Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	validation_status	validation_method	validation_tumor_sample	validation_alt_allele
AGRN	375790	broad.mit.edu	37	1	966229	966230	+	Intron	DEL	GT	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:966229_966230delGT	uc001ack.1	+							NM_198576	NP_940978			agrin precursor						axon guidance|clustering of voltage-gated sodium channels|muscarinic acetylcholine receptor signaling pathway|receptor clustering	basal lamina	laminin binding|structural constituent of cytoskeleton			central_nervous_system(2)|breast(1)	3	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		UCEC - Uterine corpus endometrioid carcinoma (11;0.00462)|Epithelial(90;5.98e-38)|OV - Ovarian serous cystadenocarcinoma(86;5.43e-23)|Colorectal(212;5.97e-05)|COAD - Colon adenocarcinoma(227;0.000201)|Kidney(185;0.0024)|BRCA - Breast invasive adenocarcinoma(365;0.00246)|STAD - Stomach adenocarcinoma(132;0.00645)|KIRC - Kidney renal clear cell carcinoma(229;0.0354)|Lung(427;0.201)														---	---	---	---
CDK11B	984	broad.mit.edu	37	1	1651078	1651079	+	Intron	DEL	GG	-	-	rs148524836		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1651078_1651079delGG	uc001agv.1	-						CDK11B_uc001aha.1_Intron|CDK11B_uc001agw.1_Intron|CDK11B_uc001agy.1_Intron|CDK11B_uc001agx.1_Intron|CDK11B_uc001agz.1_Intron|SLC35E2B_uc001ahh.3_Intron|SLC35E2_uc009vkm.1_Intron|CDK11A_uc009vkr.2_Intron|CDK11A_uc009vks.2_Intron|CDK11A_uc010nys.1_Intron|CDK11A_uc010nyt.1_Intron|CDK11A_uc010nyu.1_Intron|CDK11A_uc009vkt.1_Intron|CDK11A_uc009vku.1_Intron|CDK11A_uc009vkv.1_Intron|CDK11A_uc001aht.1_Intron|CDK11B_uc001ahu.1_Intron|CDK11B_uc001ahv.1_Intron|CDK11B_uc001ahw.1_Intron	NM_033486	NP_277021			cell division cycle 2-like 1 (PITSLRE proteins)						apoptosis|cell proliferation|mitosis|regulation of cell growth|regulation of mRNA processing|regulation of transcription, DNA-dependent	cytoplasm|nucleus	ATP binding|cyclin-dependent protein kinase activity|protein binding			skin(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	18879445	18879445	+	IGR	DEL	C	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:18879445delC								KLHDC7A (66906 upstream) : PAX7 (78055 downstream)																																			---	---	---	---
PLA2G5	5322	broad.mit.edu	37	1	20410204	20410204	+	Intron	DEL	G	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:20410204delG	uc001bcy.2	+						PLA2G5_uc001bcw.2_Intron|PLA2G5_uc001bcx.2_Intron	NM_000929	NP_000920			phospholipase A2, group V precursor						lipid catabolic process	extracellular region	calcium ion binding|calcium-dependent phospholipase A2 activity			skin(1)	1		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000249)|Lung NSC(340;0.000287)|Breast(348;0.000812)|Ovarian(437;0.00328)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|COAD - Colon adenocarcinoma(152;1.22e-05)|BRCA - Breast invasive adenocarcinoma(304;8.15e-05)|Kidney(64;0.000184)|GBM - Glioblastoma multiforme(114;0.00089)|KIRC - Kidney renal clear cell carcinoma(64;0.0027)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0652)														---	---	---	---
HMGCL	3155	broad.mit.edu	37	1	24150359	24150359	+	Intron	DEL	A	-	-	rs74601051		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:24150359delA	uc001bib.2	-						HMGCL_uc010oec.1_Intron|HMGCL_uc009vqr.2_Intron|HMGCL_uc001bic.2_Intron|HMGCL_uc009vqs.1_Intron|HMGCL_uc001bid.1_Intron	NM_000191	NP_000182			3-hydroxy-3-methylglutaryl CoA lyase isoform 1						acetoacetic acid biosynthetic process|ketone body biosynthetic process	mitochondrial matrix	hydroxymethylglutaryl-CoA lyase activity|metal ion binding			central_nervous_system(1)	1		Colorectal(325;3.46e-05)|Renal(390;0.000219)|Lung NSC(340;0.000233)|all_lung(284;0.000321)|Ovarian(437;0.00348)|Breast(348;0.0044)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;2.38e-24)|Colorectal(126;5.58e-08)|COAD - Colon adenocarcinoma(152;3.12e-06)|GBM - Glioblastoma multiforme(114;4.9e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000982)|KIRC - Kidney renal clear cell carcinoma(1967;0.0034)|STAD - Stomach adenocarcinoma(196;0.0128)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0856)|LUSC - Lung squamous cell carcinoma(448;0.188)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	27294738	27294738	+	IGR	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:27294738delA								C1orf172 (7841 upstream) : TRNP1 (25457 downstream)																																			---	---	---	---
SESN2	83667	broad.mit.edu	37	1	28603717	28603717	+	Intron	DEL	T	-	-	rs112426438		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:28603717delT	uc001bps.2	+							NM_031459	NP_113647			sestrin 2						cell cycle arrest	cytoplasm|nucleus				skin(3)|ovary(2)|pancreas(1)|lung(1)	7		Colorectal(325;3.46e-05)|Lung NSC(340;4.37e-05)|all_lung(284;4.76e-05)|Renal(390;0.00121)|Breast(348;0.00345)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0261)		OV - Ovarian serous cystadenocarcinoma(117;2.98e-22)|Colorectal(126;3.04e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00279)|STAD - Stomach adenocarcinoma(196;0.00303)|BRCA - Breast invasive adenocarcinoma(304;0.00595)|READ - Rectum adenocarcinoma(331;0.0649)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	30157742	30157742	+	IGR	DEL	C	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:30157742delC								PTPRU (504427 upstream) : None (None downstream)																																			---	---	---	---
ZCCHC17	51538	broad.mit.edu	37	1	31817996	31817999	+	Intron	DEL	TGTT	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:31817996_31817999delTGTT	uc001bsp.1	+						ZCCHC17_uc001bsq.1_Intron|ZCCHC17_uc010ogf.1_Intron|ZCCHC17_uc009vtu.1_Intron|ZCCHC17_uc001bsr.1_Intron|ZCCHC17_uc009vtv.1_Intron	NM_016505	NP_057589			zinc finger, CCHC domain containing 17							nucleolus	RNA binding|zinc ion binding			ovary(1)	1		Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.127)|all_neural(195;0.146)|Medulloblastoma(700;0.151)|Breast(348;0.222)		STAD - Stomach adenocarcinoma(196;0.0215)|READ - Rectum adenocarcinoma(331;0.168)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	32569626	32569626	+	IGR	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32569626delA								TMEM39B (1161 upstream) : KPNA6 (4018 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	32877204	32877205	+	IGR	INS	-	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32877204_32877205insT								BSDC1 (17142 upstream) : ZBTB8A (53453 downstream)																																			---	---	---	---
CSMD2	114784	broad.mit.edu	37	1	34083617	34083618	+	Intron	INS	-	AC	AC			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:34083617_34083618insAC	uc001bxn.1	-						CSMD2_uc001bxm.1_Intron|CSMD2_uc001bxo.1_Intron	NM_052896	NP_443128			CUB and Sushi multiple domains 2							integral to membrane|plasma membrane	protein binding			ovary(6)|skin(5)|pancreas(1)	12		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)																---	---	---	---
CSMD2	114784	broad.mit.edu	37	1	34187903	34187903	+	Intron	DEL	C	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:34187903delC	uc001bxn.1	-						CSMD2_uc001bxm.1_Intron	NM_052896	NP_443128			CUB and Sushi multiple domains 2							integral to membrane|plasma membrane	protein binding			ovary(6)|skin(5)|pancreas(1)	12		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)																---	---	---	---
C1orf94	84970	broad.mit.edu	37	1	34640792	34640795	+	Intron	DEL	TTTT	-	-	rs10608833		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:34640792_34640795delTTTT	uc001bxs.3	+						C1orf94_uc001bxt.2_5'Flank	NM_032884	NP_116273			hypothetical protein LOC84970 isoform b								protein binding				0		Myeloproliferative disorder(586;0.0393)																---	---	---	---
Unknown	0	broad.mit.edu	37	1	34689076	34689077	+	IGR	INS	-	T	T	rs148332887		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:34689076_34689077insT								C1orf94 (4347 upstream) : MIR552 (446123 downstream)																																			---	---	---	---
GRIK3	2899	broad.mit.edu	37	1	37365601	37365601	+	Intron	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:37365601delA	uc001caz.2	-						GRIK3_uc001cba.1_Intron	NM_000831	NP_000822			glutamate receptor, ionotropic, kainate 3						negative regulation of synaptic transmission, glutamatergic|regulation of membrane potential|synaptic transmission	cell junction|dendrite cytoplasm|integral to plasma membrane|perikaryon|postsynaptic membrane|terminal button	adenylate cyclase inhibiting metabotropic glutamate receptor activity|extracellular-glutamate-gated ion channel activity|G-protein-coupled receptor binding|kainate selective glutamate receptor activity			ovary(3)|skin(2)|large_intestine(1)|breast(1)	7		Myeloproliferative disorder(586;0.0258)|all_neural(195;0.169)			L-Glutamic Acid(DB00142)													---	---	---	---
Unknown	0	broad.mit.edu	37	1	39436168	39436169	+	IGR	INS	-	TG	TG	rs141537396	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39436168_39436169insTG								RHBDL2 (28712 upstream) : AKIRIN1 (20747 downstream)																																			---	---	---	---
HPCAL4	51440	broad.mit.edu	37	1	40158806	40158806	+	5'Flank	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:40158806delT	uc001cdr.2	-						HPCAL4_uc010oix.1_5'Flank	NM_016257	NP_057341			hippocalcin-like protein 4						central nervous system development	intracellular	calcium ion binding			central_nervous_system(1)	1	all_cancers(7;4.65e-13)|Lung NSC(20;2.88e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1.87e-18)|Epithelial(16;4.3e-17)|all cancers(16;8.48e-16)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)															---	---	---	---
ST3GAL3	6487	broad.mit.edu	37	1	44235966	44235966	+	Intron	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:44235966delA	uc001ckc.2	+						ST3GAL3_uc009vwu.1_Intron|ST3GAL3_uc010okj.1_Intron|ST3GAL3_uc001cjz.2_Intron|ST3GAL3_uc001cka.2_Intron|ST3GAL3_uc001ckb.2_Intron|ST3GAL3_uc001ckd.2_Intron|ST3GAL3_uc001cke.2_Intron|ST3GAL3_uc001ckf.2_Intron|ST3GAL3_uc001ckg.2_Intron|ST3GAL3_uc001ckh.2_Intron|ST3GAL3_uc001cki.2_Intron|ST3GAL3_uc009vwv.2_Intron|ST3GAL3_uc001ckj.2_Intron|ST3GAL3_uc009vww.2_Intron|ST3GAL3_uc001ckk.2_Intron|ST3GAL3_uc009vwy.2_Intron|ST3GAL3_uc009vwx.2_Intron|ST3GAL3_uc001ckm.2_Intron|ST3GAL3_uc001ckl.2_Intron|ST3GAL3_uc009vwz.2_Intron|ST3GAL3_uc001ckn.2_Intron|ST3GAL3_uc001ckp.2_Intron|ST3GAL3_uc001cko.2_Intron|ST3GAL3_uc009vxa.2_Intron|ST3GAL3_uc001ckq.2_Intron|ST3GAL3_uc001ckr.2_Intron|ST3GAL3_uc009vxb.2_Intron	NM_006279	NP_006270			sialyltransferase 6 isoform j						protein glycosylation	extracellular region|Golgi cisterna membrane|integral to Golgi membrane	N-acetyllactosaminide alpha-2,3-sialyltransferase activity			ovary(3)	3	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0518)																---	---	---	---
KLF17	128209	broad.mit.edu	37	1	44572113	44572120	+	Intron	DEL	CCTATTCT	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:44572113_44572120delCCTATTCT	uc009vxf.1	+							NM_173484	NP_775755			zinc finger protein 393						regulation of transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|zinc ion binding			ovary(1)|skin(1)	2	Acute lymphoblastic leukemia(166;0.155)																	---	---	---	---
Unknown	0	broad.mit.edu	37	1	47668232	47668232	+	IGR	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:47668232delA								PDZK1IP1 (12461 upstream) : TAL1 (13731 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	47931770	47931773	+	IGR	DEL	TCTC	-	-	rs68176672		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:47931770_47931773delTCTC								FOXD2 (25408 upstream) : SKINTL (635614 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	48149789	48149789	+	IGR	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:48149789delT								FOXD2 (243427 upstream) : SKINTL (417598 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	51480742	51480742	+	IGR	DEL	A	-	-	rs35273009		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:51480742delA								CDKN2C (40435 upstream) : C1orf185 (87164 downstream)														p.0?(1)|p.?(1)																					---	---	---	---
Unknown	0	broad.mit.edu	37	1	53639390	53639391	+	IGR	DEL	CA	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:53639390_53639391delCA								SLC1A7 (31101 upstream) : CPT2 (22710 downstream)																																			---	---	---	---
SSBP3	23648	broad.mit.edu	37	1	54841865	54841866	+	Intron	DEL	GT	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:54841865_54841866delGT	uc001cxe.2	-						SSBP3_uc001cxf.2_Intron|SSBP3_uc001cxg.2_Intron	NM_145716	NP_663768			single stranded DNA binding protein 3 isoform a						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	single-stranded DNA binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	55222267	55222267	+	IGR	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:55222267delT								C1orf175 (14287 upstream) : PARS2 (306 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	61064063	61064065	+	IGR	DEL	GAG	-	-	rs66931197		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:61064063_61064065delGAG								C1orf87 (524637 upstream) : NFIA (478881 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	62081043	62081044	+	IGR	INS	-	AG	AG			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:62081043_62081044insAG								NFIA (152584 upstream) : TM2D1 (65675 downstream)																																			---	---	---	---
TM2D1	83941	broad.mit.edu	37	1	62160525	62160526	+	Intron	INS	-	TA	TA	rs149200386	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:62160525_62160526insTA	uc001czz.1	-							NM_032027	NP_114416			beta-amyloid binding protein precursor						apoptosis					ovary(1)	1																		---	---	---	---
DOCK7	85440	broad.mit.edu	37	1	62929379	62929379	+	Intron	DEL	A	-	-	rs75160723		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:62929379delA	uc001daq.2	-						DOCK7_uc001dan.2_Intron|DOCK7_uc001dao.2_Intron|DOCK7_uc001dap.2_Intron|DOCK7_uc001dam.2_Intron|DOCK7_uc010oov.1_Intron	NM_033407	NP_212132			dedicator of cytokinesis 7						activation of Rac GTPase activity|axonogenesis|establishment of neuroblast polarity|microtubule cytoskeleton organization|positive regulation of peptidyl-serine phosphorylation	axon|basal part of cell|growth cone	GTP binding|guanyl-nucleotide exchange factor activity|Rac GTPase binding			ovary(2)	2																		---	---	---	---
ROR1	4919	broad.mit.edu	37	1	64520755	64520755	+	Intron	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:64520755delA	uc001dbj.2	+						ROR1_uc001dbi.3_Intron	NM_005012	NP_005003			receptor tyrosine kinase-like orphan receptor 1						transmembrane receptor protein tyrosine kinase signaling pathway	cytoplasm|integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity|Wnt-protein binding			ovary(6)|large_intestine(3)|breast(3)|stomach(2)|lung(2)|central_nervous_system(1)|skin(1)|kidney(1)	19																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	65598264	65598264	+	IGR	DEL	T	-	-	rs72677666	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:65598264delT								MIR101-1 (74073 upstream) : AK3L1 (14968 downstream)																																			---	---	---	---
WDR78	79819	broad.mit.edu	37	1	67365717	67365717	+	Intron	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:67365717delT	uc001dcx.2	-						WDR78_uc001dcy.2_Intron|WDR78_uc001dcz.2_Intron	NM_024763	NP_079039			WD repeat domain 78 isoform 1											ovary(2)	2																		---	---	---	---
AK5	26289	broad.mit.edu	37	1	77838451	77838452	+	Intron	INS	-	GTGC	GTGC	rs72042133		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:77838451_77838452insGTGC	uc001dhn.2	+						AK5_uc001dho.2_Intron	NM_174858	NP_777283			adenylate kinase 5 isoform 1						ADP biosynthetic process|ATP metabolic process|dADP biosynthetic process|nucleobase, nucleoside and nucleotide interconversion|pyrimidine ribonucleotide biosynthetic process|signal transduction	centrosome|cytosol	adenylate kinase activity|ATP binding|cAMP-dependent protein kinase regulator activity|nucleoside kinase activity			skin(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	80611765	80611766	+	IGR	INS	-	TG	TG	rs61773496		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:80611765_80611766insTG								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	83059502	83059502	+	IGR	DEL	G	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:83059502delG								LPHN2 (601396 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	85221550	85221550	+	IGR	DEL	C	-	-	rs67533437		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:85221550delC								SSX2IP (65110 upstream) : LPAR3 (57536 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	86886617	86886617	+	IGR	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:86886617delA								ODF2L (24614 upstream) : CLCA2 (3152 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	88124714	88124715	+	IGR	DEL	GC	-	-	rs140238963	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:88124714_88124715delGC								LMO4 (310111 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	91377311	91377311	+	IGR	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:91377311delT								BARHL2 (194517 upstream) : ZNF644 (3549 downstream)																																			---	---	---	---
CCDC18	343099	broad.mit.edu	37	1	93668658	93668658	+	Intron	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:93668658delA	uc001dpq.2	+						CCDC18_uc009wdl.1_5'Flank	NM_206886	NP_996769			sarcoma antigen NY-SAR-41											ovary(2)|breast(2)|pancreas(1)	5		all_lung(203;0.00196)|Lung NSC(277;0.00903)|Melanoma(281;0.099)|all_neural(321;0.185)|Glioma(108;0.203)		all cancers(265;0.00166)|GBM - Glioblastoma multiforme(16;0.00551)|Epithelial(280;0.0967)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	95956148	95956151	+	IGR	DEL	AGAA	-	-	rs149752975		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:95956148_95956151delAGAA								RWDD3 (243375 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	99494378	99494378	+	Intron	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:99494378delA	uc001dsd.1	+											Homo sapiens cDNA FLJ38225 fis, clone FCBBF2003528.																														---	---	---	---
Unknown	0	broad.mit.edu	37	1	100425455	100425455	+	IGR	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:100425455delT								AGL (35876 upstream) : SLC35A3 (10085 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	105426203	105426204	+	IGR	INS	-	CA	CA			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:105426203_105426204insCA								None (None upstream) : None (None downstream)																																			---	---	---	---
FAM102B	284611	broad.mit.edu	37	1	109161458	109161459	+	Intron	INS	-	A	A	rs75360315		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109161458_109161459insA	uc010ouy.1	+							NM_001010883	NP_001010883			hypothetical protein LOC284611											large_intestine(1)	1		all_epithelial(167;5.52e-05)|all_lung(203;0.00026)|Lung NSC(277;0.000508)		Colorectal(144;0.0217)|Lung(183;0.109)|COAD - Colon adenocarcinoma(174;0.141)|Epithelial(280;0.182)														---	---	---	---
WDR47	22911	broad.mit.edu	37	1	109521116	109521116	+	Intron	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109521116delA	uc001dwj.2	-						WDR47_uc001dwl.2_Intron|WDR47_uc001dwi.2_Intron|WDR47_uc010ovf.1_Intron	NM_001142551	NP_001136023			WD repeat domain 47 isoform 3											ovary(1)	1		all_lung(203;0.00519)|all_epithelial(167;0.00611)|Lung NSC(277;0.00822)		Colorectal(144;0.0165)|Lung(183;0.0484)|COAD - Colon adenocarcinoma(174;0.128)|Epithelial(280;0.168)|all cancers(265;0.201)|LUSC - Lung squamous cell carcinoma(189;0.244)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	113353028	113353028	+	IGR	DEL	C	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:113353028delC								FAM19A3 (83174 upstream) : SLC16A1 (101444 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	114842816	114842816	+	IGR	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:114842816delA								SYT6 (146344 upstream) : TRIM33 (92585 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	119362472	119362472	+	IGR	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:119362472delA								SPAG17 (634624 upstream) : TBX15 (63194 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	120196924	120196925	+	IGR	INS	-	A	A	rs35693863		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120196924_120196925insA								ZNF697 (6534 upstream) : PHGDH (57494 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	120917198	120917198	+	IGR	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120917198delT								HIST2H2BA (2356 upstream) : FCGR1B (9711 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	121352613	121352613	+	IGR	DEL	A	-	-	rs111583359		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:121352613delA								LOC647121 (38927 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	142543012	142543012	+	IGR	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142543012delA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	142641755	142641755	+	Intron	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142641755delT	uc001eiw.1	+						uc001eix.1_Intron					Homo sapiens PNAS-130 mRNA, complete cds.																														---	---	---	---
Unknown	0	broad.mit.edu	37	1	142808478	142808478	+	Intron	DEL	A	-	-	rs71221819		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142808478delA	uc001eiw.1	+						uc001ejb.2_Intron|uc001ejd.1_Intron|uc001ejc.2_Intron					Homo sapiens PNAS-130 mRNA, complete cds.																														---	---	---	---
PDE4DIP	9659	broad.mit.edu	37	1	145024585	145024590	+	Intron	DEL	ACACAT	-	-	rs72171398		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145024585_145024590delACACAT	uc001elx.3	-						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001emh.2_Intron	NM_014644	NP_055459			phosphodiesterase 4D interacting protein isoform						cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)				T	PDGFRB	MPD								---	---	---	---
NBPF9	400818	broad.mit.edu	37	1	145092864	145092864	+	Intron	DEL	A	-	-	rs11401146		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145092864delA	uc010oye.1	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron					RecName: Full=Neuroblastoma breakpoint family member 8;							cytoplasm					0																		---	---	---	---
NBPF10	100132406	broad.mit.edu	37	1	145381736	145381736	+	Intron	DEL	A	-	-	rs150712838		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145381736delA	uc001emp.3	+							NM_017940	NP_060410			hypothetical protein LOC55672												0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)														---	---	---	---
NBPF10	100132406	broad.mit.edu	37	1	145645967	145645968	+	Intron	INS	-	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145645967_145645968insA	uc001emp.3	+						RNF115_uc001eoj.2_Intron|RNF115_uc001eok.2_Intron|RNF115_uc009wiy.2_Intron	NM_017940	NP_060410			hypothetical protein LOC55672												0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)														---	---	---	---
CHD1L	9557	broad.mit.edu	37	1	146758657	146758658	+	Intron	DEL	CT	-	-	rs145516505		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:146758657_146758658delCT	uc001epm.3	+						uc001epp.2_Intron|CHD1L_uc001epn.3_Intron|CHD1L_uc010ozo.1_Intron|CHD1L_uc009wjg.2_Intron|CHD1L_uc009wjh.2_Intron|CHD1L_uc010ozp.1_Intron|CHD1L_uc001epo.3_Intron|CHD1L_uc009wji.2_Intron	NM_004284	NP_004275			chromodomain helicase DNA binding protein						chromatin remodeling|DNA repair	cytoplasm|nucleus|plasma membrane	ATP binding|ATP-dependent DNA helicase activity|DNA binding|protein binding			ovary(3)|lung(2)|upper_aerodigestive_tract(1)	6	all_hematologic(923;0.0487)																	---	---	---	---
LOC200030	200030	broad.mit.edu	37	1	147720385	147720385	+	Intron	DEL	T	-	-	rs111322116		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:147720385delT	uc001eqf.2	-						LOC200030_uc010ozz.1_Intron|LOC200030_uc001eqe.2_Intron|LOC200030_uc001eqg.2_Intron	NM_017940	NP_060410			hypothetical protein LOC55672							cytoplasm					0																		---	---	---	---
LOC388692	388692	broad.mit.edu	37	1	149283132	149283132	+	RNA	DEL	A	-	-	rs149398765		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149283132delA	uc010pbf.1	+	1		c.3657delA				NR_027002				Homo sapiens cDNA FLJ13580 fis, clone PLACE1008851.												0																		---	---	---	---
OTUD7B	56957	broad.mit.edu	37	1	149981906	149981907	+	Intron	DEL	AC	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149981906_149981907delAC	uc001etn.2	-							NM_020205	NP_064590			zinc finger protein Cezanne						negative regulation of I-kappaB kinase/NF-kappaB cascade	cytoplasm|microtubule cytoskeleton|nucleus	cysteine-type peptidase activity|DNA binding|protein binding|zinc ion binding			ovary(1)|breast(1)|skin(1)	3	Breast(34;0.0009)|Ovarian(49;0.0265)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.247)															---	---	---	---
KCNN3	3782	broad.mit.edu	37	1	154728129	154728132	+	Intron	DEL	AAGG	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154728129_154728132delAAGG	uc001ffp.2	-						KCNN3_uc001ffo.2_Intron	NM_002249	NP_002240			small conductance calcium-activated potassium							integral to membrane	calmodulin binding			lung(1)	1	all_lung(78;2.29e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.108)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00819)															---	---	---	---
IQGAP3	128239	broad.mit.edu	37	1	156530966	156530966	+	Intron	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156530966delT	uc001fpf.2	-						IQGAP3_uc009wsb.1_Intron	NM_178229	NP_839943			IQ motif containing GTPase activating protein 3						small GTPase mediated signal transduction	intracellular	calmodulin binding|Ras GTPase activator activity			ovary(5)|skin(1)	6	all_hematologic(923;0.088)|Hepatocellular(266;0.158)																	---	---	---	---
CADM3	57863	broad.mit.edu	37	1	159171878	159171879	+	3'UTR	DEL	TG	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:159171878_159171879delTG	uc001ftl.2	+	9					CADM3_uc001ftk.2_3'UTR|uc001ftm.1_Intron|DARC_uc001fto.2_5'Flank	NM_001127173	NP_001120645			cell adhesion molecule 3 isoform 2						adherens junction organization|cell junction assembly|heterophilic cell-cell adhesion|homophilic cell adhesion	cell-cell junction|integral to membrane	protein homodimerization activity			ovary(2)	2	all_hematologic(112;0.0429)																	---	---	---	---
Unknown	0	broad.mit.edu	37	1	163682209	163682209	+	IGR	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:163682209delA								NUF2 (356656 upstream) : PBX1 (846593 downstream)																																			---	---	---	---
BAT2L2	23215	broad.mit.edu	37	1	171487093	171487093	+	Intron	DEL	G	-	-	rs80115932		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:171487093delG	uc010pmg.1	+						BAT2L2_uc001ghr.1_Intron	NM_015172	NP_055987			HBxAg transactivated protein 2								protein C-terminus binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	176248067	176248067	+	IGR	DEL	T	-	-	rs77593084		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:176248067delT								RFWD2 (71697 upstream) : PAPPA2 (184240 downstream)																																			---	---	---	---
FAM5B	57795	broad.mit.edu	37	1	177204506	177204506	+	Intron	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:177204506delT	uc001glf.2	+							NM_021165	NP_066988			family with sequence similarity 5, member B							extracellular region				skin(3)|ovary(2)|upper_aerodigestive_tract(1)	6																		---	---	---	---
ACBD6	84320	broad.mit.edu	37	1	180362221	180362222	+	Intron	DEL	GT	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:180362221_180362222delGT	uc001gog.2	-							NM_032360	NP_115736			acyl-coenzyme A binding domain containing 6							cytoplasm|nucleus	fatty-acyl-CoA binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	186583497	186583497	+	IGR	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186583497delA								PDC (153258 upstream) : PTGS2 (57448 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	186989424	186989424	+	IGR	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186989424delA								PLA2G4A (31319 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	188752727	188752727	+	IGR	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:188752727delT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	191037120	191037122	+	IGR	DEL	AAC	-	-	rs1116650	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:191037120_191037122delAAC								FAM5C (590361 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	192403482	192403485	+	IGR	DEL	TGTG	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:192403482_192403485delTGTG								RGS21 (67070 upstream) : RGS1 (141372 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	196005782	196005782	+	IGR	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:196005782delT								None (None upstream) : KCNT2 (189131 downstream)																																			---	---	---	---
ZNF281	23528	broad.mit.edu	37	1	200379783	200379783	+	5'Flank	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:200379783delA	uc001gve.2	-						uc010ppi.1_5'Flank|ZNF281_uc001gvf.1_5'Flank|ZNF281_uc001gvg.1_5'Flank	NM_012482	NP_036614			zinc finger protein 281						negative regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|zinc ion binding			ovary(1)|breast(1)	2																		---	---	---	---
IGFN1	91156	broad.mit.edu	37	1	201174290	201174290	+	RNA	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201174290delT	uc001gwb.2	+	11		c.1127delT								Homo sapiens eEF1A2 binding protein mRNA, complete cds.											ovary(2)|pancreas(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	204026222	204026225	+	IGR	DEL	CAAA	-	-	rs71787555		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:204026222_204026225delCAAA								C1orf157 (15830 upstream) : SOX13 (16021 downstream)																																			---	---	---	---
PLEKHA6	22874	broad.mit.edu	37	1	204231464	204231464	+	Intron	DEL	G	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:204231464delG	uc001hau.2	-							NM_014935	NP_055750			phosphoinositol 3-phosphate-binding protein-3											ovary(3)|pancreas(1)	4	all_cancers(21;0.0222)|Breast(84;0.179)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|BRCA - Breast invasive adenocarcinoma(75;0.0833)|Kidney(21;0.0934)|Epithelial(59;0.229)															---	---	---	---
KCNH1	3756	broad.mit.edu	37	1	211088134	211088136	+	Intron	DEL	GGA	-	-	rs10590477		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:211088134_211088136delGGA	uc001hib.2	-						KCNH1_uc001hic.2_Intron	NM_172362	NP_758872			potassium voltage-gated channel, subfamily H,						myoblast fusion|regulation of transcription, DNA-dependent	voltage-gated potassium channel complex	calmodulin binding|delayed rectifier potassium channel activity|two-component sensor activity			ovary(4)|central_nervous_system(1)	5				OV - Ovarian serous cystadenocarcinoma(81;0.0109)|all cancers(67;0.141)|Epithelial(68;0.185)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	214908957	214908958	+	IGR	INS	-	TG	TG	rs72065590		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:214908957_214908958insTG								CENPF (71045 upstream) : KCNK2 (269927 downstream)																																			---	---	---	---
SUSD4	55061	broad.mit.edu	37	1	223534024	223534024	+	Intron	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:223534024delT	uc001hnx.2	-						SUSD4_uc001hny.3_Intron|SUSD4_uc010puw.1_Intron|SUSD4_uc001hnz.2_Intron|SUSD4_uc010pux.1_Intron	NM_017982	NP_060452			sushi domain containing 4 isoform a							integral to membrane					0				GBM - Glioblastoma multiforme(131;0.0611)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	223885250	223885251	+	IGR	INS	-	G	G	rs142725187	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:223885250_223885251insG								CAPN8 (31814 upstream) : CAPN2 (4044 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	224644967	224644972	+	Intron	DEL	CTCTCT	-	-	rs71755086		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:224644967_224644972delCTCTCT	uc001hor.1	+											full-length cDNA clone CS0DC026YN07 of Neuroblastoma Cot 25-normalized of Homo sapiens (human).																														---	---	---	---
DNAH14	127602	broad.mit.edu	37	1	225516346	225516347	+	Intron	INS	-	A	A	rs138034187	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:225516346_225516347insA	uc001how.2	+						DNAH14_uc001hox.2_Intron	NM_001373	NP_001364			dynein, axonemal, heavy polypeptide 14 isoform						microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|microtubule motor activity			central_nervous_system(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	228667703	228667704	+	IGR	DEL	AC	-	-	rs148828138		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:228667703_228667704delAC								HIST3H2BB (21445 upstream) : RNF187 (7364 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	230009642	230009642	+	IGR	DEL	C	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:230009642delC								URB2 (213696 upstream) : GALNT2 (183894 downstream)																																			---	---	---	---
CAPN9	10753	broad.mit.edu	37	1	230896167	230896167	+	Intron	DEL	C	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:230896167delC	uc001htz.1	+						CAPN9_uc009xfg.1_Intron|CAPN9_uc001hua.1_Intron	NM_006615	NP_006606			calpain 9 isoform 1						digestion|proteolysis	intracellular	calcium ion binding|calcium-dependent cysteine-type endopeptidase activity			ovary(1)	1	Breast(184;0.0871)|Ovarian(103;0.183)	Prostate(94;0.167)																---	---	---	---
Unknown	0	broad.mit.edu	37	1	231588472	231588473	+	IGR	INS	-	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:231588472_231588473insA								EGLN1 (27682 upstream) : TSNAX-DISC1 (75926 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	233057085	233057086	+	IGR	DEL	TG	-	-	rs61823466		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:233057085_233057086delTG								KIAA1383 (110993 upstream) : C1orf57 (29284 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	233656569	233656570	+	IGR	DEL	TC	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:233656569_233656570delTC								KIAA1804 (135676 upstream) : KCNK1 (93180 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	234471634	234471634	+	IGR	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:234471634delT								SLC35F3 (11372 upstream) : C1orf31 (37641 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	236832373	236832374	+	IGR	INS	-	TTCCTTCC	TTCCTTCC	rs71993165		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236832373_236832374insTTCCTTCC								HEATR1 (64559 upstream) : ACTN2 (17396 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	240201899	240201900	+	IGR	INS	-	T	T	rs150355004		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:240201899_240201900insT								CHRM3 (129184 upstream) : FMN2 (53285 downstream)																																			---	---	---	---
RGS7	6000	broad.mit.edu	37	1	241469772	241469773	+	Intron	INS	-	CA	CA	rs36207025		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:241469772_241469773insCA	uc001hyv.2	-						RGS7_uc001hyu.2_Intron|RGS7_uc009xgn.1_Intron|RGS7_uc001hyw.2_Intron	NM_002924	NP_002915			regulator of G-protein signaling 7						G-protein coupled receptor protein signaling pathway|intracellular signal transduction|negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway	cytoplasm|heterotrimeric G-protein complex	GTPase activator activity|protein binding|signal transducer activity			ovary(4)|skin(2)|kidney(1)	7		all_cancers(173;0.0131)	OV - Ovarian serous cystadenocarcinoma(106;0.027)															---	---	---	---
Unknown	0	broad.mit.edu	37	1	244496045	244496048	+	IGR	DEL	AGAA	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:244496045_244496048delAGAA								ZNF238 (275269 upstream) : C1orf100 (19889 downstream)																																			---	---	---	---
SMYD3	64754	broad.mit.edu	37	1	246213804	246213804	+	Intron	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:246213804delA	uc001ibl.2	-						SMYD3_uc001ibk.2_Intron	NM_022743	NP_073580			SET and MYND domain containing 3							cytoplasm|nucleus	histone-lysine N-methyltransferase activity|protein binding|zinc ion binding				0	all_cancers(71;0.000291)|all_epithelial(71;0.000174)|Ovarian(71;0.0377)|all_lung(81;0.0568)|Lung NSC(105;0.0804)|Breast(184;0.173)|Melanoma(84;0.242)	all_cancers(173;0.0496)|Acute lymphoblastic leukemia(190;0.164)	OV - Ovarian serous cystadenocarcinoma(106;0.0129)	all cancers(4;0.028)|GBM - Glioblastoma multiforme(49;0.0537)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	247938139	247938140	+	IGR	INS	-	TCTC	TCTC	rs148761356	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247938139_247938140insTCTC								OR1C1 (16431 upstream) : OR14A16 (39962 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	2466322	2466323	+	IGR	INS	-	A	A	rs139386443	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:2466322_2466323insA								MYT1L (131277 upstream) : TSSC1 (726418 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	2956424	2956425	+	Intron	DEL	AG	-	-	rs79254933		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:2956424_2956425delAG	uc002qxh.1	-											Homo sapiens cDNA FLJ37991 fis, clone CTONG2011765.																														---	---	---	---
Unknown	0	broad.mit.edu	37	2	4110309	4110309	+	IGR	DEL	G	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:4110309delG								ALLC (360051 upstream) : None (None downstream)																																			---	---	---	---
ASAP2	8853	broad.mit.edu	37	2	9419191	9419193	+	Intron	DEL	AGG	-	-	rs142596288		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:9419191_9419193delAGG	uc002qzh.2	+						ASAP2_uc002qzi.2_Intron	NM_003887	NP_003878			ArfGAP with SH3 domain, ankyrin repeat and PH						regulation of ARF GTPase activity	Golgi cisterna membrane|plasma membrane	ARF GTPase activator activity|protein binding|zinc ion binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	10153869	10153869	+	IGR	DEL	G	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:10153869delG								GRHL1 (11458 upstream) : KLF11 (29813 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	14860438	14860445	+	IGR	DEL	ACACACAA	-	-	rs142344769	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:14860438_14860445delACACACAA								FAM84A (69505 upstream) : NBAS (446587 downstream)																																			---	---	---	---
NBAS	51594	broad.mit.edu	37	2	15383702	15383702	+	Intron	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:15383702delA	uc002rcc.1	-						NBAS_uc010exl.1_Intron|NBAS_uc002rcd.1_Intron	NM_015909	NP_056993			neuroblastoma-amplified protein											ovary(2)|liver(1)|skin(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	16118099	16118099	+	IGR	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:16118099delA								MYCN (30971 upstream) : FAM49A (615802 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	19180773	19180774	+	IGR	INS	-	TCCC	TCCC	rs139507657	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:19180773_19180774insTCCC								NT5C1B (409935 upstream) : OSR1 (370473 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	19934791	19934794	+	IGR	DEL	GAAA	-	-	rs72315540	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:19934791_19934794delGAAA								OSR1 (376419 upstream) : TTC32 (161724 downstream)																																			---	---	---	---
PUM2	23369	broad.mit.edu	37	2	20454511	20454512	+	Intron	INS	-	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:20454511_20454512insA	uc002rds.1	-						PUM2_uc002rdq.1_Intron|PUM2_uc002rdt.1_Intron|PUM2_uc002rdr.2_Intron|PUM2_uc010yjy.1_Intron|PUM2_uc002rdu.1_Intron|PUM2_uc010yjz.1_Intron	NM_015317	NP_056132			pumilio homolog 2						regulation of translation	perinuclear region of cytoplasm|stress granule	protein binding|RNA binding			ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)																	---	---	---	---
Unknown	0	broad.mit.edu	37	2	20755731	20755731	+	IGR	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:20755731delT								RHOB (106531 upstream) : HS1BP3 (61833 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	23429880	23429880	+	IGR	DEL	C	-	-	rs34281647		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:23429880delC								None (None upstream) : KLHL29 (325575 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	27784080	27784080	+	IGR	DEL	C	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27784080delC								GCKR (37532 upstream) : C2orf16 (15309 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	32030964	32030965	+	IGR	INS	-	ACGT	ACGT			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:32030964_32030965insACGT								SRD5A2 (224924 upstream) : MEMO1 (61931 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	32558050	32558050	+	IGR	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:32558050delA								YIPF4 (26393 upstream) : BIRC6 (24046 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	35042218	35042219	+	IGR	INS	-	AT	AT			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:35042218_35042219insAT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	38001914	38001915	+	IGR	INS	-	T	T	rs144052306	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:38001914_38001915insT								CDC42EP3 (102588 upstream) : FAM82A1 (150547 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	43149750	43149751	+	IGR	INS	-	C	C	rs150231768	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:43149750_43149751insC								HAAO (129999 upstream) : ZFP36L2 (299791 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	45286112	45286113	+	IGR	INS	-	C	C	rs148145946	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:45286112_45286113insC								SIX2 (49569 upstream) : SRBD1 (329707 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	45371536	45371539	+	IGR	DEL	GTGG	-	-	rs112416419	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:45371536_45371539delGTGG								SIX2 (134993 upstream) : SRBD1 (244281 downstream)																																			---	---	---	---
SRBD1	55133	broad.mit.edu	37	2	45619575	45619575	+	Intron	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:45619575delT	uc002rus.2	-						SRBD1_uc010yoc.1_Intron	NM_018079	NP_060549			S1 RNA binding domain 1						nucleobase, nucleoside, nucleotide and nucleic acid metabolic process		hydrolase activity, acting on ester bonds|RNA binding			central_nervous_system(1)	1		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)	LUSC - Lung squamous cell carcinoma(58;0.0917)|Lung(47;0.154)															---	---	---	---
Unknown	0	broad.mit.edu	37	2	48309384	48309385	+	IGR	DEL	AC	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:48309384_48309385delAC								FBXO11 (176570 upstream) : FOXN2 (232410 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	56380257	56380257	+	Intron	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:56380257delT	uc002rzk.2	+											Homo sapiens, clone IMAGE:3873411, mRNA.																														---	---	---	---
Unknown	0	broad.mit.edu	37	2	57775058	57775059	+	IGR	INS	-	GAGA	GAGA	rs142098534	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:57775058_57775059insGAGA								None (None upstream) : VRK2 (359727 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	59138773	59138773	+	Intron	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:59138773delT	uc002rzy.2	+						uc002rzz.2_Intron					Homo sapiens cDNA FLJ30838 fis, clone FEBRA2002399.																														---	---	---	---
Unknown	0	broad.mit.edu	37	2	60319152	60319153	+	IGR	DEL	CA	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:60319152_60319153delCA								None (None upstream) : BCL11A (359150 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	60538118	60538118	+	IGR	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:60538118delA								None (None upstream) : BCL11A (140185 downstream)																																			---	---	---	---
USP34	9736	broad.mit.edu	37	2	61431066	61431067	+	Intron	INS	-	A	A	rs35872665		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:61431066_61431067insA	uc002sbe.2	-						USP34_uc002sbd.2_Intron	NM_014709	NP_055524			ubiquitin specific protease 34						positive regulation of canonical Wnt receptor signaling pathway|protein K48-linked deubiquitination|ubiquitin-dependent protein catabolic process|Wnt receptor signaling pathway		cysteine-type endopeptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(8)|breast(5)|skin(3)|lung(2)|prostate(1)	19			Epithelial(17;0.229)															---	---	---	---
Unknown	0	broad.mit.edu	37	2	61821895	61821896	+	IGR	INS	-	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:61821895_61821896insT								XPO1 (56477 upstream) : FAM161A (230089 downstream)																																			---	---	---	---
C2orf86	51057	broad.mit.edu	37	2	63397411	63397412	+	Intron	INS	-	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:63397411_63397412insT	uc002sch.2	-						C2orf86_uc002sce.2_Intron|C2orf86_uc002scf.2_Intron|C2orf86_uc010ypu.1_Intron|C2orf86_uc002scg.2_Intron	NM_015910	NP_056994			hypothetical protein LOC51057 isoform 2						cilium morphogenesis|regulation of embryonic cell shape|regulation of protein localization|septin cytoskeleton organization	cilium axoneme|cytoplasm|cytoskeleton|plasma membrane					0																		---	---	---	---
UGP2	7360	broad.mit.edu	37	2	64082653	64082654	+	Intron	DEL	TG	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:64082653_64082654delTG	uc002scm.2	+						UGP2_uc002scl.2_Intron|UGP2_uc010ypx.1_Intron	NM_006759	NP_006750			UDP-glucose pyrophosphorylase 2 isoform a						glycogen biosynthetic process|phosphorylation|UDP-glucose metabolic process|UDP-glucuronate biosynthetic process|xenobiotic metabolic process	cytosol	metal ion binding|protein binding|UTP:glucose-1-phosphate uridylyltransferase activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	64603286	64603288	+	IGR	DEL	CAC	-	-	rs141929982		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:64603286_64603288delCAC								PELI1 (231681 upstream) : HSPC159 (78039 downstream)																																			---	---	---	---
SPRED2	200734	broad.mit.edu	37	2	65634753	65634753	+	Intron	DEL	G	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:65634753delG	uc002sdr.3	-						SPRED2_uc010fcx.1_Intron	NM_181784	NP_861449			sprouty-related protein with EVH-1 domain 2						inactivation of MAPK activity|multicellular organismal development	transport vesicle membrane	stem cell factor receptor binding			ovary(1)|lung(1)|central_nervous_system(1)	3																		---	---	---	---
MEIS1	4211	broad.mit.edu	37	2	66789528	66789528	+	Intron	DEL	A	-	-	rs71409177		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:66789528delA	uc002sdu.2	+						MEIS1_uc002sdt.2_Intron|MEIS1_uc002sdv.2_Intron|MEIS1_uc010yqh.1_Intron|MEIS1_uc010yqi.1_Intron|MEIS1_uc002sdw.1_Intron	NM_002398	NP_002389			Meis homeobox 1								sequence-specific DNA binding transcription factor activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	69211536	69211537	+	IGR	INS	-	ATT	ATT	rs144475713	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:69211536_69211537insATT								GKN1 (3425 upstream) : ANTXR1 (28739 downstream)																																			---	---	---	---
DYSF	8291	broad.mit.edu	37	2	71679775	71679775	+	5'Flank	DEL	T	-	-	rs80339059		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71679775delT	uc002sie.2	+						DYSF_uc010feg.2_5'Flank|DYSF_uc010feh.2_5'Flank|DYSF_uc002sig.3_5'Flank|DYSF_uc010yqx.1_5'Flank|DYSF_uc010fee.2_5'Flank|DYSF_uc010fef.2_5'Flank|DYSF_uc010fei.2_5'Flank	NM_003494	NP_003485			dysferlin isoform 8							cytoplasmic vesicle membrane|integral to membrane|sarcolemma	calcium-dependent phospholipid binding			ovary(3)|breast(2)|pancreas(1)|skin(1)	7																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	75271545	75271546	+	IGR	DEL	AG	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:75271545_75271546delAG								POLE4 (74687 upstream) : TACR1 (2044 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	78087933	78087934	+	IGR	DEL	GT	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:78087933_78087934delGT								LRRTM4 (338431 upstream) : SNAR-H (94099 downstream)																																			---	---	---	---
RMND5A	64795	broad.mit.edu	37	2	87015007	87015008	+	Intron	INS	-	GA	GA	rs142344123	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:87015007_87015008insGA	uc002srs.3	+						CD8A_uc002srv.2_Intron|CD8A_uc010ytn.1_Intron|CD8A_uc002srt.2_Intron|CD8A_uc002sru.2_Intron					SubName: Full=cDNA FLJ10361 fis, clone NT2RM2001256, highly similar to Anaphase-promoting complex subunit 1;											ovary(1)|skin(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	90451097	90451097	+	Intron	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:90451097delT	uc010fhm.2	+											Parts of antibodies, mostly variable regions.																														---	---	---	---
Unknown	0	broad.mit.edu	37	2	92317890	92317890	+	IGR	DEL	T	-	-	rs7597972		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:92317890delT								FKSG73 (187396 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	96183280	96183280	+	IGR	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:96183280delT								FAHD2A (104402 upstream) : TRIM43 (74486 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	96833428	96833428	+	IGR	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:96833428delA								DUSP2 (22249 upstream) : STARD7 (17177 downstream)																																			---	---	---	---
CNNM4	26504	broad.mit.edu	37	2	97433819	97433821	+	Intron	DEL	AAC	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:97433819_97433821delAAC	uc002swx.2	+							NM_020184	NP_064569			cyclin M4						biomineral tissue development|ion transport|response to stimulus|visual perception	integral to membrane|plasma membrane				breast(2)|ovary(1)	3																		---	---	---	---
MRPL30	51263	broad.mit.edu	37	2	99779655	99779655	+	Intron	DEL	C	-	-	rs68130738		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:99779655delC	uc002szr.2	+						MRPL30_uc002szl.1_Intron	NM_145213	NP_660214			SubName: Full=HCG1989457, isoform CRA_a; SubName: Full=Putative uncharacterized protein MRPL30;						translation	mitochondrion|ribosome	structural constituent of ribosome			ovary(1)	1																		---	---	---	---
AFF3	3899	broad.mit.edu	37	2	100408956	100408957	+	Intron	INS	-	AAAC	AAAC	rs150902761	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:100408956_100408957insAAAC	uc002tag.2	-						AFF3_uc002taf.2_Intron|AFF3_uc010fiq.1_Intron|AFF3_uc010yvr.1_Intron|AFF3_uc002tah.1_Intron|AFF3_uc010fir.1_Intron	NM_002285	NP_002276			AF4/FMR2 family, member 3 isoform 1						multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(2)|pancreas(1)|lung(1)|kidney(1)|skin(1)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	102670119	102670119	+	IGR	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:102670119delA								IL1R2 (25239 upstream) : IL1R1 (16717 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	105773887	105773888	+	IGR	INS	-	G	G	rs142422613	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:105773887_105773888insG								MRPS9 (57470 upstream) : GPR45 (84312 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	106556545	106556546	+	IGR	INS	-	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:106556545_106556546insT								NCK2 (45819 upstream) : C2orf40 (125567 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	106566595	106566602	+	IGR	DEL	AGGAAGGA	-	-	rs72456657		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:106566595_106566602delAGGAAGGA								NCK2 (55869 upstream) : C2orf40 (115511 downstream)																																			---	---	---	---
C2orf40	84417	broad.mit.edu	37	2	106685722	106685725	+	Intron	DEL	TTTC	-	-	rs9752213		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:106685722_106685725delTTTC	uc010fjf.2	+							NM_032411	NP_115787			esophageal cancer related gene 4 protein							extracellular region|transport vesicle					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	108153738	108153739	+	IGR	INS	-	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:108153738_108153739insT								ST6GAL2 (650175 upstream) : LOC729121 (285781 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	108819294	108819295	+	IGR	INS	-	A	A	rs141695007	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:108819294_108819295insA								SLC5A7 (188855 upstream) : SULT1C3 (44356 downstream)																																			---	---	---	---
SEPT10	151011	broad.mit.edu	37	2	110327424	110327425	+	Intron	INS	-	T	T	rs142950735	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:110327424_110327425insT	uc002tew.2	-						SEPT10_uc010ywu.1_Intron|SEPT10_uc002tex.2_Intron|SEPT10_uc002tey.2_Intron|SEPT10_uc010ywv.1_Intron|SEPT10_uc002tev.1_Intron|SEPT10_uc010fjo.2_Intron|SEPT10_uc002tez.1_5'Flank	NM_144710	NP_653311			septin 10 isoform 1						cell cycle|cell division	septin complex	GTP binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	112445578	112445581	+	IGR	DEL	CTCT	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:112445578_112445581delCTCT								LOC541471 (192886 upstream) : ANAPC1 (81060 downstream)																																			---	---	---	---
ANAPC1	64682	broad.mit.edu	37	2	112544737	112544738	+	Intron	INS	-	C	C	rs74267316	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:112544737_112544738insC	uc002thi.2	-							NM_022662	NP_073153			anaphase promoting complex subunit 1						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|mitosis|mitotic cell cycle spindle assembly checkpoint|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination	anaphase-promoting complex|cytosol|nucleoplasm				skin(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	113477589	113477590	+	5'Flank	INS	-	CCTT	CCTT	rs11273854		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:113477589_113477590insCCTT	uc002tid.2	+											RecName: Full=5'-nucleotidase domain-containing protein 4;																														---	---	---	---
Unknown	0	broad.mit.edu	37	2	119453493	119453493	+	IGR	DEL	G	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:119453493delG								INSIG2 (585897 upstream) : EN1 (146255 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	119865144	119865145	+	IGR	INS	-	TGTGTG	TGTGTG	rs72438757		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:119865144_119865145insTGTGTG								MARCO (112908 upstream) : C1QL2 (48674 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	121083050	121083050	+	IGR	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:121083050delT								RALB (30767 upstream) : INHBB (20669 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	121160078	121160079	+	IGR	INS	-	GT	GT	rs138268128	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:121160078_121160079insGT								INHBB (50695 upstream) : LOC84931 (61832 downstream)																																			---	---	---	---
TFCP2L1	29842	broad.mit.edu	37	2	122012379	122012379	+	Intron	DEL	A	-	-	rs35562172		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:122012379delA	uc002tmx.2	-						TFCP2L1_uc010flr.2_Intron	NM_014553	NP_055368			LBP-9						female pregnancy|steroid biosynthetic process	mitochondrion|nucleolus	DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity			pancreas(2)|ovary(1)	3	Renal(3;0.01)																	---	---	---	---
Unknown	0	broad.mit.edu	37	2	124026742	124026742	+	IGR	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:124026742delA								None (None upstream) : CNTNAP5 (756122 downstream)																																			---	---	---	---
CNTNAP5	129684	broad.mit.edu	37	2	125144502	125144502	+	Intron	DEL	G	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:125144502delG	uc002tno.2	+						CNTNAP5_uc010flu.2_Intron	NM_130773	NP_570129			contactin associated protein-like 5 precursor						cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(10)	10				BRCA - Breast invasive adenocarcinoma(221;0.248)														---	---	---	---
