
OR6C2	341416	broad.mit.edu	37	12	55846275	55846275	+	Missense_Mutation	SNP	A	G	G			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:55846275A>G	uc001sgz.1	+	1	278	c.278A>G	c.(277-279)AAT>AGT	p.N93S		NM_054105	NP_473446	Q9NZP2	OR6C2_HUMAN	olfactory receptor, family 6, subfamily C,	93	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2						ATTACCTACAATGCTTGTGCC	0.378													69	221	---	---	---	---	PASS
C12orf56	115749	broad.mit.edu	37	12	64671569	64671569	+	Missense_Mutation	SNP	T	C	C			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:64671569T>C	uc001ssa.3	-	7	845	c.845A>G	c.(844-846)AAT>AGT	p.N282S	uc001srx.2_Intron|C12orf56_uc001sry.2_Missense_Mutation_p.N24S|C12orf56_uc001srz.2_Intron	NM_001099676	NP_001093146	Q8IXR9	CL056_HUMAN	hypothetical protein LOC115749	445											0			GBM - Glioblastoma multiforme(3;0.000582)	GBM - Glioblastoma multiforme(28;0.0259)		TACCAAGAGATTAAATAGTGC	0.353													6	23	---	---	---	---	PASS
RASSF3	283349	broad.mit.edu	37	12	65085342	65085342	+	Missense_Mutation	SNP	G	C	C			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:65085342G>C	uc001ssd.2	+	4	670	c.550G>C	c.(550-552)GAA>CAA	p.E184Q	RASSF3_uc009zqn.2_RNA|RASSF3_uc001sse.2_Missense_Mutation_p.E114Q	NM_178169	NP_835463	Q86WH2	RASF3_HUMAN	Ras association (RalGDS/AF-6) domain family	184	Ras-associating.				signal transduction	cytoplasm|microtubule	identical protein binding				0			Lung(2;0.00133)|LUAD - Lung adenocarcinoma(6;0.0665)|LUSC - Lung squamous cell carcinoma(43;0.132)	GBM - Glioblastoma multiforme(28;0.0611)		TGTTCTTCGTGAACATGAAAT	0.448													15	31	---	---	---	---	PASS
RAP1B	5908	broad.mit.edu	37	12	69050901	69050901	+	Silent	SNP	G	A	A			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:69050901G>A	uc001sub.2	+	7	652	c.489G>A	c.(487-489)CGG>CGA	p.R163R	RAP1B_uc010ste.1_Silent_p.R97R|RAP1B_uc001suc.2_Silent_p.R163R|RAP1B_uc010stf.1_Silent_p.R144R|RAP1B_uc010stg.1_Silent_p.R121R|RAP1B_uc010sth.1_Silent_p.R121R|RAP1B_uc010sti.1_Silent_p.R116R	NM_001089704	NP_001083173	P61224	RAP1B_HUMAN	SubName: Full=Ras-related protein Rap-1A; SubName: Full=cDNA FLJ75985, highly similar to Homo sapiens RAP1A, member of RAS oncogene family (RAP1A), transcript variant 2, mRNA; SubName: Full=RAP1A, member of RAS oncogene family;	163					blood coagulation|energy reserve metabolic process|regulation of establishment of cell polarity|regulation of insulin secretion	cell-cell junction|cytosol	GDP binding|GTP binding|GTPase activity|protein binding				0	Breast(13;1.24e-05)		Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.00694)	GBM - Glioblastoma multiforme(7;0.000306)		ACCTAGTGCGGCAAATTAACA	0.373													4	148	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	12	80749604	80749604	+	5'Flank	SNP	G	T	T			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:80749604G>T	uc009zsg.1	+						uc001szd.2_5'Flank					RecName: Full=Uncharacterized protein C12orf64;																		AATGTTTGGAGAATGGAAGCA	0.448													4	144	---	---	---	---	PASS
C12orf26	84190	broad.mit.edu	37	12	82796821	82796821	+	Missense_Mutation	SNP	A	G	G			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:82796821A>G	uc001szq.2	+	5	1212	c.1191A>G	c.(1189-1191)ATA>ATG	p.I397M		NM_032230	NP_115606	Q8N6Q8	CL026_HUMAN	hypothetical protein LOC84190	397											0						CTTTGCGAATATTTACCTCCA	0.373													16	76	---	---	---	---	PASS
ATXN2	6311	broad.mit.edu	37	12	111893890	111893890	+	Missense_Mutation	SNP	A	C	C			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:111893890A>C	uc001tsj.2	-	23	3849	c.3687T>G	c.(3685-3687)CAT>CAG	p.H1229Q	ATXN2_uc001tsh.2_Missense_Mutation_p.H964Q|ATXN2_uc001tsi.2_Missense_Mutation_p.H922Q|ATXN2_uc001tsk.2_RNA|ATXN2_uc001tsg.2_Missense_Mutation_p.H417Q|ATXN2_uc001tsl.1_Missense_Mutation_p.H230Q	NM_002973	NP_002964	Q99700	ATX2_HUMAN	ataxin 2	1229					cell death|cytoplasmic mRNA processing body assembly|regulation of translation|RNA metabolic process|RNA transport|stress granule assembly	nucleus|perinuclear region of cytoplasm|polysome|stress granule|trans-Golgi network	protein C-terminus binding|RNA binding			ovary(1)|breast(1)	2						CGTGAGAAGGATGGATCGTAA	0.547													45	166	---	---	---	---	PASS
ATXN2	6311	broad.mit.edu	37	12	111893891	111893891	+	Missense_Mutation	SNP	T	A	A			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:111893891T>A	uc001tsj.2	-	23	3848	c.3686A>T	c.(3685-3687)CAT>CTT	p.H1229L	ATXN2_uc001tsh.2_Missense_Mutation_p.H964L|ATXN2_uc001tsi.2_Missense_Mutation_p.H922L|ATXN2_uc001tsk.2_RNA|ATXN2_uc001tsg.2_Missense_Mutation_p.H417L|ATXN2_uc001tsl.1_Missense_Mutation_p.H230L	NM_002973	NP_002964	Q99700	ATX2_HUMAN	ataxin 2	1229					cell death|cytoplasmic mRNA processing body assembly|regulation of translation|RNA metabolic process|RNA transport|stress granule assembly	nucleus|perinuclear region of cytoplasm|polysome|stress granule|trans-Golgi network	protein C-terminus binding|RNA binding			ovary(1)|breast(1)	2						GTGAGAAGGATGGATCGTAAA	0.552													48	165	---	---	---	---	PASS
C12orf43	64897	broad.mit.edu	37	12	121442228	121442228	+	Missense_Mutation	SNP	G	C	C			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:121442228G>C	uc001tzh.1	-	6	540	c.517C>G	c.(517-519)CAG>GAG	p.Q173E	C12orf43_uc009zxa.1_Missense_Mutation_p.Q204E|C12orf43_uc010szo.1_Missense_Mutation_p.Q132E|C12orf43_uc010szp.1_Missense_Mutation_p.Q163E|C12orf43_uc001tzi.1_Missense_Mutation_p.Q174E	NM_022895	NP_075046	Q96C57	CL043_HUMAN	hypothetical protein LOC64897	173											0	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					GCTGACTCCTGTAGGATGTCG	0.587													41	119	---	---	---	---	PASS
IL31	386653	broad.mit.edu	37	12	122656992	122656992	+	Silent	SNP	T	C	C			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122656992T>C	uc001ubv.2	-	3	489	c.462A>G	c.(460-462)TCA>TCG	p.S154S	LRRC43_uc001ubw.3_Intron|LRRC43_uc009zxl.1_Intron	NM_001014336	NP_001014358	Q6EBC2	IL31_HUMAN	interleukin 31 precursor	154						extracellular space	cytokine activity			central_nervous_system(1)	1	all_neural(191;0.0837)|Medulloblastoma(191;0.163)	Lung NSC(355;6.93e-05)|Breast(359;0.0544)		OV - Ovarian serous cystadenocarcinoma(86;3.27e-29)|Epithelial(86;4.86e-27)|BRCA - Breast invasive adenocarcinoma(302;0.223)		CAGAGGTCAATGATTTTAGTG	0.453													19	86	---	---	---	---	PASS
EP400	57634	broad.mit.edu	37	12	132547138	132547138	+	Silent	SNP	A	G	G	rs111782215	byFrequency	TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:132547138A>G	uc001ujn.2	+	46	8261	c.8226A>G	c.(8224-8226)CAA>CAG	p.Q2742Q	EP400_uc001ujl.2_Silent_p.Q2741Q|EP400_uc001ujm.2_Silent_p.Q2661Q|EP400_uc001ujp.2_5'UTR	NM_015409	NP_056224	Q96L91	EP400_HUMAN	E1A binding protein p400	2778	Poly-Gln.|Interaction with ZNF42 (By similarity).				histone H2A acetylation|histone H4 acetylation|regulation of transcription, DNA-dependent	NuA4 histone acetyltransferase complex|nuclear speck	ATP binding|DNA binding|helicase activity			central_nervous_system(4)|ovary(3)|breast(3)|skin(2)	12	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		agcagcagcaacagcagcagc	0.328													8	37	---	---	---	---	PASS
KIAA1704	55425	broad.mit.edu	37	13	45589098	45589098	+	Missense_Mutation	SNP	C	A	A			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:45589098C>A	uc001uzq.2	+	5	523	c.420C>A	c.(418-420)AGC>AGA	p.S140R	KIAA1704_uc010tfo.1_RNA|KIAA1704_uc001uzr.1_Missense_Mutation_p.S140R|KIAA1704_uc001uzs.2_Missense_Mutation_p.S17R|KIAA1704_uc001uzt.2_5'UTR	NM_018559	NP_061029	Q8IXQ4	K1704_HUMAN	hypothetical protein LOC55425	140										pancreas(1)|skin(1)	2		Lung NSC(96;0.00143)|Prostate(109;0.0137)|Breast(139;0.0192)|Lung SC(185;0.0367)|Hepatocellular(98;0.133)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000313)|BRCA - Breast invasive adenocarcinoma(63;0.126)		AAACAGACAGCAGTGAAGATG	0.343													20	78	---	---	---	---	PASS
