Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
APITD1	378708	broad.mit.edu	37	1	10490531	10490531	+	5'UTR	SNP	C	G	G			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:10490531C>G	uc001are.2	+	1					APITD1_uc001arf.2_5'UTR|APITD1_uc001arg.2_Silent_p.A65A|APITD1_uc001arh.2_5'Flank	NM_199294	NP_954988	Q8N2Z9	CENPS_HUMAN	apoptosis-inducing, TAF9-like domain 1 isoform						DNA repair|mitotic prometaphase|transcription initiation, DNA-dependent	chromosome, centromeric region|cytosol|Fanconi anaemia nuclear complex	chromatin binding|DNA binding|protein binding			ovary(1)	1	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.19e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.31e-07)|COAD - Colon adenocarcinoma(227;7.32e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000297)|Kidney(185;0.000747)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(132;0.0167)|READ - Rectum adenocarcinoma(331;0.0487)		GCACCACCGCCCCTTCTCGGC	0.552													9	10	---	---	---	---	PASS
APITD1	378708	broad.mit.edu	37	1	10490545	10490545	+	5'UTR	SNP	C	T	T			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:10490545C>T	uc001are.2	+	1					APITD1_uc001arf.2_5'UTR|APITD1_uc001arg.2_Missense_Mutation_p.S70F|APITD1_uc001arh.2_5'Flank	NM_199294	NP_954988	Q8N2Z9	CENPS_HUMAN	apoptosis-inducing, TAF9-like domain 1 isoform						DNA repair|mitotic prometaphase|transcription initiation, DNA-dependent	chromosome, centromeric region|cytosol|Fanconi anaemia nuclear complex	chromatin binding|DNA binding|protein binding			ovary(1)	1	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.19e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.31e-07)|COAD - Colon adenocarcinoma(227;7.32e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000297)|Kidney(185;0.000747)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(132;0.0167)|READ - Rectum adenocarcinoma(331;0.0487)		TCTCGGCCCTCCTGCGTTTGC	0.532													14	14	---	---	---	---	PASS
CLCN6	1185	broad.mit.edu	37	1	11896171	11896171	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11896171G>A	uc001ate.3	+	18	2054	c.1941G>A	c.(1939-1941)ATG>ATA	p.M647I	CLCN6_uc010oat.1_Missense_Mutation_p.M363I|CLCN6_uc010oau.1_Missense_Mutation_p.M625I	NM_001286	NP_001277	P51797	CLCN6_HUMAN	chloride channel 6 isoform ClC-6a	647	Cytoplasmic (By similarity).|CBS 1.				cell volume homeostasis|signal transduction	endosome membrane|integral to membrane	antiporter activity|ATP binding|voltage-gated chloride channel activity				0	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.13e-06)|COAD - Colon adenocarcinoma(227;0.000274)|BRCA - Breast invasive adenocarcinoma(304;0.000311)|Kidney(185;0.000816)|KIRC - Kidney renal clear cell carcinoma(229;0.00268)|STAD - Stomach adenocarcinoma(313;0.00743)|READ - Rectum adenocarcinoma(331;0.0649)		AGGAGTTCATGAAGGGCAACC	0.567													44	62	---	---	---	---	PASS
CROCCL1	84809	broad.mit.edu	37	1	16956555	16956555	+	Intron	SNP	C	T	T	rs9329440	by1000genomes	TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16956555C>T	uc009vov.1	-						CROCCL1_uc001aze.2_Intron|CROCCL1_uc001azf.2_Intron|CROCCL1_uc001azg.1_Intron|CROCCL1_uc001azi.1_RNA	NR_026752				Homo sapiens mRNA for FLJ00313 protein.												0						CTCTAGGGCCCGCCGCTCACT	0.502													3	7	---	---	---	---	PASS
C1orf168	199920	broad.mit.edu	37	1	57189298	57189298	+	Missense_Mutation	SNP	A	C	C			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:57189298A>C	uc001cym.3	-	17	2343	c.1937T>G	c.(1936-1938)ATG>AGG	p.M646R	C1orf168_uc001cyl.2_RNA	NM_001004303	NP_001004303	Q5VWT5	CA168_HUMAN	hypothetical protein LOC199920	646										ovary(3)|skin(2)	5						TTCTCTTTTCATTCTGTTCTT	0.303													129	257	---	---	---	---	PASS
SGIP1	84251	broad.mit.edu	37	1	67161174	67161174	+	Missense_Mutation	SNP	A	G	G			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:67161174A>G	uc001dcr.2	+	18	1845	c.1628A>G	c.(1627-1629)GAA>GGA	p.E543G	SGIP1_uc010opd.1_Missense_Mutation_p.E143G|SGIP1_uc001dcs.2_Missense_Mutation_p.E143G|SGIP1_uc001dct.2_Intron|SGIP1_uc009wat.2_Missense_Mutation_p.E337G|SGIP1_uc001dcu.2_Missense_Mutation_p.E48G	NM_032291	NP_115667	Q9BQI5	SGIP1_HUMAN	SH3-domain GRB2-like (endophilin) interacting	543					positive regulation of energy homeostasis|positive regulation of feeding behavior|positive regulation of receptor-mediated endocytosis|response to dietary excess	AP-2 adaptor complex	microtubule binding|phospholipid binding|SH3 domain binding			ovary(3)	3						TTGACTTTTGAAGGTAAGTAG	0.413													120	383	---	---	---	---	PASS
ELTD1	64123	broad.mit.edu	37	1	79387344	79387344	+	Missense_Mutation	SNP	T	C	C			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:79387344T>C	uc001diq.3	-	9	1367	c.1211A>G	c.(1210-1212)AAT>AGT	p.N404S		NM_022159	NP_071442	Q9HBW9	ELTD1_HUMAN	EGF, latrophilin and seven transmembrane domain	404	GPS.|Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(1)|skin(1)	2				COAD - Colon adenocarcinoma(225;0.0905)|Colorectal(170;0.103)|all cancers(265;0.105)|Epithelial(280;0.148)		TGTCAGGTGATTACAGCGGCA	0.403													135	238	---	---	---	---	PASS
VANGL1	81839	broad.mit.edu	37	1	116226627	116226627	+	Missense_Mutation	SNP	G	T	T			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:116226627G>T	uc001efv.1	+	6	1280	c.1009G>T	c.(1009-1011)GAC>TAC	p.D337Y	VANGL1_uc009wgy.1_Missense_Mutation_p.D335Y	NM_138959	NP_620409	Q8TAA9	VANG1_HUMAN	vang-like 1	337	Cytoplasmic (Potential).				multicellular organismal development	integral to membrane	protein binding			central_nervous_system(1)	1	Lung SC(450;0.211)	all_cancers(81;1.24e-06)|all_epithelial(167;1.02e-06)|all_lung(203;7.95e-06)|Lung NSC(69;4.97e-05)		Lung(183;0.0171)|Colorectal(144;0.0686)|LUSC - Lung squamous cell carcinoma(189;0.0903)|all cancers(265;0.108)|COAD - Colon adenocarcinoma(174;0.111)|Epithelial(280;0.12)		TCGGCGCAGGGACTCAAGCCA	0.532													11	15	---	---	---	---	PASS
MIR9-1	407046	broad.mit.edu	37	1	156390181	156390181	+	RNA	SNP	C	A	A			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156390181C>A	hsa-mir-9-1|MI0000466	-			c.41C>A			C1orf61_uc001fou.1_Intron|C1orf61_uc001fov.1_Intron|C1orf61_uc001fow.1_Intron|C1orf61_uc001fox.1_Intron|C1orf61_uc001foy.1_Intron|uc001foz.1_RNA																	0						GACTCCACACCACTCATACAG	0.353													4	93	---	---	---	---	PASS
TPR	7175	broad.mit.edu	37	1	186286645	186286645	+	Silent	SNP	G	T	T			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186286645G>T	uc001grv.2	-	49	7206	c.6909C>A	c.(6907-6909)ACC>ACA	p.T2303T		NM_003292	NP_003283	P12270	TPR_HUMAN	nuclear pore complex-associated protein TPR	2303					carbohydrate metabolic process|glucose transport|mitotic cell cycle spindle assembly checkpoint|mRNA transport|protein import into nucleus|regulation of glucose transport|seryl-tRNA aminoacylation|transmembrane transport|viral reproduction	condensed chromosome kinetochore|cytoplasm|nuclear membrane|nuclear pore|nucleoplasm	ATP binding|protein binding|serine-tRNA ligase activity			ovary(2)|lung(2)|urinary_tract(1)|central_nervous_system(1)|skin(1)	7		Breast(1374;0.000659)|Lung SC(1967;0.0262)|Prostate(1639;0.157)		Colorectal(1306;1.12e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00553)		GATCCTGGCTGGTGGAGGGGA	0.443			T	NTRK1	papillary thyroid								49	138	---	---	---	---	PASS
CR1	1378	broad.mit.edu	37	1	207790124	207790124	+	Missense_Mutation	SNP	G	T	T			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:207790124G>T	uc001hfy.2	+	33	5656	c.5516G>T	c.(5515-5517)CGC>CTC	p.R1839L	CR1_uc001hfx.2_Missense_Mutation_p.R2289L	NM_000573	NP_000564	P17927	CR1_HUMAN	complement receptor 1 isoform F precursor	1839	Sushi 28.|Extracellular (Potential).				complement activation, classical pathway|innate immune response	integral to plasma membrane	complement receptor activity			ovary(3)	3						CCTGCCCCTCGCTGTGAACTT	0.502													41	104	---	---	---	---	PASS
KCNH7	90134	broad.mit.edu	37	2	163256789	163256789	+	Missense_Mutation	SNP	C	T	T			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:163256789C>T	uc002uch.1	-	10	2529	c.2317G>A	c.(2317-2319)GTT>ATT	p.V773I		NM_033272	NP_150375	Q9NS40	KCNH7_HUMAN	potassium voltage-gated channel, subfamily H,	773	Cytoplasmic (Potential).|cNMP.				regulation of transcription, DNA-dependent	integral to membrane	protein binding|signal transducer activity			ovary(3)|skin(2)	5					Ibutilide(DB00308)	CCACAGTGAACGAGGGTGTCT	0.478													9	257	---	---	---	---	PASS
DNAJC10	54431	broad.mit.edu	37	2	183605974	183605974	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:183605974G>A	uc002uow.1	+	13	1497	c.1082G>A	c.(1081-1083)CGT>CAT	p.R361H	DNAJC10_uc002uox.1_RNA|DNAJC10_uc002uoy.1_RNA|DNAJC10_uc002uoz.1_Missense_Mutation_p.R315H|DNAJC10_uc010fro.1_RNA	NM_018981	NP_061854	Q8IXB1	DJC10_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 10	361					apoptosis in response to endoplasmic reticulum stress|cell redox homeostasis|ER-associated protein catabolic process|glycerol ether metabolic process|negative regulation of protein phosphorylation|protein folding|response to endoplasmic reticulum stress	endoplasmic reticulum chaperone complex|endoplasmic reticulum lumen|extracellular region	ATPase activator activity|ATPase binding|chaperone binding|electron carrier activity|heat shock protein binding|misfolded protein binding|protein disulfide oxidoreductase activity|unfolded protein binding			ovary(1)|large_intestine(1)|breast(1)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.0942)|Epithelial(96;0.209)			TTTAAGGATCGTTTGGCTCAT	0.313													246	521	---	---	---	---	PASS
MPP4	58538	broad.mit.edu	37	2	202530782	202530782	+	Intron	SNP	C	T	T			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:202530782C>T	uc002uyk.3	-						MPP4_uc002uyi.3_5'Flank|MPP4_uc010ftj.2_Intron|MPP4_uc010zhq.1_Intron|MPP4_uc010zhr.1_Intron|MPP4_uc010zhs.1_Intron|MPP4_uc002uyj.3_Intron|MPP4_uc010zht.1_Intron|MPP4_uc002uyl.3_Intron|MPP4_uc010ftk.2_Intron|MPP4_uc002uym.1_3'UTR	NM_033066	NP_149055	Q96JB8	MPP4_HUMAN	membrane protein, palmitoylated 4							cytoplasm	protein binding				0						gttctaccatcggaTATGCTG	0.219													16	13	---	---	---	---	PASS
SETD2	29072	broad.mit.edu	37	3	47163086	47163086	+	Missense_Mutation	SNP	C	A	A			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:47163086C>A	uc003cqs.2	-	3	3093	c.3040G>T	c.(3040-3042)GGT>TGT	p.G1014C	SETD2_uc003cqv.2_Missense_Mutation_p.G1003C	NM_014159	NP_054878	Q9BYW2	SETD2_HUMAN	SET domain containing 2	1014					regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleus	DNA binding|histone-lysine N-methyltransferase activity|oxidoreductase activity|transition metal ion binding			kidney(24)|ovary(5)|skin(1)|central_nervous_system(1)|breast(1)	32		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		TAAGTTACACCATCACTGTCT	0.373			N|F|S|Mis		clear cell renal carcinoma								4	95	---	---	---	---	PASS
ATG3	64422	broad.mit.edu	37	3	112256693	112256693	+	Missense_Mutation	SNP	T	G	G			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:112256693T>G	uc003dzd.2	-	9	665	c.555A>C	c.(553-555)AAA>AAC	p.K185N	ATG3_uc003dzc.2_Missense_Mutation_p.K185N|ATG3_uc010hqe.2_Missense_Mutation_p.K185N	NM_022488	NP_071933	Q9NT62	ATG3_HUMAN	Apg3p	185					autophagic vacuole assembly|mitochondrial fragmentation involved in apoptosis|protein targeting to membrane|protein ubiquitination	cytoplasmic ubiquitin ligase complex|cytosol	Atg12 ligase activity|Atg8 ligase activity|enzyme binding			ovary(3)	3						CAGCATCAGTTTTGGCTTTAC	0.343													189	160	---	---	---	---	PASS
RABL3	285282	broad.mit.edu	37	3	120461341	120461341	+	Missense_Mutation	SNP	T	C	C			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:120461341T>C	uc003edx.2	-	1	44	c.14A>G	c.(13-15)GAT>GGT	p.D5G	GTF2E1_uc003edy.2_5'Flank|GTF2E1_uc003edz.3_5'Flank	NM_173825	NP_776186	Q5HYI8	RABL3_HUMAN	RAB, member of RAS oncogene family-like 3	5	Small GTPase-like.				small GTPase mediated signal transduction		GTP binding				0				GBM - Glioblastoma multiforme(114;0.151)		CTTCACCCGATCCAGGGACGC	0.552													19	22	---	---	---	---	PASS
EPHB3	2049	broad.mit.edu	37	3	184298608	184298608	+	Missense_Mutation	SNP	T	C	C			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184298608T>C	uc003foz.2	+	13	2917	c.2480T>C	c.(2479-2481)GTC>GCC	p.V827A		NM_004443	NP_004434	P54753	EPHB3_HUMAN	ephrin receptor EphB3 precursor	827	Cytoplasmic (Potential).|Protein kinase.					integral to plasma membrane	ATP binding|ephrin receptor activity			lung(5)|breast(2)|upper_aerodigestive_tract(1)|stomach(1)|skin(1)|ovary(1)	11	all_cancers(143;1.89e-10)|Ovarian(172;0.0339)		Epithelial(37;1.27e-34)|OV - Ovarian serous cystadenocarcinoma(80;3.8e-22)			TACGGAATTGTCATGTGGGAG	0.577													4	64	---	---	---	---	PASS
RFC4	5984	broad.mit.edu	37	3	186508151	186508151	+	Silent	SNP	C	T	T			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186508151C>T	uc003fqz.2	-	9	1069	c.846G>A	c.(844-846)CAG>CAA	p.Q282Q	RFC4_uc011bsc.1_Silent_p.Q282Q	NM_002916	NP_002907	P35249	RFC4_HUMAN	replication factor C 4	282					cell cycle checkpoint|DNA strand elongation involved in DNA replication|nucleotide-excision repair, DNA gap filling|phosphatidylinositol-mediated signaling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	DNA replication factor C complex|nucleoplasm	ATP binding|DNA clamp loader activity|protein binding			breast(2)|upper_aerodigestive_tract(1)|ovary(1)|large_intestine(1)	5	all_cancers(143;2.92e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;7.41e-21)	GBM - Glioblastoma multiforme(93;0.0739)		AAGAGCCACTCTGACAGGCAG	0.368													26	272	---	---	---	---	PASS
MUC4	4585	broad.mit.edu	37	3	195505867	195505867	+	Missense_Mutation	SNP	A	T	T			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195505867A>T	uc011bto.1	-	3	12660	c.12200T>A	c.(12199-12201)GTC>GAC	p.V4067D	MUC4_uc003fva.2_5'Flank|MUC4_uc003fvb.2_5'Flank|MUC4_uc003fvc.2_5'Flank|MUC4_uc003fvd.2_5'Flank|MUC4_uc003fve.2_5'Flank|MUC4_uc010hzr.2_5'Flank|MUC4_uc011btf.1_Intron|MUC4_uc011btg.1_Intron|MUC4_uc011bth.1_Intron|MUC4_uc011bti.1_Intron|MUC4_uc011btj.1_Intron|MUC4_uc011btk.1_Intron|MUC4_uc011btl.1_Intron|MUC4_uc011btm.1_Intron|MUC4_uc011btn.1_Intron|MUC4_uc003fvo.2_Intron|MUC4_uc003fvp.2_Intron|MUC4_uc010hzu.1_Intron	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		AGTGTCGGTGACAGGAAGAGG	0.607													3	11	---	---	---	---	PASS
POLN	353497	broad.mit.edu	37	4	2132991	2132991	+	Silent	SNP	T	G	G			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:2132991T>G	uc003ger.2	-	15	1758	c.1758A>C	c.(1756-1758)CCA>CCC	p.P586P	POLN_uc010icg.1_Silent_p.P34P|POLN_uc010ich.1_Silent_p.P118P	NM_181808	NP_861524	Q7Z5Q5	DPOLN_HUMAN	DNA-directed DNA polymerase nu	586					DNA repair|DNA replication	nucleus	DNA binding|DNA-directed DNA polymerase activity			kidney(2)|ovary(1)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(23;0.0955)			TAATCTGAATTGGGTGCTTGG	0.284								DNA_polymerases_(catalytic_subunits)|Direct_reversal_of_damage					22	672	---	---	---	---	PASS
GAR1	54433	broad.mit.edu	37	4	110737330	110737330	+	Nonsense_Mutation	SNP	C	T	T			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:110737330C>T	uc003hzt.2	+	2	317	c.10C>T	c.(10-12)CGA>TGA	p.R4*	GAR1_uc003hzu.2_Nonsense_Mutation_p.R4*|GAR1_uc010imh.1_Nonsense_Mutation_p.R4*|GAR1_uc010imi.2_Nonsense_Mutation_p.R4*	NM_018983	NP_061856	Q9NY12	GAR1_HUMAN	nucleolar protein family A, member 1	4	RGG-box 1.				rRNA processing|snRNA pseudouridine synthesis	box H/ACA snoRNP complex|Cajal body	cation channel activity|pseudouridine synthase activity|snoRNA binding				0						AATGTCTTTTCGAGGCGGAGG	0.323													27	98	---	---	---	---	PASS
MAML3	55534	broad.mit.edu	37	4	140640694	140640694	+	Missense_Mutation	SNP	T	C	C			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:140640694T>C	uc003ihz.1	-	7	3937	c.3185A>G	c.(3184-3186)CAG>CGG	p.Q1062R	MGST2_uc010ioi.1_Intron|MAML3_uc011chd.1_Missense_Mutation_p.Q530R	NM_018717	NP_061187	Q96JK9	MAML3_HUMAN	mastermind-like 3	1063					Notch signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nuclear speck	transcription coactivator activity			ovary(1)	1	all_hematologic(180;0.162)					TATCTGCTGCTGTGCTGGGGG	0.627													5	21	---	---	---	---	PASS
CYP4V2	285440	broad.mit.edu	37	4	187131676	187131676	+	Missense_Mutation	SNP	C	G	G			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:187131676C>G	uc003iyw.3	+	11	1763	c.1459C>G	c.(1459-1461)CAC>GAC	p.H487D	CYP4V2_uc010ism.2_RNA	NM_207352	NP_997235	Q6ZWL3	CP4V2_HUMAN	cytochrome P450, family 4, subfamily v,	487					response to stimulus|visual perception	endoplasmic reticulum membrane|integral to membrane	electron carrier activity|heme binding|monooxygenase activity|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen				0		all_cancers(14;4.27e-52)|all_epithelial(14;7.69e-39)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.0066)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|all_neural(102;0.243)		OV - Ovarian serous cystadenocarcinoma(60;1.33e-10)|BRCA - Breast invasive adenocarcinoma(30;3.84e-05)|GBM - Glioblastoma multiforme(59;0.000132)|STAD - Stomach adenocarcinoma(60;0.000293)|LUSC - Lung squamous cell carcinoma(40;0.00242)|READ - Rectum adenocarcinoma(43;0.17)		CATCCTGAGGCACTTTTGGAT	0.403													9	331	---	---	---	---	PASS
POU5F2	134187	broad.mit.edu	37	5	93076921	93076921	+	Missense_Mutation	SNP	C	T	T			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:93076921C>T	uc003kkl.1	-	1	389	c.349G>A	c.(349-351)GAG>AAG	p.E117K	FAM172A_uc010jbd.2_Intron|FAM172A_uc011cuf.1_Intron|FAM172A_uc011cug.1_Intron|FAM172A_uc011cuh.1_Intron|FAM172A_uc011cui.1_Intron|FAM172A_uc011cuj.1_Intron	NM_153216	NP_694948	Q8N7G0	PO5F2_HUMAN	POU domain class 5, transcription factor 2	117						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0		all_cancers(142;3.87e-05)|all_epithelial(76;4.59e-07)|all_lung(232;0.0126)|Lung NSC(167;0.0155)|Ovarian(174;0.0218)|Prostate(281;0.173)|Colorectal(57;0.19)		UCEC - Uterine corpus endometrioid carcinoma (5;0.0415)|all cancers(79;2.03e-19)		GAGATGTCCTCTGGCGGCGGC	0.627													5	131	---	---	---	---	PASS
RPL26L1	51121	broad.mit.edu	37	5	172386880	172386880	+	Missense_Mutation	SNP	A	C	C			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:172386880A>C	uc003mcc.2	+	2	46	c.4A>C	c.(4-6)AAG>CAG	p.K2Q	LOC100268168_uc011dfb.1_5'Flank|LOC100268168_uc011dfc.1_5'Flank	NM_016093	NP_057177	Q9UNX3	RL26L_HUMAN	ribosomal protein L26-like 1	2					endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosol|large ribosomal subunit	structural constituent of ribosome				0	Renal(175;0.000159)|Lung NSC(126;0.00344)|all_lung(126;0.00594)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			GGTCACCATGAAGTTCAATCC	0.562											OREG0017052	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	110	98	---	---	---	---	PASS
RUFY1	80230	broad.mit.edu	37	5	178996375	178996375	+	Silent	SNP	C	A	A			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:178996375C>A	uc003mka.1	+	5	777	c.777C>A	c.(775-777)CTC>CTA	p.L259L	RUFY1_uc003mkb.1_Silent_p.L151L|RUFY1_uc003mkc.1_Silent_p.L151L	NM_025158	NP_079434	Q96T51	RUFY1_HUMAN	RUN and FYVE domain-containing 1 isoform a	259	RUN.				endocytosis|protein transport	early endosome membrane	lipid binding|zinc ion binding			ovary(4)|breast(1)	5	all_cancers(89;0.00018)|all_epithelial(37;8.37e-05)|Renal(175;0.000159)|Lung NSC(126;0.00108)|all_lung(126;0.00195)	all_cancers(40;0.0322)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TGGTGGGACTCAATGTTCTCG	0.463										HNSCC(44;0.11)			15	712	---	---	---	---	PASS
OR2J2	26707	broad.mit.edu	37	6	29141585	29141585	+	Missense_Mutation	SNP	C	A	A			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29141585C>A	uc011dlm.1	+	1	275	c.173C>A	c.(172-174)ACA>AAA	p.T58K		NM_030905	NP_112167	O76002	OR2J2_HUMAN	olfactory receptor, family 2, subfamily J,	58	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						CATCTCCACACACCAATGTAC	0.473													48	66	---	---	---	---	PASS
KCNK5	8645	broad.mit.edu	37	6	39162007	39162007	+	Missense_Mutation	SNP	A	G	G			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:39162007A>G	uc003oon.2	-	4	936	c.572T>C	c.(571-573)ATC>ACC	p.I191T		NM_003740	NP_003731	O95279	KCNK5_HUMAN	potassium channel, subfamily K, member 5	191					excretion	integral to plasma membrane	potassium channel activity|voltage-gated ion channel activity			central_nervous_system(1)|skin(1)	2						GAGGCCCTCGATGTAGTTCCA	0.567													22	61	---	---	---	---	PASS
ZNF451	26036	broad.mit.edu	37	6	57018881	57018881	+	Intron	SNP	A	G	G			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57018881A>G	uc003pdm.1	+						ZNF451_uc003pdl.2_Missense_Mutation_p.R1036G|ZNF451_uc003pdn.1_Intron|uc003pdq.1_Intron	NM_001031623	NP_001026794	Q9Y4E5	ZN451_HUMAN	zinc finger protein 451 isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			ovary(1)|pancreas(1)	2	Lung NSC(77;0.145)		LUSC - Lung squamous cell carcinoma(124;0.0785)|Lung(124;0.13)			ACCACCCAAGAGGAGGAGACT	0.458													4	57	---	---	---	---	PASS
KLHL32	114792	broad.mit.edu	37	6	97423877	97423877	+	Missense_Mutation	SNP	C	A	A			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:97423877C>A	uc010kcm.1	+	3	500	c.28C>A	c.(28-30)CAA>AAA	p.Q10K	KLHL32_uc003poy.2_Missense_Mutation_p.Q10K|KLHL32_uc011ead.1_Missense_Mutation_p.Q10K|KLHL32_uc003poz.2_5'UTR|KLHL32_uc011eae.1_Missense_Mutation_p.Q10K	NM_052904	NP_443136	Q96NJ5	KLH32_HUMAN	kelch-like 32	10										ovary(3)|skin(1)	4		all_cancers(76;1.19e-06)|Acute lymphoblastic leukemia(125;5.83e-10)|all_hematologic(75;3.67e-07)|all_epithelial(107;0.00778)|Colorectal(196;0.122)		BRCA - Breast invasive adenocarcinoma(108;0.0558)		TTGTAGTATTCAAGAAATGCT	0.517													41	68	---	---	---	---	PASS
NT5DC1	221294	broad.mit.edu	37	6	116431962	116431962	+	Intron	SNP	G	T	T			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:116431962G>T	uc003pwj.2	+						NT5DC1_uc003pwk.2_Intron|NT5DC1_uc003pwl.2_Missense_Mutation_p.R19S	NM_152729	NP_689942	Q5TFE4	NT5D1_HUMAN	5'-nucleotidase, cytosolic II-like 1 protein								hydrolase activity|metal ion binding				0		all_cancers(87;0.00367)|all_epithelial(87;0.00449)|Colorectal(196;0.0469)		all cancers(137;0.0327)|OV - Ovarian serous cystadenocarcinoma(136;0.0445)|GBM - Glioblastoma multiforme(226;0.0719)|Epithelial(106;0.112)		ATAGAGGAAGGGGCATTCAAG	0.463													21	29	---	---	---	---	PASS
BCLAF1	9774	broad.mit.edu	37	6	136599666	136599666	+	Missense_Mutation	SNP	C	A	A	rs147857152		TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:136599666C>A	uc003qgx.1	-	4	606	c.353G>T	c.(352-354)AGA>ATA	p.R118I	BCLAF1_uc003qgw.1_Missense_Mutation_p.R118I|BCLAF1_uc003qgy.1_Missense_Mutation_p.R116I|BCLAF1_uc011edc.1_RNA|BCLAF1_uc011edd.1_RNA|BCLAF1_uc011ede.1_Missense_Mutation_p.R116I	NM_014739	NP_055554	Q9NYF8	BCLF1_HUMAN	BCL2-associated transcription factor 1 isoform	118					induction of apoptosis|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus	DNA binding|protein binding			ovary(1)	1	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00226)|OV - Ovarian serous cystadenocarcinoma(155;0.00331)		AGAAACGGATCTTCTTTTTGG	0.468													50	181	---	---	---	---	PASS
CCDC129	223075	broad.mit.edu	37	7	31617614	31617614	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:31617614G>A	uc003tcj.1	+	8	1729	c.736G>A	c.(736-738)GCC>ACC	p.A246T	CCDC129_uc011kad.1_Missense_Mutation_p.A256T|CCDC129_uc003tci.1_Intron|CCDC129_uc011kae.1_Missense_Mutation_p.A272T|CCDC129_uc003tck.1_Missense_Mutation_p.A154T	NM_194300	NP_919276	Q6ZRS4	CC129_HUMAN	coiled-coil domain containing 129	246											0						AGTGAGTGCCGCCAAAGAGCA	0.488													18	86	---	---	---	---	PASS
AP4M1	9179	broad.mit.edu	37	7	99700547	99700547	+	Silent	SNP	T	C	C			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99700547T>C	uc003utb.3	+	4	523	c.315T>C	c.(313-315)AAT>AAC	p.N105N	MCM7_uc003usv.1_5'Flank|MCM7_uc003usw.1_5'Flank|MCM7_uc003usx.1_5'Flank|AP4M1_uc011kjg.1_Silent_p.N105N|AP4M1_uc010lgl.1_Silent_p.N105N|AP4M1_uc003utc.3_Silent_p.N112N|AP4M1_uc010lgm.2_Intron|AP4M1_uc003utd.2_Silent_p.N105N|AP4M1_uc011kjh.1_Silent_p.N57N|AP4M1_uc003ute.3_5'UTR|AP4M1_uc003utf.3_5'UTR	NM_004722	NP_004713	O00189	AP4M1_HUMAN	adaptor-related protein complex 4, mu 1 subunit	105					intracellular protein transport|vesicle-mediated transport	clathrin adaptor complex|coated pit|Golgi trans cisterna	transporter activity				0	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					TCTCCCGCAATGTGGCTCTGG	0.542													26	61	---	---	---	---	PASS
MUC17	140453	broad.mit.edu	37	7	100680896	100680896	+	Missense_Mutation	SNP	A	C	C			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100680896A>C	uc003uxp.1	+	3	6252	c.6199A>C	c.(6199-6201)ACT>CCT	p.T2067P	MUC17_uc010lho.1_RNA	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN	mucin 17 precursor	2067	Extracellular (Potential).|32.|59 X approximate tandem repeats.|Ser-rich.					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity			ovary(14)|skin(8)|breast(3)|lung(2)	27	Lung NSC(181;0.136)|all_lung(186;0.182)					CCTTTCAACAACTCCTGTTGA	0.488													6	130	---	---	---	---	PASS
PPP1R3A	5506	broad.mit.edu	37	7	113518058	113518058	+	Missense_Mutation	SNP	C	A	A			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:113518058C>A	uc010ljy.1	-	4	3120	c.3089G>T	c.(3088-3090)GGA>GTA	p.G1030V		NM_002711	NP_002702	Q16821	PPR3A_HUMAN	protein phosphatase 1, regulatory (inhibitor)	1030					glycogen metabolic process	integral to membrane				lung(9)|ovary(9)|pancreas(7)|skin(6)|breast(2)|prostate(1)	34						GCTTACTAATCCTTCATTTTC	0.403													196	322	---	---	---	---	PASS