CNTNAP5	129684	broad.mit.edu	37	2	125172299	125172300	+	Intron	INS	-	GTGT	GTGT	rs141128090	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:125172299_125172300insGTGT	uc002tno.2	+						CNTNAP5_uc010flu.2_Intron	NM_130773	NP_570129			contactin associated protein-like 5 precursor						cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(10)	10				BRCA - Breast invasive adenocarcinoma(221;0.248)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	125833059	125833059	+	IGR	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:125833059delA								CNTNAP5 (160198 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	127554688	127554691	+	IGR	DEL	ACAG	-	-	rs10606959		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:127554688_127554691delACAG								GYPC (100443 upstream) : BIN1 (250916 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	127992953	127992956	+	IGR	DEL	AAGA	-	-	rs62157501		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:127992953_127992956delAAGA								CYP27C1 (29610 upstream) : ERCC3 (21910 downstream)																																			---	---	---	---
WDR33	55339	broad.mit.edu	37	2	128473100	128473100	+	Intron	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128473100delT	uc002tpg.1	-							NM_018383	NP_060853			WD repeat domain 33 isoform 1						postreplication repair|spermatogenesis	collagen|nucleus	protein binding				0	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0695)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	130287634	130287635	+	IGR	INS	-	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:130287634_130287635insA								None (None upstream) : LOC389033 (392800 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	132775777	132775779	+	IGR	DEL	TAT	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:132775777_132775779delTAT								C2orf27B (216543 upstream) : NCRNA00164 (129385 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	132800307	132800308	+	IGR	INS	-	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:132800307_132800308insT								C2orf27B (241073 upstream) : NCRNA00164 (104856 downstream)																																			---	---	---	---
NCRNA00164	554226	broad.mit.edu	37	2	132939126	132939127	+	Intron	DEL	AC	-	-	rs113866565		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:132939126_132939127delAC	uc002ttj.3	-							NR_027020				Homo sapiens non-protein coding RNA 164, mRNA (cDNA clone IMAGE:5169389), with apparent retained intron.												0																		---	---	---	---
NCRNA00164	554226	broad.mit.edu	37	2	132974712	132974712	+	Intron	DEL	G	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:132974712delG	uc002ttj.3	-							NR_027020				Homo sapiens non-protein coding RNA 164, mRNA (cDNA clone IMAGE:5169389), with apparent retained intron.												0																		---	---	---	---
NCRNA00164	554226	broad.mit.edu	37	2	133016676	133016677	+	5'Flank	INS	-	TGTC	TGTC	rs67307110		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133016676_133016677insTGTC	uc002ttj.3	-						MIR663B_hsa-mir-663b|MI0006336_5'Flank	NR_027020				Homo sapiens non-protein coding RNA 164, mRNA (cDNA clone IMAGE:5169389), with apparent retained intron.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	133032781	133032786	+	IGR	DEL	TGTGTA	-	-	rs145019277		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133032781_133032786delTGTGTA								NCRNA00164 (17239 upstream) : GPR39 (141361 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	133052910	133052911	+	IGR	INS	-	T	T	rs138624541	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133052910_133052911insT								NCRNA00164 (37368 upstream) : GPR39 (121236 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	133114164	133114166	+	IGR	DEL	TCT	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133114164_133114166delTCT								NCRNA00164 (98622 upstream) : GPR39 (59981 downstream)																																			---	---	---	---
NCKAP5	344148	broad.mit.edu	37	2	134084226	134084226	+	Intron	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:134084226delA	uc002ttp.2	-						NCKAP5_uc002ttq.2_Intron|NCKAP5_uc002ttt.1_Intron|NCKAP5_uc002tts.1_Intron	NM_207363	NP_997246			Nck-associated protein 5 isoform 1								protein binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	139334799	139334800	+	IGR	DEL	GA	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:139334799_139334800delGA								SPOPL (3996 upstream) : NXPH2 (91929 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	139380694	139380694	+	IGR	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:139380694delT								SPOPL (49891 upstream) : NXPH2 (46035 downstream)																																			---	---	---	---
LRP1B	53353	broad.mit.edu	37	2	141210530	141210530	+	Intron	DEL	G	-	-	rs35299875		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141210530delG	uc002tvj.1	-							NM_018557	NP_061027			low density lipoprotein-related protein 1B						protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)											TSP Lung(27;0.18)			---	---	---	---
Unknown	0	broad.mit.edu	37	2	144668494	144668495	+	IGR	INS	-	GT	GT	rs138987372	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:144668494_144668495insGT								ARHGAP15 (142574 upstream) : GTDC1 (35088 downstream)																																			---	---	---	---
ZEB2	9839	broad.mit.edu	37	2	145221469	145221470	+	Intron	DEL	GA	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:145221469_145221470delGA	uc002tvu.2	-						ZEB2_uc002tvv.2_Intron|ZEB2_uc010zbm.1_Intron|ZEB2_uc010fnp.2_Intron|ZEB2_uc010fnq.1_Intron|ZEB2_uc002tvw.2_Intron|ZEB2_uc002tvx.1_Intron	NM_014795	NP_055610			zinc finger homeobox 1b							cytoplasm|nucleolus	phosphatase regulator activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|SMAD binding|zinc ion binding			ovary(5)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)	9				BRCA - Breast invasive adenocarcinoma(221;0.112)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	145593160	145593160	+	Intron	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:145593160delT	uc002twc.2	+											Homo sapiens hypothetical gene supported by BC043549; BX648102, mRNA (cDNA clone IMAGE:5172341).																														---	---	---	---
Unknown	0	broad.mit.edu	37	2	147773033	147773034	+	IGR	INS	-	AAGAAAGG	AAGAAAGG	rs147590188	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:147773033_147773034insAAGAAAGG								PABPC1P2 (424476 upstream) : ACVR2A (829052 downstream)																																			---	---	---	---
EPC2	26122	broad.mit.edu	37	2	149494506	149494506	+	Intron	DEL	A	-	-	rs112062976		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:149494506delA	uc010zbt.1	+							NM_015630	NP_056445			enhancer of polycomb homolog 2						chromatin modification|DNA repair|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus				ovary(1)|breast(1)|pancreas(1)	3				BRCA - Breast invasive adenocarcinoma(221;0.0516)														---	---	---	---
KIF5C	3800	broad.mit.edu	37	2	149684571	149684571	+	Intron	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:149684571delA	uc010zbu.1	+							NM_004522	NP_004513			kinesin family member 5C						microtubule-based movement|organelle organization	cytoplasm|kinesin complex|microtubule	ATP binding|microtubule motor activity			skin(1)	1				BRCA - Breast invasive adenocarcinoma(221;0.108)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	151314609	151314609	+	IGR	DEL	T	-	-	rs111478649		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:151314609delT								MMADHC (870279 upstream) : RND3 (10103 downstream)																																			---	---	---	---
RND3	390	broad.mit.edu	37	2	151343663	151343664	+	Intron	INS	-	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:151343663_151343664insT	uc002txe.2	-						RND3_uc002txf.2_Intron|RND3_uc002txg.2_Intron|RND3_uc010zbv.1_Intron|RND3_uc010zbw.1_5'Flank	NM_005168	NP_005159			ras homolog gene family, member E precursor						actin cytoskeleton organization|cell adhesion|small GTPase mediated signal transduction	Golgi membrane	GTP binding|GTPase activity			lung(2)	2				BRCA - Breast invasive adenocarcinoma(221;0.106)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	151363812	151363813	+	IGR	DEL	AA	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:151363812_151363813delAA								RND3 (19632 upstream) : RBM43 (740916 downstream)																																			---	---	---	---
NEB	4703	broad.mit.edu	37	2	152352181	152352183	+	Intron	DEL	AAC	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:152352181_152352183delAAC	uc010fnx.2	-						NEB_uc002txr.2_Intron|RIF1_uc002txp.2_Intron|NEB_uc010zbz.1_Intron|NEB_uc002txq.2_Intron|NEB_uc010zca.1_Intron|NEB_uc010zcb.1_Intron	NM_004543	NP_004534			nebulin isoform 3						muscle filament sliding|muscle organ development|regulation of actin filament length|somatic muscle development	actin cytoskeleton|cytosol|Z disc	actin binding|structural constituent of muscle			ovary(8)|large_intestine(5)|breast(3)|central_nervous_system(2)|skin(1)|pancreas(1)	20				BRCA - Breast invasive adenocarcinoma(221;0.219)														---	---	---	---
CACNB4	785	broad.mit.edu	37	2	152798117	152798118	+	Intron	INS	-	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:152798117_152798118insA	uc002tya.2	-						CACNB4_uc002txy.2_Intron|CACNB4_uc002txz.2_Intron|CACNB4_uc010fnz.2_Intron|CACNB4_uc002tyb.2_Intron	NM_000726	NP_000717			calcium channel, voltage-dependent, beta 4						axon guidance|membrane depolarization|synaptic transmission	cytosol|internal side of plasma membrane|plasma membrane|synapse|voltage-gated calcium channel complex	protein binding|voltage-gated calcium channel activity			ovary(2)	2				BRCA - Breast invasive adenocarcinoma(221;0.156)	Verapamil(DB00661)													---	---	---	---
Unknown	0	broad.mit.edu	37	2	154250503	154250506	+	IGR	DEL	CACC	-	-	rs71865006	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:154250503_154250506delCACC								ARL6IP6 (632736 upstream) : RPRM (83346 downstream)																																			---	---	---	---
GPD2	2820	broad.mit.edu	37	2	157425727	157425728	+	Intron	INS	-	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:157425727_157425728insT	uc002tzf.3	+						GPD2_uc010zch.1_Intron|GPD2_uc002tzd.3_Intron|GPD2_uc002tze.1_Intron	NM_001083112	NP_001076581			glycerol-3-phosphate dehydrogenase 2,						cellular lipid metabolic process	glycerol-3-phosphate dehydrogenase complex|mitochondrial inner membrane	calcium ion binding|sn-glycerol-3-phosphate:ubiquinone-8 oxidoreductase activity			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	158222932	158222932	+	IGR	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:158222932delA								ERMN (38786 upstream) : CYTIP (48199 downstream)																																			---	---	---	---
ACVR1C	130399	broad.mit.edu	37	2	158413676	158413677	+	Intron	INS	-	A	A	rs112617784		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:158413676_158413677insA	uc002tzk.3	-						ACVR1C_uc002tzl.3_Intron|ACVR1C_uc010fof.2_Intron|ACVR1C_uc010foe.2_Intron	NM_145259	NP_660302			activin A receptor, type IC isoform 1						apoptosis|cell differentiation|regulation of apoptosis	activin receptor complex	activin receptor activity, type I|ATP binding|transforming growth factor beta receptor activity			lung(3)|ovary(2)|skin(2)	7																		---	---	---	---
PKP4	8502	broad.mit.edu	37	2	159353831	159353833	+	Intron	DEL	GCA	-	-	rs140007734		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:159353831_159353833delGCA	uc002tzv.2	+						PKP4_uc002tzt.1_Intron|PKP4_uc002tzu.2_Intron|PKP4_uc002tzw.2_Intron|PKP4_uc002tzx.2_Intron|PKP4_uc002tzy.1_Intron	NM_003628	NP_003619			plakophilin 4 isoform a						cell adhesion	desmosome	protein binding			ovary(5)|skin(2)	7															HNSCC(62;0.18)			---	---	---	---
FIGN	55137	broad.mit.edu	37	2	164584322	164584322	+	Intron	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:164584322delT	uc002uck.1	-							NM_018086	NP_060556			fidgetin							nuclear matrix	ATP binding|nucleoside-triphosphatase activity			large_intestine(2)|ovary(1)|skin(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	165928316	165928316	+	IGR	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:165928316delA								SLC38A11 (116281 upstream) : SCN3A (15716 downstream)																																			---	---	---	---
SCN2A	6326	broad.mit.edu	37	2	166232330	166232331	+	Intron	DEL	CA	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:166232330_166232331delCA	uc002udc.2	+						SCN2A_uc002udd.2_Intron|SCN2A_uc002ude.2_Intron	NM_001040142	NP_001035232			sodium channel, voltage-gated, type II, alpha						myelination	node of Ranvier|voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(6)|breast(1)|pancreas(1)	8					Lamotrigine(DB00555)													---	---	---	---
STK39	27347	broad.mit.edu	37	2	168848026	168848028	+	Intron	DEL	ATC	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:168848026_168848028delATC	uc002uea.2	-							NM_013233	NP_037365			serine threonine kinase 39 (STE20/SPS1 homolog,						response to stress	cytoplasm|nucleus	ATP binding|protein binding|receptor signaling protein serine/threonine kinase activity			central_nervous_system(1)|skin(1)	2																		---	---	---	---
TLK1	9874	broad.mit.edu	37	2	171850178	171850179	+	3'UTR	INS	-	AA	AA	rs144505944		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:171850178_171850179insAA	uc002ugn.2	-	21					TLK1_uc002ugo.2_3'UTR|TLK1_uc002ugp.2_3'UTR|TLK1_uc010zdn.1_3'UTR	NM_012290	NP_036422			tousled-like kinase 1 isoform 1						cell cycle|chromatin modification|intracellular protein transport|intracellular signal transduction|regulation of chromatin assembly or disassembly|response to DNA damage stimulus	nucleus	ATP binding|protein binding|protein serine/threonine kinase activity			central_nervous_system(1)	1																		---	---	---	---
SLC25A12	8604	broad.mit.edu	37	2	172692698	172692700	+	Intron	DEL	AGG	-	-	rs149731455		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:172692698_172692700delAGG	uc002uhh.2	-						SLC25A12_uc010fqh.2_Intron|SLC25A12_uc010zdv.1_Intron	NM_003705	NP_003696			solute carrier family 25, member 12						gluconeogenesis|malate-aspartate shuttle|response to calcium ion	integral to membrane|mitochondrial inner membrane	calcium ion binding|L-aspartate transmembrane transporter activity|L-glutamate transmembrane transporter activity|protein binding				0			OV - Ovarian serous cystadenocarcinoma(117;0.216)		L-Aspartic Acid(DB00128)													---	---	---	---
Unknown	0	broad.mit.edu	37	2	172754759	172754759	+	IGR	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:172754759delT								SLC25A12 (3946 upstream) : HAT1 (24176 downstream)																																			---	---	---	---
MAP1D	254042	broad.mit.edu	37	2	172893452	172893455	+	Intron	DEL	TGTG	-	-	rs72238174		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:172893452_172893455delTGTG	uc002uhk.2	+						MAP1D_uc010zdw.1_Intron	NM_199227	NP_954697			methionine aminopeptidase 1D precursor						N-terminal protein amino acid modification|peptidyl-methionine modification|proteolysis	mitochondrion	aminopeptidase activity|metal ion binding|metalloexopeptidase activity				0			OV - Ovarian serous cystadenocarcinoma(117;0.216)															---	---	---	---
Unknown	0	broad.mit.edu	37	2	174142357	174142357	+	Intron	DEL	G	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:174142357delG	uc002uib.2	-											Homo sapiens hypothetical protein LOC339751, mRNA (cDNA clone IMAGE:5266974).																														---	---	---	---
Unknown	0	broad.mit.edu	37	2	175649795	175649795	+	IGR	DEL	C	-	-	rs34932292		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:175649795delC								CHRNA1 (20595 upstream) : CHN1 (14247 downstream)																																			---	---	---	---
CHN1	1123	broad.mit.edu	37	2	175839627	175839628	+	Intron	DEL	AC	-	-	rs71983992		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:175839627_175839628delAC	uc002uji.2	-						CHN1_uc010zeq.1_Intron|CHN1_uc002ujj.2_Intron	NM_001822	NP_001813			chimerin (chimaerin) 1 isoform a						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|metal ion binding|SH3/SH2 adaptor activity			ovary(2)|skin(1)	3			OV - Ovarian serous cystadenocarcinoma(117;0.226)					T	TAF15	extraskeletal myxoid chondrosarcoma								---	---	---	---
CHN1	1123	broad.mit.edu	37	2	175872940	175872940	+	5'Flank	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:175872940delA	uc002uji.2	-						CHN1_uc010zeq.1_5'Flank|CHN1_uc002ujj.2_5'Flank	NM_001822	NP_001813			chimerin (chimaerin) 1 isoform a						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|metal ion binding|SH3/SH2 adaptor activity			ovary(2)|skin(1)	3			OV - Ovarian serous cystadenocarcinoma(117;0.226)					T	TAF15	extraskeletal myxoid chondrosarcoma								---	---	---	---
Unknown	0	broad.mit.edu	37	2	177664431	177664432	+	IGR	INS	-	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:177664431_177664432insA								MIR1246 (198651 upstream) : HNRNPA3 (412990 downstream)																																			---	---	---	---
AGPS	8540	broad.mit.edu	37	2	178270401	178270402	+	Intron	INS	-	T	T	rs56860445		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:178270401_178270402insT	uc002ull.2	+						AGPS_uc010zfb.1_Intron	NM_003659	NP_003650			alkyldihydroxyacetone phosphate synthase						ether lipid biosynthetic process	peroxisomal matrix|peroxisomal membrane|plasma membrane	alkylglycerone-phosphate synthase activity|flavin adenine dinucleotide binding|oxidoreductase activity			ovary(2)|central_nervous_system(1)	3			OV - Ovarian serous cystadenocarcinoma(117;0.0018)|Epithelial(96;0.00919)|all cancers(119;0.0358)															---	---	---	---
Unknown	0	broad.mit.edu	37	2	192810374	192810374	+	IGR	DEL	G	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:192810374delG								SDPR (98393 upstream) : TMEFF2 (4375 downstream)																																			---	---	---	---
KCTD18	130535	broad.mit.edu	37	2	201363895	201363895	+	Intron	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:201363895delA	uc002uvs.2	-						KCTD18_uc002uvt.2_Intron|KCTD18_uc002uvu.1_Intron	NM_152387	NP_689600			potassium channel tetramerization domain							voltage-gated potassium channel complex	voltage-gated potassium channel activity			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	202876856	202876867	+	IGR	DEL	GAAAGAAAGAAT	-	-	rs72289966		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:202876856_202876867delGAAAGAAAGAAT								CDK15 (118593 upstream) : FZD7 (22443 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	204413852	204413853	+	IGR	INS	-	C	C			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:204413852_204413853insC								RAPH1 (13794 upstream) : CD28 (157345 downstream)																																			---	---	---	---
PARD3B	117583	broad.mit.edu	37	2	205936447	205936448	+	Intron	DEL	TG	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:205936447_205936448delTG	uc002var.1	+						PARD3B_uc010fub.1_Intron|PARD3B_uc002vao.1_Intron|PARD3B_uc002vap.1_Intron|PARD3B_uc002vaq.1_Intron	NM_152526	NP_689739			par-3 partitioning defective 3 homolog B isoform						cell cycle|cell division	endomembrane system|tight junction				skin(2)|ovary(1)|breast(1)	4		all_cancers(1;2.88e-06)|all_epithelial(1;3.23e-06)		Epithelial(149;0.0739)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	208276265	208276265	+	IGR	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:208276265delT								MIR1302-4 (142117 upstream) : CREB1 (118351 downstream)																																			---	---	---	---
SPAG16	79582	broad.mit.edu	37	2	214832888	214832889	+	Intron	INS	-	TCTCA	TCTCA	rs150684026	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:214832888_214832889insTCTCA	uc002veq.2	+						SPAG16_uc010fuz.1_Intron|SPAG16_uc002ver.2_Intron|SPAG16_uc010zjk.1_Intron	NM_024532	NP_078808			sperm associated antigen 16 isoform 1						cilium assembly	cilium axoneme|flagellar axoneme				ovary(1)|skin(1)	2		Renal(323;0.00461)		UCEC - Uterine corpus endometrioid carcinoma (47;0.0525)|Epithelial(149;7.07e-07)|all cancers(144;7.96e-05)|Lung(261;0.00255)|LUSC - Lung squamous cell carcinoma(224;0.00599)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	216798265	216798265	+	IGR	DEL	G	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:216798265delG								FN1 (497474 upstream) : MREG (9050 downstream)																																			---	---	---	---
DIRC3	729582	broad.mit.edu	37	2	218266439	218266439	+	Intron	DEL	G	-	-	rs66470855		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:218266439delG	uc002vgn.1	-						DIRC3_uc002vgo.2_Intron					Homo sapiens cDNA FLJ14199 fis, clone NT2RP3002713.												0																		---	---	---	---
TTLL4	9654	broad.mit.edu	37	2	219616610	219616611	+	Intron	INS	-	TTT	TTT	rs10694172		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219616610_219616611insTTT	uc002viy.2	+						TTLL4_uc010zkl.1_Intron|TTLL4_uc010fvx.2_Intron|TTLL4_uc010zkm.1_Intron	NM_014640	NP_055455			tubulin tyrosine ligase-like family, member 4						protein polyglutamylation	cilium|microtubule basal body	ATP binding|tubulin binding|tubulin-tyrosine ligase activity			ovary(2)|skin(1)	3		Renal(207;0.0915)		Epithelial(149;5.03e-07)|all cancers(144;0.000106)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0101)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	222888542	222888542	+	IGR	DEL	G	-	-	rs137962049	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:222888542delG								EPHA4 (449620 upstream) : PAX3 (176065 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	223529880	223529880	+	IGR	DEL	T	-	-	rs72065484		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:223529880delT								FARSB (9053 upstream) : MOGAT1 (6577 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	226715458	226715459	+	IGR	INS	-	TG	TG	rs148028398	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:226715458_226715459insTG								KIAA1486 (119987 upstream) : IRS1 (880575 downstream)																																			---	---	---	---
PSMD1	5707	broad.mit.edu	37	2	231985172	231985172	+	Intron	DEL	C	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:231985172delC	uc002vrn.1	+						PSMD1_uc002vrm.1_Intron|PSMD1_uc010fxu.1_Intron|HTR2B_uc010fxv.2_Intron|HTR2B_uc002vro.2_Intron	NM_002807	NP_002798			proteasome 26S non-ATPase subunit 1						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|regulation of protein catabolic process|S phase of mitotic cell cycle|viral reproduction	proteasome regulatory particle	enzyme regulator activity|protein binding			ovary(1)|skin(1)	2		Ovarian(221;0.000626)|Medulloblastoma(418;0.0109)|Renal(207;0.0112)|Lung NSC(271;0.0538)|all_lung(227;0.0713)|all_hematologic(139;0.0748)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;4e-26)|LUSC - Lung squamous cell carcinoma(224;0.0138)|Lung(119;0.0168)	Bortezomib(DB00188)													---	---	---	---
Unknown	0	broad.mit.edu	37	2	235010088	235010097	+	IGR	DEL	ACACACACAC	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:235010088_235010097delACACACACAC								SPP2 (24312 upstream) : ARL4C (391591 downstream)																																			---	---	---	---
AGAP1	116987	broad.mit.edu	37	2	236459157	236459157	+	Intron	DEL	C	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:236459157delC	uc002vvs.2	+						AGAP1_uc002vvt.2_Intron	NM_001037131	NP_001032208			centaurin, gamma 2 isoform 1						protein transport|regulation of ARF GTPase activity|small GTPase mediated signal transduction	cytoplasm	ARF GTPase activator activity|GTP binding|zinc ion binding			ovary(2)|skin(1)	3																		---	---	---	---
AGAP1	116987	broad.mit.edu	37	2	236947460	236947463	+	Intron	DEL	TGTA	-	-	rs112489634		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:236947460_236947463delTGTA	uc002vvs.2	+						AGAP1_uc002vvt.2_Intron	NM_001037131	NP_001032208			centaurin, gamma 2 isoform 1						protein transport|regulation of ARF GTPase activity|small GTPase mediated signal transduction	cytoplasm	ARF GTPase activator activity|GTP binding|zinc ion binding			ovary(2)|skin(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	237044914	237044914	+	IGR	DEL	C	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:237044914delC								AGAP1 (10800 upstream) : GBX2 (29393 downstream)																																			---	---	---	---
HDAC4	9759	broad.mit.edu	37	2	240006739	240006740	+	Intron	INS	-	AG	AG	rs139333488	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:240006739_240006740insAG	uc002vyk.3	-						HDAC4_uc010fyy.2_Intron	NM_006037	NP_006028			histone deacetylase 4						B cell differentiation|cardiac muscle hypertrophy in response to stress|chromatin remodeling|histone H3 deacetylation|histone H4 deacetylation|inflammatory response|negative regulation of glycolysis|negative regulation of myotube differentiation|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|nervous system development|peptidyl-lysine deacetylation|positive regulation of cell proliferation|positive regulation of protein sumoylation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|regulation of protein binding|response to denervation involved in regulation of muscle adaptation|response to interleukin-1|transcription, DNA-dependent	histone deacetylase complex|transcriptional repressor complex	activating transcription factor binding|histone deacetylase activity (H3-K16 specific)|histone deacetylase binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|potassium ion binding|repressing transcription factor binding|zinc ion binding			breast(3)|skin(2)|ovary(1)	6		all_epithelial(40;1.45e-17)|Breast(86;1.53e-05)|Renal(207;0.000355)|all_lung(227;0.0121)|Ovarian(221;0.0183)|Lung NSC(271;0.0413)|Melanoma(123;0.0749)|all_hematologic(139;0.159)		Epithelial(121;6.38e-25)|OV - Ovarian serous cystadenocarcinoma(60;2.48e-12)|Kidney(56;6.04e-08)|KIRC - Kidney renal clear cell carcinoma(57;1.18e-06)|BRCA - Breast invasive adenocarcinoma(100;3.99e-05)|Lung(119;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.04)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	241595629	241595629	+	IGR	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241595629delT								GPR35 (24954 upstream) : AQP12B (20207 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	1003193	1003194	+	IGR	INS	-	TTCCTTCC	TTCCTTCC	rs62230836		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:1003193_1003194insTTCCTTCC								CHL1 (552098 upstream) : CNTN6 (131426 downstream)																																			---	---	---	---
COLQ	8292	broad.mit.edu	37	3	15495593	15495593	+	Intron	DEL	C	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:15495593delC	uc003bzx.2	-						COLQ_uc003bzv.2_Intron|COLQ_uc003bzz.2_Intron|COLQ_uc010heo.2_Intron|COLQ_uc003cac.1_Intron|COLQ_uc003cae.1_Intron|COLQ_uc003cad.1_Intron	NM_005677	NP_005668			acetylcholinesterase collagen-like tail subunit						acetylcholine catabolic process in synaptic cleft|asymmetric protein localization	basal lamina|cell junction|collagen|extracellular space|synaptic cleft					0																		---	---	---	---
ZNF385D	79750	broad.mit.edu	37	3	21896175	21896175	+	Intron	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:21896175delA	uc010hfb.1	-											Homo sapiens cDNA: FLJ22419 fis, clone HRC08593.							nucleus	nucleic acid binding|zinc ion binding			large_intestine(2)|skin(2)|ovary(1)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	22421035	22421038	+	IGR	DEL	AGGA	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:22421035_22421038delAGGA								ZNF385D (6912 upstream) : UBE2E2 (823615 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	23148207	23148207	+	IGR	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:23148207delT								ZNF385D (734084 upstream) : UBE2E2 (96446 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	24092010	24092010	+	IGR	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:24092010delA								NR1D2 (69901 upstream) : LOC152024 (45770 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	25878628	25878628	+	IGR	DEL	G	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:25878628delG								OXSM (42604 upstream) : LRRC3B (785672 downstream)																																			---	---	---	---
ZCWPW2	152098	broad.mit.edu	37	3	28516110	28516113	+	Intron	DEL	GTGC	-	-	rs9868003	by1000genomes;by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:28516110_28516113delGTGC	uc003ceh.2	+						ZCWPW2_uc003cei.2_Intron|ZCWPW2_uc010hfo.2_Intron	NM_001040432	NP_001035522			zinc finger, CW type with PWWP domain 2								zinc ion binding			ovary(2)	2																		---	---	---	---
RBMS3	27303	broad.mit.edu	37	3	29940227	29940228	+	Intron	INS	-	GTGTGT	GTGTGT	rs145413086	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:29940227_29940228insGTGTGT	uc003cel.2	+						RBMS3_uc003cek.2_Intron|RBMS3_uc010hfq.2_Intron|RBMS3_uc003cem.2_Intron|RBMS3_uc010hfr.2_Intron	NM_001003793	NP_001003793			RNA binding motif, single stranded interacting							cytoplasm	nucleotide binding|RNA binding			central_nervous_system(1)	1		Ovarian(412;0.0956)																---	---	---	---
GADL1	339896	broad.mit.edu	37	3	30769972	30769973	+	Intron	INS	-	C	C			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:30769972_30769973insC	uc003cep.2	-							NM_207359	NP_997242			glutamate decarboxylase-like 1						carboxylic acid metabolic process		carboxy-lyase activity|pyridoxal phosphate binding				0					Pyridoxal Phosphate(DB00114)													---	---	---	---
GADL1	339896	broad.mit.edu	37	3	30869863	30869863	+	Intron	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:30869863delT	uc003cep.2	-						GADL1_uc003ceq.1_Intron	NM_207359	NP_997242			glutamate decarboxylase-like 1						carboxylic acid metabolic process		carboxy-lyase activity|pyridoxal phosphate binding				0					Pyridoxal Phosphate(DB00114)													---	---	---	---
GLB1	2720	broad.mit.edu	37	3	33042712	33042713	+	Intron	DEL	TC	-	-	rs7618005	by1000genomes;by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:33042712_33042713delTC	uc003cfi.1	-						GLB1_uc003cfh.1_Intron|GLB1_uc003cfj.1_Intron|GLB1_uc011axk.1_Intron	NM_000404	NP_000395			galactosidase, beta 1 isoform a preproprotein						carbohydrate metabolic process	lysosome|perinuclear region of cytoplasm	beta-galactosidase activity|cation binding|protein binding			large_intestine(1)	1		Melanoma(143;0.104)																---	---	---	---
MYRIP	25924	broad.mit.edu	37	3	40125847	40125850	+	Intron	DEL	GATA	-	-	rs67369976		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:40125847_40125850delGATA	uc003cka.2	+						MYRIP_uc010hhu.2_Intron|MYRIP_uc010hhv.2_Intron|MYRIP_uc010hhw.2_Intron|MYRIP_uc010hhx.1_Intron	NM_015460	NP_056275			myosin VIIA and Rab interacting protein						intracellular protein transport		actin binding|zinc ion binding			ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	5				KIRC - Kidney renal clear cell carcinoma(284;0.174)|Kidney(284;0.206)														---	---	---	---
ULK4	54986	broad.mit.edu	37	3	41899362	41899363	+	Intron	INS	-	G	G	rs138421212	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:41899362_41899363insG	uc003ckv.3	-						ULK4_uc003ckw.2_Intron	NM_017886	NP_060356			unc-51-like kinase 4								ATP binding|protein serine/threonine kinase activity				0				KIRC - Kidney renal clear cell carcinoma(284;0.214)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	43304181	43304182	+	IGR	INS	-	AGGG	AGGG	rs139493780	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:43304181_43304182insAGGG								C3orf39 (156616 upstream) : SNRK (23822 downstream)																																			---	---	---	---
CDCP1	64866	broad.mit.edu	37	3	45142415	45142415	+	Intron	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:45142415delA	uc003com.2	-							NM_022842	NP_073753			CUB domain-containing protein 1 isoform 1							extracellular region|integral to membrane|plasma membrane				ovary(1)|central_nervous_system(1)|skin(1)	3				BRCA - Breast invasive adenocarcinoma(193;0.00928)|KIRC - Kidney renal clear cell carcinoma(197;0.0519)|Kidney(197;0.0651)														---	---	---	---
SMARCC1	6599	broad.mit.edu	37	3	47754136	47754139	+	Intron	DEL	CAAA	-	-	rs149444819		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:47754136_47754139delCAAA	uc003crq.2	-						SMARCC1_uc011bbd.1_Intron	NM_003074	NP_003065			SWI/SNF-related matrix-associated						chromatin remodeling|nervous system development|transcription, DNA-dependent	nBAF complex|npBAF complex|nucleoplasm|SWI/SNF complex|WINAC complex	DNA binding|protein N-terminus binding|transcription coactivator activity			skin(2)|lung(1)	3				BRCA - Breast invasive adenocarcinoma(193;7.47e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00862)|Kidney(197;0.01)														---	---	---	---
FBXW12	285231	broad.mit.edu	37	3	48415387	48415387	+	Intron	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48415387delT	uc003csr.2	+						FBXW12_uc010hjv.2_Intron|FBXW12_uc003css.2_Intron|FBXW12_uc010hjw.2_Intron	NM_207102	NP_996985			F-box and WD repeat domain containing 12 isoform												0				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)														---	---	---	---
DOCK3	1795	broad.mit.edu	37	3	50848657	50848658	+	Intron	INS	-	A	A	rs139245787	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:50848657_50848658insA	uc011bds.1	+							NM_004947	NP_004938			dedicator of cytokinesis 3							cytoplasm	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity|SH3 domain binding				0				BRCA - Breast invasive adenocarcinoma(193;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00449)|Kidney(197;0.00518)														---	---	---	---
PBRM1	55193	broad.mit.edu	37	3	52696841	52696841	+	Intron	DEL	A	-	-	rs34605756		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52696841delA	uc003des.2	-						PBRM1_uc003dex.2_Intron|PBRM1_uc003deq.2_Intron|PBRM1_uc003der.2_Intron|PBRM1_uc003det.2_Intron|PBRM1_uc003deu.2_Intron|PBRM1_uc003dev.2_Intron|PBRM1_uc003dew.2_Intron|PBRM1_uc010hmk.1_Intron|PBRM1_uc003dey.2_Intron|PBRM1_uc003dez.1_Intron|PBRM1_uc003dfb.1_Intron	NM_181042	NP_060635			polybromo 1 isoform 4						chromatin remodeling|mitosis|negative regulation of cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear chromosome	chromatin binding|DNA binding|protein binding			kidney(136)|breast(4)	140				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)				Mis|N|F|S|D|O		clear cell renal carcinoma|breast								---	---	---	---
Unknown	0	broad.mit.edu	37	3	54040347	54040347	+	IGR	DEL	T	-	-	rs72040620		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:54040347delT								SELK (114358 upstream) : CACNA2D3 (116346 downstream)																																			---	---	---	---
FHIT	2272	broad.mit.edu	37	3	61205002	61205003	+	Intron	DEL	TG	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:61205002_61205003delTG	uc003dkx.3	-						FHIT_uc003dky.2_Intron|FHIT_uc010hnn.1_Intron	NM_002012	NP_002003			fragile histidine triad gene						nucleotide metabolic process		bis(5'-adenosyl)-triphosphatase activity|protein binding				0		all_cancers(2;2.37e-314)|all_epithelial(2;5.17e-286)|Colorectal(2;1.24e-68)|all_lung(2;1.31e-45)|Lung NSC(2;1.79e-44)|all_hematologic(2;1.59e-23)|Renal(2;1.03e-13)|Breast(2;1.06e-10)|Esophageal squamous(2;6.31e-09)|Melanoma(2;1.83e-07)|Acute lymphoblastic leukemia(2;5.46e-05)|all_neural(2;0.00118)|Medulloblastoma(2;0.00263)|Hepatocellular(2;0.0245)|Ovarian(2;0.0408)		UCEC - Uterine corpus endometrioid carcinoma (45;0.0887)|Epithelial(1;9.28e-70)|all cancers(1;3.07e-60)|Colorectal(1;2.33e-53)|STAD - Stomach adenocarcinoma(1;7.22e-48)|COAD - Colon adenocarcinoma(3;1.05e-44)|READ - Rectum adenocarcinoma(3;2.41e-08)|KIRC - Kidney renal clear cell carcinoma(10;0.000109)|Kidney(10;0.000125)|Lung(1;0.000161)|LUSC - Lung squamous cell carcinoma(1;0.000742)|OV - Ovarian serous cystadenocarcinoma(275;0.00372)|BRCA - Breast invasive adenocarcinoma(55;0.00448)				T	HMGA2	pleomorphic salivary gland adenoma				Renal_Cell_Cancer_associated_with_constitutional_translocation_of_chromosome_3				---	---	---	---
FHIT	2272	broad.mit.edu	37	3	61227965	61227966	+	Intron	INS	-	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:61227965_61227966insA	uc003dkx.3	-						FHIT_uc003dky.2_Intron|FHIT_uc010hnn.1_Intron	NM_002012	NP_002003			fragile histidine triad gene						nucleotide metabolic process		bis(5'-adenosyl)-triphosphatase activity|protein binding				0		all_cancers(2;2.37e-314)|all_epithelial(2;5.17e-286)|Colorectal(2;1.24e-68)|all_lung(2;1.31e-45)|Lung NSC(2;1.79e-44)|all_hematologic(2;1.59e-23)|Renal(2;1.03e-13)|Breast(2;1.06e-10)|Esophageal squamous(2;6.31e-09)|Melanoma(2;1.83e-07)|Acute lymphoblastic leukemia(2;5.46e-05)|all_neural(2;0.00118)|Medulloblastoma(2;0.00263)|Hepatocellular(2;0.0245)|Ovarian(2;0.0408)		UCEC - Uterine corpus endometrioid carcinoma (45;0.0887)|Epithelial(1;9.28e-70)|all cancers(1;3.07e-60)|Colorectal(1;2.33e-53)|STAD - Stomach adenocarcinoma(1;7.22e-48)|COAD - Colon adenocarcinoma(3;1.05e-44)|READ - Rectum adenocarcinoma(3;2.41e-08)|KIRC - Kidney renal clear cell carcinoma(10;0.000109)|Kidney(10;0.000125)|Lung(1;0.000161)|LUSC - Lung squamous cell carcinoma(1;0.000742)|OV - Ovarian serous cystadenocarcinoma(275;0.00372)|BRCA - Breast invasive adenocarcinoma(55;0.00448)				T	HMGA2	pleomorphic salivary gland adenoma				Renal_Cell_Cancer_associated_with_constitutional_translocation_of_chromosome_3				---	---	---	---
ATXN7	6314	broad.mit.edu	37	3	63982841	63982841	+	Intron	DEL	G	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:63982841delG	uc003dlw.3	+						ATXN7_uc010hnv.2_Intron|ATXN7_uc011bfn.1_Intron	NM_000333	NP_000324			ataxin 7 isoform a						cell death|histone deubiquitination|nucleus organization|regulation of transcription, DNA-dependent|transcription, DNA-dependent|visual perception	cytoplasm|nuclear matrix|nucleolus	protein binding|zinc ion binding				0		Prostate(884;0.0181)		BRCA - Breast invasive adenocarcinoma(55;0.000614)|KIRC - Kidney renal clear cell carcinoma(15;0.00294)|Kidney(15;0.00305)														---	---	---	---
ADAMTS9	56999	broad.mit.edu	37	3	64563966	64563967	+	Intron	DEL	AA	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:64563966_64563967delAA	uc003dmg.2	-						ADAMTS9_uc011bfo.1_Intron|ADAMTS9_uc003dmh.1_Intron|ADAMTS9_uc011bfp.1_Intron|uc003dmi.1_Intron	NM_182920	NP_891550			ADAM metallopeptidase with thrombospondin type 1						glycoprotein catabolic process|multicellular organismal development|proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(2)|urinary_tract(1)|skin(1)	4		Lung NSC(201;0.00682)		BRCA - Breast invasive adenocarcinoma(55;0.00142)|Kidney(15;0.00202)|KIRC - Kidney renal clear cell carcinoma(15;0.00221)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	66568968	66568969	+	IGR	INS	-	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:66568968_66568969insT								LRIG1 (18123 upstream) : KBTBD8 (479758 downstream)																																			---	---	---	---
SUCLG2	8801	broad.mit.edu	37	3	67666044	67666045	+	Intron	DEL	AA	-	-	rs9808978		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:67666044_67666045delAA	uc003dna.3	-							NM_003848	NP_003839			succinate-CoA ligase, GDP-forming beta subunit						succinyl-CoA metabolic process|tricarboxylic acid cycle	mitochondrial matrix	ATP binding|GTP binding|succinate-CoA ligase (GDP-forming) activity			central_nervous_system(1)|skin(1)	2		Renal(2;0.00294)|Lung NSC(201;0.012)|Hepatocellular(537;0.121)		BRCA - Breast invasive adenocarcinoma(55;3.53e-05)|Epithelial(33;0.000153)	Succinic acid(DB00139)													---	---	---	---
PPP4R2	151987	broad.mit.edu	37	3	73056096	73056097	+	Intron	INS	-	G	G	rs142724167	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:73056096_73056097insG	uc003dph.1	+						PPP4R2_uc003dpi.1_Intron	NM_174907	NP_777567			protein phosphatase 4, regulatory subunit 2						mRNA processing|protein modification process|regulation of double-strand break repair via homologous recombination|RNA splicing	centrosome|nucleus|protein phosphatase 4 complex	protein binding, bridging|protein phosphatase type 4 regulator activity			lung(1)	1		Prostate(10;0.0187)|Lung SC(41;0.236)		Epithelial(33;1.76e-07)|BRCA - Breast invasive adenocarcinoma(55;9.42e-05)|LUSC - Lung squamous cell carcinoma(21;0.00211)|Lung(16;0.00643)|KIRC - Kidney renal clear cell carcinoma(39;0.0164)|Kidney(39;0.0193)|OV - Ovarian serous cystadenocarcinoma(275;0.031)														---	---	---	---
PPP4R2	151987	broad.mit.edu	37	3	73076811	73076814	+	Intron	DEL	GTGT	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:73076811_73076814delGTGT	uc003dph.1	+						PPP4R2_uc003dpi.1_Intron	NM_174907	NP_777567			protein phosphatase 4, regulatory subunit 2						mRNA processing|protein modification process|regulation of double-strand break repair via homologous recombination|RNA splicing	centrosome|nucleus|protein phosphatase 4 complex	protein binding, bridging|protein phosphatase type 4 regulator activity			lung(1)	1		Prostate(10;0.0187)|Lung SC(41;0.236)		Epithelial(33;1.76e-07)|BRCA - Breast invasive adenocarcinoma(55;9.42e-05)|LUSC - Lung squamous cell carcinoma(21;0.00211)|Lung(16;0.00643)|KIRC - Kidney renal clear cell carcinoma(39;0.0164)|Kidney(39;0.0193)|OV - Ovarian serous cystadenocarcinoma(275;0.031)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	75035822	75035822	+	IGR	DEL	C	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:75035822delC								CNTN3 (465479 upstream) : FAM86D (434883 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	75852558	75852559	+	IGR	INS	-	T	T	rs146922229	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:75852558_75852559insT								ZNF717 (17888 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	76066840	76066841	+	IGR	DEL	AG	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:76066840_76066841delAG								ZNF717 (232170 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	76956011	76956018	+	IGR	DEL	AATATATT	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:76956011_76956018delAATATATT								None (None upstream) : ROBO2 (133276 downstream)																																			---	---	---	---
ROBO2	6092	broad.mit.edu	37	3	77116180	77116181	+	Intron	DEL	CA	-	-	rs67063631		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:77116180_77116181delCA	uc003dpy.3	+						ROBO2_uc003dpz.2_Intron|ROBO2_uc011bgj.1_Intron|ROBO2_uc011bgk.1_Intron	NM_002942	NP_002933			roundabout, axon guidance receptor, homolog 2						apoptosis involved in luteolysis|axon midline choice point recognition|cellular response to hormone stimulus|homophilic cell adhesion|metanephros development|negative regulation of negative chemotaxis|negative regulation of synaptogenesis|olfactory bulb interneuron development|positive regulation of axonogenesis|retinal ganglion cell axon guidance|ureteric bud development	axolemma|cell surface|integral to membrane	axon guidance receptor activity|identical protein binding			lung(5)|skin(3)|ovary(1)|large_intestine(1)|liver(1)	11				Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	80330157	80330158	+	IGR	INS	-	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:80330157_80330158insT								ROBO1 (513098 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	82114264	82114264	+	Intron	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:82114264delA	uc003dqh.1	+											Homo sapiens cDNA clone IMAGE:5271111.																														---	---	---	---
Unknown	0	broad.mit.edu	37	3	83373676	83373676	+	IGR	DEL	C	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:83373676delC								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	86294183	86294184	+	IGR	DEL	TG	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:86294183_86294184delTG								CADM2 (176235 upstream) : VGLL3 (692941 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	90327090	90327090	+	IGR	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:90327090delT								EPHA3 (795808 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	94898157	94898157	+	IGR	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:94898157delT								LOC255025 (3078 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	95999217	95999219	+	IGR	DEL	GAT	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:95999217_95999219delGAT								None (None upstream) : EPHA6 (534206 downstream)																																			---	---	---	---
COL8A1	1295	broad.mit.edu	37	3	99368632	99368633	+	Intron	DEL	CA	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:99368632_99368633delCA	uc003dtg.1	+						COL8A1_uc003dth.1_Intron|COL8A1_uc010hpe.1_Intron	NM_001850	NP_001841			alpha 1 type VIII collagen precursor						angiogenesis|cell adhesion	basement membrane|collagen type VIII					0																		---	---	---	---
FILIP1L	11259	broad.mit.edu	37	3	99628159	99628159	+	Intron	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:99628159delA	uc003dtm.2	-						C3orf26_uc003dtk.1_Intron|C3orf26_uc003dtl.2_Intron|FILIP1L_uc003dto.2_Intron	NM_182909	NP_878913			filamin A interacting protein 1-like isoform 1							cytoplasm|membrane|myosin complex|nucleus				ovary(1)	1																		---	---	---	---
CEP97	79598	broad.mit.edu	37	3	101476293	101476293	+	Intron	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:101476293delT	uc003dvk.1	+						CEP97_uc010hpm.1_Intron|CEP97_uc011bhf.1_Intron|CEP97_uc003dvl.1_Intron|CEP97_uc003dvm.1_Intron	NM_024548	NP_078824			centrosomal protein 97kDa							centrosome|nucleus	protein binding			ovary(2)	2																		---	---	---	---
BBX	56987	broad.mit.edu	37	3	107273909	107273909	+	Intron	DEL	C	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:107273909delC	uc010hpr.2	+						BBX_uc003dwk.3_Intron|BBX_uc003dwl.3_Intron	NM_001142568	NP_001136040			HMG-BOX transcription factor BBX isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(3)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(3;0.112)															---	---	---	---
Unknown	0	broad.mit.edu	37	3	109648950	109648953	+	IGR	DEL	TCCC	-	-	rs113948167		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:109648950_109648953delTCCC								FLJ25363 (434936 upstream) : None (None downstream)																																			---	---	---	---
SLC9A10	285335	broad.mit.edu	37	3	111944614	111944615	+	Intron	INS	-	T	T	rs137931971	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:111944614_111944615insT	uc003dyu.2	-						SLC9A10_uc011bhu.1_Intron|SLC9A10_uc010hqc.2_Intron	NM_183061	NP_898884			sperm-specific sodium proton exchanger						cell differentiation|multicellular organismal development|sodium ion transport|spermatogenesis	cilium|flagellar membrane|integral to membrane	solute:hydrogen antiporter activity			ovary(3)|breast(2)	5																		---	---	---	---
QTRTD1	79691	broad.mit.edu	37	3	113802116	113802118	+	Intron	DEL	TTG	-	-	rs72503931		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113802116_113802118delTTG	uc003eay.2	+						QTRTD1_uc003eaz.2_Intron|QTRTD1_uc011biq.1_Intron|QTRTD1_uc011bir.1_Intron	NM_024638	NP_078914			queuine tRNA-ribosyltransferase domain						queuosine biosynthetic process	mitochondrion	metal ion binding|queuine tRNA-ribosyltransferase activity			central_nervous_system(1)|skin(1)	2																		---	---	---	---
ZBTB20	26137	broad.mit.edu	37	3	114724849	114724849	+	Intron	DEL	G	-	-	rs141515986	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:114724849delG	uc003ebm.2	-						ZBTB20_uc003ebn.2_Intron|ZBTB20_uc003ebp.2_Intron	NM_015642	NP_056457			zinc finger and BTB domain containing 20 isoform						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(4)|skin(1)	5				LUSC - Lung squamous cell carcinoma(41;0.0581)|Lung(219;0.191)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	116394584	116394591	+	IGR	DEL	ACACACAC	-	-	rs66680402		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:116394584_116394591delACACACAC								LSAMP (870566 upstream) : LOC285194 (34044 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	116483799	116483804	+	IGR	DEL	AGATAT	-	-	rs72145012		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:116483799_116483804delAGATAT								LOC285194 (47914 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	116788334	116788334	+	IGR	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:116788334delT								LOC285194 (352449 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	117019691	117019691	+	IGR	DEL	G	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:117019691delG								LOC285194 (583806 upstream) : None (None downstream)																																			---	---	---	---
POLQ	10721	broad.mit.edu	37	3	121212882	121212883	+	Intron	DEL	CT	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121212882_121212883delCT	uc003eee.3	-							NM_199420	NP_955452			DNA polymerase theta						DNA repair|DNA replication	nucleoplasm	ATP binding|ATP-dependent helicase activity|damaged DNA binding|DNA-directed DNA polymerase activity|single-stranded DNA-dependent ATPase activity			ovary(4)|breast(3)|lung(2)|upper_aerodigestive_tract(1)|skin(1)	11				GBM - Glioblastoma multiforme(114;0.0915)									DNA_polymerases_(catalytic_subunits)					---	---	---	---
SEMA5B	54437	broad.mit.edu	37	3	122705546	122705547	+	Intron	DEL	AC	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:122705546_122705547delAC	uc003efz.1	-						SEMA5B_uc011bju.1_Intron|SEMA5B_uc003ega.1_Intron|SEMA5B_uc003egb.1_Intron|SEMA5B_uc010hro.1_Intron|SEMA5B_uc010hrp.1_Intron	NM_001031702	NP_001026872			semaphorin 5B isoform 1						cell differentiation|nervous system development	integral to membrane	receptor activity			ovary(2)|breast(2)|pancreas(2)|central_nervous_system(1)	7				GBM - Glioblastoma multiforme(114;0.0367)														---	---	---	---
MGLL	11343	broad.mit.edu	37	3	127410937	127410938	+	3'UTR	INS	-	T	T	rs148189529		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:127410937_127410938insT	uc003ejx.2	-	8					MGLL_uc003ejw.2_3'UTR|MGLL_uc011bko.1_3'UTR|MGLL_uc003ejv.2_3'UTR	NM_001003794	NP_001003794			monoglyceride lipase isoform 2						arachidonic acid metabolic process|fatty acid biosynthetic process|inflammatory response|platelet activation|regulation of endocannabinoid signaling pathway|regulation of inflammatory response|regulation of sensory perception of pain|triglyceride catabolic process	plasma membrane	acylglycerol lipase activity|carboxylesterase activity|lysophospholipase activity|protein homodimerization activity				0																		---	---	---	---
SEC61A1	29927	broad.mit.edu	37	3	127773473	127773476	+	Intron	DEL	AAAG	-	-	rs3836539		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:127773473_127773476delAAAG	uc003ekb.2	+						SEC61A1_uc003ekc.2_Intron|SEC61A1_uc003ekd.2_Intron	NM_013336	NP_037468			Sec61 alpha 1 subunit						protein targeting to ER	integral to endoplasmic reticulum membrane	P-P-bond-hydrolysis-driven protein transmembrane transporter activity|protein binding|ribosome binding			ovary(1)	1																		---	---	---	---
RAB43	339122	broad.mit.edu	37	3	128863558	128863559	+	Intron	DEL	TG	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:128863558_128863559delTG	uc003elo.1	-						ISY1_uc010hsz.1_Intron|ISY1_uc003elp.1_Intron|ISY1_uc010hta.1_Intron	NM_020701	NP_065752			ISY1 splicing factor homolog						protein transport|small GTPase mediated signal transduction	plasma membrane	GTP binding			lung(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	128933096	128933096	+	IGR	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:128933096delT								CNBP (30286 upstream) : COPG (35357 downstream)																																			---	---	---	---
CPNE4	131034	broad.mit.edu	37	3	131869422	131869423	+	Intron	DEL	TG	-	-	rs72434742		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:131869422_131869423delTG	uc003eom.2	-							NM_130808	NP_570720			copine IV											upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3																		---	---	---	---
EPHB1	2047	broad.mit.edu	37	3	134853329	134853330	+	Intron	DEL	GT	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:134853329_134853330delGT	uc003eqt.2	+						EPHB1_uc003equ.2_Intron	NM_004441	NP_004432			ephrin receptor EphB1 precursor							integral to plasma membrane	ATP binding|ephrin receptor activity|protein binding			lung(11)|ovary(6)|stomach(4)|breast(3)|central_nervous_system(2)|skin(2)|large_intestine(1)|pancreas(1)	30																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	134984286	134984286	+	IGR	DEL	G	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:134984286delG								EPHB1 (4981 upstream) : PPP2R3A (700281 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	135569471	135569471	+	IGR	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:135569471delA								EPHB1 (590166 upstream) : PPP2R3A (115096 downstream)																																			---	---	---	---
STAG1	10274	broad.mit.edu	37	3	136179524	136179524	+	Intron	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:136179524delT	uc003era.1	-						STAG1_uc003erb.1_Intron|STAG1_uc003erc.1_Intron|STAG1_uc010hua.1_Intron	NM_005862	NP_005853			stromal antigen 1						cell division|chromosome segregation|mitotic metaphase/anaphase transition|mitotic prometaphase	cell junction|chromatin|chromosome, centromeric region|nucleoplasm	protein binding			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	146345115	146345116	+	IGR	DEL	AC	-	-	rs139866818		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:146345115_146345116delAC								PLSCR5 (21112 upstream) : ZIC4 (758721 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	146724870	146724873	+	IGR	DEL	GTTC	-	-	rs1604499	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:146724870_146724873delGTTC								PLSCR5 (400867 upstream) : ZIC4 (378964 downstream)																																			---	---	---	---
TM4SF4	7104	broad.mit.edu	37	3	149199064	149199065	+	Intron	INS	-	AGGGAAGAGG	AGGGAAGAGG	rs151302970	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:149199064_149199065insAGGGAAGAGG	uc003exd.1	+							NM_004617	NP_004608			transmembrane 4 superfamily member 4							integral to membrane					0			LUSC - Lung squamous cell carcinoma(72;0.0378)|Lung(72;0.048)															---	---	---	---
WWTR1	25937	broad.mit.edu	37	3	149243507	149243508	+	Intron	DEL	TT	-	-	rs11312622		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:149243507_149243508delTT	uc003exe.2	-						WWTR1_uc003exf.2_Intron|WWTR1_uc011bns.1_Intron|WWTR1_uc003exh.2_Intron	NM_015472	NP_056287			WW domain containing transcription regulator 1						hippo signaling cascade|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of catenin import into nucleus|negative regulation of protein kinase activity|negative regulation of protein phosphorylation|positive regulation of cell proliferation|positive regulation of epithelial to mesenchymal transition|regulation of SMAD protein import into nucleus|stem cell division|transcription, DNA-dependent	cytoplasm	transcription coactivator activity			breast(3)|skin(1)	4			LUSC - Lung squamous cell carcinoma(72;0.0378)|Lung(72;0.048)															---	---	---	---
Unknown	0	broad.mit.edu	37	3	152764946	152764946	+	IGR	DEL	T	-	-	rs67442941		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:152764946delT								P2RY1 (209105 upstream) : RAP2B (115083 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	153490883	153490883	+	IGR	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:153490883delA								C3orf79 (270400 upstream) : SGEF (348266 downstream)																																			---	---	---	---
MFSD1	64747	broad.mit.edu	37	3	158530942	158530942	+	Intron	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:158530942delT	uc003fcl.1	+						MFSD1_uc003fcm.1_Intron|MFSD1_uc003fcn.1_Intron|MFSD1_uc011bow.1_Intron|MFSD1_uc011box.1_Intron	NM_022736	NP_073573			major facilitator superfamily domain containing						transmembrane transport	integral to membrane					0			Lung(72;0.00372)|LUSC - Lung squamous cell carcinoma(72;0.00523)															---	---	---	---
Unknown	0	broad.mit.edu	37	3	159908358	159908359	+	Intron	INS	-	A	A	rs149975502	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:159908358_159908359insA	uc003fcw.1	-											Homo sapiens cDNA FLJ39842 fis, clone SPLEN2014293.																														---	---	---	---