C14orf93	60686	broad.mit.edu	37	14	23458974	23458974	+	Missense_Mutation	SNP	T	A	A			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23458974T>A	uc001wib.1	-	5	1371	c.1061A>T	c.(1060-1062)AAT>ATT	p.N354I	C14orf93_uc001wic.1_Missense_Mutation_p.N174I|C14orf93_uc001wid.1_Missense_Mutation_p.N354I|C14orf93_uc001wig.2_Missense_Mutation_p.N354I|C14orf93_uc001wih.2_Missense_Mutation_p.N354I|C14orf93_uc001wie.2_Missense_Mutation_p.N354I|C14orf93_uc001wia.3_Missense_Mutation_p.N354I|C14orf93_uc001wif.2_Missense_Mutation_p.N174I	NM_021944	NP_068763	Q9H972	CN093_HUMAN	hypothetical protein LOC60686 precursor	354						extracellular region				ovary(1)	1	all_cancers(95;3.3e-05)			GBM - Glioblastoma multiforme(265;0.0127)		ATCAGTGTAATTGTGGGGACT	0.453													24	90	---	---	---	---	PASS
SLC7A8	23428	broad.mit.edu	37	14	23635656	23635656	+	Missense_Mutation	SNP	G	A	A			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23635656G>A	uc001wiz.2	-	2	971	c.245C>T	c.(244-246)ACG>ATG	p.T82M	SLC7A8_uc010akj.2_Missense_Mutation_p.T82M	NM_012244	NP_036376	Q9UHI5	LAT2_HUMAN	solute carrier family 7 (cationic amino acid	82	Helical; (Potential).				blood coagulation|cellular amino acid metabolic process|leukocyte migration|metal ion homeostasis|response to toxin	basolateral plasma membrane|cytoplasm|integral to plasma membrane	neutral amino acid transmembrane transporter activity|organic cation transmembrane transporter activity|peptide antigen binding|protein binding|toxin transporter activity			ovary(1)	1	all_cancers(95;4.6e-05)			GBM - Glioblastoma multiforme(265;0.00809)	L-Alanine(DB00160)|L-Glutamine(DB00130)|L-Phenylalanine(DB00120)	GATGAAGCCCGTCACAATCCA	0.537													6	316	---	---	---	---	PASS
ARHGAP5	394	broad.mit.edu	37	14	32619205	32619205	+	Silent	SNP	A	G	G			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:32619205A>G	uc001wrl.2	+	5	4280	c.4041A>G	c.(4039-4041)CCA>CCG	p.P1347P	ARHGAP5_uc001wrm.2_Silent_p.P1346P|ARHGAP5_uc001wrn.2_Silent_p.P1347P|ARHGAP5_uc001wro.2_Silent_p.P86P|ARHGAP5_uc001wrp.2_Silent_p.P82P	NM_001173	NP_001025226	Q13017	RHG05_HUMAN	Rho GTPase activating protein 5 isoform b	1347	Rho-GAP.				cell adhesion|Rho protein signal transduction	cytosol|membrane	GTP binding|GTPase activity|Rho GTPase activator activity|SH2 domain binding			ovary(4)|central_nervous_system(1)	5	Hepatocellular(127;0.0604)|Prostate(35;0.15)|Breast(36;0.186)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.00714)|BRCA - Breast invasive adenocarcinoma(188;0.0952)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00566)		CTTTAATTCCATATTCTCTTC	0.363													11	35	---	---	---	---	PASS
DLGAP5	9787	broad.mit.edu	37	14	55655785	55655785	+	Missense_Mutation	SNP	T	C	C			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:55655785T>C	uc001xbs.2	-	2	330	c.113A>G	c.(112-114)GAA>GGA	p.E38G	DLGAP5_uc001xbt.2_Missense_Mutation_p.E38G	NM_014750	NP_055565	Q15398	DLGP5_HUMAN	discs large homolog 7 isoform a	38					cell proliferation|cell-cell signaling|mitotic chromosome movement towards spindle pole|positive regulation of mitotic metaphase/anaphase transition	nucleus|spindle pole centrosome	phosphoprotein phosphatase activity|protein binding			ovary(1)|skin(1)	2						TCGTTCGTATTCCTTATGTCT	0.353													13	45	---	---	---	---	PASS
PSMA3	5684	broad.mit.edu	37	14	58714515	58714515	+	Silent	SNP	A	G	G			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:58714515A>G	uc001xdj.1	+	2	115	c.69A>G	c.(67-69)CAA>CAG	p.Q23Q	C14orf37_uc010tro.1_Intron|PSMA3_uc001xdk.1_Silent_p.Q23Q	NM_002788	NP_002779	P25788	PSA3_HUMAN	proteasome alpha 3 subunit isoform 1	23					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|interspecies interaction between organisms|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	cytoplasm|nucleus|proteasome core complex, alpha-subunit complex	protein binding|threonine-type endopeptidase activity				0						GAGTTTTTCAAGTTGAATATG	0.368													18	45	---	---	---	---	PASS
ZFYVE26	23503	broad.mit.edu	37	14	68242709	68242709	+	Missense_Mutation	SNP	C	A	A			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:68242709C>A	uc001xka.2	-	26	5228	c.5089G>T	c.(5089-5091)GCT>TCT	p.A1697S	ZFYVE26_uc010tsz.1_RNA|ZFYVE26_uc001xkc.3_Missense_Mutation_p.A1697S	NM_015346	NP_056161	Q68DK2	ZFY26_HUMAN	zinc finger, FYVE domain containing 26	1697					cell cycle|cell death|cytokinesis|double-strand break repair via homologous recombination	centrosome|midbody	metal ion binding|phosphatidylinositol-3-phosphate binding|protein binding			ovary(9)|breast(2)	11				all cancers(60;0.000763)|OV - Ovarian serous cystadenocarcinoma(108;0.0011)|BRCA - Breast invasive adenocarcinoma(234;0.0115)		GTCTGCACAGCCACAGTGGCC	0.562													4	107	---	---	---	---	PASS
DUOX2	50506	broad.mit.edu	37	15	45387657	45387657	+	Missense_Mutation	SNP	C	A	A			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:45387657C>A	uc010bea.2	-	31	4420	c.4217G>T	c.(4216-4218)GGC>GTC	p.G1406V	DUOX2_uc001zun.2_Missense_Mutation_p.G1406V	NM_014080	NP_054799	Q9NRD8	DUOX2_HUMAN	dual oxidase 2 precursor	1406	Cytoplasmic (Potential).				cuticle development|cytokine-mediated signaling pathway|hormone biosynthetic process|hydrogen peroxide catabolic process|response to cAMP|response to virus	apical plasma membrane|integral to membrane	calcium ion binding|electron carrier activity|flavin adenine dinucleotide binding|heme binding|NAD(P)H oxidase activity|peroxidase activity			ovary(2)|skin(2)|pancreas(1)	5		all_cancers(109;3.79e-11)|all_epithelial(112;2.92e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;1.05e-18)|GBM - Glioblastoma multiforme(94;4.23e-07)|COAD - Colon adenocarcinoma(120;0.0668)|Colorectal(133;0.068)		CATTTGGCTGCCCAAGGATGA	0.532													5	94	---	---	---	---	PASS
NEDD4	4734	broad.mit.edu	37	15	56208025	56208025	+	Silent	SNP	G	A	A			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:56208025G>A	uc002adj.2	-	1	1305	c.1005C>T	c.(1003-1005)CCC>CCT	p.P335P	NEDD4_uc002adl.2_Intron|NEDD4_uc002adi.2_Silent_p.P335P|NEDD4_uc010ugj.1_Silent_p.P335P|NEDD4_uc010bfm.2_Silent_p.P335P|NEDD4_uc002adk.2_RNA	NM_198400	NP_006145	P46934	NEDD4_HUMAN	neural precursor cell expressed, developmentally	335					development involved in symbiotic interaction|glucocorticoid receptor signaling pathway|negative regulation of sodium ion transport|negative regulation of transcription from RNA polymerase II promoter in response to UV-induced DNA damage|negative regulation of vascular endothelial growth factor receptor signaling pathway|neuron projection development|positive regulation of nucleocytoplasmic transport|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of protein catabolic process|progesterone receptor signaling pathway|protein K63-linked ubiquitination|protein targeting to lysosome|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|receptor catabolic process|receptor internalization|regulation of dendrite morphogenesis|response to calcium ion|transmission of virus	apicolateral plasma membrane|cell cortex|chromatin|cytosol|perinuclear region of cytoplasm|ubiquitin ligase complex	beta-2 adrenergic receptor binding|phosphoserine binding|phosphothreonine binding|proline-rich region binding|protein domain specific binding|RNA polymerase binding|sodium channel inhibitor activity|ubiquitin binding|ubiquitin-protein ligase activity			skin(2)|ovary(1)|breast(1)	4				all cancers(107;0.0299)|GBM - Glioblastoma multiforme(80;0.113)		TTACTTCTCCGGGGGTACAAA	0.423													35	116	---	---	---	---	PASS