KCND2	3751	broad.mit.edu	37	7	119915447	119915447	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:119915447G>A	uc003vjj.1	+	1	1726	c.761G>A	c.(760-762)CGT>CAT	p.R254H		NM_012281	NP_036413	Q9NZV8	KCND2_HUMAN	potassium voltage-gated channel, Shal-related	254	Cytoplasmic (Potential).				regulation of action potential|synaptic transmission	cell surface|dendritic spine	metal ion binding			ovary(2)|central_nervous_system(2)|skin(1)	5	all_neural(327;0.117)					GCGCCTAGTCGTTACCGTTTT	0.532													57	98	---	---	---	---	PASS
GALNT11	63917	broad.mit.edu	37	7	151791383	151791383	+	Missense_Mutation	SNP	T	A	A			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151791383T>A	uc010lqg.1	+	2	301	c.71T>A	c.(70-72)CTT>CAT	p.L24H	GALNT11_uc011kvm.1_Intron|GALNT11_uc003wku.2_Missense_Mutation_p.L24H|GALNT11_uc003wkv.1_Missense_Mutation_p.L24H|GALNT11_uc011kvn.1_RNA	NM_022087	NP_071370	Q8NCW6	GLT11_HUMAN	N-acetylgalactosaminyltransferase 11	24	Helical; Signal-anchor for type II membrane protein; (Potential).					Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding				0	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.214)	OV - Ovarian serous cystadenocarcinoma(82;0.00168)	UCEC - Uterine corpus endometrioid carcinoma (81;0.177)|BRCA - Breast invasive adenocarcinoma(188;0.0932)		ACAGTTTTGCTTTTTGTTTAT	0.458													155	268	---	---	---	---	PASS
PRKDC	5591	broad.mit.edu	37	8	48707054	48707054	+	Silent	SNP	G	T	T			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:48707054G>T	uc003xqi.2	-	75	10524	c.10467C>A	c.(10465-10467)TCC>TCA	p.S3489S	PRKDC_uc003xqj.2_Silent_p.S3489S|PRKDC_uc011ldh.1_Intron	NM_006904	NP_008835	P78527	PRKDC_HUMAN	protein kinase, DNA-activated, catalytic	3489	FAT.				cellular response to insulin stimulus|double-strand break repair via nonhomologous end joining|peptidyl-serine phosphorylation|positive regulation of transcription from RNA polymerase II promoter	DNA-dependent protein kinase-DNA ligase 4 complex|transcription factor complex	ATP binding|DNA binding|DNA-dependent protein kinase activity|transcription factor binding			lung(12)|central_nervous_system(9)|ovary(6)|skin(4)|large_intestine(3)	34		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)				AGCAGGGAACGGAAGAGATCT	0.423								NHEJ					4	84	---	---	---	---	PASS
ZFPM2	23414	broad.mit.edu	37	8	106813324	106813324	+	Silent	SNP	C	T	T	rs141238169	by1000genomes	TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:106813324C>T	uc003ymd.2	+	8	1037	c.1014C>T	c.(1012-1014)ACC>ACT	p.T338T	ZFPM2_uc011lhs.1_Silent_p.T69T|uc003yme.1_5'Flank	NM_012082	NP_036214	Q8WW38	FOG2_HUMAN	zinc finger protein, multitype 2	338	C2H2-type 2.				blood coagulation|negative regulation of fat cell differentiation|outflow tract septum morphogenesis|right ventricular cardiac muscle tissue morphogenesis|ventricular septum morphogenesis	nucleoplasm	DNA binding|RNA polymerase II transcription coactivator activity|transcription corepressor activity|transcription factor binding|zinc ion binding			ovary(4)|large_intestine(1)	5			OV - Ovarian serous cystadenocarcinoma(57;8.28e-08)			TAAAATGCACCGTCTGTAGCT	0.443													11	139	---	---	---	---	PASS
NXNL2	158046	broad.mit.edu	37	9	91159434	91159434	+	Missense_Mutation	SNP	C	A	A			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:91159434C>A	uc011ltj.1	+	2	777	c.443C>A	c.(442-444)GCC>GAC	p.A148D	NXNL2_uc004aqa.2_Intron	NM_001161625	NP_001155097	Q5VZ03	NXNL2_HUMAN	nucleoredoxin-like 2 isoform 1	148											0						GTGGAGGCGGCCGATATCTTC	0.577													15	26	---	---	---	---	PASS
ZNF462	58499	broad.mit.edu	37	9	109689490	109689490	+	Silent	SNP	A	C	C			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:109689490A>C	uc004bcz.2	+	3	3586	c.3297A>C	c.(3295-3297)CCA>CCC	p.P1099P	ZNF462_uc010mto.2_Silent_p.P947P|ZNF462_uc004bda.2_Silent_p.P947P	NM_021224	NP_067047	Q96JM2	ZN462_HUMAN	zinc finger protein 462	1099					transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(5)	5						TGGGTTCCCCACCCCCCCCAC	0.532													9	65	---	---	---	---	PASS
SCAI	286205	broad.mit.edu	37	9	127790688	127790688	+	Missense_Mutation	SNP	C	A	A			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:127790688C>A	uc004bpe.2	-	5	477	c.396G>T	c.(394-396)CAG>CAT	p.Q132H	SCAI_uc004bpd.2_Missense_Mutation_p.Q155H|SCAI_uc010mwu.2_RNA	NM_001144877	NP_001138349	Q8N9R8	SCAI_HUMAN	suppressor of cancer cell invasion isoform 2	132	Required for interaction with MKL1 (By similarity).|Necessary to inhibit MKL1-induced SRF transcriptional activity (By similarity).				negative regulation of cell migration|negative regulation of Rho protein signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|integral to membrane|nucleus	protein binding|transcription corepressor activity			ovary(2)|breast(2)|central_nervous_system(1)	5						GATAGTATAGCTGCCCAATCT	0.338													12	352	---	---	---	---	PASS
MED27	9442	broad.mit.edu	37	9	134955076	134955076	+	Silent	SNP	A	G	G			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:134955076A>G	uc004cbe.1	-	1	178	c.156T>C	c.(154-156)TTT>TTC	p.F52F	MED27_uc004cbf.1_Silent_p.F52F|MED27_uc011mco.1_Silent_p.F52F|MED27_uc004cbg.3_Silent_p.F52F	NM_004269	NP_004260	Q6P2C8	MED27_HUMAN	mediator complex subunit 27	52					regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	cytoplasm|nucleolus|transcription factor complex	protein binding|transcription coactivator activity			skin(1)	1		Myeloproliferative disorder(178;0.206)		OV - Ovarian serous cystadenocarcinoma(145;6.82e-06)|Epithelial(140;0.000193)		AGTGCGCAATAAAGGCCTTCT	0.647													7	47	---	---	---	---	PASS
TPRN	286262	broad.mit.edu	37	9	140093554	140093554	+	Missense_Mutation	SNP	A	T	T			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140093554A>T	uc004clt.2	-	1	1427	c.1427T>A	c.(1426-1428)CTC>CAC	p.L476H	TPRN_uc004clu.2_Missense_Mutation_p.L476H	NM_173691	NP_775962	Q4KMQ1	TPRN_HUMAN	hypothetical protein LOC286262 isoform 2	537					sensory perception of sound	stereocilium					0						GGGCCCCAGGAGGCAACTAGC	0.647													19	21	---	---	---	---	PASS
ITIH2	3698	broad.mit.edu	37	10	7791323	7791323	+	3'UTR	SNP	A	G	G			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:7791323A>G	uc001ijs.2	+	21						NM_002216	NP_002207	P19823	ITIH2_HUMAN	inter-alpha globulin inhibitor H2 polypeptide						hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity			ovary(1)|pancreas(1)|skin(1)	3						GAAATTATATATATTAATATA	0.353													5	54	---	---	---	---	PASS
MARCH5	54708	broad.mit.edu	37	10	94110949	94110949	+	Missense_Mutation	SNP	A	T	T			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:94110949A>T	uc001khx.1	+	6	1154	c.822A>T	c.(820-822)GAA>GAT	p.E274D	MARCH5_uc010qno.1_Missense_Mutation_p.E170D	NM_017824	NP_060294	Q9NX47	MARH5_HUMAN	membrane-associated ring finger (C3HC4) 5	274					cell aging|protein autoubiquitination|protein localization in mitochondrion|protein polyubiquitination|regulation of mitochondrial fission	endoplasmic reticulum membrane|integral to membrane|mitochondrial outer membrane	GTPase binding|ubiquitin-protein ligase activity|zinc ion binding			skin(1)	1						ATTATCCAGAACAAGAAGAAG	0.378													97	162	---	---	---	---	PASS
MUC6	4588	broad.mit.edu	37	11	1023622	1023622	+	Missense_Mutation	SNP	G	A	A	rs138887092	by1000genomes	TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1023622G>A	uc001lsw.2	-	26	3464	c.3413C>T	c.(3412-3414)ACG>ATG	p.T1138M		NM_005961	NP_005952	Q6W4X9	MUC6_HUMAN	mucin 6, gastric	1138					maintenance of gastrointestinal epithelium	extracellular region	extracellular matrix structural constituent			ovary(1)	1		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GCCGTCCTGCGTGTGCGTGTT	0.667													27	53	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	11	55063168	55063168	+	Splice_Site	SNP	T	C	C			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55063168T>C	uc001nhl.1	-	3		c.469_splice	c.e3-1							Homo sapiens mRNA for hypothetical protein, partial sequence, clone:Hsa11-digit20-11-30-F.																		CACATAATCCTGCAGTGACAA	0.348													16	31	---	---	---	---	PASS
OR4S2	219431	broad.mit.edu	37	11	55418663	55418663	+	Missense_Mutation	SNP	G	T	T			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55418663G>T	uc001nhs.1	+	1	284	c.284G>T	c.(283-285)TGC>TTC	p.C95F		NM_001004059	NP_001004059	Q8NH73	OR4S2_HUMAN	olfactory receptor, family 4, subfamily S,	95	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)	3		all_epithelial(135;0.0748)				TATGTGGGGTGCATGTTGCAA	0.423													188	307	---	---	---	---	PASS
UBXN1	51035	broad.mit.edu	37	11	62445741	62445741	+	Intron	SNP	C	T	T			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62445741C>T	uc001nul.1	-						UBXN1_uc001nuj.2_Intron|UBXN1_uc001num.1_Intron|UBXN1_uc001nuk.2_Intron|UBXN1_uc010rme.1_Intron|UBXN1_uc010rmf.1_Silent_p.K120K	NM_015853	NP_056937	Q04323	UBXN1_HUMAN	UBX domain protein 1						negative regulation of proteasomal ubiquitin-dependent protein catabolic process|negative regulation of protein ubiquitination|proteasomal ubiquitin-dependent protein catabolic process	cytoplasm	ATPase binding|K6-linked polyubiquitin binding				0						GGTCAAGGTTCTTTGACCAGA	0.398													68	155	---	---	---	---	PASS
C11orf54	28970	broad.mit.edu	37	11	93494976	93494976	+	3'UTR	SNP	C	A	A			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:93494976C>A	uc009ywi.2	+	10					C11orf54_uc001pef.2_3'UTR|C11orf54_uc001peg.2_3'UTR|C11orf54_uc001peh.2_3'UTR|C11orf54_uc001pei.2_3'UTR|C11orf54_uc001pej.2_3'UTR|C11orf54_uc001pek.2_3'UTR	NM_014039	NP_054758	Q9H0W9	CK054_HUMAN	hypothetical protein LOC28970							nucleus	hydrolase activity, acting on ester bonds|protein binding|zinc ion binding				0		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)				tggctcatgcctataatccca	0.055													6	5	---	---	---	---	PASS
MMP8	4317	broad.mit.edu	37	11	102595498	102595498	+	Missense_Mutation	SNP	G	T	T			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:102595498G>T	uc001phe.2	-	1	188	c.89C>A	c.(88-90)ACA>AAA	p.T30K	MMP8_uc010rut.1_5'Flank|MMP8_uc010ruu.1_5'UTR	NM_002424	NP_002415	P22894	MMP8_HUMAN	matrix metalloproteinase 8 preproprotein	30					collagen catabolic process|proteolysis	extracellular space|proteinaceous extracellular matrix	metalloendopeptidase activity|serine-type endopeptidase activity|zinc ion binding			ovary(3)|breast(1)	4	all_cancers(8;0.00092)|all_epithelial(12;0.00389)|Lung NSC(15;0.227)	all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)	Epithelial(9;0.0555)|Lung(13;0.0828)|LUSC - Lung squamous cell carcinoma(19;0.151)|all cancers(10;0.189)	BRCA - Breast invasive adenocarcinoma(274;0.0141)		AACAGTTTTTGTATTTTTCTC	0.368													60	126	---	---	---	---	PASS
MMP12	4321	broad.mit.edu	37	11	102736586	102736586	+	Missense_Mutation	SNP	A	C	C			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:102736586A>C	uc001phk.2	-	9	1171	c.1126T>G	c.(1126-1128)TTT>GTT	p.F376V		NM_002426	NP_002417	P39900	MMP12_HUMAN	matrix metalloproteinase 12 preproprotein	376					positive regulation of epithelial cell proliferation involved in wound healing|proteolysis|wound healing, spreading of epidermal cells	proteinaceous extracellular matrix	calcium ion binding|metalloendopeptidase activity|zinc ion binding				0		all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)		BRCA - Breast invasive adenocarcinoma(274;0.014)	Acetohydroxamic Acid(DB00551)	TTTTTCACAAAGTTAGGAAAA	0.343													147	245	---	---	---	---	PASS
C11orf93	120376	broad.mit.edu	37	11	111179126	111179126	+	Nonsense_Mutation	SNP	T	A	A			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:111179126T>A	uc010rwf.1	+	5	1187	c.429T>A	c.(427-429)TAT>TAA	p.Y143*		NM_001136105	NP_001129577	A8K830	CK093_HUMAN	hypothetical protein LOC120376	143											0						GTGATTTCTATAAGAGGGAAA	0.458													26	44	---	---	---	---	PASS
B4GALNT3	283358	broad.mit.edu	37	12	667220	667220	+	Nonsense_Mutation	SNP	C	A	A			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:667220C>A	uc001qii.1	+	17	2573	c.2573C>A	c.(2572-2574)TCA>TAA	p.S858*	B4GALNT3_uc001qik.1_Nonsense_Mutation_p.S407*	NM_173593	NP_775864	Q6L9W6	B4GN3_HUMAN	beta	858	Lumenal (Potential).					Golgi cisterna membrane|integral to membrane	N-acetyl-beta-glucosaminyl-glycoprotein 4-beta-N-acetylgalactosaminyltransferase activity			ovary(1)|skin(1)	2	all_cancers(10;0.0158)|all_epithelial(11;0.0274)|Ovarian(42;0.0512)|all_lung(10;0.154)|Lung NSC(10;0.215)		OV - Ovarian serous cystadenocarcinoma(31;0.00018)|BRCA - Breast invasive adenocarcinoma(9;0.0262)			TTTGAACGCTCAGCTGGACTT	0.552													30	57	---	---	---	---	PASS
LPCAT3	10162	broad.mit.edu	37	12	7090783	7090783	+	Silent	SNP	A	C	C			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7090783A>C	uc001qsi.2	-	5	585	c.471T>G	c.(469-471)GTT>GTG	p.V157V	EMG1_uc010sfv.1_Intron|LPCAT3_uc010sfw.1_Silent_p.V51V|LPCAT3_uc009zfp.2_RNA|LPCAT3_uc010sfx.1_Intron|LPCAT3_uc009zfq.1_Silent_p.V15V	NM_005768	NP_005759	Q6P1A2	MBOA5_HUMAN	lysophosphatidylcholine acyltransferase 3	157					phospholipid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	1-acylglycerophosphocholine O-acyltransferase activity			ovary(1)	1						CAAAGTAGTCAACAGCCAAAC	0.483													66	135	---	---	---	---	PASS
CD163L1	283316	broad.mit.edu	37	12	7526111	7526111	+	Missense_Mutation	SNP	T	A	A			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7526111T>A	uc001qsy.2	-	14	3561	c.3535A>T	c.(3535-3537)ATT>TTT	p.I1179F	CD163L1_uc010sge.1_Missense_Mutation_p.I1189F	NM_174941	NP_777601	Q9NR16	C163B_HUMAN	scavenger receptor cysteine-rich type 1	1179	SRCR 11.|Extracellular (Potential).					extracellular region|integral to membrane|plasma membrane	scavenger receptor activity			ovary(8)|skin(2)|central_nervous_system(1)	11						CTGCACACAATGCCTGCTATG	0.542													21	42	---	---	---	---	PASS
KIAA1467	57613	broad.mit.edu	37	12	13233566	13233566	+	3'UTR	SNP	C	G	G			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:13233566C>G	uc001rbi.2	+	13					KIAA1467_uc009zhx.1_RNA	NM_020853	NP_065904	A2RU67	K1467_HUMAN	hypothetical protein LOC57613							integral to membrane				central_nervous_system(2)|skin(1)	3		Prostate(47;0.184)		BRCA - Breast invasive adenocarcinoma(232;0.157)		TAGATCTAATCTGATGGAATC	0.368													106	171	---	---	---	---	PASS
SLC6A15	55117	broad.mit.edu	37	12	85255559	85255559	+	Missense_Mutation	SNP	G	T	T			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:85255559G>T	uc001szv.2	-	12	2538	c.2045C>A	c.(2044-2046)CCG>CAG	p.P682Q	SLC6A15_uc010sul.1_Missense_Mutation_p.P575Q|SLC6A15_uc001szw.1_3'UTR	NM_182767	NP_877499	Q9H2J7	S6A15_HUMAN	solute carrier family 6, member 15 isoform 1	682	Cytoplasmic (Potential).				cellular nitrogen compound metabolic process|leucine transport|proline transport	integral to plasma membrane	amino acid transmembrane transporter activity|neurotransmitter:sodium symporter activity			pancreas(2)|ovary(1)	3						CATCTCGCTCGGTATTTTTCC	0.443													6	270	---	---	---	---	PASS
ZMYM2	7750	broad.mit.edu	37	13	20660011	20660011	+	Missense_Mutation	SNP	T	C	C			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:20660011T>C	uc001umr.2	+	26	4289	c.3991T>C	c.(3991-3993)TGC>CGC	p.C1331R	ZMYM2_uc001ums.2_Missense_Mutation_p.C1331R|ZMYM2_uc001umt.2_Missense_Mutation_p.C1331R|ZMYM2_uc001umv.2_Missense_Mutation_p.C711R|ZMYM2_uc001umw.2_Missense_Mutation_p.C784R	NM_003453	NP_003444	Q9UBW7	ZMYM2_HUMAN	zinc finger protein 198	1331					regulation of transcription, DNA-dependent|transcription, DNA-dependent	PML body	ubiquitin conjugating enzyme binding|zinc ion binding			lung(3)|ovary(2)|prostate(1)	6		all_cancers(29;8.65e-21)|all_epithelial(30;1.04e-18)|all_lung(29;6.75e-18)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;0.000148)|Epithelial(112;0.000249)|OV - Ovarian serous cystadenocarcinoma(117;0.00816)|Lung(94;0.0173)|LUSC - Lung squamous cell carcinoma(192;0.0856)		GCAACCAGAATGCTCTAGTTC	0.393													104	230	---	---	---	---	PASS
ZC3H13	23091	broad.mit.edu	37	13	46543242	46543242	+	Missense_Mutation	SNP	G	C	C			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:46543242G>C	uc010tfw.1	-	13	3443	c.3437C>G	c.(3436-3438)ACC>AGC	p.T1146S	ZC3H13_uc001vaq.2_5'Flank|ZC3H13_uc001vas.1_Missense_Mutation_p.T1146S|ZC3H13_uc001vat.1_Missense_Mutation_p.T1146S	NM_015070	NP_055885	Q5T200	ZC3HD_HUMAN	zinc finger CCCH-type containing 13	1146							nucleic acid binding|zinc ion binding			ovary(1)|lung(1)	2		Lung NSC(96;7.26e-05)|Breast(56;0.000118)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;4.18e-05)		ATTATtggtggtattggtggg	0.194													129	204	---	---	---	---	PASS
CLDN10	9071	broad.mit.edu	37	13	96230215	96230215	+	Missense_Mutation	SNP	G	C	C			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:96230215G>C	uc001vmh.2	+	5	695	c.634G>C	c.(634-636)GAT>CAT	p.D212H	CLDN10_uc001vmg.2_Missense_Mutation_p.D210H|CLDN10_uc010tii.1_Missense_Mutation_p.D191H|DZIP1_uc010afn.2_Intron	NM_006984	NP_008915	P78369	CLD10_HUMAN	claudin 10 isoform b	212	Cytoplasmic (Potential).				calcium-independent cell-cell adhesion	integral to membrane|tight junction	identical protein binding|structural molecule activity			ovary(1)	1	all_neural(89;0.0878)|Breast(111;0.148)|Medulloblastoma(90;0.163)		BRCA - Breast invasive adenocarcinoma(86;0.18)			TGGTGGAGAAGATTTTAAAAC	0.378													167	299	---	---	---	---	PASS
OR6S1	341799	broad.mit.edu	37	14	21109008	21109008	+	Silent	SNP	C	T	T			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21109008C>T	uc001vxv.1	-	1	843	c.843G>A	c.(841-843)ACG>ACA	p.T281T		NM_001001968	NP_001001968	Q8NH40	OR6S1_HUMAN	olfactory receptor, family 6, subfamily S,	281	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2	all_cancers(95;0.00304)		Epithelial(56;1.23e-06)|all cancers(55;1.01e-05)	GBM - Glioblastoma multiforme(265;0.0135)		TCACAAATGTCGTTATTACTG	0.463													11	153	---	---	---	---	PASS
FLJ10357	55701	broad.mit.edu	37	14	21543858	21543858	+	Missense_Mutation	SNP	C	T	T			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21543858C>T	uc001vzp.2	+	5	1702	c.1673C>T	c.(1672-1674)CCT>CTT	p.P558L	FLJ10357_uc001vzo.1_Intron|FLJ10357_uc010aij.2_RNA|FLJ10357_uc010tln.1_5'UTR	NM_018071	NP_060541	Q8TER5	ARH40_HUMAN	hypothetical protein LOC55701	558					regulation of Rho protein signal transduction	cytoplasm	Rho guanyl-nucleotide exchange factor activity				0	all_cancers(95;0.00185)		OV - Ovarian serous cystadenocarcinoma(11;5.79e-11)|Epithelial(56;8.35e-09)|all cancers(55;4.23e-08)	GBM - Glioblastoma multiforme(265;0.0197)		CCGTGCCCTCCTGAGGAGCCC	0.612													3	48	---	---	---	---	PASS
SDR39U1	56948	broad.mit.edu	37	14	24911166	24911166	+	Intron	SNP	T	G	G			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24911166T>G	uc001wpm.2	-						SDR39U1_uc001wpi.2_Intron|SDR39U1_uc001wpj.2_Intron|SDR39U1_uc001wpk.2_Intron|SDR39U1_uc001wpl.2_5'UTR|SDR39U1_uc001wpn.2_Intron|uc001wpo.1_5'Flank	NM_020195	NP_064580	Q9NRG7	D39U1_HUMAN	short chain dehydrogenase/reductase family 39U,								binding			pancreas(1)	1						GGGCATTCATTTCCTGGGCAT	0.488													10	5	---	---	---	---	PASS
TMEM85	51234	broad.mit.edu	37	15	34522008	34522008	+	3'UTR	SNP	T	C	C			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:34522008T>C	uc001zhq.2	+	5					TMEM85_uc001zhr.2_RNA|TMEM85_uc001zhs.2_Missense_Mutation_p.L137P|TMEM85_uc010bat.2_Silent_p.P47P	NM_016454	NP_057538	Q5J8M3	TMM85_HUMAN	transmembrane protein 85						apoptosis	integral to membrane					0		all_lung(180;1.15e-06)		all cancers(64;1.03e-17)|GBM - Glioblastoma multiforme(113;3.33e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0244)|Lung(196;0.217)		AAGCAGCGCCTGGTCCCTATG	0.398													187	378	---	---	---	---	PASS
VPS13C	54832	broad.mit.edu	37	15	62214721	62214721	+	Missense_Mutation	SNP	G	C	C			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:62214721G>C	uc002agz.2	-	54	6924	c.6850C>G	c.(6850-6852)CAA>GAA	p.Q2284E	VPS13C_uc002aha.2_Missense_Mutation_p.Q2241E|VPS13C_uc002ahb.1_Missense_Mutation_p.Q2284E|VPS13C_uc002ahc.1_Missense_Mutation_p.Q2241E	NM_020821	NP_065872	Q709C8	VP13C_HUMAN	vacuolar protein sorting 13C protein isoform 2A	2284					protein localization					ovary(2)	2						AAGGTAACTTGAATGGATTCT	0.378													133	241	---	---	---	---	PASS
C15orf26	161502	broad.mit.edu	37	15	81428896	81428896	+	Missense_Mutation	SNP	G	T	T			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:81428896G>T	uc002bgb.2	+	3	226	c.199G>T	c.(199-201)GGT>TGT	p.G67C	C15orf26_uc010blp.1_Missense_Mutation_p.G42C	NM_173528	NP_775799	Q6P656	CO026_HUMAN	hypothetical protein LOC161502	67											0						TATTCATTACGGTGACAAAGT	0.408													6	266	---	---	---	---	PASS
SLCO3A1	28232	broad.mit.edu	37	15	92669422	92669422	+	Missense_Mutation	SNP	G	A	A			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:92669422G>A	uc002bqx.2	+	6	1507	c.1306G>A	c.(1306-1308)GTC>ATC	p.V436I	SLCO3A1_uc002bqy.2_Missense_Mutation_p.V436I|SLCO3A1_uc010boc.1_RNA|SLCO3A1_uc002bqz.1_Missense_Mutation_p.V378I	NM_013272	NP_037404	Q9UIG8	SO3A1_HUMAN	solute carrier organic anion transporter family,	436	Helical; Name=9; (Potential).				sodium-independent organic anion transport	integral to membrane|plasma membrane	sodium-independent organic anion transmembrane transporter activity			skin(1)	1	Lung NSC(78;0.0158)|all_lung(78;0.0255)		BRCA - Breast invasive adenocarcinoma(143;0.0841)			TGCTTGCTACGTCTCCTTCCT	0.587													44	62	---	---	---	---	PASS
ZMYND15	84225	broad.mit.edu	37	17	4647403	4647403	+	Intron	SNP	G	T	T			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4647403G>T	uc002fyt.2	+						ZMYND15_uc002fyv.2_Splice_Site_p.F499_splice|ZMYND15_uc002fyu.2_Splice_Site_p.F499_splice	NM_032265	NP_115641	Q9H091	ZMY15_HUMAN	zinc finger, MYND-type containing 15 isoform 2								zinc ion binding				0						CCCCAGTCCTGTAAGGAGAGC	0.597													41	54	---	---	---	---	PASS
TP53	7157	broad.mit.edu	37	17	7577124	7577124	+	Missense_Mutation	SNP	C	T	T	rs121912657		TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7577124C>T	uc002gim.2	-	8	1008	c.814G>A	c.(814-816)GTG>ATG	p.V272M	TP53_uc002gig.1_Intron|TP53_uc002gih.2_Missense_Mutation_p.V272M|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.V140M|TP53_uc010cng.1_Missense_Mutation_p.V140M|TP53_uc002gii.1_Missense_Mutation_p.V140M|TP53_uc010cnh.1_Missense_Mutation_p.V272M|TP53_uc010cni.1_Missense_Mutation_p.V272M|TP53_uc002gij.2_Missense_Mutation_p.V272M	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	272	|Interaction with E4F1.|Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		V -> M (in sporadic cancers; somatic mutation).|V -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation).|V -> A (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).|V -> G (in sporadic cancers; somatic mutation).|V -> E (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.V272M(67)|p.V272L(24)|p.V272E(8)|p.0?(7)|p.V272A(7)|p.V272G(4)|p.V272fs*73(4)|p.V272V(3)|p.?(2)|p.F270fs*72(1)|p.E271fs*73(1)|p.V272fs*34(1)|p.L265_K305del41(1)|p.S269fs*21(1)|p.E258fs*71(1)|p.G266_E271delGRNSFE(1)|p.V272fs*74(1)|p.F270_D281del12(1)|p.E271_R273delEVR(1)|p.V272_K292del21(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		CAAACACGCACCTCAAAGCTG	0.527		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			44	59	---	---	---	---	PASS
TMEM98	26022	broad.mit.edu	37	17	31260288	31260288	+	Silent	SNP	C	A	A			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:31260288C>A	uc002hhq.2	+	4	686	c.228C>A	c.(226-228)GCC>GCA	p.A76A	TMEM98_uc002hhr.2_Silent_p.A76A	NM_015544	NP_056359	Q9Y2Y6	TMM98_HUMAN	transmembrane protein 98	76						endoplasmic reticulum|integral to membrane					0		Ovarian(249;0.182)|Breast(31;0.244)	BRCA - Breast invasive adenocarcinoma(9;0.0769)			ACATTGAGGCCATTCTGGAGA	0.532													65	109	---	---	---	---	PASS
ENOSF1	55556	broad.mit.edu	37	18	674266	674266	+	3'UTR	SNP	T	G	G			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:674266T>G	uc002kku.3	-	16					ENOSF1_uc002kkt.3_3'UTR|ENOSF1_uc010dke.2_RNA|ENOSF1_uc010dkf.2_3'UTR|ENOSF1_uc002kkv.3_3'UTR|ENOSF1_uc002kkw.3_3'UTR|ENOSF1_uc002kkx.3_3'UTR	NM_017512	NP_059982	Q7L5Y1	ENOF1_HUMAN	enolase superfamily 1 isoform rTS beta						cellular amino acid catabolic process	mitochondrion	isomerase activity|metal ion binding			ovary(1)	1						TTTTAAGCCCTTTCACTTCAG	0.373													93	161	---	---	---	---	PASS
PSG6	5675	broad.mit.edu	37	19	43407789	43407789	+	3'UTR	SNP	C	G	G			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43407789C>G	uc002ovj.1	-	6					PSG3_uc002ouf.2_Intron|PSG11_uc002ouw.2_Intron|PSG7_uc002ous.1_Intron|PSG7_uc002out.1_Intron|PSG10_uc002ouv.1_Intron|PSG6_uc002ovh.1_Intron|PSG6_uc002ovi.2_Intron|PSG6_uc010xwk.1_Intron|PSG6_uc002ove.1_Intron|PSG6_uc002ovf.1_Intron|PSG6_uc002ovg.1_Intron	NM_002782	NP_002773	Q00889	PSG6_HUMAN	pregnancy specific beta-1-glycoprotein 6 isoform						female pregnancy	extracellular region				ovary(1)|skin(1)	2		Prostate(69;0.00899)				atgttttaatcctagcacttt	0.000													53	86	---	---	---	---	PASS
PSG6	5675	broad.mit.edu	37	19	43407790	43407790	+	3'UTR	SNP	C	T	T			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43407790C>T	uc002ovj.1	-	6					PSG3_uc002ouf.2_Intron|PSG11_uc002ouw.2_Intron|PSG7_uc002ous.1_Intron|PSG7_uc002out.1_Intron|PSG10_uc002ouv.1_Intron|PSG6_uc002ovh.1_Intron|PSG6_uc002ovi.2_Intron|PSG6_uc010xwk.1_Intron|PSG6_uc002ove.1_Intron|PSG6_uc002ovf.1_Intron|PSG6_uc002ovg.1_Intron	NM_002782	NP_002773	Q00889	PSG6_HUMAN	pregnancy specific beta-1-glycoprotein 6 isoform						female pregnancy	extracellular region				ovary(1)|skin(1)	2		Prostate(69;0.00899)				tgttttaatcctagcactttg	0.000													53	83	---	---	---	---	PASS
LMTK3	114783	broad.mit.edu	37	19	48988934	48988934	+	3'UTR	SNP	C	T	T			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48988934C>T	uc002pjk.2	-	16						NM_001080434	NP_001073903			lemur tyrosine kinase 3											lung(5)|central_nervous_system(1)	6		all_lung(116;0.000147)|Lung NSC(112;0.000251)|all_epithelial(76;0.000326)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000114)|all cancers(93;0.000141)|Epithelial(262;0.00854)|GBM - Glioblastoma multiforme(486;0.0231)		TCCCCAGAGGCGGCGTCTGCG	0.562													3	8	---	---	---	---	PASS