IFT80	57560	broad.mit.edu	37	3	159984128	159984128	+	Intron	DEL	C	-	-	rs11294435		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:159984128delC	uc011boy.1	-						IFT80_uc003fda.2_Intron|IFT80_uc003fdb.1_Intron|IFT80_uc003fdd.1_Intron|IFT80_uc003fde.1_Intron	NM_020800	NP_065851			WD repeat domain 56							cilium axoneme|microtubule basal body				ovary(1)	1			Lung(72;0.00334)|LUSC - Lung squamous cell carcinoma(72;0.00523)															---	---	---	---
Unknown	0	broad.mit.edu	37	3	160186099	160186099	+	IGR	DEL	A	-	-	rs74541378		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:160186099delA								IFT80 (18473 upstream) : KPNA4 (31864 downstream)																																			---	---	---	---
PPM1L	151742	broad.mit.edu	37	3	160526078	160526081	+	Intron	DEL	TGTG	-	-	rs145547354		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:160526078_160526081delTGTG	uc003fdr.2	+							NM_139245	NP_640338			protein phosphatase 1 (formerly 2C)-like						protein dephosphorylation|sphingolipid metabolic process	endoplasmic reticulum membrane|integral to membrane|protein serine/threonine phosphatase complex	metal ion binding|protein serine/threonine phosphatase activity			breast(1)	1			Lung(72;0.00149)|LUSC - Lung squamous cell carcinoma(72;0.00216)															---	---	---	---
PPM1L	151742	broad.mit.edu	37	3	160672749	160672749	+	Intron	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:160672749delT	uc003fdr.2	+						PPM1L_uc003fds.2_Intron|PPM1L_uc003fdt.2_Intron|PPM1L_uc010hwf.2_Intron	NM_139245	NP_640338			protein phosphatase 1 (formerly 2C)-like						protein dephosphorylation|sphingolipid metabolic process	endoplasmic reticulum membrane|integral to membrane|protein serine/threonine phosphatase complex	metal ion binding|protein serine/threonine phosphatase activity			breast(1)	1			Lung(72;0.00149)|LUSC - Lung squamous cell carcinoma(72;0.00216)															---	---	---	---
Unknown	0	broad.mit.edu	37	3	161796301	161796302	+	IGR	DEL	TG	-	-	rs72362439		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:161796301_161796302delTG								OTOL1 (574573 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	162219366	162219366	+	IGR	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:162219366delT								OTOL1 (997638 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	162548087	162548088	+	Intron	INS	-	AAATA	AAATA	rs137944185	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:162548087_162548088insAAATA	uc003feg.2	+											Homo sapiens, clone IMAGE:2905387, mRNA.																														---	---	---	---
Unknown	0	broad.mit.edu	37	3	166483749	166483749	+	IGR	DEL	C	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:166483749delC								BCHE (928496 upstream) : ZBBX (474332 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	166517468	166517468	+	IGR	DEL	T	-	-	rs72136358		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:166517468delT								BCHE (962215 upstream) : ZBBX (440613 downstream)																																			---	---	---	---
WDR49	151790	broad.mit.edu	37	3	167283200	167283201	+	Intron	INS	-	AT	AT	rs144511770	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:167283200_167283201insAT	uc003fev.1	-						WDR49_uc003feu.1_Intron|WDR49_uc011bpd.1_Intron|WDR49_uc003few.1_Intron	NM_178824	NP_849146			WD repeat domain 49											large_intestine(1)|ovary(1)|skin(1)	3																		---	---	---	---
WDR49	151790	broad.mit.edu	37	3	167352470	167352470	+	Intron	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:167352470delA	uc003fev.1	-						WDR49_uc003few.1_Intron	NM_178824	NP_849146			WD repeat domain 49											large_intestine(1)|ovary(1)|skin(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	167966398	167966399	+	IGR	INS	-	T	T	rs71883683		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:167966398_167966399insT								GOLIM4 (152981 upstream) : MIR551B (303243 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	168519761	168519761	+	IGR	DEL	T	-	-	rs63235260		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:168519761delT								MIR551B (250024 upstream) : C3orf50 (7823 downstream)																																			---	---	---	---
MECOM	2122	broad.mit.edu	37	3	169096372	169096375	+	Intron	DEL	AAGT	-	-	rs72046347	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:169096372_169096375delAAGT	uc011bpj.1	-						MECOM_uc003ffl.2_Intron|MECOM_uc011bpk.1_Intron|MECOM_uc010hwn.2_Intron|MECOM_uc011bpl.1_Intron	NM_004991	NP_004982			MDS1 and EVI1 complex locus isoform c						apoptosis|cell differentiation|hemopoietic stem cell proliferation|negative regulation of JNK cascade|negative regulation of programmed cell death|negative regulation of transcription, DNA-dependent|regulation of cell cycle	nuclear speck	DNA binding|protein binding|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(5)|skin(5)|upper_aerodigestive_tract(1)|central_nervous_system(1)|ovary(1)|pancreas(1)	14																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	171641274	171641274	+	IGR	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:171641274delA								TMEM212 (64166 upstream) : FNDC3B (116144 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	172299678	172299679	+	IGR	DEL	AG	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:172299678_172299679delAG								TNFSF10 (58409 upstream) : NCEH1 (48757 downstream)																																			---	---	---	---
ECT2	1894	broad.mit.edu	37	3	172468342	172468351	+	5'Flank	DEL	CACATCCGGG	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:172468342_172468351delCACATCCGGG	uc003fii.2	+						ECT2_uc010hwv.1_5'Flank|ECT2_uc003fih.2_5'Flank	NM_018098	NP_060568			epithelial cell transforming sequence 2 oncogene						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	Rho guanyl-nucleotide exchange factor activity|signal transducer activity			breast(2)|ovary(1)|skin(1)	4	Ovarian(172;0.00197)|Breast(254;0.158)		Lung(28;1.33e-14)|LUSC - Lung squamous cell carcinoma(14;1.48e-14)													OREG0009067|OREG0015928	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)|type=TRANSCRIPTION FACTOR BINDING SITE|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip); Conservation found by scanning with a motif model	---	---	---	---
Unknown	0	broad.mit.edu	37	3	172911379	172911379	+	IGR	DEL	G	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:172911379delG								SPATA16 (52347 upstream) : NLGN1 (204865 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	174274535	174274535	+	Intron	DEL	T	-	-	rs112062960		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:174274535delT	uc003fir.2	+						uc003fis.2_Intron|uc010hwx.1_Intron					Homo sapiens NAALADL2 gene, partial 5'UTR, variant 1.																														---	---	---	---
NAALADL2	254827	broad.mit.edu	37	3	174821182	174821182	+	Intron	DEL	G	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:174821182delG	uc003fit.2	+						NAALADL2_uc003fiu.1_Intron	NM_207015	NP_996898			N-acetylated alpha-linked acidic dipeptidase 2						proteolysis	integral to membrane	peptidase activity			pancreas(1)	1	Ovarian(172;0.0102)	all_cancers(1;0.0272)|all_epithelial(1;0.0553)	OV - Ovarian serous cystadenocarcinoma(80;9.26e-28)	Colorectal(1;1.66e-10)|COAD - Colon adenocarcinoma(1;2.1e-07)|STAD - Stomach adenocarcinoma(1;0.00261)|READ - Rectum adenocarcinoma(3;0.0284)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	176066969	176066969	+	IGR	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:176066969delT								NAALADL2 (543543 upstream) : TBL1XR1 (671574 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	176487539	176487542	+	IGR	DEL	AGGA	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:176487539_176487542delAGGA								NAALADL2 (964113 upstream) : TBL1XR1 (251001 downstream)																																			---	---	---	---
TBL1XR1	79718	broad.mit.edu	37	3	176882139	176882139	+	Intron	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:176882139delT	uc003fiw.3	-						TBL1XR1_uc003fix.3_Intron|TBL1XR1_uc011bpz.1_Intron|TBL1XR1_uc003fiy.2_Intron	NM_024665	NP_078941			transducin (beta)-like 1 X-linked receptor 1						canonical Wnt receptor signaling pathway|cellular lipid metabolic process|chromatin modification|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|proteasomal ubiquitin-dependent protein catabolic process|transcription, DNA-dependent	spindle microtubule|transcriptional repressor complex	beta-catenin binding|histone binding|protein N-terminus binding|transcription corepressor activity|transcription regulatory region DNA binding			ovary(1)	1	all_cancers(143;1.44e-17)|Ovarian(172;0.00163)|Breast(254;0.214)	Acute lymphoblastic leukemia(1;0.00599)|all_hematologic(1;0.0632)|Prostate(884;0.215)	OV - Ovarian serous cystadenocarcinoma(80;9.83e-31)															---	---	---	---
Unknown	0	broad.mit.edu	37	3	177337925	177337925	+	IGR	DEL	G	-	-	rs12630655	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:177337925delG								TBL1XR1 (422877 upstream) : KCNMB2 (916299 downstream)																																			---	---	---	---
PEX5L	51555	broad.mit.edu	37	3	179520651	179520652	+	Intron	INS	-	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:179520651_179520652insT	uc003fki.1	-						PEX5L_uc011bqd.1_Intron|PEX5L_uc011bqe.1_Intron|PEX5L_uc011bqf.1_Intron|PEX5L_uc003fkj.1_Intron|PEX5L_uc010hxd.1_Intron|PEX5L_uc011bqg.1_Intron|PEX5L_uc011bqh.1_Intron	NM_016559	NP_057643			peroxisomal biogenesis factor 5-like						protein import into peroxisome matrix|regulation of cAMP-mediated signaling	cytosol|peroxisomal membrane	peroxisome matrix targeting signal-1 binding			ovary(3)|large_intestine(1)	4	all_cancers(143;3.94e-14)|Ovarian(172;0.0338)|Breast(254;0.183)		OV - Ovarian serous cystadenocarcinoma(80;1.75e-26)|GBM - Glioblastoma multiforme(14;0.000518)															---	---	---	---
Unknown	0	broad.mit.edu	37	3	180519884	180519885	+	Intron	INS	-	A	A	rs143792975	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:180519884_180519885insA	uc003fko.2	-											Homo sapiens mRNA; cDNA DKFZp434A128 (from clone DKFZp434A128).																														---	---	---	---
Unknown	0	broad.mit.edu	37	3	181567365	181567366	+	IGR	DEL	GT	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:181567365_181567366delGT								SOX2OT (108362 upstream) : ATP11B (943925 downstream)																																			---	---	---	---
MCF2L2	23101	broad.mit.edu	37	3	183015430	183015431	+	Intron	INS	-	CCTTCCTT	CCTTCCTT	rs138473795	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183015430_183015431insCCTTCCTT	uc003fli.1	-						MCF2L2_uc003flj.1_Intron|MCF2L2_uc011bqr.1_Intron|uc003fln.1_RNA|uc003flo.2_5'Flank	NM_015078	NP_055893			Rho family guanine-nucleotide exchange factor						regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity			ovary(2)|large_intestine(2)|breast(1)	5	all_cancers(143;1.26e-12)|Ovarian(172;0.0355)		all cancers(12;3.35e-44)|Epithelial(37;6.48e-38)|LUSC - Lung squamous cell carcinoma(7;7.12e-25)|Lung(8;6.39e-23)|OV - Ovarian serous cystadenocarcinoma(80;6.75e-21)															---	---	---	---
ECE2	9718	broad.mit.edu	37	3	183986757	183986757	+	Intron	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183986757delA	uc003fni.3	+							NM_014693	NP_055508			endothelin converting enzyme 2 isoform A						brain development|cardioblast differentiation|cell-cell signaling|peptide hormone processing	cytoplasmic vesicle membrane|Golgi membrane|integral to membrane	metal ion binding|metalloendopeptidase activity|methyltransferase activity			ovary(2)|skin(2)	4	all_cancers(143;1.39e-10)|Ovarian(172;0.0339)		Epithelial(37;8.28e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)															---	---	---	---
Unknown	0	broad.mit.edu	37	3	184150686	184150687	+	IGR	DEL	AT	-	-	rs139228284	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184150686_184150687delAT								CHRD (43067 upstream) : EPHB3 (128900 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	184392241	184392264	+	IGR	DEL	TGGATGGGTGGATGGATGGATGGG	-	-	rs146709641	by1000genomes;by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184392241_184392264delTGGATGGGTGGATGGATGGATGGG								EPHB3 (92046 upstream) : MAGEF1 (35892 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	184499397	184499397	+	IGR	DEL	C	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184499397delC								MAGEF1 (69561 upstream) : VPS8 (30534 downstream)																																			---	---	---	---
BCL6	604	broad.mit.edu	37	3	187443242	187443243	+	Intron	INS	-	CTC	CTC	rs67024507		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:187443242_187443243insCTC	uc003frp.3	-						BCL6_uc011bsf.1_Intron|BCL6_uc010hza.2_Intron|BCL6_uc003frq.1_Intron	NM_001130845	NP_001124317			B-cell lymphoma 6 protein isoform 1						negative regulation of B cell apoptosis|negative regulation of cell growth|negative regulation of S phase of mitotic cell cycle|negative regulation of transcription from RNA polymerase II promoter|positive regulation of apoptosis|protein import into nucleus, translocation|regulation of germinal center formation|response to DNA damage stimulus	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)|lung(2)|central_nervous_system(1)	5	all_cancers(143;9.45e-12)|Ovarian(172;0.0418)		OV - Ovarian serous cystadenocarcinoma(80;1.76e-18)	GBM - Glioblastoma multiforme(93;0.0141)				T|Mis	IG loci|ZNFN1A1|LCP1|PIM1|TFRC|MHC2TA|NACA|HSPCB|HSPCA|HIST1H4I|IL21R| POU2AF1|ARHH|EIF4A2|SFRS3	NHL|CLL								---	---	---	---
LPP	4026	broad.mit.edu	37	3	188123668	188123671	+	Intron	DEL	TCTT	-	-	rs72210157		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:188123668_188123671delTCTT	uc003frs.1	+						LPP_uc011bsg.1_Intron|LPP_uc011bsi.1_Intron|LPP_uc003frt.2_Intron	NM_005578	NP_005569			LIM domain containing preferred translocation						cell adhesion	cytoplasm|focal adhesion|nucleus	protein binding|zinc ion binding		HMGA2/LPP(161)	soft_tissue(134)|bone(27)|lung(2)|ovary(1)|breast(1)	165	all_cancers(143;1.37e-09)|all_hematologic(3;0.0429)|Ovarian(172;0.088)	all_lung(153;0.00139)|Lung NSC(153;0.00202)		GBM - Glioblastoma multiforme(93;0.00602)				T	HMGA2|MLL|C12orf9	lipoma|leukemia								---	---	---	---
TPRG1	285386	broad.mit.edu	37	3	188942286	188942286	+	Intron	DEL	C	-	-	rs2122437		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:188942286delC	uc003frv.1	+						TPRG1_uc003frw.1_Intron	NM_198485	NP_940887			tumor protein p63 regulated 1												0	all_cancers(143;6.12e-12)|all_hematologic(3;0.0359)|Ovarian(172;0.0925)	all_lung(153;8.23e-09)|Lung NSC(153;3.55e-06)|all_neural(597;0.0019)|Myeloproliferative disorder(1037;0.0255)	Lung(62;6.93e-06)	GBM - Glioblastoma multiforme(93;4.77e-14)														---	---	---	---
IL1RAP	3556	broad.mit.edu	37	3	190287374	190287374	+	Intron	DEL	T	-	-	rs3841957		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:190287374delT	uc003fsm.1	+						IL1RAP_uc003fsk.2_Intron|IL1RAP_uc003fsl.2_Intron|IL1RAP_uc010hzf.2_Intron|IL1RAP_uc010hzg.1_Intron|IL1RAP_uc003fsn.1_Intron|IL1RAP_uc003fso.1_Intron|IL1RAP_uc003fsp.1_Intron|IL1RAP_uc003fsq.2_Intron	NM_002182	NP_002173			interleukin 1 receptor accessory protein isoform						inflammatory response|innate immune response|protein complex assembly	extracellular region|integral to plasma membrane				ovary(1)	1	all_cancers(143;3.61e-10)|Ovarian(172;0.0733)|Breast(254;0.21)		Lung(62;1.95e-06)|LUSC - Lung squamous cell carcinoma(58;2.05e-06)	GBM - Glioblastoma multiforme(93;0.00851)														---	---	---	---
FGF12	2257	broad.mit.edu	37	3	192428417	192428417	+	Intron	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:192428417delA	uc003fsy.2	-							NM_004113	NP_004104			fibroblast growth factor 12 isoform 2						cell-cell signaling|heart development|JNK cascade|nervous system development|signal transduction	extracellular space|nucleus	growth factor activity|heparin binding			ovary(1)|skin(1)|lung(1)|pancreas(1)	4	all_cancers(143;1.72e-08)|Ovarian(172;0.0634)|Breast(254;0.247)	Lung NSC(153;0.21)	LUSC - Lung squamous cell carcinoma(58;5.45e-06)|Lung(62;6.17e-06)	GBM - Glioblastoma multiforme(46;0.00032)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	193497543	193497543	+	IGR	DEL	T	-	-	rs112117968		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:193497543delT								OPA1 (81944 upstream) : LOC100128023 (213341 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	193701166	193701167	+	IGR	DEL	AC	-	-	rs113253998		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:193701166_193701167delAC								OPA1 (285567 upstream) : LOC100128023 (9717 downstream)																																			---	---	---	---
LRRC15	131578	broad.mit.edu	37	3	194092595	194092596	+	5'Flank	DEL	AT	-	-	rs112884343	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:194092595_194092596delAT	uc003ftu.2	-						LRRC15_uc003ftt.2_5'Flank	NM_130830	NP_570843			leucine rich repeat containing 15 isoform b							integral to membrane				ovary(3)	3	all_cancers(143;5.31e-09)|Ovarian(172;0.0634)		OV - Ovarian serous cystadenocarcinoma(49;2.2e-17)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;4.94e-05)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	194303700	194303700	+	IGR	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:194303700delT								ATP13A3 (114732 upstream) : TMEM44 (4703 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	194711994	194711995	+	IGR	INS	-	CTC	CTC	rs142616777	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:194711994_194711995insCTC								FAM43A (302230 upstream) : C3orf21 (77020 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	194712076	194712081	+	IGR	DEL	CTCCTA	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:194712076_194712081delCTCCTA								FAM43A (302312 upstream) : C3orf21 (76934 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	194783804	194783805	+	IGR	INS	-	GCAGGGG	GCAGGGG			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:194783804_194783805insGCAGGGG								FAM43A (374040 upstream) : C3orf21 (5210 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	195433715	195433716	+	Intron	INS	-	T	T	rs9862341		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195433715_195433716insT	uc011btd.1	+						uc003fux.1_Intron					Homo sapiens cDNA FLJ46488 fis, clone THYMU3026869.																														---	---	---	---
FBXO45	200933	broad.mit.edu	37	3	196313773	196313773	+	3'UTR	DEL	A	-	-	rs11297150		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196313773delA	uc010iai.2	+	3						NM_001105573	NP_001099043			F-box protein 45						nervous system development|proteasomal ubiquitin-dependent protein catabolic process|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|response to DNA damage stimulus	cell junction|postsynaptic membrane|presynaptic membrane	protein binding			skin(1)	1	all_cancers(143;8.88e-09)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;2.75e-23)|all cancers(36;2.47e-21)|OV - Ovarian serous cystadenocarcinoma(49;2.32e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00314)														---	---	---	---
DLG1	1739	broad.mit.edu	37	3	196871910	196871911	+	Intron	INS	-	CT	CT	rs35261692		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196871910_196871911insCT	uc003fxo.3	-						DLG1_uc011bub.1_Intron|DLG1_uc011buc.1_Intron|DLG1_uc011bud.1_Intron|DLG1_uc003fxn.3_Intron|DLG1_uc011bue.1_Intron|DLG1_uc010ial.2_Intron|DLG1_uc011buf.1_Intron|DLG1_uc003fxp.2_Intron|DLG1_uc010iam.1_Intron|DLG1_uc010ian.2_Intron	NM_001098424	NP_001091894			discs, large homolog 1 isoform 1						actin filament organization|axon guidance|cell-cell adhesion|cortical actin cytoskeleton organization|endothelial cell proliferation|establishment or maintenance of cell polarity|interspecies interaction between organisms|mitotic cell cycle G1/S transition checkpoint|negative regulation of mitotic cell cycle|protein localization in plasma membrane|synaptic transmission|tight junction assembly	basolateral plasma membrane|cytosol|endoplasmic reticulum membrane|immunological synapse|MPP7-DLG1-LIN7 complex|nucleus|postsynaptic density|postsynaptic membrane|sarcolemma|tight junction	cytoskeletal protein binding|guanylate kinase activity|L27 domain binding|phosphatase binding|phosphoprotein phosphatase activity|potassium channel regulator activity|protein binding|protein C-terminus binding|protein kinase binding			ovary(3)	3	all_cancers(143;6.22e-10)|Ovarian(172;0.0418)|Breast(254;0.0589)	Lung NSC(153;0.133)	Epithelial(36;3.23e-24)|all cancers(36;2.15e-22)|OV - Ovarian serous cystadenocarcinoma(49;3.88e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.0148)														---	---	---	---
ZNF141	7700	broad.mit.edu	37	4	353088	353088	+	Intron	DEL	A	-	-	rs78449876		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:353088delA	uc003gaa.2	+						ZNF141_uc003gab.2_Intron	NM_003441	NP_003432			zinc finger protein 141						anatomical structure morphogenesis|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	nucleus	DNA binding|zinc ion binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	3583719	3583725	+	Intron	DEL	GGAAGGA	-	-	rs66844729		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3583719_3583725delGGAAGGA	uc003ghj.1	+						uc003ghk.1_Intron					Homo sapiens cDNA FLJ35424 fis, clone SMINT2001461.																														---	---	---	---
Unknown	0	broad.mit.edu	37	4	3604432	3604434	+	IGR	DEL	GGG	-	-	rs66512680		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3604432_3604434delGGG								LRPAP1 (70208 upstream) : ADRA2C (163641 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	3608063	3608068	+	IGR	DEL	GTGAGT	-	-	rs36227767		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3608063_3608068delGTGAGT								LRPAP1 (73839 upstream) : ADRA2C (160007 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	3824565	3824565	+	IGR	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3824565delA								ADRA2C (54314 upstream) : LOC348926 (119105 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	3829172	3829173	+	IGR	INS	-	GT	GT	rs73794447		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3829172_3829173insGT								ADRA2C (58921 upstream) : LOC348926 (114497 downstream)																																			---	---	---	---
SORCS2	57537	broad.mit.edu	37	4	7192176	7192179	+	5'Flank	DEL	TCTT	-	-	rs140124190		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:7192176_7192179delTCTT	uc003gkb.3	+							NM_020777	NP_065828			VPS10 domain receptor protein SORCS 2 precursor							integral to membrane	neuropeptide receptor activity			ovary(1)|central_nervous_system(1)	2																		---	---	---	---
SORCS2	57537	broad.mit.edu	37	4	7495758	7495761	+	Intron	DEL	ACAG	-	-	rs138322071		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:7495758_7495761delACAG	uc003gkb.3	+						SORCS2_uc011bwi.1_Intron	NM_020777	NP_065828			VPS10 domain receptor protein SORCS 2 precursor							integral to membrane	neuropeptide receptor activity			ovary(1)|central_nervous_system(1)	2																		---	---	---	---
GPR78	27201	broad.mit.edu	37	4	8583585	8583586	+	Intron	INS	-	CA	CA	rs142941176	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:8583585_8583586insCA	uc003glk.2	+						CPZ_uc003gll.2_Intron	NM_080819	NP_543009			G protein-coupled receptor 78						activation of adenylate cyclase activity by G-protein signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			central_nervous_system(4)|ovary(2)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	13023188	13023189	+	IGR	INS	-	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:13023188_13023189insA								None (None upstream) : HSP90AB2P (311848 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	14509493	14509493	+	Intron	DEL	T	-	-	rs112408937		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:14509493delT	uc003gne.2	-						uc003gnf.2_Intron					Homo sapiens cDNA clone IMAGE:3604199, **** WARNING: chimeric clone ****.																														---	---	---	---
Unknown	0	broad.mit.edu	37	4	15293608	15293608	+	IGR	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:15293608delA								CPEB2 (221834 upstream) : C1QTNF7 (47952 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	18152681	18152682	+	IGR	DEL	AC	-	-	rs113242823		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:18152681_18152682delAC								LCORL (129296 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	19022298	19022301	+	IGR	DEL	TTCA	-	-	rs36149485		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:19022298_19022301delTTCA								LCORL (998913 upstream) : None (None downstream)																																			---	---	---	---
KCNIP4	80333	broad.mit.edu	37	4	21503617	21503618	+	Intron	DEL	CA	-	-	rs77637490		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:21503617_21503618delCA	uc003gqh.1	-						KCNIP4_uc003gqg.1_Intron|KCNIP4_uc003gqi.1_Intron	NM_001035003	NP_001030175			Kv channel interacting protein 4 isoform 5							plasma membrane	calcium ion binding|potassium channel activity|protein binding|voltage-gated ion channel activity				0		Breast(46;0.134)																---	---	---	---
PPARGC1A	10891	broad.mit.edu	37	4	23818615	23818615	+	Intron	DEL	G	-	-	rs3774914	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:23818615delG	uc003gqs.2	-						PPARGC1A_uc003gqt.2_Intron|PPARGC1A_uc011bxp.1_Intron|PPARGC1A_uc010ier.1_Intron	NM_013261	NP_037393			peroxisome proliferator-activated receptor						androgen receptor signaling pathway|brown fat cell differentiation|cellular glucose homeostasis|digestion|fatty acid oxidation|gluconeogenesis|mitochondrion organization|mRNA processing|neuron death|positive regulation of fatty acid oxidation|positive regulation of gluconeogenesis|positive regulation of histone acetylation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|protein complex assembly|protein stabilization|response to muscle activity|response to starvation|RNA splicing|temperature homeostasis|transcription initiation from RNA polymerase II promoter	DNA-directed RNA polymerase II, core complex	androgen receptor binding|DNA binding|ligand-dependent nuclear receptor binding|ligand-dependent nuclear receptor transcription coactivator activity|nucleotide binding|RNA binding|RNA polymerase II transcription cofactor activity|transcription factor binding			ovary(2)|lung(2)|kidney(2)|skin(2)	8		Breast(46;0.0503)																---	---	---	---
Unknown	0	broad.mit.edu	37	4	25121446	25121447	+	IGR	INS	-	T	T	rs151095327	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:25121446_25121447insT								LGI2 (89032 upstream) : SEPSECS (181 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	26179007	26179007	+	IGR	DEL	G	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:26179007delG								C4orf52 (247507 upstream) : RBPJ (142325 downstream)																																			---	---	---	---
RBPJ	3516	broad.mit.edu	37	4	26362670	26362671	+	Intron	INS	-	GT	GT	rs71899348		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:26362670_26362671insGT	uc003grx.1	+						RBPJ_uc003gry.1_Intron|RBPJ_uc003grz.1_Intron|RBPJ_uc011bxt.1_Intron|RBPJ_uc003gsa.1_Intron|RBPJ_uc003gsb.1_Intron|RBPJ_uc003gsc.1_5'Flank	NM_005349	NP_005340			recombining binding protein suppressor of						DNA recombination|negative regulation of transcription, DNA-dependent|positive regulation of transcription of Notch receptor target	cytoplasm|nucleolus|nucleoplasm	DNA binding|protein binding|recombinase activity|sequence-specific DNA binding transcription factor activity			ovary(1)|lung(1)|central_nervous_system(1)	3		Breast(46;0.0503)																---	---	---	---
RBPJ	3516	broad.mit.edu	37	4	26362683	26362684	+	Intron	INS	-	TC	TC			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:26362683_26362684insTC	uc003grx.1	+						RBPJ_uc003gry.1_Intron|RBPJ_uc003grz.1_Intron|RBPJ_uc011bxt.1_Intron|RBPJ_uc003gsa.1_Intron|RBPJ_uc003gsb.1_Intron|RBPJ_uc003gsc.1_5'Flank	NM_005349	NP_005340			recombining binding protein suppressor of						DNA recombination|negative regulation of transcription, DNA-dependent|positive regulation of transcription of Notch receptor target	cytoplasm|nucleolus|nucleoplasm	DNA binding|protein binding|recombinase activity|sequence-specific DNA binding transcription factor activity			ovary(1)|lung(1)|central_nervous_system(1)	3		Breast(46;0.0503)																---	---	---	---
Unknown	0	broad.mit.edu	37	4	27068531	27068531	+	IGR	DEL	C	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:27068531delC								STIM2 (42723 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	29927713	29927714	+	IGR	INS	-	G	G			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:29927713_29927714insG								None (None upstream) : PCDH7 (794323 downstream)																																			---	---	---	---
PCDH7	5099	broad.mit.edu	37	4	31058168	31058169	+	Intron	DEL	GA	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:31058168_31058169delGA	uc011bxx.1	+						PCDH7_uc011bxw.1_Intron	NM_002589	NP_002580			protocadherin 7 isoform a precursor						homophilic cell adhesion	integral to plasma membrane	calcium ion binding			upper_aerodigestive_tract(1)|ovary(1)|liver(1)|skin(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	37025630	37025630	+	IGR	DEL	C	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:37025630delC								MIR1255B-1 (597580 upstream) : KIAA1239 (221060 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	38380609	38380609	+	IGR	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:38380609delA								TBC1D1 (239816 upstream) : FLJ13197 (233713 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	38826711	38826711	+	IGR	DEL	C	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:38826711delC								TLR1 (20299 upstream) : TLR6 (1697 downstream)																																			---	---	---	---
PDS5A	23244	broad.mit.edu	37	4	39842655	39842656	+	Intron	INS	-	T	T	rs143316840	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:39842655_39842656insT	uc003guv.3	-						PDS5A_uc010ifo.2_Intron	NM_001100399	NP_001093869			PDS5, regulator of cohesion maintenance, homolog						cell division|mitosis|negative regulation of DNA replication	chromatin|nucleus	identical protein binding				0																		---	---	---	---
APBB2	323	broad.mit.edu	37	4	41161897	41161897	+	Intron	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:41161897delA	uc003gvl.2	-						APBB2_uc003gvm.2_Intron|APBB2_uc003gvn.2_Intron	NM_173075	NP_775098			amyloid beta A4 precursor protein-binding,						cell cycle arrest|intracellular signal transduction|negative regulation of cell growth|negative regulation of S phase of mitotic cell cycle|regulation of transcription, DNA-dependent	growth cone|lamellipodium|membrane|nucleus|synapse	beta-amyloid binding|transcription factor binding			ovary(2)|large_intestine(1)	3																		---	---	---	---
GABRB1	2560	broad.mit.edu	37	4	47365914	47365914	+	Intron	DEL	G	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:47365914delG	uc003gxh.2	+						GABRB1_uc011bze.1_Intron	NM_000812	NP_000803			gamma-aminobutyric acid (GABA) A receptor, beta						synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			ovary(2)	2					Ethchlorvynol(DB00189)|Flurazepam(DB00690)|Lorazepam(DB00186)|Midazolam(DB00683)													---	---	---	---
SCFD2	152579	broad.mit.edu	37	4	54221976	54221976	+	Intron	DEL	C	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:54221976delC	uc003gzu.2	-						SCFD2_uc010igm.2_Intron	NM_152540	NP_689753			sec1 family domain containing 2						protein transport|vesicle docking involved in exocytosis					ovary(2)|pancreas(1)	3			GBM - Glioblastoma multiforme(3;1.07e-26)|LUSC - Lung squamous cell carcinoma(32;0.0134)															---	---	---	---
PDGFRA	5156	broad.mit.edu	37	4	54325445	54325446	+	Intron	DEL	TT	-	-	rs143855228		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:54325445_54325446delTT	uc003haa.2	+						FIP1L1_uc003gzy.2_Intron|FIP1L1_uc011bzu.1_Intron|FIP1L1_uc003gzz.2_Intron|FIP1L1_uc003hab.2_Intron|FIP1L1_uc003hac.2_Intron|FIP1L1_uc010ign.2_Intron|FIP1L1_uc003had.2_Intron|FIP1L1_uc003hae.2_Intron	NM_006206	NP_006197			platelet-derived growth factor receptor alpha						cardiac myofibril assembly|cell activation|luteinization|metanephric glomerular capillary formation|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of DNA replication|positive regulation of fibroblast proliferation|protein autophosphorylation|retina vasculature development in camera-type eye	cytoplasm|integral to plasma membrane|nucleus	ATP binding|platelet-derived growth factor alpha-receptor activity|platelet-derived growth factor binding|platelet-derived growth factor receptor binding|protein homodimerization activity|vascular endothelial growth factor receptor activity			soft_tissue(572)|small_intestine(40)|stomach(16)|lung(16)|central_nervous_system(13)|haematopoietic_and_lymphoid_tissue(7)|skin(3)|ovary(3)|gastrointestinal_tract_(site_indeterminate)(1)|autonomic_ganglia(1)|prostate(1)|bone(1)	674	all_cancers(7;0.000425)|all_lung(4;0.000343)|Lung NSC(11;0.000467)|all_epithelial(27;0.0131)|all_neural(26;0.0209)|Glioma(25;0.08)		GBM - Glioblastoma multiforme(1;4.18e-71)|all cancers(1;4.76e-45)|LUSC - Lung squamous cell carcinoma(32;0.00256)		Becaplermin(DB00102)|Imatinib(DB00619)|Sunitinib(DB01268)			Mis|O|T	FIP1L1	GIST|idiopathic hypereosinophilic syndrome				Gastrointestinal_Stromal_Tumors_Sporadic_Multiple_Primary|Familial_Intestinal_Neurofibromatosis	TSP Lung(21;0.16)			---	---	---	---
PDGFRA	5156	broad.mit.edu	37	4	54343366	54343367	+	Intron	INS	-	CTAT	CTAT	rs139919946	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:54343366_54343367insCTAT	uc003haa.2	+						LNX1_uc003haf.3_Intron|LNX1_uc003hag.3_Intron|LNX1_uc003hah.3_Intron	NM_006206	NP_006197			platelet-derived growth factor receptor alpha						cardiac myofibril assembly|cell activation|luteinization|metanephric glomerular capillary formation|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of DNA replication|positive regulation of fibroblast proliferation|protein autophosphorylation|retina vasculature development in camera-type eye	cytoplasm|integral to plasma membrane|nucleus	ATP binding|platelet-derived growth factor alpha-receptor activity|platelet-derived growth factor binding|platelet-derived growth factor receptor binding|protein homodimerization activity|vascular endothelial growth factor receptor activity			soft_tissue(572)|small_intestine(40)|stomach(16)|lung(16)|central_nervous_system(13)|haematopoietic_and_lymphoid_tissue(7)|skin(3)|ovary(3)|gastrointestinal_tract_(site_indeterminate)(1)|autonomic_ganglia(1)|prostate(1)|bone(1)	674	all_cancers(7;0.000425)|all_lung(4;0.000343)|Lung NSC(11;0.000467)|all_epithelial(27;0.0131)|all_neural(26;0.0209)|Glioma(25;0.08)		GBM - Glioblastoma multiforme(1;4.18e-71)|all cancers(1;4.76e-45)|LUSC - Lung squamous cell carcinoma(32;0.00256)		Becaplermin(DB00102)|Imatinib(DB00619)|Sunitinib(DB01268)			Mis|O|T	FIP1L1	GIST|idiopathic hypereosinophilic syndrome				Gastrointestinal_Stromal_Tumors_Sporadic_Multiple_Primary|Familial_Intestinal_Neurofibromatosis	TSP Lung(21;0.16)			---	---	---	---
PDGFRA	5156	broad.mit.edu	37	4	54981784	54981784	+	Intron	DEL	C	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:54981784delC	uc003haa.2	+							NM_006206	NP_006197			platelet-derived growth factor receptor alpha						cardiac myofibril assembly|cell activation|luteinization|metanephric glomerular capillary formation|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of DNA replication|positive regulation of fibroblast proliferation|protein autophosphorylation|retina vasculature development in camera-type eye	cytoplasm|integral to plasma membrane|nucleus	ATP binding|platelet-derived growth factor alpha-receptor activity|platelet-derived growth factor binding|platelet-derived growth factor receptor binding|protein homodimerization activity|vascular endothelial growth factor receptor activity			soft_tissue(572)|small_intestine(40)|stomach(16)|lung(16)|central_nervous_system(13)|haematopoietic_and_lymphoid_tissue(7)|skin(3)|ovary(3)|gastrointestinal_tract_(site_indeterminate)(1)|autonomic_ganglia(1)|prostate(1)|bone(1)	674	all_cancers(7;0.000425)|all_lung(4;0.000343)|Lung NSC(11;0.000467)|all_epithelial(27;0.0131)|all_neural(26;0.0209)|Glioma(25;0.08)		GBM - Glioblastoma multiforme(1;4.18e-71)|all cancers(1;4.76e-45)|LUSC - Lung squamous cell carcinoma(32;0.00256)		Becaplermin(DB00102)|Imatinib(DB00619)|Sunitinib(DB01268)			Mis|O|T	FIP1L1	GIST|idiopathic hypereosinophilic syndrome				Gastrointestinal_Stromal_Tumors_Sporadic_Multiple_Primary|Familial_Intestinal_Neurofibromatosis	TSP Lung(21;0.16)			---	---	---	---
PDGFRA	5156	broad.mit.edu	37	4	55088904	55088905	+	Intron	DEL	TC	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:55088904_55088905delTC	uc003haa.2	+							NM_006206	NP_006197			platelet-derived growth factor receptor alpha						cardiac myofibril assembly|cell activation|luteinization|metanephric glomerular capillary formation|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of DNA replication|positive regulation of fibroblast proliferation|protein autophosphorylation|retina vasculature development in camera-type eye	cytoplasm|integral to plasma membrane|nucleus	ATP binding|platelet-derived growth factor alpha-receptor activity|platelet-derived growth factor binding|platelet-derived growth factor receptor binding|protein homodimerization activity|vascular endothelial growth factor receptor activity			soft_tissue(572)|small_intestine(40)|stomach(16)|lung(16)|central_nervous_system(13)|haematopoietic_and_lymphoid_tissue(7)|skin(3)|ovary(3)|gastrointestinal_tract_(site_indeterminate)(1)|autonomic_ganglia(1)|prostate(1)|bone(1)	674	all_cancers(7;0.000425)|all_lung(4;0.000343)|Lung NSC(11;0.000467)|all_epithelial(27;0.0131)|all_neural(26;0.0209)|Glioma(25;0.08)		GBM - Glioblastoma multiforme(1;4.18e-71)|all cancers(1;4.76e-45)|LUSC - Lung squamous cell carcinoma(32;0.00256)		Becaplermin(DB00102)|Imatinib(DB00619)|Sunitinib(DB01268)			Mis|O|T	FIP1L1	GIST|idiopathic hypereosinophilic syndrome				Gastrointestinal_Stromal_Tumors_Sporadic_Multiple_Primary|Familial_Intestinal_Neurofibromatosis	TSP Lung(21;0.16)			---	---	---	---
Unknown	0	broad.mit.edu	37	4	63721771	63721771	+	IGR	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:63721771delA								LPHN3 (783604 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	65552331	65552331	+	IGR	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:65552331delT								TECRL (277153 upstream) : EPHA5 (632951 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	66034199	66034199	+	IGR	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:66034199delA								TECRL (759021 upstream) : EPHA5 (151083 downstream)																																			---	---	---	---
EPHA5	2044	broad.mit.edu	37	4	66199249	66199266	+	Intron	DEL	GTGTGTGTCTGTGTGTGT	-	-	rs72340656	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:66199249_66199266delGTGTGTGTCTGTGTGTGT	uc003hcy.2	-						EPHA5_uc003hcx.2_Intron|EPHA5_uc003hcz.2_Intron|EPHA5_uc011cah.1_Intron|EPHA5_uc011cai.1_Intron|EPHA5_uc003hda.2_Intron	NM_004439	NP_004430			ephrin receptor EphA5 isoform a precursor						cAMP-mediated signaling|neuron development	dendrite|external side of plasma membrane|integral to plasma membrane|neuronal cell body|perinuclear region of cytoplasm|rough endoplasmic reticulum	ATP binding|transmembrane-ephrin receptor activity			lung(19)|stomach(2)|ovary(2)|central_nervous_system(1)	24															TSP Lung(17;0.13)			---	---	---	---
Unknown	0	broad.mit.edu	37	4	67336778	67336779	+	IGR	INS	-	A	A	rs145558267	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:67336778_67336779insA								MIR1269 (194132 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	72013630	72013631	+	IGR	DEL	CT	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:72013630_72013631delCT								DCK (117003 upstream) : SLC4A4 (39372 downstream)																																			---	---	---	---
ADAMTS3	9508	broad.mit.edu	37	4	73316639	73316640	+	Intron	INS	-	GGAA	GGAA	rs149707445	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:73316639_73316640insGGAA	uc003hgk.1	-							NM_014243	NP_055058			ADAM metallopeptidase with thrombospondin type 1						collagen catabolic process|collagen fibril organization|proteolysis	proteinaceous extracellular matrix	heparin binding|metalloendopeptidase activity|zinc ion binding			ovary(1)|lung(1)	2			Epithelial(6;4.97e-05)|OV - Ovarian serous cystadenocarcinoma(6;5.66e-05)|all cancers(17;0.000486)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)															---	---	---	---
EREG	2069	broad.mit.edu	37	4	75250288	75250288	+	Intron	DEL	T	-	-	rs5859426		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:75250288delT	uc003hie.1	+							NM_001432	NP_001423			epiregulin preproprotein						angiogenesis|cell-cell signaling|cytokine-mediated signaling pathway|epidermal growth factor receptor signaling pathway|female meiosis|keratinocyte differentiation|keratinocyte proliferation|luteinizing hormone signaling pathway|mRNA transcription|negative regulation of epithelial cell proliferation|negative regulation of smooth muscle cell differentiation|negative regulation of transcription, DNA-dependent|oocyte maturation|organ morphogenesis|ovarian cumulus expansion|ovulation|positive regulation of cell division|positive regulation of cytokine production|positive regulation of DNA replication|positive regulation of epidermal growth factor receptor activity|positive regulation of fibroblast proliferation|positive regulation of innate immune response|positive regulation of interleukin-6 biosynthetic process|positive regulation of mitosis|positive regulation of phosphorylation|positive regulation of smooth muscle cell proliferation|primary follicle stage|wound healing	extracellular space|integral to plasma membrane	epidermal growth factor receptor binding|growth factor activity			breast(1)|skin(1)	2			Lung(101;0.196)															---	---	---	---
CCDC158	339965	broad.mit.edu	37	4	77287754	77287754	+	Intron	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:77287754delA	uc003hkb.3	-							NM_001042784	NP_001036249			coiled-coil domain containing 158											skin(3)|ovary(2)|pancreas(1)	6																		---	---	---	---
FAM190A	401145	broad.mit.edu	37	4	91663243	91663244	+	Intron	DEL	AG	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:91663243_91663244delAG	uc003hsv.3	+						FAM190A_uc010ikv.2_Intron|FAM190A_uc003hsw.2_Intron|FAM190A_uc003hsx.2_Intron	NM_001145065	NP_001138537			KIAA1680 protein isoform 1											large_intestine(1)|ovary(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	100726152	100726161	+	IGR	DEL	AAGGCAAGGC	-	-	rs72321746		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:100726152_100726161delAAGGCAAGGC								MTTP (180999 upstream) : DAPP1 (11820 downstream)																																			---	---	---	---
DAPP1	27071	broad.mit.edu	37	4	100784875	100784876	+	Intron	INS	-	T	T	rs71913814		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:100784875_100784876insT	uc003hvf.3	+						DAPP1_uc011cek.1_Intron|DAPP1_uc010ilh.2_Intron	NM_014395	NP_055210			dual adaptor of phosphotyrosine and						signal transduction	cytoplasm|plasma membrane	phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3,4-bisphosphate binding|protein tyrosine phosphatase activity				0				OV - Ovarian serous cystadenocarcinoma(123;7.04e-09)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	101041458	101041458	+	IGR	DEL	C	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:101041458delC								LOC256880 (167838 upstream) : DDIT4L (65571 downstream)																																			---	---	---	---
NHEDC1	150159	broad.mit.edu	37	4	103876331	103876332	+	Intron	INS	-	C	C			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:103876331_103876332insC	uc003hww.2	-						NHEDC1_uc003hwu.2_Intron|NHEDC1_uc010ilm.2_Intron|NHEDC1_uc003hwv.2_Intron|NHEDC1_uc011cev.1_Intron	NM_139173	NP_631912			Na+/H+ exchanger domain containing 1 isoform 1							integral to membrane	solute:hydrogen antiporter activity			ovary(1)|skin(1)	2		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;1.5e-08)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	111850861	111850862	+	IGR	INS	-	CG	CG	rs146466141	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:111850861_111850862insCG								MIR297 (69058 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	113002436	113002437	+	IGR	INS	-	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:113002436_113002437insA								None (None upstream) : C4orf32 (64116 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	116752498	116752498	+	IGR	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:116752498delA								NDST4 (717466 upstream) : MIR1973 (468383 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	116787189	116787190	+	IGR	INS	-	GT	GT	rs142750624	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:116787189_116787190insGT								NDST4 (752157 upstream) : MIR1973 (433691 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	119305239	119305240	+	IGR	INS	-	TCTT	TCTT	rs148015919	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:119305239_119305240insTCTT								PRSS12 (31317 upstream) : CEP170L (132255 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	120356464	120356465	+	IGR	DEL	AC	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:120356464_120356465delAC								FABP2 (113148 upstream) : PDE5A (59087 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	122586852	122586876	+	IGR	DEL	CCTCCCTCCCTTCCTTCCTTTCCTC	-	-	rs112147766		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:122586852_122586876delCCTCCCTCCCTTCCTTCCTTTCCTC								QRFPR (284671 upstream) : ANXA5 (2277 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	129512575	129512576	+	IGR	INS	-	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:129512575_129512576insA								PGRMC2 (303627 upstream) : PHF17 (218203 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	138749305	138749305	+	IGR	DEL	G	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:138749305delG								PCDH18 (295657 upstream) : SLC7A11 (335943 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	139916433	139916433	+	IGR	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:139916433delA								SLC7A11 (752930 upstream) : CCRN4L (20510 downstream)																																			---	---	---	---
MAML3	55534	broad.mit.edu	37	4	140990576	140990584	+	Intron	DEL	GAAGGAGGA	-	-	rs140532703	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:140990576_140990584delGAAGGAGGA	uc003ihz.1	-						MAML3_uc011chd.1_Intron	NM_018717	NP_061187			mastermind-like 3						Notch signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nuclear speck	transcription coactivator activity			ovary(1)	1	all_hematologic(180;0.162)																	---	---	---	---
Unknown	0	broad.mit.edu	37	4	144099681	144099682	+	IGR	INS	-	G	G	rs149789507	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:144099681_144099682insG								INPP4B (332077 upstream) : USP38 (6388 downstream)																																			---	---	---	---
GAB1	2549	broad.mit.edu	37	4	144338319	144338319	+	Intron	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:144338319delA	uc003ije.2	+						GAB1_uc003ijd.2_Intron|GAB1_uc011chq.1_Intron	NM_002039	NP_002030			GRB2-associated binding protein 1 isoform b						cell proliferation|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway	cytosol	SH3/SH2 adaptor activity			breast(2)|lung(1)|skin(1)	4	all_hematologic(180;0.158)																	---	---	---	---
Unknown	0	broad.mit.edu	37	4	145841700	145841700	+	IGR	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:145841700delA								HHIP (181819 upstream) : ANAPC10 (74614 downstream)																																			---	---	---	---
ZNF827	152485	broad.mit.edu	37	4	146779287	146779290	+	Intron	DEL	GTGT	-	-	rs113062859		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:146779287_146779290delGTGT	uc003ikn.2	-						ZNF827_uc003ikm.2_Intron|ZNF827_uc010iox.2_Intron	NM_178835	NP_849157			zinc finger protein 827						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	all_hematologic(180;0.151)																	---	---	---	---
PRMT10	90826	broad.mit.edu	37	4	148583949	148583950	+	Intron	INS	-	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:148583949_148583950insA	uc003ilc.2	-						PRMT10_uc003ilb.2_5'Flank|PRMT10_uc003ild.2_Intron	NM_138364	NP_612373			protein arginine methyltransferase 10							cytoplasm	binding|protein methyltransferase activity			ovary(1)|central_nervous_system(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	153010701	153010701	+	IGR	DEL	G	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:153010701delG								PET112L (328555 upstream) : FBXW7 (231710 downstream)														p.?(1)																					---	---	---	---
Unknown	0	broad.mit.edu	37	4	158556617	158556618	+	IGR	INS	-	CA	CA	rs143944145	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:158556617_158556618insCA								LOC340017 (59322 upstream) : FAM198B (489115 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	160406701	160406701	+	IGR	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:160406701delA								RAPGEF2 (125402 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	167060497	167060497	+	IGR	DEL	C	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:167060497delC								TLL1 (35504 upstream) : SPOCK3 (594039 downstream)																																			---	---	---	---
PALLD	23022	broad.mit.edu	37	4	169647108	169647108	+	Intron	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:169647108delT	uc011cjx.1	+						PALLD_uc003iru.2_Intron|PALLD_uc003irv.2_Intron	NM_016081	NP_057165			palladin isoform 2						cytoskeleton organization	actin filament|focal adhesion|lamellipodium|nucleus|ruffle|sarcomere	actin binding|muscle alpha-actinin binding			ovary(1)	1		Prostate(90;0.00996)|Renal(120;0.0203)|Melanoma(52;0.144)		GBM - Glioblastoma multiforme(119;0.204)										Pancreatic_Cancer_Familial_Clustering_of				---	---	---	---
CBR4	84869	broad.mit.edu	37	4	169931341	169931341	+	5'UTR	DEL	G	-	-	rs67009551		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:169931341delG	uc003iry.2	-	1					CBR4_uc011cjy.1_RNA|CBR4_uc003irz.1_5'UTR	NM_032783	NP_116172			carbonic reductase 4						fatty acid biosynthetic process|protein homotetramerization	mitochondrial matrix	NADPH binding|NADPH dehydrogenase (quinone) activity|protein binding|quinone binding				0		Prostate(90;0.00263)|Renal(120;0.0183)|Melanoma(52;0.123)		GBM - Glioblastoma multiforme(119;0.0321)												OREG0016397	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
GLRA3	8001	broad.mit.edu	37	4	175609731	175609732	+	Intron	DEL	GT	-	-	rs34340432		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:175609731_175609732delGT	uc003ity.1	-						GLRA3_uc003itz.1_Intron	NM_006529	NP_006520			glycine receptor, alpha 3 isoform a						synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	extracellular-glycine-gated chloride channel activity|glycine binding|receptor activity|transmitter-gated ion channel activity			ovary(3)	3		Prostate(90;0.00601)|Breast(14;0.0091)|Melanoma(52;0.00959)|Renal(120;0.0183)|all_neural(102;0.0891)|all_hematologic(60;0.107)		all cancers(43;4.99e-18)|Epithelial(43;1.18e-16)|OV - Ovarian serous cystadenocarcinoma(60;5.88e-09)|STAD - Stomach adenocarcinoma(60;0.00442)|GBM - Glioblastoma multiforme(59;0.0102)|LUSC - Lung squamous cell carcinoma(193;0.0421)	Glycine(DB00145)													---	---	---	---
ODZ3	55714	broad.mit.edu	37	4	183148005	183148005	+	Intron	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:183148005delT	uc010irv.1	+											Homo sapiens ODZ3 (ODZ3) mRNA, partial cds.						signal transduction	integral to membrane					0		all_lung(41;2.69e-14)|Lung NSC(41;1.92e-11)|Melanoma(52;1.74e-05)|Colorectal(36;0.0062)|Breast(14;0.00748)|all_hematologic(60;0.0162)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_neural(102;0.155)|Medulloblastoma(177;0.184)		all cancers(43;1.42e-24)|Epithelial(43;6.86e-23)|OV - Ovarian serous cystadenocarcinoma(60;2.16e-11)|Colorectal(24;9.75e-06)|STAD - Stomach adenocarcinoma(60;2.96e-05)|COAD - Colon adenocarcinoma(29;0.00103)|GBM - Glioblastoma multiforme(59;0.00462)|LUSC - Lung squamous cell carcinoma(40;0.0391)|READ - Rectum adenocarcinoma(43;0.0487)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	184318635	184318636	+	IGR	DEL	TT	-	-	rs113601985		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:184318635_184318636delTT								WWC2 (76708 upstream) : CDKN2AIP (47153 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	185213849	185213850	+	IGR	DEL	GT	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:185213849_185213850delGT								ENPP6 (74735 upstream) : IRF2 (95028 downstream)																																			---	---	---	---
FAT1	2195	broad.mit.edu	37	4	187516451	187516452	+	Intron	DEL	GT	-	-	rs72489341		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:187516451_187516452delGT	uc003izf.2	-						FAT1_uc010isn.2_Intron|FAT1_uc003ize.2_Intron	NM_005245	NP_005236			FAT tumor suppressor 1 precursor						actin filament organization|anatomical structure morphogenesis|cell migration|cell-cell signaling|establishment or maintenance of cell polarity|homophilic cell adhesion	cell-cell junction|integral to plasma membrane|nucleus|perinuclear region of cytoplasm	calcium ion binding|protein binding			ovary(10)|central_nervous_system(1)|pancreas(1)	12															HNSCC(5;0.00058)			---	---	---	---
Unknown	0	broad.mit.edu	37	4	188284171	188284172	+	IGR	DEL	CA	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:188284171_188284172delCA								FAT1 (636321 upstream) : ZFP42 (632753 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	190576855	190576866	+	IGR	DEL	CACACACACGCA	-	-	rs67330044	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190576855_190576866delCACACACACGCA								None (None upstream) : FRG1 (285108 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	190817157	190817157	+	Intron	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190817157delA	uc003izq.2	-											Homo sapiens cDNA clone IMAGE:30384438.																														---	---	---	---
Unknown	0	broad.mit.edu	37	4	190818636	190818637	+	Intron	INS	-	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190818636_190818637insT	uc003izq.2	-											Homo sapiens cDNA clone IMAGE:30384438.																														---	---	---	---
SDHA	6389	broad.mit.edu	37	5	220267	220267	+	Intron	DEL	G	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:220267delG	uc003jao.3	+						CCDC127_uc003jam.1_5'Flank|SDHA_uc003jan.2_Intron|SDHA_uc011clv.1_Intron|SDHA_uc011clw.1_Intron|SDHA_uc003jap.3_Intron	NM_004168	NP_004159			succinate dehydrogenase complex, subunit A,						nervous system development|respiratory electron transport chain|succinate metabolic process|transport|tricarboxylic acid cycle	mitochondrial respiratory chain complex II	electron carrier activity|flavin adenine dinucleotide binding|protein binding|succinate dehydrogenase (ubiquinone) activity				0			Epithelial(17;0.0159)|all cancers(22;0.0236)|OV - Ovarian serous cystadenocarcinoma(19;0.0674)|Lung(60;0.113)		Succinic acid(DB00139)									Familial_Paragangliomas				---	---	---	---
Unknown	0	broad.mit.edu	37	5	1867416	1867416	+	IGR	DEL	G	-	-	rs66630704		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1867416delG								NDUFS6 (51253 upstream) : IRX4 (10125 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	5366175	5366175	+	IGR	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:5366175delT								ADAMTS16 (45764 upstream) : KIAA0947 (56632 downstream)																																			---	---	---	---
UBE2QL1	134111	broad.mit.edu	37	5	6447297	6447305	+	5'Flank	DEL	CACACACAC	-	-	rs140901973		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:6447297_6447305delCACACACAC	uc003jdp.3	+							NM_001145161	NP_001138633			ubiquitin-conjugating enzyme E2Q family-like 1								ATP binding|ubiquitin-protein ligase activity				0																		---	---	---	---