ADAMTS7	11173	broad.mit.edu	37	15	79090324	79090324	+	Silent	SNP	A	C	C			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:79090324A>C	uc002bej.3	-	3	799	c.588T>G	c.(586-588)GGT>GGG	p.G196G	ADAMTS7_uc010und.1_Silent_p.G196G|ADAMTS7_uc002bek.1_Silent_p.G196G	NM_014272	NP_055087	Q9UKP4	ATS7_HUMAN	ADAM metallopeptidase with thrombospondin type 1	196					proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding				0						CACTGGAATCACCCCGCTGTG	0.647													8	62	---	---	---	---	PASS
AGBL1	123624	broad.mit.edu	37	15	87066159	87066159	+	Silent	SNP	C	A	A			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:87066159C>A	uc002blz.1	+	18	2616	c.2536C>A	c.(2536-2538)CGA>AGA	p.R846R		NM_152336	NP_689549	Q96MI9	CBPC4_HUMAN	ATP/GTP binding protein-like 1	846					C-terminal protein deglutamylation|protein side chain deglutamylation|proteolysis	cytosol	metallocarboxypeptidase activity|tubulin binding|zinc ion binding				0						CAGCATTGGCCGAAGTCCCGT	0.527													22	145	---	---	---	---	PASS
POLG	5428	broad.mit.edu	37	15	89869918	89869918	+	Missense_Mutation	SNP	C	T	T			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:89869918C>T	uc002bns.3	-	9	1919	c.1637G>A	c.(1636-1638)CGC>CAC	p.R546H	POLG_uc002bnr.3_Missense_Mutation_p.R546H	NM_002693	NP_002684	P54098	DPOG1_HUMAN	DNA-directed DNA polymerase gamma	546					base-excision repair, gap-filling|cell death|DNA-dependent DNA replication	mitochondrial nucleoid	DNA binding|DNA-directed DNA polymerase activity|protease binding			ovary(1)|lung(1)	2	Lung NSC(78;0.0472)|all_lung(78;0.089)		STAD - Stomach adenocarcinoma(125;0.165)			CAAGCAGGCGCGGGCCATGAC	0.622								DNA_polymerases_(catalytic_subunits)					19	39	---	---	---	---	PASS
ZNF710	374655	broad.mit.edu	37	15	90616318	90616318	+	Missense_Mutation	SNP	A	C	C			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90616318A>C	uc002bov.1	+	3	1597	c.1474A>C	c.(1474-1476)AAG>CAG	p.K492Q		NM_198526	NP_940928	Q8N1W2	ZN710_HUMAN	zinc finger protein 710	492	C2H2-type 8.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			central_nervous_system(1)	1	Melanoma(11;0.00551)|Lung NSC(78;0.0196)|all_lung(78;0.04)		BRCA - Breast invasive adenocarcinoma(143;0.00769)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.129)			GAAGGAGTTCAAGTGCGAGGT	0.632													13	39	---	---	---	---	PASS
EME2	197342	broad.mit.edu	37	16	1825568	1825568	+	Splice_Site	SNP	A	C	C			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1825568A>C	uc002cmq.1	+	6	817	c.817_splice	c.e6-2	p.A273_splice	MRPS34_uc002cmn.2_5'Flank|MRPS34_uc002cmo.2_5'Flank|MRPS34_uc002cmp.1_5'Flank|EME2_uc010brw.1_Splice_Site_p.A222_splice	NM_001010865	NP_001010865	A4GXA9	EME2_HUMAN	essential meiotic endonuclease 1 homolog 2						DNA recombination|DNA repair	nucleus	DNA binding|endonuclease activity			lung(1)|central_nervous_system(1)|pancreas(1)	3						CCTCCTCCCCAGGCCCTGGTA	0.632								Direct_reversal_of_damage|Homologous_recombination					3	32	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	16	16465472	16465472	+	Silent	SNP	T	C	C			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:16465472T>C	uc002dey.2	+	1	476	c.189T>C	c.(187-189)CCT>CCC	p.P63P						SubName: Full=cDNA FLJ42525 fis, clone BRACE3001391, highly similar to Polycystin;																		GCAGCAACCCTGTGGCCGTGC	0.687													7	19	---	---	---	---	PASS
APOB48R	55911	broad.mit.edu	37	16	28508786	28508786	+	Silent	SNP	A	G	G			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28508786A>G	uc002dqb.1	+	3	2407	c.2397A>G	c.(2395-2397)GAA>GAG	p.E799E	uc010vct.1_Intron|APOB48R_uc010byg.1_Silent_p.E337E	NM_018690	NP_061160	Q0VD83	APOBR_HUMAN	apolipoprotein B48 receptor	799	Glu-rich.				cholesterol metabolic process|lipid transport	chylomicron|low-density lipoprotein particle|plasma membrane|very-low-density lipoprotein particle					0						GTGGGCAAGAATTTGGTCTGG	0.597													13	31	---	---	---	---	PASS
BBS2	583	broad.mit.edu	37	16	56536004	56536004	+	Intron	SNP	A	T	T			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:56536004A>T	uc002ejd.2	-						BBS2_uc010ccg.2_3'UTR	NM_031885	NP_114091	Q9BXC9	BBS2_HUMAN	Bardet-Biedl syndrome 2 protein						adult behavior|brain morphogenesis|cerebral cortex development|cilium morphogenesis|fat cell differentiation|hippocampus development|melanosome transport|negative regulation of multicellular organism growth|photoreceptor cell maintenance|protein localization to organelle|regulation of cilium beat frequency involved in ciliary motility|sperm axoneme assembly|striatum development	BBSome|cilium membrane|microtubule basal body|motile cilium	protein binding			ovary(1)	1						ataaataaatagtgctgcagg	0.129									Bardet-Biedl_syndrome				5	11	---	---	---	---	PASS
C16orf70	80262	broad.mit.edu	37	16	67166430	67166430	+	Splice_Site	SNP	T	G	G			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67166430T>G	uc002erc.2	+	6	439	c.355_splice	c.e6+2	p.V119_splice	C16orf70_uc002erd.2_Splice_Site_p.V119_splice|C16orf70_uc002ere.1_Silent_p.G97G	NM_025187	NP_079463	Q9BSU1	CP070_HUMAN	lin-10											ovary(2)	2		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0017)|Epithelial(162;0.00655)|all cancers(182;0.0579)		ATCCTGGAGGTAAGCCAAGTC	0.488													40	106	---	---	---	---	PASS
NFAT5	10725	broad.mit.edu	37	16	69681465	69681465	+	Missense_Mutation	SNP	A	T	T			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:69681465A>T	uc002exm.1	+	3	1942	c.734A>T	c.(733-735)AAA>ATA	p.K245I	NFAT5_uc002exh.1_Intron|NFAT5_uc002exi.2_Missense_Mutation_p.K169I|NFAT5_uc002exj.1_Missense_Mutation_p.K169I|NFAT5_uc002exk.1_Missense_Mutation_p.K169I|NFAT5_uc002exl.1_Missense_Mutation_p.K263I|NFAT5_uc002exn.1_Missense_Mutation_p.K263I	NM_006599	NP_006590	O94916	NFAT5_HUMAN	nuclear factor of activated T-cells 5 isoform c	245					excretion|signal transduction|transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity				0						ACGGACAACAAAGGCAACTCA	0.363													19	89	---	---	---	---	PASS
ZFHX3	463	broad.mit.edu	37	16	72991477	72991477	+	Silent	SNP	G	A	A			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:72991477G>A	uc002fck.2	-	2	3241	c.2568C>T	c.(2566-2568)CCC>CCT	p.P856P	ZFHX3_uc002fcl.2_Intron	NM_006885	NP_008816	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3 isoform A	856					muscle organ development|negative regulation of myoblast differentiation|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|positive regulation of myoblast differentiation	transcription factor complex	enzyme binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|transcription regulatory region DNA binding|zinc ion binding			ovary(2)|skin(2)	4		Ovarian(137;0.13)				CGGCCTCGGCGGGTGAGGGCA	0.572													19	48	---	---	---	---	PASS
ANKRD11	29123	broad.mit.edu	37	16	89345631	89345631	+	Missense_Mutation	SNP	T	G	G			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89345631T>G	uc002fmx.1	-	9	7780	c.7319A>C	c.(7318-7320)GAA>GCA	p.E2440A	ANKRD11_uc002fmy.1_Missense_Mutation_p.E2440A|ANKRD11_uc002fnc.1_Missense_Mutation_p.E2440A|ANKRD11_uc002fna.1_Missense_Mutation_p.E105A|ANKRD11_uc002fnb.1_Missense_Mutation_p.E2397A	NM_013275	NP_037407	Q6UB99	ANR11_HUMAN	ankyrin repeat domain 11	2440						nucleus				ovary(4)|large_intestine(1)|central_nervous_system(1)	6		all_hematologic(23;0.00824)|Colorectal(91;0.0475)		Epithelial(1;5.33e-11)|all cancers(4;2.6e-09)|OV - Ovarian serous cystadenocarcinoma(4;2.29e-07)|BRCA - Breast invasive adenocarcinoma(80;0.0142)		CTGCAGGTATTCGAAGTAGGG	0.612													8	23	---	---	---	---	PASS
NEURL4	84461	broad.mit.edu	37	17	7224466	7224466	+	Missense_Mutation	SNP	C	G	G			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7224466C>G	uc002gga.1	-	20	3332	c.3325G>C	c.(3325-3327)GAG>CAG	p.E1109Q	NEURL4_uc002gfy.1_5'Flank|GPS2_uc002gfz.1_5'Flank|NEURL4_uc002ggb.1_Missense_Mutation_p.E1107Q	NM_032442	NP_115818	Q96JN8	NEUL4_HUMAN	neuralized homolog 4 isoform 1	1109							protein binding			upper_aerodigestive_tract(1)|ovary(1)	2						TCATCCTCCTCGCCCTCACTG	0.627													7	28	---	---	---	---	PASS