FGF21	26291	broad.mit.edu	37	19	49260211	49260211	+	Silent	SNP	G	A	A			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49260211G>A	uc002pkn.1	+	3	836	c.264G>A	c.(262-264)CCG>CCA	p.P88P	FUT1_uc002pkk.2_5'Flank|FUT1_uc002pkm.1_5'Flank|FGF21_uc002pko.1_Silent_p.P88P	NM_019113	NP_061986	Q9NSA1	FGF21_HUMAN	fibroblast growth factor 21 precursor	88					cell-cell signaling|positive regulation of ERK1 and ERK2 cascade|positive regulation of glucose import	extracellular region|soluble fraction	growth factor activity			breast(1)	1		all_lung(116;1.7e-06)|all_epithelial(76;3.52e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000134)|all cancers(93;0.000348)|Epithelial(262;0.019)|GBM - Glioblastoma multiforme(486;0.022)		CCTTGAAGCCGGGAGTTATTC	0.582													6	85	---	---	---	---	PASS
ZNF677	342926	broad.mit.edu	37	19	53740523	53740523	+	Missense_Mutation	SNP	G	T	T			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53740523G>T	uc002qbf.1	-	5	1642	c.1457C>A	c.(1456-1458)CCT>CAT	p.P486H	ZNF677_uc002qbg.1_Missense_Mutation_p.P486H	NM_182609	NP_872415	Q86XU0	ZN677_HUMAN	zinc finger protein 677	486					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1				GBM - Glioblastoma multiforme(134;0.00352)		ACATTTGTAAGGTTTCTCTCC	0.363													99	172	---	---	---	---	PASS
NLRP7	199713	broad.mit.edu	37	19	55450708	55450708	+	Silent	SNP	G	A	A			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55450708G>A	uc002qih.3	-	4	1555	c.1479C>T	c.(1477-1479)CAC>CAT	p.H493H	NLRP7_uc002qig.3_Silent_p.H493H|NLRP7_uc002qii.3_Silent_p.H493H|NLRP7_uc010esk.2_Silent_p.H493H|NLRP7_uc010esl.2_Silent_p.H521H	NM_206828	NP_996611	Q8WX94	NALP7_HUMAN	NACHT, leucine rich repeat and PYD containing 7	493							ATP binding			large_intestine(1)|breast(1)|central_nervous_system(1)	3				GBM - Glioblastoma multiforme(193;0.0325)		TGTCCCAGGCGTGGCCGTCCC	0.567													8	58	---	---	---	---	PASS
KIAA0406	9675	broad.mit.edu	37	20	36611752	36611752	+	3'UTR	SNP	A	G	G			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:36611752A>G	uc002xhl.2	-	9					KIAA0406_uc002xhm.2_3'UTR	NM_014657	NP_055472	O43156	TTI1_HUMAN	hypothetical protein LOC9675								binding				0		Myeloproliferative disorder(115;0.00874)				TAACTAATTCACCTTCTCTGC	0.507													10	8	---	---	---	---	PASS
BAGE2	85319	broad.mit.edu	37	21	11038844	11038844	+	3'UTR	SNP	G	A	A			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11038844G>A	uc002yit.1	-	6					TPTE_uc002yis.1_RNA	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		TCCAGCAGAGGAACTAAGAGC	0.448													24	338	---	---	---	---	PASS
RRP1B	23076	broad.mit.edu	37	21	45106571	45106571	+	Intron	SNP	A	G	G			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45106571A>G	uc002zdk.2	+						RRP1B_uc002zdl.2_5'UTR	NM_015056	NP_055871	Q14684	RRP1B_HUMAN	ribosomal RNA processing 1 homolog B						rRNA processing	cytosol|nucleolus|preribosome, small subunit precursor	protein binding			skin(1)	1				STAD - Stomach adenocarcinoma(101;0.178)		GGTGGGAGAAACGGTGAGGAA	0.527													4	52	---	---	---	---	PASS
CD24	100133941	broad.mit.edu	37	Y	21154603	21154603	+	5'UTR	SNP	A	C	C	rs79788321		TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:21154603A>C	uc004ftz.1	-	1					TTTY14_uc004fty.2_Intron	NM_013230	NP_037362	P25063	CD24_HUMAN	CD24 antigen precursor						axon guidance|B cell receptor transport into membrane raft|cell activation|cell migration|cell-cell adhesion|chemokine receptor transport out of membrane raft|cholesterol homeostasis|elevation of cytosolic calcium ion concentration|induction of apoptosis by intracellular signals|negative regulation of transforming growth factor-beta3 production|positive regulation of activated T cell proliferation|positive regulation of MAP kinase activity|regulation of cytokine-mediated signaling pathway|regulation of epithelial cell differentiation|regulation of MAPKKK cascade|respiratory burst|response to estrogen stimulus|response to hypoxia|response to molecule of bacterial origin|T cell costimulation|Wnt receptor signaling pathway	anchored to membrane|cell surface|membrane raft|plasma membrane	protein kinase binding|protein tyrosine kinase activator activity|signal transducer activity				0						CATGTCCCCTACGTCGGTGCG	0.662													3	2	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	7830	7830	+	RNA	SNP	G	A	A			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:7830G>A	uc004cou.3	+	1		c.245G>A			uc011mfi.1_5'Flank|uc004cov.3_5'Flank					Homo sapiens mRNA expressed only in placental villi, clone SMAP42.																		CCCATCCCTACGCATCCTTTA	0.488													21	57	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	8104	8104	+	RNA	SNP	T	C	C			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:8104T>C	uc004cou.3	+	1		c.519T>C			uc011mfi.1_5'Flank|uc004cov.3_5'Flank					Homo sapiens mRNA expressed only in placental villi, clone SMAP42.																		TTAAAAACAGATGCAATTCCC	0.463													23	57	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	8995	8995	+	RNA	SNP	G	C	C			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:8995G>C	uc011mfi.1	+	1		c.333G>C			uc004cov.3_5'Flank					Homo sapiens mRNA for OK/SW-CL.16, complete cds.																		CAATAGCCCTGGCCGTACGCC	0.493													17	54	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	9133	9133	+	RNA	SNP	G	A	A			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:9133G>A	uc011mfi.1	+	1		c.471G>A			uc004cov.3_5'Flank					Homo sapiens mRNA for OK/SW-CL.16, complete cds.																		TGACTATCCTAGAAATCGCTG	0.428													30	69	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	9422	9422	+	RNA	SNP	A	C	C			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:9422A>C	uc011mfi.1	+	1		c.760A>C			uc004cov.3_5'Flank|uc004cow.1_5'Flank|uc004cox.3_5'Flank					Homo sapiens mRNA for OK/SW-CL.16, complete cds.																		GGCCACCACACACCACCTGTC	0.453													55	5	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	M	15428	15428	+	3'UTR	SNP	G	A	A			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:15428G>A	uc004coy.2	+	1					uc004coz.1_5'Flank					Homo sapiens clone 35w unknown mRNA; mitochondrial.																		ACACAATCAAAGACGCCCTCG	0.478											OREG0007583	type=REGULATORY REGION|TFbs=ESR1|Dataset=Estrogen Receptor Alpha Binding Sites|EvidenceSubtype=Chromatin immunoprecipitation with tag sequencing (ChIP-TS)	12	71	---	---	---	---	PASS
CASZ1	54897	broad.mit.edu	37	1	10835023	10835024	+	Intron	DEL	AC	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:10835023_10835024delAC	uc001aro.2	-						CASZ1_uc001arp.1_Intron	NM_001079843	NP_001073312	Q86V15	CASZ1_HUMAN	castor homolog 1, zinc finger isoform a						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|zinc ion binding			skin(1)	1	Ovarian(185;0.203)|all_lung(157;0.204)	Lung NSC(185;4.96e-06)|all_lung(284;1.22e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00212)|Hepatocellular(190;0.00913)|Ovarian(437;0.0229)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.0224)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0265)|Colorectal(212;3.54e-08)|COAD - Colon adenocarcinoma(227;9.56e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000219)|Kidney(185;0.00142)|KIRC - Kidney renal clear cell carcinoma(229;0.00381)|READ - Rectum adenocarcinoma(331;0.0419)|STAD - Stomach adenocarcinoma(132;0.0623)		TCTGCATTAAACACACACACAC	0.510													5	3	---	---	---	---	
EPHA2	1969	broad.mit.edu	37	1	16458077	16458077	+	Intron	DEL	A	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16458077delA	uc001aya.1	-							NM_004431	NP_004422	P29317	EPHA2_HUMAN	ephrin receptor EphA2 precursor						activation of Rac GTPase activity|angiogenesis|apoptosis|cell chemotaxis|negative regulation of protein kinase B signaling cascade|positive regulation of establishment of protein localization in plasma membrane|protein kinase B signaling cascade|regulation of blood vessel endothelial cell migration|regulation of cell adhesion mediated by integrin|regulation of lamellipodium assembly|response to growth factor stimulus	focal adhesion|integral to plasma membrane|lamellipodium membrane|ruffle membrane	ATP binding|ephrin receptor activity|protein binding			lung(3)|central_nervous_system(3)|stomach(2)|ovary(2)	10		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0181)|Colorectal(212;3.63e-07)|COAD - Colon adenocarcinoma(227;2.25e-05)|BRCA - Breast invasive adenocarcinoma(304;9.58e-05)|Kidney(64;0.000175)|KIRC - Kidney renal clear cell carcinoma(64;0.00261)|STAD - Stomach adenocarcinoma(313;0.00669)|READ - Rectum adenocarcinoma(331;0.0649)	Dasatinib(DB01254)	ctccgtctccaaaaaaaaaaa	0.199													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	16842311	16842311	+	IGR	DEL	G	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16842311delG								CROCCL2 (23115 upstream) : NBPF1 (48101 downstream)																							caccacggctggggtcgagat	0.095													4	2	---	---	---	---	
KCNQ4	9132	broad.mit.edu	37	1	41259408	41259408	+	Intron	DEL	T	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:41259408delT	uc001cgh.1	+						KCNQ4_uc001cgi.1_Intron	NM_004700	NP_004691	P56696	KCNQ4_HUMAN	potassium voltage-gated channel KQT-like protein						sensory perception of sound	basal plasma membrane|voltage-gated potassium channel complex				central_nervous_system(1)	1	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1.38e-17)			gcttctgtgcttttccttctg	0.204													4	2	---	---	---	---	
SCMH1	22955	broad.mit.edu	37	1	41571550	41571550	+	Intron	DEL	T	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:41571550delT	uc001cgo.2	-						SCMH1_uc010ojr.1_Intron|SCMH1_uc001cgp.2_Intron|SCMH1_uc001cgr.2_Intron|SCMH1_uc001cgs.2_Intron|SCMH1_uc001cgt.2_Intron|SCMH1_uc001cgq.2_Intron|SCMH1_uc010ojs.1_Intron	NM_001031694	NP_001026864	Q96GD3	SCMH1_HUMAN	sex comb on midleg 1 isoform 1						anatomical structure morphogenesis|gene silencing|multicellular organismal development|negative regulation of transcription, DNA-dependent		DNA binding|sequence-specific DNA binding transcription factor activity				0	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)|Breast(333;0.162)	Myeloproliferative disorder(586;0.0393)				catttgatagttttttttttt	0.000													4	2	---	---	---	---	
SPATA6	54558	broad.mit.edu	37	1	48878968	48878968	+	Intron	DEL	T	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:48878968delT	uc001crr.1	-						SPATA6_uc001crs.1_Intron|SPATA6_uc010omv.1_Intron|SPATA6_uc001crt.2_Intron	NM_019073	NP_061946	Q9NWH7	SPAT6_HUMAN	spermatogenesis associated 6 precursor						cell differentiation|multicellular organismal development|spermatogenesis	extracellular region				ovary(1)	1						TGTACACttcttttttttttt	0.129													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	69987900	69987900	+	IGR	DEL	T	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:69987900delT								None (None upstream) : LRRC7 (44968 downstream)																							TCCTGATTTCTTTTCTGTGGT	0.323													4	2	---	---	---	---	
DDAH1	23576	broad.mit.edu	37	1	86000655	86000657	+	Intron	DEL	AAG	-	-	rs66688926		TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:86000655_86000657delAAG	uc001dlc.2	-							NM_001134445	NP_001127917	O94760	DDAH1_HUMAN	dimethylarginine dimethylaminohydrolase 1						arginine catabolic process|citrulline metabolic process|nitric oxide mediated signal transduction		dimethylargininase activity|metal ion binding				0				all cancers(265;0.0318)|Epithelial(280;0.0657)	L-Citrulline(DB00155)	ACCAAAGAAAAAGAAGAAAAGGA	0.389													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	98921347	98921347	+	IGR	DEL	T	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:98921347delT								MIR137 (409620 upstream) : SNX7 (205889 downstream)																							AATCTATTACTTTTTTTTTGT	0.289													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	102516358	102516358	+	IGR	DEL	C	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:102516358delC								OLFM3 (53568 upstream) : COL11A1 (825666 downstream)																							ccttgaatgacggagacagaa	0.000													4	2	---	---	---	---	
TRIM33	51592	broad.mit.edu	37	1	115012329	115012329	+	Intron	DEL	G	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:115012329delG	uc001eew.2	-						TRIM33_uc001eex.2_Intron	NM_015906	NP_056990	Q9UPN9	TRI33_HUMAN	tripartite motif-containing 33 protein isoform						negative regulation of BMP signaling pathway|negative regulation of transcription, DNA-dependent|protein ubiquitination|regulation of transforming growth factor beta receptor signaling pathway|transcription, DNA-dependent	nucleus	co-SMAD binding|DNA binding|ligase activity|R-SMAD binding|zinc ion binding			lung(4)|central_nervous_system(3)|large_intestine(1)|breast(1)|skin(1)|ovary(1)	11	all_epithelial(7;0.000132)|all_lung(7;0.00106)|Lung SC(450;0.184)	all_cancers(81;3.03e-08)|all_epithelial(167;3.24e-08)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		TAGCAATGGAGGTAGCGGCAG	0.368			T	RET	papillary thyroid								4	2	---	---	---	---	
CASQ2	845	broad.mit.edu	37	1	116311366	116311367	+	5'UTR	INS	-	CACACACA	CACACACA	rs146969305	by1000genomes	TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:116311366_116311367insCACACACA	uc001efx.3	-	1					CASQ2_uc010owu.1_5'UTR	NM_001232	NP_001223	O14958	CASQ2_HUMAN	cardiac calsequestrin 2 precursor						heart development|striated muscle contraction	sarcoplasmic reticulum lumen	calcium ion binding			skin(1)	1	Lung SC(450;0.211)	all_cancers(81;1.25e-06)|all_epithelial(167;1.02e-06)|all_lung(203;8.03e-06)|Lung NSC(69;5.01e-05)		Lung(183;0.0171)|Colorectal(144;0.0686)|LUSC - Lung squamous cell carcinoma(189;0.0903)|all cancers(265;0.108)|COAD - Colon adenocarcinoma(174;0.111)|Epithelial(280;0.12)		AAGAGCAGAGGCAcacacacac	0.441													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	118812360	118812360	+	IGR	DEL	C	-	-	rs34359182		TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:118812360delC								SPAG17 (84512 upstream) : TBX15 (613306 downstream)																							TGAAAACACTCCCGTGCTGAT	0.388													7	5	---	---	---	---	
PHGDH	26227	broad.mit.edu	37	1	120267598	120267598	+	Intron	DEL	C	-	-	rs3838425		TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120267598delC	uc001ehz.2	+						PHGDH_uc009whl.2_Intron|PHGDH_uc009whm.2_Intron|PHGDH_uc001eia.2_Intron|PHGDH_uc009whn.2_Intron|PHGDH_uc001eib.2_Intron	NM_006623	NP_006614	O43175	SERA_HUMAN	phosphoglycerate dehydrogenase						brain development|L-serine biosynthetic process		electron carrier activity|NAD binding|phosphoglycerate dehydrogenase activity			ovary(1)	1	all_cancers(5;1.18e-09)|all_epithelial(5;2.16e-10)|Melanoma(3;1.93e-05)|all_neural(166;0.219)	all_lung(203;3.66e-05)|Lung NSC(69;0.000202)|all_epithelial(167;0.0347)		Lung(183;0.0111)|LUSC - Lung squamous cell carcinoma(189;0.0593)	NADH(DB00157)	AGTGTGGGTGCCTATATGTAG	0.552													2	4	---	---	---	---	
NOTCH2	4853	broad.mit.edu	37	1	120495937	120495937	+	Intron	DEL	A	-	-	rs72047996		TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120495937delA	uc001eik.2	-						NOTCH2_uc001eil.2_Intron|NOTCH2_uc001eim.3_Intron	NM_024408	NP_077719	Q04721	NOTC2_HUMAN	notch 2 preproprotein						anti-apoptosis|bone remodeling|cell cycle arrest|cell fate determination|cell growth|hemopoiesis|induction of apoptosis|negative regulation of cell proliferation|nervous system development|Notch receptor processing|Notch signaling pathway|organ morphogenesis|positive regulation of Ras protein signal transduction|regulation of transcription, DNA-dependent|stem cell maintenance|transcription, DNA-dependent	cell surface|cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to plasma membrane|nucleoplasm	calcium ion binding|ligand-regulated transcription factor activity|protein binding|receptor activity			lung(8)|haematopoietic_and_lymphoid_tissue(7)|ovary(4)|central_nervous_system(2)|skin(2)|kidney(2)|breast(1)|prostate(1)	27	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		actctgtgtcaaaaaaaaaaa	0.070			N|F|Mis		marginal zone lymphoma|DLBCL				Alagille_Syndrome				4	3	---	---	---	---	
SEC22B	9554	broad.mit.edu	37	1	145116147	145116148	+	3'UTR	INS	-	A	A	rs138980379		TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145116147_145116148insA	uc001eml.1	+	7					NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron	NM_004892	NP_004883	O75396	SC22B_HUMAN	SEC22 vesicle trafficking protein homolog B						ER to Golgi vesicle-mediated transport|protein transport	endoplasmic reticulum membrane|ER-Golgi intermediate compartment membrane|Golgi membrane|integral to membrane|melanosome	protein binding				0						AGTAGATTGTTATTTCGTTTTT	0.416													5	4	---	---	---	---	
ITGA10	8515	broad.mit.edu	37	1	145540091	145540091	+	Intron	DEL	T	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145540091delT	uc001eoa.2	+						NBPF10_uc001emp.3_Intron|ITGA10_uc010oyv.1_Intron|ITGA10_uc009wiw.2_Intron|ITGA10_uc010oyw.1_Intron	NM_003637	NP_003628	O75578	ITA10_HUMAN	integrin, alpha 10 precursor						cell-matrix adhesion|integrin-mediated signaling pathway	integrin complex	collagen binding|receptor activity			lung(2)|ovary(2)|kidney(2)|large_intestine(1)|skin(1)	8	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					TGACCATTACTTTTTTTTTTC	0.219													5	3	---	---	---	---	
CRTC2	200186	broad.mit.edu	37	1	153929691	153929691	+	Intron	DEL	A	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153929691delA	uc010ped.1	-						CRTC2_uc001fde.3_5'Flank|CRTC2_uc001fdf.3_5'Flank	NM_181715	NP_859066	Q53ET0	CRTC2_HUMAN	CREB regulated transcription coactivator 2						interspecies interaction between organisms|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	protein binding			ovary(2)	2	all_lung(78;3.05e-32)|Lung NSC(65;3.74e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			AAAGGACGAGAAAAAAAAAAA	0.468													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	164406659	164406659	+	IGR	DEL	G	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:164406659delG								None (None upstream) : PBX1 (122143 downstream)																							gtgagttggtggggactcagt	0.000													4	2	---	---	---	---	
PBX1	5087	broad.mit.edu	37	1	164759576	164759576	+	Intron	DEL	A	-	-	rs34062084		TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:164759576delA	uc001gct.2	+						PBX1_uc010pku.1_Intron|PBX1_uc010pkv.1_Intron|PBX1_uc001gcs.2_Intron|PBX1_uc010pkw.1_Intron	NM_002585	NP_002576	P40424	PBX1_HUMAN	pre-B-cell leukemia homeobox 1						negative regulation of sequence-specific DNA binding transcription factor activity|sex differentiation|steroid biosynthetic process	cytoplasm|nucleus	sequence-specific DNA binding transcription factor activity|transcription factor binding		EWSR1/PBX1(3)	soft_tissue(3)|lung(1)|skin(1)	5						ATTTTATTGGAAAAAAAAGTC	0.373			T	TCF3|EWSR1	pre B-ALL|myoepithelioma								4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	166440902	166440903	+	IGR	INS	-	A	A	rs151102656	by1000genomes	TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:166440902_166440903insA								FAM78B (304696 upstream) : FMO9P (132250 downstream)																							ttcccctgcccaaaaaaactgc	0.000													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	194488701	194488701	+	IGR	DEL	T	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:194488701delT								None (None upstream) : None (None downstream)																							AAGAAGAAAGTTTTTTTTTGT	0.199													4	2	---	---	---	---	
MAPKAPK2	9261	broad.mit.edu	37	1	206906626	206906629	+	3'UTR	DEL	TGTG	-	-	rs5780359		TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:206906626_206906629delTGTG	uc001hem.1	+	10					MAPKAPK2_uc001hel.1_3'UTR	NM_032960	NP_116584	P49137	MAPK2_HUMAN	mitogen-activated protein kinase-activated						activation of MAPK activity|hormone biosynthetic process|innate immune response|leukotriene biosynthetic process|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|prostanoid metabolic process|Ras protein signal transduction|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|protein binding|protein serine/threonine kinase activity|signal transducer activity				0	Breast(84;0.183)		BRCA - Breast invasive adenocarcinoma(75;0.211)			Agtgagtgtatgtgtgtgtgtgtg	0.451													2	5	---	---	---	---	
PTPN14	5784	broad.mit.edu	37	1	214581292	214581293	+	Intron	INS	-	C	C			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:214581292_214581293insC	uc001hkk.1	-						PTPN14_uc010pty.1_Intron	NM_005401	NP_005392	Q15678	PTN14_HUMAN	protein tyrosine phosphatase, non-receptor type						lymphangiogenesis	cytoplasm|cytoskeleton	protein tyrosine phosphatase activity|receptor tyrosine kinase binding			breast(2)|ovary(1)|kidney(1)|skin(1)	5				OV - Ovarian serous cystadenocarcinoma(81;0.00181)|all cancers(67;0.00194)|Epithelial(68;0.0157)|GBM - Glioblastoma multiforme(131;0.155)		CTACAGTCAAACCAGCCAGTGG	0.500													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	215044119	215044119	+	IGR	DEL	G	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:215044119delG								CENPF (206207 upstream) : KCNK2 (134766 downstream)																							TGGCCGTATTGGGCACCTGGT	0.468													4	2	---	---	---	---	
RAB3GAP2	25782	broad.mit.edu	37	1	220372511	220372511	+	Intron	DEL	A	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:220372511delA	uc010puk.1	-						RAB3GAP2_uc001hmf.2_Intron|RAB3GAP2_uc001hmg.2_Intron	NM_012414	NP_036546	Q9H2M9	RBGPR_HUMAN	rab3 GTPase-activating protein, non-catalytic						intracellular protein transport	cytoplasm|soluble fraction	GTPase activator activity|protein heterodimerization activity			central_nervous_system(1)	1				GBM - Glioblastoma multiforme(131;0.0443)		GATgatgtagaaaaaaaaagg	0.040													4	3	---	---	---	---	
ABCB10	23456	broad.mit.edu	37	1	229692976	229692984	+	Intron	DEL	CACAGGCCC	-	-	rs112298919		TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:229692976_229692984delCACAGGCCC	uc001htp.3	-							NM_012089	NP_036221	Q9NRK6	ABCBA_HUMAN	ATP-binding cassette, sub-family B, member 10							integral to mitochondrial membrane|mitochondrial inner membrane	ATP binding|oligopeptide-transporting ATPase activity			breast(2)	2	Breast(184;0.143)|Ovarian(103;0.249)	Prostate(94;0.167)				CTGACAACCTCACAGGCCCCACAGGCCCC	0.402													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	232781098	232781098	+	IGR	DEL	T	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:232781098delT								SIPA1L2 (129855 upstream) : KIAA1383 (159540 downstream)																							GGAAATTCTATTTTAGCTTGA	0.338													4	2	---	---	---	---	
ARID4B	51742	broad.mit.edu	37	1	235386685	235386686	+	Intron	DEL	TA	-	-	rs72023021		TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:235386685_235386686delTA	uc001hwq.2	-						ARID4B_uc001hwr.2_Intron|ARID4B_uc001hws.3_Intron|ARID4B_uc001hwt.3_Intron	NM_016374	NP_057458	Q4LE39	ARI4B_HUMAN	AT rich interactive domain 4B isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|protein binding			ovary(2)|lung(1)	3	Ovarian(103;0.0473)|Breast(184;0.23)	all_cancers(173;0.000782)|Prostate(94;0.0132)|all_epithelial(177;0.0808)|Lung SC(1967;0.24)	OV - Ovarian serous cystadenocarcinoma(106;2.86e-05)			tatatacacgtatatatatata	0.129													6	3	---	---	---	---	
LGALS8	3964	broad.mit.edu	37	1	236707683	236707684	+	Intron	INS	-	G	G	rs144465931	by1000genomes	TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236707683_236707684insG	uc001hxz.1	+						LGALS8_uc001hxw.1_Intron|LGALS8_uc001hxy.1_Intron|LGALS8_uc009xgg.1_Intron|LGALS8_uc001hya.1_Intron|LGALS8_uc001hyb.1_Intron|LGALS8_uc001hyc.1_Intron	NM_201543	NP_963837	O00214	LEG8_HUMAN	galectin-8 isoform b							cytoplasm|extracellular space	sugar binding			ovary(1)	1	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;0.0253)|Prostate(94;0.174)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)			CATACTTTCAAGAAGGAAGGAA	0.411													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	2892491	2892492	+	IGR	INS	-	A	A	rs148608753	by1000genomes	TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:2892491_2892492insA								MYT1L (557446 upstream) : TSSC1 (300249 downstream)																							TAAGAGAAGTGAAAAAAAAAAC	0.347													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	4052438	4052439	+	IGR	INS	-	TC	TC	rs148147638	by1000genomes	TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:4052438_4052439insTC								ALLC (302180 upstream) : None (None downstream)																							ttgtgtcttcatctctctctct	0.000													5	3	---	---	---	---	
ROCK2	9475	broad.mit.edu	37	2	11481772	11481773	+	Intron	DEL	TG	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:11481772_11481773delTG	uc002rbd.1	-							NM_004850	NP_004841	O75116	ROCK2_HUMAN	Rho-associated, coiled-coil containing protein						axon guidance|cytokinesis|intracellular signal transduction	cytosol|plasma membrane	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|structural molecule activity			stomach(2)|skin(2)	4	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.137)|OV - Ovarian serous cystadenocarcinoma(76;0.162)		GTGTCGCAGCTGTGTTTGCTTT	0.302													1	5	---	---	---	---	