DAP	1611	broad.mit.edu	37	5	10725273	10725273	+	Intron	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:10725273delT	uc003jez.3	-						DAP_uc011cmw.1_Intron	NM_004394	NP_004385			death-associated protein						activation of caspase activity|cellular response to amino acid starvation|induction of apoptosis by extracellular signals|negative regulation of autophagy|negative regulation of NF-kappaB transcription factor activity|negative regulation of transcription, DNA-dependent		death domain binding				0		Ovarian(839;1.34e-05)|Breast(839;0.0634)|Lung NSC(810;0.0804)																---	---	---	---
Unknown	0	broad.mit.edu	37	5	10966076	10966077	+	IGR	INS	-	TT	TT	rs148183551	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:10966076_10966077insTT								DAP (204689 upstream) : CTNND2 (5875 downstream)																																			---	---	---	---
CTNND2	1501	broad.mit.edu	37	5	11770524	11770527	+	Intron	DEL	GAAA	-	-	rs72309569		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:11770524_11770527delGAAA	uc003jfa.1	-						CTNND2_uc011cmz.1_Intron|CTNND2_uc010itu.1_Intron	NM_001332	NP_001323			catenin (cadherin-associated protein), delta 2						multicellular organismal development|neuron cell-cell adhesion|regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	adherens junction|cytoplasm|nucleus	protein binding			large_intestine(2)|ovary(2)|skin(2)|pancreas(1)|lung(1)	8																		---	---	---	---
Unknown	0	broad.mit.edu	37	5	12221494	12221495	+	IGR	INS	-	TTTTA	TTTTA	rs113973051		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:12221494_12221495insTTTTA								CTNND2 (317384 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	17089160	17089160	+	IGR	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:17089160delT								MYO10 (152775 upstream) : LOC285696 (40977 downstream)																																			---	---	---	---
GUSBP1	728411	broad.mit.edu	37	5	21566580	21566583	+	Intron	DEL	TCTA	-	-	rs144446846		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:21566580_21566583delTCTA	uc003jgh.3	+							NR_027026				Homo sapiens cDNA FLJ38337 fis, clone FCBBF3026692, moderately similar to Homo sapiens WD repeat domain 70 (WDR70), mRNA.												0																		---	---	---	---
CDH12	1010	broad.mit.edu	37	5	22202275	22202278	+	Intron	DEL	CCTC	-	-	rs72243697		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:22202275_22202278delCCTC	uc010iuc.2	-						CDH12_uc011cno.1_Intron|CDH12_uc003jgk.2_Intron	NM_004061	NP_004052			cadherin 12, type 2 preproprotein						adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)	2															HNSCC(59;0.17)			---	---	---	---
Unknown	0	broad.mit.edu	37	5	24913845	24913846	+	IGR	INS	-	GAA	GAA	rs35921848		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:24913845_24913846insGAA								CDH10 (268934 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	27058185	27058185	+	IGR	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:27058185delT								CDH9 (19496 upstream) : None (None downstream)																																			---	---	---	---
PDZD2	23037	broad.mit.edu	37	5	31908815	31908825	+	Intron	DEL	CCCCTTGCAAT	-	-	rs112636797		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:31908815_31908825delCCCCTTGCAAT	uc003jhl.2	+						PDZD2_uc003jhm.2_Intron|PDZD2_uc011cnx.1_Intron	NM_178140	NP_835260			PDZ domain containing 2						cell adhesion	cell-cell junction|endoplasmic reticulum|extracellular region|nucleus				central_nervous_system(4)|ovary(2)|skin(2)|large_intestine(1)	9																		---	---	---	---
CAPSL	133690	broad.mit.edu	37	5	35931679	35931679	+	Intron	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:35931679delT	uc003jjt.1	-						CAPSL_uc003jju.1_Intron	NM_001042625	NP_001036090			calcyphosine-like							cytoplasm	calcium ion binding			skin(1)	1	all_lung(31;0.000268)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.167)|Colorectal(62;0.202)															---	---	---	---
WDR70	55100	broad.mit.edu	37	5	37599015	37599015	+	Intron	DEL	C	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:37599015delC	uc003jkv.2	+						WDR70_uc010iva.1_Intron	NM_018034	NP_060504			WD repeat domain 70											ovary(1)|central_nervous_system(1)	2	all_lung(31;0.000285)		COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	40700865	40700866	+	IGR	DEL	AG	-	-	rs75753536		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:40700865_40700866delAG								PTGER4 (7030 upstream) : TTC33 (10814 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	56629598	56629598	+	IGR	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:56629598delA								GPBP1 (70188 upstream) : ACTBL2 (146246 downstream)																																			---	---	---	---
PDE4D	5144	broad.mit.edu	37	5	58375676	58375680	+	Intron	DEL	GGAGA	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:58375676_58375680delGGAGA	uc003jsa.2	-						PDE4D_uc003jrx.2_Intron|PDE4D_uc003jry.2_Intron|PDE4D_uc003jrz.2_Intron|PDE4D_uc003jsb.2_Intron|PDE4D_uc003jrv.2_Intron|PDE4D_uc003jrw.2_Intron|PDE4D_uc010iwi.1_Intron	NM_001104631	NP_001098101			phosphodiesterase 4D isoform 1						signal transduction	cytosol|insoluble fraction|membrane|microtubule organizing center|soluble fraction	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding			breast(1)|central_nervous_system(1)	2		all_cancers(5;6.5e-58)|all_epithelial(5;1.75e-57)|all_lung(5;6.84e-18)|Lung NSC(5;1.29e-17)|Melanoma(5;0.00168)|Prostate(74;0.00234)|Colorectal(97;0.00629)|Ovarian(174;0.00832)|Breast(144;0.00996)|all_hematologic(6;0.0344)|Hepatocellular(6;0.0742)|Esophageal squamous(6;0.0954)		Epithelial(2;2.6e-55)|all cancers(2;2.66e-49)|OV - Ovarian serous cystadenocarcinoma(10;1.48e-39)|Colorectal(2;8.29e-08)|Lung(2;4.47e-07)|STAD - Stomach adenocarcinoma(2;1.11e-05)|COAD - Colon adenocarcinoma(2;0.00012)|LUSC - Lung squamous cell carcinoma(2;0.000775)|LUAD - Lung adenocarcinoma(3;0.0173)|READ - Rectum adenocarcinoma(2;0.0276)	Adenosine monophosphate(DB00131)|Dyphylline(DB00651)													---	---	---	---
PDE4D	5144	broad.mit.edu	37	5	58719641	58719642	+	Intron	INS	-	T	T	rs34296140		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:58719641_58719642insT	uc003jsa.2	-						PDE4D_uc003jrx.2_Intron|PDE4D_uc003jry.2_Intron|PDE4D_uc003jrz.2_Intron|PDE4D_uc003jsb.2_Intron|PDE4D_uc003jsc.2_Intron	NM_001104631	NP_001098101			phosphodiesterase 4D isoform 1						signal transduction	cytosol|insoluble fraction|membrane|microtubule organizing center|soluble fraction	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding			breast(1)|central_nervous_system(1)	2		all_cancers(5;6.5e-58)|all_epithelial(5;1.75e-57)|all_lung(5;6.84e-18)|Lung NSC(5;1.29e-17)|Melanoma(5;0.00168)|Prostate(74;0.00234)|Colorectal(97;0.00629)|Ovarian(174;0.00832)|Breast(144;0.00996)|all_hematologic(6;0.0344)|Hepatocellular(6;0.0742)|Esophageal squamous(6;0.0954)		Epithelial(2;2.6e-55)|all cancers(2;2.66e-49)|OV - Ovarian serous cystadenocarcinoma(10;1.48e-39)|Colorectal(2;8.29e-08)|Lung(2;4.47e-07)|STAD - Stomach adenocarcinoma(2;1.11e-05)|COAD - Colon adenocarcinoma(2;0.00012)|LUSC - Lung squamous cell carcinoma(2;0.000775)|LUAD - Lung adenocarcinoma(3;0.0173)|READ - Rectum adenocarcinoma(2;0.0276)	Adenosine monophosphate(DB00131)|Dyphylline(DB00651)													---	---	---	---
Unknown	0	broad.mit.edu	37	5	59872999	59872999	+	IGR	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:59872999delT								PART1 (29515 upstream) : DEPDC1B (19741 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	61008062	61008063	+	IGR	DEL	CA	-	-	rs6868406		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:61008062_61008063delCA								FLJ37543 (5700 upstream) : KIF2A (593926 downstream)																																			---	---	---	---
KIF2A	3796	broad.mit.edu	37	5	61635098	61635120	+	Intron	DEL	GCACTCATCACCAAGGGGATGGT	-	-	rs72438686	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:61635098_61635120delGCACTCATCACCAAGGGGATGGT	uc003jsy.3	+						KIF2A_uc003jsz.3_Intron|KIF2A_uc010iwp.2_Intron|KIF2A_uc003jsx.3_Intron	NM_004520	NP_004511			kinesin heavy chain member 2 isoform 1						blood coagulation|cell differentiation|cell division|microtubule-based movement|mitotic prometaphase|mitotic spindle organization|nervous system development	centrosome|cytosol|microtubule|spindle pole	ATP binding|microtubule motor activity|protein binding				0		Lung NSC(810;8.94e-06)|Prostate(74;0.0132)|Ovarian(174;0.051)|Breast(144;0.077)		Lung(70;0.14)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	62768566	62768567	+	IGR	DEL	AC	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:62768566_62768567delAC								ISCA1P1 (695396 upstream) : HTR1A (487712 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	67760096	67760096	+	IGR	DEL	G	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:67760096delG								PIK3R1 (162449 upstream) : SLC30A5 (629722 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	71221629	71221630	+	IGR	DEL	AG	-	-	rs10602952		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:71221629_71221630delAG								CARTPT (204757 upstream) : MAP1B (181488 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	73643559	73643559	+	IGR	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:73643559delT								RGNEF (406146 upstream) : ENC1 (279676 downstream)																																			---	---	---	---
IQGAP2	10788	broad.mit.edu	37	5	75748057	75748057	+	Intron	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:75748057delT	uc003kek.2	+							NM_006633	NP_006624			IQ motif containing GTPase activating protein 2						small GTPase mediated signal transduction	actin cytoskeleton	actin binding|calmodulin binding|GTPase inhibitor activity|Ras GTPase activator activity			ovary(6)|central_nervous_system(1)	7		all_lung(232;0.000514)|Lung NSC(167;0.00135)|Prostate(461;0.00838)|Ovarian(174;0.0149)		all cancers(79;1.38e-36)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	76314732	76314733	+	IGR	DEL	GA	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:76314732_76314733delGA								CRHBP (49434 upstream) : AGGF1 (11499 downstream)																																			---	---	---	---
AP3B1	8546	broad.mit.edu	37	5	77570739	77570739	+	Intron	DEL	T	-	-	rs71861453		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:77570739delT	uc003kfj.2	-							NM_003664	NP_003655			adaptor-related protein complex 3, beta 1						endocytosis|melanosome organization	clathrin coated vesicle membrane|Golgi apparatus|membrane coat	protein phosphatase binding|protein transporter activity			central_nervous_system(1)	1		all_lung(232;0.000397)|Lung NSC(167;0.00106)|Ovarian(174;0.0105)|Prostate(461;0.215)		OV - Ovarian serous cystadenocarcinoma(54;8.23e-47)|Epithelial(54;2.74e-41)|all cancers(79;4.8e-36)										Hermansky-Pudlak_syndrome				---	---	---	---
LHFPL2	10184	broad.mit.edu	37	5	77796125	77796125	+	Intron	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:77796125delT	uc003kfo.2	-							NM_005779	NP_005770			lipoma HMGIC fusion partner-like 2							integral to membrane					0		all_lung(232;0.000409)|Lung NSC(167;0.00108)|Ovarian(174;0.0107)|Prostate(461;0.218)		OV - Ovarian serous cystadenocarcinoma(54;6.48e-46)|Epithelial(54;8.43e-42)|all cancers(79;1.42e-36)														---	---	---	---
SSBP2	23635	broad.mit.edu	37	5	80753484	80753485	+	Intron	INS	-	TT	TT			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:80753484_80753485insTT	uc003kho.2	-						SSBP2_uc010jar.2_Intron|SSBP2_uc003khn.2_Intron|SSBP2_uc003khp.2_Intron|SSBP2_uc011ctp.1_Intron|SSBP2_uc011ctq.1_Intron|SSBP2_uc011ctr.1_Intron	NM_012446	NP_036578			single-stranded DNA binding protein 2						regulation of transcription, DNA-dependent	cytoplasm|nucleus	single-stranded DNA binding		SSBP2/JAK2(4)	haematopoietic_and_lymphoid_tissue(4)|skin(1)	5		Lung NSC(167;0.00154)|all_lung(232;0.00179)|Ovarian(174;0.0338)		OV - Ovarian serous cystadenocarcinoma(54;1.07e-41)|Epithelial(54;2.79e-35)|all cancers(79;1.18e-29)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	81262231	81262232	+	IGR	INS	-	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:81262231_81262232insT								SSBP2 (215159 upstream) : ATG10 (5612 downstream)																																			---	---	---	---
ATG10	83734	broad.mit.edu	37	5	81283543	81283543	+	Intron	DEL	G	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:81283543delG	uc003khs.2	+						ATG10_uc003khq.2_Intron|ATG10_uc003khr.2_Intron|ATG10_uc010jas.2_Intron|ATG10_uc003kht.1_RNA	NM_001131028	NP_001124500			APG10 autophagy 10-like						autophagy in response to ER overload|positive regulation of protein modification process|protein lipidation|protein modification by small protein conjugation|protein transport	cytoplasm	Atg12 ligase activity|protein binding				0		Lung NSC(167;0.0258)|all_lung(232;0.0294)|Ovarian(174;0.135)		OV - Ovarian serous cystadenocarcinoma(54;9.94e-41)|Epithelial(54;6.3e-36)|all cancers(79;2.31e-30)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	91716316	91716317	+	Intron	INS	-	TT	TT			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:91716316_91716317insTT	uc003kkb.1	+											Homo sapiens cDNA FLJ31923 fis, clone NT2RP7005323.																														---	---	---	---
Unknown	0	broad.mit.edu	37	5	92939572	92939572	+	IGR	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:92939572delA								NR2F1 (9794 upstream) : FAM172A (13860 downstream)																																			---	---	---	---
MCTP1	79772	broad.mit.edu	37	5	94353240	94353241	+	Intron	INS	-	TCTCTAAAGGGGGACCA	TCTCTAAAGGGGGACCA	rs139116758	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:94353240_94353241insTCTCTAAAGGGGGACCA	uc003kkx.2	-						MCTP1_uc003kkv.2_Intron|MCTP1_uc003kkw.2_Intron|MCTP1_uc003kkz.2_Intron	NM_024717	NP_078993			multiple C2 domains, transmembrane 1 isoform L						calcium-mediated signaling	integral to membrane|membrane fraction	calcium ion binding			ovary(2)	2		all_cancers(142;1.68e-05)|all_epithelial(76;1.51e-07)|all_lung(232;0.0167)|Lung NSC(167;0.0207)|Ovarian(225;0.0218)|Colorectal(57;0.207)		all cancers(79;9.1e-17)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	106221878	106221880	+	IGR	DEL	AAG	-	-	rs66925365		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:106221878_106221880delAAG								None (None upstream) : EFNA5 (490711 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	106516798	106516798	+	IGR	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:106516798delT								None (None upstream) : EFNA5 (195793 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	110479623	110479623	+	IGR	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:110479623delA								WDR36 (13422 upstream) : CAMK4 (80025 downstream)																																			---	---	---	---
APC	324	broad.mit.edu	37	5	112177228	112177228	+	Frame_Shift_Del	DEL	C	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:112177228delC	uc010jby.2	+	16	6317	c.5937delC	c.(5935-5937)AACfs	p.N1979fs	APC_uc011cvt.1_Frame_Shift_Del_p.N1961fs|APC_uc003kpz.3_Frame_Shift_Del_p.N1979fs|APC_uc003kpy.3_Frame_Shift_Del_p.N1979fs|APC_uc010jbz.2_Frame_Shift_Del_p.N1696fs|APC_uc010jca.2_Frame_Shift_Del_p.N1279fs	NM_001127511	NP_001120983	P25054	APC_HUMAN	adenomatous polyposis coli	1979	Ser-rich.				canonical Wnt receptor signaling pathway|cell adhesion|cell cycle arrest|cell migration|cellular component disassembly involved in apoptosis|cytokinesis after mitosis|mitotic cell cycle spindle assembly checkpoint|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cyclin-dependent protein kinase activity|negative regulation of microtubule depolymerization|positive regulation of apoptosis|positive regulation of cell migration|positive regulation of pseudopodium assembly|protein complex assembly|regulation of attachment of spindle microtubules to kinetochore|response to DNA damage stimulus|tight junction assembly	adherens junction|APC-Axin-1-beta-catenin complex|Axin-APC-beta-catenin-GSK3B complex|beta-catenin destruction complex|centrosome|cytosol|kinetochore|lamellipodium|lateral plasma membrane|nucleus|ruffle membrane|tight junction	beta-catenin binding|gamma-catenin binding|microtubule plus-end binding|protein kinase binding|protein kinase regulator activity	p.?(1)		large_intestine(2123)|stomach(123)|soft_tissue(55)|small_intestine(34)|breast(26)|pancreas(25)|urinary_tract(20)|lung(19)|thyroid(18)|liver(13)|central_nervous_system(10)|ovary(9)|skin(7)|upper_aerodigestive_tract(6)|adrenal_gland(6)|bone(6)|NS(5)|prostate(4)|endometrium(3)|kidney(1)|oesophagus(1)|biliary_tract(1)	2515		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)			12	D|Mis|N|F|S		colorectal|pancreatic|desmoid|hepatoblastoma|glioma|other CNS	colorectal|pancreatic|desmoid|hepatoblastoma|glioma|other CNS			Hereditary_Desmoid_Disease|Familial_Adenomatous_Polyposis|Turcot_syndrome	TSP Lung(16;0.13)			---	---	---	---
Unknown	0	broad.mit.edu	37	5	115082791	115082791	+	IGR	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:115082791delA								TMED7-TICAM2 (120921 upstream) : CDO1 (57641 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	117349452	117349452	+	IGR	DEL	C	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:117349452delC								None (None upstream) : DTWD2 (823119 downstream)																																			---	---	---	---
FAM170A	340069	broad.mit.edu	37	5	118965019	118965019	+	5'Flank	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:118965019delA	uc003ksm.2	+						FAM170A_uc003ksl.2_5'Flank|FAM170A_uc003ksn.2_5'Flank|FAM170A_uc003kso.2_5'Flank	NM_182761	NP_877438			family with sequence similarity 170, member A							intracellular	zinc ion binding			skin(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	5	118973284	118973285	+	IGR	INS	-	T	T	rs144765746	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:118973284_118973285insT								FAM170A (1768 upstream) : PRR16 (826734 downstream)																																			---	---	---	---
CEP120	153241	broad.mit.edu	37	5	122722368	122722368	+	Intron	DEL	T	-	-	rs34328840		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:122722368delT	uc003ktk.2	-						CEP120_uc011cwq.1_Intron|CEP120_uc010jcz.1_Intron	NM_153223	NP_694955			coiled-coil domain containing 100							centrosome				ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	5	128159203	128159203	+	IGR	DEL	G	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:128159203delG								FBN2 (285287 upstream) : SLC27A6 (142007 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	129103161	129103161	+	IGR	DEL	C	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:129103161delC								ADAMTS19 (28785 upstream) : CHSY3 (137362 downstream)																																			---	---	---	---
RAPGEF6	51735	broad.mit.edu	37	5	130857585	130857588	+	Intron	DEL	CTCT	-	-	rs71000993		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:130857585_130857588delCTCT	uc003kvn.1	-						RAPGEF6_uc003kvp.1_Intron|RAPGEF6_uc003kvo.1_Intron|RAPGEF6_uc010jdi.1_Intron|RAPGEF6_uc010jdj.1_Intron|RAPGEF6_uc003kvr.2_Intron|RAPGEF6_uc011cxe.1_Intron|RAPGEF6_uc010jdk.2_Intron	NM_016340	NP_057424			PDZ domain-containing guanine nucleotide						Ras protein signal transduction|regulation of GTPase activity|regulation of small GTPase mediated signal transduction	cytoplasm|plasma membrane	GTP-dependent protein binding|guanyl-nucleotide exchange factor activity|Ras GTPase binding			ovary(1)|lung(1)|central_nervous_system(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Lung(113;0.0721)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	131368611	131368612	+	IGR	INS	-	GAAA	GAAA	rs140068665	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:131368611_131368612insGAAA								ACSL6 (20741 upstream) : IL3 (27735 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	132191502	132191502	+	IGR	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:132191502delT								SHROOM1 (24912 upstream) : GDF9 (5376 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	134502720	134502720	+	Intron	DEL	G	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:134502720delG	uc003laj.1	+											Homo sapiens cDNA: FLJ23312 fis, clone HEP11874.																														---	---	---	---
SPOCK1	6695	broad.mit.edu	37	5	136718477	136718477	+	Intron	DEL	C	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:136718477delC	uc003lbo.2	-						SPOCK1_uc003lbp.2_Intron	NM_004598	NP_004589			sparc/osteonectin, cwcv and kazal-like domains						cell adhesion|cell proliferation|cellular component movement|nervous system development|signal transduction	proteinaceous extracellular matrix	calcium ion binding			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)															---	---	---	---
MYOT	9499	broad.mit.edu	37	5	137211346	137211346	+	Intron	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137211346delA	uc011cye.1	+						MYOT_uc003lbv.2_Intron|MYOT_uc011cyg.1_Intron|MYOT_uc011cyh.1_Intron	NM_001135940	NP_001129412			myotilin isoform b						muscle contraction	actin cytoskeleton|sarcolemma|sarcomere	actin binding|structural constituent of muscle			large_intestine(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	139131375	139131376	+	IGR	INS	-	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:139131375_139131376insT								CXXC5 (68695 upstream) : PSD2 (44030 downstream)																																			---	---	---	---
NRG2	9542	broad.mit.edu	37	5	139248113	139248113	+	Intron	DEL	G	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:139248113delG	uc003lex.1	-						NRG2_uc003lev.1_Intron|NRG2_uc003lew.1_Intron|NRG2_uc003ley.1_Intron	NM_004883	NP_004874			neuregulin 2 isoform 1						embryo development	extracellular region|integral to membrane|plasma membrane	growth factor activity			pancreas(2)|breast(2)|ovary(1)|skin(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	141167600	141167601	+	IGR	DEL	GA	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:141167600_141167601delGA								ARAP3 (105800 upstream) : PCDH1 (65082 downstream)																																			---	---	---	---
SH3RF2	153769	broad.mit.edu	37	5	145454337	145454338	+	Intron	DEL	CT	-	-	rs72024110		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:145454337_145454338delCT	uc011dbl.1	+							NM_152550	NP_689763			SH3 domain containing ring finger 2								ligase activity|protein phosphatase 1 binding|zinc ion binding			ovary(1)|skin(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)															---	---	---	---
TCERG1	10915	broad.mit.edu	37	5	145888469	145888470	+	Intron	INS	-	T	T	rs144112924	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:145888469_145888470insT	uc003lob.2	+						TCERG1_uc003loc.2_Intron	NM_006706	NP_006697			transcription elongation regulator 1 isoform 1						regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	nucleus	protein binding|transcription coactivator activity			ovary(1)|skin(1)	2		Lung NSC(249;0.00188)|all_lung(500;0.00307)|all_neural(839;0.0424)|Breast(839;0.0743)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)															---	---	---	---
PPP2R2B	5521	broad.mit.edu	37	5	146114568	146114568	+	Intron	DEL	C	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:146114568delC	uc003loe.2	-						PPP2R2B_uc010jgm.2_Intron|PPP2R2B_uc003log.3_Intron|PPP2R2B_uc003lof.3_Intron|PPP2R2B_uc003loi.3_Intron|PPP2R2B_uc003loh.3_Intron|PPP2R2B_uc003loj.3_Intron|PPP2R2B_uc003lok.3_Intron|PPP2R2B_uc011dbu.1_Intron|PPP2R2B_uc011dbv.1_Intron	NM_004576	NP_004567			beta isoform of regulatory subunit B55, protein						apoptosis|signal transduction	cytoskeleton|mitochondrial outer membrane|protein phosphatase type 2A complex	protein binding|protein phosphatase type 2A regulator activity			ovary(1)|prostate(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)															---	---	---	---
CYFIP2	26999	broad.mit.edu	37	5	156788246	156788247	+	Intron	DEL	CA	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:156788246_156788247delCA	uc003lwq.2	+						CYFIP2_uc011ddn.1_Intron|CYFIP2_uc011ddo.1_Intron|CYFIP2_uc003lwr.2_Intron|CYFIP2_uc003lws.2_Intron|CYFIP2_uc003lwt.2_Intron|CYFIP2_uc011ddp.1_Intron	NM_001037333	NP_001032410			cytoplasmic FMR1 interacting protein 2						apoptosis|cell-cell adhesion	cell junction|perinuclear region of cytoplasm|synapse|synaptosome	protein binding				0	Renal(175;0.00212)	Medulloblastoma(196;0.0306)|all_neural(177;0.0897)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	161005903	161005904	+	IGR	DEL	CA	-	-	rs149087093		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:161005903_161005904delCA								GABRB2 (30773 upstream) : GABRA6 (106754 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	161793601	161793601	+	IGR	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:161793601delA								GABRG2 (211057 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	162125146	162125147	+	IGR	INS	-	TATC	TATC	rs148150938	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:162125146_162125147insTATC								GABRG2 (542602 upstream) : CCNG1 (739430 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	165228623	165228623	+	IGR	DEL	G	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:165228623delG								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	165511907	165511908	+	IGR	DEL	CT	-	-	rs67950928		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:165511907_165511908delCT								None (None upstream) : None (None downstream)																																			---	---	---	---
DOCK2	1794	broad.mit.edu	37	5	169454071	169454072	+	Intron	INS	-	T	T	rs138528733	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:169454071_169454072insT	uc003maf.2	+						DOCK2_uc011der.1_Intron|DOCK2_uc010jjm.2_Intron	NM_004946	NP_004937			dedicator of cytokinesis 2						actin cytoskeleton organization|regulation of defense response to virus by virus|viral reproduction	cytoskeleton|cytosol|endomembrane system|membrane	electron carrier activity|GTP binding|GTPase binding|heme binding|Rac guanyl-nucleotide exchange factor activity|T cell receptor binding			ovary(5)|pancreas(2)	7	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)															---	---	---	---
RANBP17	64901	broad.mit.edu	37	5	170529841	170529841	+	Intron	DEL	C	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:170529841delC	uc003mba.2	+						RANBP17_uc003max.1_Intron|RANBP17_uc003may.1_Intron|RANBP17_uc003maz.1_Intron|RANBP17_uc010jjr.1_Intron	NM_022897	NP_075048			RAN binding protein 17						mRNA transport|protein import into nucleus|transmembrane transport	cytoplasm|nuclear pore	GTP binding|protein transporter activity			ovary(2)|central_nervous_system(1)	3	Renal(175;0.000159)|Lung NSC(126;0.00751)|all_lung(126;0.0123)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)					T	TRD@	ALL								---	---	---	---
Unknown	0	broad.mit.edu	37	5	174119132	174119133	+	IGR	INS	-	CGCGCA	CGCGCA	rs10631200		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:174119132_174119133insCGCGCA								HMP19 (582951 upstream) : MSX2 (32442 downstream)																																			---	---	---	---
CDHR2	54825	broad.mit.edu	37	5	176015539	176015540	+	Intron	INS	-	GA	GA	rs142821033	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176015539_176015540insGA	uc003mem.1	+						CDHR2_uc003men.1_Intron	NM_017675	NP_060145			protocadherin LKC precursor						homophilic cell adhesion|negative regulation of cell growth	apical plasma membrane|cell junction|integral to membrane	calcium ion binding|protein binding			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	5	176996258	176996258	+	IGR	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176996258delT								FAM193B (14720 upstream) : TMED9 (22955 downstream)																																			---	---	---	---
ADAMTS2	9509	broad.mit.edu	37	5	178650360	178650361	+	Intron	DEL	CA	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:178650360_178650361delCA	uc003mjw.2	-						ADAMTS2_uc011dgm.1_Intron	NM_014244	NP_055059			ADAM metallopeptidase with thrombospondin type 1						collagen catabolic process	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			large_intestine(1)|lung(1)|ovary(1)|pancreas(1)	4	all_cancers(89;0.000456)|all_epithelial(37;0.000138)|Renal(175;0.000159)|Lung NSC(126;0.00184)|all_lung(126;0.00326)	all_cancers(40;0.00604)|all_neural(177;0.00411)|Medulloblastoma(196;0.00508)|Lung NSC(249;0.0569)|all_lung(500;0.129)|all_hematologic(541;0.211)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	GBM - Glioblastoma multiforme(465;0.0473)														---	---	---	---
PRPF4B	8899	broad.mit.edu	37	6	4036457	4036457	+	Intron	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:4036457delT	uc003mvv.2	+						PRPF4B_uc003mvw.2_5'Flank|PRPF4B_uc011dhv.1_Intron	NM_003913	NP_003904			serine/threonine-protein kinase PRP4K							catalytic step 2 spliceosome	ATP binding|protein binding|protein serine/threonine kinase activity			breast(5)	5	Ovarian(93;0.0925)	all_hematologic(90;0.0895)																---	---	---	---
Unknown	0	broad.mit.edu	37	6	4245668	4245669	+	IGR	DEL	AT	-	-	rs57452702		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:4245668_4245669delAT								PECI (109837 upstream) : CDYL (460724 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	5059866	5059866	+	Intron	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:5059866delT	uc003mwn.1	+											Homo sapiens cDNA FLJ37615 fis, clone BRCOC2011996.																														---	---	---	---
Unknown	0	broad.mit.edu	37	6	7053625	7053626	+	IGR	INS	-	A	A	rs144886383		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:7053625_7053626insA								LY86 (398409 upstream) : RREB1 (54562 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	7512425	7512426	+	IGR	INS	-	A	A	rs138921020	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:7512425_7512426insA								RIOK1 (94157 upstream) : DSP (29444 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	9986531	9986531	+	Intron	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:9986531delT	uc003myn.2	-						uc010joj.1_Intron|uc003myp.1_Intron					RecName: Full=Orofacial cleft 1 candidate gene 1 protein; AltName: Full=Orofacial clefting chromosomal breakpoint region candidate 1 protein;																														---	---	---	---
Unknown	0	broad.mit.edu	37	6	10366941	10366941	+	IGR	DEL	G	-	-	rs55789841	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:10366941delG								None (None upstream) : TFAP2A (29976 downstream)																																			---	---	---	---
SYCP2L	221711	broad.mit.edu	37	6	10942299	10942300	+	Intron	DEL	AT	-	-	rs35096650		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:10942299_10942300delAT	uc003mzo.2	+						SYCP2L_uc010jow.2_Intron	NM_001040274	NP_001035364			synaptonemal complex protein 2-like							nucleus				ovary(1)|skin(1)	2	Breast(50;0.0838)|Ovarian(93;0.107)	all_hematologic(90;0.135)	Epithelial(50;0.239)															---	---	---	---
NEDD9	4739	broad.mit.edu	37	6	11268976	11268979	+	Intron	DEL	ACAG	-	-	rs112345199		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:11268976_11268979delACAG	uc010joz.2	-						NEDD9_uc003mzw.3_Intron	NM_001142393	NP_001135865			neural precursor cell expressed, developmentally						actin filament bundle assembly|cell adhesion|cell division|integrin-mediated signaling pathway|mitosis|regulation of growth	cell cortex|focal adhesion|Golgi apparatus|lamellipodium|nucleus	protein binding				0	Breast(50;0.0768)|Ovarian(93;0.152)	all_hematologic(90;0.135)	Epithelial(50;0.0647)|all cancers(50;0.179)															---	---	---	---
Unknown	0	broad.mit.edu	37	6	12216321	12216322	+	IGR	DEL	TG	-	-	rs71921059		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:12216321_12216322delTG								HIVEP1 (51090 upstream) : EDN1 (74207 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	12348462	12348465	+	IGR	DEL	TCTT	-	-	rs71754709		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:12348462_12348465delTCTT								EDN1 (51036 upstream) : PHACTR1 (368423 downstream)																																			---	---	---	---
CCDC90A	63933	broad.mit.edu	37	6	13808894	13808894	+	Intron	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:13808894delT	uc003nbd.2	-						CCDC90A_uc010jpf.2_Intron	NM_001031713	NP_001026883			coiled-coil domain containing 90A precursor							integral to membrane|mitochondrion					0	Breast(50;0.0027)|Ovarian(93;0.0964)	all_hematologic(90;0.117)																---	---	---	---
ATXN1	6310	broad.mit.edu	37	6	16426852	16426853	+	Intron	DEL	GA	-	-	rs13208159	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:16426852_16426853delGA	uc003nbt.2	-						ATXN1_uc010jpi.2_Intron|ATXN1_uc010jpj.1_Intron	NM_000332	NP_000323			ataxin 1						cell death|negative regulation of transcription, DNA-dependent|nuclear export|RNA processing	cytoplasm|nuclear inclusion body|nuclear matrix|nucleoplasm	identical protein binding|poly(G) RNA binding|poly(U) RNA binding|protein binding|protein C-terminus binding|protein self-association			skin(3)|central_nervous_system(1)	4	Breast(50;0.063)|Ovarian(93;0.0733)	all_hematologic(90;0.000682)|Ovarian(999;0.00973)																---	---	---	---
KIF13A	63971	broad.mit.edu	37	6	17984281	17984282	+	Intron	INS	-	A	A	rs141336032	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:17984281_17984282insA	uc003ncg.3	-						KIF13A_uc003ncf.2_Intron|KIF13A_uc003nch.3_Intron|KIF13A_uc003nci.3_Intron|KIF13A_uc003nck.2_Intron	NM_022113	NP_071396			kinesin family member 13A isoform a						cargo loading into vesicle|cell cycle|cytokinesis|endosome to lysosome transport|Golgi to plasma membrane protein transport|melanosome organization|plus-end-directed vesicle transport along microtubule	centrosome|endosome membrane|microtubule|midbody|trans-Golgi network membrane	ATP binding|microtubule motor activity|protein binding			large_intestine(2)|ovary(2)	4	Breast(50;0.0107)|Ovarian(93;0.016)	all_hematologic(90;0.125)	all cancers(50;0.0865)|Epithelial(50;0.0974)															---	---	---	---
Unknown	0	broad.mit.edu	37	6	18562153	18562153	+	Intron	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:18562153delT	uc003nct.1	+											Homo sapiens cDNA FLJ25799 fis, clone TST07088.																														---	---	---	---
Unknown	0	broad.mit.edu	37	6	19134481	19134482	+	Intron	INS	-	AA	AA	rs60846248		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:19134481_19134482insAA	uc003ncu.1	-											Homo sapiens cDNA FLJ40266 fis, clone TESTI2026461.																														---	---	---	---
Unknown	0	broad.mit.edu	37	6	19997441	19997444	+	IGR	DEL	GAAG	-	-	rs72294908		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:19997441_19997444delGAAG								ID4 (156527 upstream) : MBOAT1 (103491 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	23647195	23647196	+	IGR	INS	-	A	A	rs138404374	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:23647195_23647196insA								None (None upstream) : NRSN1 (479218 downstream)																																			---	---	---	---
ACOT13	55856	broad.mit.edu	37	6	24674195	24674195	+	Intron	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:24674195delT	uc003nek.2	+						ACOT13_uc010jpv.2_Intron	NM_018473	NP_060943			acyl-CoA thioesterase 13 isoform 1						protein homotetramerization	mitochondrion	acyl-CoA thioesterase activity				0																		---	---	---	---
ACOT13	55856	broad.mit.edu	37	6	24697013	24697014	+	Intron	INS	-	C	C			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:24697013_24697014insC	uc003nek.2	+						ACOT13_uc010jpv.2_Intron	NM_018473	NP_060943			acyl-CoA thioesterase 13 isoform 1						protein homotetramerization	mitochondrion	acyl-CoA thioesterase activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	25237534	25237535	+	IGR	DEL	CT	-	-	rs67195151		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:25237534_25237535delCT								CMAH (70741 upstream) : LRRC16A (42113 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	25261990	25261990	+	5'Flank	DEL	A	-	-	rs150117437		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:25261990delA	uc003nex.3	-											Homo sapiens cDNA clone IMAGE:5297808.																														---	---	---	---
Unknown	0	broad.mit.edu	37	6	26311418	26311422	+	IGR	DEL	CAGGA	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26311418_26311422delCAGGA								HIST1H4H (25656 upstream) : BTN3A2 (53976 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	27491130	27491131	+	IGR	DEL	TC	-	-	rs71706046	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:27491130_27491131delTC								ZNF184 (50233 upstream) : HIST1H2BL (284127 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	29675203	29675204	+	IGR	DEL	CC	-	-	rs3116787		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29675203_29675204delCC								ZFP57 (26316 upstream) : HLA-F (15913 downstream)																																			---	---	---	---
LOC285830	285830	broad.mit.edu	37	6	29709414	29709414	+	Intron	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29709414delA	uc003nnp.2	-						LOC285830_uc011dlz.1_Intron|LOC285830_uc003rsi.3_Intron	NR_026972				Homo sapiens cDNA FLJ35429 fis, clone SMINT2002126.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	29733529	29733530	+	IGR	INS	-	C	C	rs145065194	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29733529_29733530insC								IFITM4P (14604 upstream) : HCG4 (25279 downstream)																																			---	---	---	---
HCG4	54435	broad.mit.edu	37	6	29762440	29762441	+	5'Flank	INS	-	C	C	rs148756468	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29762440_29762441insC	uc003nns.2	-						uc003nnt.2_Intron|uc011dma.1_RNA	NR_002139				Homo sapiens clone HCG IV.9 unknown mRNA.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	29770021	29770021	+	IGR	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29770021delA								HCG4 (9171 upstream) : HLA-G (24735 downstream)																																			---	---	---	---
HLA-G	3135	broad.mit.edu	37	6	29909633	29909634	+	Intron	INS	-	T	T	rs141035764	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29909633_29909634insT	uc011dmb.1	+						HCG4P6_uc003nog.1_Intron|HLA-A_uc010jrq.2_5'Flank|HLA-A_uc003nok.2_5'Flank|HLA-A_uc003nol.2_5'Flank|HLA-A_uc003non.2_5'Flank|HLA-A_uc003noo.2_5'Flank|HLA-A_uc010jrr.2_5'Flank|HLA-A_uc003nom.2_5'Flank|HLA-A_uc010klp.2_5'Flank|HLA-A_uc011dmc.1_5'Flank|HLA-A_uc011dmd.1_5'Flank	NM_002127	NP_002118			major histocompatibility complex, class I, G						antigen processing and presentation of peptide antigen via MHC class I|cellular defense response|interferon-gamma-mediated signaling pathway|regulation of immune response|type I interferon-mediated signaling pathway	integral to membrane|MHC class I protein complex	MHC class I receptor activity			ovary(3)|central_nervous_system(1)	4																		---	---	---	---
HLA-G	3135	broad.mit.edu	37	6	29928322	29928323	+	Intron	DEL	AG	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29928322_29928323delAG	uc011dmb.1	+							NM_002127	NP_002118			major histocompatibility complex, class I, G						antigen processing and presentation of peptide antigen via MHC class I|cellular defense response|interferon-gamma-mediated signaling pathway|regulation of immune response|type I interferon-mediated signaling pathway	integral to membrane|MHC class I protein complex	MHC class I receptor activity			ovary(3)|central_nervous_system(1)	4																		---	---	---	---
HLA-G	3135	broad.mit.edu	37	6	29941336	29941341	+	Intron	DEL	ACAGAG	-	-	rs112572453	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29941336_29941341delACAGAG	uc011dmb.1	+						HCG9_uc003rth.2_5'Flank	NM_002127	NP_002118			major histocompatibility complex, class I, G						antigen processing and presentation of peptide antigen via MHC class I|cellular defense response|interferon-gamma-mediated signaling pathway|regulation of immune response|type I interferon-mediated signaling pathway	integral to membrane|MHC class I protein complex	MHC class I receptor activity			ovary(3)|central_nervous_system(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	30345809	30345810	+	IGR	INS	-	GGAAGGAGGGAGGGAG	GGAAGGAGGGAGGGAG			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30345809_30345810insGGAAGGAGGGAGGGAG								TRIM39 (31177 upstream) : HLA-E (111461 downstream)																																			---	---	---	---
PPP1R10	5514	broad.mit.edu	37	6	30582485	30582488	+	Intron	DEL	ACAC	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30582485_30582488delACAC	uc003nqn.1	-						PPP1R10_uc010jsc.1_Intron|MRPS18B_uc003nqo.2_5'Flank|MRPS18B_uc011dml.1_5'Flank|MRPS18B_uc010jsd.1_5'Flank	NM_002714	NP_002705			protein phosphatase 1, regulatory subunit 10						protein import into nucleus|transcription, DNA-dependent	PTW/PP1 phosphatase complex	DNA binding|protein phosphatase inhibitor activity|RNA binding|zinc ion binding			ovary(2)|lung(1)|kidney(1)	4																		---	---	---	---
C6orf134	79969	broad.mit.edu	37	6	30597021	30597022	+	Intron	INS	-	T	T	rs111725584		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30597021_30597022insT	uc003nqu.2	+						C6orf134_uc003nqr.3_Intron|C6orf134_uc003rdc.2_Intron|C6orf134_uc003nqs.3_Intron|C6orf134_uc003rdd.2_Intron|C6orf134_uc003nqt.2_Intron|C6orf134_uc011dmm.1_Intron|C6orf134_uc003nqv.2_Intron	NM_024909	NP_079185			hypothetical protein LOC79969 isoform 2								tubulin N-acetyltransferase activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	30938798	30938798	+	IGR	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30938798delA								DPCR1 (16800 upstream) : MUC21 (12687 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	31003218	31003218	+	IGR	DEL	T	-	-	rs71552028		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31003218delT								MUC21 (45543 upstream) : HCG22 (18766 downstream)																																			---	---	---	---
HLA-B	3106	broad.mit.edu	37	6	31321838	31321838	+	3'UTR	DEL	C	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31321838delC	uc003nth.2	-	8					HLA-C_uc003ntb.2_Intron|HLA-C_uc003ntc.1_Intron|HLA-B_uc010jsm.1_Intron|HLA-B_uc011dnk.1_Intron|HLA-B_uc003ntf.2_Intron|HLA-B_uc003ntg.1_3'UTR	NM_005514	NP_005505			major histocompatibility complex, class I, B						antigen processing and presentation of peptide antigen via MHC class I|interferon-gamma-mediated signaling pathway|interspecies interaction between organisms|regulation of immune response|type I interferon-mediated signaling pathway	integral to plasma membrane|MHC class I protein complex	MHC class I receptor activity				0														Melanoma_Familial_Clustering_of|Lichen_Sclerosis_et_Atrophicus_Familial_Clustering_of				---	---	---	---
CLIC1	1192	broad.mit.edu	37	6	31703584	31703585	+	Intron	INS	-	CA	CA	rs140766705	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31703584_31703585insCA	uc003nwr.2	-						CLIC1_uc003rje.2_Intron	NM_001288	NP_001279			chloride intracellular channel 1						signal transduction	brush border|chloride channel complex|cytoplasm|membrane fraction|nuclear membrane|plasma membrane|soluble fraction	protein binding|voltage-gated chloride channel activity			ovary(1)|central_nervous_system(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	32210220	32210227	+	IGR	DEL	TTCTTTCC	-	-	rs41286494		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32210220_32210227delTTCTTTCC								NOTCH4 (18376 upstream) : C6orf10 (46076 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	32227913	32227913	+	Intron	DEL	G	-	-	rs144338179		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32227913delG	uc003obd.1	+											Homo sapiens cDNA FLJ40408 fis, clone TESTI2037673.																														---	---	---	---
C6orf10	10665	broad.mit.edu	37	6	32287119	32287119	+	Intron	DEL	G	-	-	rs113536385		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32287119delG	uc011dpy.1	-							NM_006781	NP_006772			chromosome 6 open reading frame 10							integral to membrane				skin(1)	1																		---	---	---	---
C6orf10	10665	broad.mit.edu	37	6	32309946	32309947	+	Intron	INS	-	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32309946_32309947insT	uc011dpy.1	-						C6orf10_uc011dpz.1_Intron	NM_006781	NP_006772			chromosome 6 open reading frame 10							integral to membrane				skin(1)	1																		---	---	---	---
ANKS1A	23294	broad.mit.edu	37	6	34922352	34922352	+	Intron	DEL	C	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:34922352delC	uc003ojx.3	+						ANKS1A_uc011dss.1_Intron|ANKS1A_uc011dst.1_Intron|ANKS1A_uc010jvp.1_Intron	NM_015245	NP_056060			ankyrin repeat and sterile alpha motif domain							cytoplasm	protein binding			ovary(3)|upper_aerodigestive_tract(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	35128961	35128961	+	IGR	DEL	G	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:35128961delG								TCP11 (19774 upstream) : SCUBE3 (53229 downstream)																																			---	---	---	---
SCUBE3	222663	broad.mit.edu	37	6	35196368	35196375	+	Intron	DEL	TCTCAGCT	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:35196368_35196375delTCTCAGCT	uc003okf.1	+						SCUBE3_uc003okg.1_Intron|SCUBE3_uc003okh.1_Intron	NM_152753	NP_689966			signal peptide, CUB domain, EGF-like 3						protein heterooligomerization|protein homooligomerization	cell surface|extracellular region	calcium ion binding|protein binding			skin(1)	1																		---	---	---	---
SRPK1	6732	broad.mit.edu	37	6	35889356	35889356	+	5'Flank	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:35889356delA	uc003olj.2	-						SRPK1_uc003olh.2_5'Flank|SRPK1_uc003oli.2_5'Flank	NM_003137	NP_003128			SFRS protein kinase 1						cell differentiation|chromosome segregation|interspecies interaction between organisms|intracellular protein kinase cascade|mRNA processing|negative regulation of viral genome replication|positive regulation of viral genome replication|regulation of mRNA processing|RNA splicing	cytoplasm|nucleus	ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity			ovary(1)	1																		---	---	---	---
BTBD9	114781	broad.mit.edu	37	6	38296722	38296723	+	Intron	INS	-	A	A	rs35867305		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:38296722_38296723insA	uc003ooa.3	-						BTBD9_uc003ony.3_Intron|BTBD9_uc010jwv.2_Intron|BTBD9_uc010jww.2_Intron|BTBD9_uc010jwx.2_Intron	NM_052893	NP_443125			BTB (POZ) domain containing 9 isoform a						cell adhesion						0																		---	---	---	---
DAAM2	23500	broad.mit.edu	37	6	39778676	39778676	+	Intron	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:39778676delT	uc003oow.2	+						DAAM2_uc010jxc.2_Intron|DAAM2_uc003oox.2_Intron|DAAM2_uc003oov.3_Intron	NM_015345	NP_056160			dishevelled associated activator of						actin cytoskeleton organization		actin binding|Rho GTPase binding			ovary(2)|skin(1)	3	Ovarian(28;0.0355)|Colorectal(47;0.196)																	---	---	---	---
DAAM2	23500	broad.mit.edu	37	6	39780923	39780924	+	Intron	DEL	TG	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:39780923_39780924delTG	uc003oow.2	+						DAAM2_uc010jxc.2_Intron|DAAM2_uc003oox.2_Intron|DAAM2_uc003oov.3_Intron	NM_015345	NP_056160			dishevelled associated activator of						actin cytoskeleton organization		actin binding|Rho GTPase binding			ovary(2)|skin(1)	3	Ovarian(28;0.0355)|Colorectal(47;0.196)																	---	---	---	---
PGC	5225	broad.mit.edu	37	6	41710342	41710343	+	Intron	DEL	TT	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:41710342_41710343delTT	uc003ora.1	-							NM_002630	NP_002621			progastricsin (pepsinogen C) precursor						digestion|proteolysis	extracellular space	aspartic-type endopeptidase activity				0	Ovarian(28;0.0355)|Colorectal(47;0.121)		Epithelial(12;0.000132)|STAD - Stomach adenocarcinoma(11;0.000204)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00507)															---	---	---	---
TRERF1	55809	broad.mit.edu	37	6	42268880	42268880	+	Intron	DEL	G	-	-	rs35574294		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:42268880delG	uc003osd.2	-						TRERF1_uc003osb.2_Intron|TRERF1_uc003osc.2_Intron|TRERF1_uc003ose.2_Intron|TRERF1_uc010jxu.1_Intron	NM_033502	NP_277037			transcriptional regulating factor 1						cholesterol catabolic process|homeostatic process|multicellular organismal development|positive regulation of transcription, DNA-dependent|regulation of hormone biosynthetic process|steroid biosynthetic process	nucleus	DNA bending activity|ligand-dependent nuclear receptor transcription coactivator activity|RNA polymerase II transcription cofactor activity|sequence-specific DNA binding transcription factor activity|transcription factor binding|zinc ion binding			ovary(3)|pancreas(1)|skin(1)	5	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)															---	---	---	---
Unknown	0	broad.mit.edu	37	6	42521091	42521092	+	IGR	INS	-	AA	AA	rs56137022	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:42521091_42521092insAA								TRERF1 (101226 upstream) : UBR2 (10966 downstream)																																			---	---	---	---
TTBK1	84630	broad.mit.edu	37	6	43219921	43219930	+	Intron	DEL	TGTGTGTGTG	-	-	rs71773499		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43219921_43219930delTGTGTGTGTG	uc003ouq.1	+							NM_032538	NP_115927			tau tubulin kinase 1							cell junction|cytoplasm|nucleus	ATP binding|protein binding|protein serine/threonine kinase activity			lung(4)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	9			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0125)|OV - Ovarian serous cystadenocarcinoma(102;0.0399)															---	---	---	---
CAPN11	11131	broad.mit.edu	37	6	44150043	44150044	+	Intron	INS	-	AT	AT	rs143072463	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:44150043_44150044insAT	uc003owt.1	+						CAPN11_uc011dvn.1_Intron	NM_007058	NP_008989			calpain 11						proteolysis	acrosomal vesicle	calcium ion binding|calcium-dependent cysteine-type endopeptidase activity			ovary(1)|breast(1)	2	all_cancers(18;3.19e-06)|Lung NSC(15;0.00108)|all_lung(25;0.00278)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)															---	---	---	---
Unknown	0	broad.mit.edu	37	6	47193814	47193815	+	IGR	INS	-	C	C	rs992282	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:47193814_47193815insC								GPR110 (183732 upstream) : TNFRSF21 (5454 downstream)																																			---	---	---	---
CD2AP	23607	broad.mit.edu	37	6	47557801	47557801	+	Intron	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:47557801delA	uc003oyw.2	+							NM_012120	NP_036252			CD2-associated protein						cell division|mitosis|protein complex assembly|signal transduction|substrate-dependent cell migration, cell extension	cytoplasm|filamentous actin|nucleolus|plasma membrane|ruffle	SH3 domain binding|structural constituent of cytoskeleton			ovary(1)|skin(1)	2			Lung(136;0.105)|LUSC - Lung squamous cell carcinoma(51;0.138)															---	---	---	---
Unknown	0	broad.mit.edu	37	6	49539279	49539279	+	IGR	DEL	T	-	-	rs11368102		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:49539279delT								C6orf141 (9654 upstream) : RHAG (33614 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	49621963	49621965	+	IGR	DEL	TTC	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:49621963_49621965delTTC								RHAG (17376 upstream) : CRISP2 (38107 downstream)																																			---	---	---	---
EFHC1	114327	broad.mit.edu	37	6	52326216	52326218	+	Intron	DEL	GCA	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:52326216_52326218delGCA	uc003pap.3	+						EFHC1_uc011dwv.1_Intron|EFHC1_uc011dww.1_Intron	NM_018100	NP_060570			EF-hand domain (C-terminal) containing 1							axoneme|neuronal cell body	calcium ion binding|protein C-terminus binding			ovary(2)|skin(1)	3	Lung NSC(77;0.109)																	---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57373212	57373213	+	Intron	INS	-	T	T	rs149057632	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57373212_57373213insT	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57390726	57390728	+	Intron	DEL	TTG	-	-	rs34695317		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57390726_57390728delTTG	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57415028	57415029	+	Intron	INS	-	T	T	rs145113134		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57415028_57415029insT	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57500198	57500198	+	Intron	DEL	A	-	-	rs11329134		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57500198delA	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57511048	57511049	+	Intron	INS	-	TA	TA	rs10643529		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57511048_57511049insTA	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	57517526	57517529	+	IGR	DEL	CATA	-	-	rs146081336		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57517526_57517529delCATA								PRIM2 (4151 upstream) : GUSBL2 (728630 downstream)																																			---	---	---	---
EYS	346007	broad.mit.edu	37	6	65538963	65538964	+	Intron	INS	-	ATGAC	ATGAC	rs140119069	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:65538963_65538964insATGAC	uc011dxu.1	-							NM_001142800	NP_001136272			eyes shut homolog isoform 1						response to stimulus|visual perception	extracellular region	calcium ion binding			lung(4)|ovary(1)|skin(1)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	75520020	75520021	+	IGR	DEL	TG	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:75520020_75520021delTG								CD109 (981980 upstream) : COL12A1 (274022 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	80756182	80756185	+	IGR	DEL	TCTT	-	-	rs140319904		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:80756182_80756185delTCTT								TTK (3945 upstream) : BCKDHB (60159 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	82095705	82095708	+	IGR	DEL	ACAC	-	-	rs141658651		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:82095705_82095708delACAC								None (None upstream) : FAM46A (359740 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	82150191	82150191	+	IGR	DEL	G	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:82150191delG								None (None upstream) : FAM46A (305257 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	86581999	86582000	+	IGR	DEL	TC	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:86581999_86582000delTC								SNHG5 (193548 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	87290233	87290233	+	IGR	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:87290233delT								SNHG5 (901782 upstream) : HTR1E (356791 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	112230414	112230437	+	Splice_Site	DEL	TGCACCTCTGCCCTTCTGCCCTCC	-	-	rs67493955		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:112230414_112230437delTGCACCTCTGCCCTTCTGCCCTCC	uc003pvl.1	-	2		c.159_splice	c.e2-1							full-length cDNA clone CS0DI032YF23 of Placenta Cot 25-normalized of Homo sapiens (human).																														---	---	---	---
SLC35F1	222553	broad.mit.edu	37	6	118503652	118503653	+	Intron	INS	-	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:118503652_118503653insA	uc003pxx.3	+							NM_001029858	NP_001025029			solute carrier family 35, member F1						transport	integral to membrane				breast(1)	1				GBM - Glioblastoma multiforme(226;0.217)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	120199300	120199300	+	IGR	DEL	A	-	-	rs79518014		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:120199300delA								MAN1A1 (528374 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	121820554	121820554	+	IGR	DEL	C	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:121820554delC								GJA1 (49682 upstream) : HSF2 (900142 downstream)																																			---	---	---	---
PKIB	5570	broad.mit.edu	37	6	122999036	122999039	+	Intron	DEL	CTTT	-	-	rs7752574	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:122999036_122999039delCTTT	uc003pyz.2	+						PKIB_uc003pza.2_Intron|PKIB_uc003pzb.2_Intron|PKIB_uc003pzc.2_Intron	NM_181794	NP_861459			cAMP-dependent protein kinase inhibitor beta								cAMP-dependent protein kinase inhibitor activity				0				GBM - Glioblastoma multiforme(226;0.164)														---	---	---	---
C6orf192	116843	broad.mit.edu	37	6	133117334	133117334	+	Intron	DEL	A	-	-	rs11312283		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:133117334delA	uc003qdw.1	-						C6orf192_uc011eco.1_Intron	NM_052831	NP_439896			hypothetical protein LOC116843						transmembrane transport	integral to membrane				ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(155;0.00303)|GBM - Glioblastoma multiforme(226;0.0265)														---	---	---	---