C17orf68	80169	broad.mit.edu	37	17	8139169	8139169	+	Silent	SNP	G	T	T			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8139169G>T	uc002gkq.3	-	7	1245	c.1186C>A	c.(1186-1188)CGA>AGA	p.R396R	C17orf68_uc010cnv.2_RNA	NM_025099	NP_079375	Q2NKJ3	CTC1_HUMAN	alpha accessory factor 132	396					positive regulation of DNA replication|telomere maintenance	Stn1-Ten1 complex	protein binding|single-stranded DNA binding				0						ACTCCAGGTCGCATCACCCGC	0.567													3	44	---	---	---	---	PASS
TMEM98	26022	broad.mit.edu	37	17	31266546	31266546	+	Silent	SNP	G	A	A			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:31266546G>A	uc002hhq.2	+	7	923	c.465G>A	c.(463-465)CTG>CTA	p.L155L	TMEM98_uc002hhr.2_Silent_p.L155L	NM_015544	NP_056359	Q9Y2Y6	TMM98_HUMAN	transmembrane protein 98	155						endoplasmic reticulum|integral to membrane					0		Ovarian(249;0.182)|Breast(31;0.244)	BRCA - Breast invasive adenocarcinoma(9;0.0769)			CCAAACTCCTGGACGCACGGT	0.522													3	54	---	---	---	---	PASS
PPM1E	22843	broad.mit.edu	37	17	57057344	57057344	+	Missense_Mutation	SNP	A	C	C			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:57057344A>C	uc002iwx.2	+	7	1347	c.1220A>C	c.(1219-1221)GAA>GCA	p.E407A	PPM1E_uc010ddd.2_Missense_Mutation_p.E170A	NM_014906	NP_055721	Q8WY54	PPM1E_HUMAN	protein phosphatase 1E	416	PP2C-like.				protein dephosphorylation	cytoplasm|nucleolus|protein serine/threonine phosphatase complex	metal ion binding|protein serine/threonine phosphatase activity			breast(3)|lung(1)|skin(1)	5	Medulloblastoma(34;0.127)|all_neural(34;0.237)		BRCA - Breast invasive adenocarcinoma(1;5.76e-11)			GGAGATGCTGAACATAAGCCA	0.478													11	28	---	---	---	---	PASS
APOH	350	broad.mit.edu	37	17	64222147	64222147	+	Missense_Mutation	SNP	C	T	T			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:64222147C>T	uc002jfn.3	-	3	396	c.337G>A	c.(337-339)GGG>AGG	p.G113R		NM_000042	NP_000033	P02749	APOH_HUMAN	apolipoprotein H precursor	113	Sushi 2.				blood coagulation, intrinsic pathway|negative regulation of angiogenesis|negative regulation of blood coagulation|negative regulation of endothelial cell migration|negative regulation of endothelial cell proliferation|negative regulation of fibrinolysis|negative regulation of myeloid cell apoptosis|negative regulation of smooth muscle cell apoptosis|plasminogen activation|positive regulation of lipoprotein lipase activity|triglyceride metabolic process|triglyceride transport	cell surface|chylomicron|high-density lipoprotein particle|very-low-density lipoprotein particle	eukaryotic cell surface binding|glycoprotein binding|heparin binding|lipoprotein lipase activator activity|phospholipid binding				0			BRCA - Breast invasive adenocarcinoma(6;9.74e-08)			AGTTCTTACCCAGTGTTACAA	0.383													18	45	---	---	---	---	PASS
LAMA1	284217	broad.mit.edu	37	18	7036007	7036007	+	Silent	SNP	C	T	T			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:7036007C>T	uc002knm.2	-	13	1912	c.1818G>A	c.(1816-1818)TCG>TCA	p.S606S	LAMA1_uc010wzj.1_Silent_p.S82S	NM_005559	NP_005550	P25391	LAMA1_HUMAN	laminin, alpha 1 precursor	606	Laminin IV type A 1.				axon guidance|cell adhesion|cell surface receptor linked signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	extracellular space|laminin-1 complex|laminin-3 complex	extracellular matrix structural constituent|receptor binding			ovary(8)|large_intestine(4)|upper_aerodigestive_tract(2)|breast(2)|skin(2)|pancreas(2)|central_nervous_system(1)	21		Colorectal(10;0.172)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	CGTCAGCATGCGACATGAGGT	0.438													10	37	---	---	---	---	PASS
FAM38B	63895	broad.mit.edu	37	18	10697808	10697808	+	Silent	SNP	C	T	T			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:10697808C>T	uc002kor.3	-	3	437	c.297G>A	c.(295-297)AGG>AGA	p.R99R	FAM38B_uc002koq.2_5'UTR	NM_022068	NP_071351	Q9H5I5	PIEZ2_HUMAN	family with sequence similarity 38, member B	2142						integral to membrane	ion channel activity			ovary(1)	1						TATAAAGTTCCCTTTTGCCTT	0.368													16	53	---	---	---	---	PASS
THEG	51298	broad.mit.edu	37	19	375847	375847	+	Missense_Mutation	SNP	C	T	T			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:375847C>T	uc002lol.2	-	1	163	c.124G>A	c.(124-126)GTC>ATC	p.V42I	THEG_uc002lom.2_Missense_Mutation_p.V42I	NM_016585	NP_057669	Q9P2T0	THEG_HUMAN	Theg homolog isoform 1	42					cell differentiation|chaperone-mediated protein complex assembly|multicellular organismal development|spermatogenesis	nucleus	protein binding			ovary(1)	1		all_cancers(10;1.13e-36)|all_epithelial(18;1.46e-23)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.1e-06)|all_lung(49;1.55e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGGTCTGTGACCCGCCGGCTC	0.677													25	51	---	---	---	---	PASS
NFIC	4782	broad.mit.edu	37	19	3382025	3382025	+	Missense_Mutation	SNP	C	T	T			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3382025C>T	uc010xhi.1	+	2	408	c.346C>T	c.(346-348)CGG>TGG	p.R116W	NFIC_uc002lxo.2_Missense_Mutation_p.R107W|NFIC_uc010xhh.1_Missense_Mutation_p.R107W|NFIC_uc002lxp.2_Missense_Mutation_p.R116W|NFIC_uc010xhj.1_Missense_Mutation_p.R116W|NFIC_uc002lxq.1_Missense_Mutation_p.R68W	NM_205843	NP_995315	P08651	NFIC_HUMAN	nuclear factor I/C isoform 2	116	CTF/NF-I.				DNA replication|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;7.8e-05)|Epithelial(107;2.94e-108)|BRCA - Breast invasive adenocarcinoma(158;0.00154)|STAD - Stomach adenocarcinoma(1328;0.191)		GGGCAAGATGCGGCGCATCGA	0.667													4	130	---	---	---	---	PASS
FZR1	51343	broad.mit.edu	37	19	3523035	3523035	+	Missense_Mutation	SNP	G	C	C			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3523035G>C	uc010dtk.2	+	1	82	c.48G>C	c.(46-48)CAG>CAC	p.Q16H	FZR1_uc002lxt.2_Missense_Mutation_p.Q16H|FZR1_uc002lxv.2_Missense_Mutation_p.Q16H	NM_001136198	NP_001129670	Q9UM11	FZR_HUMAN	Fzr1 protein isoform 1	16					activation of anaphase-promoting complex activity|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|DNA repair|G2/M transition DNA damage checkpoint|mitosis|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of protein catabolic process|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|S phase of mitotic cell cycle	cytosol|nucleoplasm	protein binding			lung(1)|kidney(1)	2				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00253)|STAD - Stomach adenocarcinoma(1328;0.18)		TCGTCATCCAGAATGAGAACA	0.687													31	87	---	---	---	---	PASS
ACTL9	284382	broad.mit.edu	37	19	8807902	8807902	+	Missense_Mutation	SNP	C	T	T			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8807902C>T	uc002mkl.2	-	1	1271	c.1150G>A	c.(1150-1152)GGC>AGC	p.G384S		NM_178525	NP_848620	Q8TC94	ACTL9_HUMAN	actin-like 9	384						cytoplasm|cytoskeleton				large_intestine(2)|pancreas(1)	3						AGGATGGAGCCCCCGATCCAT	0.652													11	30	---	---	---	---	PASS
MAST3	23031	broad.mit.edu	37	19	18255405	18255405	+	Missense_Mutation	SNP	A	G	G			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18255405A>G	uc002nhz.3	+	22	2627	c.2627A>G	c.(2626-2628)AAG>AGG	p.K876R		NM_015016	NP_055831	O60307	MAST3_HUMAN	microtubule associated serine/threonine kinase	876							ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity			large_intestine(2)|ovary(2)|stomach(1)	5						GCCCCTGAGAAGTCCAGAGCC	0.687													6	37	---	---	---	---	PASS