NBAS	51594	broad.mit.edu	37	2	15480049	15480049	+	Intron	DEL	A	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:15480049delA	uc002rcc.1	-						NBAS_uc010exl.1_Intron|NBAS_uc002rcd.1_Intron	NM_015909	NP_056993	A2RRP1	NBAS_HUMAN	neuroblastoma-amplified protein											ovary(2)|liver(1)|skin(1)	4						ggcaaaaaggaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	16499410	16499411	+	IGR	INS	-	G	G	rs79511412	by1000genomes	TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:16499410_16499411insG								MYCN (412282 upstream) : FAM49A (234490 downstream)																							aggcaaagagagaagggagagt	0.045													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	34333381	34333381	+	IGR	DEL	A	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:34333381delA								MYADML (380097 upstream) : None (None downstream)																							aatttgacataaaaaactgtg	0.080													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	43152516	43152525	+	IGR	DEL	AGAGAGAGAG	-	-	rs10581553		TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:43152516_43152525delAGAGAGAGAG								HAAO (132765 upstream) : ZFP36L2 (297017 downstream)																							CTGAGGACTCagagagagagagagagagag	0.429													4	2	---	---	---	---	
SLC3A1	6519	broad.mit.edu	37	2	44547384	44547385	+	Frame_Shift_Ins	INS	-	A	A			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:44547384_44547385insA	uc002ruc.3	+	10	1742_1743	c.1664_1665insA	c.(1663-1665)TTAfs	p.L555fs	PREPL_uc002ruf.2_3'UTR|PREPL_uc002rug.2_3'UTR|PREPL_uc002ruh.2_3'UTR|PREPL_uc010fax.2_3'UTR|PREPL_uc002rui.3_3'UTR|PREPL_uc002ruj.1_3'UTR|PREPL_uc002ruk.1_3'UTR|SLC3A1_uc002rud.3_Frame_Shift_Ins_p.L277fs|SLC3A1_uc002rue.3_Frame_Shift_Ins_p.L175fs	NM_000341	NP_000332	Q07837	SLC31_HUMAN	solute carrier family 3, member 1	555	Extracellular (Potential).				carbohydrate metabolic process|cellular amino acid metabolic process|ion transport	integral to plasma membrane|membrane fraction	basic amino acid transmembrane transporter activity|catalytic activity|cation binding|L-cystine transmembrane transporter activity				0		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)			L-Cystine(DB00138)	TATCAAGATTTAAGTCTACTTC	0.386													145	73	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	47096418	47096418	+	IGR	DEL	A	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:47096418delA								LOC100134259 (10273 upstream) : MCFD2 (32599 downstream)																							GTCCTCACTGAAGGTCAGAGC	0.443													4	2	---	---	---	---	
NRXN1	9378	broad.mit.edu	37	2	50839749	50839749	+	Intron	DEL	T	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:50839749delT	uc010fbq.2	-						NRXN1_uc002rxb.3_Intron|NRXN1_uc002rxe.3_Intron|NRXN1_uc002rxc.1_Intron	NM_001135659	NP_001129131	P58400	NRX1B_HUMAN	neurexin 1 isoform alpha2 precursor						angiogenesis|neuron cell-cell adhesion|neuronal signal transduction	cell surface|endocytic vesicle|integral to membrane|presynaptic membrane	cell adhesion molecule binding|receptor binding			ovary(2)	2		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			GCTGACTCCCTTACCCCTTCA	0.378													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	56797778	56797779	+	IGR	INS	-	A	A			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:56797778_56797779insA								CCDC85A (184470 upstream) : None (None downstream)																							CAGAAAACCAGAAATCCTGCAG	0.376													4	2	---	---	---	---	
FANCL	55120	broad.mit.edu	37	2	58388456	58388456	+	Intron	DEL	C	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:58388456delC	uc002rzw.3	-						FANCL_uc002rzx.3_Intron|FANCL_uc010fce.2_Intron|FANCL_uc010fcf.1_Intron	NM_018062	NP_060532	Q9NW38	FANCL_HUMAN	Fanconi anemia, complementation group L isoform						DNA repair	cytoplasm|nucleoplasm	ubiquitin-protein ligase activity|zinc ion binding			ovary(2)	2						TTGGATACTTCAGAACATTTC	0.328								Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				6	10	---	---	---	---	
RMND5A	64795	broad.mit.edu	37	2	87423423	87423424	+	Intron	DEL	CT	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:87423423_87423424delCT	uc002srs.3	+						uc002ssh.2_Intron			Q9H871	RMD5A_HUMAN	SubName: Full=cDNA FLJ10361 fis, clone NT2RM2001256, highly similar to Anaphase-promoting complex subunit 1;											ovary(1)|skin(1)	2						tccaaaacacctctctcttcgg	0.069													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	90417010	90417011	+	Intron	INS	-	CGAAA	CGAAA	rs149420300	by1000genomes	TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:90417010_90417011insCGAAA	uc010fhm.2	+											Parts of antibodies, mostly variable regions.																		ACATGTATCACTGaaatgaaat	0.223													4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	91665165	91665166	+	IGR	INS	-	A	A			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91665165_91665166insA								None (None upstream) : LOC654342 (140026 downstream)																							aaaatttcactaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	91729145	91729145	+	IGR	DEL	T	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91729145delT								None (None upstream) : LOC654342 (76047 downstream)																							gaaagacttgttttTTTTTTT	0.124													5	3	---	---	---	---	
RFX8	731220	broad.mit.edu	37	2	102026854	102026855	+	Intron	DEL	CA	-	-	rs5832964		TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:102026854_102026855delCA	uc010yvx.1	-						RFX8_uc002tbb.1_Intron	NM_001145664	NP_001139136	Q6ZV50	RFX8_HUMAN	regulatory factor X, 8						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding				0						tgcccacactcacacacacaca	0.218													4	2	---	---	---	---	
BCL2L11	10018	broad.mit.edu	37	2	111905812	111905813	+	Intron	DEL	CA	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:111905812_111905813delCA	uc002tgv.1	+						BCL2L11_uc002tgu.1_Intron|BCL2L11_uc002tgw.1_Intron|BCL2L11_uc002tgx.1_Intron|BCL2L11_uc010fkd.1_Intron|BCL2L11_uc002tgy.1_Intron|BCL2L11_uc002tgz.1_Intron|BCL2L11_uc010fke.1_Intron|BCL2L11_uc002tha.1_Intron|BCL2L11_uc002thb.1_Intron|BCL2L11_uc002thc.1_Intron|BCL2L11_uc002thd.1_Intron	NM_138621	NP_619527	O43521	B2L11_HUMAN	BCL2-like 11 isoform 1						activation of pro-apoptotic gene products|induction of apoptosis by extracellular signals|induction of apoptosis by intracellular signals|nerve growth factor receptor signaling pathway|positive regulation of protein homooligomerization|positive regulation of release of cytochrome c from mitochondria	cytosol|endomembrane system|mitochondrial outer membrane|plasma membrane	protein binding|protein binding				0						GCTGGACGTTCACTTGTGCATA	0.520													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	120766610	120766610	+	IGR	DEL	G	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:120766610delG								PTPN4 (31573 upstream) : EPB41L5 (4059 downstream)																							gtctgagttagggcaggtagt	0.179													4	2	---	---	---	---	
TFCP2L1	29842	broad.mit.edu	37	2	121989684	121989693	+	Intron	DEL	TTTTGTTTTG	-	-	rs3835787		TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:121989684_121989693delTTTTGTTTTG	uc002tmx.2	-						TFCP2L1_uc010flr.2_Intron|TFCP2L1_uc010flq.2_Intron	NM_014553	NP_055368	Q9NZI6	TF2L1_HUMAN	LBP-9						female pregnancy|steroid biosynthetic process	mitochondrion|nucleolus	DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity			pancreas(2)|ovary(1)	3	Renal(3;0.01)					CTGCCACTCTttttgttttgttttgttttg	0.281													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	132774380	132774380	+	IGR	DEL	T	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:132774380delT								C2orf27B (215146 upstream) : NCRNA00164 (130784 downstream)																							TATACCAAGCTTGTGGGATTC	0.383													2	4	---	---	---	---	
THSD7B	80731	broad.mit.edu	37	2	137872510	137872510	+	Intron	DEL	T	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:137872510delT	uc002tva.1	+						THSD7B_uc010zbj.1_Intron|THSD7B_uc002tvb.2_Intron	NM_001080427	NP_001073896			thrombospondin, type I, domain containing 7B											ovary(4)|central_nervous_system(2)|pancreas(1)	7				BRCA - Breast invasive adenocarcinoma(221;0.19)		CTGCTGGATGTTTTTTTTTTC	0.393													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	164304803	164304804	+	IGR	INS	-	AC	AC			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:164304803_164304804insAC								KCNH7 (609563 upstream) : FIGN (159314 downstream)																							aacatatatgtacacacatata	0.158													4	2	---	---	---	---	
MYO3B	140469	broad.mit.edu	37	2	171259144	171259144	+	Intron	DEL	A	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:171259144delA	uc002ufy.2	+						MYO3B_uc002ufv.2_Intron|MYO3B_uc010fqb.1_Intron|MYO3B_uc002ufz.2_Intron|MYO3B_uc002ufw.2_Intron|MYO3B_uc002ufx.2_Intron|MYO3B_uc002ugb.2_Intron	NM_138995	NP_620482	Q8WXR4	MYO3B_HUMAN	myosin IIIB isoform 2						response to stimulus|visual perception	cytoplasm|myosin complex	actin binding|ATP binding|motor activity|protein serine/threonine kinase activity			lung(8)|ovary(6)|skin(4)|central_nervous_system(1)	19						ctactgcttgaaaaaaaaaag	0.239													3	3	---	---	---	---	
DCAF17	80067	broad.mit.edu	37	2	172300342	172300342	+	Intron	DEL	T	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:172300342delT	uc002ugx.2	+						DCAF17_uc010zdq.1_Intron|DCAF17_uc010fqf.1_Intron|DCAF17_uc010zdr.1_Intron	NM_025000	NP_079276	Q5H9S7	DCA17_HUMAN	DDB1 and CUL4 associated factor 17 isoform 1							CUL4 RING ubiquitin ligase complex|integral to membrane|nucleolus					0						ATTAGATAGATTTTTTTTAGA	0.214													14	15	---	---	---	---	
OLA1	29789	broad.mit.edu	37	2	175058158	175058158	+	Intron	DEL	T	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:175058158delT	uc002uih.2	-						OLA1_uc002uii.2_Intron|OLA1_uc010fqq.2_Intron|OLA1_uc002uij.2_Intron|OLA1_uc002uik.2_Intron|OLA1_uc010fqr.2_Intron	NM_013341	NP_037473	Q9NTK5	OLA1_HUMAN	Obg-like ATPase 1 isoform 1						ATP catabolic process	cytoplasm	ATP binding|GTP binding|hydrolase activity|protein binding			ovary(1)|breast(1)	2						ccctgagtgcttttttttctt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	186761460	186761462	+	IGR	DEL	GAA	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:186761460_186761462delGAA								ZNF804A (957248 upstream) : ZC3H15 (589423 downstream)																							aggaggaggggaagaagaagagg	0.069													4	2	---	---	---	---	
GLS	2744	broad.mit.edu	37	2	191819800	191819800	+	Intron	DEL	T	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:191819800delT	uc002usf.2	+						GLS_uc002ush.2_Intron|GLS_uc010zgi.1_Intron|GLS_uc010zgj.1_Intron	NM_014905	NP_055720	O94925	GLSK_HUMAN	glutaminase precursor						cellular amino acid biosynthetic process|glutamate secretion|glutamine catabolic process|neurotransmitter secretion	mitochondrial matrix	glutaminase activity			ovary(1)|skin(1)	2			OV - Ovarian serous cystadenocarcinoma(117;0.00625)|Epithelial(96;0.0744)|all cancers(119;0.181)		L-Glutamic Acid(DB00142)|L-Glutamine(DB00130)	AACAAAACAATTTTTTTTTTG	0.229													5	3	---	---	---	---	
C2orf80	389073	broad.mit.edu	37	2	209045174	209045174	+	Intron	DEL	A	-	-	rs78022420		TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:209045174delA	uc002vcr.2	-							NM_001099334	NP_001092804	Q0P641	CB080_HUMAN	hypothetical protein LOC389073											skin(1)	1						actctgtctcaaaaaaaaaaa	0.194													4	2	---	---	---	---	
DES	1674	broad.mit.edu	37	2	220286839	220286839	+	Intron	DEL	A	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220286839delA	uc002vll.2	+							NM_001927	NP_001918	P17661	DESM_HUMAN	desmin						cytoskeleton organization|muscle filament sliding|regulation of heart contraction	cytosol|Z disc	protein binding|structural constituent of cytoskeleton			central_nervous_system(2)	2		Renal(207;0.0183)		Epithelial(149;5.25e-07)|all cancers(144;0.000103)|Lung(261;0.00533)|LUSC - Lung squamous cell carcinoma(224;0.008)		AACCAGCAGCAAAAAAAACCA	0.239													4	2	---	---	---	---	
ARMC9	80210	broad.mit.edu	37	2	232143440	232143441	+	Intron	INS	-	TC	TC	rs149202270	by1000genomes	TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:232143440_232143441insTC	uc002vrq.3	+						ARMC9_uc002vrp.3_Intron|ARMC9_uc002vrr.1_Intron	NM_025139	NP_079415	Q7Z3E5	ARMC9_HUMAN	armadillo repeat containing 9								binding			ovary(1)	1		Renal(207;0.0112)|all_lung(227;0.0744)|all_hematologic(139;0.0749)|Acute lymphoblastic leukemia(138;0.167)|Medulloblastoma(418;0.184)|Lung NSC(271;0.205)		Epithelial(121;1.43e-10)|LUSC - Lung squamous cell carcinoma(224;0.017)|Lung(119;0.0189)		GTTTCTCATCATCTAGccccca	0.277													3	3	---	---	---	---	
SH3BP4	23677	broad.mit.edu	37	2	235900847	235900847	+	Intron	DEL	G	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:235900847delG	uc002vvp.2	+						SH3BP4_uc010fym.2_Intron|SH3BP4_uc002vvq.2_Intron	NM_014521	NP_055336	Q9P0V3	SH3B4_HUMAN	SH3-domain binding protein 4						endocytosis	clathrin-coated vesicle|coated pit|nucleus	protein binding			skin(3)|ovary(1)	4		Breast(86;0.000332)|Renal(207;0.00339)|all_lung(227;0.00458)|all_hematologic(139;0.0296)|Lung NSC(271;0.0419)		Epithelial(121;7.66e-20)|BRCA - Breast invasive adenocarcinoma(100;0.000402)|Lung(119;0.00299)|LUSC - Lung squamous cell carcinoma(224;0.00645)|GBM - Glioblastoma multiforme(43;0.237)		GGGGCGAGGTGGCATCTGGAG	0.572													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	4889376	4889376	+	IGR	DEL	T	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:4889376delT								ITPR1 (90 upstream) : BHLHE40 (131721 downstream)																							AGAACAAACATTGGGGAGTAT	0.388													4	2	---	---	---	---	
STT3B	201595	broad.mit.edu	37	3	31658789	31658789	+	Intron	DEL	A	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:31658789delA	uc011axe.1	+						STT3B_uc010hft.1_Intron|STT3B_uc003cer.1_Intron|STT3B_uc003cet.2_Intron	NM_178862	NP_849193	Q8TCJ2	STT3B_HUMAN	source of immunodominant MHC-associated						protein N-linked glycosylation via asparagine	integral to membrane|oligosaccharyltransferase complex	dolichyl-diphosphooligosaccharide-protein glycotransferase activity|protein binding				0						CTATAAAAAGAAAAAAAAAAT	0.353													4	2	---	---	---	---	
UBP1	7342	broad.mit.edu	37	3	33458429	33458430	+	Intron	DEL	AT	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:33458429_33458430delAT	uc003cfq.3	-						UBP1_uc003cfr.3_Intron|UBP1_uc010hga.2_Intron	NM_014517	NP_055332	Q9NZI7	UBIP1_HUMAN	upstream binding protein 1 (LBP-1a) isoform a						negative regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|viral genome replication	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity			kidney(2)	2						TTACACAATGATAGTTTGTTAA	0.312													26	22	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	40803346	40803346	+	IGR	DEL	A	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:40803346delA								ZNF621 (222303 upstream) : CTNNB1 (433055 downstream)																							attttggattaaaaaaaaaaa	0.000													4	2	---	---	---	---	
TLR9	54106	broad.mit.edu	37	3	52264648	52264648	+	Intron	DEL	G	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52264648delG	uc003ddb.2	-						TLR9_uc003ddc.1_5'Flank|TWF2_uc003ddd.2_Intron|TWF2_uc010hmc.2_Intron	NM_017442	NP_059138	Q9NR96	TLR9_HUMAN	toll-like receptor 9 isoform A precursor						defense response to bacterium|fibroblast growth factor receptor signaling pathway|I-kappaB phosphorylation|inflammatory response|innate immune response|insulin receptor signaling pathway|maintenance of gastrointestinal epithelium|negative regulation of interleukin-6 production|negative regulation of interleukin-8 production|negative regulation of NF-kappaB transcription factor activity|negative regulation of toll-like receptor signaling pathway|positive regulation of chemokine production|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interferon-alpha biosynthetic process|positive regulation of interferon-beta biosynthetic process|positive regulation of interferon-beta production|positive regulation of interferon-gamma biosynthetic process|positive regulation of interleukin-10 production|positive regulation of interleukin-12 production|positive regulation of interleukin-18 production|positive regulation of interleukin-6 production|positive regulation of interleukin-8 production|positive regulation of JUN kinase activity|positive regulation of NF-kappaB import into nucleus|positive regulation of NF-kappaB transcription factor activity|positive regulation of nitric-oxide synthase biosynthetic process|positive regulation of toll-like receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tumor necrosis factor production|response to molecule of bacterial origin	apical plasma membrane|basolateral plasma membrane|early phagosome|endoplasmic reticulum membrane|endosome membrane|extracellular region|integral to membrane|lysosome	interleukin-1 receptor binding|siRNA binding|transmembrane receptor activity			large_intestine(2)|skin(2)	4				BRCA - Breast invasive adenocarcinoma(193;2.41e-05)|Kidney(197;0.000537)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)	Chloroquine(DB00608)	TGTATGAGCAGGGCCTGGGGA	0.622													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	98790161	98790161	+	IGR	DEL	A	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:98790161delA								DCBLD2 (169628 upstream) : COL8A1 (567293 downstream)																							ggcctgtgccaaaatacagca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	99256271	99256271	+	IGR	DEL	T	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:99256271delT								DCBLD2 (635738 upstream) : COL8A1 (101183 downstream)																							ATAGCCACGCTTTCCACACAG	0.413													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	107735636	107735638	+	IGR	DEL	CTT	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:107735636_107735638delCTT								LOC285205 (87885 upstream) : CD47 (26303 downstream)																							TCGCTTCCTCCTTCTTCCTGTCA	0.458													4	2	---	---	---	---	
MYH15	22989	broad.mit.edu	37	3	108173172	108173172	+	Intron	DEL	A	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108173172delA	uc003dxa.1	-							NM_014981	NP_055796	Q9Y2K3	MYH15_HUMAN	myosin, heavy polypeptide 15							myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity			ovary(5)|central_nervous_system(2)	7						CTAAAATGTGAAAAAAAAAAC	0.264													9	7	---	---	---	---	
CD96	10225	broad.mit.edu	37	3	111304460	111304461	+	Intron	INS	-	A	A	rs147534937	by1000genomes	TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:111304460_111304461insA	uc003dxw.2	+						CD96_uc003dxv.2_Intron|CD96_uc003dxx.2_Intron|CD96_uc010hpy.1_Intron	NM_198196	NP_937839	P40200	TACT_HUMAN	CD96 antigen isoform 1 precursor						cell adhesion|immune response|regulation of immune response	integral to plasma membrane				skin(2)|central_nervous_system(1)	3						AAATTTCTCAGAAAAAAAAATA	0.361									Opitz_Trigonocephaly_syndrome				3	3	---	---	---	---	
VPS8	23355	broad.mit.edu	37	3	184560716	184560716	+	Intron	DEL	T	-	-	rs68026955		TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184560716delT	uc003fpb.1	+						VPS8_uc010hyd.1_Intron	NM_015303	NP_056118	Q8N3P4	VPS8_HUMAN	vacuolar protein sorting 8 homolog isoform b								zinc ion binding			ovary(1)	1	all_cancers(143;2.51e-11)|Ovarian(172;0.0339)|Breast(254;0.247)		Epithelial(37;1.02e-33)|OV - Ovarian serous cystadenocarcinoma(80;4.81e-22)			AGTTTTCCTCTTTTTTTTTTT	0.269													4	4	---	---	---	---	
SORCS2	57537	broad.mit.edu	37	4	7222170	7222171	+	Intron	DEL	TG	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:7222170_7222171delTG	uc003gkb.3	+							NM_020777	NP_065828	Q96PQ0	SORC2_HUMAN	VPS10 domain receptor protein SORCS 2 precursor							integral to membrane	neuropeptide receptor activity			ovary(1)|central_nervous_system(1)	2						AATGAGTGGATGAAGTCCTGGC	0.515													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	11334556	11334556	+	IGR	DEL	C	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:11334556delC								CLNK (648170 upstream) : MIR572 (35895 downstream)																							ctacccttttccttttgcctc	0.000													4	2	---	---	---	---	
KCNIP4	80333	broad.mit.edu	37	4	21796831	21796831	+	Intron	DEL	T	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:21796831delT	uc003gqi.1	-							NM_147182	NP_671711	Q6PIL6	KCIP4_HUMAN	Kv channel interacting protein 4 isoform 3							plasma membrane	calcium ion binding|potassium channel activity|protein binding|voltage-gated ion channel activity				0		Breast(46;0.134)				ttaggacatgtaagtagacat	0.000													4	2	---	---	---	---	
GPR125	166647	broad.mit.edu	37	4	22422867	22422867	+	Intron	DEL	T	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:22422867delT	uc003gqm.1	-						GPR125_uc010ieo.1_Intron|GPR125_uc003gqn.1_Intron|GPR125_uc003gqo.2_Intron	NM_145290	NP_660333	Q8IWK6	GP125_HUMAN	G protein-coupled receptor 125 precursor						neuropeptide signaling pathway	integral to membrane	G-protein coupled receptor activity			skin(1)	1		Breast(46;0.198)				ACTGGCAGAATAAAAAAAAAA	0.358													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	26839410	26839410	+	IGR	DEL	G	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:26839410delG								TBC1D19 (82495 upstream) : STIM2 (22954 downstream)																							GGGTGAGTCTGGGAAGGATGA	0.493													4	2	---	---	---	---	
ATP8A1	10396	broad.mit.edu	37	4	42448913	42448913	+	Intron	DEL	A	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:42448913delA	uc003gwr.2	-						ATP8A1_uc003gwq.2_Intron|ATP8A1_uc003gws.2_Intron	NM_006095	NP_006086	Q9Y2Q0	AT8A1_HUMAN	ATPase, aminophospholipid transporter (APLT),						ATP biosynthetic process	chromaffin granule membrane|integral to membrane|plasma membrane	aminophospholipid transporter activity|ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|cation-transporting ATPase activity|magnesium ion binding|phospholipid-translocating ATPase activity			skin(2)|central_nervous_system(1)	3					Phosphatidylserine(DB00144)	CCACAAGATTAAAAAAAAAAA	0.358													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	57439183	57439183	+	IGR	DEL	A	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:57439183delA								ARL9 (49125 upstream) : HOPX (74971 downstream)																							ctctatctccaaaaaaaaaaa	0.219													4	3	---	---	---	---	
SEC31A	22872	broad.mit.edu	37	4	83774375	83774375	+	Intron	DEL	C	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:83774375delC	uc003hnf.2	-						SEC31A_uc003hne.2_Intron|SEC31A_uc011ccl.1_Intron|SEC31A_uc003hnl.2_Intron|SEC31A_uc003hng.2_Intron|SEC31A_uc003hnh.2_Intron|SEC31A_uc003hni.2_Intron|SEC31A_uc003hnj.2_Intron|SEC31A_uc011ccm.1_Intron|SEC31A_uc011ccn.1_Intron|SEC31A_uc003hnk.2_Intron|SEC31A_uc003hnm.2_Intron|SEC31A_uc003hnn.1_Intron	NM_001077207	NP_001070675	O94979	SC31A_HUMAN	SEC31 homolog A isoform 1						COPII vesicle coating|post-translational protein modification|protein N-linked glycosylation via asparagine|protein transport|response to calcium ion	COPII vesicle coat|cytosol|endoplasmic reticulum membrane|perinuclear region of cytoplasm	calcium-dependent protein binding		SEC31A/JAK2(4)|SEC31A/ALK(3)	haematopoietic_and_lymphoid_tissue(4)|soft_tissue(3)|breast(1)	8		Hepatocellular(203;0.114)				TATTCCTTTACCCACATTGCT	0.418													4	2	---	---	---	---	
PPP3CA	5530	broad.mit.edu	37	4	102122669	102122669	+	Intron	DEL	A	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:102122669delA	uc011cen.1	-						PPP3CA_uc003hvu.2_Intron|PPP3CA_uc010ilj.2_Intron|PPP3CA_uc003hvt.2_Intron|PPP3CA_uc003hvs.2_Intron|PPP3CA_uc010ilk.2_Intron	NM_000944	NP_000935	Q08209	PP2BA_HUMAN	protein phosphatase 3, catalytic subunit, alpha						protein dephosphorylation	calcineurin complex|cytosol|nucleus	calcium ion binding|calmodulin binding			ovary(1)|skin(1)	2				OV - Ovarian serous cystadenocarcinoma(123;6.79e-08)		TACCATAAGTAAACGCATACA	0.244													4	2	---	---	---	---	
PDE5A	8654	broad.mit.edu	37	4	120450947	120450947	+	Intron	DEL	G	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:120450947delG	uc003idh.2	-						uc003ide.3_Intron|PDE5A_uc003idf.2_Intron|PDE5A_uc003idg.2_Intron|uc003idi.3_Intron	NM_001083	NP_001074	O76074	PDE5A_HUMAN	phosphodiesterase 5A isoform 1						platelet activation|signal transduction	cytosol	3',5'-cyclic-GMP phosphodiesterase activity|cGMP binding|zinc ion binding				0					Dipyridamole(DB00975)|Pentoxifylline(DB00806)|Sildenafil(DB00203)|Tadalafil(DB00820)|Theophylline(DB00277)|Vardenafil(DB00862)	gcTCTATTTTGCAACGAAAGC	0.204													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	121293562	121293563	+	IGR	INS	-	GT	GT	rs72526507	by1000genomes	TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:121293562_121293563insGT								MAD2L1 (305549 upstream) : PRDM5 (322367 downstream)																							GAAAATAACACTTCATTCCTAC	0.312													3	7	---	---	---	---	
ARHGAP10	79658	broad.mit.edu	37	4	148668318	148668318	+	Intron	DEL	C	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:148668318delC	uc003ilf.2	+						ARHGAP10_uc003ile.1_Intron	NM_024605	NP_078881	A1A4S6	RHG10_HUMAN	Rho GTPase activating protein 10						apoptosis|filopodium assembly|regulation of apoptosis|small GTPase mediated signal transduction	cytosol|perinuclear region of cytoplasm|plasma membrane	cytoskeletal adaptor activity|SH3 domain binding			skin(2)|pancreas(1)|lung(1)	4	all_hematologic(180;0.151)	Renal(17;0.0166)		GBM - Glioblastoma multiforme(119;0.0423)		TTTTTTTTTTCCCCCAAAGTA	0.423													4	2	---	---	---	---	