PDE7B	27115	broad.mit.edu	37	6	136229400	136229401	+	Intron	INS	-	T	T	rs140137447	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:136229400_136229401insT	uc003qgp.2	+						uc003qgq.1_Intron	NM_018945	NP_061818			phosphodiesterase 7B						signal transduction|synaptic transmission	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding			ovary(1)	1	Colorectal(23;0.24)			OV - Ovarian serous cystadenocarcinoma(155;0.0136)|GBM - Glioblastoma multiforme(68;0.0147)	Dyphylline(DB00651)|Ketotifen(DB00920)													---	---	---	---
Unknown	0	broad.mit.edu	37	6	137704617	137704618	+	IGR	INS	-	TCTTCCTT	TCTTCCTT	rs71009542		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:137704617_137704618insTCTTCCTT								IFNGR1 (164050 upstream) : OLIG3 (108718 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	138225121	138225121	+	IGR	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:138225121delT								TNFAIP3 (20676 upstream) : PERP (184521 downstream)																																			---	---	---	---
STX11	8676	broad.mit.edu	37	6	144490800	144490801	+	Intron	INS	-	CCTTCCTT	CCTTCCTT	rs144586806	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:144490800_144490801insCCTTCCTT	uc003qks.3	+							NM_003764	NP_003755			syntaxin 11						cellular membrane fusion|intracellular protein transport|vesicle-mediated transport	Golgi apparatus|membrane	SNAP receptor activity			ovary(1)|central_nervous_system(1)	2				OV - Ovarian serous cystadenocarcinoma(155;2.17e-06)|GBM - Glioblastoma multiforme(68;0.0492)										Familial_Hemophagocytic_Lymphohistiocytosis				---	---	---	---
Unknown	0	broad.mit.edu	37	6	147964880	147964881	+	IGR	INS	-	GAAGGAAG	GAAGGAAG	rs5880721		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:147964880_147964881insGAAGGAAG								SAMD5 (73723 upstream) : SASH1 (698848 downstream)																																			---	---	---	---
ESR1	2099	broad.mit.edu	37	6	152331834	152331834	+	Intron	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152331834delT	uc003qom.3	+						ESR1_uc010kin.2_Intron|ESR1_uc010kio.2_Intron|ESR1_uc010kip.2_Intron|ESR1_uc003qon.3_Intron|ESR1_uc003qoo.3_Intron|ESR1_uc010kiq.2_Intron|ESR1_uc010kir.2_Intron|ESR1_uc011eet.1_Intron|ESR1_uc011eeu.1_Intron|ESR1_uc011eev.1_Intron|ESR1_uc011eew.1_Intron|ESR1_uc010kis.2_Intron|ESR1_uc011eex.1_Intron|ESR1_uc010kit.1_Intron|ESR1_uc011eey.1_Intron	NM_001122742	NP_001116214			estrogen receptor alpha isoform 4						positive regulation of retinoic acid receptor signaling pathway|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to estradiol stimulus	chromatin remodeling complex|cytoplasm|nucleoplasm	beta-catenin binding|enzyme binding|estrogen receptor activity|estrogen response element binding|nitric-oxide synthase regulator activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid binding|zinc ion binding			central_nervous_system(2)|ovary(1)|lung(1)|breast(1)	5		Ovarian(120;0.0448)	BRCA - Breast invasive adenocarcinoma(37;0.0841)	OV - Ovarian serous cystadenocarcinoma(155;4.55e-10)	Chlorotrianisene(DB00269)|Clomifene(DB00882)|Conjugated Estrogens(DB00286)|Danazol(DB01406)|Desogestrel(DB00304)|Dienestrol(DB00890)|Diethylstilbestrol(DB00255)|Dromostanolone(DB00858)|Drospirenone(DB01395)|Estradiol(DB00783)|Estramustine(DB01196)|Estriol(DB04573)|Estrone(DB00655)|Ethinyl Estradiol(DB00977)|Ethynodiol Diacetate(DB00823)|Etonogestrel(DB00294)|Fluoxymesterone(DB01185)|Fulvestrant(DB00947)|Letrozole(DB01006)|Levonorgestrel(DB00367)|Medroxyprogesterone(DB00603)|Megestrol(DB00351)|Melatonin(DB01065)|Mestranol(DB01357)|Naloxone(DB01183)|Norgestimate(DB00957)|Norgestrel(DB00506)|Progesterone(DB00396)|Quinestrol(DB04575)|Raloxifene(DB00481)|Tamoxifen(DB00675)|Toremifene(DB00539)													---	---	---	---
Unknown	0	broad.mit.edu	37	6	153133097	153133098	+	IGR	INS	-	CTT	CTT	rs143473605	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:153133097_153133098insCTT								VIP (52199 upstream) : FBXO5 (158562 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	156062251	156062251	+	IGR	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:156062251delT								NOX3 (285214 upstream) : MIR1202 (205680 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	156789295	156789296	+	IGR	INS	-	AC	AC	rs141318227	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:156789295_156789296insAC								MIR1202 (521282 upstream) : ARID1B (309790 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	156979572	156979573	+	IGR	INS	-	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:156979572_156979573insA								MIR1202 (711559 upstream) : ARID1B (119513 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	157620048	157620049	+	IGR	INS	-	GTGT	GTGT			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:157620048_157620049insGTGT								ARID1B (89647 upstream) : C6orf35 (90006 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	157691697	157691699	+	IGR	DEL	ACT	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:157691697_157691699delACT								ARID1B (161296 upstream) : C6orf35 (18356 downstream)																																			---	---	---	---
ZDHHC14	79683	broad.mit.edu	37	6	158075773	158075773	+	Intron	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:158075773delT	uc003qqt.2	+						ZDHHC14_uc003qqs.2_Intron|ZDHHC14_uc010kjn.2_Intron	NM_024630	NP_078906			zinc finger, DHHC-type containing 14 isoform 1							integral to membrane	acyltransferase activity|zinc ion binding			ovary(1)|skin(1)	2		Breast(66;0.00586)|Ovarian(120;0.123)		OV - Ovarian serous cystadenocarcinoma(65;2.9e-17)|BRCA - Breast invasive adenocarcinoma(81;5.8e-05)														---	---	---	---
SYNJ2	8871	broad.mit.edu	37	6	158402833	158402833	+	5'Flank	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:158402833delA	uc003qqx.1	+						SYNJ2_uc011efm.1_5'Flank|SYNJ2_uc003qqw.1_5'Flank	NM_003898	NP_003889			synaptojanin 2								nucleotide binding|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity|RNA binding			skin(1)	1				OV - Ovarian serous cystadenocarcinoma(65;4.42e-18)|BRCA - Breast invasive adenocarcinoma(81;4.23e-05)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	159943893	159943893	+	IGR	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:159943893delA								FNDC1 (250754 upstream) : SOD2 (156258 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	160062810	160062811	+	IGR	DEL	GA	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:160062810_160062811delGA								FNDC1 (369671 upstream) : SOD2 (37340 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	160078408	160078411	+	IGR	DEL	AAAC	-	-	rs148644707		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:160078408_160078411delAAAC								FNDC1 (385269 upstream) : SOD2 (21740 downstream)																																			---	---	---	---
PARK2	5071	broad.mit.edu	37	6	162904591	162904592	+	Intron	INS	-	GGAG	GGAG	rs142168440	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:162904591_162904592insGGAG	uc003qtx.3	-						PARK2_uc003qty.3_Intron|PARK2_uc003qtz.3_Intron|PARK2_uc010kke.1_Intron	NM_004562	NP_004553			parkin isoform 1						aggresome assembly|central nervous system development|mitochondrion degradation|negative regulation of actin filament bundle assembly|negative regulation of cell death|negative regulation of protein phosphorylation|negative regulation of release of cytochrome c from mitochondria|neuron death|positive regulation of I-kappaB kinase/NF-kappaB cascade|protein autoubiquitination|protein K48-linked ubiquitination|protein K63-linked ubiquitination|protein monoubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of autophagy|regulation of reactive oxygen species metabolic process	aggresome|cytosol|endoplasmic reticulum|Golgi apparatus|mitochondrion|nucleus|perinuclear region of cytoplasm	chaperone binding|PDZ domain binding|protein kinase binding|ubiquitin protein ligase binding|ubiquitin-protein ligase activity|zinc ion binding			upper_aerodigestive_tract(1)	1		all_cancers(1;8.13e-65)|all_epithelial(1;5.77e-64)|Colorectal(1;9.65e-15)|all_lung(1;1.66e-13)|Lung NSC(1;7.54e-11)|Melanoma(1;1.75e-09)|Breast(66;7.81e-05)|Ovarian(120;0.000981)|Prostate(117;0.0288)|Esophageal squamous(34;0.102)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0663)|all cancers(1;1.9e-63)|Epithelial(1;1.5e-59)|Colorectal(1;2.16e-23)|OV - Ovarian serous cystadenocarcinoma(65;3.53e-20)|COAD - Colon adenocarcinoma(1;2.11e-15)|STAD - Stomach adenocarcinoma(1;4.64e-07)|BRCA - Breast invasive adenocarcinoma(81;1.49e-06)|READ - Rectum adenocarcinoma(1;2.95e-06)|GBM - Glioblastoma multiforme(2;7.23e-06)|Lung(1;0.00163)|KIRC - Kidney renal clear cell carcinoma(4;0.00371)|LUSC - Lung squamous cell carcinoma(1;0.00442)|Kidney(4;0.0046)														---	---	---	---
PACRG	135138	broad.mit.edu	37	6	163396801	163396802	+	Intron	INS	-	CTCC	CTCC	rs145828950	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:163396801_163396802insCTCC	uc003qua.2	+						PACRG_uc003qub.2_Intron|PACRG_uc003quc.2_Intron	NM_152410	NP_689623			parkin co-regulated gene protein isoform 1												0		Breast(66;2.41e-05)|Ovarian(120;0.0245)|Prostate(117;0.0273)|all_neural(5;0.0416)|Glioma(2;0.203)		OV - Ovarian serous cystadenocarcinoma(33;4.31e-19)|GBM - Glioblastoma multiforme(2;7.42e-11)|BRCA - Breast invasive adenocarcinoma(81;3.19e-05)|KIRC - Kidney renal clear cell carcinoma(3;0.205)|Kidney(3;0.242)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	164572949	164572950	+	IGR	INS	-	G	G	rs139736923	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:164572949_164572950insG								QKI (578057 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	165541373	165541376	+	IGR	DEL	GATG	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:165541373_165541376delGATG								None (None upstream) : C6orf118 (151779 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	165541596	165541599	+	IGR	DEL	GGAC	-	-	rs13204253		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:165541596_165541599delGGAC								None (None upstream) : C6orf118 (151556 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	165557996	165557996	+	IGR	DEL	T	-	-	rs10556621		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:165557996delT								None (None upstream) : C6orf118 (135159 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	166172015	166172016	+	IGR	INS	-	GAAGAG	GAAGAG	rs112372946	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:166172015_166172016insGAAGAG								PDE10A (96431 upstream) : C6orf176 (165520 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	168617025	168617025	+	IGR	DEL	G	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:168617025delG								FRMD1 (137186 upstream) : DACT2 (90561 downstream)																																			---	---	---	---
SMOC2	64094	broad.mit.edu	37	6	169040852	169040857	+	Intron	DEL	TTGGTG	-	-	rs5881803		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:169040852_169040857delTTGGTG	uc003qws.1	+						SMOC2_uc003qwr.1_Intron|SMOC2_uc011egu.1_Intron	NM_022138	NP_071421			SPARC related modular calcium binding 2						signal transduction	basement membrane	calcium ion binding			ovary(1)	1		Breast(66;0.000141)|Esophageal squamous(34;0.222)|Ovarian(120;0.231)		OV - Ovarian serous cystadenocarcinoma(33;1.31e-19)|BRCA - Breast invasive adenocarcinoma(81;3.06e-06)|GBM - Glioblastoma multiforme(31;0.00109)														---	---	---	---
WDR27	253769	broad.mit.edu	37	6	169975508	169975523	+	Intron	DEL	CCATCCATCCATCCAC	-	-	rs140265014	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:169975508_169975523delCCATCCATCCATCCAC	uc003qwx.2	-						WDR27_uc003qwv.1_Intron|WDR27_uc010kkw.1_Intron|WDR27_uc003qwy.2_Intron					RecName: Full=WD repeat-containing protein 27;											pancreas(1)	1		Breast(66;1.53e-05)|Ovarian(120;0.216)		OV - Ovarian serous cystadenocarcinoma(33;6.48e-20)|BRCA - Breast invasive adenocarcinoma(81;3.56e-07)|GBM - Glioblastoma multiforme(31;0.00168)														---	---	---	---
WDR27	253769	broad.mit.edu	37	6	170085234	170085234	+	Intron	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:170085234delA	uc003qwx.2	-						WDR27_uc010kkw.1_Intron|WDR27_uc003qwy.2_Intron|WDR27_uc011egw.1_Intron|WDR27_uc010kkx.2_Intron					RecName: Full=WD repeat-containing protein 27;											pancreas(1)	1		Breast(66;1.53e-05)|Ovarian(120;0.216)		OV - Ovarian serous cystadenocarcinoma(33;6.48e-20)|BRCA - Breast invasive adenocarcinoma(81;3.56e-07)|GBM - Glioblastoma multiforme(31;0.00168)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	170423528	170423529	+	IGR	INS	-	G	G			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:170423528_170423529insG								C6orf208 (220559 upstream) : LOC154449 (139893 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	91026	91027	+	IGR	DEL	TG	-	-	rs72331461		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:91026_91027delTG								None (None upstream) : FAM20C (101942 downstream)																																			---	---	---	---
PDGFA	5154	broad.mit.edu	37	7	537947	537948	+	3'UTR	INS	-	TC	TC			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:537947_537948insTC	uc003sir.2	-	7					PDGFA_uc003sis.2_3'UTR	NM_002607	NP_002598			platelet-derived growth factor alpha isoform 1						actin cytoskeleton organization|angiogenesis|cell projection assembly|embryo development|hair follicle development|lung alveolus development|negative chemotaxis|negative regulation of phosphatidylinositol biosynthetic process|negative regulation of platelet activation|organ morphogenesis|platelet activation|platelet degranulation|positive regulation of cell division|positive regulation of DNA replication|positive regulation of ERK1 and ERK2 cascade|positive regulation of fibroblast proliferation|positive regulation of MAP kinase activity|positive regulation of mesenchymal cell proliferation|positive regulation of metanephric mesenchymal cell migration by platelet-derived growth factor receptor-beta signaling pathway|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of protein autophosphorylation|positive regulation of protein kinase B signaling cascade|regulation of actin cytoskeleton organization|regulation of branching involved in salivary gland morphogenesis by epithelial-mesenchymal signaling|regulation of peptidyl-tyrosine phosphorylation|regulation of smooth muscle cell migration|skin development	cell surface|endoplasmic reticulum lumen|extracellular space|Golgi membrane|microvillus|platelet alpha granule lumen	collagen binding|eukaryotic cell surface binding|growth factor activity|platelet-derived growth factor binding|platelet-derived growth factor receptor binding|protein heterodimerization activity|protein homodimerization activity				0		Ovarian(82;0.0112)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0178)|Epithelial(4;1.1e-17)|OV - Ovarian serous cystadenocarcinoma(56;1.7e-17)|all cancers(6;4.89e-15)														---	---	---	---
PRKAR1B	5575	broad.mit.edu	37	7	591536	591537	+	Intron	INS	-	C	C			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:591536_591537insC	uc003siu.1	-						PRKAR1B_uc003siv.2_Intron|PRKAR1B_uc003siw.1_Intron	NM_002735	NP_002726			protein kinase, cAMP-dependent, regulatory, type						activation of phospholipase C activity|activation of protein kinase A activity|blood coagulation|cellular response to glucagon stimulus|energy reserve metabolic process|nerve growth factor receptor signaling pathway|protein phosphorylation|regulation of insulin secretion|transmembrane transport|water transport	cAMP-dependent protein kinase complex|cytosol	cAMP binding|cAMP-dependent protein kinase regulator activity				0		Ovarian(82;0.0779)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0181)|Epithelial(4;5.75e-19)|OV - Ovarian serous cystadenocarcinoma(56;2.01e-18)|all cancers(6;3.96e-16)|BRCA - Breast invasive adenocarcinoma(126;0.152)														---	---	---	---
INTS1	26173	broad.mit.edu	37	7	1546839	1546840	+	5'Flank	INS	-	T	T	rs145815622		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:1546839_1546840insT	uc003skn.2	-						INTS1_uc003skq.2_5'Flank	NM_001080453	NP_001073922			integrator complex subunit 1						snRNA processing	integral to membrane|integrator complex|nuclear membrane					0		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0181)|OV - Ovarian serous cystadenocarcinoma(56;6.99e-15)														---	---	---	---
Unknown	0	broad.mit.edu	37	7	1634961	1634962	+	IGR	INS	-	ATCC	ATCC	rs141966771	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:1634961_1634962insATCC								KIAA1908 (5702 upstream) : TFAMP1 (19144 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	1658095	1658096	+	IGR	DEL	GT	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:1658095_1658096delGT								TFAMP1 (1768 upstream) : ELFN1 (90702 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	3188019	3188020	+	Intron	INS	-	T	T	rs55948230		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:3188019_3188020insT	uc003smw.1	-											Homo sapiens hypothetical protein LOC389457, mRNA (cDNA clone IMAGE:5267367).																														---	---	---	---
Unknown	0	broad.mit.edu	37	7	4436036	4436036	+	IGR	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:4436036delA								SDK1 (127407 upstream) : FOXK1 (247352 downstream)																																			---	---	---	---
PMS2CL	441194	broad.mit.edu	37	7	6775748	6775748	+	Intron	DEL	T	-	-	rs71539976		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6775748delT	uc011jxb.1	+						PMS2CL_uc003squ.2_Intron|PMS2CL_uc003sqv.1_Intron					SubName: Full=cDNA FLJ60281, highly similar to PMS1 protein homolog 2;												0																		---	---	---	---
NXPH1	30010	broad.mit.edu	37	7	8661121	8661121	+	Intron	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:8661121delT	uc003srv.2	+						NXPH1_uc011jxh.1_Intron	NM_152745	NP_689958			neurexophilin 1 precursor							extracellular region				ovary(1)|central_nervous_system(1)	2		Ovarian(82;0.0628)		UCEC - Uterine corpus endometrioid carcinoma (126;0.101)														---	---	---	---
Unknown	0	broad.mit.edu	37	7	9184128	9184128	+	IGR	DEL	T	-	-	rs35330453		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:9184128delT								NXPH1 (391536 upstream) : PER4 (489772 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	10308994	10308995	+	IGR	INS	-	G	G	rs72594909	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:10308994_10308995insG								PER4 (633547 upstream) : NDUFA4 (663820 downstream)																																			---	---	---	---
PHF14	9678	broad.mit.edu	37	7	11061987	11061987	+	Intron	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:11061987delA	uc003sry.1	+						PHF14_uc011jxi.1_Intron|PHF14_uc003srz.2_Intron|PHF14_uc011jxj.1_Intron	NM_014660	NP_055475			PHD finger protein 14 isoform 2								zinc ion binding			kidney(2)|skin(1)	3				UCEC - Uterine corpus endometrioid carcinoma (126;0.205)														---	---	---	---
Unknown	0	broad.mit.edu	37	7	12854648	12854649	+	IGR	INS	-	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:12854648_12854649insT								ARL4A (124092 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	13528664	13528664	+	IGR	DEL	G	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:13528664delG								ARL4A (798108 upstream) : ETV1 (402194 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	13725202	13725203	+	IGR	INS	-	A	A	rs10627627		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:13725202_13725203insA								ARL4A (994646 upstream) : ETV1 (205655 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	15044020	15044022	+	IGR	DEL	TTC	-	-	rs67878807		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:15044020_15044022delTTC								DGKB (101470 upstream) : TMEM195 (195921 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	17431258	17431258	+	IGR	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:17431258delA								AHR (45483 upstream) : SNX13 (399128 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	25690105	25690105	+	Intron	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:25690105delT	uc003sxp.1	-											Homo sapiens cDNA FLJ32817 fis, clone TESTI2002877.																														---	---	---	---
Unknown	0	broad.mit.edu	37	7	26058556	26058556	+	IGR	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:26058556delT								MIR148A (68950 upstream) : NFE2L3 (133291 downstream)																																			---	---	---	---
AVL9	23080	broad.mit.edu	37	7	32721804	32721805	+	Intron	DEL	CT	-	-	rs145238109		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:32721804_32721805delCT	uc011kai.1	+						uc003tcw.2_Intron	NM_015060	NP_055875			AVL9 homolog (S. cerevisiase)							integral to membrane					0																		---	---	---	---
EEPD1	80820	broad.mit.edu	37	7	36298504	36298505	+	Intron	INS	-	C	C			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:36298504_36298505insC	uc003tfa.2	+							NM_030636	NP_085139			endonuclease/exonuclease/phosphatase family						DNA repair		DNA binding				0																		---	---	---	---
TXNDC3	51314	broad.mit.edu	37	7	37887565	37887573	+	5'Flank	DEL	GAGGAGGAA	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:37887565_37887573delGAGGAGGAA	uc003tfn.2	+							NM_016616	NP_057700			thioredoxin domain containing 3						cell differentiation|cell redox homeostasis|CTP biosynthetic process|GTP biosynthetic process|multicellular organismal development|spermatogenesis|UTP biosynthetic process	cytoplasm|microtubule cytoskeleton	ATP binding|nucleoside diphosphate kinase activity			ovary(1)|breast(1)|central_nervous_system(1)	3														Kartagener_syndrome				---	---	---	---
VPS41	27072	broad.mit.edu	37	7	38918760	38918760	+	Intron	DEL	G	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:38918760delG	uc003tgy.2	-						VPS41_uc003tgz.2_Intron|VPS41_uc010kxn.2_Intron	NM_014396	NP_055211			vacuolar protein sorting 41 isoform 1						Golgi vesicle transport|intracellular protein transport|vesicle-mediated transport	cytosol|Golgi-associated vesicle|HOPS complex|membrane fraction	zinc ion binding			skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	4																		---	---	---	---
C7orf10	79783	broad.mit.edu	37	7	40807508	40807509	+	Intron	INS	-	T	T	rs147953086	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:40807508_40807509insT	uc003thn.1	+						C7orf10_uc003thm.1_Intron|C7orf10_uc003tho.1_Intron	NM_024728	NP_079004			dermal papilla derived protein 13								transferase activity			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	41081136	41081136	+	IGR	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:41081136delA								C7orf10 (180779 upstream) : INHBA (647467 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	41713601	41713602	+	IGR	INS	-	CC	CC	rs10246775		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:41713601_41713602insCC								C7orf10 (813244 upstream) : INHBA (15001 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	42609688	42609688	+	IGR	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:42609688delA								GLI3 (333070 upstream) : C7orf25 (339186 downstream)																																			---	---	---	---
MRPL32	64983	broad.mit.edu	37	7	42972437	42972438	+	Intron	INS	-	A	A	rs148719987	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:42972437_42972438insA	uc003tia.2	+						C7orf25_uc010kxr.2_5'Flank|PSMA2_uc003thy.2_5'Flank|PSMA2_uc010kxt.2_5'Flank|PSMA2_uc003thz.1_5'Flank|MRPL32_uc003tib.2_Intron|MRPL32_uc003tic.2_Intron	NM_031903	NP_114109			mitochondrial ribosomal protein L32 precursor						translation	large ribosomal subunit|mitochondrial ribosome	structural constituent of ribosome				0																		---	---	---	---
HECW1	23072	broad.mit.edu	37	7	43238325	43238326	+	Intron	DEL	CT	-	-	rs140743343		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:43238325_43238326delCT	uc003tid.1	+						HECW1_uc011kbi.1_Intron|HECW1_uc003tie.1_Intron	NM_015052	NP_055867			NEDD4-like ubiquitin-protein ligase 1						protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	ubiquitin-protein ligase activity			ovary(8)|lung(6)|breast(4)|skin(4)|pancreas(1)	23																		---	---	---	---
HECW1	23072	broad.mit.edu	37	7	43375570	43375571	+	Intron	DEL	CT	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:43375570_43375571delCT	uc003tid.1	+						HECW1_uc011kbi.1_Intron|HECW1_uc003tie.1_Intron	NM_015052	NP_055867			NEDD4-like ubiquitin-protein ligase 1						protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	ubiquitin-protein ligase activity			ovary(8)|lung(6)|breast(4)|skin(4)|pancreas(1)	23																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	46943682	46943682	+	IGR	DEL	A	-	-	rs77927075		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:46943682delA								IGFBP3 (982811 upstream) : TNS3 (371071 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	47144534	47144535	+	IGR	INS	-	T	T	rs71567785		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:47144534_47144535insT								None (None upstream) : TNS3 (170218 downstream)																																			---	---	---	---
GRB10	2887	broad.mit.edu	37	7	50690485	50690486	+	Intron	INS	-	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:50690485_50690486insT	uc003tpi.2	-						GRB10_uc003tph.3_Intron|GRB10_uc003tpj.2_Intron|GRB10_uc003tpk.2_Intron|GRB10_uc010kzb.2_Intron|GRB10_uc003tpl.2_Intron|GRB10_uc003tpm.2_Intron|GRB10_uc003tpn.2_Intron	NM_005311	NP_005302			growth factor receptor-bound protein 10 isoform						insulin receptor signaling pathway|insulin receptor signaling pathway|negative regulation of glucose import|negative regulation of glycogen biosynthetic process|negative regulation of insulin receptor signaling pathway|negative regulation of Wnt receptor signaling pathway|positive regulation of phosphorylation|positive regulation of vascular endothelial growth factor receptor signaling pathway	cytosol|plasma membrane	insulin receptor binding|insulin receptor binding|SH3/SH2 adaptor activity			lung(3)|ovary(2)|upper_aerodigestive_tract(1)	6	Glioma(55;0.08)|all_neural(89;0.245)													Russell-Silver_syndrome				---	---	---	---
GRB10	2887	broad.mit.edu	37	7	50744487	50744487	+	Intron	DEL	G	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:50744487delG	uc003tpi.2	-						GRB10_uc003tph.3_Intron|GRB10_uc003tpj.2_Intron|GRB10_uc003tpk.2_Intron|GRB10_uc010kzb.2_Intron|GRB10_uc003tpl.2_Intron|GRB10_uc003tpm.2_Intron|GRB10_uc003tpn.2_Intron	NM_005311	NP_005302			growth factor receptor-bound protein 10 isoform						insulin receptor signaling pathway|insulin receptor signaling pathway|negative regulation of glucose import|negative regulation of glycogen biosynthetic process|negative regulation of insulin receptor signaling pathway|negative regulation of Wnt receptor signaling pathway|positive regulation of phosphorylation|positive regulation of vascular endothelial growth factor receptor signaling pathway	cytosol|plasma membrane	insulin receptor binding|insulin receptor binding|SH3/SH2 adaptor activity			lung(3)|ovary(2)|upper_aerodigestive_tract(1)	6	Glioma(55;0.08)|all_neural(89;0.245)													Russell-Silver_syndrome				---	---	---	---
COBL	23242	broad.mit.edu	37	7	51132663	51132663	+	Intron	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:51132663delT	uc003tpr.3	-						COBL_uc003tps.2_Intron|COBL_uc011kcl.1_Intron|COBL_uc010kzc.2_Intron|COBL_uc003tpp.3_Intron|COBL_uc003tpq.3_Intron	NM_015198	NP_056013			cordon-bleu homolog											skin(3)|ovary(2)	5	Glioma(55;0.08)																	---	---	---	---
COBL	23242	broad.mit.edu	37	7	51147304	51147304	+	Intron	DEL	C	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:51147304delC	uc003tpr.3	-						COBL_uc003tps.2_Intron|COBL_uc011kcl.1_Intron|COBL_uc010kzc.2_Intron|COBL_uc003tpt.2_Intron|COBL_uc003tpp.3_Intron|COBL_uc003tpq.3_Intron	NM_015198	NP_056013			cordon-bleu homolog											skin(3)|ovary(2)	5	Glioma(55;0.08)																	---	---	---	---
Unknown	0	broad.mit.edu	37	7	53199790	53199791	+	IGR	INS	-	CTTG	CTTG	rs144211853	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:53199790_53199791insCTTG								POM121L12 (95173 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	53555521	53555522	+	IGR	INS	-	T	T	rs12113922		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:53555521_53555522insT								POM121L12 (450904 upstream) : HPVC1 (713395 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	53894075	53894084	+	IGR	DEL	AAGAGAAGAA	-	-	rs142119231	by1000genomes;by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:53894075_53894084delAAGAGAAGAA								POM121L12 (789458 upstream) : HPVC1 (374833 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	55512968	55512971	+	IGR	DEL	ACAG	-	-	rs60711282		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:55512968_55512971delACAG								LANCL2 (11535 upstream) : VOPP1 (25336 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	56395369	56395370	+	IGR	DEL	TC	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:56395369_56395370delTC								PSPH (211279 upstream) : DKFZp434L192 (168546 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	57498588	57498589	+	IGR	INS	-	T	T	rs75462970		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57498588_57498589insT								ZNF479 (291017 upstream) : ZNF716 (11294 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	57628416	57628417	+	IGR	INS	-	A	A	rs150287172	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57628416_57628417insA								ZNF716 (95151 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	57638532	57638533	+	IGR	DEL	CT	-	-	rs139578097		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57638532_57638533delCT								ZNF716 (105267 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	57648800	57648800	+	IGR	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57648800delT								ZNF716 (115535 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	57707794	57707794	+	IGR	DEL	C	-	-	rs112466662		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57707794delC								ZNF716 (174529 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	57741928	57741928	+	IGR	DEL	C	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57741928delC								ZNF716 (208663 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	61536664	61536664	+	IGR	DEL	G	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:61536664delG								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	61770995	61770995	+	IGR	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:61770995delA								None (None upstream) : LOC643955 (980677 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	61771659	61771659	+	IGR	DEL	G	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:61771659delG								None (None upstream) : LOC643955 (980013 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	61779819	61779823	+	IGR	DEL	GTGTC	-	-	rs143423122		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:61779819_61779823delGTGTC								None (None upstream) : LOC643955 (971849 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	64324775	64324776	+	IGR	INS	-	GTGTGTGC	GTGTGTGC	rs143856499	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:64324775_64324776insGTGTGTGC								LOC168474 (10597 upstream) : ZNF273 (18095 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	64957994	64957994	+	IGR	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:64957994delT								ZNF92 (91997 upstream) : INTS4L2 (154783 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	65282922	65282923	+	IGR	INS	-	T	T	rs112461860	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:65282922_65282923insT								CCT6P1 (54261 upstream) : VKORC1L1 (55334 downstream)																																			---	---	---	---
C7orf42	55069	broad.mit.edu	37	7	66411073	66411074	+	Intron	DEL	AA	-	-	rs142376273		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:66411073_66411074delAA	uc003tvk.2	+						C7orf42_uc010lah.2_Intron|C7orf42_uc003tvl.2_Intron	NM_017994	NP_060464			hypothetical protein LOC55069							integral to membrane				ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	67411473	67411473	+	IGR	DEL	A	-	-	rs113815976		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:67411473delA								STAG3L4 (624961 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	68393742	68393743	+	IGR	INS	-	AA	AA	rs148424943		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:68393742_68393743insAA								None (None upstream) : AUTS2 (670162 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	68942226	68942226	+	IGR	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:68942226delA								None (None upstream) : AUTS2 (121679 downstream)																																			---	---	---	---
WBSCR17	64409	broad.mit.edu	37	7	70723884	70723884	+	Intron	DEL	G	-	-	rs78481677		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:70723884delG	uc003tvy.2	+							NM_022479	NP_071924			UDP-GalNAc:polypeptide							Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			skin(3)|upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)|central_nervous_system(1)	7		all_cancers(73;0.2)|Lung NSC(55;0.094)|all_lung(88;0.125)																---	---	---	---
SBDSP1	155370	broad.mit.edu	37	7	72304629	72304630	+	Intron	INS	-	T	T	rs66937252		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:72304629_72304630insT	uc003twg.2	+						SBDSP1_uc003twh.2_Intron|SBDSP1_uc003twe.2_Intron	NR_024110				Homo sapiens Shwachman-Bodian-Diamond syndrome pseudogene, mRNA (cDNA clone IMAGE:4329436).												0																		---	---	---	---
BCL7B	9275	broad.mit.edu	37	7	72968301	72968302	+	Intron	DEL	TT	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:72968301_72968302delTT	uc003tyf.1	-						BCL7B_uc003tye.1_Intron|BCL7B_uc003tyg.1_Intron	NM_001707	NP_001698			B-cell CLL/lymphoma 7B								actin binding			ovary(1)	1		Lung NSC(55;0.0659)|all_lung(88;0.152)																---	---	---	---
Unknown	0	broad.mit.edu	37	7	73140088	73140096	+	IGR	DEL	AAGCAAGCA	-	-	rs138736845		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:73140088_73140096delAAGCAAGCA								STX1A (6100 upstream) : WBSCR26 (9303 downstream)																																			---	---	---	---
RFC2	5982	broad.mit.edu	37	7	73165952	73165952	+	Intron	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:73165952delA	uc011kfa.1	-							NM_181471				replication factor C 2 isoform 1						cell cycle checkpoint|DNA strand elongation involved in DNA replication|nucleotide-excision repair, DNA gap filling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	DNA replication factor C complex|nucleoplasm	ATP binding|DNA clamp loader activity|protein binding			liver(1)|central_nervous_system(1)	2																		---	---	---	---
RFC2	5982	broad.mit.edu	37	7	73618597	73618598	+	Intron	INS	-	AGG	AGG			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:73618597_73618598insAGG	uc011kfa.1	-							NM_181471				replication factor C 2 isoform 1						cell cycle checkpoint|DNA strand elongation involved in DNA replication|nucleotide-excision repair, DNA gap filling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	DNA replication factor C complex|nucleoplasm	ATP binding|DNA clamp loader activity|protein binding			liver(1)|central_nervous_system(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	77610989	77610990	+	IGR	INS	-	A	A	rs149395692	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:77610989_77610990insA								PHTF2 (24171 upstream) : MAGI2 (35385 downstream)																																			---	---	---	---
MAGI2	9863	broad.mit.edu	37	7	77931883	77931883	+	Intron	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:77931883delT	uc003ugx.2	-						MAGI2_uc003ugy.2_Intron|MAGI2_uc010ldx.1_Intron|MAGI2_uc010ldy.1_Intron|MAGI2_uc011kgr.1_Intron|MAGI2_uc011kgs.1_Intron	NM_012301	NP_036433			membrane associated guanylate kinase, WW and PDZ							cell junction|synapse|synaptosome	phosphatase binding			ovary(5)|lung(4)|breast(1)|skin(1)	11		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)																---	---	---	---
CD36	948	broad.mit.edu	37	7	80001996	80001996	+	Intron	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:80001996delT	uc003uhc.2	+							NM_001127444	NP_001120916			CD36 antigen						cell adhesion|cGMP-mediated signaling|cholesterol transport|lipid metabolic process|lipid storage|lipoprotein transport|low-density lipoprotein particle clearance|nitric oxide mediated signal transduction|plasma membrane long-chain fatty acid transport|platelet activation|platelet degranulation|positive regulation of cell-matrix adhesion|positive regulation of macrophage derived foam cell differentiation	integral to plasma membrane|membrane fraction|platelet alpha granule membrane	lipid binding|low-density lipoprotein receptor activity|thrombospondin receptor activity|transforming growth factor beta binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	81116671	81116672	+	IGR	INS	-	G	G	rs147559578	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:81116671_81116672insG								SEMA3C (564996 upstream) : HGF (214773 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	83841849	83841849	+	IGR	DEL	C	-	-	rs5885404		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:83841849delC								SEMA3A (17632 upstream) : SEMA3D (783025 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	84526300	84526301	+	IGR	DEL	AC	-	-	rs1367365	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:84526300_84526301delAC								SEMA3A (702083 upstream) : SEMA3D (98573 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	84845673	84845674	+	IGR	INS	-	TG	TG	rs142967497	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:84845673_84845674insTG								SEMA3D (29502 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	85982718	85982718	+	IGR	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:85982718delT								None (None upstream) : GRM3 (290512 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	86251735	86251735	+	IGR	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:86251735delA								None (None upstream) : GRM3 (21495 downstream)																																			---	---	---	---
GRM3	2913	broad.mit.edu	37	7	86458762	86458762	+	Intron	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:86458762delT	uc003uid.2	+						GRM3_uc010lef.2_Intron|GRM3_uc010leg.2_Intron|GRM3_uc010leh.2_Intron	NM_000840	NP_000831			glutamate receptor, metabotropic 3 precursor						synaptic transmission	integral to plasma membrane				lung(4)|ovary(3)|central_nervous_system(2)|skin(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)	13	Esophageal squamous(14;0.0058)|all_lung(186;0.132)|Lung NSC(181;0.142)				Acamprosate(DB00659)|Nicotine(DB00184)													---	---	---	---
CDK14	5218	broad.mit.edu	37	7	90453574	90453574	+	Intron	DEL	T	-	-	rs35884222		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:90453574delT	uc003uky.2	+						CDK14_uc003ukz.1_Intron|CDK14_uc010les.1_Intron|CDK14_uc011khl.1_Intron	NM_012395	NP_036527			PFTAIRE protein kinase 1						cell division|G2/M transition of mitotic cell cycle|regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	cytoplasmic cyclin-dependent protein kinase holoenzyme complex|nucleus|plasma membrane	ATP binding|cyclin binding|cyclin-dependent protein kinase activity			lung(3)|ovary(1)	4																		---	---	---	---
CDK14	5218	broad.mit.edu	37	7	90778599	90778599	+	Intron	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:90778599delA	uc003uky.2	+						CDK14_uc003ukz.1_Intron|CDK14_uc010les.1_Intron|CDK14_uc011khl.1_Intron	NM_012395	NP_036527			PFTAIRE protein kinase 1						cell division|G2/M transition of mitotic cell cycle|regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	cytoplasmic cyclin-dependent protein kinase holoenzyme complex|nucleus|plasma membrane	ATP binding|cyclin binding|cyclin-dependent protein kinase activity			lung(3)|ovary(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	91205736	91205737	+	IGR	INS	-	GTTTGTTT	GTTTGTTT	rs146232269	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:91205736_91205737insGTTTGTTT								FZD1 (307605 upstream) : MTERF (225723 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	98043569	98043569	+	IGR	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:98043569delT								BAIAP2L1 (13142 upstream) : NPTX2 (203028 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	98151735	98151735	+	IGR	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:98151735delA								BAIAP2L1 (121308 upstream) : NPTX2 (94862 downstream)																																			---	---	---	---
MYH16	84176	broad.mit.edu	37	7	98879511	98879511	+	Intron	DEL	G	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:98879511delG	uc003upw.2	+							NR_002147				SubName: Full=cDNA: FLJ22037 fis, clone HEP08868; Flags: Fragment;												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	99487602	99487603	+	IGR	DEL	TG	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99487602_99487603delTG								OR2AE1 (12946 upstream) : TRIM4 (434 downstream)																																			---	---	---	---
GATS	352954	broad.mit.edu	37	7	99843428	99843428	+	Intron	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99843428delT	uc003uua.3	-						GATS_uc003uty.3_Intron|GATS_uc003utz.3_Intron|GATS_uc010lgt.2_Intron|GATS_uc010lgu.2_Intron	NM_178831	NP_849153			GATS, stromal antigen 3 opposite strand												0	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)																	---	---	---	---
ZCWPW1	55063	broad.mit.edu	37	7	100005386	100005386	+	Intron	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100005386delT	uc003uut.2	-						ZCWPW1_uc011kjq.1_Intron|ZCWPW1_uc003uur.2_Intron|ZCWPW1_uc003uus.2_Intron|ZCWPW1_uc011kjr.1_Intron|ZCWPW1_uc003uuu.1_Intron|ZCWPW1_uc011kjp.1_Intron	NM_017984	NP_060454			zinc finger, CW type with PWWP domain 1								zinc ion binding				0	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)																	---	---	---	---
Unknown	0	broad.mit.edu	37	7	100940418	100940420	+	IGR	DEL	AGA	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100940418_100940420delAGA								FIS1 (44825 upstream) : RABL5 (16229 downstream)																																			---	---	---	---
EMID2	136227	broad.mit.edu	37	7	101106989	101106990	+	Intron	DEL	TC	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:101106989_101106990delTC	uc010lhy.1	+						EMID2_uc003uyo.1_Intron	NM_133457	NP_597714			EMI domain containing 2							collagen				ovary(1)	1	Lung NSC(181;0.215)																	---	---	---	---
Unknown	0	broad.mit.edu	37	7	101235739	101235742	+	IGR	DEL	CATC	-	-	rs138355850		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:101235739_101235742delCATC								EMID2 (33435 upstream) : MYL10 (20864 downstream)																																			---	---	---	---
NAPEPLD	222236	broad.mit.edu	37	7	102781687	102781687	+	Intron	DEL	G	-	-	rs59381915		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:102781687delG	uc003vbc.2	-						NAPEPLD_uc003vbd.2_Intron|NAPEPLD_uc011klj.1_Intron|NAPEPLD_uc003vbe.2_Intron|NAPEPLD_uc003vbf.2_Intron	NM_198990	NP_945341			N-acyl phosphatidylethanolamine phospholipase D						phospholipid catabolic process	membrane	metal ion binding			skin(1)	1																		---	---	---	---
RELN	5649	broad.mit.edu	37	7	103485593	103485594	+	Intron	DEL	AT	-	-	rs149710228		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:103485593_103485594delAT	uc003vca.2	-						RELN_uc010liz.2_Intron	NM_005045	NP_005036			reelin isoform a						axon guidance|cell adhesion|cerebral cortex tangential migration|glial cell differentiation|neuron migration|peptidyl-tyrosine phosphorylation|positive regulation of protein kinase activity|positive regulation of small GTPase mediated signal transduction|response to pain|spinal cord patterning	cytoplasm|dendrite|extracellular space|proteinaceous extracellular matrix	metal ion binding|protein serine/threonine/tyrosine kinase activity|serine-type peptidase activity			ovary(8)|upper_aerodigestive_tract(5)|large_intestine(2)|central_nervous_system(2)|skin(1)|pancreas(1)	19				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)														---	---	---	---
LHFPL3	375612	broad.mit.edu	37	7	104376955	104376956	+	Intron	DEL	CA	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:104376955_104376956delCA	uc003vce.2	+						LHFPL3_uc003vcf.2_Intron	NM_199000	NP_945351			lipoma HMGIC fusion partner-like 3							integral to membrane					0																		---	---	---	---
PRKAR2B	5577	broad.mit.edu	37	7	106773164	106773165	+	Intron	INS	-	G	G			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:106773164_106773165insG	uc003vdx.2	+							NM_002736	NP_002727			cAMP-dependent protein kinase, regulatory						activation of phospholipase C activity|activation of protein kinase A activity|blood coagulation|cellular response to glucagon stimulus|energy reserve metabolic process|G2/M transition of mitotic cell cycle|intracellular signal transduction|nerve growth factor receptor signaling pathway|regulation of insulin secretion|transmembrane transport|water transport	centrosome|cytosol|plasma membrane	cAMP binding|cAMP-dependent protein kinase regulator activity			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	107659346	107659346	+	IGR	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:107659346delA								LAMB1 (15542 upstream) : LAMB4 (4650 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	108970674	108970675	+	IGR	DEL	CA	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:108970674_108970675delCA								C7orf66 (446037 upstream) : EIF3IP1 (628609 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	109192933	109192934	+	IGR	INS	-	AC	AC	rs139632456	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:109192933_109192934insAC								C7orf66 (668296 upstream) : EIF3IP1 (406350 downstream)																																			---	---	---	---
IMMP2L	83943	broad.mit.edu	37	7	111098437	111098438	+	Intron	INS	-	A	A	rs111432225		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:111098437_111098438insA	uc003vfq.1	-						IMMP2L_uc010ljr.1_Intron|IMMP2L_uc003vfr.2_Intron	NM_032549	NP_115938			IMP2 inner mitochondrial membrane protease-like						protein processing involved in protein targeting to mitochondrion|proteolysis	integral to membrane|mitochondrial inner membrane peptidase complex|nucleus	serine-type peptidase activity				0				UCEC - Uterine corpus endometrioid carcinoma (4;0.053)|Epithelial(3;2.27e-07)|all cancers(3;1.36e-05)|STAD - Stomach adenocarcinoma(3;0.00148)|KIRC - Kidney renal clear cell carcinoma(11;0.0339)|Lung(3;0.0375)|Kidney(11;0.0415)|LUSC - Lung squamous cell carcinoma(290;0.173)														---	---	---	---
DOCK4	9732	broad.mit.edu	37	7	111769553	111769554	+	Intron	DEL	AC	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:111769553_111769554delAC	uc003vfx.2	-						DOCK4_uc003vfy.2_Intron|DOCK4_uc003vga.1_Intron|DOCK4_uc010ljt.1_Intron	NM_014705	NP_055520			dedicator of cytokinesis 4						cell chemotaxis	cytosol|endomembrane system|membrane|stereocilium	GTP binding|guanyl-nucleotide exchange factor activity|PDZ domain binding|Rac GTPase activator activity|Rac GTPase binding|receptor tyrosine kinase binding|SH3 domain binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)	4		Acute lymphoblastic leukemia(1;0.0441)																---	---	---	---
Unknown	0	broad.mit.edu	37	7	114355075	114355076	+	IGR	INS	-	T	T	rs149906209	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:114355075_114355076insT								FOXP2 (23983 upstream) : MDFIC (207133 downstream)																																			---	---	---	---
C7orf58	79974	broad.mit.edu	37	7	120789335	120789335	+	Intron	DEL	C	-	-	rs10712111		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:120789335delC	uc003vjq.3	+						C7orf58_uc003vjs.3_Intron|C7orf58_uc003vjt.3_Intron	NM_024913	NP_079189			hypothetical protein LOC79974 isoform 1							endoplasmic reticulum				ovary(4)|large_intestine(2)|skin(2)|pancreas(1)	9	all_neural(327;0.117)																	---	---	---	---
CADPS2	93664	broad.mit.edu	37	7	122033120	122033120	+	Intron	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:122033120delA	uc010lkp.2	-						CADPS2_uc011knx.1_Intron|CADPS2_uc003vkg.3_Intron|CADPS2_uc010lkq.2_Intron	NM_017954	NP_060424			Ca2+-dependent activator protein for secretion 2						exocytosis|protein transport	cell junction|cytoplasmic vesicle membrane|synapse	lipid binding|metal ion binding			ovary(1)|central_nervous_system(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	125464356	125464357	+	IGR	DEL	CA	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:125464356_125464357delCA								POT1 (894319 upstream) : GRM8 (614295 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	125856243	125856246	+	IGR	DEL	ACAC	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:125856243_125856246delACAC								None (None upstream) : GRM8 (222406 downstream)																																			---	---	---	---
GRM8	2918	broad.mit.edu	37	7	126560098	126560098	+	Intron	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:126560098delA	uc003vlr.2	-						GRM8_uc003vls.2_Intron|GRM8_uc011kof.1_Intron|GRM8_uc003vlt.2_Intron|GRM8_uc010lkz.1_Intron|GRM8_uc003vlu.1_Intron	NM_000845	NP_000836			glutamate receptor, metabotropic 8 isoform a						negative regulation of cAMP biosynthetic process|sensory perception of smell|visual perception	integral to plasma membrane				lung(15)|ovary(5)|pancreas(1)|breast(1)|skin(1)	23		Prostate(267;0.186)			L-Glutamic Acid(DB00142)										HNSCC(24;0.065)			---	---	---	---
TNPO3	23534	broad.mit.edu	37	7	128607794	128607795	+	Intron	DEL	AC	-	-	rs35430377		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128607794_128607795delAC	uc003vol.1	-						TNPO3_uc010llx.1_Intron|TNPO3_uc003vom.1_Intron|TNPO3_uc010lly.1_Intron|TNPO3_uc010llz.1_Intron	NM_012470	NP_036602			transportin 3						splicing factor protein import into nucleus	cytoplasm|nucleus	protein binding|receptor activity			ovary(2)|skin(2)|lung(1)	5																		---	---	---	---
TSGA14	95681	broad.mit.edu	37	7	130055281	130055281	+	Intron	DEL	G	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:130055281delG	uc003vpz.2	-						TSGA14_uc010lmf.2_Intron|TSGA14_uc003vqa.2_Intron|TSGA14_uc011kpg.1_Intron	NM_018718	NP_061188			testis specific, 14						G2/M transition of mitotic cell cycle	centrosome|cytosol					0	Melanoma(18;0.0435)																	---	---	---	---
MKLN1	4289	broad.mit.edu	37	7	130859790	130859797	+	Intron	DEL	GATGGATG	-	-	rs66786066		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:130859790_130859797delGATGGATG	uc011kpl.1	+							NM_001145354	NP_001138826			muskelin 1, intracellular mediator containing						signal transduction	cytoplasm	protein binding			breast(1)	1	Melanoma(18;0.162)																	---	---	---	---
PLXNA4	91584	broad.mit.edu	37	7	132248878	132248883	+	Intron	DEL	TCTTCT	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:132248878_132248883delTCTTCT	uc003vra.3	-						PLXNA4_uc003vrc.2_Intron|PLXNA4_uc003vrb.2_Intron	NM_020911	NP_065962			plexin A4 isoform 1							integral to membrane|intracellular|plasma membrane				ovary(1)	1																		---	---	---	---
CHCHD3	54927	broad.mit.edu	37	7	132606868	132606869	+	Intron	INS	-	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:132606868_132606869insA	uc003vre.2	-						CHCHD3_uc010lmi.2_Intron|CHCHD3_uc003vrf.2_Intron|CHCHD3_uc010lmj.2_Intron	NM_017812	NP_060282			coiled-coil-helix-coiled-coil-helix domain						inner mitochondrial membrane organization|mitochondrial fusion	mitochondrial inner membrane	protein complex scaffold				0																		---	---	---	---
CHCHD3	54927	broad.mit.edu	37	7	132743000	132743000	+	Intron	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:132743000delT	uc003vre.2	-						CHCHD3_uc010lmi.2_Intron|CHCHD3_uc003vrf.2_Intron|CHCHD3_uc010lmj.2_Intron|CHCHD3_uc011kpn.1_Intron	NM_017812	NP_060282			coiled-coil-helix-coiled-coil-helix domain						inner mitochondrial membrane organization|mitochondrial fusion	mitochondrial inner membrane	protein complex scaffold				0																		---	---	---	---
CALD1	800	broad.mit.edu	37	7	134550389	134550389	+	Intron	DEL	G	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:134550389delG	uc003vrz.2	+						CALD1_uc003vry.2_Intron|CALD1_uc003vsa.2_Intron|CALD1_uc003vsb.2_Intron|CALD1_uc010lmm.2_Intron|CALD1_uc011kpt.1_Intron	NM_033138	NP_149129			caldesmon 1 isoform 1						cellular component movement|muscle contraction	cytosol|focal adhesion|myofibril	actin binding|calmodulin binding|myosin binding|tropomyosin binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	135473730	135473735	+	IGR	DEL	TGTGTA	-	-	rs66491975		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:135473730_135473735delTGTGTA								FAM180A (40136 upstream) : LUZP6 (137770 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	135577821	135577822	+	IGR	DEL	TT	-	-	rs141629539		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:135577821_135577822delTT								FAM180A (144227 upstream) : LUZP6 (33683 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	135772846	135772847	+	IGR	DEL	TG	-	-	rs71989068		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:135772846_135772847delTG								LUZP6 (110642 upstream) : CHRM2 (780552 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	136115345	136115346	+	IGR	DEL	AT	-	-	rs59635281	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:136115345_136115346delAT								LUZP6 (453141 upstream) : CHRM2 (438053 downstream)																																			---	---	---	---
CHRM2	1129	broad.mit.edu	37	7	136685478	136685478	+	Intron	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:136685478delT	uc003vtf.1	+						CHRM2_uc003vtg.1_Intron|CHRM2_uc003vtj.1_Intron|CHRM2_uc003vtk.1_Intron|CHRM2_uc003vtl.1_Intron|CHRM2_uc003vtm.1_Intron|CHRM2_uc003vti.1_Intron|CHRM2_uc003vto.1_Intron|CHRM2_uc003vtn.1_Intron|uc003vtp.1_Intron	NM_001006630	NP_001006631			cholinergic receptor, muscarinic 2						activation of phospholipase C activity by muscarinic acetylcholine receptor signaling pathway|G-protein signaling, coupled to cAMP nucleotide second messenger|nervous system development|regulation of heart contraction|response to virus	cell junction|integral to plasma membrane|postsynaptic membrane	muscarinic acetylcholine receptor activity|protein binding			ovary(4)|central_nervous_system(1)	5					Anisotropine Methylbromide(DB00517)|Atropine(DB00572)|Benzquinamide(DB00767)|Carbachol(DB00411)|Cryptenamine(DB00785)|Cyclizine(DB01176)|Desipramine(DB01151)|Diphenidol(DB01231)|Doxacurium(DB01334)|Doxacurium chloride(DB01135)|Flavoxate(DB01148)|Gallamine Triethiodide(DB00483)|Homatropine Methylbromide(DB00725)|Hyoscyamine(DB00424)|Ipratropium(DB00332)|Methotrimeprazine(DB01403)|Metixene(DB00340)|Metocurine(DB01336)|Mivacurium(DB01226)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Pilocarpine(DB01085)|Procyclidine(DB00387)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Rocuronium(DB00728)|Thiethylperazine(DB00372)|Tolterodine(DB01036)|Tridihexethyl(DB00505)|Triflupromazine(DB00508)													---	---	---	---
PTN	5764	broad.mit.edu	37	7	136972200	136972200	+	Intron	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:136972200delT	uc003vtq.2	-						PTN_uc010lmx.2_Intron|PTN_uc003vtr.1_Intron	NM_002825	NP_002816			pleiotrophin						nervous system development|positive regulation of cell division|positive regulation of cell proliferation|transmembrane receptor protein tyrosine phosphatase signaling pathway	endoplasmic reticulum|extracellular space	growth factor activity|heparin binding|protein phosphatase inhibitor activity			upper_aerodigestive_tract(1)|pancreas(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	142936719	142936720	+	IGR	DEL	TG	-	-	rs66675620		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142936719_142936720delTG								TAS2R40 (16577 upstream) : GSTK1 (23802 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	144990241	144990241	+	IGR	DEL	G	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:144990241delG								TPK1 (457095 upstream) : CNTNAP2 (823212 downstream)																																			---	---	---	---