ZFP14	57677	broad.mit.edu	37	19	36831956	36831956	+	Missense_Mutation	SNP	A	G	G			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36831956A>G	uc002odx.1	-	4	865	c.772T>C	c.(772-774)TGT>CGT	p.C258R	ZFP14_uc010xtd.1_Missense_Mutation_p.C259R|ZFP14_uc010eex.1_Missense_Mutation_p.C258R	NM_020917	NP_065968	Q9HCL3	ZFP14_HUMAN	zinc finger protein 14-like	258	C2H2-type 4.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1	Esophageal squamous(110;0.162)					CATTCCTTACATTCATAGGGT	0.433													22	71	---	---	---	---	PASS
SLC17A7	57030	broad.mit.edu	37	19	49934326	49934326	+	Silent	SNP	G	A	A			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49934326G>A	uc002pnp.2	-	11	1507	c.1335C>T	c.(1333-1335)GGC>GGT	p.G445G	SLC17A7_uc002pno.2_Silent_p.G107G	NM_020309	NP_064705	Q9P2U7	VGLU1_HUMAN	solute carrier family 17, member 7	445	Helical; (Potential).				glutamate secretion|neurotransmitter secretion	cell junction|clathrin sculpted glutamate transport vesicle membrane|integral to membrane|synaptic vesicle membrane|synaptosome	L-glutamate transmembrane transporter activity|sodium-dependent phosphate transmembrane transporter activity|sodium:inorganic phosphate symporter activity			ovary(1)|pancreas(1)|skin(1)	3		all_lung(116;1.62e-07)|Lung NSC(112;8.47e-07)|all_neural(266;0.0381)|Ovarian(192;0.0392)		OV - Ovarian serous cystadenocarcinoma(262;0.00153)|GBM - Glioblastoma multiforme(486;0.0245)		CCGACAGTGTGCCCACGCCGT	0.617													11	33	---	---	---	---	PASS
PLCG1	5335	broad.mit.edu	37	20	39796506	39796506	+	Silent	SNP	G	T	T			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:39796506G>T	uc002xjp.1	+	20	2437	c.2316G>T	c.(2314-2316)GGG>GGT	p.G772G	PLCG1_uc002xjo.1_Silent_p.G772G|PLCG1_uc010zwe.1_Silent_p.G398G|PLCG1_uc010ggf.2_Intron	NM_182811	NP_877963	P19174	PLCG1_HUMAN	phospholipase C, gamma 1 isoform b	772					activation of phospholipase C activity|axon guidance|blood coagulation|cellular response to epidermal growth factor stimulus|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|interspecies interaction between organisms|intracellular signal transduction|leukocyte migration|nerve growth factor receptor signaling pathway|phospholipid catabolic process|positive regulation of angiogenesis|positive regulation of blood vessel endothelial cell migration|positive regulation of epithelial cell migration|T cell receptor signaling pathway	cytosol|lamellipodium|plasma membrane|ruffle	calcium ion binding|phosphatidylinositol phospholipase C activity|protein binding|receptor signaling protein activity			lung(3)|breast(3)|skin(2)	8		Myeloproliferative disorder(115;0.00878)				CTGACTACGGGGCCCTGTATG	0.542													14	43	---	---	---	---	PASS
SULF2	55959	broad.mit.edu	37	20	46365503	46365503	+	Missense_Mutation	SNP	G	T	T			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:46365503G>T	uc002xto.2	-	3	689	c.359C>A	c.(358-360)GCA>GAA	p.A120E	SULF2_uc002xtr.2_Missense_Mutation_p.A120E|SULF2_uc002xtq.2_Missense_Mutation_p.A120E|SULF2_uc010ghv.1_Missense_Mutation_p.A120E	NM_018837	NP_061325	Q8IWU5	SULF2_HUMAN	sulfatase 2 isoform a precursor	120					bone development|heparan sulfate proteoglycan metabolic process|kidney development|negative regulation of fibroblast growth factor receptor signaling pathway	cell surface|endoplasmic reticulum|extracellular space|Golgi stack	arylsulfatase activity|calcium ion binding			ovary(2)|breast(2)|pancreas(1)|skin(1)	6						CTCGTGCTGTGCCTGCCAGGA	0.607													9	34	---	---	---	---	PASS
TTC3	7267	broad.mit.edu	37	21	38512927	38512927	+	Missense_Mutation	SNP	T	C	C	rs142142246		TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:38512927T>C	uc002yvz.2	+	20	1831	c.1726T>C	c.(1726-1728)TGC>CGC	p.C576R	TTC3_uc011aee.1_Missense_Mutation_p.C266R|TTC3_uc002ywa.2_Missense_Mutation_p.C576R|TTC3_uc002ywb.2_Missense_Mutation_p.C576R|TTC3_uc010gnf.2_Missense_Mutation_p.C341R|TTC3_uc002ywc.2_Missense_Mutation_p.C266R|TTC3_uc011aed.1_Missense_Mutation_p.C266R|TTC3_uc010gne.1_Missense_Mutation_p.C576R	NM_001001894	NP_001001894	P53804	TTC3_HUMAN	tetratricopeptide repeat domain 3	576	TPR 4.				protein K48-linked ubiquitination|ubiquitin-dependent protein catabolic process	nucleus	protein binding|ubiquitin-protein ligase activity|zinc ion binding			skin(3)|ovary(2)|lung(2)|breast(2)	9		Myeloproliferative disorder(46;0.0412)				GGGCCTTGATTGCTTGGCCTA	0.368													4	220	---	---	---	---	PASS
POTEH	23784	broad.mit.edu	37	22	16287491	16287491	+	Missense_Mutation	SNP	C	T	T			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:16287491C>T	uc010gqp.2	-	1	447	c.395G>A	c.(394-396)AGG>AAG	p.R132K	POTEH_uc002zlg.1_5'Flank|POTEH_uc002zlh.1_5'Flank|POTEH_uc002zlj.1_Intron	NM_001136213	NP_001129685	Q6S545	POTEH_HUMAN	ANKRD26-like family C, member 3	132										skin(1)	1						CATCTTGCTCCTGAGTGTCTT	0.617													5	205	---	---	---	---	PASS
MYO18B	84700	broad.mit.edu	37	22	26164741	26164741	+	Silent	SNP	A	T	T			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26164741A>T	uc003abz.1	+	4	1108	c.858A>T	c.(856-858)GGA>GGT	p.G286G	MYO18B_uc003aca.1_Silent_p.G167G|MYO18B_uc010guy.1_Silent_p.G167G|MYO18B_uc010guz.1_Silent_p.G167G|MYO18B_uc011aka.1_5'UTR|MYO18B_uc011akb.1_5'Flank	NM_032608	NP_115997	Q8IUG5	MY18B_HUMAN	myosin XVIIIB	286						nucleus|sarcomere|unconventional myosin complex	actin binding|ATP binding|motor activity			ovary(5)|central_nervous_system(3)|large_intestine(2)|breast(2)	12						AGAAGGAGGGAGCAGAGCCCA	0.617													7	9	---	---	---	---	PASS
SUN2	25777	broad.mit.edu	37	22	39132222	39132222	+	3'UTR	SNP	T	G	G			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:39132222T>G	uc003awh.1	-	19					SUN2_uc011anz.1_3'UTR|SUN2_uc011aoa.1_3'UTR|SUN2_uc003awi.1_3'UTR|SUN2_uc010gxq.1_3'UTR|SUN2_uc010gxr.1_3'UTR|SUN2_uc010gxs.1_Intron	NM_015374	NP_056189	Q9UH99	SUN2_HUMAN	unc-84 homolog B						centrosome localization|cytoskeletal anchoring at nuclear membrane|mitotic spindle organization|nuclear envelope organization|nuclear matrix anchoring at nuclear membrane|nuclear migration along microfilament|positive regulation of cell migration	endosome membrane|integral to membrane|nuclear inner membrane|SUN-KASH complex	lamin binding|microtubule binding			large_intestine(1)|skin(1)	2						AGCGGCGGGGTGCTGTTCACC	0.627													8	27	---	---	---	---	PASS
CXorf22	170063	broad.mit.edu	37	X	35974189	35974189	+	Missense_Mutation	SNP	G	A	A			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:35974189G>A	uc004ddj.2	+	8	1345	c.1286G>A	c.(1285-1287)CGT>CAT	p.R429H	CXorf22_uc010ngv.2_RNA	NM_152632	NP_689845	Q6ZTR5	CX022_HUMAN	hypothetical protein LOC170063	429										large_intestine(1)|lung(1)|ovary(1)	3						ATGGGTGAACGTTCAGAAATT	0.373													30	32	---	---	---	---	PASS
CLCN5	1184	broad.mit.edu	37	X	49851500	49851500	+	Silent	SNP	C	T	T			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:49851500C>T	uc004dos.1	+	8	1568	c.1320C>T	c.(1318-1320)GTC>GTT	p.V440V	CLCN5_uc004dor.1_Silent_p.V510V|CLCN5_uc004doq.1_Silent_p.V510V|CLCN5_uc004dot.1_Silent_p.V440V	NM_000084	NP_000075	P51795	CLCN5_HUMAN	chloride channel 5 isoform b	440	Helical; (By similarity).				excretion	apical part of cell|endosome membrane|Golgi membrane|integral to plasma membrane	antiporter activity|ATP binding			ovary(2)|lung(1)|central_nervous_system(1)	4	Ovarian(276;0.236)					TGAAAATTGTCATTACTATAT	0.498													14	12	---	---	---	---	PASS
NUDT10	170685	broad.mit.edu	37	X	51075924	51075924	+	Missense_Mutation	SNP	T	C	C			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:51075924T>C	uc004dph.2	+	2	327	c.107T>C	c.(106-108)GTG>GCG	p.V36A	NUDT10_uc004dpi.3_Missense_Mutation_p.V36A	NM_153183	NP_694853	Q8NFP7	NUD10_HUMAN	nudix-type motif 10	36	Nudix hydrolase.					cytoplasm	diphosphoinositol-polyphosphate diphosphatase activity|metal ion binding				0	Ovarian(276;0.236)					GTCCTGTTAGTGAGTAGCAGC	0.687													7	9	---	---	---	---	PASS