GUCY1A3	2982	broad.mit.edu	37	4	156634339	156634339	+	Frame_Shift_Del	DEL	T	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:156634339delT	uc003iov.2	+	8	1712	c.1176delT	c.(1174-1176)GATfs	p.D392fs	GUCY1A3_uc010iqc.2_Frame_Shift_Del_p.D392fs|GUCY1A3_uc003iow.2_Frame_Shift_Del_p.D392fs|GUCY1A3_uc010iqd.2_Frame_Shift_Del_p.D391fs|GUCY1A3_uc003iox.2_Frame_Shift_Del_p.D392fs|GUCY1A3_uc003ioz.2_Frame_Shift_Del_p.D157fs|GUCY1A3_uc003ioy.2_Frame_Shift_Del_p.D392fs|GUCY1A3_uc010iqe.2_Frame_Shift_Del_p.D157fs|GUCY1A3_uc003ipa.2_Intron|GUCY1A3_uc003ipb.2_Frame_Shift_Del_p.D392fs	NM_000856	NP_000847	Q02108	GCYA3_HUMAN	guanylate cyclase 1, soluble, alpha 3 isoform A	392					blood circulation|intracellular signal transduction|nitric oxide mediated signal transduction|platelet activation	guanylate cyclase complex, soluble	GTP binding|guanylate cyclase activity|heme binding|receptor activity			central_nervous_system(2)|ovary(1)|skin(1)	4	all_hematologic(180;0.24)	Renal(120;0.0854)		COAD - Colon adenocarcinoma(41;0.17)		GATTAGAAGATTTTACAGGAC	0.463													214	92	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	161928372	161928372	+	IGR	DEL	T	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:161928372delT								None (None upstream) : FSTL5 (376679 downstream)																							ATACTGTGGGTTTTTTTTTTG	0.229													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	182720767	182720767	+	IGR	DEL	A	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:182720767delA								None (None upstream) : MGC45800 (339392 downstream)																							TAAGTCATATAAGCACTGAGA	0.348													4	2	---	---	---	---	
SNX25	83891	broad.mit.edu	37	4	186180379	186180379	+	Intron	DEL	T	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:186180379delT	uc003ixh.2	+							NM_031953	NP_114159	Q9H3E2	SNX25_HUMAN	sorting nexin 25						cell communication|protein transport	endosome membrane	phosphatidylinositol binding|signal transducer activity			ovary(2)|breast(2)|pancreas(1)	5		all_lung(41;1.03e-13)|Lung NSC(41;2.5e-13)|Hepatocellular(41;0.00826)|Colorectal(36;0.00886)|Renal(120;0.00988)|Prostate(90;0.0235)|all_hematologic(60;0.0592)|all_neural(102;0.243)		all cancers(43;2.13e-24)|Epithelial(43;6.15e-22)|OV - Ovarian serous cystadenocarcinoma(60;5.6e-11)|BRCA - Breast invasive adenocarcinoma(30;0.00013)|Colorectal(24;0.000165)|GBM - Glioblastoma multiforme(59;0.000357)|COAD - Colon adenocarcinoma(29;0.000887)|STAD - Stomach adenocarcinoma(60;0.00118)|LUSC - Lung squamous cell carcinoma(40;0.0129)|READ - Rectum adenocarcinoma(43;0.228)		TGGTAGAGTATTTTTTTTTTT	0.289													7	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	4114491	4114491	+	IGR	DEL	T	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:4114491delT								IRX1 (512975 upstream) : LOC340094 (919981 downstream)																							ATTCTATCCATTTTTTTTTTA	0.284													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	4650122	4650122	+	IGR	DEL	A	-	-	rs67435142		TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:4650122delA								None (None upstream) : LOC340094 (384350 downstream)																							AGAAAATGGGAAAAAAAAAAG	0.458													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	8102590	8102590	+	IGR	DEL	T	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:8102590delT								MTRR (201357 upstream) : SEMA5A (932548 downstream)																							cttttaagacttttttttttc	0.000													4	2	---	---	---	---	
FAM134B	54463	broad.mit.edu	37	5	16551410	16551410	+	Intron	DEL	A	-	-	rs11307693		TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:16551410delA	uc003jfs.2	-							NM_001034850	NP_001030022	Q9H6L5	F134B_HUMAN	hypothetical protein LOC54463 isoform 1						sensory perception of pain	cis-Golgi network|endoplasmic reticulum|integral to membrane				ovary(2)|breast(1)	3						ACATATAAACAAAAAAACATG	0.428													0	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	17813045	17813045	+	Intron	DEL	G	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:17813045delG	uc003jgb.2	+											Homo sapiens cDNA clone IMAGE:5201079.																		TCTCTGGAGTGGGTTTTTACT	0.398													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	18947004	18947008	+	IGR	DEL	GAGTC	-	-	rs139579492		TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:18947004_18947008delGAGTC								None (None upstream) : CDH18 (526149 downstream)																							CACTGTCCAGGAGTCGAGTCTGGAG	0.254													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	42908528	42908528	+	IGR	DEL	T	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:42908528delT								SEPP1 (82530 upstream) : C5orf39 (130655 downstream)																							GTCAAAATAGTTTTTTTTCTG	0.403													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	71375368	71375368	+	IGR	DEL	A	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:71375368delA								CARTPT (358496 upstream) : MAP1B (27750 downstream)																							GGGTGGGGGGAGCCCAGGGCT	0.607													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	72815631	72815632	+	IGR	INS	-	CTGC	CTGC	rs140390945	by1000genomes	TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:72815631_72815632insCTGC								BTF3 (14183 upstream) : ANKRA2 (32531 downstream)																							GAAGGCTTGTACTGCCTCTCCT	0.342											OREG0016657	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	6	---	---	---	---	
FAM169A	26049	broad.mit.edu	37	5	74092246	74092247	+	Intron	DEL	TC	-	-	rs76402838		TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:74092246_74092247delTC	uc003kdm.2	-						FAM169A_uc010izm.2_Intron|FAM169A_uc003kdl.2_Intron	NM_015566	NP_056381	Q9Y6X4	F169A_HUMAN	hypothetical protein LOC26049												0						tttttttttttccgagataaag	0.134													5	4	---	---	---	---	
ATG10	83734	broad.mit.edu	37	5	81504525	81504526	+	Intron	INS	-	GA	GA			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:81504525_81504526insGA	uc003khs.2	+						ATG10_uc003khr.2_Intron|ATG10_uc010jas.2_Intron	NM_001131028	NP_001124500	Q9H0Y0	ATG10_HUMAN	APG10 autophagy 10-like						autophagy in response to ER overload|positive regulation of protein modification process|protein lipidation|protein modification by small protein conjugation|protein transport	cytoplasm	Atg12 ligase activity|protein binding				0		Lung NSC(167;0.0258)|all_lung(232;0.0294)|Ovarian(174;0.135)		OV - Ovarian serous cystadenocarcinoma(54;9.94e-41)|Epithelial(54;6.3e-36)|all cancers(79;2.31e-30)		tattcctagttgagtcagtgtg	0.000													4	2	---	---	---	---	
ARSK	153642	broad.mit.edu	37	5	94926065	94926065	+	Intron	DEL	C	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:94926065delC	uc003kld.2	+						ARSK_uc010jbg.2_Intron|ARSK_uc011cum.1_Intron	NM_198150	NP_937793	Q6UWY0	ARSK_HUMAN	arylsulfatase K precursor							extracellular region	arylsulfatase activity|metal ion binding			pancreas(1)	1		all_cancers(142;3.38e-06)|all_epithelial(76;6.57e-09)|all_lung(232;0.00307)|Lung NSC(167;0.00452)|Ovarian(225;0.00473)		all cancers(79;6.5e-16)		gccgagggtgctgagtgtgga	0.149													4	2	---	---	---	---	
PAM	5066	broad.mit.edu	37	5	102342897	102342898	+	Intron	DEL	AC	-	-	rs34471961		TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:102342897_102342898delAC	uc003knw.2	+						PAM_uc003kns.2_Intron|PAM_uc003knt.2_Intron|PAM_uc003knu.2_Intron|PAM_uc003knv.2_Intron|PAM_uc011cuz.1_Intron|PAM_uc003knz.2_5'Flank	NM_000919	NP_000910	P19021	AMD_HUMAN	peptidylglycine alpha-amidating monooxygenase						peptide metabolic process|protein modification process	extracellular region|integral to membrane|stored secretory granule	L-ascorbic acid binding|peptidylamidoglycolate lyase activity|peptidylglycine monooxygenase activity|protein binding				0		all_cancers(142;3.12e-07)|all_epithelial(76;3.48e-10)|Prostate(80;0.00914)|Lung NSC(167;0.0213)|Ovarian(225;0.024)|Colorectal(57;0.0251)|all_lung(232;0.0284)		Epithelial(69;1.1e-13)|COAD - Colon adenocarcinoma(37;0.0127)	Vitamin C(DB00126)	acatatacatacacacacacac	0.277													6	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	106209294	106209295	+	IGR	DEL	CT	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:106209294_106209295delCT								None (None upstream) : EFNA5 (503296 downstream)																							atggcttttactctctctctct	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	115735297	115735297	+	IGR	DEL	A	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:115735297delA								COMMD10 (106319 upstream) : SEMA6A (43955 downstream)																							CCCTTTTTGGAAGCTCCTCTT	0.468													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	122621590	122621591	+	IGR	DEL	TC	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:122621590_122621591delTC								PRDM6 (97846 upstream) : CEP120 (58989 downstream)																							ACCAGCCATTTCTCTCTCTCTG	0.505													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	134921903	134921903	+	IGR	DEL	G	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:134921903delG								CXCL14 (6934 upstream) : LOC340074 (62471 downstream)																							GGAGGAGGGTGGGGGGACGCT	0.388													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	158667690	158667690	+	IGR	DEL	T	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:158667690delT								RNF145 (30629 upstream) : UBLCP1 (22399 downstream)																							tacaggatgattggagggtaa	0.169													4	2	---	---	---	---	
WWC1	23286	broad.mit.edu	37	5	167856944	167856944	+	Intron	DEL	A	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:167856944delA	uc003lzu.2	+						WWC1_uc003lzv.2_Intron|WWC1_uc011den.1_Intron|WWC1_uc003lzw.2_Intron|WWC1_uc010jjf.1_5'Flank	NM_015238	NP_056053	Q8IX03	KIBRA_HUMAN	WW and C2 domain containing 1 isoform 3						cell migration|positive regulation of MAPKKK cascade|regulation of hippo signaling cascade|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus|perinuclear region of cytoplasm|ruffle membrane	protein binding|transcription coactivator activity			ovary(2)|skin(2)|breast(1)	5	Renal(175;0.000212)|Lung NSC(126;0.0875)|all_lung(126;0.166)	Medulloblastoma(196;0.0399)|all_neural(177;0.0577)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0364)|Epithelial(171;0.0765)|OV - Ovarian serous cystadenocarcinoma(192;0.0918)		gtttcaaaacaaaaaaaaaat	0.139													4	3	---	---	---	---	
BNIP1	662	broad.mit.edu	37	5	172587243	172587243	+	Intron	DEL	T	-	-	rs10693152		TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:172587243delT	uc003mcj.3	+						BNIP1_uc003mci.3_Intron|BNIP1_uc003mck.3_Intron|BNIP1_uc003mcl.3_Intron	NM_001205	NP_001196	Q12981	SEC20_HUMAN	BCL2/adenovirus E1B 19kD interacting protein 1						anti-apoptosis|apoptosis|endoplasmic reticulum membrane fusion|endoplasmic reticulum organization|induction of apoptosis|vesicle-mediated transport	integral to endoplasmic reticulum membrane|nuclear envelope|SNARE complex	protein binding			ovary(1)	1	Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)			CCTAtttctcttttttttttt	0.244													5	4	---	---	---	---	
C5orf45	51149	broad.mit.edu	37	5	179287622	179287623	+	5'Flank	INS	-	TA	TA	rs140708301	by1000genomes	TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179287622_179287623insTA	uc003mky.2	-						C5orf45_uc011dgt.1_5'Flank|C5orf45_uc011dgu.1_5'Flank|C5orf45_uc003mla.2_5'Flank|C5orf45_uc003mlc.2_5'Flank|C5orf45_uc003mlb.2_5'Flank|uc003mle.2_Frame_Shift_Ins_p.V105fs			Q6NTE8	CE045_HUMAN	RecName: Full=UPF0544 protein C5orf45;												0						ctcccttgctgtagcaagctct	0.094													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	6874879	6874880	+	IGR	DEL	CT	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:6874879_6874880delCT								LY86 (219663 upstream) : RREB1 (233308 downstream)																							ttgaagcttcctctctctccct	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	12516310	12516312	+	IGR	DEL	GAA	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:12516310_12516312delGAA								EDN1 (218884 upstream) : PHACTR1 (200576 downstream)																							tgggataggtgaagaagaagaaa	0.310													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	12516350	12516351	+	IGR	DEL	AA	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:12516350_12516351delAA								EDN1 (218924 upstream) : PHACTR1 (200537 downstream)																							ATGGTTTTCTAAAAAGTGGAAG	0.317													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	20294428	20294429	+	IGR	INS	-	TT	TT	rs3057512		TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:20294428_20294429insTT								MBOAT1 (81758 upstream) : E2F3 (107708 downstream)																							AAATTCTAGTCTTTTTTTTTTT	0.351													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	35759074	35759075	+	IGR	INS	-	A	A			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:35759074_35759075insA								C6orf127 (3234 upstream) : CLPS (3685 downstream)																							tgtttaagttgaaaatatcgta	0.094													4	2	---	---	---	---	
DAAM2	23500	broad.mit.edu	37	6	39829272	39829272	+	Intron	DEL	G	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:39829272delG	uc003oow.2	+						DAAM2_uc010jxc.2_Intron|DAAM2_uc003oox.2_Intron	NM_015345	NP_056160	Q86T65	DAAM2_HUMAN	dishevelled associated activator of						actin cytoskeleton organization		actin binding|Rho GTPase binding			ovary(2)|skin(1)	3	Ovarian(28;0.0355)|Colorectal(47;0.196)					CTCATTAAAAGATGCTGTTAG	0.512													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	52117117	52117118	+	IGR	INS	-	A	A	rs138873188	by1000genomes	TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:52117117_52117118insA								IL17F (7819 upstream) : MCM3 (11694 downstream)																							AAAGTGCTACCAAAAAAAAAAT	0.282													4	2	---	---	---	---	
BAI3	577	broad.mit.edu	37	6	69665690	69665690	+	Intron	DEL	A	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:69665690delA	uc003pev.3	+						BAI3_uc010kak.2_Intron	NM_001704	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3						negative regulation of angiogenesis|neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			lung(27)|ovary(8)|skin(6)|pancreas(4)|central_nervous_system(3)|urinary_tract(1)|breast(1)	50		all_lung(197;0.212)				tctccaaatgaaaaaaaaaaa	0.129													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	98976959	98976959	+	IGR	DEL	T	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:98976959delT								MIR2113 (504462 upstream) : POU3F2 (305621 downstream)																							AGAAAGAGTGTAGAGACGGGG	0.468													4	2	---	---	---	---	
ASCC3	10973	broad.mit.edu	37	6	101315536	101315536	+	Intron	DEL	A	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:101315536delA	uc003pqk.2	-						ASCC3_uc011eai.1_Intron|ASCC3_uc003pql.2_Intron|ASCC3_uc010kcv.2_Intron|ASCC3_uc003pqm.2_Intron	NM_006828	NP_006819	Q8N3C0	HELC1_HUMAN	activating signal cointegrator 1 complex subunit						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|microtubule cytoskeleton	ATP binding|ATP-dependent helicase activity|nucleic acid binding			ovary(5)|skin(1)	6		all_cancers(76;1.45e-07)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(87;0.00149)|Hepatocellular(1;0.0893)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0539)|all cancers(137;0.103)|GBM - Glioblastoma multiforme(226;0.199)		GGAGCTGAACAAAAAAAAAAT	0.318													4	3	---	---	---	---	
CDC40	51362	broad.mit.edu	37	6	110534599	110534599	+	Intron	DEL	T	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:110534599delT	uc003pua.2	+							NM_015891	NP_056975	O60508	PRP17_HUMAN	cell division cycle 40 homolog						mRNA 3'-end processing|mRNA export from nucleus|termination of RNA polymerase II transcription	catalytic step 2 spliceosome|nucleoplasm					0		all_cancers(87;6.23e-06)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.00159)|Colorectal(196;0.0488)		Epithelial(106;0.0221)|all cancers(137;0.0314)|OV - Ovarian serous cystadenocarcinoma(136;0.034)		tgtttttttgttttttttttt	0.154													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	116760594	116760594	+	IGR	DEL	T	-	-	rs148943061		TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:116760594delT								DSE (1154 upstream) : FAM26F (21962 downstream)																							AAATTATGTGTTTTTTTTTTT	0.279													3	4	---	---	---	---	
RFX6	222546	broad.mit.edu	37	6	117239530	117239530	+	Intron	DEL	G	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:117239530delG	uc003pxm.2	+							NM_173560	NP_775831	Q8HWS3	RFX6_HUMAN	regulatory factor X, 6						glucose homeostasis|pancreatic A cell differentiation|pancreatic D cell differentiation|pancreatic E cell differentiation|positive regulation of transcription, DNA-dependent|regulation of insulin secretion|transcription, DNA-dependent|type B pancreatic cell differentiation	nucleus	protein binding|transcription regulatory region DNA binding			ovary(1)|pancreas(1)|skin(1)	3						GAAACTAGCTGGAGTATGATA	0.269													4	2	---	---	---	---	
DCBLD1	285761	broad.mit.edu	37	6	117856267	117856267	+	Intron	DEL	G	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:117856267delG	uc003pxs.2	+						GOPC_uc003pxq.1_Intron|DCBLD1_uc003pxr.1_Intron	NM_173674	NP_775945	Q8N8Z6	DCBD1_HUMAN	discoidin, CUB and LCCL domain containing 1						cell adhesion	integral to membrane				ovary(1)	1		all_cancers(87;0.171)		GBM - Glioblastoma multiforme(226;0.0447)|OV - Ovarian serous cystadenocarcinoma(136;0.0921)|all cancers(137;0.125)		TGCGGTCATTGAACTTATGTT	0.423													4	2	---	---	---	---	
VTA1	51534	broad.mit.edu	37	6	142510897	142510897	+	Intron	DEL	T	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:142510897delT	uc003qiw.2	+						VTA1_uc011edt.1_Intron|VTA1_uc011edu.1_Intron	NM_016485	NP_057569	Q9NP79	VTA1_HUMAN	Vps20-associated 1 homolog						cellular membrane organization|endosome transport|protein transport	cytosol|endosome membrane	protein binding				0	Breast(32;0.155)			OV - Ovarian serous cystadenocarcinoma(155;1.34e-05)|GBM - Glioblastoma multiforme(68;0.00182)		TGTCTCCTGCttttttttttt	0.179													8	4	---	---	---	---	
LPA	4018	broad.mit.edu	37	6	160958644	160958644	+	Intron	DEL	A	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:160958644delA	uc003qtl.2	-							NM_005577	NP_005568	P08519	APOA_HUMAN	lipoprotein Lp(a) precursor						blood circulation|lipid metabolic process|lipid transport|lipoprotein metabolic process|proteolysis|receptor-mediated endocytosis	plasma lipoprotein particle	apolipoprotein binding|endopeptidase inhibitor activity|fibronectin binding|heparin binding|serine-type endopeptidase activity			ovary(3)|skin(2)|pancreas(1)	6		Breast(66;0.000496)|Ovarian(120;0.0303)|Prostate(117;0.0965)		OV - Ovarian serous cystadenocarcinoma(65;2.5e-17)|BRCA - Breast invasive adenocarcinoma(81;6.48e-06)	Aminocaproic Acid(DB00513)	CAATCATTACAAAAAAAATTA	0.368													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	161195336	161195336	+	IGR	DEL	A	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:161195336delA								PLG (20991 upstream) : MAP3K4 (217486 downstream)																							AGTCTAGTTGAAAAAAAAATA	0.398													6	4	---	---	---	---	
SMOC2	64094	broad.mit.edu	37	6	169004404	169004405	+	Intron	DEL	AC	-	-	rs146630696		TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:169004404_169004405delAC	uc003qws.1	+						SMOC2_uc003qwr.1_Intron	NM_022138	NP_071421	Q9H3U7	SMOC2_HUMAN	SPARC related modular calcium binding 2						signal transduction	basement membrane	calcium ion binding			ovary(1)	1		Breast(66;0.000141)|Esophageal squamous(34;0.222)|Ovarian(120;0.231)		OV - Ovarian serous cystadenocarcinoma(33;1.31e-19)|BRCA - Breast invasive adenocarcinoma(81;3.06e-06)|GBM - Glioblastoma multiforme(31;0.00109)		aaaaaaaaaaaccagtaatcca	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	24810034	24810036	+	IGR	DEL	GAG	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:24810034_24810036delGAG								DFNA5 (12395 upstream) : OSBPL3 (26129 downstream)																							tgagttctgtgagtcattccaga	0.000													4	2	---	---	---	---	
ANLN	54443	broad.mit.edu	37	7	36483097	36483098	+	Intron	DEL	AA	-	-	rs35586687		TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:36483097_36483098delAA	uc003tff.2	+						ANLN_uc011kaz.1_Intron|ANLN_uc003tfg.2_Intron|ANLN_uc010kxe.2_Intron	NM_018685	NP_061155	Q9NQW6	ANLN_HUMAN	anillin, actin binding protein						cytokinesis|mitosis|regulation of exit from mitosis|septin ring assembly	actomyosin contractile ring|nucleus	actin binding			ovary(2)|skin(1)	3						TATACTTTTTAAAAGTCTTAAA	0.272													8	5	---	---	---	---	
ELMO1	9844	broad.mit.edu	37	7	37290899	37290899	+	Intron	DEL	C	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:37290899delC	uc003tfk.1	-						ELMO1_uc011kbc.1_Intron|ELMO1_uc010kxg.1_Intron	NM_014800	NP_055615	Q92556	ELMO1_HUMAN	engulfment and cell motility 1 isoform 1						actin cytoskeleton organization|apoptosis|cellular component movement|phagocytosis, engulfment|Rac protein signal transduction|regulation of defense response to virus by virus|viral reproduction	cytoskeleton|cytosol|plasma membrane	SH3 domain binding			ovary(3)|skin(2)|upper_aerodigestive_tract(1)	6						CAACATGTTTCCCCACAGCTG	0.353													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	61967990	61967990	+	IGR	DEL	A	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:61967990delA								None (None upstream) : LOC643955 (783682 downstream)																							aaatatctgcaaataaaaaca	0.000													17	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	64728451	64728451	+	IGR	DEL	A	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:64728451delA								INTS4L1 (33852 upstream) : ZNF92 (110317 downstream)																							TGAAGAGGTTAAAAAAAAAAA	0.507													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	76591849	76591849	+	IGR	DEL	C	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:76591849delC								POMZP3 (335229 upstream) : PMS2L11 (18290 downstream)																							TAGGAGATTTCCATGAGGGTC	0.289													11	5	---	---	---	---	
PMS2L11	441263	broad.mit.edu	37	7	76627426	76627426	+	Intron	DEL	G	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:76627426delG	uc003ufw.3	+						PMS2L11_uc011kgn.1_Intron	NR_023383				Homo sapiens cDNA FLJ59034 complete cds, moderately similar to Protein deltex-2.												0						gtggaggtgtggggtgtgtgg	0.000													4	2	---	---	---	---	
STEAP2	261729	broad.mit.edu	37	7	89859613	89859613	+	Intron	DEL	A	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:89859613delA	uc003ujz.2	+						STEAP2_uc010len.2_Intron|STEAP2_uc003uka.2_Intron|STEAP2_uc003ukb.2_Intron|STEAP2_uc003ukc.2_Intron|STEAP2_uc003ukd.2_Intron	NM_152999	NP_694544	Q8NFT2	STEA2_HUMAN	six transmembrane epithelial antigen of the						electron transport chain|endocytosis|Golgi to plasma membrane transport|ion transport|iron ion homeostasis|regulated secretory pathway|response to hormone stimulus	cytosol|early endosome|endosome membrane|integral to Golgi membrane|plasma membrane|trans-Golgi network transport vesicle|vesicular fraction	electron carrier activity|flavin adenine dinucleotide binding|iron ion binding|oxidoreductase activity|transporter activity			ovary(2)	2	all_hematologic(106;0.112)					CTTAAAAGAGAAAAAAAAAAT	0.289													6	3	---	---	---	---	
MTERF	7978	broad.mit.edu	37	7	91490778	91490778	+	Intron	DEL	T	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:91490778delT	uc010let.1	-									Q99551	MTERF_HUMAN	Synthetic construct DNA, clone: pF1KB8286, Homo sapiens MTERF gene for mitochondrial transcription termination factor, without stop codon, in Flexi system.						DNA geometric change|regulation of transcription, DNA-dependent|termination of mitochondrial transcription	mitochondrial nucleoid	double-stranded DNA binding				0	all_cancers(62;2.28e-09)|all_epithelial(64;1.07e-07)|Breast(17;0.00371)|all_hematologic(106;0.091)|all_lung(186;0.178)|Lung NSC(181;0.235)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.0993)|Kidney(17;0.118)|Epithelial(20;0.136)|LUSC - Lung squamous cell carcinoma(200;0.176)			cattcctagctttttttttcc	0.065													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	95232305	95232306	+	IGR	DEL	TC	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:95232305_95232306delTC								PDK4 (6380 upstream) : DYNC1I1 (169512 downstream)																							aacccttaattctctctctctc	0.040													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	95349986	95349986	+	IGR	DEL	A	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:95349986delA								PDK4 (124061 upstream) : DYNC1I1 (51832 downstream)																							aattcctactaaaaaaaaatt	0.055													4	2	---	---	---	---	
TRIM4	89122	broad.mit.edu	37	7	99516500	99516501	+	Intron	INS	-	T	T			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99516500_99516501insT	uc003usd.2	-						TRIM4_uc003use.2_Intron|TRIM4_uc011kjc.1_Intron|TRIM4_uc003usf.2_Intron	NM_033017	NP_148977	Q9C037	TRIM4_HUMAN	tripartite motif protein TRIM4 isoform alpha						protein trimerization	cytoplasm|plasma membrane	zinc ion binding			ovary(1)|kidney(1)	2	Esophageal squamous(72;0.0166)|Lung NSC(181;0.0211)|all_lung(186;0.0323)	Ovarian(593;0.238)				TGCTTAACTTCTTTGAGTTTCA	0.431													4	2	---	---	---	---	
ZNF3	7551	broad.mit.edu	37	7	99674888	99674888	+	Intron	DEL	T	-	-	rs111692543		TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99674888delT	uc003usq.2	-						ZNF3_uc003usp.2_Intron|ZNF3_uc003usr.2_Intron|ZNF3_uc010lgj.2_Intron|ZNF3_uc003uss.2_Intron|ZNF3_uc003ust.3_Intron	NM_032924	NP_116313	P17036	ZNF3_HUMAN	zinc finger protein 3 isoform 2						cell differentiation|leukocyte activation|multicellular organismal development	nucleus	DNA binding|identical protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)	Ovarian(593;2.06e-05)|Myeloproliferative disorder(862;0.0122)|Breast(660;0.029)	STAD - Stomach adenocarcinoma(171;0.129)			gattgcagaatgactgagtAA	0.224													117	53	---	---	---	---	