CNTNAP2	26047	broad.mit.edu	37	7	146368521	146368522	+	Intron	INS	-	CACACACACACA	CACACACACACA	rs147594471	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:146368521_146368522insCACACACACACA	uc003weu.1	+							NM_014141	NP_054860			cell recognition molecule Caspr2 precursor						behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding			ovary(9)|central_nervous_system(1)|pancreas(1)	11	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)												HNSCC(39;0.1)			---	---	---	---
Unknown	0	broad.mit.edu	37	7	148176044	148176045	+	IGR	DEL	GT	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:148176044_148176045delGT								CNTNAP2 (57958 upstream) : C7orf33 (111612 downstream)																																			---	---	---	---
EZH2	2146	broad.mit.edu	37	7	148570960	148570961	+	Intron	INS	-	C	C	rs34003774	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:148570960_148570961insC	uc003wfd.1	-						EZH2_uc011kug.1_Intron|EZH2_uc003wfb.1_Intron|EZH2_uc003wfc.1_Intron|EZH2_uc011kuh.1_Intron|EZH2_uc011kui.1_Intron|EZH2_uc011kuj.1_Intron	NM_004456	NP_004447			enhancer of zeste 2 isoform a						negative regulation of retinoic acid receptor signaling pathway|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	ESC/E(Z) complex	DNA binding|histone-lysine N-methyltransferase activity|protein binding			haematopoietic_and_lymphoid_tissue(180)|skin(2)|large_intestine(1)	183	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00239)					Mis		DLBCL								---	---	---	---
Unknown	0	broad.mit.edu	37	7	149076118	149076119	+	IGR	DEL	CA	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:149076118_149076119delCA								ZNF212 (123437 upstream) : ZNF777 (52342 downstream)																																			---	---	---	---
MLL3	58508	broad.mit.edu	37	7	152099382	152099383	+	Intron	INS	-	AATCATA	AATCATA	rs138524798		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:152099382_152099383insAATCATA	uc003wla.2	-							NM_170606	NP_733751			myeloid/lymphoid or mixed-lineage leukemia 3						intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)				N		medulloblastoma								---	---	---	---
DPP6	1804	broad.mit.edu	37	7	153589403	153589404	+	Intron	INS	-	T	T	rs5888534		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:153589403_153589404insT	uc003wli.2	+							NM_001039350	NP_001034439			dipeptidyl-peptidase 6 isoform 3						cell death|proteolysis	integral to membrane	dipeptidyl-peptidase activity|serine-type peptidase activity			pancreas(3)|breast(1)	4	all_neural(206;0.181)	all_hematologic(28;0.0044)|all_lung(21;0.0176)|Lung NSC(21;0.0204)	OV - Ovarian serous cystadenocarcinoma(82;0.0562)															---	---	---	---
DPP6	1804	broad.mit.edu	37	7	154402416	154402423	+	Intron	DEL	TCTGTGTG	-	-	rs937004	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:154402416_154402423delTCTGTGTG	uc003wlk.2	+						DPP6_uc003wli.2_Intron|DPP6_uc003wlm.2_Intron|DPP6_uc011kvq.1_Intron	NM_130797	NP_570629			dipeptidyl-peptidase 6 isoform 1						cell death|proteolysis	integral to membrane	dipeptidyl-peptidase activity|serine-type peptidase activity			pancreas(3)|breast(1)	4	all_neural(206;0.181)	all_hematologic(28;0.0044)|all_lung(21;0.0176)|Lung NSC(21;0.0204)	OV - Ovarian serous cystadenocarcinoma(82;0.0562)															---	---	---	---
Unknown	0	broad.mit.edu	37	7	155584767	155584768	+	IGR	INS	-	T	T	rs147360748		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:155584767_155584768insT								RBM33 (10588 upstream) : SHH (7968 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	155700753	155700760	+	IGR	DEL	AGTGTTTT	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:155700753_155700760delAGTGTTTT								SHH (95786 upstream) : C7orf4 (632425 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	155739522	155739525	+	IGR	DEL	TTCC	-	-	rs5888641		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:155739522_155739525delTTCC								SHH (134555 upstream) : C7orf4 (593660 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	155862069	155862072	+	IGR	DEL	CCTC	-	-	rs67810242		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:155862069_155862072delCCTC								SHH (257102 upstream) : C7orf4 (471113 downstream)																																			---	---	---	---
LMBR1	64327	broad.mit.edu	37	7	156675999	156676001	+	Intron	DEL	AGG	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:156675999_156676001delAGG	uc003wmw.3	-						LMBR1_uc003wmx.3_Intron|LMBR1_uc010lqn.2_Intron|LMBR1_uc011kvx.1_Intron|LMBR1_uc010lqo.2_Intron	NM_022458	NP_071903			limb region 1 protein							integral to membrane	receptor activity				0	Ovarian(565;0.218)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.00231)	UCEC - Uterine corpus endometrioid carcinoma (81;0.208)														---	---	---	---
UBE3C	9690	broad.mit.edu	37	7	156979109	156979110	+	Intron	INS	-	A	A	rs35161630		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:156979109_156979110insA	uc010lqs.2	+						UBE3C_uc003wnf.2_Intron|UBE3C_uc003wng.2_Intron	NM_014671	NP_055486			ubiquitin protein ligase E3C						protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus|proteasome complex	protein binding|ubiquitin-protein ligase activity			ovary(2)|lung(2)|large_intestine(1)	5		all_hematologic(28;0.0185)|all_epithelial(9;0.0664)	OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.19)														---	---	---	---
PTPRN2	5799	broad.mit.edu	37	7	157768448	157768448	+	Intron	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:157768448delT	uc003wno.2	-						PTPRN2_uc003wnp.2_Intron|PTPRN2_uc003wnq.2_Intron|PTPRN2_uc003wnr.2_Intron|PTPRN2_uc011kwa.1_Intron	NM_002847	NP_002838			protein tyrosine phosphatase, receptor type, N							integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(4)|large_intestine(1)|pleura(1)|skin(1)	7	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)														---	---	---	---
Unknown	0	broad.mit.edu	37	7	158791139	158791139	+	IGR	DEL	C	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:158791139delC								WDR60 (52257 upstream) : LOC154822 (9906 downstream)																																			---	---	---	---
C8orf42	157695	broad.mit.edu	37	8	479575	479576	+	Intron	INS	-	T	T	rs144832607	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:479575_479576insT	uc003wpd.2	-						C8orf42_uc011kwg.1_Intron	NM_175075	NP_778250			hypothetical protein LOC157695												0		Ovarian(12;0.0481)|Colorectal(14;0.0815)|Hepatocellular(245;0.0968)|Myeloproliferative disorder(644;0.116)|all_neural(12;0.122)		Epithelial(5;5.16e-14)|OV - Ovarian serous cystadenocarcinoma(5;7.35e-07)|BRCA - Breast invasive adenocarcinoma(11;4.17e-06)|COAD - Colon adenocarcinoma(149;0.0255)														---	---	---	---
CSMD1	64478	broad.mit.edu	37	8	2997871	2997872	+	Intron	INS	-	TC	TC	rs145618802	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:2997871_2997872insTC	uc011kwk.1	-						CSMD1_uc011kwj.1_Intron|CSMD1_uc010lrg.2_Intron	NM_033225	NP_150094			CUB and Sushi multiple domains 1 precursor							integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	5664120	5664120	+	IGR	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:5664120delT								CSMD1 (811792 upstream) : MCPH1 (600001 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	9210468	9210471	+	IGR	DEL	TGTG	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:9210468_9210471delTGTG								PPP1R3B (201384 upstream) : TNKS (202974 downstream)																																			---	---	---	---
FAM167A	83648	broad.mit.edu	37	8	11279883	11279886	+	3'UTR	DEL	GTGT	-	-	rs58169131		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11279883_11279886delGTGT	uc010lry.1	-	3					C8orf12_uc003wtu.2_Intron|C8orf12_uc003wtv.2_Intron|FAM167A_uc003wtw.2_3'UTR	NM_053279	NP_444509			hypothetical protein LOC83648												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	8	11868669	11868669	+	5'Flank	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11868669delT	uc003wuy.1	+											Homo sapiens cDNA FLJ33940 fis, clone CTONG2018069.																														---	---	---	---
Unknown	0	broad.mit.edu	37	8	23750459	23750459	+	IGR	DEL	T	-	-	rs35565340		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:23750459delT								STC1 (38139 upstream) : ADAM28 (401121 downstream)																																			---	---	---	---
ADAM28	10863	broad.mit.edu	37	8	24187383	24187386	+	Intron	DEL	TGTG	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:24187383_24187386delTGTG	uc003xdy.2	+						ADAM28_uc003xdx.2_Intron|ADAM28_uc011kzz.1_Intron|ADAM28_uc011laa.1_Intron|ADAM28_uc010lua.2_Intron	NM_014265	NP_055080			ADAM metallopeptidase domain 28 isoform 1						proteolysis|spermatogenesis	extracellular region|integral to membrane|plasma membrane	metalloendopeptidase activity|zinc ion binding			skin(3)|lung(1)|central_nervous_system(1)	5		Prostate(55;0.0959)		Colorectal(74;0.0129)|COAD - Colon adenocarcinoma(73;0.0434)|BRCA - Breast invasive adenocarcinoma(99;0.175)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	31067777	31067778	+	IGR	INS	-	GA	GA	rs142540775	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:31067777_31067778insGA								WRN (36501 upstream) : NRG1 (429490 downstream)																																			---	---	---	---
NRG1	3084	broad.mit.edu	37	8	31665465	31665466	+	Intron	DEL	GT	-	-	rs111367095		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:31665465_31665466delGT	uc003xip.2	+							NM_013962	NP_039256			neuregulin 1 isoform GGF2						activation of transmembrane receptor protein tyrosine kinase activity|anti-apoptosis|cardiac muscle cell differentiation|cell communication|cell proliferation|cellular protein complex disassembly|embryo development|mammary gland development|negative regulation of cardiac muscle cell apoptosis|negative regulation of secretion|negative regulation of transcription, DNA-dependent|nervous system development|neural crest cell development|Notch signaling pathway|positive regulation of cardiac muscle cell proliferation|positive regulation of cell adhesion|positive regulation of cell growth|positive regulation of striated muscle cell differentiation|regulation of protein heterodimerization activity|regulation of protein homodimerization activity|transmembrane receptor protein tyrosine kinase signaling pathway|ventricular cardiac muscle cell differentiation|wound healing|wound healing	apical plasma membrane|extracellular region|extracellular space|integral to membrane|nucleus|plasma membrane	cytokine activity|ErbB-3 class receptor binding|growth factor activity|growth factor activity|protein binding|protein tyrosine kinase activator activity|receptor tyrosine kinase binding|transcription cofactor activity|transmembrane receptor protein tyrosine kinase activator activity				0		Breast(100;0.203)		KIRC - Kidney renal clear cell carcinoma(67;0.0768)|Kidney(114;0.0943)														---	---	---	---
NRG1	3084	broad.mit.edu	37	8	32072178	32072179	+	Intron	DEL	AG	-	-	rs138994423		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:32072178_32072179delAG	uc003xip.2	+							NM_013962	NP_039256			neuregulin 1 isoform GGF2						activation of transmembrane receptor protein tyrosine kinase activity|anti-apoptosis|cardiac muscle cell differentiation|cell communication|cell proliferation|cellular protein complex disassembly|embryo development|mammary gland development|negative regulation of cardiac muscle cell apoptosis|negative regulation of secretion|negative regulation of transcription, DNA-dependent|nervous system development|neural crest cell development|Notch signaling pathway|positive regulation of cardiac muscle cell proliferation|positive regulation of cell adhesion|positive regulation of cell growth|positive regulation of striated muscle cell differentiation|regulation of protein heterodimerization activity|regulation of protein homodimerization activity|transmembrane receptor protein tyrosine kinase signaling pathway|ventricular cardiac muscle cell differentiation|wound healing|wound healing	apical plasma membrane|extracellular region|extracellular space|integral to membrane|nucleus|plasma membrane	cytokine activity|ErbB-3 class receptor binding|growth factor activity|growth factor activity|protein binding|protein tyrosine kinase activator activity|receptor tyrosine kinase binding|transcription cofactor activity|transmembrane receptor protein tyrosine kinase activator activity				0		Breast(100;0.203)		KIRC - Kidney renal clear cell carcinoma(67;0.0768)|Kidney(114;0.0943)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	34411282	34411283	+	IGR	INS	-	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:34411282_34411283insA								DUSP26 (953843 upstream) : UNC5D (681692 downstream)																																			---	---	---	---
FGFR1	2260	broad.mit.edu	37	8	38291848	38291848	+	Intron	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38291848delT	uc003xlp.2	-						FGFR1_uc011lbo.1_Intron|FGFR1_uc011lbp.1_Intron|FGFR1_uc011lbq.1_Intron|FGFR1_uc010lwk.2_Intron|FGFR1_uc011lbs.1_Intron|FGFR1_uc011lbt.1_Intron|FGFR1_uc011lbu.1_Intron|FGFR1_uc011lbv.1_Intron|FGFR1_uc011lbw.1_Intron|FGFR1_uc011lbx.1_Intron|FGFR1_uc003xlv.2_Intron|FGFR1_uc003xlu.2_Intron|FGFR1_uc003xlw.1_Intron	NM_023110	NP_075598			fibroblast growth factor receptor 1 isoform 1						axon guidance|cell growth|insulin receptor signaling pathway|MAPKKK cascade|positive regulation of cell proliferation|skeletal system development	extracellular region|integral to plasma membrane|membrane fraction	ATP binding|fibroblast growth factor receptor activity|heparin binding|protein homodimerization activity			lung(5)|central_nervous_system(5)|stomach(2)|breast(2)|ovary(1)	15	all_cancers(2;9.05e-47)|all_epithelial(2;2.64e-50)|all_lung(3;1.71e-23)|Lung NSC(2;3.61e-23)|Colorectal(12;0.000442)	Breast(189;1.48e-05)|all_lung(54;0.00354)|Lung NSC(58;0.0138)|Hepatocellular(245;0.065)	Epithelial(3;3.96e-34)|all cancers(3;3.06e-30)|BRCA - Breast invasive adenocarcinoma(5;2.28e-21)|COAD - Colon adenocarcinoma(9;0.24)		Palifermin(DB00039)		1	T	BCR|FOP|ZNF198|CEP1	MPD|NHL		Pfeiffer syndrome|Kallman syndrome						---	---	---	---
Unknown	0	broad.mit.edu	37	8	42668247	42668248	+	IGR	INS	-	A	A	rs146812723	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:42668247_42668248insA								CHRNA6 (44628 upstream) : THAP1 (23570 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	49713388	49713388	+	IGR	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:49713388delA								EFCAB1 (65518 upstream) : SNAI2 (116851 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	57614045	57614045	+	IGR	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:57614045delA								PENK (254763 upstream) : IMPAD1 (256446 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	60684962	60684963	+	IGR	DEL	GT	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:60684962_60684963delGT								TOX (653195 upstream) : CA8 (416460 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	61932209	61932209	+	IGR	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:61932209delT								CHD7 (152746 upstream) : CLVS1 (268316 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	67337646	67337649	+	IGR	DEL	GGAT	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:67337646_67337649delGGAT								CRH (246948 upstream) : RRS1 (3614 downstream)																																			---	---	---	---
PREX2	80243	broad.mit.edu	37	8	68937822	68937822	+	Intron	DEL	T	-	-	rs66813805		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:68937822delT	uc003xxv.1	+						PREX2_uc003xxu.1_Intron|PREX2_uc011lez.1_Intron	NM_024870	NP_079146			DEP domain containing 2 isoform a						G-protein coupled receptor protein signaling pathway|intracellular signal transduction	intracellular	protein binding|Rac GTPase activator activity|Rac guanyl-nucleotide exchange factor activity			skin(6)|large_intestine(4)|pancreas(3)|lung(2)|ovary(1)|kidney(1)	17																		---	---	---	---
C8orf34	116328	broad.mit.edu	37	8	69288846	69288846	+	Intron	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:69288846delT	uc010lyz.2	+						C8orf34_uc010lyx.1_Intron|C8orf34_uc010lyy.1_Intron	NM_052958	NP_443190			hypothetical protein LOC116328						signal transduction		cAMP-dependent protein kinase regulator activity			large_intestine(1)	1			Epithelial(68;0.0117)|OV - Ovarian serous cystadenocarcinoma(28;0.0227)|all cancers(69;0.0502)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	72109417	72109417	+	IGR	DEL	G	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:72109417delG								XKR9 (461241 upstream) : EYA1 (253 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	75292419	75292421	+	IGR	DEL	AAG	-	-	rs75294319		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:75292419_75292421delAAG								GDAP1 (13086 upstream) : MIR2052 (325507 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	75687248	75687248	+	IGR	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:75687248delA								MIR2052 (69266 upstream) : PI15 (49524 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	82679827	82679827	+	IGR	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:82679827delT								CHMP4C (8081 upstream) : SNX16 (31993 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	83846948	83846948	+	IGR	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:83846948delA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	84526647	84526648	+	IGR	DEL	TC	-	-	rs144135500	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:84526647_84526648delTC								None (None upstream) : RALYL (568805 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	87859757	87859760	+	IGR	DEL	AGAA	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:87859757_87859760delAGAA								CNGB3 (103856 upstream) : CNBD1 (18916 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	94762901	94762902	+	IGR	DEL	GA	-	-	rs113449839		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:94762901_94762902delGA								RBM12B (9677 upstream) : TMEM67 (4170 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	98459676	98459676	+	IGR	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:98459676delT								TSPYL5 (169500 upstream) : MTDH (196731 downstream)																																			---	---	---	---
LAPTM4B	55353	broad.mit.edu	37	8	98828551	98828551	+	Intron	DEL	C	-	-	rs2331658	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:98828551delC	uc003yia.2	+						LAPTM4B_uc010mbg.2_Intron	NM_018407	NP_060877			lysosomal associated transmembrane protein 4						transport	endomembrane system|integral to membrane	protein binding			skin(1)	1	Breast(36;1.59e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.149)															---	---	---	---
RGS22	26166	broad.mit.edu	37	8	101083100	101083101	+	Intron	INS	-	A	A	rs112307199		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:101083100_101083101insA	uc003yjb.1	-						RGS22_uc003yja.1_Intron|RGS22_uc003yjc.1_Intron|RGS22_uc011lgz.1_Intron|RGS22_uc010mbo.1_Intron	NM_015668	NP_056483			regulator of G-protein signaling 22						negative regulation of signal transduction	cytoplasm|plasma membrane	GTPase activator activity|signal transducer activity			ovary(3)|skin(2)|breast(1)|central_nervous_system(1)	7			Epithelial(11;6.71e-08)|all cancers(13;4.19e-06)|OV - Ovarian serous cystadenocarcinoma(57;0.000469)|STAD - Stomach adenocarcinoma(118;0.169)															---	---	---	---
RRM2B	50484	broad.mit.edu	37	8	103240047	103240048	+	Intron	DEL	AG	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:103240047_103240048delAG	uc003ykn.2	-						RRM2B_uc003yko.2_Intron|RRM2B_uc010mbv.1_Intron|RRM2B_uc010mbw.1_Intron|RRM2B_uc010mbx.1_Intron|RRM2B_uc010mby.1_Intron	NM_015713	NP_056528			ribonucleotide reductase M2 B (TP53 inducible)						deoxyribonucleoside diphosphate metabolic process|DNA repair|nucleobase, nucleoside and nucleotide interconversion	nucleoplasm	ribonucleoside-diphosphate reductase activity|transition metal ion binding			ovary(2)	2	all_cancers(14;8e-07)|all_epithelial(15;2.18e-08)|Lung NSC(17;2.55e-05)|all_lung(17;8.85e-05)		OV - Ovarian serous cystadenocarcinoma(57;0.000728)										Direct_reversal_of_damage|Modulation_of_nucleotide_pools					---	---	---	---
ZFPM2	23414	broad.mit.edu	37	8	106526232	106526232	+	Intron	DEL	T	-	-	rs111594419		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:106526232delT	uc003ymd.2	+							NM_012082	NP_036214			zinc finger protein, multitype 2						blood coagulation|negative regulation of fat cell differentiation|outflow tract septum morphogenesis|right ventricular cardiac muscle tissue morphogenesis|ventricular septum morphogenesis	nucleoplasm	DNA binding|RNA polymerase II transcription coactivator activity|transcription corepressor activity|transcription factor binding|zinc ion binding			ovary(4)|large_intestine(1)	5			OV - Ovarian serous cystadenocarcinoma(57;8.28e-08)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	108204385	108204386	+	IGR	DEL	GT	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:108204385_108204386delGT								ABRA (421913 upstream) : ANGPT1 (57325 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	109150388	109150389	+	IGR	INS	-	T	T	rs147144655	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:109150388_109150389insT								RSPO2 (54475 upstream) : EIF3E (63584 downstream)																																			---	---	---	---
CSMD3	114788	broad.mit.edu	37	8	114235990	114235991	+	Intron	DEL	TA	-	-	rs5894132		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:114235990_114235991delTA	uc003ynu.2	-						CSMD3_uc003ynt.2_Intron|CSMD3_uc011lhx.1_Intron|CSMD3_uc010mcx.1_Intron	NM_198123	NP_937756			CUB and Sushi multiple domains 3 isoform 1							integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63															HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			---	---	---	---
Unknown	0	broad.mit.edu	37	8	114831581	114831581	+	IGR	DEL	G	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:114831581delG								CSMD3 (382339 upstream) : None (None downstream)																																			---	---	---	---
EXT1	2131	broad.mit.edu	37	8	118973356	118973357	+	Intron	INS	-	TTCCCTCC	TTCCCTCC	rs141052832	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:118973356_118973357insTTCCCTCC	uc003yok.1	-							NM_000127	NP_000118			exostosin 1						glycosaminoglycan biosynthetic process|heparan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process|ossification|signal transduction|skeletal system development	Golgi membrane|integral to endoplasmic reticulum membrane	glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity|heparan sulfate N-acetylglucosaminyltransferase activity|N-acetylglucosaminyl-proteoglycan 4-beta-glucuronosyltransferase activity|protein heterodimerization activity|protein homodimerization activity			ovary(2)|lung(2)	4	all_cancers(13;2.36e-26)|Lung NSC(37;5.02e-07)|Ovarian(258;0.0173)		STAD - Stomach adenocarcinoma(47;0.012)					Mis|N|F|S			exostoses|osteosarcoma			Hereditary_Multiple_Exostoses|Langer-Giedion_syndrome				---	---	---	---
SAMD12	401474	broad.mit.edu	37	8	119244135	119244135	+	Intron	DEL	A	-	-	rs112689134		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:119244135delA	uc010mda.1	-						SAMD12_uc010mdb.1_Intron	NM_001101676	NP_001095146			sterile alpha motif domain containing 12 isoform											ovary(1)	1	all_cancers(13;3.91e-25)|Lung NSC(37;1.13e-07)|Ovarian(258;0.0249)		STAD - Stomach adenocarcinoma(47;0.00391)															---	---	---	---
DEPDC6	64798	broad.mit.edu	37	8	120990371	120990371	+	Intron	DEL	G	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:120990371delG	uc003yow.3	+						DEPDC6_uc011lid.1_Intron	NM_022783	NP_073620			DEP domain containing 6						intracellular signal transduction|negative regulation of cell size|negative regulation of protein kinase activity|negative regulation of TOR signaling cascade|regulation of apoptosis	intracellular	protein binding				0	Lung NSC(37;9.35e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00185)															---	---	---	---
DEPDC6	64798	broad.mit.edu	37	8	121041311	121041312	+	Intron	INS	-	A	A	rs34423520		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:121041311_121041312insA	uc003yow.3	+						DEPDC6_uc011lid.1_Intron	NM_022783	NP_073620			DEP domain containing 6						intracellular signal transduction|negative regulation of cell size|negative regulation of protein kinase activity|negative regulation of TOR signaling cascade|regulation of apoptosis	intracellular	protein binding				0	Lung NSC(37;9.35e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00185)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	122697209	122697209	+	IGR	DEL	T	-	-	rs34704011		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:122697209delT								HAS2AS (40276 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	123049090	123049090	+	Intron	DEL	T	-	-	rs79465189		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:123049090delT	uc003ypj.2	-											Homo sapiens, clone IMAGE:5466006, mRNA.																														---	---	---	---
Unknown	0	broad.mit.edu	37	8	123540244	123540244	+	IGR	DEL	A	-	-	rs77721660		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:123540244delA								HAS2AS (883311 upstream) : ZHX2 (253657 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	127454105	127454105	+	IGR	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:127454105delT								None (None upstream) : FAM84B (110582 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	127898958	127898958	+	IGR	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:127898958delT								FAM84B (328492 upstream) : LOC727677 (403104 downstream)																																			---	---	---	---
PVT1	5820	broad.mit.edu	37	8	128923158	128923159	+	Intron	INS	-	GA	GA	rs150373603	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:128923158_128923159insGA	uc010mdq.2	+						PVT1_uc003ysl.2_Intron|PVT1_uc010mdp.1_Intron	NR_003367				Homo sapiens Pvt1 oncogene (non-protein coding), mRNA (cDNA clone IMAGE:5517530), with apparent retained intron.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	8	129653359	129653360	+	IGR	DEL	AC	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:129653359_129653360delAC								MIR1208 (490925 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	130483354	130483355	+	IGR	DEL	AG	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:130483354_130483355delAG								None (None upstream) : GSDMC (277088 downstream)																																			---	---	---	---
ADCY8	114	broad.mit.edu	37	8	132046017	132046018	+	Intron	DEL	CA	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:132046017_132046018delCA	uc003ytd.3	-						ADCY8_uc010mds.2_Intron	NM_001115	NP_001106			adenylate cyclase 8						activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane|membrane fraction|plasma membrane	ATP binding|calcium- and calmodulin-responsive adenylate cyclase activity|metal ion binding			skin(4)|large_intestine(1)|central_nervous_system(1)	6	Esophageal squamous(12;0.00693)|Ovarian(258;0.00707)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000538)												HNSCC(32;0.087)			---	---	---	---
Unknown	0	broad.mit.edu	37	8	132696434	132696434	+	IGR	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:132696434delA								ADCY8 (643599 upstream) : EFR3A (219925 downstream)																																			---	---	---	---
TG	7038	broad.mit.edu	37	8	134013470	134013471	+	Intron	INS	-	C	C	rs139905475	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:134013470_134013471insC	uc003ytw.2	+						TG_uc010mdw.2_Intron|TG_uc011ljb.1_Intron|TG_uc011ljc.1_Intron	NM_003235	NP_003226			thyroglobulin precursor						hormone biosynthetic process|signal transduction|thyroid gland development|thyroid hormone generation	extracellular space	hormone activity			ovary(8)|breast(4)|pancreas(1)|central_nervous_system(1)|skin(1)	15	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	134690128	134690129	+	IGR	INS	-	TTTG	TTTG	rs147322892	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:134690128_134690129insTTTG								ST3GAL1 (105945 upstream) : ZFAT (799904 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	135357588	135357589	+	IGR	INS	-	A	A	rs112035388		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:135357588_135357589insA								ST3GAL1 (773405 upstream) : ZFAT (132444 downstream)																																			---	---	---	---
ZFAT	57623	broad.mit.edu	37	8	135641745	135641745	+	Intron	DEL	C	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:135641745delC	uc003yup.2	-						ZFAT_uc003yun.2_Intron|ZFAT_uc003yuo.2_Intron|ZFAT_uc010meh.2_Intron|ZFAT_uc010mei.2_Intron|ZFAT_uc003yuq.2_Intron|ZFAT_uc010mej.2_Intron|ZFAT_uc003yur.2_Intron	NM_020863	NP_065914			zinc finger protein 406 isoform ZFAT-1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|nucleus	DNA binding|zinc ion binding			central_nervous_system(1)	1	all_epithelial(106;8.26e-19)|Lung NSC(106;3.47e-07)|all_lung(105;1.39e-06)|Ovarian(258;0.0102)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0432)															---	---	---	---
ZFAT	57623	broad.mit.edu	37	8	135661445	135661446	+	Intron	DEL	CC	-	-	rs71298211	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:135661445_135661446delCC	uc003yup.2	-						ZFAT_uc003yun.2_Intron|ZFAT_uc003yuo.2_Intron|ZFAT_uc010meh.2_Intron|ZFAT_uc010mei.2_Intron|ZFAT_uc003yuq.2_Intron|ZFAT_uc010mej.2_Intron|ZFAT_uc003yur.2_Intron	NM_020863	NP_065914			zinc finger protein 406 isoform ZFAT-1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|nucleus	DNA binding|zinc ion binding			central_nervous_system(1)	1	all_epithelial(106;8.26e-19)|Lung NSC(106;3.47e-07)|all_lung(105;1.39e-06)|Ovarian(258;0.0102)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0432)															---	---	---	---
KHDRBS3	10656	broad.mit.edu	37	8	136531022	136531023	+	Intron	DEL	TG	-	-	rs3832559		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:136531022_136531023delTG	uc003yuv.2	+						KHDRBS3_uc003yuw.2_Intron	NM_006558	NP_006549			KH domain containing, RNA binding, signal						regulation of transcription, DNA-dependent|spermatogenesis|transcription, DNA-dependent	nucleus	SH3 domain binding			ovary(2)	2	all_epithelial(106;2.85e-16)|all_neural(2;2.72e-06)|Lung NSC(106;3.95e-06)|all_lung(105;1.11e-05)|Ovarian(258;0.00579)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.247)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	138774603	138774603	+	IGR	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:138774603delA								None (None upstream) : FAM135B (367665 downstream)																																			---	---	---	---
COL22A1	169044	broad.mit.edu	37	8	139727809	139727809	+	Intron	DEL	T	-	-	rs5895555		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139727809delT	uc003yvd.2	-						COL22A1_uc011ljo.1_Intron	NM_152888	NP_690848			collagen, type XXII, alpha 1						cell adhesion	collagen|cytoplasm	structural molecule activity			ovary(11)|pancreas(1)|skin(1)	13	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)												HNSCC(7;0.00092)			---	---	---	---
Unknown	0	broad.mit.edu	37	8	140509806	140509807	+	IGR	INS	-	T	T	rs141909324	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:140509806_140509807insT								COL22A1 (583570 upstream) : KCNK9 (103275 downstream)																																			---	---	---	---
TRAPPC9	83696	broad.mit.edu	37	8	141267587	141267588	+	Intron	DEL	GC	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:141267587_141267588delGC	uc003yvj.2	-						TRAPPC9_uc003yvh.2_Intron|TRAPPC9_uc010mel.1_Intron|TRAPPC9_uc003yvi.1_Intron	NM_001160372	NP_001153844			trafficking protein particle complex 9 isoform						cell differentiation	endoplasmic reticulum|Golgi apparatus				skin(2)	2																		---	---	---	---
SLC45A4	57210	broad.mit.edu	37	8	142230003	142230003	+	Intron	DEL	T	-	-	rs58594043		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:142230003delT	uc003ywd.1	-						SLC45A4_uc003ywc.1_Intron|SLC45A4_uc010meq.1_Intron	NM_001080431	NP_001073900			solute carrier family 45, member 4						transport	integral to membrane				ovary(2)	2	all_cancers(97;1.52e-15)|all_epithelial(106;2.92e-14)|Lung NSC(106;1.23e-05)|all_lung(105;1.75e-05)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0493)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	142345968	142345968	+	IGR	DEL	A	-	-	rs113421780		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:142345968delA								SLC45A4 (81743 upstream) : LOC731779 (4680 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	142565299	142565300	+	IGR	INS	-	C	C	rs141772575		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:142565299_142565300insC								FLJ43860 (47969 upstream) : MIR1302-7 (302303 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	142936880	142936881	+	IGR	INS	-	GCAGGA	GCAGGA			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:142936880_142936881insGCAGGA								MIR1302-7 (69206 upstream) : NCRNA00051 (342836 downstream)																																			---	---	---	---
NCRNA00051	619434	broad.mit.edu	37	8	143286440	143286441	+	Intron	INS	-	AC	AC	rs10622353		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143286440_143286441insAC	uc011ljt.1	+							NR_024378				Homo sapiens chromosome 8 open reading frame 43, mRNA (cDNA clone IMAGE:3866356).												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	8	144751786	144751787	+	IGR	INS	-	TT	TT	rs66509775		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144751786_144751787insTT								ZNF623 (15886 upstream) : ZNF707 (14835 downstream)																																			---	---	---	---
ARHGAP39	80728	broad.mit.edu	37	8	145838876	145838876	+	5'UTR	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145838876delT	uc003zdt.1	-	1					ARHGAP39_uc011llk.1_Intron|ARHGAP39_uc003zds.1_5'UTR	NM_025251	NP_079527			KIAA1688 protein						axon guidance|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytoskeleton|cytosol|nucleus	GTPase activator activity				0																		---	---	---	---
ZNF252	286101	broad.mit.edu	37	8	146227846	146227846	+	Intron	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:146227846delA	uc011llo.1	-						ZNF252_uc003zew.3_Intron|C8orf77_uc003zfb.3_5'Flank					SubName: Full=cDNA FLJ52642, weakly similar to Zinc finger protein 3;												0																		---	---	---	---
KDM4C	23081	broad.mit.edu	37	9	7040381	7040382	+	Intron	INS	-	TGTGTC	TGTGTC	rs140375667	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:7040381_7040382insTGTGTC	uc003zkh.2	+						KDM4C_uc010mhu.2_Intron|KDM4C_uc011lmi.1_Intron|KDM4C_uc011lmj.1_Intron|KDM4C_uc003zkg.2_Intron|KDM4C_uc011lmk.1_Intron|KDM4C_uc011lml.1_Intron	NM_015061	NP_055876			jumonji domain containing 2C isoform 1						positive regulation of cell proliferation|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|transcription, DNA-dependent	nuclear chromatin	androgen receptor binding|enzyme binding|histone demethylase activity (H3-K9 specific)|nucleic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	11091208	11091208	+	IGR	DEL	C	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:11091208delC								PTPRD (478485 upstream) : None (None downstream)																																			---	---	---	---
MOBKL2B	79817	broad.mit.edu	37	9	27368351	27368352	+	Intron	INS	-	AC	AC	rs138287792	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:27368351_27368352insAC	uc003zqn.2	-							NM_024761	NP_079037			MOB1, Mps One Binder kinase activator-like 2B								metal ion binding|protein binding			ovary(1)|pleura(1)	2		all_neural(11;9.12e-11)		Lung(218;6.54e-05)|LUSC - Lung squamous cell carcinoma(38;0.000397)														---	---	---	---
Unknown	0	broad.mit.edu	37	9	29072999	29073000	+	IGR	INS	-	CA	CA			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:29072999_29073000insCA								MIR873 (184046 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	29756114	29756114	+	IGR	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:29756114delT								MIR873 (867161 upstream) : None (None downstream)																																			---	---	---	---
RECK	8434	broad.mit.edu	37	9	36094511	36094511	+	Intron	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:36094511delA	uc003zyv.2	+						RECK_uc003zyw.2_Intron|RECK_uc003zyx.2_Intron	NM_021111	NP_066934			RECK protein precursor							anchored to membrane|peripheral to membrane of membrane fraction|plasma membrane	metalloendopeptidase inhibitor activity|serine-type endopeptidase inhibitor activity			skin(2)|ovary(1)	3			LUSC - Lung squamous cell carcinoma(32;0.112)|STAD - Stomach adenocarcinoma(86;0.228)															---	---	---	---
Unknown	0	broad.mit.edu	37	9	44876306	44876306	+	IGR	DEL	G	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:44876306delG								None (None upstream) : FAM27C (113930 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	45357072	45357073	+	IGR	INS	-	C	C	rs142554331		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:45357072_45357073insC								FAM27C (365581 upstream) : FAM27A (369956 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	45362789	45362791	+	IGR	DEL	TTC	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:45362789_45362791delTTC								FAM27C (371298 upstream) : FAM27A (364238 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	66459932	66459933	+	5'Flank	DEL	AA	-	-	rs112939877	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66459932_66459933delAA	uc010mng.1	-						uc004aeb.2_5'Flank|uc004aec.2_RNA					Homo sapiens cDNA, FLJ98602.																														---	---	---	---
Unknown	0	broad.mit.edu	37	9	66486940	66486940	+	IGR	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66486940delA								FAM74A4 (992554 upstream) : LOC442421 (9530 downstream)																																			---	---	---	---
AQP7P1	375719	broad.mit.edu	37	9	67285600	67285600	+	Intron	DEL	T	-	-	rs148259327	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:67285600delT	uc004aen.1	-						AQP7P1_uc004aeo.1_Intron|AQP7P1_uc004aep.1_Intron					Homo sapiens cDNA FLJ46364 fis, clone TESTI4051015.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	68475556	68475557	+	IGR	DEL	TG	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68475556_68475557delTG								FAM27B (681367 upstream) : MIR1299 (526682 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	69572714	69572715	+	IGR	INS	-	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:69572714_69572715insA								ANKRD20A4 (147606 upstream) : LOC100133920 (78646 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	69642095	69642096	+	Intron	INS	-	C	C			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:69642095_69642096insC	uc004afu.3	-											Homo sapiens aquaporin 7 pseudogene 2, mRNA (cDNA clone IMAGE:30406582).																														---	---	---	---
Unknown	0	broad.mit.edu	37	9	69834009	69834009	+	IGR	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:69834009delT								LOC100133920 (169060 upstream) : FOXD4L5 (341700 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	82393882	82393882	+	IGR	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:82393882delT								TLE4 (52225 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	83575432	83575432	+	IGR	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:83575432delT								None (None upstream) : TLE1 (623168 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	83703197	83703198	+	IGR	DEL	TG	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:83703197_83703198delTG								None (None upstream) : TLE1 (495402 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	83981958	83981959	+	IGR	INS	-	A	A	rs35010041		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:83981958_83981959insA								None (None upstream) : TLE1 (216641 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	84364578	84364581	+	Intron	DEL	TCTC	-	-	rs61175004		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:84364578_84364581delTCTC	uc004amc.2	+						uc004amd.2_Intron					Homo sapiens cDNA clone IMAGE:4813482.																														---	---	---	---
Unknown	0	broad.mit.edu	37	9	84743211	84743211	+	IGR	DEL	C	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:84743211delC								FLJ46321 (133041 upstream) : RASEF (854106 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	88542916	88542919	+	IGR	DEL	CCCT	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:88542916_88542919delCCCT								AGTPBP1 (185972 upstream) : NAA35 (13138 downstream)																																			---	---	---	---
C9orf153	389766	broad.mit.edu	37	9	88855426	88855426	+	Intron	DEL	G	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:88855426delG	uc004aoo.2	-						GOLM1_uc010mqd.1_Intron|C9orf153_uc004aon.2_Intron	NM_001010907	NP_001010907			hypothetical protein LOC389766												0																		---	---	---	---
C9orf153	389766	broad.mit.edu	37	9	88856546	88856547	+	Intron	INS	-	T	T	rs11418899		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:88856546_88856547insT	uc004aoo.2	-						GOLM1_uc010mqd.1_Intron|C9orf153_uc004aon.2_Intron	NM_001010907	NP_001010907			hypothetical protein LOC389766												0																		---	---	---	---
DAPK1	1612	broad.mit.edu	37	9	90127200	90127201	+	Intron	INS	-	T	T	rs35543817		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:90127200_90127201insT	uc004apc.2	+						DAPK1_uc004ape.2_Intron|DAPK1_uc004apd.2_Intron|DAPK1_uc011ltg.1_Intron|DAPK1_uc011lth.1_Intron	NM_004938	NP_004929			death-associated protein kinase 1						apoptosis|induction of apoptosis by extracellular signals|intracellular protein kinase cascade	actin cytoskeleton|cytoplasm	ATP binding|calmodulin binding|protein serine/threonine kinase activity			ovary(1)|breast(1)	2														Chronic_Lymphocytic_Leukemia_Familial_Clustering_of				---	---	---	---
SPIN1	10927	broad.mit.edu	37	9	91021208	91021208	+	Intron	DEL	T	-	-	rs34100420		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:91021208delT	uc010mqj.2	+						SPIN1_uc004apy.2_Intron|SPIN1_uc004apz.2_Intron|SPIN1_uc010mqk.2_Intron	NM_006717	NP_006708			spindlin						cell cycle|gamete generation|multicellular organismal development	nucleus	methylated histone residue binding				0																		---	---	---	---
NXNL2	158046	broad.mit.edu	37	9	91150746	91150747	+	Intron	INS	-	C	C	rs150222723	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:91150746_91150747insC	uc011ltj.1	+						NXNL2_uc004aqa.2_Intron	NM_001161625	NP_001155097			nucleoredoxin-like 2 isoform 1												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	93806448	93806449	+	IGR	DEL	AC	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:93806448_93806449delAC								SYK (145615 upstream) : AUH (169650 downstream)																																			---	---	---	---
ZNF169	169841	broad.mit.edu	37	9	97048293	97048294	+	Intron	INS	-	A	A	rs75050480		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:97048293_97048294insA	uc004aum.1	+						ZNF169_uc004aun.2_Intron|ZNF169_uc004auo.2_Intron	NM_194320	NP_919301			zinc finger protein 169							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)	2		Acute lymphoblastic leukemia(62;0.136)																---	---	---	---
ZNF169	169841	broad.mit.edu	37	9	97054922	97054923	+	Intron	INS	-	GTGC	GTGC	rs74578608	byFrequency	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:97054922_97054923insGTGC	uc004aum.1	+						ZNF169_uc004aun.2_Intron|ZNF169_uc004auo.2_Intron	NM_194320	NP_919301			zinc finger protein 169							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)	2		Acute lymphoblastic leukemia(62;0.136)																---	---	---	---
TMOD1	7111	broad.mit.edu	37	9	100261647	100261648	+	5'Flank	INS	-	A	A	rs34953285		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:100261647_100261648insA	uc004axk.1	+							NM_003275	NP_003266			tropomodulin 1						muscle filament sliding	cytosol	actin binding				0		Acute lymphoblastic leukemia(62;0.154)		STAD - Stomach adenocarcinoma(157;0.105)														---	---	---	---
TMOD1	7111	broad.mit.edu	37	9	100286779	100286780	+	Intron	INS	-	GTGTGTGT	GTGTGTGT			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:100286779_100286780insGTGTGTGT	uc004axk.1	+						TMOD1_uc004axl.1_Intron	NM_003275	NP_003266			tropomodulin 1						muscle filament sliding	cytosol	actin binding				0		Acute lymphoblastic leukemia(62;0.154)		STAD - Stomach adenocarcinoma(157;0.105)														---	---	---	---
GABBR2	9568	broad.mit.edu	37	9	101253279	101253279	+	Intron	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:101253279delT	uc004ays.2	-							NM_005458	NP_005449			G protein-coupled receptor 51 precursor						negative regulation of adenylate cyclase activity|synaptic transmission	cell junction|integral to plasma membrane|postsynaptic membrane	G-protein coupled receptor activity|GABA-B receptor activity			ovary(2)|skin(2)	4		Acute lymphoblastic leukemia(62;0.0527)			Baclofen(DB00181)													---	---	---	---
Unknown	0	broad.mit.edu	37	9	101618714	101618715	+	IGR	INS	-	A	A	rs150556802	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:101618714_101618715insA								GALNT12 (6356 upstream) : COL15A1 (87423 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	103551131	103551131	+	IGR	DEL	A	-	-	rs10819838	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:103551131delA								MURC (200960 upstream) : LPPR1 (239900 downstream)																																			---	---	---	---
C9orf125	84302	broad.mit.edu	37	9	104239493	104239494	+	Intron	INS	-	AAACAAAC	AAACAAAC	rs67389871	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:104239493_104239494insAAACAAAC	uc004bbm.2	-						uc004bbl.1_5'Flank	NM_032342	NP_115718			hypothetical protein LOC84302							integral to membrane					0		Acute lymphoblastic leukemia(62;0.0527)																---	---	---	---
Unknown	0	broad.mit.edu	37	9	106460873	106460874	+	IGR	INS	-	G	G			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:106460873_106460874insG								CYLC2 (680103 upstream) : SMC2 (395667 downstream)																																			---	---	---	---
TMEM38B	55151	broad.mit.edu	37	9	108495839	108495839	+	Intron	DEL	G	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:108495839delG	uc004bcu.1	+						TMEM38B_uc010mtn.1_Intron	NM_018112	NP_060582			transmembrane protein 38B							integral to membrane|nuclear membrane|sarcoplasmic reticulum membrane	potassium channel activity			ovary(1)|skin(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	109012133	109012134	+	Intron	INS	-	CTT	CTT	rs138182860	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:109012133_109012134insCTT	uc004bcw.2	+											Homo sapiens, clone IMAGE:5538960, mRNA.																														---	---	---	---
C9orf5	23731	broad.mit.edu	37	9	111860835	111860835	+	Intron	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:111860835delA	uc004bdt.3	-						C9orf5_uc004bds.3_Intron|C9orf5_uc004bdr.3_Intron	NM_032012	NP_114401			hypothetical protein LOC23731							integral to membrane				central_nervous_system(1)	1		Myeloproliferative disorder(63;0.204)		OV - Ovarian serous cystadenocarcinoma(323;3.08e-05)|STAD - Stomach adenocarcinoma(157;0.0823)														---	---	---	---
ROD1	9991	broad.mit.edu	37	9	115081996	115081997	+	Intron	DEL	TC	-	-	rs139037884		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:115081996_115081997delTC	uc004bfw.2	-						ROD1_uc004bfv.2_Intron|ROD1_uc004bfx.2_Intron|ROD1_uc011lwu.1_Intron|ROD1_uc004bfy.2_Intron|ROD1_uc004bfz.2_Intron	NM_005156	NP_005147			ROD1 regulator of differentiation 1 isoform 1						anatomical structure morphogenesis|mRNA processing	nucleus	nucleotide binding|RNA binding			skin(1)	1																		---	---	---	---
RGS3	5998	broad.mit.edu	37	9	116264788	116264788	+	Intron	DEL	C	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:116264788delC	uc004bhq.2	+						RGS3_uc004bhr.2_Intron|RGS3_uc004bhs.2_Intron|RGS3_uc004bht.2_Intron|RGS3_uc010muy.2_Intron|RGS3_uc004bhu.2_5'Flank	NM_144488	NP_652759			regulator of G-protein signalling 3 isoform 6						inactivation of MAPK activity|regulation of G-protein coupled receptor protein signaling pathway	cytosol|nucleus|plasma membrane	GTPase activator activity|signal transducer activity			ovary(1)|lung(1)|skin(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	116500519	116500520	+	IGR	INS	-	T	T	rs146812528	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:116500519_116500520insT								RGS3 (140502 upstream) : ZNF618 (138042 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	117464553	117464553	+	IGR	DEL	T	-	-	rs113901322		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:117464553delT								C9orf91 (55857 upstream) : TNFSF15 (87060 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	117528940	117528941	+	IGR	INS	-	CCTT	CCTT	rs113822880	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:117528940_117528941insCCTT								C9orf91 (120244 upstream) : TNFSF15 (22672 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	120486324	120486324	+	IGR	DEL	C	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:120486324delC								TLR4 (6560 upstream) : None (None downstream)																																			---	---	---	---
DBC1	1620	broad.mit.edu	37	9	122012083	122012084	+	Intron	INS	-	GGAAGGAA	GGAAGGAA			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:122012083_122012084insGGAAGGAA	uc004bkc.2	-						DBC1_uc004bkd.2_Intron	NM_014618	NP_055433			deleted in bladder cancer 1 precursor						cell cycle arrest|cell death	cytoplasm	protein binding			skin(3)|ovary(2)|central_nervous_system(2)|large_intestine(1)	8																		---	---	---	---
CDK5RAP2	55755	broad.mit.edu	37	9	123224719	123224719	+	Intron	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:123224719delA	uc004bkf.2	-						CDK5RAP2_uc004bke.2_Intron|CDK5RAP2_uc004bkg.2_Intron|CDK5RAP2_uc011lxw.1_Intron|CDK5RAP2_uc011lxx.1_Intron|CDK5RAP2_uc011lxy.1_Intron|CDK5RAP2_uc011lxz.1_Intron|CDK5RAP2_uc011lya.1_Intron|CDK5RAP2_uc004bkh.1_Intron|CDK5RAP2_uc004bki.2_Intron	NM_018249	NP_060719			CDK5 regulatory subunit associated protein 2						brain development|centrosome organization|chromosome segregation|G2/M transition of mitotic cell cycle|microtubule bundle formation|negative regulation of centriole replication|positive regulation of transcription, DNA-dependent|regulation of neuron differentiation|regulation of spindle checkpoint	cytosol|Golgi apparatus|microtubule|pericentriolar material|perinuclear region of cytoplasm|spindle pole	calmodulin binding|microtubule binding|neuronal Cdc2-like kinase binding|transcription regulatory region DNA binding			ovary(2)|lung(1)|skin(1)	4																		---	---	---	---
DENND1A	57706	broad.mit.edu	37	9	126690134	126690135	+	Intron	DEL	CT	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:126690134_126690135delCT	uc004bnz.1	-						DENND1A_uc011lzm.1_Intron|DENND1A_uc004boa.1_Intron|DENND1A_uc004bob.1_Intron|DENND1A_uc004boc.2_Intron	NM_020946	NP_065997			DENN/MADD domain containing 1A isoform 1							cell junction|clathrin coated vesicle membrane|presynaptic membrane	guanyl-nucleotide exchange factor activity			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	126957180	126957180	+	IGR	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:126957180delA								LHX2 (161738 upstream) : NEK6 (62706 downstream)																																			---	---	---	---
CERCAM	51148	broad.mit.edu	37	9	131191885	131191886	+	Intron	INS	-	T	T	rs148811411	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131191885_131191886insT	uc004buz.3	+						CERCAM_uc004buy.1_Intron|CERCAM_uc010mxz.2_Intron|CERCAM_uc010mya.1_Intron	NM_016174	NP_057258			cerebral endothelial cell adhesion molecule 1						cellular component movement|leukocyte cell-cell adhesion|lipopolysaccharide biosynthetic process	endoplasmic reticulum lumen|plasma membrane				pancreas(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	132151681	132151682	+	IGR	INS	-	TT	TT	rs150251877	by1000genomes;by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:132151681_132151682insTT								C9orf106 (66799 upstream) : C9orf50 (222824 downstream)																																			---	---	---	---
PRRX2	51450	broad.mit.edu	37	9	132466562	132466563	+	Intron	INS	-	CC	CC	rs142153795	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:132466562_132466563insCC	uc004byh.2	+							NM_016307	NP_057391			paired related homeobox 2							nuclear chromosome	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			pancreas(1)	1		Ovarian(14;0.00556)																---	---	---	---
ABL1	25	broad.mit.edu	37	9	133721469	133721470	+	Intron	DEL	TG	-	-	rs145532635		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:133721469_133721470delTG	uc004bzw.2	+						ABL1_uc004bzv.2_Intron	NM_005157	NP_005148			c-abl oncogene 1, receptor tyrosine kinase						actin cytoskeleton organization|axon guidance|blood coagulation|cell adhesion|DNA damage induced protein phosphorylation|DNA damage response, signal transduction resulting in induction of apoptosis|mismatch repair|muscle cell differentiation|negative regulation of protein serine/threonine kinase activity|peptidyl-tyrosine phosphorylation|positive regulation of muscle cell differentiation|positive regulation of oxidoreductase activity|regulation of transcription involved in S phase of mitotic cell cycle	cytoskeleton|cytosol|nuclear membrane|nucleolus|perinuclear region of cytoplasm	ATP binding|DNA binding|magnesium ion binding|manganese ion binding|mitogen-activated protein kinase binding|non-membrane spanning protein tyrosine kinase activity|proline-rich region binding|protein C-terminus binding|SH3 domain binding			haematopoietic_and_lymphoid_tissue(807)|lung(5)|stomach(2)|central_nervous_system(1)|breast(1)|skin(1)	817		all_hematologic(13;0.0361)|Acute lymphoblastic leukemia(5;0.0543)|Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.4e-05)	Adenosine triphosphate(DB00171)|Dasatinib(DB01254)|Imatinib(DB00619)			T|Mis	BCR|ETV6|NUP214	CML|ALL|T-ALL								---	---	---	---
Unknown	0	broad.mit.edu	37	9	133834291	133834293	+	IGR	DEL	TGT	-	-	rs151170497		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:133834291_133834293delTGT								FIBCD1 (19836 upstream) : LAMC3 (50211 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	136193781	136193782	+	IGR	INS	-	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136193781_136193782insA								ABO (43151 upstream) : SURF6 (3771 downstream)																																			---	---	---	---
VAV2	7410	broad.mit.edu	37	9	136795503	136795504	+	Intron	INS	-	CTGCCTCCTGGCCTCCACC	CTGCCTCCTGGCCTCCACC	rs140586685	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136795503_136795504insCTGCCTCCTGGCCTCCACC	uc004ces.2	-						VAV2_uc004cer.2_Intron	NM_001134398	NP_001127870			vav 2 guanine nucleotide exchange factor isoform						angiogenesis|apoptosis|axon guidance|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|platelet activation|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	metal ion binding|Rho guanyl-nucleotide exchange factor activity			central_nervous_system(3)|ovary(2)|lung(2)|breast(1)	8				OV - Ovarian serous cystadenocarcinoma(145;3.9e-07)|Epithelial(140;2.07e-06)|all cancers(34;9.39e-06)														---	---	---	---
Unknown	0	broad.mit.edu	37	9	137931723	137931724	+	IGR	INS	-	T	T	rs146867020	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:137931723_137931724insT								FCN1 (121914 upstream) : OLFM1 (35365 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	138866149	138866150	+	IGR	INS	-	TGTT	TGTT	rs149131942	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:138866149_138866150insTGTT								UBAC1 (12923 upstream) : NACC2 (37055 downstream)																																			---	---	---	---
GPSM1	26086	broad.mit.edu	37	9	139235823	139235824	+	Intron	INS	-	GGGCT	GGGCT	rs150586482	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139235823_139235824insGGGCT	uc004chd.2	+						GPSM1_uc004chc.2_3'UTR	NM_001145638	NP_001139110			G-protein signaling modulator 1 (AGS3-like, C.						cell differentiation|nervous system development|signal transduction	cytosol|endoplasmic reticulum membrane|Golgi membrane|plasma membrane	binding|GTPase activator activity				0		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;2.39e-06)|Epithelial(140;3.24e-06)														---	---	---	---