NAP1L2	4674	broad.mit.edu	37	X	72433770	72433770	+	Missense_Mutation	SNP	C	T	T			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:72433770C>T	uc004ebi.2	-	1	915	c.559G>A	c.(559-561)GGT>AGT	p.G187S	NAP1L2_uc011mqj.1_Missense_Mutation_p.G45S	NM_021963	NP_068798	Q9ULW6	NP1L2_HUMAN	nucleosome assembly protein 1-like 2	187	Glu-rich (acidic).				nucleosome assembly	chromatin assembly complex				lung(1)	1	Renal(35;0.156)					TCCTCATTACCATACATCTCT	0.333													3	71	---	---	---	---	PASS
MAGEC1	9947	broad.mit.edu	37	X	140994794	140994794	+	Missense_Mutation	SNP	G	C	C			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:140994794G>C	uc004fbt.2	+	4	1890	c.1604G>C	c.(1603-1605)AGT>ACT	p.S535T	MAGEC1_uc010nsl.1_Intron	NM_005462	NP_005453	O60732	MAGC1_HUMAN	melanoma antigen family C, 1	535							protein binding			ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4	Acute lymphoblastic leukemia(192;6.56e-05)					ATTGTTCCAAGTCTTCCTGAG	0.527										HNSCC(15;0.026)			97	87	---	---	---	---	PASS
MAGEA1	4100	broad.mit.edu	37	X	152482622	152482622	+	Missense_Mutation	SNP	T	C	C			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:152482622T>C	uc004fhf.2	-	3	609	c.389A>G	c.(388-390)GAG>GGG	p.E130G		NM_004988	NP_004979	P43355	MAGA1_HUMAN	melanoma antigen family A, 1	130	MAGE.					cytoplasm|plasma membrane				central_nervous_system(7)|ovary(1)|lung(1)|breast(1)	10	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					GATGACACTCTCCAGCATTTC	0.473													3	103	---	---	---	---	PASS
IDH3G	3421	broad.mit.edu	37	X	153051518	153051518	+	Intron	SNP	G	A	A			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153051518G>A	uc004fip.2	-						IDH3G_uc004fio.2_Intron|IDH3G_uc004fiq.2_3'UTR|IDH3G_uc010num.2_Intron|IDH3G_uc004fir.2_Intron|IDH3G_uc004fit.1_3'UTR|IDH3G_uc004fis.2_3'UTR|IDH3G_uc004fiu.2_Intron	NM_004135	NP_004126	P51553	IDH3G_HUMAN	isocitrate dehydrogenase 3 (NAD+) gamma isoform						carbohydrate metabolic process|isocitrate metabolic process|tricarboxylic acid cycle	mitochondrial matrix|nucleolus	ATP binding|isocitrate dehydrogenase (NAD+) activity|magnesium ion binding|NAD binding				0	all_hematologic(71;4.25e-06)|all_lung(58;3.83e-05)|Lung NSC(58;5.54e-05)|Acute lymphoblastic leukemia(192;6.56e-05)				NADH(DB00157)	GCCACAGGAGGGAAGTGGCAC	0.642													10	8	---	---	---	---	PASS
CCDC17	149483	broad.mit.edu	37	1	46087629	46087629	+	Frame_Shift_Del	DEL	G	-	-			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:46087629delG	uc010olt.1	-	8	1154	c.1006delC	c.(1006-1008)CAAfs	p.Q336fs	CCDC17_uc009vxy.2_Frame_Shift_Del_p.Q304fs|CCDC17_uc010ols.1_Frame_Shift_Del_p.Q327fs|CCDC17_uc001com.3_Frame_Shift_Del_p.Q157fs|CCDC17_uc001con.3_RNA|CCDC17_uc009vxz.2_Intron	NM_001114938	NP_001108410	Q96LX7	CCD17_HUMAN	coiled-coil domain containing 17	336										ovary(1)	1	Acute lymphoblastic leukemia(166;0.155)					CCCTTCGGTTGTAGGCTGGCA	0.612													16	9	---	---	---	---	
NRD1	4898	broad.mit.edu	37	1	52287168	52287169	+	Splice_Site	INS	-	C	C			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:52287168_52287169insC	uc001ctc.3	-	10	1743	c.1421_splice	c.e10+1	p.N474_splice	NRD1_uc009vzb.2_Splice_Site_p.N169_splice|NRD1_uc001ctd.3_Splice_Site_p.N406_splice|NRD1_uc001cte.2_Splice_Site_p.N342_splice|NRD1_uc001ctf.2_Splice_Site_p.N406_splice|NRD1_uc010ong.1_Splice_Site|NRD1_uc009vzc.1_Splice_Site_p.N274_splice	NM_002525	NP_002516	O43847	NRDC_HUMAN	nardilysin isoform a						cell migration|cell proliferation|neuromuscular junction development|positive regulation of membrane protein ectodomain proteolysis|proteolysis|regulation of endopeptidase activity	cell surface|cytosol	epidermal growth factor binding|metalloendopeptidase activity|zinc ion binding				0						TAAATATCTTACTTGTTTGGTA	0.228													40	23	---	---	---	---	
CC2D1B	200014	broad.mit.edu	37	1	52823616	52823617	+	Intron	INS	-	T	T			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:52823616_52823617insT	uc001ctq.1	-						CC2D1B_uc001ctr.2_Intron|CC2D1B_uc001cts.2_Intron	NM_032449	NP_115825	Q5T0F9	C2D1B_HUMAN	coiled-coil and C2 domain containing 1B											ovary(2)	2						GTTCCCTAGCATAGTCATGGCG	0.391													42	20	---	---	---	---	
THADA	63892	broad.mit.edu	37	2	43793964	43793964	+	Intron	DEL	A	-	-			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:43793964delA	uc002rsw.3	-						THADA_uc010far.2_Intron|THADA_uc002rsx.3_Intron|THADA_uc002rsy.3_Intron|THADA_uc010fas.1_Intron|THADA_uc002rsz.2_Intron|THADA_uc010fat.1_Intron|THADA_uc002rta.2_Intron|THADA_uc002rtb.1_Intron|THADA_uc002rtc.3_Intron|THADA_uc002rtd.2_Intron	NM_001083953	NP_001077422	Q6YHU6	THADA_HUMAN	thyroid adenoma associated								binding			ovary(2)|skin(1)	3		Acute lymphoblastic leukemia(82;0.00361)|all_hematologic(82;0.00837)				TGAAATTCttaaaaaaaaaaa	0.289													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	139045439	139045439	+	3'UTR	DEL	T	-	-			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:139045439delT	uc010zbk.1	-	1										SubName: Full=cDNA, FLJ79100, highly similar to 14-3-3 protein epsilon (14-3-3E);																		TTGAAAACTGtttttttaaaa	0.368													0	6	---	---	---	---	
SATB2	23314	broad.mit.edu	37	2	200173298	200173299	+	Intron	DEL	CA	-	-			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:200173298_200173299delCA	uc002uuy.1	-						SATB2_uc010fsq.1_Intron|SATB2_uc002uuz.1_Intron|SATB2_uc002uva.1_Intron	NM_015265	NP_056080	Q9UPW6	SATB2_HUMAN	SATB homeobox 2							cytoplasm|nuclear matrix	sequence-specific DNA binding transcription factor activity			ovary(1)	1						cacgcacatgcacacacacaca	0.342													4	2	---	---	---	---	
NBEAL1	65065	broad.mit.edu	37	2	204030767	204030768	+	Intron	INS	-	A	A			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:204030767_204030768insA	uc002uzt.3	+						NBEAL1_uc002uzs.3_Intron	NM_001114132	NP_001107604	Q6ZS30	NBEL1_HUMAN	neurobeachin-like 1 isoform 3								binding			ovary(1)|skin(1)	2						gaccttgtctcaaaaaaaagaa	0.094													4	2	---	---	---	---	
VHL	7428	broad.mit.edu	37	3	10188224	10188224	+	Frame_Shift_Del	DEL	G	-	-			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10188224delG	uc003bvc.2	+	2	580	c.367delG	c.(367-369)GGGfs	p.G123fs	VHL_uc003bvd.2_Intron	NM_000551	NP_000542	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor isoform 1	123	Involved in binding to CCT complex.				anti-apoptosis|cell morphogenesis|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of cell differentiation|positive regulation of transcription, DNA-dependent|protein stabilization|protein ubiquitination|proteolysis	cytosol|endoplasmic reticulum|membrane|mitochondrion|nucleus	protein binding|transcription factor binding	p.A122fs*7(1)|p.R120fs*34(1)|p.?(1)|p.G123fs*8(1)		kidney(1273)|soft_tissue(24)|adrenal_gland(15)|large_intestine(13)|pancreas(5)|endometrium(4)|thyroid(3)|upper_aerodigestive_tract(3)|central_nervous_system(2)|lung(2)|pleura(1)|paratesticular_tissues(1)	1346				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		CAGAGATGCAGGGACACACGA	0.393		1	D|Mis|N|F|S		renal|hemangioma|pheochromocytoma	renal|hemangioma|pheochromocytoma			von_Hippel-Lindau_disease|Chuvash_Polycythemia_|Pheochromocytoma_(Adrenal)_Familial				127	56	---	---	---	---	
RBM5	10181	broad.mit.edu	37	3	50142740	50142740	+	Intron	DEL	A	-	-	rs77676195		TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:50142740delA	uc003cyg.2	+						RBM5_uc011bdj.1_Intron|RBM5_uc011bdk.1_Intron	NM_005778	NP_005769	P52756	RBM5_HUMAN	RNA binding motif protein 5						apoptosis|negative regulation of cell proliferation|positive regulation of apoptosis|regulation of alternative nuclear mRNA splicing, via spliceosome|spliceosome assembly	nucleoplasm|spliceosomal complex	DNA binding|mRNA binding|nucleotide binding|protein binding|zinc ion binding			lung(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.000121)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		actcCGTCTCAAAAAAAAAAA	0.209													5	3	---	---	---	---	