DOCK4	9732	broad.mit.edu	37	7	111829566	111829566	+	Intron	DEL	A	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:111829566delA	uc003vfx.2	-						DOCK4_uc003vfy.2_Intron|DOCK4_uc003vga.1_Intron|DOCK4_uc010ljt.1_Intron	NM_014705	NP_055520	Q8N1I0	DOCK4_HUMAN	dedicator of cytokinesis 4						cell chemotaxis	cytosol|endomembrane system|membrane|stereocilium	GTP binding|guanyl-nucleotide exchange factor activity|PDZ domain binding|Rac GTPase activator activity|Rac GTPase binding|receptor tyrosine kinase binding|SH3 domain binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)	4		Acute lymphoblastic leukemia(1;0.0441)				ATGGTGTTGTAAAGACTTCAG	0.358													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	114542528	114542528	+	IGR	DEL	A	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:114542528delA								FOXP2 (211436 upstream) : MDFIC (19681 downstream)																							ttatgcatagaaaaaaaaaga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	128736164	128736164	+	IGR	DEL	T	-	-	rs66837005		TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128736164delT								TPI1P2 (38871 upstream) : LOC407835 (30161 downstream)																							GGAATGAATCttttttttttt	0.174													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	135526090	135526090	+	IGR	DEL	A	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:135526090delA								FAM180A (92496 upstream) : LUZP6 (85415 downstream)																							TATGTATATTAAAAAAAGAAG	0.318													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	136265376	136265376	+	IGR	DEL	A	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:136265376delA								LUZP6 (603172 upstream) : CHRM2 (288023 downstream)																							ACCTCAGTAGAAAAAAATGCC	0.502													4	2	---	---	---	---	
ADCK2	90956	broad.mit.edu	37	7	140381123	140381123	+	Intron	DEL	T	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:140381123delT	uc003vvy.1	+						ADCK2_uc003vvz.2_Intron	NM_052853	NP_443085	Q7Z695	ADCK2_HUMAN	aarF domain containing kinase 2							integral to membrane	ATP binding|protein serine/threonine kinase activity				0	Melanoma(164;0.00956)					AGCTCttttattttttttttt	0.254													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	150352839	150352840	+	IGR	INS	-	C	C	rs140563340	by1000genomes	TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150352839_150352840insC								GIMAP6 (23159 upstream) : GIMAP2 (29954 downstream)																							acgggcattgtccctgcctatt	0.158													3	4	---	---	---	---	
MLL3	58508	broad.mit.edu	37	7	152101925	152101925	+	Intron	DEL	T	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:152101925delT	uc003wla.2	-							NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3						intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)		ATCTTttttgtttttttgttt	0.139			N		medulloblastoma								4	2	---	---	---	---	
UBE3C	9690	broad.mit.edu	37	7	156962791	156962798	+	Intron	DEL	GGCATGAG	-	-	rs143520728		TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:156962791_156962798delGGCATGAG	uc010lqs.2	+						UBE3C_uc003wnf.2_Intron|UBE3C_uc003wng.2_Intron	NM_014671	NP_055486	Q15386	UBE3C_HUMAN	ubiquitin protein ligase E3C						protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus|proteasome complex	protein binding|ubiquitin-protein ligase activity			ovary(2)|lung(2)|large_intestine(1)	5		all_hematologic(28;0.0185)|all_epithelial(9;0.0664)	OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.19)		tgggattaaaggcatgagccaccatgcc	0.106													3	3	---	---	---	---	
CSMD1	64478	broad.mit.edu	37	8	3165574	3165592	+	Intron	DEL	ATGTGATAATTCTAATAAT	-	-	rs11268389		TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:3165574_3165592delATGTGATAATTCTAATAAT	uc011kwk.1	-						CSMD1_uc011kwj.1_Intron|CSMD1_uc003wqe.2_Intron	NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1 precursor							integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		TAAGACACTCATGTGATAATTCTAATAATATGTGATAAT	0.338													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	11528321	11528321	+	IGR	DEL	T	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11528321delT								BLK (106214 upstream) : GATA4 (6147 downstream)																							AATGAAATAAttttttttttg	0.204													4	2	---	---	---	---	
NSMAF	8439	broad.mit.edu	37	8	59536595	59536595	+	Intron	DEL	T	-	-	rs35328777		TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:59536595delT	uc003xtt.2	-						NSMAF_uc011lee.1_Intron|NSMAF_uc003xtu.2_Intron	NM_003580	NP_003571	Q92636	FAN_HUMAN	neutral sphingomyelinase (N-SMase) activation						ceramide metabolic process	cytoplasm|soluble fraction	protein binding|receptor signaling protein activity			ovary(1)	1		all_lung(136;0.174)|Lung NSC(129;0.2)				agagttaggattttttttttt	0.010													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	60513624	60513624	+	IGR	DEL	A	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:60513624delA								TOX (481857 upstream) : CA8 (587799 downstream)																							ATAGCAAGATAATAGGAGTAA	0.358													4	2	---	---	---	---	
PREX2	80243	broad.mit.edu	37	8	68981075	68981075	+	Intron	DEL	T	-	-	rs35256634		TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:68981075delT	uc003xxv.1	+						PREX2_uc003xxu.1_Intron|PREX2_uc011lez.1_Intron	NM_024870	NP_079146	Q70Z35	PREX2_HUMAN	DEP domain containing 2 isoform a						G-protein coupled receptor protein signaling pathway|intracellular signal transduction	intracellular	protein binding|Rac GTPase activator activity|Rac guanyl-nucleotide exchange factor activity			skin(6)|large_intestine(4)|pancreas(3)|lung(2)|ovary(1)|kidney(1)	17						AACTGtaatatttttaaataa	0.219													2	6	---	---	---	---	
RIMS2	9699	broad.mit.edu	37	8	105010142	105010143	+	Intron	INS	-	AT	AT	rs138236558	by1000genomes	TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:105010142_105010143insAT	uc003yls.2	+						RIMS2_uc003ylp.2_Intron|RIMS2_uc003ylw.2_Intron|RIMS2_uc003ylq.2_Intron|RIMS2_uc003ylr.2_Intron	NM_014677	NP_055492	Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2						intracellular protein transport	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding			ovary(6)|lung(2)|breast(2)|skin(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	15			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			TATCATATAACATTCTAGGTGG	0.257										HNSCC(12;0.0054)			0	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	105721025	105721025	+	IGR	DEL	G	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:105721025delG								LRP12 (119805 upstream) : ZFPM2 (610122 downstream)																							TGGATTGCCTGGAATTTGGCT	0.448													4	2	---	---	---	---	
ENPP2	5168	broad.mit.edu	37	8	120598168	120598169	+	Intron	DEL	AC	-	-	rs142862962		TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:120598168_120598169delAC	uc003yot.1	-						ENPP2_uc011lic.1_5'Flank|ENPP2_uc003yor.1_Intron|ENPP2_uc003yos.1_Intron|ENPP2_uc010mdd.1_Intron	NM_001040092	NP_001035181	Q13822	ENPP2_HUMAN	autotaxin isoform 2 preproprotein						cellular component movement|chemotaxis|G-protein coupled receptor protein signaling pathway|immune response|phosphate metabolic process|phosphatidylcholine catabolic process|regulation of cell migration	extracellular space|integral to plasma membrane	alkylglycerophosphoethanolamine phosphodiesterase activity|calcium ion binding|lysophospholipase activity|nucleic acid binding|nucleotide diphosphatase activity|phosphodiesterase I activity|polysaccharide binding|scavenger receptor activity|transcription factor binding|zinc ion binding			ovary(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)|large_intestine(1)|kidney(1)	7	Lung NSC(37;5.03e-06)|Ovarian(258;0.0249)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00185)			GATGAAAGAGacacacacacac	0.312													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	26704529	26704529	+	IGR	DEL	A	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:26704529delA								None (None upstream) : C9orf82 (136155 downstream)																							TGTAGGCTTCAAAAAAAAACC	0.433													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	28937788	28937788	+	IGR	DEL	T	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:28937788delT								MIR873 (48835 upstream) : None (None downstream)																							ATCATTTTTCtttttttttcc	0.259													3	3	---	---	---	---	
MELK	9833	broad.mit.edu	37	9	36652397	36652397	+	Intron	DEL	T	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:36652397delT	uc003zzn.2	+						MELK_uc011lpm.1_Intron|MELK_uc011lpn.1_Intron|MELK_uc011lpo.1_Intron|MELK_uc010mll.2_Intron|MELK_uc011lpp.1_Intron|MELK_uc010mlm.2_Intron|MELK_uc011lpq.1_Intron|MELK_uc011lpr.1_Intron|MELK_uc011lps.1_Intron	NM_014791	NP_055606	Q14680	MELK_HUMAN	maternal embryonic leucine zipper kinase							cytoplasm	ATP binding|protein binding|protein serine/threonine kinase activity			ovary(3)|upper_aerodigestive_tract(1)|lung(1)|skin(1)	6		Acute lymphoblastic leukemia(2;1.09e-08)|all_hematologic(2;8.15e-06)	STAD - Stomach adenocarcinoma(86;0.228)			CCCTGACTCCTTTTTTTTCAT	0.174													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	66471182	66471182	+	IGR	DEL	G	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66471182delG								FAM74A4 (976796 upstream) : LOC442421 (25288 downstream)																							gtgaggctttgcaataaactc	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	69823244	69823245	+	IGR	INS	-	A	A	rs144648870	by1000genomes	TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:69823244_69823245insA								LOC100133920 (158295 upstream) : FOXD4L5 (352464 downstream)																							TCAGATATAGTTCTACTATGTA	0.376													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	74204892	74204892	+	IGR	DEL	A	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:74204892delA								TRPM3 (143072 upstream) : TMEM2 (93390 downstream)																							TATGCTCTTGAAAAAAAAAAT	0.393													9	4	---	---	---	---	
TRPM6	140803	broad.mit.edu	37	9	77473305	77473306	+	Intron	INS	-	AAAAACAAAAAAAC	AAAAACAAAAAAAC	rs142488578	by1000genomes	TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:77473305_77473306insAAAAACAAAAAAAC	uc004ajl.1	-						TRPM6_uc004ajk.1_Intron|TRPM6_uc010mpb.1_Intron|TRPM6_uc010mpc.1_Intron|TRPM6_uc010mpd.1_Intron|TRPM6_uc010mpe.1_Intron|TRPM6_uc004ajn.1_Intron	NM_017662	NP_060132	Q9BX84	TRPM6_HUMAN	transient receptor potential cation channel,						response to toxin	integral to membrane	ATP binding|calcium channel activity|metal ion binding|protein binding|protein serine/threonine kinase activity			lung(3)|stomach(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|skin(1)	8						cttcgtctcaaaaaaacaaaaa	0.005													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	81077593	81077594	+	IGR	DEL	GT	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:81077593_81077594delGT								PSAT1 (132586 upstream) : None (None downstream)																							AGATGCCAAAGTGTGGAGTGGC	0.436													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	111398033	111398033	+	IGR	DEL	T	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:111398033delT								None (None upstream) : ACTL7B (218838 downstream)																							TCCTTTTACATTTTTTTCTTC	0.373													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	113827191	113827191	+	IGR	DEL	T	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:113827191delT								LPAR1 (25665 upstream) : OR2K2 (262573 downstream)																							CATGTTTTCATTTTTTTTCTG	0.363													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	115431501	115431501	+	IGR	DEL	T	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:115431501delT								KIAA1958 (8795 upstream) : C9orf80 (17292 downstream)																							TTGGAAGGGATTTTTTTTTGT	0.463													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	129467661	129467661	+	IGR	DEL	C	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:129467661delC								LMX1B (4350 upstream) : ZBTB43 (99624 downstream)																							GCTGTTAAATCCCCAGAACAG	0.582											OREG0019497	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	6314239	6314241	+	IGR	DEL	CCT	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:6314239_6314241delCCT								PFKFB3 (36734 upstream) : PRKCQ (154864 downstream)																							CTCCTGTGTCCCTCCCTTGACTC	0.473													3	3	---	---	---	---	
ITIH5	80760	broad.mit.edu	37	10	7654622	7654622	+	Intron	DEL	T	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:7654622delT	uc001ijq.2	-						ITIH5_uc001ijp.2_Intron|ITIH5_uc001ijr.1_Intron	NM_030569	NP_085046	Q86UX2	ITIH5_HUMAN	inter-alpha trypsin inhibitor heavy chain						hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity			ovary(2)|central_nervous_system(2)	4						AAAAGCTGTGTTTTTTTTTTT	0.363													3	4	---	---	---	---	
SVIL	6840	broad.mit.edu	37	10	29874590	29874591	+	Intron	DEL	AC	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:29874590_29874591delAC	uc001iut.1	-						SVIL_uc001iuu.1_Intron|SVIL_uc009xld.1_Intron	NM_021738	NP_068506	O95425	SVIL_HUMAN	supervillin isoform 2						cytoskeleton organization|skeletal muscle tissue development	cell junction|costamere|invadopodium|nucleus|podosome	actin filament binding			ovary(5)|upper_aerodigestive_tract(1)	6		Breast(68;0.103)				TGCTAAAAATACACACACACAC	0.520													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	30900616	30900617	+	IGR	DEL	GG	-	-	rs111568344		TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:30900616_30900617delGG								MAP3K8 (149855 upstream) : LYZL2 (92 downstream)																							aaggaaggaaggaaagaaagaa	0.064													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	30900630	30900631	+	IGR	DEL	AA	-	-	rs72207434		TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:30900630_30900631delAA								MAP3K8 (149869 upstream) : LYZL2 (78 downstream)																							agaaagaaagaaaaagaaagaa	0.084													4	4	---	---	---	---	
KCNMA1	3778	broad.mit.edu	37	10	78639614	78639614	+	Intron	DEL	A	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:78639614delA	uc001jxj.2	-						KCNMA1_uc001jxk.1_Intron|KCNMA1_uc009xrt.1_Intron	NM_001014797	NP_001014797	Q12791	KCMA1_HUMAN	large conductance calcium-activated potassium						cellular potassium ion homeostasis|negative regulation of cell volume|platelet activation|positive regulation of apoptosis|regulation of membrane potential|response to calcium ion|response to carbon monoxide|response to hypoxia|response to osmotic stress|smooth muscle contraction involved in micturition	apical plasma membrane|caveola|integral to membrane|voltage-gated potassium channel complex	actin binding|calcium-activated potassium channel activity|large conductance calcium-activated potassium channel activity|metal ion binding|voltage-gated potassium channel activity			pancreas(2)|ovary(1)	3	all_cancers(46;0.203)|all_epithelial(25;0.00604)|Prostate(51;0.0198)		OV - Ovarian serous cystadenocarcinoma(4;0.0586)|Epithelial(14;0.081)|all cancers(16;0.183)		Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Chlorothiazide(DB00880)|Chlorzoxazone(DB00356)|Cromoglicate(DB01003)|Cyclothiazide(DB00606)|Diazoxide(DB01119)|Enflurane(DB00228)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Quinethazone(DB01325)|Trichlormethiazide(DB01021)	TGTGATGGTTATCATGTTTTA	0.378													4	2	---	---	---	---	
GRID1	2894	broad.mit.edu	37	10	87613718	87613718	+	Intron	DEL	A	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:87613718delA	uc001kdl.1	-						GRID1_uc009xsu.1_Intron	NM_017551	NP_060021	Q9ULK0	GRID1_HUMAN	glutamate receptor, ionotropic, delta 1							cell junction|integral to membrane|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|ionotropic glutamate receptor activity			ovary(5)|upper_aerodigestive_tract(2)|large_intestine(2)|central_nervous_system(1)	10					L-Glutamic Acid(DB00142)	AGCACCAAATAAAAAAGCCAA	0.483										Multiple Myeloma(13;0.14)			4	2	---	---	---	---	
PAPSS2	9060	broad.mit.edu	37	10	89481816	89481816	+	Intron	DEL	T	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:89481816delT	uc001kex.2	+						PAPSS2_uc001kew.2_Intron|PAPSS2_uc009xtg.1_Intron	NM_004670	NP_004661	O95340	PAPS2_HUMAN	3'-phosphoadenosine 5'-phosphosulfate synthase 2						3'-phosphoadenosine 5'-phosphosulfate biosynthetic process|skeletal system development|sulfate assimilation|xenobiotic metabolic process	cytosol	adenylylsulfate kinase activity|ATP binding|protein binding|sulfate adenylyltransferase (ATP) activity			central_nervous_system(1)|skin(1)	2		Melanoma(5;0.019)|Colorectal(252;0.123)		UCEC - Uterine corpus endometrioid carcinoma (6;0.00164)|Colorectal(12;0.000323)|COAD - Colon adenocarcinoma(12;0.00124)		TTCCTGAGTCTTTTACATTTA	0.313													4	2	---	---	---	---	
PDZD7	79955	broad.mit.edu	37	10	102777635	102777636	+	Intron	INS	-	G	G			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:102777635_102777636insG	uc001kso.1	-						PDZD7_uc001ksn.2_Intron	NM_024895	NP_079171	Q9H5P4	PDZD7_HUMAN	PDZ domain containing 7							cilium|nucleus	protein binding			ovary(1)|breast(1)|central_nervous_system(1)	3				Epithelial(162;6.98e-09)|all cancers(201;3.55e-07)		aaagaaagaaagaaagaaagaa	0.005													4	2	---	---	---	---	
PDCD11	22984	broad.mit.edu	37	10	105159972	105159973	+	Intron	INS	-	G	G			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:105159972_105159973insG	uc001kwy.1	+							NM_014976	NP_055791	Q14690	RRP5_HUMAN	programmed cell death 11						mRNA processing|rRNA processing	nucleolus	RNA binding|transcription factor binding			ovary(2)|breast(2)|skin(2)|central_nervous_system(1)	7		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;7.21e-09)|all cancers(201;1.17e-08)|BRCA - Breast invasive adenocarcinoma(275;0.208)		GGAACATTGGCGGCCCCCCCCC	0.480													2	4	---	---	---	---	
TDRD1	56165	broad.mit.edu	37	10	115985616	115985616	+	Intron	DEL	A	-	-	rs74608976		TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:115985616delA	uc001lbg.1	+						TDRD1_uc001lbf.2_Intron|TDRD1_uc001lbh.1_Intron|TDRD1_uc001lbi.1_Intron|TDRD1_uc010qsc.1_Intron|TDRD1_uc001lbj.2_Intron	NM_198795	NP_942090	Q9BXT4	TDRD1_HUMAN	tudor domain containing 1						DNA methylation involved in gamete generation|gene silencing by RNA|germ cell development|meiosis|multicellular organismal development|piRNA metabolic process|spermatogenesis	pi-body	nucleic acid binding|protein binding|zinc ion binding				0		Colorectal(252;0.172)|Breast(234;0.188)		Epithelial(162;0.0343)|all cancers(201;0.0754)		accctgtctcaaaaaaaaaaa	0.114													7	5	---	---	---	---	
KCNK18	338567	broad.mit.edu	37	10	118954327	118954327	+	5'Flank	DEL	G	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:118954327delG	uc010qsr.1	+							NM_181840	NP_862823	Q7Z418	KCNKI_HUMAN	potassium channel, subfamily K, member 18							integral to membrane|plasma membrane				upper_aerodigestive_tract(1)	1		Colorectal(252;0.19)		all cancers(201;0.0211)		gaataatagtgggggaggtca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	49428320	49428321	+	IGR	INS	-	T	T	rs71049344		TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:49428320_49428321insT								FOLH1 (198098 upstream) : LOC440040 (151759 downstream)																							atctatctatcatctatatctg	0.163													7	5	---	---	---	---	
DDB1	1642	broad.mit.edu	37	11	61068106	61068107	+	Intron	INS	-	AGCG	AGCG			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61068106_61068107insAGCG	uc001nrc.3	-							NM_001923	NP_001914	Q16531	DDB1_HUMAN	damage-specific DNA binding protein 1						cell cycle checkpoint|interspecies interaction between organisms|nucleotide-excision repair, DNA damage removal|proteasomal ubiquitin-dependent protein catabolic process|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	Cul4A-RING ubiquitin ligase complex|Cul4B-RING ubiquitin ligase complex|cytoplasm|nucleoplasm	damaged DNA binding|protein binding			ovary(2)|lung(1)|central_nervous_system(1)	4						TACCCACGAGCCACAACTACAA	0.505								NER					6	3	---	---	---	---	
SCGB1D1	10648	broad.mit.edu	37	11	61959294	61959294	+	Intron	DEL	A	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61959294delA	uc001nsz.1	+							NM_006552	NP_006543	O95968	SG1D1_HUMAN	lipophilin A precursor							extracellular space	binding			skin(1)	1						AGTGTGCTTTAAaaaaaaaac	0.184													4	2	---	---	---	---	
TMEM223	79064	broad.mit.edu	37	11	62557904	62557904	+	3'UTR	DEL	T	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62557904delT	uc001nve.2	-	2						NM_001080501	NP_001073970	A0PJW6	TM223_HUMAN	transmembrane protein 223							integral to membrane					0						AAGATTGGCGTTTTTTtttgt	0.229													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	69611324	69611324	+	IGR	DEL	A	-	-	rs35685020		TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:69611324delA								FGF4 (21153 upstream) : FGF3 (13413 downstream)																							CACTCAGAACAAAATGCAGAG	0.617													2	4	---	---	---	---	
SHANK2	22941	broad.mit.edu	37	11	70744837	70744837	+	Intron	DEL	G	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:70744837delG	uc001oqc.2	-							NM_012309	NP_036441	Q9UPX8	SHAN2_HUMAN	SH3 and multiple ankyrin repeat domains 2						intracellular signal transduction	cell junction|cytoplasm|postsynaptic density|postsynaptic membrane	GKAP/Homer scaffold activity|ionotropic glutamate receptor binding|SH3 domain binding			ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5			LUSC - Lung squamous cell carcinoma(11;4.72e-09)|STAD - Stomach adenocarcinoma(18;0.071)			gaattgttaagcaaaaaggaa	0.000													4	2	---	---	---	---	
UCP2	7351	broad.mit.edu	37	11	73686860	73686862	+	Intron	DEL	CTT	-	-	rs141148353		TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:73686860_73686862delCTT	uc001oup.1	-						UCP2_uc001ouq.1_Intron	NM_003355	NP_003346	P55851	UCP2_HUMAN	uncoupling protein 2						proton transport|respiratory electron transport chain	integral to membrane|mitochondrial inner membrane	binding				0	Breast(11;0.000112)					taatccaggacttcttttggagg	0.118													3	4	---	---	---	---	
DLG2	1740	broad.mit.edu	37	11	83195550	83195558	+	Intron	DEL	GAATTTTTT	-	-	rs148881236		TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:83195550_83195558delGAATTTTTT	uc001paj.2	-						DLG2_uc001pai.2_Intron|DLG2_uc010rsy.1_Intron|DLG2_uc010rsz.1_Intron|DLG2_uc010rta.1_Intron|DLG2_uc001pak.2_Intron|DLG2_uc010rtb.1_Intron|DLG2_uc010rsw.1_Intron|DLG2_uc010rsx.1_Intron	NM_001364	NP_001355	Q15700	DLG2_HUMAN	chapsyn-110 isoform 2							cell junction|postsynaptic density|postsynaptic membrane	guanylate kinase activity|protein binding|protein binding			ovary(3)|pancreas(2)|skin(1)	6		all_cancers(6;0.00791)|Acute lymphoblastic leukemia(157;4.44e-05)|all_hematologic(158;0.0036)				agaagacccagaattttttgaattttttg	0.110													4	2	---	---	---	---	
TYR	7299	broad.mit.edu	37	11	89026757	89026757	+	Intron	DEL	A	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:89026757delA	uc001pcs.2	+							NM_000372	NP_000363	P14679	TYRO_HUMAN	tyrosinase precursor						eye pigment biosynthetic process|melanin biosynthetic process from tyrosine|visual perception	Golgi-associated vesicle|integral to membrane|lysosome|melanosome membrane|perinuclear region of cytoplasm	copper ion binding|monophenol monooxygenase activity|protein heterodimerization activity|protein homodimerization activity			ovary(2)|central_nervous_system(1)	3		Acute lymphoblastic leukemia(157;2.33e-05)|all_hematologic(158;0.0033)			Azelaic Acid(DB00548)|Mimosine(DB01055)|NADH(DB00157)	GGTATTGATGAAAAAAAAACA	0.279									Oculocutaneous_Albinism				4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	110784651	110784651	+	IGR	DEL	T	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:110784651delT								ARHGAP20 (200739 upstream) : C11orf53 (342056 downstream)																							TGTCACATACTTTTAAAAAAA	0.368													4	2	---	---	---	---	
USP28	57646	broad.mit.edu	37	11	113702425	113702425	+	Intron	DEL	A	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:113702425delA	uc001poh.2	-						USP28_uc001pog.2_5'Flank|USP28_uc010rwy.1_Intron|USP28_uc001poi.2_Intron|USP28_uc001poj.3_Intron|USP28_uc010rwz.1_Intron	NM_020886	NP_065937	Q96RU2	UBP28_HUMAN	ubiquitin specific protease 28						cell proliferation|DNA damage checkpoint|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA repair|protein deubiquitination|response to ionizing radiation|ubiquitin-dependent protein catabolic process	nucleolus|nucleoplasm	protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			lung(2)|breast(2)|ovary(1)|large_intestine(1)|kidney(1)	7		all_cancers(61;3.74e-18)|all_epithelial(67;3.75e-11)|Melanoma(852;1.46e-05)|all_hematologic(158;4.65e-05)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|Prostate(24;0.0153)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;3.93e-06)|Epithelial(105;0.000122)|all cancers(92;0.00104)		CTTTAGTTAGAAAAAAAAAAA	0.388													4	3	---	---	---	---	
MPZL2	10205	broad.mit.edu	37	11	118136421	118136421	+	5'Flank	DEL	A	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118136421delA	uc001psn.2	-						MPZL2_uc001pso.2_5'Flank|MPZL2_uc001psp.1_5'Flank	NM_005797	NP_005788	O60487	MPZL2_HUMAN	myelin protein zero-like 2 precursor						anatomical structure morphogenesis|homophilic cell adhesion	cytoskeleton|integral to membrane				skin(1)	1	all_hematologic(175;0.046)	Medulloblastoma(222;0.0425)|Breast(348;0.181)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.04e-05)		GCATGGTGAGAGTTTCTGAAA	0.458													4	2	---	---	---	---	