SNHG7	84973	broad.mit.edu	37	9	139620988	139620992	+	Intron	DEL	CGTAC	-	-	rs10609067		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139620988_139620992delCGTAC	uc004cim.2	-						SNHG7_uc004cin.2_5'UTR|SNHG7_uc004ciq.3_Intron|SNHG7_uc004cio.2_Intron|SNHG7_uc004cip.3_Intron|SNHG7_uc011meb.1_RNA|SNHG7_uc011mec.1_5'Flank					Homo sapiens cDNA FLJ30346 fis, clone BRACE2007527.												0																OREG0019621	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
TUBBP5	643224	broad.mit.edu	37	9	141046859	141046860	+	Intron	INS	-	T	T	rs113702714		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:141046859_141046860insT	uc010ncq.2	+							NR_027156				Homo sapiens cDNA, FLJ98407.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	837813	837813	+	IGR	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:837813delT								DIP2C (102205 upstream) : LARP4B (17671 downstream)																																			---	---	---	---
ADARB2	105	broad.mit.edu	37	10	1660130	1660130	+	Intron	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:1660130delT	uc009xhq.2	-							NM_018702	NP_061172			adenosine deaminase, RNA-specific, B2						mRNA processing	mitochondrion|nucleus	adenosine deaminase activity|double-stranded RNA binding|metal ion binding|single-stranded RNA binding			large_intestine(2)|central_nervous_system(1)	3		all_epithelial(10;0.059)|Colorectal(49;0.0815)		all cancers(11;0.0224)|GBM - Glioblastoma multiforme(2;0.0414)|Epithelial(11;0.165)														---	---	---	---
FRMD4A	55691	broad.mit.edu	37	10	14416888	14416897	+	Intron	DEL	GAAAGGGAAA	-	-	rs11277364	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:14416888_14416897delGAAAGGGAAA	uc001imv.2	-						FRMD4A_uc001imw.1_Intron					Homo sapiens mRNA for KIAA1294 protein, partial cds.							cytoplasm|cytoskeleton	binding			ovary(1)|skin(1)|pancreas(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	20958390	20958390	+	IGR	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:20958390delA								PLXDC2 (389275 upstream) : NEBL (110515 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	23497876	23497876	+	IGR	DEL	C	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:23497876delC								PTF1A (14697 upstream) : C10orf67 (107645 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	23717184	23717184	+	IGR	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:23717184delT								C10orf67 (83412 upstream) : OTUD1 (11014 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	28635928	28635928	+	IGR	DEL	G	-	-	rs113868621		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:28635928delG								MPP7 (43933 upstream) : WAC (185499 downstream)																																			---	---	---	---
SVIL	6840	broad.mit.edu	37	10	30002191	30002192	+	Intron	INS	-	TG	TG	rs140576513	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:30002191_30002192insTG	uc001iuu.1	-						SVIL_uc009xld.1_Intron	NM_003174	NP_003165			supervillin isoform 1						cytoskeleton organization|skeletal muscle tissue development	cell junction|costamere|invadopodium|nucleus|podosome	actin filament binding			ovary(5)|upper_aerodigestive_tract(1)	6		Breast(68;0.103)																---	---	---	---
Unknown	0	broad.mit.edu	37	10	42674743	42674743	+	IGR	DEL	C	-	-	rs112350006		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42674743delC								None (None upstream) : LOC441666 (152572 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	42723444	42723445	+	IGR	INS	-	TCA	TCA	rs146856801	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42723444_42723445insTCA								None (None upstream) : LOC441666 (103870 downstream)																																			---	---	---	---
ZNF37B	100129482	broad.mit.edu	37	10	43009824	43009824	+	RNA	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:43009824delT	uc001jab.3	-	5		c.9376delA			ZNF37B_uc001jac.3_RNA|ZNF37B_uc001jaa.3_RNA					Homo sapiens cDNA: FLJ23327 fis, clone HEP12630, highly similar to HSZNF37 Homo sapiens ZNF37A mRNA for zinc finger protein.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	43339413	43339415	+	IGR	DEL	CCA	-	-	rs35580067		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:43339413_43339415delCCA								BMS1 (9030 upstream) : RET (233102 downstream)																																			---	---	---	---
ANXA8	653145	broad.mit.edu	37	10	47090757	47090758	+	Intron	DEL	AG	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:47090757_47090758delAG	uc001jed.3	-											Homo sapiens cDNA FLJ58071 complete cds, highly similar to Annexin A8.						blood coagulation		calcium ion binding|calcium-dependent phospholipid binding			central_nervous_system(3)	3																		---	---	---	---
ARHGAP22	58504	broad.mit.edu	37	10	49735538	49735539	+	Intron	INS	-	TGGA	TGGA	rs144394666	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:49735538_49735539insTGGA	uc001jgt.2	-						ARHGAP22_uc001jgu.2_Intron|ARHGAP22_uc010qgl.1_Intron|ARHGAP22_uc010qgm.1_Intron|ARHGAP22_uc001jgv.2_Intron	NM_021226	NP_067049			Rho GTPase activating protein 2						angiogenesis|cell differentiation|regulation of small GTPase mediated signal transduction|regulation of transcription, DNA-dependent|small GTPase mediated signal transduction|transcription, DNA-dependent	cytosol|nucleus	GTPase activator activity			ovary(1)	1																		---	---	---	---
ERCC6	2074	broad.mit.edu	37	10	50668944	50668944	+	Intron	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:50668944delA	uc001jhs.3	-						ERCC6_uc009xod.2_Intron|ERCC6_uc010qgr.1_Intron|ERCC6_uc001jhr.3_Intron	NM_000124	NP_000115			excision repair cross-complementing rodent						base-excision repair|positive regulation of transcription elongation, DNA-dependent|transcription from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair	nucleolus|soluble fraction|transcription elongation factor complex	ATP binding|chromatin binding|DNA binding|DNA-dependent ATPase activity|helicase activity|protein C-terminus binding|protein complex binding|protein N-terminus binding			lung(5)|breast(5)|ovary(3)|large_intestine(2)|skin(1)	16													Direct_reversal_of_damage|NER					---	---	---	---
ERCC6	2074	broad.mit.edu	37	10	50696689	50696689	+	Intron	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:50696689delT	uc001jhs.3	-						ERCC6_uc010qgr.1_Intron|ERCC6_uc001jhr.3_Intron	NM_000124	NP_000115			excision repair cross-complementing rodent						base-excision repair|positive regulation of transcription elongation, DNA-dependent|transcription from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair	nucleolus|soluble fraction|transcription elongation factor complex	ATP binding|chromatin binding|DNA binding|DNA-dependent ATPase activity|helicase activity|protein C-terminus binding|protein complex binding|protein N-terminus binding			lung(5)|breast(5)|ovary(3)|large_intestine(2)|skin(1)	16													Direct_reversal_of_damage|NER					---	---	---	---
PARG	8505	broad.mit.edu	37	10	51571778	51571778	+	Intron	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:51571778delT	uc001jih.2	-						uc010qha.1_Intron|uc001jin.2_Intron|uc010qhb.1_Intron|uc010qhc.1_Intron|NCOA4_uc009xon.2_Intron|NCOA4_uc010qhd.1_Intron|NCOA4_uc001jis.3_Intron|NCOA4_uc010qhe.1_Intron|NCOA4_uc010qhf.1_Intron|NCOA4_uc001jit.2_5'Flank	NM_003631	NP_003622			poly (ADP-ribose) glycohydrolase						carbohydrate metabolic process	nucleus	poly(ADP-ribose) glycohydrolase activity			ovary(2)	2				Epithelial(53;0.213)														---	---	---	---
PRKG1	5592	broad.mit.edu	37	10	52919719	52919719	+	Intron	DEL	G	-	-	rs11297792		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:52919719delG	uc001jjm.2	+						PRKG1_uc001jjn.2_Intron|PRKG1_uc001jjo.2_Intron|PRKG1_uc010qhp.1_Intron	NM_001098512	NP_001091982			protein kinase, cGMP-dependent, type I isoform						actin cytoskeleton organization|platelet activation|signal transduction	cytosol	ATP binding|cGMP binding|cGMP-dependent protein kinase activity			lung(2)|stomach(1)|ovary(1)|central_nervous_system(1)|skin(1)	6		all_cancers(4;2.13e-08)|all_epithelial(4;2.44e-08)|all_lung(4;0.000173)		all cancers(4;1.18e-05)|GBM - Glioblastoma multiforme(4;0.000359)|Epithelial(53;0.00532)|Lung(62;0.0606)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	54100960	54100960	+	IGR	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:54100960delT								DKK1 (23544 upstream) : MBL2 (424181 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	57897725	57897725	+	IGR	DEL	T	-	-	rs71836334		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:57897725delT								PCDH15 (510023 upstream) : ZWINT (219474 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	59302815	59302816	+	IGR	INS	-	AAAG	AAAG	rs10645503		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:59302815_59302816insAAAG								None (None upstream) : IPMK (652802 downstream)																																			---	---	---	---
ANK3	288	broad.mit.edu	37	10	62032211	62032212	+	Intron	INS	-	TTG	TTG	rs145292305	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:62032211_62032212insTTG	uc001jky.2	-						ANK3_uc010qih.1_Intron|ANK3_uc001jkz.3_Intron|ANK3_uc001jlb.1_Intron	NM_020987	NP_066267			ankyrin 3 isoform 1						establishment of protein localization|signal transduction	basolateral plasma membrane|cytoplasm|cytoskeleton	protein binding			skin(9)|ovary(6)|pancreas(2)|central_nervous_system(2)	19																		---	---	---	---
ARID5B	84159	broad.mit.edu	37	10	63753016	63753016	+	Intron	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:63753016delT	uc001jlt.1	+						ARID5B_uc010qil.1_Intron	NM_032199	NP_115575			AT rich interactive domain 5B (MRF1-like)						liver development|negative regulation of transcription, DNA-dependent|positive regulation of sequence-specific DNA binding transcription factor activity|transcription, DNA-dependent		protein binding|transcription regulatory region DNA binding			ovary(2)|upper_aerodigestive_tract(1)|kidney(1)	4	Prostate(12;0.016)|all_hematologic(501;0.215)																	---	---	---	---
RTKN2	219790	broad.mit.edu	37	10	63983730	63983733	+	Intron	DEL	TGTA	-	-	rs145420361	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:63983730_63983733delTGTA	uc001jlw.2	-						RTKN2_uc009xpf.1_Intron	NM_145307	NP_660350			rhotekin 2						signal transduction	intracellular					0	Prostate(12;0.0297)|all_hematologic(501;0.215)																	---	---	---	---
Unknown	0	broad.mit.edu	37	10	64437949	64437949	+	IGR	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:64437949delT								ZNF365 (6178 upstream) : ADO (126567 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	64665654	64665657	+	IGR	DEL	GAAA	-	-	rs10569806		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:64665654_64665657delGAAA								EGR2 (86727 upstream) : NRBF2 (227350 downstream)																																			---	---	---	---
CTNNA3	29119	broad.mit.edu	37	10	68282523	68282523	+	Intron	DEL	C	-	-	rs34457176		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:68282523delC	uc009xpn.1	-						CTNNA3_uc001jmw.2_Intron|CTNNA3_uc001jmx.3_Intron	NM_001127384	NP_001120856			catenin, alpha 3						cell-cell adhesion	actin cytoskeleton|cytoplasm|fascia adherens	cadherin binding|structural molecule activity			skin(3)|ovary(2)|pancreas(1)|lung(1)|central_nervous_system(1)	8																		---	---	---	---
HERC4	26091	broad.mit.edu	37	10	69732959	69732960	+	Intron	INS	-	A	A	rs140675793		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:69732959_69732960insA	uc001jng.3	-						HERC4_uc009xpq.2_Intron|HERC4_uc001jnf.3_Intron|HERC4_uc001jnh.3_Intron|HERC4_uc009xpr.2_Intron|HERC4_uc001jni.3_Intron|HERC4_uc001jnj.2_Intron	NM_022079	NP_071362			hect domain and RLD 4 isoform a						cell differentiation|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|spermatogenesis	cytosol	ubiquitin-protein ligase activity			ovary(1)|breast(1)|skin(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	72146678	72146679	+	IGR	DEL	GA	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:72146678_72146679delGA								LRRC20 (4296 upstream) : EIF4EBP2 (17182 downstream)																																			---	---	---	---
KIAA1274	27143	broad.mit.edu	37	10	72322839	72322840	+	Intron	DEL	GC	-	-	rs10552811		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:72322839_72322840delGC	uc001jrd.3	+						KIAA1274_uc001jre.3_Intron	NM_014431	NP_055246			KIAA1274											ovary(2)|central_nervous_system(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	73656840	73656840	+	IGR	DEL	C	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:73656840delC								PSAP (45758 upstream) : CHST3 (67280 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	75728253	75728254	+	IGR	INS	-	A	A	rs147029114	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75728253_75728254insA								C10orf55 (45718 upstream) : VCL (26697 downstream)																																			---	---	---	---
MIR606	693191	broad.mit.edu	37	10	77312184	77312184	+	5'Flank	DEL	C	-	-	rs1367290		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:77312184delC	hsa-mir-606|MI0003619	+																							0																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	77396604	77396604	+	IGR	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:77396604delT								MIR606 (84293 upstream) : C10orf11 (145915 downstream)																																			---	---	---	---
C10orf11	83938	broad.mit.edu	37	10	78266964	78266964	+	Intron	DEL	T	-	-	rs145212438		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:78266964delT	uc001jxi.2	+							NM_032024	NP_114413			chromosome 10 open reading frame 11												0	Prostate(51;0.0095)|all_epithelial(25;0.0221)																	---	---	---	---
KCNMA1	3778	broad.mit.edu	37	10	78763972	78763973	+	Intron	DEL	CA	-	-	rs143390722		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:78763972_78763973delCA	uc001jxn.2	-						KCNMA1_uc001jxj.2_Intron|KCNMA1_uc001jxk.1_Intron|KCNMA1_uc009xrt.1_Intron|KCNMA1_uc001jxl.1_Intron|KCNMA1_uc001jxo.2_Intron|KCNMA1_uc001jxm.2_Intron|KCNMA1_uc001jxq.2_Intron	NM_001161352	NP_001154824			large conductance calcium-activated potassium						cellular potassium ion homeostasis|negative regulation of cell volume|platelet activation|positive regulation of apoptosis|regulation of membrane potential|response to calcium ion|response to carbon monoxide|response to hypoxia|response to osmotic stress|smooth muscle contraction involved in micturition	apical plasma membrane|caveola|integral to membrane|voltage-gated potassium channel complex	actin binding|calcium-activated potassium channel activity|large conductance calcium-activated potassium channel activity|metal ion binding|voltage-gated potassium channel activity			pancreas(2)|ovary(1)	3	all_cancers(46;0.203)|all_epithelial(25;0.00604)|Prostate(51;0.0198)		OV - Ovarian serous cystadenocarcinoma(4;0.0586)|Epithelial(14;0.081)|all cancers(16;0.183)		Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Chlorothiazide(DB00880)|Chlorzoxazone(DB00356)|Cromoglicate(DB01003)|Cyclothiazide(DB00606)|Diazoxide(DB01119)|Enflurane(DB00228)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Quinethazone(DB01325)|Trichlormethiazide(DB01021)													---	---	---	---
POLR3A	11128	broad.mit.edu	37	10	79770062	79770063	+	Intron	INS	-	A	A	rs3832673		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:79770062_79770063insA	uc001jzn.2	-							NM_007055	NP_008986			polymerase (RNA) III (DNA directed) polypeptide						innate immune response|positive regulation of interferon-beta production|response to virus|termination of RNA polymerase III transcription|transcription elongation from RNA polymerase III promoter	DNA-directed RNA polymerase III complex	DNA binding|DNA-directed RNA polymerase activity|ribonucleoside binding|zinc ion binding				0	all_cancers(46;0.0356)|all_epithelial(25;0.00102)|Breast(12;0.00124)|Prostate(51;0.0095)		Epithelial(14;0.00161)|OV - Ovarian serous cystadenocarcinoma(4;0.00323)|all cancers(16;0.00646)															---	---	---	---
Unknown	0	broad.mit.edu	37	10	85042127	85042128	+	IGR	INS	-	A	A	rs144747077	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:85042127_85042128insA								NRG3 (295192 upstream) : GHITM (857057 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	85394251	85394251	+	IGR	DEL	C	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:85394251delC								NRG3 (647316 upstream) : GHITM (504934 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	87168316	87168317	+	IGR	DEL	TG	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:87168316_87168317delTG								FAM190B (890040 upstream) : GRID1 (190995 downstream)																																			---	---	---	---
BTAF1	9044	broad.mit.edu	37	10	93770664	93770665	+	Intron	DEL	AC	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:93770664_93770665delAC	uc001khr.2	+							NM_003972	NP_003963			BTAF1 RNA polymerase II, B-TFIID transcription						negative regulation of transcription, DNA-dependent	nucleus	ATP binding|DNA binding|helicase activity|sequence-specific DNA binding transcription factor activity			ovary(1)|central_nervous_system(1)|skin(1)	3		Colorectal(252;0.0846)																---	---	---	---
TCTN3	26123	broad.mit.edu	37	10	97452515	97452516	+	Intron	INS	-	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:97452515_97452516insT	uc001klb.3	-						TCTN3_uc001kla.3_Intron|TCTN3_uc010qoi.1_Intron|TCTN3_uc001kld.2_Intron|TCTN3_uc009xux.1_Intron|TCTN3_uc009xuy.1_Intron	NM_015631	NP_056446			tectonic 3 isoform a precursor						apoptosis	integral to membrane					0		Colorectal(252;0.0815)		Epithelial(162;1.69e-07)|all cancers(201;5.63e-06)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	99566957	99566960	+	IGR	DEL	TGTG	-	-	rs112111303		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:99566957_99566960delTGTG								SFRP5 (35201 upstream) : GOLGA7B (43036 downstream)																																			---	---	---	---
ABCC2	1244	broad.mit.edu	37	10	101580148	101580149	+	Intron	DEL	CA	-	-	rs10555122		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:101580148_101580149delCA	uc001kqf.2	+							NM_000392	NP_000383			ATP-binding cassette, sub-family C (CFTR/MRP),							apical plasma membrane|integral to plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances|organic anion transmembrane transporter activity			ovary(1)	1		Colorectal(252;0.234)		Epithelial(162;2.77e-10)|all cancers(201;2.47e-08)	Adenosine triphosphate(DB00171)|Norgestimate(DB00957)|Pravastatin(DB00175)|Saquinavir(DB01232)|Sulfinpyrazone(DB01138)													---	---	---	---
Unknown	0	broad.mit.edu	37	10	106065778	106065779	+	IGR	INS	-	GT	GT	rs72065344		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:106065778_106065779insGT								GSTO2 (6603 upstream) : ITPRIP (6122 downstream)																																	OREG0020518	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
VTI1A	143187	broad.mit.edu	37	10	114559716	114559717	+	Intron	DEL	AG	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:114559716_114559717delAG	uc001kzz.2	+							NM_145206	NP_660207			SNARE Vti1a-beta protein						intracellular protein transport|retrograde transport, endosome to Golgi	SNARE complex	protein transporter activity|SNAP receptor activity			ovary(1)	1		Colorectal(252;0.0314)|Breast(234;0.183)		Epithelial(162;0.0126)|all cancers(201;0.0487)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	115735614	115735625	+	IGR	DEL	GAGAGAGAAAGA	-	-	rs71007447		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:115735614_115735625delGAGAGAGAAAGA								NHLRC2 (67162 upstream) : ADRB1 (68181 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	118275998	118275998	+	IGR	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:118275998delT								PNLIPRP3 (38532 upstream) : PNLIP (29430 downstream)																																			---	---	---	---
HSPA12A	259217	broad.mit.edu	37	10	118495346	118495347	+	Intron	INS	-	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:118495346_118495347insA	uc001lct.2	-						HSPA12A_uc001lcu.2_Intron	NM_025015	NP_079291			heat shock 70kDa protein 12A								ATP binding			ovary(1)	1				all cancers(201;0.0158)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	120173974	120173979	+	IGR	DEL	GTGTGT	-	-	rs72157931		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:120173974_120173979delGTGTGT								C10orf84 (72135 upstream) : PRLHR (178937 downstream)																																			---	---	---	---
SFXN4	119559	broad.mit.edu	37	10	120909661	120909661	+	Intron	DEL	T	-	-	rs34949099		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:120909661delT	uc001leb.2	-						SFXN4_uc001ldy.2_Intron|SFXN4_uc001ldz.2_Intron|SFXN4_uc001lea.2_Intron	NM_213649	NP_998814			sideroflexin 4						iron ion homeostasis	integral to membrane|mitochondrial membrane	cation transmembrane transporter activity			ovary(1)	1		Lung NSC(174;0.094)|all_lung(145;0.123)		all cancers(201;0.0261)														---	---	---	---
BAG3	9531	broad.mit.edu	37	10	121426059	121426060	+	Intron	INS	-	GTGCTCAGCGAGATGCATGAG	GTGCTCAGCGAGATGCATGAG	rs151175385	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:121426059_121426060insGTGCTCAGCGAGATGCATGAG	uc001lem.2	+						BAG3_uc001lel.2_Intron	NM_004281	NP_004272			BCL2-associated athanogene 3						anti-apoptosis|apoptosis|protein folding	cytosol				ovary(2)	2		Lung NSC(174;0.109)|all_lung(145;0.142)		all cancers(201;0.00187)|BRCA - Breast invasive adenocarcinoma(275;0.148)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	122533594	122533595	+	Intron	DEL	GA	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:122533594_122533595delGA	uc001lfa.1	-						uc001lfb.1_Intron					Homo sapiens cDNA FLJ37330 fis, clone BRAMY2019509.																														---	---	---	---
Unknown	0	broad.mit.edu	37	10	125369296	125369298	+	IGR	DEL	TTG	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:125369296_125369298delTTG								BUB3 (444410 upstream) : GPR26 (56573 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	126073084	126073084	+	IGR	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:126073084delA								CHST15 (219878 upstream) : OAT (12788 downstream)																																			---	---	---	---
LHPP	64077	broad.mit.edu	37	10	126267533	126267533	+	Intron	DEL	G	-	-	rs66829264		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:126267533delG	uc001lhs.1	+						LHPP_uc001lht.1_Intron|LHPP_uc009yai.1_Intron	NM_022126	NP_071409			phospholysine phosphohistidine inorganic						protein dephosphorylation	cytosol|nucleus	inorganic diphosphatase activity|magnesium ion binding|phosphohistidine phosphatase activity|protein homodimerization activity				0		all_lung(145;0.174)|Colorectal(57;0.178)|Glioma(114;0.222)|all_neural(114;0.226)|Lung NSC(174;0.233)		COAD - Colon adenocarcinoma(40;0.163)|Colorectal(40;0.187)														---	---	---	---
FAM53B	9679	broad.mit.edu	37	10	126306691	126306691	+	3'UTR	DEL	A	-	-	rs68133372		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:126306691delA	uc001lhu.1	-	9						NM_014661	NP_055476			hypothetical protein LOC9679											ovary(1)|pancreas(1)	2		all_lung(145;0.0191)|Lung NSC(174;0.0301)|Colorectal(57;0.106)|all_neural(114;0.117)		COAD - Colon adenocarcinoma(40;0.141)|Colorectal(40;0.15)														---	---	---	---
CTBP2	1488	broad.mit.edu	37	10	126711047	126711083	+	Intron	DEL	GGGTACAGGTCAATGAGGAAGGAAGGAAGGAACAGCA	-	-	rs57308644		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:126711047_126711083delGGGTACAGGTCAATGAGGAAGGAAGGAAGGAACAGCA	uc009yak.2	-						CTBP2_uc009yal.2_Intron|CTBP2_uc001lif.3_Intron|CTBP2_uc001lih.3_Intron|CTBP2_uc001lie.3_Intron	NM_001329	NP_001320			C-terminal binding protein 2 isoform 1						negative regulation of cell proliferation|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent|viral genome replication|white fat cell differentiation	cell junction|synapse|transcriptional repressor complex	NAD binding|oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor|protein binding				0		all_lung(145;0.0132)|Lung NSC(174;0.0193)|all_neural(114;0.116)|Colorectal(57;0.173)		Colorectal(40;0.00572)|COAD - Colon adenocarcinoma(40;0.0127)|GBM - Glioblastoma multiforme(135;0.147)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	126959286	126959287	+	IGR	INS	-	GC	GC			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:126959286_126959287insGC								CTBP2 (109662 upstream) : LOC100169752 (303653 downstream)																																			---	---	---	---
DHX32	55760	broad.mit.edu	37	10	127579684	127579685	+	Intron	INS	-	T	T	rs140105042		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:127579684_127579685insT	uc001ljg.1	-							NM_018180	NP_060650			DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 32							mitochondrion|nucleus	ATP binding|helicase activity			breast(2)|ovary(1)|lung(1)	4		all_lung(145;0.00751)|Lung NSC(174;0.0115)|Colorectal(57;0.0846)|all_neural(114;0.0936)																---	---	---	---
DOCK1	1793	broad.mit.edu	37	10	128794799	128794800	+	Intron	INS	-	T	T	rs67529279		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:128794799_128794800insT	uc001ljt.2	+						DOCK1_uc010qun.1_Intron	NM_001380	NP_001371			dedicator of cytokinesis 1						apoptosis|axon guidance|blood coagulation|integrin-mediated signaling pathway|phagocytosis, engulfment|small GTPase mediated signal transduction	cytosol|membrane	GTP binding|GTPase activator activity|GTPase binding|guanyl-nucleotide exchange factor activity|SH3 domain binding			central_nervous_system(4)|ovary(2)|lung(1)|breast(1)|kidney(1)	9		all_epithelial(44;2.3e-07)|all_lung(145;0.00466)|Lung NSC(174;0.00685)|Colorectal(57;0.0107)|Renal(717;0.0113)|Breast(234;0.0492)|all_neural(114;0.108)|all_hematologic(284;0.14)		BRCA - Breast invasive adenocarcinoma(275;0.0221)|Colorectal(40;0.115)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	132320928	132320929	+	IGR	DEL	AC	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:132320928_132320929delAC								GLRX3 (338144 upstream) : TCERG1L (569727 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	132588922	132588922	+	IGR	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:132588922delA								GLRX3 (606138 upstream) : TCERG1L (301734 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	134638600	134638601	+	Intron	DEL	GA	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134638600_134638601delGA	uc010qux.1	-							NM_017609	NP_060079			Homo sapiens cDNA, FLJ17989.																														---	---	---	---
TUBGCP2	10844	broad.mit.edu	37	10	135105966	135105967	+	Intron	INS	-	A	A	rs111433159	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135105966_135105967insA	uc001lmg.1	-						TUBGCP2_uc001lmf.1_5'Flank|TUBGCP2_uc010qvc.1_Intron|TUBGCP2_uc009ybk.1_Intron|TUBGCP2_uc010qvd.1_Intron|TUBGCP2_uc001lmh.1_Intron	NM_006659	NP_006650			tubulin, gamma complex associated protein 2						G2/M transition of mitotic cell cycle|microtubule nucleation|protein complex assembly	centrosome|cytoplasmic microtubule|cytosol|spindle pole	protein binding				0		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.87e-06)|all cancers(32;8.98e-06)|Epithelial(32;1.15e-05)														---	---	---	---
PAOX	196743	broad.mit.edu	37	10	135202325	135202359	+	Intron	DEL	GTCATCCCGGGGCTCTCTTTCTCCATGCAGGTCTG	-	-	rs144417516	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135202325_135202359delGTCATCCCGGGGCTCTCTTTCTCCATGCAGGTCTG	uc001lmv.2	+						PAOX_uc001lmw.2_Intron|PAOX_uc001lmx.2_Intron|PAOX_uc001lmy.2_Intron|PAOX_uc001lmz.2_Intron|PAOX_uc001lna.2_Intron|PAOX_uc001lnb.2_Intron|PAOX_uc001lnc.2_Intron	NM_152911	NP_690875			polyamine oxidase isoform 1						polyamine biosynthetic process|xenobiotic metabolic process	peroxisomal matrix	polyamine oxidase activity				0		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		all cancers(32;4.39e-07)|OV - Ovarian serous cystadenocarcinoma(35;1.21e-06)|Epithelial(32;1.94e-06)														---	---	---	---
FAM99B	100132464	broad.mit.edu	37	11	1707866	1707881	+	5'Flank	DEL	CTTCTTCCCTCCCTCA	-	-	rs113231874		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1707866_1707881delCTTCTTCCCTCCCTCA	uc010qxa.1	-						uc001ltz.1_5'Flank	NR_026642				Homo sapiens family with sequence similarity 99, member B (FAM99B), non-coding RNA.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	11287168	11287169	+	IGR	DEL	TC	-	-	rs138233899		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:11287168_11287169delTC								ZBED5 (407548 upstream) : GALNTL4 (5252 downstream)																																			---	---	---	---
TEAD1	7003	broad.mit.edu	37	11	12900180	12900181	+	Intron	INS	-	T	T	rs139197403	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:12900180_12900181insT	uc001mkj.3	+						TEAD1_uc001mkk.3_5'Flank|TEAD1_uc009ygl.2_5'Flank	NM_021961	NP_068780			TEA domain family member 1						hippo signaling cascade		DNA binding|protein binding|sequence-specific DNA binding transcription factor activity				0				Epithelial(150;0.00223)|BRCA - Breast invasive adenocarcinoma(625;0.236)														---	---	---	---
SAA3P	6290	broad.mit.edu	37	11	18137742	18137745	+	5'Flank	DEL	CACG	-	-	rs141125543		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:18137742_18137745delCACG	uc001mnt.2	-							NR_026576				Homo sapiens truncated serum amyloid A3 precursor (SAA3) mRNA, complete cds.												0																OREG0020820	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
Unknown	0	broad.mit.edu	37	11	22049322	22049322	+	IGR	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:22049322delT								NELL1 (452095 upstream) : ANO5 (165400 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	29715749	29715752	+	IGR	DEL	TGTA	-	-	rs60437853		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:29715749_29715752delTGTA								None (None upstream) : KCNA4 (316014 downstream)																																			---	---	---	---
MPPED2	744	broad.mit.edu	37	11	30606532	30606533	+	Intron	DEL	GT	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:30606532_30606533delGT	uc001msq.3	-						MPPED2_uc009yji.2_5'Flank	NM_001145399	NP_001138871			metallophosphoesterase domain containing 2						nervous system development		hydrolase activity|metal ion binding			skin(1)	1																		---	---	---	---
HIPK3	10114	broad.mit.edu	37	11	33302429	33302429	+	Intron	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:33302429delA	uc001mul.1	+						HIPK3_uc001mum.1_Intron|HIPK3_uc009yjv.1_Intron	NM_005734	NP_005725			homeodomain interacting protein kinase 3 isoform						anti-apoptosis|apoptosis|negative regulation of JUN kinase activity|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm	ATP binding|protein serine/threonine kinase activity			large_intestine(1)|skin(1)|stomach(1)|ovary(1)|pancreas(1)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	42010406	42010407	+	IGR	INS	-	AAAG	AAAG	rs71868073		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:42010406_42010407insAAAG								LRRC4C (529083 upstream) : None (None downstream)																																			---	---	---	---
AGBL2	79841	broad.mit.edu	37	11	47682108	47682109	+	Intron	INS	-	T	T	rs112707895		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47682108_47682109insT	uc001ngg.2	-						AGBL2_uc001ngf.2_Intron	NM_024783	NP_079059			carboxypeptidase 2, cytosolic						proteolysis	cytosol	metallocarboxypeptidase activity|zinc ion binding			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	47933609	47933610	+	IGR	INS	-	AT	AT	rs144562710	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47933609_47933610insAT								NUP160 (63552 upstream) : PTPRJ (68500 downstream)																																			---	---	---	---
LOC440040	440040	broad.mit.edu	37	11	49650713	49650713	+	Intron	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:49650713delT	uc010rhy.1	+						LOC440040_uc009ymb.2_Intron	NR_027044				SubName: Full=cDNA FLJ60249, highly similar to Metabotropic glutamate receptor 5;												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	55529377	55529378	+	IGR	INS	-	G	G			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55529377_55529378insG								OR4C6 (95219 upstream) : OR5D13 (11536 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	55568573	55568576	+	IGR	DEL	GTGT	-	-	rs141163335		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55568573_55568576delGTGT								OR5D14 (4598 upstream) : OR5L1 (10367 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	57412160	57412160	+	Intron	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57412160delT	uc001nkt.1	+											Homo sapiens cDNA FLJ34998 fis, clone OCBBF2011706.																												OREG0020972	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
Unknown	0	broad.mit.edu	37	11	58136183	58136184	+	IGR	INS	-	T	T	rs143981122	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:58136183_58136184insT								OR5B17 (9641 upstream) : OR5B3 (33756 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	59066135	59066136	+	IGR	INS	-	GGAAGGAA	GGAAGGAA	rs36130299		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:59066135_59066136insGGAAGGAA								MPEG1 (85641 upstream) : OR5AN1 (65796 downstream)																																			---	---	---	---
RPLP0P2	113157	broad.mit.edu	37	11	61405251	61405252	+	3'UTR	INS	-	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61405251_61405252insA	uc001nrz.1	+	5						NR_002775				SubName: Full=cDNA FLJ51469, highly similar to 60S acidic ribosomal protein P0;												0																		---	---	---	---
STX5	6811	broad.mit.edu	37	11	62584195	62584195	+	Intron	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62584195delA	uc001nvh.2	-						STX5_uc010rmi.1_Intron|STX5_uc009yoh.2_Intron|STX5_uc001nvi.2_Intron|STX5_uc010rmj.1_Intron|STX5_uc001nvj.2_Intron	NM_003164	NP_003155			syntaxin 5						intracellular protein transport|retrograde transport, endosome to Golgi|vesicle targeting	ER-Golgi intermediate compartment membrane|Golgi membrane|integral to membrane|nucleus|SNARE complex	protein N-terminus binding|SNAP receptor activity			ovary(1)|breast(1)	2																		---	---	---	---
SLC22A9	114571	broad.mit.edu	37	11	63150349	63150349	+	Intron	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:63150349delT	uc001nww.2	+						SLC22A9_uc001nwx.2_Intron	NM_080866	NP_543142			solute carrier family 22 (organic anion/cation						transmembrane transport	integral to membrane				breast(2)|large_intestine(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	63539389	63539394	+	IGR	DEL	AGGAGA	-	-	rs523291		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:63539389_63539394delAGGAGA								C11orf95 (3276 upstream) : C11orf84 (41529 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	65274658	65274658	+	IGR	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65274658delT								MALAT1 (721 upstream) : SCYL1 (17890 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	67518970	67518970	+	IGR	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67518970delA								ALDH3B2 (70285 upstream) : LOC645332 (40270 downstream)																																			---	---	---	---
SUV420H1	51111	broad.mit.edu	37	11	67970013	67970014	+	Intron	INS	-	T	T	rs72077919		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67970013_67970014insT	uc001onm.1	-						SUV420H1_uc001onn.1_Intron|SUV420H1_uc009ysf.2_Intron|SUV420H1_uc001ono.1_Intron|SUV420H1_uc001onp.2_Intron|SUV420H1_uc010rqa.1_Intron|SUV420H1_uc001onq.2_Intron	NM_017635	NP_060105			suppressor of variegation 4-20 homolog 1 isoform						regulation of transcription, DNA-dependent|transcription, DNA-dependent		protein binding			ovary(2)|kidney(1)	3																		---	---	---	---
GAL	51083	broad.mit.edu	37	11	68458593	68458593	+	3'UTR	DEL	T	-	-	rs75147512		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68458593delT	uc001oob.2	+	6						NM_015973	NP_057057			galanin preproprotein						growth hormone secretion|insulin secretion|neuropeptide signaling pathway|smooth muscle contraction	extracellular region	neuropeptide hormone activity				0	Esophageal squamous(3;7.33e-10)	Melanoma(852;0.0749)	LUAD - Lung adenocarcinoma(13;0.0514)	Kidney(183;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(183;3.23e-08)|Lung(977;0.000152)|LUSC - Lung squamous cell carcinoma(976;0.00154)														---	---	---	---
FGF3	2248	broad.mit.edu	37	11	69625580	69625580	+	Intron	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:69625580delA	uc001oph.2	-							NM_005247	NP_005238			fibroblast growth factor 3 precursor						fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|negative regulation of cardiac muscle tissue development|positive regulation of cell division|positive regulation of cell proliferation	extracellular region	growth factor activity			ovary(1)|lung(1)	2			LUSC - Lung squamous cell carcinoma(11;5.05e-15)|STAD - Stomach adenocarcinoma(18;0.0278)															---	---	---	---
ANO1	55107	broad.mit.edu	37	11	69971959	69971959	+	Intron	DEL	C	-	-	rs60749334		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:69971959delC	uc001opj.2	+						ANO1_uc001opk.1_Intron|ANO1_uc001opl.1_Intron|ANO1_uc010rqk.1_Intron	NM_018043	NP_060513			anoctamin 1, calcium activated chloride channel						multicellular organismal development	chloride channel complex|cytoplasm|plasma membrane	intracellular calcium activated chloride channel activity			ovary(1)|pancreas(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	71959982	71959997	+	IGR	DEL	CTTGCTGTGAAGCCTC	-	-	rs147668041	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:71959982_71959997delCTTGCTGTGAAGCCTC								PHOX2A (4762 upstream) : CLPB (43475 downstream)																																			---	---	---	---
ACER3	55331	broad.mit.edu	37	11	76652084	76652085	+	Intron	DEL	CG	-	-	rs66523072		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:76652084_76652085delCG	uc009yum.1	+						ACER3_uc010rsg.1_Intron|ACER3_uc009yul.1_Intron|ACER3_uc001oxu.2_Intron|ACER3_uc009yun.1_Intron|ACER3_uc009yuo.1_Intron|ACER3_uc010rsh.1_Intron|ACER3_uc010rsi.1_Intron|ACER3_uc010rsj.1_Intron	NM_018367	NP_060837			phytoceramidase, alkaline						ceramide metabolic process|phytosphingosine biosynthetic process|positive regulation of cell proliferation|sphingosine biosynthetic process	integral to endoplasmic reticulum membrane|integral to Golgi membrane	phytoceramidase activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	80934407	80934408	+	IGR	INS	-	GT	GT	rs145549275	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:80934407_80934408insGT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	81353720	81353721	+	IGR	DEL	TG	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:81353720_81353721delTG								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	88009656	88009657	+	IGR	DEL	TC	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:88009656_88009657delTC								RAB38 (101057 upstream) : CTSC (17104 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	91733337	91733338	+	IGR	DEL	TG	-	-	rs113111798		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:91733337_91733338delTG								None (None upstream) : FAT3 (351924 downstream)																																			---	---	---	---
FAT3	120114	broad.mit.edu	37	11	92180389	92180390	+	Intron	DEL	GT	-	-	rs34833885		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:92180389_92180390delGT	uc001pdj.3	+							NM_001008781	NP_001008781			FAT tumor suppressor homolog 3						homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|pancreas(1)	5		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)													TCGA Ovarian(4;0.039)			---	---	---	---
Unknown	0	broad.mit.edu	37	11	95357934	95357935	+	IGR	DEL	AT	-	-	rs71040105		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:95357934_95357935delAT								SESN3 (392229 upstream) : FAM76B (144171 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	114382056	114382056	+	IGR	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:114382056delT								REXO2 (61058 upstream) : FAM55A (10382 downstream)																																			---	---	---	---
FAM55A	120400	broad.mit.edu	37	11	114424641	114424642	+	Intron	INS	-	T	T	rs139484758		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:114424641_114424642insT	uc001ppa.2	-						FAM55A_uc001ppb.1_5'UTR	NM_152315	NP_689528			hypothetical protein LOC120400							extracellular region					0		all_cancers(61;8.53e-16)|all_epithelial(67;1.71e-08)|all_hematologic(158;3.05e-05)|Melanoma(852;0.000902)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0194)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Prostate(24;0.0906)		BRCA - Breast invasive adenocarcinoma(274;3.02e-06)|Epithelial(105;0.000144)|all cancers(92;0.00106)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	116566656	116566687	+	IGR	DEL	CTTCCTCCTTCTCTCCATTCTTCCCTTCCTCC	-	-	rs74213851	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:116566656_116566687delCTTCCTCCTTCTCTCCATTCTTCCCTTCCTCC								None (None upstream) : BUD13 (52201 downstream)																																			---	---	---	---
DSCAML1	57453	broad.mit.edu	37	11	117383477	117383478	+	Intron	DEL	CA	-	-	rs72324377		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117383477_117383478delCA	uc001prh.1	-							NM_020693	NP_065744			Down syndrome cell adhesion molecule like 1						axonogenesis|brain development|cell fate determination|dorsal/ventral pattern formation|embryonic skeletal system morphogenesis|homophilic cell adhesion	cell surface|integral to membrane|plasma membrane	protein homodimerization activity			ovary(3)|large_intestine(2)|skin(2)|upper_aerodigestive_tract(1)	8	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)														---	---	---	---
LOC399959	399959	broad.mit.edu	37	11	122201318	122201319	+	Intron	DEL	AC	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:122201318_122201319delAC	uc009zbb.1	-											Homo sapiens cDNA FLJ34394 fis, clone HCHON2000676.												0																		---	---	---	---
VWA5A	4013	broad.mit.edu	37	11	124000864	124000864	+	Intron	DEL	C	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124000864delC	uc001pzu.2	+						VWA5A_uc001pzt.2_Intron	NM_001130142	NP_001123614			BCSC-1 isoform 1											upper_aerodigestive_tract(1)|ovary(1)	2																		---	---	---	---
PKNOX2	63876	broad.mit.edu	37	11	125046849	125046849	+	Intron	DEL	C	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:125046849delC	uc001qbu.2	+						PKNOX2_uc010saz.1_Intron|PKNOX2_uc010sba.1_Intron|PKNOX2_uc010sbb.1_Intron	NM_022062	NP_071345			PBX/knotted 1 homeobox 2							nucleus	sequence-specific DNA binding transcription factor activity			ovary(3)	3		Breast(109;0.00234)|all_lung(97;0.0191)|Lung NSC(97;0.0196)|Medulloblastoma(222;0.0447)|all_neural(223;0.116)		BRCA - Breast invasive adenocarcinoma(274;5.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.117)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	130420742	130420744	+	IGR	DEL	TCC	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:130420742_130420744delTCC								ADAMTS15 (77027 upstream) : SNX19 (325023 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	133885422	133885422	+	IGR	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:133885422delA								IGSF9B (58542 upstream) : LOC100128239 (16745 downstream)																																			---	---	---	---
CACNA1C	775	broad.mit.edu	37	12	2547523	2547525	+	Intron	DEL	TAA	-	-	rs61537036		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:2547523_2547525delTAA	uc009zdu.1	+						CACNA1C_uc009zdv.1_Intron|CACNA1C_uc001qkb.2_Intron|CACNA1C_uc001qkc.2_Intron|CACNA1C_uc001qke.2_Intron|CACNA1C_uc001qkf.2_Intron|CACNA1C_uc001qjz.2_Intron|CACNA1C_uc001qkd.2_Intron|CACNA1C_uc001qkg.2_Intron|CACNA1C_uc009zdw.1_Intron|CACNA1C_uc001qkh.2_Intron|CACNA1C_uc001qkl.2_Intron|CACNA1C_uc001qkn.2_Intron|CACNA1C_uc001qko.2_Intron|CACNA1C_uc001qkp.2_Intron|CACNA1C_uc001qkr.2_Intron|CACNA1C_uc001qku.2_Intron|CACNA1C_uc001qkq.2_Intron|CACNA1C_uc001qks.2_Intron|CACNA1C_uc001qkt.2_Intron|CACNA1C_uc001qka.1_Intron|CACNA1C_uc001qki.1_Intron|CACNA1C_uc001qkj.1_Intron|CACNA1C_uc001qkk.1_Intron|CACNA1C_uc001qkm.1_Intron	NM_199460	NP_955630			calcium channel, voltage-dependent, L type,						axon guidance|calcium ion transport into cytosol|energy reserve metabolic process|regulation of insulin secretion	cytoplasm|postsynaptic density|voltage-gated calcium channel complex	calmodulin binding|voltage-gated calcium channel activity			ovary(10)|central_nervous_system(1)	11			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Mibefradil(DB01388)|Nicardipine(DB00622)|Verapamil(DB00661)													---	---	---	---
Unknown	0	broad.mit.edu	37	12	2882329	2882329	+	IGR	DEL	C	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:2882329delC								CACNA1C (75214 upstream) : FKBP4 (21779 downstream)																																			---	---	---	---
STYK1	55359	broad.mit.edu	37	12	10814842	10814843	+	Intron	INS	-	AG	AG	rs150556988	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:10814842_10814843insAG	uc001qys.2	-							NM_018423	NP_060893			serine/threonine/tyrosine kinase 1							integral to membrane|plasma membrane	ATP binding|non-membrane spanning protein tyrosine kinase activity			central_nervous_system(3)|ovary(2)|lung(2)|breast(1)	8															HNSCC(73;0.22)			---	---	---	---
PRB4	5545	broad.mit.edu	37	12	11140142	11140143	+	Intron	DEL	AG	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:11140142_11140143delAG	uc001qzf.1	-						PRR4_uc009zhp.2_Intron|PRH1_uc001qzb.3_Intron|PRH1_uc001qzc.2_Intron|PRH1_uc001qzj.2_Intron|TAS2R50_uc001qzl.2_5'Flank	NM_002723	NP_002714			proline-rich protein BstNI subfamily 4							extracellular region				ovary(1)	1															HNSCC(22;0.051)			---	---	---	---
MGP	4256	broad.mit.edu	37	12	15037011	15037011	+	Intron	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:15037011delA	uc001rcn.1	-							NM_000900	NP_000891			matrix Gla protein precursor						cartilage condensation|cell differentiation|ossification|regulation of bone mineralization	proteinaceous extracellular matrix	calcium ion binding|extracellular matrix structural constituent|structural constituent of bone			ovary(1)	1																		---	---	---	---
SLCO1C1	53919	broad.mit.edu	37	12	20856890	20856891	+	Intron	DEL	TG	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:20856890_20856891delTG	uc001rej.3	+						SLCO1C1_uc010sii.1_Intron|SLCO1C1_uc010sij.1_Intron|SLCO1C1_uc009zip.2_Intron|SLCO1C1_uc001rei.2_Intron|SLCO1C1_uc010sik.1_Intron	NM_017435	NP_059131			solute carrier organic anion transporter family,						sodium-independent organic anion transport	integral to membrane|plasma membrane	thyroid hormone transmembrane transporter activity			ovary(5)|pancreas(1)|skin(1)	7	Esophageal squamous(101;0.149)																	---	---	---	---
Unknown	0	broad.mit.edu	37	12	21261110	21261111	+	IGR	INS	-	AC	AC	rs147783581	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:21261110_21261111insAC								SLCO1B3 (18072 upstream) : SLCO1B1 (23017 downstream)																																			---	---	---	---
ST8SIA1	6489	broad.mit.edu	37	12	22382155	22382155	+	Intron	DEL	G	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:22382155delG	uc001rfo.3	-						ST8SIA1_uc009zix.2_Intron	NM_003034	NP_003025			alpha-2,8-sialyltransferase 1						glycosphingolipid biosynthetic process|protein glycosylation	integral to Golgi membrane	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity			ovary(3)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	22863783	22863783	+	IGR	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:22863783delT								ETNK1 (20176 upstream) : SOX5 (821449 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	23187686	23187689	+	Intron	DEL	CTTT	-	-	rs72496365		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:23187686_23187689delCTTT	uc001rfu.1	+											Homo sapiens cDNA FLJ37414 fis, clone BRAWH1000157.																														---	---	---	---
Unknown	0	broad.mit.edu	37	12	23286542	23286542	+	Intron	DEL	G	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:23286542delG	uc001rfu.1	+											Homo sapiens cDNA FLJ37414 fis, clone BRAWH1000157.																														---	---	---	---
Unknown	0	broad.mit.edu	37	12	25993970	25993970	+	IGR	DEL	G	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:25993970delG								IFLTD1 (192482 upstream) : RASSF8 (117999 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	27218808	27218808	+	IGR	DEL	G	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:27218808delG								MED21 (36126 upstream) : C12orf71 (15183 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	37991301	37991301	+	IGR	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:37991301delT								None (None upstream) : ALG10B (719256 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	45312299	45312300	+	IGR	DEL	TA	-	-	rs2731060		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:45312299_45312300delTA								NELL2 (4588 upstream) : DBX2 (96239 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	47145224	47145225	+	IGR	DEL	CT	-	-	rs61567424		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:47145224_47145225delCT								SLC38A2 (378579 upstream) : SLC38A4 (13319 downstream)																																			---	---	---	---
CALCOCO1	57658	broad.mit.edu	37	12	54108990	54108991	+	Frame_Shift_Del	DEL	AG	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54108990_54108991delAG	uc001sef.2	-	10	1523_1524	c.1379_1380delCT	c.(1378-1380)TCTfs	p.S460fs	CALCOCO1_uc001see.2_5'Flank|CALCOCO1_uc010som.1_Frame_Shift_Del_p.S375fs|CALCOCO1_uc010son.1_Frame_Shift_Del_p.S337fs|CALCOCO1_uc001seh.2_Frame_Shift_Del_p.S460fs|CALCOCO1_uc009znd.2_Frame_Shift_Del_p.S460fs|CALCOCO1_uc001seg.2_Frame_Shift_Del_p.S285fs|CALCOCO1_uc010soo.1_Frame_Shift_Del_p.S453fs	NM_020898	NP_065949	Q9P1Z2	CACO1_HUMAN	coiled-coil transcriptional coactivator isoform	460	Potential.				steroid hormone receptor signaling pathway|transcription, DNA-dependent|Wnt receptor signaling pathway	cytoplasm	armadillo repeat domain binding|beta-catenin binding|ligand-dependent nuclear receptor transcription coactivator activity|protein C-terminus binding|sequence-specific DNA binding|transcription regulatory region DNA binding			ovary(1)	1																		---	---	---	---
PA2G4	5036	broad.mit.edu	37	12	56502909	56502909	+	Intron	DEL	A	-	-	rs71706474		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56502909delA	uc001sjm.2	+						PA2G4_uc009zol.2_Intron|PA2G4_uc009zom.2_Intron	NM_006191	NP_006182			ErbB3-binding protein 1						cell cycle arrest|cell proliferation|negative regulation of transcription, DNA-dependent|regulation of translation|rRNA processing	cytoplasm|nucleolus|ribonucleoprotein complex	DNA binding|RNA binding|sequence-specific DNA binding transcription factor activity|ubiquitin protein ligase binding				0			OV - Ovarian serous cystadenocarcinoma(18;0.0739)															---	---	---	---
APOF	319	broad.mit.edu	37	12	56759255	56759256	+	5'Flank	INS	-	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56759255_56759256insT	uc001sle.1	-							NM_001638	NP_001629			apolipoprotein F precursor						cholesterol metabolic process	high-density lipoprotein particle|low-density lipoprotein particle	cholesterol binding|lipid transporter activity|receptor binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	58065357	58065358	+	IGR	INS	-	AAAG	AAAG	rs150140755		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:58065357_58065358insAAAG								B4GALNT1 (38372 upstream) : OS9 (22528 downstream)																																			---	---	---	---
LRIG3	121227	broad.mit.edu	37	12	59316608	59316610	+	5'Flank	DEL	CAC	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:59316608_59316610delCAC	uc001sqr.2	-						LRIG3_uc010ssh.1_5'Flank	NM_153377	NP_700356			leucine-rich repeats and immunoglobulin-like							integral to membrane				skin(3)|ovary(1)	4			GBM - Glioblastoma multiforme(1;1.17e-18)															---	---	---	---
Unknown	0	broad.mit.edu	37	12	59900901	59900902	+	IGR	INS	-	TG	TG	rs145426343	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:59900901_59900902insTG								LRIG3 (586639 upstream) : SLC16A7 (88946 downstream)																																			---	---	---	---
DPY19L2	283417	broad.mit.edu	37	12	64020321	64020321	+	Intron	DEL	C	-	-	rs7310030	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:64020321delC	uc001srp.1	-						DPY19L2_uc009zqk.1_Intron	NM_173812	NP_776173			dpy-19-like 2						multicellular organismal development|spermatid development	integral to membrane				central_nervous_system(1)|skin(1)	2			GBM - Glioblastoma multiforme(1;2.77e-05)	GBM - Glioblastoma multiforme(28;0.044)														---	---	---	---
C12orf66	144577	broad.mit.edu	37	12	64599539	64599540	+	Intron	INS	-	GGAAGGAAGGAAAAAGGGAAGGAAGGAAAAAGGGAAGGAA	GGAAGGAAGGAAAAAGGGAAGGAAGGAAAAAGGGAAGGAA	rs72194087		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:64599539_64599540insGGAAGGAAGGAAAAAGGGAAGGAAGGAAAAAGGGAAGGAA	uc001srw.3	-						C12orf66_uc009zql.2_Intron	NM_152440	NP_689653			hypothetical protein LOC144577											ovary(1)	1																		---	---	---	---
C12orf56	115749	broad.mit.edu	37	12	64712546	64712547	+	Intron	INS	-	GTT	GTT	rs143777478	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:64712546_64712547insGTT	uc001ssa.3	-						uc001srx.2_Intron	NM_001099676	NP_001093146			hypothetical protein LOC115749												0			GBM - Glioblastoma multiforme(3;0.000582)	GBM - Glioblastoma multiforme(28;0.0259)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	68844820	68844821	+	IGR	INS	-	A	A	rs144283854		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:68844820_68844821insA								MDM1 (118659 upstream) : RAP1B (159831 downstream)																																			---	---	---	---
CNOT2	4848	broad.mit.edu	37	12	70732794	70732795	+	Intron	INS	-	TGTG	TGTG	rs143055295	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:70732794_70732795insTGTG	uc001svv.2	+						CNOT2_uc009zro.2_Intron|CNOT2_uc009zrp.2_Intron|CNOT2_uc009zrq.2_Intron|CNOT2_uc001svw.1_Intron	NM_014515	NP_055330			CCR4-NOT transcription complex, subunit 2						nuclear-transcribed mRNA poly(A) tail shortening|regulation of transcription from RNA polymerase II promoter	cytosol|nucleus	protein binding|RNA polymerase II transcription cofactor activity				0	Renal(347;0.236)		GBM - Glioblastoma multiforme(1;4.77e-09)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00243)|STAD - Stomach adenocarcinoma(21;0.0118)															---	---	---	---
PTPRB	5787	broad.mit.edu	37	12	70922690	70922691	+	Intron	INS	-	GAAA	GAAA	rs142652430	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:70922690_70922691insGAAA	uc001swb.3	-						uc001svz.2_Intron|PTPRB_uc010sto.1_Intron|PTPRB_uc010stp.1_Intron|PTPRB_uc001swc.3_Intron|PTPRB_uc001swa.3_Intron	NM_002837	NP_002828			protein tyrosine phosphatase, receptor type, B						angiogenesis	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(2)|skin(1)	3	Renal(347;0.236)		GBM - Glioblastoma multiforme(2;2.17e-05)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00306)|STAD - Stomach adenocarcinoma(21;0.149)															---	---	---	---
TSPAN8	7103	broad.mit.edu	37	12	71573754	71573755	+	Intron	INS	-	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:71573754_71573755insA	uc001swk.1	-							NM_004616	NP_004607			transmembrane 4 superfamily member 3						protein glycosylation	integral to membrane|lysosome	signal transducer activity			skin(2)|lung(1)|central_nervous_system(1)	4			LUSC - Lung squamous cell carcinoma(43;0.24)|OV - Ovarian serous cystadenocarcinoma(12;0.244)															---	---	---	---
LOC283392	283392	broad.mit.edu	37	12	72666481	72666483	+	Intron	DEL	AAG	-	-	rs111457826		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:72666481_72666483delAAG	uc010stv.1	-						TRHDE_uc001sxa.2_5'Flank	NR_026836				Homo sapiens thyrotropin-releasing hormone degrading enzyme, mRNA (cDNA clone IMAGE:4992272).												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	74338944	74338945	+	IGR	INS	-	ACAC	ACAC	rs138798661	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:74338944_74338945insACAC								None (None upstream) : ATXN7L3B (592606 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	75228003	75228004	+	IGR	INS	-	CTTG	CTTG	rs112493946	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:75228003_75228004insCTTG								ATXN7L3B (292780 upstream) : KCNC2 (205893 downstream)																																			---	---	---	---