IQCF1	132141	broad.mit.edu	37	3	51930712	51930713	+	Intron	DEL	CA	-	-	rs113385405	by1000genomes	TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:51930712_51930713delCA	uc003dbv.2	-						IQCF1_uc003dbq.3_Intron	NM_152397	NP_689610	Q8N6M8	IQCF1_HUMAN	IQ motif containing F1											ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000541)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		aacacgcgcgcacacacacaca	0.257													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	70803309	70803309	+	IGR	DEL	T	-	-			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:70803309delT								MITF (785823 upstream) : FOXP1 (201428 downstream)																							TCCTTTGGCCTTTTTCTCCTT	0.393													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	75264906	75264908	+	IGR	DEL	CCC	-	-	rs74266981	by1000genomes	TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:75264906_75264908delCCC								CNTN3 (694563 upstream) : FAM86D (205797 downstream)																							AACCTGATGACCCCaaaaaaaaa	0.305													4	2	---	---	---	---	
UBA6	55236	broad.mit.edu	37	4	68531149	68531150	+	Intron	INS	-	T	T			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:68531149_68531150insT	uc003hdg.3	-						UBA6_uc003hdi.2_Intron|UBA6_uc003hdj.2_Intron	NM_018227	NP_060697	A0AVT1	UBA6_HUMAN	ubiquitin-activating enzyme E1-like 2						protein ubiquitination|ubiquitin-dependent protein catabolic process	cytoplasm	ATP binding|FAT10 activating enzyme activity|ligase activity|protein binding				0						ttgtttgtttgttttttttttt	0.213													4	2	---	---	---	---	
SOX4	6659	broad.mit.edu	37	6	21596216	21596217	+	3'UTR	INS	-	G	G			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:21596216_21596217insG	uc003ndi.2	+	1						NM_003107	NP_003098	Q06945	SOX4_HUMAN	SRY (sex determining region Y)-box 4						canonical Wnt receptor signaling pathway|cardiac ventricle formation|cellular response to glucose stimulus|DNA damage response, detection of DNA damage|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|glial cell development|glial cell proliferation|limb bud formation|negative regulation of apoptosis|negative regulation of cell proliferation|negative regulation of protein export from nucleus|negative regulation of protein ubiquitination|neural tube formation|neuroepithelial cell differentiation|noradrenergic neuron differentiation|positive regulation of apoptosis|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cell proliferation|positive regulation of insulin secretion|positive regulation of N-terminal peptidyl-lysine acetylation|positive regulation of translation|pro-B cell differentiation|protein stabilization|skeletal system development|spinal cord motor neuron differentiation|sympathetic nervous system development|T cell differentiation	mitochondrion|nucleus	core promoter sequence-specific DNA binding|protein binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription|RNA polymerase II transcription coactivator activity				0	Ovarian(93;0.163)		all cancers(50;0.0751)|Epithelial(50;0.155)			GGAGAAGGGCCGGGGGGGGTAG	0.371													4	2	---	---	---	---	
HLA-C	3107	broad.mit.edu	37	6	31237576	31237577	+	Intron	DEL	CA	-	-	rs72558156		TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31237576_31237577delCA	uc003nsy.2	-						HLA-C_uc011dnj.1_Intron|HLA-C_uc003nsx.2_Intron|HLA-C_uc003nsz.2_Intron|HLA-C_uc010jsl.2_Intron|HLA-C_uc003nta.2_Intron|HLA-C_uc003ntb.2_Intron|HLA-C_uc003ntc.1_Intron|HLA-B_uc010jsm.1_Intron|HLA-B_uc011dnk.1_Intron	NM_002117	NP_002108	Q9TNN7	1C05_HUMAN	major histocompatibility complex, class I, C						antigen processing and presentation of peptide antigen via MHC class I|interferon-gamma-mediated signaling pathway|interspecies interaction between organisms|regulation of immune response|type I interferon-mediated signaling pathway	integral to membrane|MHC class I protein complex					0						CCTTCATTGTCACATGTGCTTC	0.520													4	2	---	---	---	---	
CRIP3	401262	broad.mit.edu	37	6	43275176	43275179	+	Intron	DEL	AGAA	-	-			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43275176_43275179delAGAA	uc010jyn.1	-						CRIP3_uc003ouu.1_Intron	NM_206922	NP_996805	Q6Q6R5	CRIP3_HUMAN	cysteine-rich protein 3							cytoplasm	zinc ion binding			skin(1)	1			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00998)|OV - Ovarian serous cystadenocarcinoma(102;0.0305)			ATGAGGGAATAGAAAGAAAGAAAG	0.299													5	4	---	---	---	---	
SNX3	8724	broad.mit.edu	37	6	108533549	108533549	+	Intron	DEL	T	-	-			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:108533549delT	uc003psh.2	-						SNX3_uc003psi.2_Intron|SNX3_uc010kdi.2_Intron	NM_003795	NP_003786	O60493	SNX3_HUMAN	sorting nexin 3 isoform a						cell communication|endocytosis|protein transport	early endosome|endosome membrane	phosphatidylinositol-3-phosphate binding|protein phosphatase binding				0		all_cancers(87;3.82e-07)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.000195)|Colorectal(196;0.0293)|all_lung(197;0.0938)		BRCA - Breast invasive adenocarcinoma(108;0.0136)|Epithelial(106;0.0564)|OV - Ovarian serous cystadenocarcinoma(136;0.0717)|all cancers(137;0.0743)		GCATGTATAAttttttttttt	0.154													5	3	---	---	---	---	
SPDYE6	729597	broad.mit.edu	37	7	101987478	101987478	+	3'UTR	DEL	C	-	-			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:101987478delC	uc011kkp.1	-	8					SPDYE6_uc003uzb.2_3'UTR	NM_001146210	NP_001139682	P0CI01	SPDE6_HUMAN	speedy homolog E6												0						AAGGACCCCACCCCCCTCCCC	0.512													4	3	---	---	---	---	
IFRD1	3475	broad.mit.edu	37	7	112097284	112097284	+	Intron	DEL	A	-	-			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:112097284delA	uc003vgh.2	+						IFRD1_uc011kmn.1_Intron|IFRD1_uc003vgi.2_3'UTR|IFRD1_uc003vgj.2_Intron|IFRD1_uc011kmo.1_Intron|IFRD1_uc011kmp.1_Intron	NM_001007245	NP_001007246	O00458	IFRD1_HUMAN	interferon-related developmental regulator 1						multicellular organismal development|myoblast cell fate determination		binding			kidney(1)|central_nervous_system(1)	2						TACGTAAACCAAAAAAAAATA	0.343													6	3	---	---	---	---	
ADAMTSL1	92949	broad.mit.edu	37	9	18723077	18723077	+	Intron	DEL	G	-	-			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:18723077delG	uc003zne.3	+							NM_001040272	NP_001035362	Q8N6G6	ATL1_HUMAN	ADAMTS-like 1 isoform 4 precursor							proteinaceous extracellular matrix	metallopeptidase activity|zinc ion binding			ovary(3)|upper_aerodigestive_tract(1)|lung(1)	5				GBM - Glioblastoma multiforme(50;1.29e-17)		caagaggcctggcttctcatc	0.179													19	10	---	---	---	---	
NOXA1	10811	broad.mit.edu	37	9	140320927	140320928	+	Intron	INS	-	GGGTC	GGGTC	rs145312088	by1000genomes	TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140320927_140320928insGGGTC	uc004cmv.2	+						C9orf167_uc011mew.1_Intron|NOXA1_uc004cmu.2_Intron|NOXA1_uc010nch.2_Intron	NM_006647	NP_006638	Q86UR1	NOXA1_HUMAN	NADPH oxidase activator 1						regulation of hydrogen peroxide metabolic process|regulation of respiratory burst|superoxide metabolic process	cytoplasm|NADPH oxidase complex	Rac GTPase binding|superoxide-generating NADPH oxidase activator activity				0	all_cancers(76;0.0926)			OV - Ovarian serous cystadenocarcinoma(145;0.000238)|Epithelial(140;0.000982)		CAGGGAAACCTGAGACTGTGGC	0.426													4	2	---	---	---	---	