MLL	4297	broad.mit.edu	37	11	118391366	118391366	+	Intron	DEL	A	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118391366delA	uc001pta.2	+						MLL_uc001ptb.2_Intron	NM_005933	NP_005924	Q03164	MLL1_HUMAN	myeloid/lymphoid or mixed-lineage leukemia						apoptosis|embryonic hemopoiesis|histone H4-K16 acetylation|positive regulation of transcription, DNA-dependent|protein complex assembly|transcription from RNA polymerase II promoter	MLL1 complex	AT DNA binding|histone acetyl-lysine binding|histone methyltransferase activity (H3-K4 specific)|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|unmethylated CpG binding|zinc ion binding			lung(7)|ovary(5)|kidney(5)|central_nervous_system(3)|pancreas(2)|urinary_tract(1)|breast(1)|skin(1)	25	all_hematologic(175;0.046)	all_hematologic(192;1.13e-50)|all_neural(223;3.18e-06)|Breast(348;1.07e-05)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.244)		OV - Ovarian serous cystadenocarcinoma(223;2.77e-44)|BRCA - Breast invasive adenocarcinoma(274;1.2e-11)|Lung(307;3.48e-06)|LUSC - Lung squamous cell carcinoma(976;7.92e-05)|Colorectal(284;0.144)		actccatctcaaaaaaaaaaG	0.194			T|O	MLL|MLLT1|MLLT2|MLLT3|MLLT4|MLLT7|MLLT10|MLLT6|ELL|EPS15|AF1Q|CREBBP|SH3GL1|FNBP1|PNUTL1|MSF|GPHN|GMPS|SSH3BP1|ARHGEF12|GAS7|FOXO3A|LAF4|LCX|SEPT6|LPP|CBFA2T1|GRAF|EP300|PICALM|HEAB	AML|ALL								3	3	---	---	---	---	
ARHGEF12	23365	broad.mit.edu	37	11	120335722	120335722	+	Intron	DEL	A	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:120335722delA	uc001pxl.1	+						ARHGEF12_uc009zat.2_Intron|ARHGEF12_uc010rzn.1_Intron|ARHGEF12_uc009zau.1_Intron	NM_015313	NP_056128	Q9NZN5	ARHGC_HUMAN	Rho guanine nucleotide exchange factor (GEF) 12						apoptosis|axon guidance|G-protein coupled receptor protein signaling pathway|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|membrane	G-protein-coupled receptor binding|GTPase activator activity|Rho guanyl-nucleotide exchange factor activity			lung(2)|breast(2)|skin(2)|ovary(1)	7		Breast(109;0.000813)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.0831)|all_hematologic(192;0.107)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.231)		caaaaaaaagaaaaaaaaaag	0.144			T	MLL	AML								4	2	---	---	---	---	
FLI1	2313	broad.mit.edu	37	11	128669940	128669940	+	Intron	DEL	G	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:128669940delG	uc010sbu.1	+						FLI1_uc010sbt.1_Intron|FLI1_uc010sbv.1_Intron|FLI1_uc009zci.2_Intron	NM_002017	NP_002008	Q01543	FLI1_HUMAN	Friend leukemia virus integration 1						hemostasis|organ morphogenesis	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity		EWSR1/FLI1(2266)	bone(2210)|soft_tissue(48)|autonomic_ganglia(4)|central_nervous_system(4)|lung(3)|ovary(2)|pancreas(2)	2273	all_hematologic(175;0.0641)	Lung NSC(97;0.00588)|all_lung(97;0.00764)|Breast(109;0.0115)|Medulloblastoma(222;0.0523)|all_neural(223;0.0862)|all_hematologic(192;0.182)		OV - Ovarian serous cystadenocarcinoma(99;0.01)|LUSC - Lung squamous cell carcinoma(976;0.0324)|Lung(977;0.0327)		TCCTCCTCGTGGGCTTGGCTC	0.512			T	EWSR1	Ewing sarcoma								4	2	---	---	---	---	
ZBTB44	29068	broad.mit.edu	37	11	130109527	130109527	+	Intron	DEL	A	-	-	rs139777343	by1000genomes	TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:130109527delA	uc001qga.2	-						ZBTB44_uc001qgb.3_Intron|ZBTB44_uc001qfx.2_Intron|ZBTB44_uc001qgc.1_3'UTR|ZBTB44_uc001qfz.2_Intron	NM_014155	NP_054874	Q8NCP5	ZBT44_HUMAN	zinc finger and BTB domain containing 44						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1	all_hematologic(175;0.0429)	Lung NSC(97;0.000601)|Breast(109;0.000962)|all_lung(97;0.00125)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0192)|Lung(977;0.235)		AATGCTGGGGAAAAAAAAAAG	0.249													15	7	---	---	---	---	
SNX19	399979	broad.mit.edu	37	11	130776249	130776249	+	Intron	DEL	T	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:130776249delT	uc001qgk.3	-						SNX19_uc009zcw.2_Intron|SNX19_uc010sce.1_Intron|SNX19_uc010scf.1_Intron|SNX19_uc010scg.1_Intron|SNX19_uc001qgl.3_Intron|SNX19_uc009zcx.1_Intron	NM_014758	NP_055573	Q92543	SNX19_HUMAN	sorting nexin 19						cell communication|protein transport	cytoplasmic vesicle membrane	phosphatidylinositol binding|protein binding			ovary(2)|lung(2)	4	all_hematologic(175;0.0597)	Lung NSC(97;0.000272)|all_lung(97;0.000608)|Breast(109;0.000962)|all_neural(223;0.0298)|Medulloblastoma(222;0.0425)		OV - Ovarian serous cystadenocarcinoma(99;0.0195)|Lung(977;0.233)		TGGTCATCCATTTTTTTTTCC	0.413													4	2	---	---	---	---	
DYRK4	8798	broad.mit.edu	37	12	4689964	4689964	+	Intron	DEL	T	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:4689964delT	uc009zeh.1	+							NM_003845	NP_003836	Q9NR20	DYRK4_HUMAN	dual-specificity tyrosine-(Y)-phosphorylation							Golgi apparatus	ATP binding|metal ion binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			lung(2)|skin(1)	3			Colorectal(7;0.103)			CACTTAGGGATTTTTTTTTTT	0.463													7	4	---	---	---	---	
CLEC9A	283420	broad.mit.edu	37	12	10197962	10197962	+	Intron	DEL	T	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:10197962delT	uc001qxa.2	+							NM_207345	NP_997228	Q6UXN8	CLC9A_HUMAN	C-type lectin domain family 9, member A						positive regulation of cytokine secretion|receptor-mediated endocytosis	cell surface|integral to membrane	receptor activity|sugar binding			ovary(1)	1						AATGAGAAACTTTTTTTTTTA	0.348													4	5	---	---	---	---	
PRB4	5545	broad.mit.edu	37	12	11218796	11218796	+	Intron	DEL	G	-	-	rs11291284		TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:11218796delG	uc001qzf.1	-						PRR4_uc009zhp.2_Intron|PRH1_uc001qzb.3_Intron|PRH1_uc001qzc.2_Intron|PRH1_uc001qzj.2_Intron	NM_002723	NP_002714	P10163	PRB4_HUMAN	proline-rich protein BstNI subfamily 4							extracellular region				ovary(1)	1						CCCTATCCGTGAGTATAGTTT	0.348										HNSCC(22;0.051)			7	7	---	---	---	---	
GSG1	83445	broad.mit.edu	37	12	13251076	13251076	+	Intron	DEL	T	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:13251076delT	uc001rbn.2	-						GSG1_uc001rbj.2_5'Flank|GSG1_uc001rbk.2_5'Flank|GSG1_uc001rbl.2_5'Flank|GSG1_uc001rbm.2_5'Flank|GSG1_uc001rbo.2_Intron|GSG1_uc001rbp.2_Intron|GSG1_uc001rbq.1_Intron	NM_001080555	NP_001074024	Q2KHT4	GSG1_HUMAN	germ cell associated 1 isoform 4							endoplasmic reticulum membrane|integral to membrane					0		Prostate(47;0.183)		BRCA - Breast invasive adenocarcinoma(232;0.15)		GTGTTCTTTGTTTTTTTTTTT	0.448													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	13427179	13427179	+	IGR	DEL	T	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:13427179delT								EMP1 (57472 upstream) : C12orf36 (96844 downstream)																							ACACACAATATTTTTTTTCCT	0.498													4	2	---	---	---	---	
SOX5	6660	broad.mit.edu	37	12	24506413	24506413	+	Intron	DEL	T	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:24506413delT	uc001rfx.2	-						SOX5_uc001rfy.2_Intron	NM_152989	NP_694534	P35711	SOX5_HUMAN	SRY (sex determining region Y)-box 5 isoform b						transcription from RNA polymerase II promoter	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(5)|lung(1)	6						AAGCTAGGAGTTCAGATGTTT	0.428													4	2	---	---	---	---	
LRMP	4033	broad.mit.edu	37	12	25250172	25250173	+	Intron	INS	-	AAC	AAC	rs147884989	by1000genomes	TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:25250172_25250173insAAC	uc001rgh.2	+						LRMP_uc010sja.1_Intron|LRMP_uc010sjb.1_Intron|LRMP_uc001rgi.2_Intron|LRMP_uc010sjc.1_Intron|LRMP_uc010sjd.1_Intron	NM_006152	NP_006143	Q12912	LRMP_HUMAN	lymphoid-restricted membrane protein						vesicle fusion|vesicle targeting	endoplasmic reticulum membrane|integral to plasma membrane				ovary(1)|skin(1)	2	Acute lymphoblastic leukemia(6;0.00112)|all_hematologic(7;0.00152)|Colorectal(261;0.11)					aaaaatataataCGATCCAGTG	0.183													9	10	---	---	---	---	
FAR2	55711	broad.mit.edu	37	12	29464480	29464480	+	Intron	DEL	G	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:29464480delG	uc001ris.3	+						FAR2_uc001rit.2_Intron|FAR2_uc009zjm.2_Intron|uc001riu.1_Intron	NM_018099	NP_060569	Q96K12	FACR2_HUMAN	fatty acyl CoA reductase 2						ether lipid biosynthetic process	endoplasmic reticulum membrane|integral to membrane|peroxisomal matrix|peroxisomal membrane	binding|oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor				0						GAAGCTTCCTGGTACAAAGGA	0.333													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	68154615	68154616	+	IGR	DEL	GA	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:68154615_68154616delGA								DYRK2 (98172 upstream) : IFNG (393934 downstream)																							gggctattgtgaaaggtgtgag	0.040													4	2	---	---	---	---	
PPFIA2	8499	broad.mit.edu	37	12	81839264	81839264	+	Intron	DEL	G	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:81839264delG	uc001szo.1	-						PPFIA2_uc010sue.1_Intron|PPFIA2_uc010sug.1_Intron|PPFIA2_uc010suh.1_Intron|PPFIA2_uc010sui.1_Intron|PPFIA2_uc010suj.1_Intron|PPFIA2_uc009zsi.1_Intron	NM_003625	NP_003616	B7Z663	B7Z663_HUMAN	PTPRF interacting protein alpha 2											ovary(3)|lung(2)|pancreas(1)	6						GTGAGTCAATGGATGAAGACA	0.368													172	107	---	---	---	---	
TMTC2	160335	broad.mit.edu	37	12	83517525	83517525	+	Intron	DEL	A	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:83517525delA	uc001szt.2	+						TMTC2_uc010suk.1_Intron	NM_152588	NP_689801	Q8N394	TMTC2_HUMAN	transmembrane and tetratricopeptide repeat							endoplasmic reticulum|integral to membrane	binding			ovary(2)	2						GCAGTCTGCTAAAAATGTTTT	0.393													4	2	---	---	---	---	
EEA1	8411	broad.mit.edu	37	12	93247569	93247569	+	Intron	DEL	T	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:93247569delT	uc001tck.2	-							NM_003566	NP_003557	Q15075	EEA1_HUMAN	early endosome antigen 1, 162kD						early endosome to late endosome transport|synaptic vesicle to endosome fusion|vesicle fusion	cytosol|early endosome membrane|extrinsic to plasma membrane|membrane fraction	1-phosphatidylinositol binding|calmodulin binding|GTP-dependent protein binding|protein homodimerization activity|zinc ion binding			ovary(2)|skin(1)	3						ATCTTCACTGTTTTAGAGTCA	0.269													26	12	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	119701416	119701416	+	IGR	DEL	A	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:119701416delA								HSPB8 (68866 upstream) : LOC144742 (20214 downstream)																							GAGAGGGAACAAAAAAAACCC	0.428													6	3	---	---	---	---	
CIT	11113	broad.mit.edu	37	12	120220651	120220652	+	Intron	INS	-	G	G	rs139544982	by1000genomes	TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120220651_120220652insG	uc001txi.1	-						CIT_uc001txh.1_Intron|CIT_uc001txj.1_Intron	NM_007174	NP_009105	O14578	CTRO_HUMAN	citron						intracellular signal transduction		ATP binding|metal ion binding|protein serine/threonine kinase activity|SH3 domain binding|small GTPase regulator activity			ovary(6)|urinary_tract(1)|lung(1)|breast(1)|skin(1)	10	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)	Myeloproliferative disorder(1001;0.0255)		BRCA - Breast invasive adenocarcinoma(302;0.211)		TGGTGACCTTAGGGATCCAGCC	0.490													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	132911099	132911100	+	IGR	INS	-	T	T	rs113537162		TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:132911099_132911100insT								GALNT9 (5194 upstream) : FBRSL1 (156057 downstream)																							GACACCCCGGATTTTTTTTTTa	0.322													6	3	---	---	---	---	
PDS5B	23047	broad.mit.edu	37	13	33275759	33275760	+	Intron	DEL	AT	-	-	rs36089979	byFrequency	TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:33275759_33275760delAT	uc010abf.2	+						PDS5B_uc010abg.2_Intron	NM_015032	NP_055847	Q9NTI5	PDS5B_HUMAN	PDS5, regulator of cohesion maintenance, homolog						cell division|cell proliferation|mitotic sister chromatid cohesion|negative regulation of cell proliferation	chromatin|nucleus	ATP binding|DNA binding|identical protein binding			ovary(2)|lung(1)|pancreas(1)	4		Lung SC(185;0.0367)		all cancers(112;5.55e-06)|Epithelial(112;2.7e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00303)|BRCA - Breast invasive adenocarcinoma(63;0.0204)		agacacacacatatatatatat	0.243													4	2	---	---	---	---	
MIR320D-1	100302230	broad.mit.edu	37	13	41303257	41303257	+	5'Flank	DEL	A	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:41303257delA	hsa-mir-320d-1|MI0008190	-																							0						GAGTGAAAAGAAAAAGGTTAG	0.284													4	2	---	---	---	---	
SUCLA2	8803	broad.mit.edu	37	13	48563349	48563349	+	Intron	DEL	T	-	-	rs147155518		TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:48563349delT	uc001vbs.2	-						SUCLA2_uc010tgb.1_Intron|SUCLA2_uc010tgc.1_Intron|SUCLA2_uc010tgd.1_Intron|SUCLA2_uc001vbt.1_Intron|SUCLA2_uc001vbu.1_Intron	NM_003850	NP_003841	Q9P2R7	SUCB1_HUMAN	succinate-CoA ligase, ADP-forming, beta subunit						succinyl-CoA pathway|tricarboxylic acid cycle	mitochondrial matrix	ATP binding|metal ion binding|protein binding|succinate-CoA ligase (ADP-forming) activity			central_nervous_system(1)	1		all_cancers(8;1.13e-24)|all_epithelial(8;1.78e-13)|all_lung(13;2.85e-06)|Breast(56;0.000141)|Lung NSC(96;0.000226)|all_hematologic(8;0.000885)|Prostate(109;0.00132)|Acute lymphoblastic leukemia(8;0.0167)|Myeloproliferative disorder(33;0.039)|Hepatocellular(98;0.0556)|Lung SC(185;0.102)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(144;2.1e-06)	Succinic acid(DB00139)	AAACCAtttcttttttttttt	0.144													3	3	---	---	---	---	
RB1	5925	broad.mit.edu	37	13	48922817	48922817	+	Intron	DEL	T	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:48922817delT	uc001vcb.2	+						RB1_uc010acs.1_Intron	NM_000321	NP_000312	P06400	RB_HUMAN	retinoblastoma 1						androgen receptor signaling pathway|cell cycle arrest|chromatin remodeling|G1 phase of mitotic cell cycle|interspecies interaction between organisms|maintenance of mitotic sister chromatid cohesion|mitotic cell cycle G1/S transition checkpoint|myoblast differentiation|negative regulation of cell growth|negative regulation of protein kinase activity|negative regulation of S phase of mitotic cell cycle|negative regulation of sequence-specific DNA binding transcription factor activity|positive regulation of mitotic metaphase/anaphase transition|protein localization to chromosome, centromeric region|Ras protein signal transduction|regulation of centromere complex assembly|regulation of cohesin localization to chromatin|regulation of lipid kinase activity|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle|sister chromatid biorientation	chromatin|PML body|Rb-E2F complex|SWI/SNF complex	androgen receptor binding|DNA binding|kinase binding|phosphoprotein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription factor binding|ubiquitin protein ligase binding	p.?(5)		lung(94)|eye(89)|central_nervous_system(47)|bone(22)|breast(21)|urinary_tract(17)|haematopoietic_and_lymphoid_tissue(14)|ovary(10)|prostate(9)|soft_tissue(8)|skin(7)|endometrium(5)|cervix(3)|liver(3)|salivary_gland(2)|stomach(2)|oesophagus(1)|adrenal_gland(1)|kidney(1)|gastrointestinal_tract_(site_indeterminate)(1)|pituitary(1)	358		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	TTTTTCTTAATTTTTTTTTTT	0.204		6	D|Mis|N|F|S		retinoblastoma|sarcoma|breast|small cell lung	retinoblastoma|sarcoma|breast|small cell lung			Hereditary_Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)			6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	66708439	66708439	+	IGR	DEL	A	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:66708439delA								None (None upstream) : PCDH9 (168528 downstream)																							AAAGACAAACAAAAAGGACAA	0.398													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	80469213	80469214	+	Intron	INS	-	T	T			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:80469213_80469214insT	uc001vlh.2	+											Homo sapiens cDNA clone IMAGE:4825993.																		GGAGGCTAGTATTTTTTTTCAG	0.441													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	95323630	95323630	+	IGR	DEL	C	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:95323630delC								GPR180 (41686 upstream) : SOX21 (38252 downstream)																							ccgcctcactcatcacctggc	0.015													4	2	---	---	---	---	
ERCC5	2073	broad.mit.edu	37	13	103486546	103486546	+	Intron	DEL	T	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:103486546delT	uc001vpu.1	+						BIVM_uc001vps.2_Intron|BIVM_uc010agc.2_Intron|BIVM_uc001vpv.2_Intron	NM_000123	NP_000114	P28715	ERCC5_HUMAN	XPG-complementing protein						negative regulation of apoptosis|nucleotide-excision repair, DNA damage removal|nucleotide-excision repair, DNA incision, 3'-to lesion|response to UV-C|transcription-coupled nucleotide-excision repair|UV protection	nucleoplasm	bubble DNA binding|double-stranded DNA binding|endodeoxyribonuclease activity|metal ion binding|protein homodimerization activity|protein N-terminus binding|single-stranded DNA binding			ovary(4)|lung(1)|central_nervous_system(1)|skin(1)	7	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.211)					CATTCCAGGATTTTTTTTTCC	0.318			Mis|N|F			skin basal cell|skin squamous cell|melanoma		Direct_reversal_of_damage|NER	Xeroderma_Pigmentosum				4	3	---	---	---	---	
EFNB2	1948	broad.mit.edu	37	13	107160515	107160516	+	Intron	DEL	GG	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:107160515_107160516delGG	uc001vqi.2	-							NM_004093	NP_004084	P52799	EFNB2_HUMAN	ephrin B2 precursor						cell differentiation|cell-cell signaling|interspecies interaction between organisms|nervous system development	integral to plasma membrane	ephrin receptor binding			ovary(1)	1	Lung NSC(43;0.015)|all_neural(89;0.0741)|Lung SC(71;0.14)|Medulloblastoma(90;0.169)					ATTCAGCTCTGGGTGTCGCCTC	0.460													4	2	---	---	---	---	
FAM155A	728215	broad.mit.edu	37	13	107907737	107907737	+	Intron	DEL	G	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:107907737delG	uc001vql.2	-							NM_001080396	NP_001073865	B1AL88	F155A_HUMAN	family with sequence similarity 155, member A							integral to membrane	binding			skin(1)	1						ATTACAGTGTGGGTCTGTATT	0.368													4	2	---	---	---	---	
ING1	3621	broad.mit.edu	37	13	111367630	111367630	+	5'UTR	DEL	A	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:111367630delA	uc001vri.2	+	1					CARS2_uc010tjm.1_5'Flank|uc001vre.2_5'Flank|ING1_uc001vrf.2_Intron|ING1_uc001vrg.2_Intron|ING1_uc001vrh.2_Intron	NM_005537	NP_005528	Q9UK53	ING1_HUMAN	inhibitor of growth family, member 1 isoform D						cell cycle|negative regulation of cell growth|negative regulation of cell proliferation	nucleus	zinc ion binding			ovary(1)	1	all_lung(23;3.61e-05)|Lung NSC(43;0.00144)|Lung SC(71;0.0753)|all_neural(89;0.077)|Medulloblastoma(90;0.148)		BRCA - Breast invasive adenocarcinoma(86;0.188)			GGGTGGGGGCAAAAAAAAAAA	0.517													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	22934297	22934297	+	Intron	DEL	A	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22934297delA	uc001wbw.2	+						uc010aja.1_Intron|uc010tmk.1_Intron|uc010tmo.1_Intron|uc001wco.2_Intron|uc010aje.1_Intron|uc001wcp.2_Intron|uc001wcr.1_Intron|uc001wcs.1_Intron|uc010ajf.1_Intron|uc001wcx.3_Intron|uc001wdd.2_Intron|uc010ajj.1_Intron|uc001wde.1_Intron|uc001wdf.2_Intron|uc010ajk.1_Intron|uc001wdg.1_Intron|uc010ajl.1_Intron|uc001wdj.2_Intron|uc010ajo.1_Intron|uc010ajp.1_Intron|uc001wds.1_Intron|uc001wdv.3_Intron|uc001wdx.3_Intron|uc001wea.3_Intron					SubName: Full=Alpha-chain C region; Flags: Fragment;																		caaatgagttaaaaaaaataa	0.189													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	44065125	44065125	+	IGR	DEL	T	-	-	rs138953745	by1000genomes	TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:44065125delT								None (None upstream) : FSCB (908230 downstream)																							AGAACACACCTTTTAAGTGTG	0.313													4	2	---	---	---	---	
C14orf135	64430	broad.mit.edu	37	14	60618147	60618147	+	Intron	DEL	A	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:60618147delA	uc001xeq.2	+						DHRS7_uc001xes.2_Intron|DHRS7_uc001xet.2_Intron|DHRS7_uc001xeu.2_Intron	NM_022495	NP_071940	Q63HM2	CN135_HUMAN	hepatitis C virus F protein-binding protein 2							integral to membrane				ovary(2)	2		Myeloproliferative disorder(585;0.163)		OV - Ovarian serous cystadenocarcinoma(108;0.127)		TATATGATCCAAAAATGTTAA	0.393													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	62438150	62438150	+	IGR	DEL	A	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:62438150delA								SNAPC1 (175005 upstream) : SYT16 (15653 downstream)																							ccaggatggcaaaaggcctca	0.000													4	2	---	---	---	---	
EIF2S1	1965	broad.mit.edu	37	14	67849558	67849558	+	Intron	DEL	A	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:67849558delA	uc001xjg.2	+							NM_004094	NP_004085	P05198	IF2A_HUMAN	eukaryotic translation initiation factor 2,							cytosol|eukaryotic translation initiation factor 2 complex|polysome|stress granule	protein binding|ribosome binding|translation initiation factor activity			ovary(1)	1				all cancers(60;0.000683)|OV - Ovarian serous cystadenocarcinoma(108;0.00579)|BRCA - Breast invasive adenocarcinoma(234;0.00937)		AGAATTGGAGAAAAAAAAAGT	0.284													4	2	---	---	---	---	
RBM25	58517	broad.mit.edu	37	14	73538647	73538647	+	Intron	DEL	T	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:73538647delT	uc001xno.2	+						RBM25_uc001xnn.3_Intron|RBM25_uc010ttu.1_Intron|RBM25_uc001xnp.2_Intron	NM_021239	NP_067062	P49756	RBM25_HUMAN	RNA binding motif protein 25						apoptosis|mRNA processing|regulation of alternative nuclear mRNA splicing, via spliceosome|RNA splicing	cytoplasm|nuclear speck	mRNA binding|nucleotide binding|protein binding			central_nervous_system(2)|ovary(1)|breast(1)	4				BRCA - Breast invasive adenocarcinoma(234;0.00362)|OV - Ovarian serous cystadenocarcinoma(108;0.0688)		CATCTGGAAATTTTTTTTTTT	0.234													11	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	95316446	95316446	+	IGR	DEL	A	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:95316446delA								GSC (79947 upstream) : DICER1 (236119 downstream)																							gcagagacgtaagataACACG	0.174													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	103830564	103830565	+	IGR	INS	-	T	T	rs146710972	by1000genomes	TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:103830564_103830565insT								EIF5 (19205 upstream) : MARK3 (21136 downstream)																							CAGTTAAACGATTTTTTTTTAT	0.149													4	2	---	---	---	---	
ATP10A	57194	broad.mit.edu	37	15	25928848	25928850	+	Intron	DEL	AAG	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25928848_25928850delAAG	uc010ayu.2	-							NM_024490	NP_077816	O60312	AT10A_HUMAN	ATPase, class V, type 10A						ATP biosynthetic process|regulation of cell shape	integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			pancreas(2)|ovary(1)|breast(1)|liver(1)	5		all_cancers(20;5.16e-25)|all_lung(180;1.51e-14)|Acute lymphoblastic leukemia(1;2.53e-05)|all_hematologic(1;0.000267)|Breast(32;0.00125)		all cancers(64;9.48e-07)|Epithelial(43;1.69e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0252)|Lung(196;0.244)		tccctTAAGAAAGAAGAACTGGC	0.365													8	12	---	---	---	---	
TRPM1	4308	broad.mit.edu	37	15	31320485	31320485	+	Intron	DEL	T	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:31320485delT	uc001zfm.2	-						TRPM1_uc010azy.2_Intron|TRPM1_uc001zfl.2_Intron	NM_002420	NP_002411	Q7Z4N2	TRPM1_HUMAN	transient receptor potential cation channel,						cellular response to light stimulus|visual perception	integral to plasma membrane	calcium channel activity|receptor activity			ovary(2)|pancreas(1)|skin(1)	4		all_lung(180;1.92e-11)		all cancers(64;3.52e-16)|Epithelial(43;1.65e-11)|GBM - Glioblastoma multiforme(186;3.57e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00533)|COAD - Colon adenocarcinoma(236;0.0609)|Lung(196;0.199)		AAATGGAAAATCTGTACAGTA	0.388													24	19	---	---	---	---	
RYR3	6263	broad.mit.edu	37	15	33991583	33991584	+	Intron	DEL	CT	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:33991583_33991584delCT	uc001zhi.2	+						RYR3_uc010bar.2_Intron	NM_001036	NP_001027	Q15413	RYR3_HUMAN	ryanodine receptor 3						cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(5)|central_nervous_system(4)|lung(1)	10		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		actctctctcctctctctctct	0.153													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	37546474	37546475	+	IGR	INS	-	TAT	TAT	rs147091078	by1000genomes	TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:37546474_37546475insTAT								MEIS2 (152974 upstream) : TMCO5A (680352 downstream)																							aaaattGATTCTATTATACTTA	0.262													6	4	---	---	---	---	
TTBK2	146057	broad.mit.edu	37	15	43109141	43109141	+	Intron	DEL	T	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43109141delT	uc001zqo.2	-						TTBK2_uc010bcy.2_Intron|TTBK2_uc001zqp.2_Intron|TTBK2_uc010bcz.1_Intron	NM_173500	NP_775771	Q6IQ55	TTBK2_HUMAN	tau tubulin kinase 2						cell death		ATP binding|protein serine/threonine kinase activity			ovary(2)|lung(2)|stomach(1)|pancreas(1)|skin(1)	7		all_cancers(109;6.11e-16)|all_epithelial(112;5.5e-14)|Lung NSC(122;1.76e-08)|all_lung(180;6.04e-08)|Melanoma(134;0.0179)|Colorectal(260;0.216)		GBM - Glioblastoma multiforme(94;3.23e-07)		tatatatatatataaaataat	0.134													4	3	---	---	---	---	