COL17A1	1308	broad.mit.edu	37	10	105831901	105831901	+	Intron	DEL	T	-	-			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:105831901delT	uc001kxr.2	-						COL17A1_uc010qqv.1_Intron|COL17A1_uc009xxp.1_Intron	NM_000494	NP_000485	Q9UMD9	COHA1_HUMAN	alpha 1 type XVII collagen						cell-matrix adhesion|epidermis development|hemidesmosome assembly	basement membrane|cell-cell junction|collagen|hemidesmosome|integral to plasma membrane	protein binding			ovary(4)|pancreas(1)	5		Colorectal(252;0.103)|Breast(234;0.122)		Epithelial(162;2.5e-09)|all cancers(201;7.94e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0165)		TCCCTGACACTGAACTCCTAG	0.488													12	6	---	---	---	---	
TUBGCP2	10844	broad.mit.edu	37	10	135097228	135097228	+	Intron	DEL	G	-	-	rs67681147		TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135097228delG	uc001lmg.1	-						TUBGCP2_uc001lmf.1_Intron|TUBGCP2_uc010qvc.1_Intron|TUBGCP2_uc009ybk.1_Intron|TUBGCP2_uc010qvd.1_Intron|TUBGCP2_uc001lmh.1_Intron	NM_006659	NP_006650	Q9BSJ2	GCP2_HUMAN	tubulin, gamma complex associated protein 2						G2/M transition of mitotic cell cycle|microtubule nucleation|protein complex assembly	centrosome|cytoplasmic microtubule|cytosol|spindle pole	protein binding				0		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.87e-06)|all cancers(32;8.98e-06)|Epithelial(32;1.15e-05)		tgcctctcccgcactccctgc	0.055													8	4	---	---	---	---	
MUC5B	727897	broad.mit.edu	37	11	1274322	1274331	+	Intron	DEL	ATGGTGGGGC	-	-			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1274322_1274331delATGGTGGGGC	uc009ycr.1	+						MUC5B_uc001ltb.2_Intron	NM_017511	NP_059981	Q9HC84	MUC5B_HUMAN	SubName: Full=Mucin 5AC, oligomeric mucus/gel-forming;						cell adhesion	extracellular region	extracellular matrix structural constituent|protein binding				0		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		gcagtggggaatggtggggcatggtggggc	0.319													6	3	---	---	---	---	
HOMEZ	57594	broad.mit.edu	37	14	23764733	23764733	+	Intron	DEL	A	-	-			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23764733delA	uc001wjb.2	-							NM_020834	NP_065885	Q8IX15	HOMEZ_HUMAN	homeodomain leucine zipper protein							nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0	all_cancers(95;5.54e-06)			GBM - Glioblastoma multiforme(265;0.00643)		CTTCATTCTTAAAAAAAAAAA	0.403													4	2	---	---	---	---	
C14orf21	161424	broad.mit.edu	37	14	24772593	24772593	+	Intron	DEL	T	-	-	rs112529240		TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24772593delT	uc001wol.1	+						C14orf21_uc001wom.1_Intron	NM_174913	NP_777573	Q86U38	CN021_HUMAN	hypothetical protein LOC161424								RNA binding			breast(2)|central_nervous_system(1)|skin(1)	4				GBM - Glioblastoma multiforme(265;0.0185)		ACCCAGCTAAttttttttttt	0.313													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	35209719	35209719	+	IGR	DEL	A	-	-			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:35209719delA								CFL2 (25690 upstream) : BAZ1A (12220 downstream)																							TGACGATCTCATCAAAAGTGA	0.458													56	30	---	---	---	---	
MBTD1	54799	broad.mit.edu	37	17	49270644	49270644	+	Intron	DEL	T	-	-	rs66924763		TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:49270644delT	uc002itr.3	-						MBTD1_uc002itp.3_Intron|MBTD1_uc002itq.3_Intron	NM_017643	NP_060113	Q05BQ5	MBTD1_HUMAN	mbt domain containing 1						chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(2)	2			BRCA - Breast invasive adenocarcinoma(22;1.54e-08)			AAAGAAAATATTTATATTGTT	0.244													3	3	---	---	---	---	
MAP2K2	5605	broad.mit.edu	37	19	4097203	4097204	+	Intron	INS	-	A	A	rs11449985		TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4097203_4097204insA	uc002lzk.2	-						MAP2K2_uc002lzj.2_Intron	NM_030662	NP_109587	P36507	MP2K2_HUMAN	mitogen-activated protein kinase kinase 2						activation of MAPK activity|activation of MAPKK activity|axon guidance|epidermal growth factor receptor signaling pathway|ERK1 and ERK2 cascade|innate immune response|insulin receptor signaling pathway|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|Ras protein signal transduction|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|extracellular region	ATP binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0149)|STAD - Stomach adenocarcinoma(1328;0.18)		agactctgcctaaaaaaaaaaa	0.139									Cardiofaciocutaneous_syndrome				8	4	---	---	---	---	
SEMA6B	10501	broad.mit.edu	37	19	4555211	4555226	+	Intron	DEL	GGAGCCCCTGTCTCCA	-	-			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4555211_4555226delGGAGCCCCTGTCTCCA	uc010duc.1	-						SEMA6B_uc010dud.2_Intron|SEMA6B_uc010xih.1_Intron	NM_032108	NP_115484	Q9H3T3	SEM6B_HUMAN	semaphorin 6B precursor						cell differentiation|nervous system development	integral to membrane	receptor activity			skin(1)	1		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0149)|STAD - Stomach adenocarcinoma(1328;0.18)		TGAGCCTAGGGGagcccctgtctccaggctgagccc	0.292													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	9389759	9389764	+	IGR	DEL	TCTGCA	-	-			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9389759_9389764delTCTGCA								OR7E24 (27020 upstream) : ZNF699 (16222 downstream)																							GGCGATGCAGTCTGCATAGCTGATGG	0.529													9	4	---	---	---	---	
MCM8	84515	broad.mit.edu	37	20	5975124	5975125	+	3'UTR	INS	-	AC	AC	rs11472210		TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:5975124_5975125insAC	uc002wmi.2	+	19					MCM8_uc002wmj.2_3'UTR|MCM8_uc002wmk.2_3'UTR|MCM8_uc002wml.2_3'UTR|MCM8_uc010gbp.2_3'UTR|MCM8_uc002wmm.2_3'UTR	NM_032485	NP_115874	Q9UJA3	MCM8_HUMAN	minichromosome maintenance complex component 8						cell cycle checkpoint|DNA strand elongation involved in DNA replication|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|regulation of transcription, DNA-dependent|S phase of mitotic cell cycle|transcription, DNA-dependent	nucleoplasm	ATP binding|DNA binding|nucleoside-triphosphatase activity			skin(1)	1						cagacagacagacacacacaca	0.252													6	3	---	---	---	---	
KIF3B	9371	broad.mit.edu	37	20	30914791	30914791	+	Intron	DEL	T	-	-			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30914791delT	uc002wxq.2	+						KIF3B_uc010ztw.1_Intron	NM_004798	NP_004789	O15066	KIF3B_HUMAN	kinesin family member 3B						anterograde axon cargo transport|blood coagulation|determination of left/right symmetry|mitotic centrosome separation|plus-end-directed vesicle transport along microtubule|spindle assembly involved in mitosis	centrosome|cytosol|kinesin II complex|plus-end kinesin complex|spindle microtubule	ATP binding|plus-end-directed microtubule motor activity|Rho GTPase binding			central_nervous_system(3)|ovary(2)	5			UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)			AAGAACACAGTTTGGCTTATT	0.373													16	9	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11085863	11085864	+	Intron	INS	-	C	C			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11085863_11085864insC	uc002yit.1	-						BAGE_uc002yix.2_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		catcaccaccaccaccatcacc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	42384560	42384560	+	IGR	DEL	A	-	-			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:42384560delA								CASK (602273 upstream) : PPP1R2P9 (252059 downstream)																							CAGCCAAGGGAAAAAAAAAAA	0.219													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	48136137	48136141	+	IGR	DEL	ACTCA	-	-			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48136137_48136141delACTCA								SSX1 (9258 upstream) : SSX3 (69722 downstream)																							CTTCCCATCTACTCACCCTGATGCC	0.488													15	12	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	13496206	13496206	+	IGR	DEL	G	-	-			TCGA-CW-6093-01A-11D-1669-08	TCGA-CW-6093-11A-01D-1669-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:13496206delG								None (None upstream) : None (None downstream)																							CTTCTGTCATGTGAAATAATT	0.318													2	4	---	---	---	---	