TTBK2	146057	broad.mit.edu	37	15	43109143	43109143	+	Intron	DEL	T	-	-	rs66947001		TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43109143delT	uc001zqo.2	-						TTBK2_uc010bcy.2_Intron|TTBK2_uc001zqp.2_Intron|TTBK2_uc010bcz.1_Intron	NM_173500	NP_775771	Q6IQ55	TTBK2_HUMAN	tau tubulin kinase 2						cell death		ATP binding|protein serine/threonine kinase activity			ovary(2)|lung(2)|stomach(1)|pancreas(1)|skin(1)	7		all_cancers(109;6.11e-16)|all_epithelial(112;5.5e-14)|Lung NSC(122;1.76e-08)|all_lung(180;6.04e-08)|Melanoma(134;0.0179)|Colorectal(260;0.216)		GBM - Glioblastoma multiforme(94;3.23e-07)		tatatatatataaaataataa	0.139													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	52412564	52412564	+	IGR	DEL	C	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:52412564delC								BCL2L10 (7592 upstream) : GNB5 (559 downstream)																							CCCGACAGCACCCACTGCGAG	0.512													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	59722142	59722142	+	IGR	DEL	C	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:59722142delC								MYO1E (57071 upstream) : FAM81A (8230 downstream)																							AGGGTTGAGTCCAGGCCAGGT	0.438													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	70642368	70642368	+	IGR	DEL	A	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:70642368delA								TLE3 (252112 upstream) : UACA (304527 downstream)																							caaacaaactaaaaaaaaaaa	0.199													3	3	---	---	---	---	
PTPN9	5780	broad.mit.edu	37	15	75797813	75797813	+	Intron	DEL	A	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:75797813delA	uc002bal.2	-							NM_002833	NP_002824	P43378	PTN9_HUMAN	protein tyrosine phosphatase, non-receptor type							cytoplasmic part	non-membrane spanning protein tyrosine phosphatase activity|protein binding			lung(1)|skin(1)	2						ataaaaatttaaaaaaaaaag	0.159													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	95217770	95217770	+	IGR	DEL	T	-	-	rs71841657		TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:95217770delT								MCTP2 (190590 upstream) : LOC145820 (758552 downstream)																							CTTCTTTGACTTTTTTTTTTT	0.438													3	3	---	---	---	---	
ABCC6	368	broad.mit.edu	37	16	16246763	16246764	+	Intron	INS	-	T	T	rs150942309	by1000genomes	TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:16246763_16246764insT	uc002den.3	-						ABCC6_uc010bvo.2_Intron|ABCC6_uc002dem.2_Intron	NM_001171	NP_001162	O95255	MRP6_HUMAN	ATP-binding cassette, sub-family C, member 6						response to drug|visual perception	integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			skin(2)|ovary(1)	3				UCEC - Uterine corpus endometrioid carcinoma (3;0.123)		Gtttttttttgttttttttgag	0.218													2	4	---	---	---	---	
SCNN1B	6338	broad.mit.edu	37	16	23388893	23388895	+	Intron	DEL	TTC	-	-	rs149646061	by1000genomes	TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:23388893_23388895delTTC	uc002dln.2	+							NM_000336	NP_000327	P51168	SCNNB_HUMAN	sodium channel, nonvoltage-gated 1, beta						excretion|sensory perception of taste	apical plasma membrane	ligand-gated sodium channel activity|WW domain binding			ovary(3)|breast(2)|large_intestine(1)|pancreas(1)	7				GBM - Glioblastoma multiforme(48;0.0465)	Amiloride(DB00594)|Triamterene(DB00384)	ctcctctcttttcccttcctccc	0.044													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33982909	33982909	+	IGR	DEL	T	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33982909delT								MIR1826 (17317 upstream) : UBE2MP1 (420893 downstream)																							gattaagcagtttggaaacag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	34180389	34180389	+	IGR	DEL	T	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:34180389delT								MIR1826 (214797 upstream) : UBE2MP1 (223413 downstream)																							ccctttgtcattttgaaatgt	0.070													5	4	---	---	---	---	
SLC6A2	6530	broad.mit.edu	37	16	55734427	55734427	+	Intron	DEL	A	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:55734427delA	uc002eif.2	+						SLC6A2_uc010ccd.2_Intron|SLC6A2_uc002eig.2_Intron|SLC6A2_uc002eih.2_Intron|SLC6A2_uc002eii.2_Intron|SLC6A2_uc002eij.2_Intron	NM_001043	NP_001034	P23975	SC6A2_HUMAN	solute carrier family 6 member 2						synaptic transmission	integral to plasma membrane|membrane fraction	norepinephrine:sodium symporter activity			lung(4)|ovary(2)|pancreas(2)	8				BRCA - Breast invasive adenocarcinoma(181;0.01)|Kidney(780;0.0267)	Amineptine(DB04836)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Atomoxetine(DB00289)|Bethanidine(DB00217)|Bupropion(DB01156)|Clomipramine(DB01242)|Cocaine(DB00907)|Debrisoquin(DB04840)|Desipramine(DB01151)|Diethylpropion(DB00937)|Doxepin(DB01142)|Duloxetine(DB00476)|Ergotamine(DB00696)|Guanadrel Sulfate(DB00226)|Guanethidine(DB01170)|Imipramine(DB00458)|Maprotiline(DB00934)|Mazindol(DB00579)|Methylphenidate(DB00422)|Milnacipran(DB04896)|Nefazodone(DB01149)|Norepinephrine(DB00368)|Nortriptyline(DB00540)|Paroxetine(DB00715)|Phenmetrazine(DB00830)|Phentermine(DB00191)|Protriptyline(DB00344)|Reboxetine(DB00234)|Sibutramine(DB01105)|Tramadol(DB00193)|Trazodone(DB00656)|Trimipramine(DB00726)|Venlafaxine(DB00285)	accccaaaacaaaaaagaagt	0.184													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	73203140	73203140	+	IGR	DEL	G	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:73203140delG								HTA (75470 upstream) : None (None downstream)																							GCTAGGTGGTGGGGATTCAGA	0.363													4	2	---	---	---	---	
ZNF778	197320	broad.mit.edu	37	16	89288779	89288779	+	Intron	DEL	T	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89288779delT	uc002fmv.2	+						ZNF778_uc010vpf.1_Intron|ZNF778_uc002fmw.1_Intron|ZNF778_uc010vpg.1_Intron	NM_182531	NP_872337	Q96MU6	ZN778_HUMAN	zinc finger protein 778						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0				BRCA - Breast invasive adenocarcinoma(80;0.0269)		TCAGTGTTACttttttttttt	0.269													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	16491329	16491329	+	IGR	DEL	T	-	-	rs79101964		TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:16491329delT								ZNF287 (18809 upstream) : ZNF624 (32719 downstream)																							ttcttttttcttttttttttt	0.373													2	4	---	---	---	---	
TBC1D3	729873	broad.mit.edu	37	17	36351714	36351715	+	Intron	INS	-	A	A			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:36351714_36351715insA	uc002hpr.2	-						TBC1D3_uc010cvk.2_Intron|TBC1D3_uc010wdn.1_Intron	NM_001123391	NP_001116863	Q8IZP1	TBC3A_HUMAN	TBC1 domain family, member 3							intracellular	Rab GTPase activator activity				0	Breast(7;2.97e-12)	Breast(25;0.102)|Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		gaactttaattaaaaaaaaaga	0.040													9	6	---	---	---	---	
B4GALNT2	124872	broad.mit.edu	37	17	47244520	47244522	+	Intron	DEL	AGA	-	-	rs72351227		TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47244520_47244522delAGA	uc002ion.2	+						B4GALNT2_uc010wlt.1_Intron|B4GALNT2_uc010wlu.1_Intron	NM_153446	NP_703147	Q8NHY0	B4GN2_HUMAN	beta-1,4-N-acetyl-galactosaminyl transferase 2						lipid glycosylation|negative regulation of cell-cell adhesion|UDP-N-acetylgalactosamine metabolic process	integral to Golgi membrane	acetylgalactosaminyltransferase activity			large_intestine(1)|ovary(1)	2			all cancers(6;0.000316)			AACTTAAGAGAGAAGATGTTCCA	0.448													4	2	---	---	---	---	
TLK2	11011	broad.mit.edu	37	17	60550365	60550365	+	Intron	DEL	A	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:60550365delA	uc002izx.3	+									Q86UE8	TLK2_HUMAN	SubName: Full=Putative uncharacterized protein TLK1; Flags: Fragment;						cell cycle|chromatin modification|intracellular signal transduction|regulation of chromatin assembly or disassembly|response to DNA damage stimulus	nucleus	ATP binding|protein binding|protein serine/threonine kinase activity			stomach(1)|kidney(1)	2						ACTTACAAGCAAAAAAATAAC	0.468													1	5	---	---	---	---	
PITPNC1	26207	broad.mit.edu	37	17	65517250	65517251	+	Intron	INS	-	G	G	rs148039671	by1000genomes	TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:65517250_65517251insG	uc002jgc.2	+						PITPNC1_uc002jgb.2_Intron	NM_012417	NP_036549	Q9UKF7	PITC1_HUMAN	phosphatidylinositol transfer protein,						signal transduction	cytoplasm	lipid binding|phosphatidylinositol transporter activity|protein binding			skin(1)	1	all_cancers(12;3.03e-10)		BRCA - Breast invasive adenocarcinoma(8;2.08e-08)|Colorectal(3;0.198)			CAGCAACAGCAGGATAGAGGTT	0.455													3	4	---	---	---	---	
PTPRM	5797	broad.mit.edu	37	18	8023106	8023106	+	Intron	DEL	G	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:8023106delG	uc002knn.3	+						PTPRM_uc010dkv.2_Intron|PTPRM_uc010wzl.1_Intron	NM_002845	NP_002836	P28827	PTPRM_HUMAN	protein tyrosine phosphatase, receptor type, M						homophilic cell adhesion|negative regulation of angiogenesis|negative regulation of endothelial cell migration|negative regulation of endothelial cell proliferation|response to drug|retina layer formation|retinal ganglion cell axon guidance	cell-cell adherens junction|integral to plasma membrane|lamellipodium|perinuclear region of cytoplasm	cadherin binding|transmembrane receptor protein tyrosine phosphatase activity			lung(3)|ovary(2)|central_nervous_system(1)	6		Colorectal(10;0.234)				ATGTTGCGGAGGTGATGGAAG	0.493													1	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	8701599	8701599	+	IGR	DEL	G	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:8701599delG								RAB12 (62220 upstream) : KIAA0802 (5810 downstream)																							agatttacctggtgtcaaagc	0.199													4	2	---	---	---	---	
TWSG1	57045	broad.mit.edu	37	18	9360361	9360361	+	Intron	DEL	T	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:9360361delT	uc002knz.2	+						TWSG1_uc002koa.2_Intron	NM_020648	NP_065699	Q9GZX9	TWSG1_HUMAN	twisted gastrulation precursor											ovary(1)|pancreas(1)	2						AGCAGCAGCATTTTTTTTTTG	0.299													4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	11649281	11649282	+	IGR	INS	-	T	T	rs113300006	by1000genomes	TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:11649281_11649282insT								FAM38B (947302 upstream) : GNAL (39854 downstream)																							tttgttttttgttttttttGGC	0.089													4	2	---	---	---	---	
AFG3L2	10939	broad.mit.edu	37	18	12359741	12359741	+	Intron	DEL	A	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:12359741delA	uc002kqz.1	-							NM_006796	NP_006787	Q9Y4W6	AFG32_HUMAN	AFG3 ATPase family gene 3-like 2						cell death|protein catabolic process|proteolysis	integral to membrane	ATP binding|metalloendopeptidase activity|nucleoside-triphosphatase activity|unfolded protein binding|zinc ion binding				0					Adenosine triphosphate(DB00171)	accccacctcaaaaaaaaaag	0.129													11	5	---	---	---	---	
C18orf16	147429	broad.mit.edu	37	18	24459396	24459397	+	Intron	INS	-	T	T			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:24459396_24459397insT	uc002kwb.2	+						C18orf16_uc010xbm.1_Intron	NR_026908				Homo sapiens cDNA FLJ30507 fis, clone BRAWH2000554.												0						Tctctttcttcttttttttttc	0.163													4	2	---	---	---	---	
HDHD2	84064	broad.mit.edu	37	18	44663014	44663014	+	Intron	DEL	T	-	-	rs144963110		TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:44663014delT	uc002lcs.2	-						HDHD2_uc002lct.2_Intron	NM_032124	NP_115500	Q9H0R4	HDHD2_HUMAN	haloacid dehalogenase-like hydrolase domain								hydrolase activity				0						AATACTTAGGtttttttttaa	0.284													5	3	---	---	---	---	
ATP8B1	5205	broad.mit.edu	37	18	55351600	55351600	+	Intron	DEL	T	-	-	rs690298		TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:55351600delT	uc002lgw.2	-						uc002lgv.1_Intron	NM_005603	NP_005594	O43520	AT8B1_HUMAN	ATPase, class I, type 8B, member 1						ATP biosynthetic process|bile acid and bile salt transport|negative regulation of transcription, DNA-dependent	apical plasma membrane|integral to plasma membrane|membrane fraction	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			breast(5)|ovary(2)|central_nervous_system(2)|lung(1)	10		Colorectal(73;0.229)				GCTCCCCCCCttttttttttt	0.194									Byler_disease				4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	75491616	75491616	+	IGR	DEL	A	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:75491616delA								GALR1 (509522 upstream) : None (None downstream)																							acacaccctcaaaaaggtgga	0.000													4	2	---	---	---	---	
CSNK1G2	1455	broad.mit.edu	37	19	1953014	1953014	+	Intron	DEL	A	-	-	rs77965237		TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1953014delA	uc002lul.3	+						C19orf34_uc002lum.2_Intron	NM_001319	NP_001310	P78368	KC1G2_HUMAN	casein kinase 1, gamma 2						sphingolipid metabolic process|Wnt receptor signaling pathway	cytosol	ATP binding|protein serine/threonine kinase activity			stomach(1)	1		Ovarian(11;2.11e-07)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		actccgtctgaaaaaaaaaac	0.438													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	14793967	14793967	+	IGR	DEL	G	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14793967delG								EMR3 (8237 upstream) : ZNF333 (6646 downstream)																							AAGATTTGCTGGGGGGCAGGG	0.413													4	2	---	---	---	---	
ZNF253	56242	broad.mit.edu	37	19	20003795	20003795	+	3'UTR	DEL	T	-	-	rs141633713		TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:20003795delT	uc002noj.2	+	4					ZNF253_uc002nok.2_3'UTR|ZNF253_uc002nol.2_RNA	NM_021047	NP_066385	O75346	ZN253_HUMAN	zinc finger protein 253						negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						TCTCAATTCCtttttttttga	0.179													4	2	---	---	---	---	
ZNF585A	199704	broad.mit.edu	37	19	37641929	37641929	+	3'UTR	DEL	T	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37641929delT	uc002ofo.1	-	5					ZNF585A_uc002ofm.1_3'UTR|ZNF585A_uc002ofn.1_3'UTR	NM_199126	NP_954577	Q6P3V2	Z585A_HUMAN	zinc finger protein 585A						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding|zinc ion binding			ovary(1)|central_nervous_system(1)|skin(1)	3			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			AGGTTTTTTCTTTTTTTTTTT	0.388													6	4	---	---	---	---	
ZNF569	148266	broad.mit.edu	37	19	37916539	37916539	+	Intron	DEL	T	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37916539delT	uc002ogi.2	-						ZNF569_uc002ogh.2_Intron|ZNF569_uc002ogj.2_Intron	NM_152484	NP_689697	Q5MCW4	ZN569_HUMAN	zinc finger protein 569						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(2)|skin(1)	3			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			ttcttttctctttttttttta	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	41331423	41331426	+	IGR	DEL	TGTA	-	-	rs10534714		TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41331423_41331426delTGTA								EGLN2 (17087 upstream) : CYP2A6 (18018 downstream)																							tatgtatgtgtgtatgtatgtatg	0.123													4	3	---	---	---	---	
ZNF160	90338	broad.mit.edu	37	19	53573669	53573669	+	Intron	DEL	T	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53573669delT	uc010eqk.2	-						ZNF160_uc002qaq.3_Intron|ZNF160_uc002qar.3_Intron	NM_001102603	NP_001096073	Q9HCG1	ZN160_HUMAN	zinc finger protein 160						hemopoiesis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			central_nervous_system(1)	1				GBM - Glioblastoma multiforme(134;0.02)		AACAAAAATGttttttttttt	0.134													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	10968542	10968543	+	IGR	INS	-	A	A			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:10968542_10968543insA								JAG1 (313848 upstream) : BTBD3 (902934 downstream)																							taagactagttacaaatcataa	0.000													4	2	---	---	---	---	
ISM1	140862	broad.mit.edu	37	20	13258191	13258191	+	Intron	DEL	G	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:13258191delG	uc010gce.1	+						TASP1_uc010zri.1_Intron	NM_080826	NP_543016	B1AKI9	ISM1_HUMAN	isthmin 1 homolog precursor							extracellular region					0						GCTTCTGTGTGGGTCCCTGTT	0.498													4	2	---	---	---	---	
MACROD2	140733	broad.mit.edu	37	20	15418100	15418100	+	Intron	DEL	C	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:15418100delC	uc002wou.2	+						MACROD2_uc002wot.2_Intron|MACROD2_uc002woz.2_Intron	NM_080676	NP_542407	A1Z1Q3	MACD2_HUMAN	MACRO domain containing 2 isoform 1												0		all_neural(2;0.0381)|Acute lymphoblastic leukemia(2;0.175)				CTATCTCATGCCCCAAACAGA	0.328													4	2	---	---	---	---	
TMEM90B	79953	broad.mit.edu	37	20	24460611	24460612	+	Intron	DEL	CA	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:24460611_24460612delCA	uc002wtw.1	+							NM_024893	NP_079169	Q9H7V2	SYNG1_HUMAN	transmembrane protein 90B						response to biotic stimulus	early endosome membrane|integral to membrane|plasma membrane					0						caaatgcctgcacacacacaca	0.327													4	2	---	---	---	---	
C20orf191	149934	broad.mit.edu	37	20	26094861	26094862	+	5'Flank	INS	-	TTC	TTC			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:26094861_26094862insTTC	uc002wvj.3	-							NR_003678				SubName: Full=Putative uncharacterized protein ENSP00000323172;												0						TAATGTGTCATTTTTTATATTT	0.188													13	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	37251790	37251791	+	IGR	INS	-	GG	GG			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37251790_37251791insGG								ADIG (34686 upstream) : SLC32A1 (101314 downstream)																							ctggccctgctctgtcCCCTGC	0.257													3	3	---	---	---	---	
PTPRT	11122	broad.mit.edu	37	20	41613591	41613591	+	Intron	DEL	A	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:41613591delA	uc002xkg.2	-						PTPRT_uc010ggj.2_Intron	NM_007050	NP_008981	O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T						homophilic cell adhesion|transmembrane receptor protein tyrosine kinase signaling pathway	cell surface|integral to membrane|plasma membrane	alpha-catenin binding|beta-catenin binding|cadherin binding|delta-catenin binding|gamma-catenin binding|protein tyrosine phosphatase activity|receptor activity			skin(8)|ovary(7)|lung(5)	20		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				TAGGTGGCCTAAAGGGTGAAT	0.453													4	2	---	---	---	---	
PCK1	5105	broad.mit.edu	37	20	56139116	56139117	+	Intron	INS	-	A	A			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:56139116_56139117insA	uc002xyn.3	+						PCK1_uc010zzm.1_Intron	NM_002591	NP_002582	P35558	PCKGC_HUMAN	cytosolic phosphoenolpyruvate carboxykinase 1						gluconeogenesis|glucose homeostasis|glycerol biosynthetic process from pyruvate|response to insulin stimulus	cytosol|nucleus	carboxylic acid binding|GTP binding|magnesium ion binding|manganese ion binding|phosphoenolpyruvate carboxykinase (GTP) activity			skin(1)	1	Lung NSC(12;0.000764)|all_lung(29;0.00264)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(13;9.88e-12)|Epithelial(14;3.41e-08)|all cancers(14;2.13e-07)			TCTAGGGAGGGAAAAAAGATTT	0.381													18	10	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	56445197	56445197	+	IGR	DEL	C	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:56445197delC								PMEPA1 (158656 upstream) : C20orf85 (280786 downstream)																							CATCCATGTGCCCAGAGGCTG	0.378													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	10751362	10751362	+	IGR	DEL	T	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10751362delT								None (None upstream) : TPTE (155381 downstream)																							aactcctttgtgatgtgtgca	0.000													6	3	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11069167	11069168	+	Intron	INS	-	T	T	rs2698697		TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11069167_11069168insT	uc002yit.1	-						BAGE_uc002yix.2_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		attaaaaaaaacttagaactca	0.000													4	2	---	---	---	---	
GART	2618	broad.mit.edu	37	21	34903299	34903300	+	Intron	DEL	TT	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:34903299_34903300delTT	uc002yrx.2	-						GART_uc002yrz.2_Intron|GART_uc010gmd.2_Intron|GART_uc002yry.2_Intron|GART_uc002ysa.2_Intron	NM_000819	NP_000810	P22102	PUR2_HUMAN	phosphoribosylglycinamide formyltransferase,						'de novo' IMP biosynthetic process|purine base biosynthetic process	cytosol	ATP binding|metal ion binding|methyltransferase activity|phosphoribosylamine-glycine ligase activity|phosphoribosylformylglycinamidine cyclo-ligase activity|phosphoribosylglycinamide formyltransferase activity|protein binding			ovary(1)	1					Pemetrexed(DB00642)	GAAAAGTTTGTTTTTTTTTTTG	0.272													4	4	---	---	---	---	
SIM2	6493	broad.mit.edu	37	21	38114302	38114303	+	Intron	INS	-	T	T			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:38114302_38114303insT	uc002yvr.2	+						SIM2_uc002yvq.2_Intron	NM_005069	NP_005060	Q14190	SIM2_HUMAN	single-minded homolog 2 long isoform						cell differentiation|nervous system development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|signal transducer activity			central_nervous_system(1)	1						cttttttttaattttttttttt	0.158													4	2	---	---	---	---	
DSCAM	1826	broad.mit.edu	37	21	42058057	42058058	+	Intron	DEL	CA	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:42058057_42058058delCA	uc002yyq.1	-						DSCAM_uc002yyr.1_Intron	NM_001389	NP_001380	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule isoform						cell adhesion|dendrite self-avoidance|negative regulation of cell adhesion|positive regulation of axon extension involved in axon guidance|positive regulation of phosphorylation	axon|extracellular region|growth cone|integral to plasma membrane|membrane fraction	protein binding			ovary(6)|skin(4)|upper_aerodigestive_tract(1)	11		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)				agatacagagcacacacatcac	0.134													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	44593890	44593891	+	IGR	DEL	AC	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:44593890_44593891delAC								CRYAA (977 upstream) : SIK1 (240507 downstream)																							cacaccacagacacacacacac	0.342													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	46170870	46170870	+	IGR	DEL	T	-	-	rs72100662		TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:46170870delT								C21orf29 (39375 upstream) : UBE2G2 (18086 downstream)																							AATACTGGTATTTTTTAAAAG	0.423													1	6	---	---	---	---	
HIRA	7290	broad.mit.edu	37	22	19424345	19424345	+	Intron	DEL	A	-	-	rs68015924		TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:19424345delA	uc010gro.1	-						HIRA_uc010grp.2_Intron	NM_003325	NP_003316	P54198	HIRA_HUMAN	HIR histone cell cycle regulation defective						chromatin modification|regulation of transcription from RNA polymerase II promoter	PML body	chromatin binding|protein binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity			ovary(1)	1	Colorectal(54;0.0993)					TCAAATGGGGAAAAAAAAATG	0.438													6	3	---	---	---	---	
GGT1	2678	broad.mit.edu	37	22	25016169	25016170	+	Intron	INS	-	T	T	rs28418841	by1000genomes	TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:25016169_25016170insT	uc003aan.1	+						GGT1_uc003aas.1_Intron|GGT1_uc003aat.1_Intron|GGT1_uc003aau.1_Intron|GGT1_uc003aav.1_Intron|GGT1_uc003aaw.1_Intron|GGT1_uc003aax.1_Intron	NM_013430	NP_038347	P19440	GGT1_HUMAN	gamma-glutamyltransferase 1 precursor						glutathione biosynthetic process	integral to membrane	acyltransferase activity|gamma-glutamyltransferase activity|protein binding				0					Glutathione(DB00143)	aaaaaaaaaaaaTCTTTCCTCC	0.277													3	3	---	---	---	---	
TTC28	23331	broad.mit.edu	37	22	28526698	28526698	+	Intron	DEL	T	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:28526698delT	uc003adp.3	-							NM_001145418	NP_001138890	Q96AY4	TTC28_HUMAN	tetratricopeptide repeat domain 28								binding				0						TGGAGATTCCTTTTGCTGCAT	0.373													4	2	---	---	---	---	
LARGE	9215	broad.mit.edu	37	22	34017436	34017437	+	Intron	INS	-	TGA	TGA	rs139222701	by1000genomes	TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:34017436_34017437insTGA	uc003and.3	-						LARGE_uc003ane.3_Intron|LARGE_uc010gwp.2_Intron|LARGE_uc011ame.1_Intron|LARGE_uc011amf.1_Intron	NM_004737	NP_004728	O95461	LARGE_HUMAN	like-glycosyltransferase						glycosphingolipid biosynthetic process|muscle cell homeostasis|N-acetylglucosamine metabolic process|protein glycosylation	integral to Golgi membrane	acetylglucosaminyltransferase activity			ovary(1)|central_nervous_system(1)|skin(1)	3		Lung NSC(1;0.219)				TAAAACTGATTTGATGTAATGA	0.327													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	44945177	44945181	+	IGR	DEL	TAAAT	-	-	rs137926026		TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:44945177_44945181delTAAAT								LDOC1L (51172 upstream) : NCRNA00207 (20038 downstream)																							CCCACAGCAGTAAATTAGAGATCAG	0.478													4	3	---	---	---	---	
ASMTL	8623	broad.mit.edu	37	X	1536640	1536641	+	Intron	DEL	CG	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1536640_1536641delCG	uc004cpx.1	-						ASMTL_uc011mhe.1_Intron|ASMTL_uc004cpy.1_Intron|ASMTL_uc011mhf.1_Intron	NM_004192	NP_004183	O95671	ASML_HUMAN	acetylserotonin O-methyltransferase-like						melatonin biosynthetic process	cytoplasm	acetylserotonin O-methyltransferase activity				0		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				gacatgctcacgcacagacatg	0.040													4	3	---	---	---	---	
CETN2	1069	broad.mit.edu	37	X	151996989	151996989	+	Intron	DEL	A	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:151996989delA	uc004fgq.2	-						CETN2_uc004fgr.2_Intron|NSDHL_uc004fgt.1_5'Flank|NSDHL_uc004fgs.1_5'Flank	NM_004344	NP_004335	P41208	CETN2_HUMAN	caltractin						cell division|centriole replication|G2/M transition of mitotic cell cycle|mitosis|nucleotide-excision repair|regulation of cytokinesis	centriole|cytosol|XPC complex	ATP binding|ATP-dependent helicase activity|calcium ion binding|nucleic acid binding				0	Acute lymphoblastic leukemia(192;6.56e-05)					GCTTTTCTTCAAAGAGGTGCT	0.308								Direct_reversal_of_damage|NER					8	34	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	9960850	9960850	+	IGR	DEL	G	-	-			TCGA-CZ-5463-01A-01D-1501-10	TCGA-CZ-5463-11A-01D-1501-10									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:9960850delG								TTTY22 (309996 upstream) : None (None downstream)																							TAGAGGCCCTGGGGAATATTG	0.448													3	5	---	---	---	---	