E2F7	144455	broad.mit.edu	37	12	77450955	77450956	+	Intron	DEL	CC	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:77450955_77450956delCC	uc001sym.3	-						E2F7_uc001syn.2_Intron	NM_203394	NP_976328			E2F transcription factor 7						cell cycle	transcription factor complex	DNA binding|identical protein binding			upper_aerodigestive_tract(1)|ovary(1)|kidney(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	77581522	77581522	+	IGR	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:77581522delA								E2F7 (122162 upstream) : NAV3 (643547 downstream)																																			---	---	---	---
NAV3	89795	broad.mit.edu	37	12	78589518	78589518	+	Intron	DEL	C	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:78589518delC	uc001syp.2	+						NAV3_uc001syo.2_Intron|NAV3_uc010sub.1_Intron|NAV3_uc009zsf.2_Intron	NM_014903	NP_055718			neuron navigator 3							nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity			large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17															HNSCC(70;0.22)			---	---	---	---
PPP1R12A	4659	broad.mit.edu	37	12	80206163	80206164	+	Intron	DEL	TG	-	-	rs3838350		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:80206163_80206164delTG	uc001syz.2	-						PPP1R12A_uc010suc.1_Intron|PPP1R12A_uc001sza.2_Intron|PPP1R12A_uc010sud.1_Intron|PPP1R12A_uc001szb.2_Intron|PPP1R12A_uc001szc.2_Intron	NM_002480	NP_002471			protein phosphatase 1, regulatory (inhibitor)							contractile fiber	protein binding|signal transducer activity			ovary(2)|breast(2)|large_intestine(1)|central_nervous_system(1)|skin(1)	7																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	82405373	82405374	+	IGR	DEL	CA	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:82405373_82405374delCA								PPFIA2 (252264 upstream) : CCDC59 (340716 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	85365644	85365644	+	IGR	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:85365644delT								SLC6A15 (59038 upstream) : TSPAN19 (42451 downstream)																																			---	---	---	---
TMCC3	57458	broad.mit.edu	37	12	95006098	95006098	+	Intron	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:95006098delT	uc001tdj.2	-						TMCC3_uc001tdi.2_Intron	NM_020698	NP_065749			transmembrane and coiled-coil domain family 3							integral to membrane				ovary(1)|skin(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	96565730	96565730	+	IGR	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:96565730delT								LTA4H (128432 upstream) : ELK3 (22477 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	98744772	98744772	+	IGR	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:98744772delT								RMST (785979 upstream) : LOC100128191 (161981 downstream)																																			---	---	---	---
SCYL2	55681	broad.mit.edu	37	12	100709198	100709198	+	Intron	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:100709198delA	uc001thn.2	+						SCYL2_uc009ztw.1_Intron|SCYL2_uc001thm.1_Intron	NM_017988	NP_060458			SCY1-like 2 protein						endosome to lysosome transport|negative regulation of canonical Wnt receptor signaling pathway|positive regulation of clathrin-mediated endocytosis|positive regulation of receptor internalization	clathrin-coated vesicle|endosome membrane|Golgi apparatus|perinuclear region of cytoplasm	ATP binding|protein kinase activity|receptor binding			lung(3)|ovary(2)|skin(1)	6																		---	---	---	---
GAS2L3	283431	broad.mit.edu	37	12	101016354	101016355	+	Intron	INS	-	CA	CA	rs143608889	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:101016354_101016355insCA	uc001thu.2	+						GAS2L3_uc009zty.2_Intron|GAS2L3_uc001thv.2_Intron	NM_174942	NP_777602			growth arrest-specific 2 like 3						cell cycle arrest					skin(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	103534608	103534609	+	IGR	DEL	AC	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:103534608_103534609delAC								ASCL1 (180321 upstream) : C12orf42 (96761 downstream)																																			---	---	---	---
FOXN4	121643	broad.mit.edu	37	12	109722718	109722719	+	Intron	DEL	TG	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109722718_109722719delTG	uc001toe.3	-						FOXN4_uc009zvg.2_Intron|FOXN4_uc001tof.3_Intron	NM_213596	NP_998761			forkhead box N4						axon extension|embryo development|organ development|pattern specification process|regulation of heart contraction|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			ovary(1)|lung(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	111452322	111452323	+	IGR	INS	-	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:111452322_111452323insA								MYL2 (93918 upstream) : CUX2 (19506 downstream)																																			---	---	---	---
DTX1	1840	broad.mit.edu	37	12	113522801	113522802	+	Intron	DEL	CA	-	-	rs141769768		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:113522801_113522802delCA	uc001tuk.1	+							NM_004416	NP_004407			deltex homolog 1						negative regulation of neuron differentiation|Notch signaling pathway|regulation of Notch signaling pathway|transcription from RNA polymerase II promoter	cytoplasm|nucleus	Notch binding|SH3 domain binding|transcription coactivator activity|ubiquitin protein ligase binding|zinc ion binding			lung(2)|ovary(1)|central_nervous_system(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	117146438	117146439	+	IGR	DEL	CT	-	-	rs71442994		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:117146438_117146439delCT								MAP1LC3B2 (132013 upstream) : C12orf49 (7157 downstream)																																			---	---	---	---
RNFT2	84900	broad.mit.edu	37	12	117256126	117256126	+	Intron	DEL	A	-	-	rs34902759		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:117256126delA	uc009zwn.2	+						RNFT2_uc001twb.3_Intron|RNFT2_uc001twa.3_Intron|RNFT2_uc001twc.3_Intron	NM_001109903	NP_001103373			transmembrane protein 118 isoform 1							integral to membrane	zinc ion binding				0	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.034)														---	---	---	---
FBXO21	23014	broad.mit.edu	37	12	117595441	117595443	+	Intron	DEL	ACT	-	-	rs11068378		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:117595441_117595443delACT	uc001twk.2	-						FBXO21_uc001twj.2_Intron|FBXO21_uc009zwq.2_Intron|FBXO21_uc001twl.1_Intron	NM_033624	NP_296373			F-box only protein 21 isoform 1						ubiquitin-dependent protein catabolic process	ubiquitin ligase complex	ubiquitin-protein ligase activity			kidney(1)	1	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0291)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	119362361	119362362	+	IGR	DEL	TC	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:119362361_119362362delTC								SUDS3 (506522 upstream) : SRRM4 (57034 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	120369020	120369021	+	IGR	INS	-	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120369020_120369021insA								CIT (53928 upstream) : CCDC64 (58627 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	120725824	120725824	+	IGR	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120725824delA								NME2P1 (5192 upstream) : SIRT4 (14339 downstream)																																			---	---	---	---
GTF2H3	2967	broad.mit.edu	37	12	124124884	124124885	+	Intron	INS	-	T	T	rs113172297		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124124884_124124885insT	uc001ufo.1	+						GTF2H3_uc010tau.1_Intron	NM_001516	NP_001507			general transcription factor IIH, polypeptide 3,						mRNA capping|nucleotide-excision repair, DNA damage removal|positive regulation of viral transcription|protein phosphorylation|termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase I promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	core TFIIH complex|holo TFIIH complex	damaged DNA binding|metal ion binding|protein N-terminus binding|sequence-specific DNA binding transcription factor activity|translation factor activity, nucleic acid binding				0	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.1e-05)|Epithelial(86;0.000388)|all cancers(50;0.00362)									NER					---	---	---	---
TCTN2	79867	broad.mit.edu	37	12	124172778	124172779	+	Intron	INS	-	A	A	rs58689399		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124172778_124172779insA	uc001ufp.2	+						TCTN2_uc009zya.2_Intron	NM_024809	NP_079085			tectonic family member 2 isoform 1						cilium assembly|smoothened signaling pathway	integral to membrane				ovary(1)	1	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000163)|Epithelial(86;0.000502)|all cancers(50;0.00451)														---	---	---	---
TMEM132C	92293	broad.mit.edu	37	12	129148258	129148259	+	Intron	INS	-	TGTC	TGTC	rs139828776	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:129148258_129148259insTGTC	uc001uhs.3	+							NM_001136103	NP_001129575			transmembrane protein 132C							integral to membrane				central_nervous_system(1)	1																		---	---	---	---
RIMBP2	23504	broad.mit.edu	37	12	130967413	130967414	+	Intron	DEL	TG	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:130967413_130967414delTG	uc001uil.2	-						RIMBP2_uc001uim.2_Intron	NM_015347	NP_056162			RIM-binding protein 2							cell junction|synapse				upper_aerodigestive_tract(3)|ovary(3)|large_intestine(2)|central_nervous_system(2)|pancreas(1)	11	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.213)		OV - Ovarian serous cystadenocarcinoma(86;4.29e-06)|all cancers(50;4.56e-05)|Epithelial(86;5.41e-05)														---	---	---	---
RIMBP2	23504	broad.mit.edu	37	12	131188380	131188381	+	Intron	DEL	TC	-	-	rs57727325		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:131188380_131188381delTC	uc001uim.2	-											RecName: Full=RIMS-binding protein 2;          Short=RIM-BP2;							cell junction|synapse				upper_aerodigestive_tract(3)|ovary(3)|large_intestine(2)|central_nervous_system(2)|pancreas(1)	11	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.213)		OV - Ovarian serous cystadenocarcinoma(86;4.29e-06)|all cancers(50;4.56e-05)|Epithelial(86;5.41e-05)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	131939618	131939618	+	IGR	DEL	C	-	-	rs36096743		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:131939618delC								LOC116437 (242143 upstream) : SFRS8 (256017 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	133188309	133188312	+	IGR	DEL	AGTT	-	-	rs143873547		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:133188309_133188312delAGTT								FBRSL1 (26538 upstream) : P2RX2 (7091 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	19705063	19705064	+	IGR	INS	-	T	T	rs138613172	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:19705063_19705064insT								DKFZp686A1627 (12640 upstream) : TUBA3C (42856 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	23508009	23508010	+	IGR	DEL	AT	-	-	rs145136706		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:23508009_23508010delAT								None (None upstream) : SGCG (247050 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	23514542	23514542	+	IGR	DEL	A	-	-	rs143980667	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:23514542delA								None (None upstream) : SGCG (240518 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	26597384	26597384	+	IGR	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:26597384delA								ATP8A2 (1965 upstream) : SHISA2 (21351 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	30542850	30542851	+	IGR	INS	-	A	A	rs35291114		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:30542850_30542851insA								UBL3 (118030 upstream) : KATNAL1 (233917 downstream)																																			---	---	---	---
KATNAL1	84056	broad.mit.edu	37	13	30859461	30859463	+	Intron	DEL	CAC	-	-	rs34730544		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:30859461_30859463delCAC	uc001uss.2	-						KATNAL1_uc001ust.2_Intron	NM_001014380	NP_001014402			katanin p60 subunit A-like 1							cytoplasm|microtubule	ATP binding|microtubule-severing ATPase activity				0		Lung SC(185;0.0257)		all cancers(112;0.114)|OV - Ovarian serous cystadenocarcinoma(117;0.213)														---	---	---	---
PDS5B	23047	broad.mit.edu	37	13	33315189	33315190	+	Intron	INS	-	T	T	rs2320470		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:33315189_33315190insT	uc010abf.2	+						PDS5B_uc010abg.2_Intron	NM_015032	NP_055847			PDS5, regulator of cohesion maintenance, homolog						cell division|cell proliferation|mitotic sister chromatid cohesion|negative regulation of cell proliferation	chromatin|nucleus	ATP binding|DNA binding|identical protein binding			ovary(2)|lung(1)|pancreas(1)	4		Lung SC(185;0.0367)		all cancers(112;5.55e-06)|Epithelial(112;2.7e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00303)|BRCA - Breast invasive adenocarcinoma(63;0.0204)														---	---	---	---
DGKH	160851	broad.mit.edu	37	13	42781332	42781333	+	Intron	INS	-	C	C			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:42781332_42781333insC	uc001uyl.1	+						DGKH_uc010tfh.1_Intron|DGKH_uc001uym.1_Intron|DGKH_uc010tfi.1_Intron|DGKH_uc010tfj.1_Intron|DGKH_uc001uyn.1_Intron|DGKH_uc001uyo.1_Intron|DGKH_uc001uyp.2_Intron	NM_178009	NP_821077			diacylglycerol kinase, eta isoform 2						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation|protein oligomerization	endosome|plasma membrane	ATP binding|diacylglycerol kinase activity|metal ion binding			ovary(2)	2		Lung NSC(96;1.02e-05)|Prostate(109;0.0168)|Lung SC(185;0.0262)|Breast(139;0.0709)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;5.88e-05)|GBM - Glioblastoma multiforme(144;0.000935)|BRCA - Breast invasive adenocarcinoma(63;0.109)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	48184990	48184992	+	IGR	DEL	CAC	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:48184990_48184992delCAC								HTR2A (713940 upstream) : SUCLA2 (331800 downstream)																																			---	---	---	---
NEK5	341676	broad.mit.edu	37	13	52702331	52702332	+	Intron	INS	-	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:52702331_52702332insT	uc001vge.2	-						NEK5_uc001vgf.2_5'Flank	NM_199289	NP_954983			NIMA-related kinase 5								ATP binding|metal ion binding|protein serine/threonine kinase activity			upper_aerodigestive_tract(1)	1		Breast(56;0.00173)|Lung NSC(96;0.0168)|Prostate(109;0.0412)|Hepatocellular(98;0.152)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(99;3.7e-08)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	54591861	54591862	+	IGR	INS	-	GGAA	GGAA	rs145327528	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:54591861_54591862insGGAA								OLFM4 (965675 upstream) : MIR1297 (294245 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	57299218	57299218	+	IGR	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:57299218delA								None (None upstream) : PRR20C (415834 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	59236888	59236889	+	IGR	INS	-	AAAG	AAAG			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:59236888_59236889insAAAG								PCDH17 (933823 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	60229473	60229473	+	IGR	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:60229473delA								None (None upstream) : DIAPH3 (10252 downstream)																																			---	---	---	---
DIAPH3	81624	broad.mit.edu	37	13	60688777	60688778	+	Intron	DEL	AC	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:60688777_60688778delAC	uc001vht.2	-						DIAPH3_uc001vhw.1_Intron|DIAPH3_uc010aed.1_Intron|DIAPH3_uc010aee.1_Intron	NM_001042517	NP_001035982			diaphanous homolog 3 isoform a						actin cytoskeleton organization		actin binding|Rho GTPase binding			ovary(2)	2		Breast(118;0.052)|Prostate(109;0.103)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;2.77e-05)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	61266699	61266699	+	IGR	DEL	G	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:61266699delG								TDRD3 (118687 upstream) : PCDH20 (717122 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	63619081	63619082	+	IGR	INS	-	AGATAAAAC	AGATAAAAC	rs139719340		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:63619081_63619082insAGATAAAAC								None (None upstream) : OR7E156P (692486 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	68996354	68996354	+	IGR	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:68996354delT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	70200584	70200585	+	IGR	DEL	TC	-	-	rs113826153		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:70200584_70200585delTC								None (None upstream) : KLHL1 (74141 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	73131417	73131417	+	IGR	DEL	G	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:73131417delG								DACH1 (690087 upstream) : C13orf37 (151078 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	77949193	77949194	+	IGR	DEL	TG	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:77949193_77949194delTG								MYCBP2 (48016 upstream) : SCEL (160615 downstream)																																			---	---	---	---
SLAIN1	122060	broad.mit.edu	37	13	78282938	78282938	+	Intron	DEL	G	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:78282938delG	uc010thy.1	+						SLAIN1_uc001vkk.1_Intron	NM_144595	NP_653196			SLAIN motif family, member 1 B											ovary(1)|skin(1)	2		Acute lymphoblastic leukemia(28;0.0279)|Breast(118;0.037)		GBM - Glioblastoma multiforme(99;0.0853)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	80896551	80896552	+	IGR	INS	-	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:80896551_80896552insA								NDFIP2 (766346 upstream) : SPRY2 (13562 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	88671875	88671875	+	IGR	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:88671875delT								SLITRK5 (340007 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	91709950	91709954	+	IGR	DEL	GGAAA	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:91709950_91709954delGGAAA								LOC144776 (131099 upstream) : MIR17HG (290120 downstream)																																			---	---	---	---
GPC5	2262	broad.mit.edu	37	13	93073952	93073952	+	Intron	DEL	A	-	-	rs34055682		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:93073952delA	uc010tif.1	+							NM_004466	NP_004457			glypican 5 precursor							anchored to membrane|extracellular space|integral to plasma membrane|proteinaceous extracellular matrix	heparan sulfate proteoglycan binding			ovary(2)|skin(2)|upper_aerodigestive_tract(1)	5	all_cancers(3;1.43e-07)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)	Lung NSC(4;0.00454)																---	---	---	---
GPC6	10082	broad.mit.edu	37	13	94670547	94670547	+	Intron	DEL	T	-	-	rs113742518		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:94670547delT	uc001vlt.2	+						GPC6_uc010tig.1_Intron	NM_005708	NP_005699			glypican 6 precursor							anchored to membrane|extracellular space|integral to plasma membrane|proteinaceous extracellular matrix	heparan sulfate proteoglycan binding				0	all_neural(89;0.0684)|Medulloblastoma(90;0.163)	all_cancers(2;5.48e-07)|all_epithelial(2;5.69e-08)|all_lung(2;2.19e-05)|Lung NSC(4;6.09e-05)|Breast(118;0.0395)|Renal(2;0.0568)|Hepatocellular(115;0.217)																---	---	---	---
GPC6	10082	broad.mit.edu	37	13	94964972	94964973	+	Intron	INS	-	CG	CG	rs139235981	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:94964972_94964973insCG	uc001vlt.2	+							NM_005708	NP_005699			glypican 6 precursor							anchored to membrane|extracellular space|integral to plasma membrane|proteinaceous extracellular matrix	heparan sulfate proteoglycan binding				0	all_neural(89;0.0684)|Medulloblastoma(90;0.163)	all_cancers(2;5.48e-07)|all_epithelial(2;5.69e-08)|all_lung(2;2.19e-05)|Lung NSC(4;6.09e-05)|Breast(118;0.0395)|Renal(2;0.0568)|Hepatocellular(115;0.217)																---	---	---	---
Unknown	0	broad.mit.edu	37	13	95646211	95646211	+	IGR	DEL	A	-	-	rs71657062		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:95646211delA								SOX21 (281822 upstream) : ABCC4 (25873 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	97595087	97595087	+	IGR	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:97595087delA								HS6ST3 (103276 upstream) : OXGR1 (42886 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	100129545	100129546	+	IGR	DEL	GT	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:100129545_100129546delGT								UBAC2 (90794 upstream) : TM9SF2 (24182 downstream)																																			---	---	---	---
PCCA	5095	broad.mit.edu	37	13	100884602	100884603	+	Intron	INS	-	TGCGTG	TGCGTG	rs142463564		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:100884602_100884603insTGCGTG	uc001voo.2	+						PCCA_uc010aga.2_Intron|PCCA_uc010tiz.1_Intron	NM_000282	NP_000273			propionyl-Coenzyme A carboxylase, alpha						fatty acid beta-oxidation	mitochondrial matrix	ATP binding|biotin binding|biotin carboxylase activity|enzyme binding|metal ion binding|propionyl-CoA carboxylase activity			skin(2)	2	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)				Biotin(DB00121)													---	---	---	---
PCCA	5095	broad.mit.edu	37	13	101134523	101134523	+	Intron	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:101134523delA	uc001voo.2	+						PCCA_uc010aga.2_Intron|PCCA_uc010tiz.1_Intron|PCCA_uc001vop.2_Intron	NM_000282	NP_000273			propionyl-Coenzyme A carboxylase, alpha						fatty acid beta-oxidation	mitochondrial matrix	ATP binding|biotin binding|biotin carboxylase activity|enzyme binding|metal ion binding|propionyl-CoA carboxylase activity			skin(2)	2	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)				Biotin(DB00121)													---	---	---	---
TPP2	7174	broad.mit.edu	37	13	103303930	103303930	+	Intron	DEL	T	-	-	rs67874395		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:103303930delT	uc001vpi.3	+							NM_003291	NP_003282			tripeptidyl peptidase II						proteolysis	cytoplasm|nucleus	aminopeptidase activity|serine-type endopeptidase activity|tripeptidyl-peptidase activity			upper_aerodigestive_tract(1)|ovary(1)	2	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)																	---	---	---	---
Unknown	0	broad.mit.edu	37	13	107807001	107807004	+	IGR	DEL	TGTG	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:107807001_107807004delTGTG								ARGLU1 (586487 upstream) : FAM155A (13876 downstream)																																			---	---	---	---
MYO16	23026	broad.mit.edu	37	13	109628613	109628614	+	Intron	DEL	TC	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:109628613_109628614delTC	uc001vqt.1	+						MYO16_uc010agk.1_Intron|MYO16_uc001vqu.1_Intron|MYO16_uc010tjh.1_Intron	NM_015011	NP_055826			myosin heavy chain Myr 8						cerebellum development|negative regulation of cell proliferation|negative regulation of S phase of mitotic cell cycle	myosin complex|nucleoplasm|perinuclear region of cytoplasm|plasma membrane	actin filament binding|ATP binding|motor activity			ovary(6)|large_intestine(1)|kidney(1)|breast(1)|central_nervous_system(1)	10	all_lung(23;0.000332)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00751)|Lung SC(71;0.104)		BRCA - Breast invasive adenocarcinoma(86;0.19)|all cancers(43;0.201)															---	---	---	---
Unknown	0	broad.mit.edu	37	13	110380012	110380013	+	IGR	DEL	GT	-	-	rs150010489	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:110380012_110380013delGT								MYO16 (519657 upstream) : IRS2 (26173 downstream)																																			---	---	---	---
ATP11A	23250	broad.mit.edu	37	13	113458195	113458196	+	Intron	INS	-	CCCTCATTC	CCCTCATTC	rs112509875		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:113458195_113458196insCCCTCATTC	uc001vsi.3	+						ATP11A_uc001vsj.3_Intron|ATP11A_uc001vsm.1_Intron	NM_015205	NP_056020			ATPase, class VI, type 11A isoform a						ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			large_intestine(2)|ovary(2)	4	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_lung(25;0.134)|all_epithelial(44;0.141)																---	---	---	---
MCF2L	23263	broad.mit.edu	37	13	113725315	113725315	+	Intron	DEL	C	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:113725315delC	uc001vsu.2	+						MCF2L_uc001vsq.2_Intron|MCF2L_uc010tjr.1_Intron|MCF2L_uc001vsr.2_Intron|MCF2L_uc001vss.3_Intron|MCF2L_uc010tjs.1_Intron|MCF2L_uc001vst.1_Intron	NM_001112732	NP_001106203			MCF.2 cell line derived transforming						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|plasma membrane	Rho guanyl-nucleotide exchange factor activity			ovary(1)|kidney(1)	2	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_cancers(25;0.118)|all_lung(25;0.0368)|all_epithelial(44;0.0396)|Lung NSC(25;0.129)|Breast(118;0.188)																---	---	---	---
Unknown	0	broad.mit.edu	37	13	115098095	115098096	+	IGR	DEL	AA	-	-	rs76419391		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:115098095_115098096delAA								ZNF828 (5293 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	19026936	19026936	+	IGR	DEL	C	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:19026936delC								None (None upstream) : OR11H12 (350658 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	21014614	21014617	+	IGR	DEL	GAGG	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21014614_21014617delGAGG								RNASE10 (35300 upstream) : RNASE9 (9636 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	24244226	24244227	+	IGR	DEL	TG	-	-	rs145806715		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24244226_24244227delTG								DHRS2 (129380 upstream) : C14orf165 (147232 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	25923639	25923639	+	IGR	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:25923639delT								STXBP6 (404468 upstream) : NOVA1 (991451 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	30512812	30512812	+	IGR	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:30512812delT								PRKD1 (115913 upstream) : G2E3 (515517 downstream)																																			---	---	---	---
NPAS3	64067	broad.mit.edu	37	14	33798298	33798298	+	Intron	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:33798298delA	uc001wru.2	+						NPAS3_uc001wrs.2_Intron|NPAS3_uc001wrt.2_Intron|NPAS3_uc001wrv.2_Intron|NPAS3_uc001wrw.2_Intron	NM_173159	NP_071406			neuronal PAS domain protein 3 isoform 3						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|signal transducer activity			ovary(1)|skin(1)	2	Breast(36;0.0102)|Hepatocellular(127;0.133)		LUAD - Lung adenocarcinoma(48;0.00169)|Lung(238;0.00968)	GBM - Glioblastoma multiforme(1;1.31e-09)|all cancers(1;0.000112)|OV - Ovarian serous cystadenocarcinoma(311;0.115)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	34754049	34754049	+	IGR	DEL	G	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:34754049delG								EGLN3 (333762 upstream) : C14orf147 (148096 downstream)																																			---	---	---	---
MIPOL1	145282	broad.mit.edu	37	14	37732459	37732459	+	Intron	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:37732459delA	uc001wuc.2	+						MIPOL1_uc010amr.2_Intron|MIPOL1_uc001wub.3_Intron|MIPOL1_uc001wud.2_Intron|MIPOL1_uc010ams.2_Intron|MIPOL1_uc001wue.2_Intron|MIPOL1_uc010amt.2_Intron	NM_138731	NP_620059			mirror-image polydactyly 1											ovary(1)|central_nervous_system(1)	2	Breast(36;0.119)|Esophageal squamous(585;0.164)|Hepatocellular(127;0.213)		Lung(238;6.03e-07)|LUAD - Lung adenocarcinoma(48;2.48e-05)|Epithelial(34;0.047)|all cancers(34;0.0953)|LUSC - Lung squamous cell carcinoma(13;0.0975)|BRCA - Breast invasive adenocarcinoma(188;0.196)	GBM - Glioblastoma multiforme(112;0.0358)														---	---	---	---
LRFN5	145581	broad.mit.edu	37	14	42190887	42190887	+	Intron	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:42190887delA	uc001wvm.2	+						LRFN5_uc010ana.2_Intron	NM_152447	NP_689660			leucine rich repeat and fibronectin type III							integral to membrane				ovary(5)|pancreas(2)|central_nervous_system(1)	8			LUAD - Lung adenocarcinoma(50;0.0223)|Lung(238;0.0728)	GBM - Glioblastoma multiforme(112;0.00847)											HNSCC(30;0.082)			---	---	---	---
Unknown	0	broad.mit.edu	37	14	45976587	45976587	+	IGR	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:45976587delA								C14orf106 (253982 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	53446738	53446739	+	IGR	DEL	GT	-	-	rs138227374		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:53446738_53446739delGT								FERMT2 (28923 upstream) : DDHD1 (56720 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	53657888	53657889	+	IGR	INS	-	GT	GT	rs35685380		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:53657888_53657889insGT								DDHD1 (37842 upstream) : BMP4 (758568 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	57540281	57540282	+	IGR	INS	-	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:57540281_57540282insA								OTX2 (263097 upstream) : EXOC5 (128914 downstream)																																			---	---	---	---
WDR89	112840	broad.mit.edu	37	14	64075385	64075386	+	Intron	DEL	CA	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:64075385_64075386delCA	uc001xgh.2	-						WDR89_uc001xgi.2_Intron	NM_001008726	NP_001008726			WD repeat domain 89												0				OV - Ovarian serous cystadenocarcinoma(108;0.00543)|all cancers(60;0.0181)|BRCA - Breast invasive adenocarcinoma(234;0.101)														---	---	---	---
SYNE2	23224	broad.mit.edu	37	14	64470488	64470488	+	Intron	DEL	C	-	-	rs35418569		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:64470488delC	uc001xgm.2	+						SYNE2_uc001xgl.2_Intron	NM_015180	NP_055995			spectrin repeat containing, nuclear envelope 2						centrosome localization|cytoskeletal anchoring at nuclear membrane|nuclear migration along microfilament|positive regulation of cell migration	cytoskeleton|filopodium membrane|focal adhesion|integral to membrane|lamellipodium membrane|mitochondrial part|nuclear outer membrane|nucleoplasm|sarcoplasmic reticulum membrane|SUN-KASH complex|Z disc	actin binding|protein binding			ovary(8)|breast(4)|central_nervous_system(1)|pancreas(1)	14				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)														---	---	---	---
HSPA2	3306	broad.mit.edu	37	14	65009534	65009535	+	3'UTR	INS	-	T	T	rs148978517	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:65009534_65009535insT	uc001xhj.2	+	2					HSPA2_uc001xhk.3_3'UTR	NM_021979	NP_068814			heat shock 70kDa protein 2						response to unfolded protein|spermatid development	cell surface	ATP binding|unfolded protein binding			skin(1)	1				all cancers(60;0.00515)|OV - Ovarian serous cystadenocarcinoma(108;0.00584)|BRCA - Breast invasive adenocarcinoma(234;0.045)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	65767201	65767202	+	IGR	INS	-	A	A	rs34053938		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:65767201_65767202insA								MAX (197974 upstream) : LOC645431 (110111 downstream)																																			---	---	---	---
RAD51L1	5890	broad.mit.edu	37	14	68517294	68517294	+	Intron	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:68517294delT	uc001xkf.1	+						RAD51L1_uc001xkd.2_Intron|RAD51L1_uc010aqr.2_Intron|RAD51L1_uc001xke.2_Intron|RAD51L1_uc010aqs.1_Intron|RAD51L1_uc001xkg.1_Intron	NM_133509	NP_598193			RAD51-like 1 isoform 3						blood coagulation|DNA repair|reciprocal meiotic recombination	nucleoplasm	ATP binding|DNA binding|DNA-dependent ATPase activity				0				UCEC - Uterine corpus endometrioid carcinoma (185;0.163)|all cancers(60;3.9e-06)|OV - Ovarian serous cystadenocarcinoma(108;0.000103)|BRCA - Breast invasive adenocarcinoma(234;0.000421)				T	HMGA2	lipoma|uterine leiomyoma			Direct_reversal_of_damage|Homologous_recombination					---	---	---	---
RAD51L1	5890	broad.mit.edu	37	14	68555307	68555308	+	Intron	DEL	GT	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:68555307_68555308delGT	uc001xkf.1	+						RAD51L1_uc001xkd.2_Intron|RAD51L1_uc010aqr.2_Intron|RAD51L1_uc001xke.2_Intron|RAD51L1_uc010aqs.1_Intron|RAD51L1_uc001xkg.1_Intron	NM_133509	NP_598193			RAD51-like 1 isoform 3						blood coagulation|DNA repair|reciprocal meiotic recombination	nucleoplasm	ATP binding|DNA binding|DNA-dependent ATPase activity				0				UCEC - Uterine corpus endometrioid carcinoma (185;0.163)|all cancers(60;3.9e-06)|OV - Ovarian serous cystadenocarcinoma(108;0.000103)|BRCA - Breast invasive adenocarcinoma(234;0.000421)				T	HMGA2	lipoma|uterine leiomyoma			Direct_reversal_of_damage|Homologous_recombination					---	---	---	---
Unknown	0	broad.mit.edu	37	14	71808728	71808729	+	IGR	INS	-	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:71808728_71808729insT								PCNX (226629 upstream) : SNORD56B (56325 downstream)																																			---	---	---	---
KIAA0317	9870	broad.mit.edu	37	14	75131088	75131088	+	Intron	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:75131088delT	uc001xqb.2	-						KIAA0317_uc010tut.1_Intron	NM_001039479	NP_001034568			hypothetical protein LOC9870						protein ubiquitination involved in ubiquitin-dependent protein catabolic process	integral to membrane|intracellular	ubiquitin-protein ligase activity			ovary(2)|kidney(1)|central_nervous_system(1)|pancreas(1)	5				BRCA - Breast invasive adenocarcinoma(234;0.00404)														---	---	---	---
TGFB3	7043	broad.mit.edu	37	14	76436993	76436994	+	Intron	INS	-	TCCCCTCCTCT	TCCCCTCCTCT	rs143589998	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:76436993_76436994insTCCCCTCCTCT	uc001xsc.2	-						TGFB3_uc001xsd.2_Intron	NM_003239	NP_003230			transforming growth factor, beta 3 precursor						cell growth|cell-cell junction organization|detection of hypoxia|face morphogenesis|in utero embryonic development|induction of apoptosis|lung alveolus development|mammary gland development|menstrual cycle phase|negative regulation of cell proliferation|negative regulation of DNA replication|negative regulation of macrophage cytokine production|negative regulation of neuron apoptosis|odontogenesis|ossification involved in bone remodeling|palate development|platelet activation|platelet degranulation|positive regulation of bone mineralization|positive regulation of cell division|positive regulation of collagen biosynthetic process|positive regulation of DNA replication|positive regulation of epithelial to mesenchymal transition|positive regulation of filopodium assembly|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of protein secretion|positive regulation of SMAD protein import into nucleus|positive regulation of transcription from RNA polymerase II promoter|response to progesterone stimulus|salivary gland morphogenesis|transforming growth factor beta receptor signaling pathway	extracellular matrix|platelet alpha granule lumen	growth factor activity|identical protein binding|transforming growth factor beta binding|type I transforming growth factor beta receptor binding|type II transforming growth factor beta receptor binding			breast(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(234;0.0169)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	77338103	77338103	+	IGR	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:77338103delA								C14orf166B (1458 upstream) : C14orf4 (152785 downstream)																																			---	---	---	---
TMED8	283578	broad.mit.edu	37	14	77839880	77839880	+	Intron	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:77839880delA	uc001xto.1	-						TMED8_uc010ast.1_Intron	NM_213601	NP_998766			transmembrane emp24 protein transport domain						transport	integral to membrane					0			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0281)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	78551278	78551278	+	IGR	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:78551278delT								ADCK1 (150982 upstream) : NRXN3 (85650 downstream)																																			---	---	---	---
TSHR	7253	broad.mit.edu	37	14	81456615	81456615	+	Intron	DEL	G	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:81456615delG	uc001xvd.1	+						TSHR_uc001xvb.1_Intron|TSHR_uc001xvc.2_Intron|TSHR_uc010tvs.1_Intron	NM_000369	NP_000360			thyroid stimulating hormone receptor isoform 1						cell-cell signaling|positive regulation of cell proliferation	integral to plasma membrane	protein binding|thyroid-stimulating hormone receptor activity			thyroid(289)|ovary(5)|lung(3)|kidney(1)|skin(1)	299				BRCA - Breast invasive adenocarcinoma(234;0.0402)	Thyrotropin Alfa(DB00024)			Mis		toxic thyroid adenoma	thyroid  adenoma	Hereditary nonautoimmune hyperthyroidism; subclinical hypothyroidism 						---	---	---	---
Unknown	0	broad.mit.edu	37	14	84748636	84748637	+	IGR	DEL	GT	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:84748636_84748637delGT								None (None upstream) : None (None downstream)																																			---	---	---	---
PTPN21	11099	broad.mit.edu	37	14	88985191	88985191	+	Intron	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:88985191delT	uc001xwv.3	-						PTPN21_uc010twc.1_Intron|PTPN21_uc010atf.1_Intron	NM_007039	NP_008970			protein tyrosine phosphatase, non-receptor type							cytoplasm|cytoskeleton	binding|protein tyrosine phosphatase activity			ovary(3)|skin(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	14	89589122	89589122	+	IGR	DEL	C	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:89589122delC								TTC8 (244788 upstream) : FOXN3 (33395 downstream)																																			---	---	---	---
FOXN3	1112	broad.mit.edu	37	14	89802560	89802561	+	Intron	INS	-	TCCATCCATCCA	TCCATCCATCCA	rs150227035	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:89802560_89802561insTCCATCCATCCA	uc001xxo.3	-						FOXN3_uc001xxn.3_Intron|FOXN3_uc010atk.2_Intron	NM_001085471	NP_001078940			checkpoint suppressor 1 isoform 1						DNA damage checkpoint|embryo development|G2 phase of mitotic cell cycle|negative regulation of transcription, DNA-dependent|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|protein C-terminus binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			skin(2)|ovary(1)	3																		---	---	---	---
TTC7B	145567	broad.mit.edu	37	14	91110622	91110625	+	Intron	DEL	CACG	-	-	rs147942996	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:91110622_91110625delCACG	uc001xyp.2	-						TTC7B_uc001xyo.2_5'Flank|TTC7B_uc010ats.2_Intron|uc001xyq.2_Intron	NM_001010854	NP_001010854			tetratricopeptide repeat domain 7B								binding			ovary(2)	2		Melanoma(154;0.222)																---	---	---	---
CPSF2	53981	broad.mit.edu	37	14	92623098	92623099	+	Intron	INS	-	AATTT	AATTT	rs148978587	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92623098_92623099insAATTT	uc001yah.1	+							NM_017437	NP_059133			cleavage and polyadenylation specific factor 2						histone mRNA 3'-end processing|mRNA export from nucleus|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	mRNA cleavage and polyadenylation specificity factor complex	hydrolase activity|protein binding|RNA binding			ovary(2)	2		all_cancers(154;0.0766)		COAD - Colon adenocarcinoma(157;0.222)														---	---	---	---
PRIMA1	145270	broad.mit.edu	37	14	94237486	94237487	+	Intron	INS	-	TG	TG	rs142244698	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94237486_94237487insTG	uc001ybw.1	-						PRIMA1_uc001ybx.1_Intron	NM_178013	NP_821092			proline rich membrane anchor 1 precursor						neurotransmitter catabolic process	cell junction|integral to membrane|synapse				large_intestine(1)|skin(1)	2		all_cancers(154;0.127)		Epithelial(152;0.138)|COAD - Colon adenocarcinoma(157;0.229)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	97980586	97980593	+	IGR	DEL	TTCCTTTT	-	-	rs71883285	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:97980586_97980593delTTCCTTTT								VRK1 (632636 upstream) : C14orf64 (411354 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	102015381	102015381	+	IGR	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102015381delT								MIR656 (482243 upstream) : DIO3OS (3179 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	102218367	102218368	+	IGR	DEL	AC	-	-	rs146883470		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102218367_102218368delAC								C14orf72 (19507 upstream) : PPP2R5C (9767 downstream)																																			---	---	---	---
PACS2	23241	broad.mit.edu	37	14	105768484	105768484	+	Intron	DEL	A	-	-	rs77469203		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105768484delA	uc001yqs.2	+						BRF1_uc010tyo.1_Intron|BRF1_uc010typ.1_Intron|BRF1_uc010axg.1_5'Flank|BRF1_uc001yqp.2_5'Flank|BRF1_uc001yqr.2_5'Flank	NM_015197	NP_056012			phosphofurin acidic cluster sorting protein 2						apoptosis|interspecies interaction between organisms	endoplasmic reticulum lumen|mitochondrion				pancreas(1)	1		all_cancers(154;0.0351)|all_epithelial(191;0.153)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.0145)|Epithelial(46;0.036)	Epithelial(152;0.138)														---	---	---	---
Unknown	0	broad.mit.edu	37	15	20860093	20860093	+	IGR	DEL	T	-	-	rs71252310		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20860093delT								GOLGA8C (79067 upstream) : BCL8 (9963 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	21930169	21930170	+	IGR	INS	-	T	T	rs112406947		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:21930169_21930170insT								NF1P1 (795544 upstream) : LOC646214 (2344 downstream)																																			---	---	---	---
OR4N4	283694	broad.mit.edu	37	15	22324026	22324029	+	Intron	DEL	CTTC	-	-	rs71974442	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22324026_22324029delCTTC	uc001yuc.1	+						LOC727924_uc001ytz.1_Intron|LOC727924_uc001yua.2_Intron|LOC727924_uc001yub.1_Intron	NM_001005241	NP_001005241			olfactory receptor, family 4, subfamily N,						sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(4)|skin(1)	5		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)														---	---	---	---
OR4N4	283694	broad.mit.edu	37	15	22324352	22324353	+	Intron	DEL	TT	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22324352_22324353delTT	uc001yuc.1	+						LOC727924_uc001ytz.1_Intron|LOC727924_uc001yua.2_Intron|LOC727924_uc001yub.1_Intron	NM_001005241	NP_001005241			olfactory receptor, family 4, subfamily N,						sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(4)|skin(1)	5		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)														---	---	---	---
Unknown	0	broad.mit.edu	37	15	22506441	22506442	+	IGR	INS	-	T	T	rs7170229	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22506441_22506442insT								OR4N3P (92056 upstream) : MIR1268 (6787 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	22521923	22521924	+	IGR	INS	-	T	T	rs147118807		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22521923_22521924insT								MIR1268 (8643 upstream) : GOLGA8DP (180361 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	22558920	22558921	+	IGR	DEL	TT	-	-	rs141614747		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22558920_22558921delTT								MIR1268 (45640 upstream) : GOLGA8DP (143364 downstream)																																			---	---	---	---
IPW	3653	broad.mit.edu	37	15	25402795	25402795	+	Intron	DEL	C	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25402795delC	uc001yyp.1	+						IPW_uc010aym.1_Intron					Homo sapiens clone kid12 SNURF-SNRPN mRNA, downstream untranslated exons, alternatively spliced.												0																		---	---	---	---
GABRB3	2562	broad.mit.edu	37	15	26976215	26976216	+	Intron	DEL	CG	-	-	rs66524233		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:26976215_26976216delCG	uc001zaz.2	-						GABRB3_uc001zba.2_Intron|GABRB3_uc001zbb.2_Intron	NM_000814	NP_000805			gamma-aminobutyric acid (GABA) A receptor, beta						synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			upper_aerodigestive_tract(1)|ovary(1)|lung(1)|liver(1)|central_nervous_system(1)	5		all_cancers(20;1.89e-22)|all_lung(180;6.35e-15)|Breast(32;0.000279)|Colorectal(260;0.232)		all cancers(64;1.46e-07)|Epithelial(43;2.89e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0251)|COAD - Colon adenocarcinoma(236;0.235)|Lung(196;0.243)	Ethchlorvynol(DB00189)|Flurazepam(DB00690)|Lorazepam(DB00186)|Midazolam(DB00683)													---	---	---	---
Unknown	0	broad.mit.edu	37	15	31118027	31118027	+	IGR	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:31118027delT								ARHGAP11B (140218 upstream) : MTMR15 (78028 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	34372565	34372565	+	IGR	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:34372565delA								CHRM5 (15278 upstream) : C15orf24 (3661 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	35405573	35405574	+	IGR	DEL	GT	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:35405573_35405574delGT								ZNF770 (125119 upstream) : LOC723972 (123953 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	36214449	36214449	+	IGR	DEL	G	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:36214449delG								ATPBD4 (376045 upstream) : C15orf41 (657363 downstream)																																			---	---	---	---
MEIS2	4212	broad.mit.edu	37	15	37251774	37251774	+	Intron	DEL	G	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:37251774delG	uc001zjr.2	-						MEIS2_uc001zjl.2_Intron|MEIS2_uc010ucj.1_Intron|MEIS2_uc001zjm.2_Intron|MEIS2_uc001zjn.2_Intron|MEIS2_uc001zjo.2_Intron|MEIS2_uc001zjp.2_Intron|MEIS2_uc001zjs.2_Intron|MEIS2_uc001zju.2_Intron|MEIS2_uc001zjt.2_Intron	NM_170675	NP_733775			Meis homeobox 2 isoform c						negative regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity			ovary(2)	2		all_epithelial(112;9.77e-14)|Lung NSC(122;1.42e-09)|all_lung(180;2.2e-08)|Ovarian(310;0.134)|Melanoma(134;0.155)		all cancers(64;9.33e-21)|GBM - Glioblastoma multiforme(113;1.71e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0288)														---	---	---	---
BAHD1	22893	broad.mit.edu	37	15	40749535	40749541	+	Intron	DEL	CTGGGTA	-	-	rs144659118		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40749535_40749541delCTGGGTA	uc001zlu.2	+						BAHD1_uc001zlt.2_Intron|BAHD1_uc010bbp.1_Intron|BAHD1_uc001zlv.2_5'Flank	NM_014952	NP_055767			bromo adjacent homology domain containing 1						heterochromatin formation|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromatin silencing complex|chromosome	chromatin binding|DNA binding|protein binding				0		all_cancers(109;8.28e-19)|all_epithelial(112;2.64e-15)|Lung NSC(122;5.14e-11)|all_lung(180;1.27e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;3.46e-06)|BRCA - Breast invasive adenocarcinoma(123;0.08)														---	---	---	---
INO80	54617	broad.mit.edu	37	15	41308143	41308143	+	Intron	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41308143delA	uc001zni.2	-						INO80_uc010ucu.1_Intron	NM_017553	NP_060023			INO80 complex homolog 1						cell division|cellular response to ionizing radiation|cellular response to UV|chromatin remodeling|double-strand break repair via homologous recombination|mitotic sister chromatid segregation|positive regulation of cell growth|positive regulation of DNA replication involved in S phase|positive regulation of transcription from RNA polymerase II promoter|regulation of G1/S transition of mitotic cell cycle|spindle assembly|UV-damage excision repair	Ino80 complex|microtubule	actin binding|alpha-tubulin binding|ATP binding|ATPase activity|DNA binding|DNA helicase activity			ovary(2)|pancreas(1)|skin(1)	4																		---	---	---	---
EXD1	161829	broad.mit.edu	37	15	41497901	41497916	+	Intron	DEL	GAAGGAGGGAAGGAGA	-	-	rs139411176	by1000genomes;by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41497901_41497916delGAAGGAGGGAAGGAGA	uc001znk.2	-						EXD1_uc010ucv.1_Intron	NM_152596	NP_689809			exonuclease 3'-5' domain containing 1						nucleobase, nucleoside, nucleotide and nucleic acid metabolic process	intracellular	3'-5' exonuclease activity|nucleic acid binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	45141890	45141890	+	IGR	DEL	C	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:45141890delC								TRIM69 (81865 upstream) : C15orf43 (107013 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	45746554	45746554	+	Intron	DEL	G	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:45746554delG	uc001zvi.1	+											Homo sapiens cDNA FLJ32124 fis, clone PEBLM1000180.																														---	---	---	---
Unknown	0	broad.mit.edu	37	15	46005368	46005371	+	IGR	DEL	TTCC	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:46005368_46005371delTTCC								SQRDL (21890 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	51096623	51096623	+	IGR	DEL	G	-	-	rs56082244		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:51096623delG								SPPL2A (38713 upstream) : AP4E1 (104323 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	51162943	51162943	+	IGR	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:51162943delA								SPPL2A (105033 upstream) : AP4E1 (38003 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	51318931	51318931	+	IGR	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:51318931delT								AP4E1 (20834 upstream) : TNFAIP8L3 (29870 downstream)																																			---	---	---	---
TNFAIP8L3	388121	broad.mit.edu	37	15	51392971	51392971	+	Intron	DEL	C	-	-	rs113070839		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:51392971delC	uc001zyy.2	-							NM_207381	NP_997264			tumor necrosis factor, alpha-induced protein												0				all cancers(107;0.000389)|GBM - Glioblastoma multiforme(94;0.00338)														---	---	---	---
Unknown	0	broad.mit.edu	37	15	53563765	53563766	+	IGR	INS	-	GTGTGT	GTGTGT	rs148432779	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:53563765_53563766insGTGTGT								ONECUT1 (481556 upstream) : WDR72 (242172 downstream)																																			---	---	---	---
CGNL1	84952	broad.mit.edu	37	15	57689984	57689985	+	Intron	INS	-	T	T	rs11386688		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:57689984_57689985insT	uc002aeg.2	+						CGNL1_uc010bfw.2_Intron|uc002aeh.2_Intron	NM_032866	NP_116255			cingulin-like 1							myosin complex|tight junction	motor activity			skin(6)|ovary(4)|central_nervous_system(1)	11				all cancers(107;0.121)|GBM - Glioblastoma multiforme(80;0.186)														---	---	---	---
CGNL1	84952	broad.mit.edu	37	15	57790557	57790557	+	Intron	DEL	C	-	-	rs34622421		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:57790557delC	uc002aeg.2	+						CGNL1_uc010bfw.2_Intron	NM_032866	NP_116255			cingulin-like 1							myosin complex|tight junction	motor activity			skin(6)|ovary(4)|central_nervous_system(1)	11				all cancers(107;0.121)|GBM - Glioblastoma multiforme(80;0.186)														---	---	---	---
Unknown	0	broad.mit.edu	37	15	59688980	59688981	+	IGR	INS	-	TCTTCTTCT	TCTTCTTCT	rs146058584	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:59688980_59688981insTCTTCTTCT								MYO1E (23909 upstream) : FAM81A (41391 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	63763040	63763047	+	IGR	DEL	AAGCAAGC	-	-	rs62011269		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:63763040_63763047delAAGCAAGC								CA12 (88965 upstream) : USP3 (33763 downstream)																																			---	---	---	---
SNX1	6642	broad.mit.edu	37	15	64433782	64433782	+	3'UTR	DEL	G	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:64433782delG	uc002amv.2	+	15					SNX1_uc002amw.2_3'UTR|SNX1_uc002amx.2_3'UTR|SNX1_uc002amy.2_3'UTR|SNX1_uc010bgw.2_3'UTR	NM_003099	NP_003090			sorting nexin 1 isoform a						cell communication|early endosome to Golgi transport|endocytosis|intracellular protein transport	early endosome membrane|Golgi apparatus	phosphatidylinositol binding|protein binding|protein transporter activity				0																		---	---	---	---
ZNF609	23060	broad.mit.edu	37	15	64852255	64852256	+	Intron	INS	-	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:64852255_64852256insT	uc002ann.2	+							NM_015042	NP_055857			zinc finger protein 609							nucleus	zinc ion binding			upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	67332887	67332888	+	IGR	INS	-	T	T	rs5813422		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:67332887_67332888insT								SMAD6 (258552 upstream) : SMAD3 (25307 downstream)																																			---	---	---	---
THSD4	79875	broad.mit.edu	37	15	71533138	71533141	+	Intron	DEL	ACAC	-	-	rs139151862		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:71533138_71533141delACAC	uc002atb.1	+						THSD4_uc002atd.1_5'Flank	NM_024817	NP_079093			thrombospondin, type I, domain containing 4							proteinaceous extracellular matrix	metalloendopeptidase activity			ovary(2)	2																		---	---	---	---
THSD4	79875	broad.mit.edu	37	15	71840118	71840118	+	Intron	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:71840118delA	uc002atb.1	+						THSD4_uc002atd.1_Intron|THSD4_uc010ukg.1_Intron|THSD4_uc002ate.2_Intron	NM_024817	NP_079093			thrombospondin, type I, domain containing 4							proteinaceous extracellular matrix	metalloendopeptidase activity			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	74196395	74196396	+	IGR	DEL	AT	-	-	rs71434216		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:74196395_74196396delAT								TBC1D21 (14842 upstream) : LOXL1 (22393 downstream)																																			---	---	---	---
SCAMP5	192683	broad.mit.edu	37	15	75297074	75297074	+	Intron	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:75297074delA	uc002azk.1	+						SCAMP5_uc002azl.1_Intron|SCAMP5_uc002azm.1_Intron|SCAMP5_uc002azn.1_Intron|SCAMP5_uc010uly.1_Intron	NM_138967	NP_620417			secretory carrier membrane protein 5						exocytosis|negative regulation of endocytosis|positive regulation of calcium ion-dependent exocytosis|positive regulation of cytokine secretion|protein transport|response to endoplasmic reticulum stress	cell junction|integral to membrane|recycling endosome membrane|synaptic vesicle membrane|trans-Golgi network membrane	protein binding			ovary(1)	1																		---	---	---	---
NRG4	145957	broad.mit.edu	37	15	76248134	76248134	+	Intron	DEL	A	-	-	rs146303179		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:76248134delA	uc002bbo.2	-						NRG4_uc010bkm.1_Intron|NRG4_uc002bbn.2_Intron|NRG4_uc010bkn.2_Intron|NRG4_uc010bko.2_Intron	NM_138573	NP_612640			neuregulin 4							extracellular region|integral to membrane|plasma membrane	growth factor activity				0																		---	---	---	---
SCAPER	49855	broad.mit.edu	37	15	77016215	77016215	+	Intron	DEL	C	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:77016215delC	uc002bby.2	-						SCAPER_uc010bkr.2_Intron|SCAPER_uc002bbx.2_Intron|SCAPER_uc002bbz.1_Intron|SCAPER_uc002bca.1_Intron|SCAPER_uc002bcb.1_Intron	NM_020843	NP_065894			S-phase cyclin A-associated protein in the ER							endoplasmic reticulum|nucleus	zinc ion binding			large_intestine(1)|lung(1)|ovary(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	78202278	78202278	+	IGR	DEL	C	-	-	rs71145877		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:78202278delC								LINGO1 (213803 upstream) : LOC645752 (4281 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	79720736	79720739	+	IGR	DEL	CTCT	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:79720736_79720739delCTCT								TMED3 (16402 upstream) : KIAA1024 (4119 downstream)																																			---	---	---	---
WHAMM	123720	broad.mit.edu	37	15	83491562	83491563	+	Intron	INS	-	TG	TG	rs145821700	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:83491562_83491563insTG	uc002bje.2	+							NM_001080435	NP_001073904			WAS protein homolog associated with actin, golgi							cytoplasmic vesicle membrane|ER-Golgi intermediate compartment|Golgi apparatus	actin binding				0																		---	---	---	---
SLC28A1	9154	broad.mit.edu	37	15	85459161	85459163	+	Intron	DEL	TGT	-	-	rs71466061		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85459161_85459163delTGT	uc002blg.2	+						SLC28A1_uc010upd.1_Intron|SLC28A1_uc010bnb.2_Intron|SLC28A1_uc010upe.1_Intron|SLC28A1_uc010upf.1_Intron|SLC28A1_uc010upg.1_Intron	NM_004213	NP_004204			solute carrier family 28, member 1 isoform 1						nucleobase, nucleoside and nucleotide metabolic process	integral to plasma membrane|membrane fraction	nucleoside binding			skin(2)|ovary(1)	3			BRCA - Breast invasive adenocarcinoma(143;0.0587)															---	---	---	---
PDE8A	5151	broad.mit.edu	37	15	85633548	85633548	+	Intron	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85633548delA	uc002blh.2	+						PDE8A_uc002bli.2_Intron|PDE8A_uc010bnc.2_Intron|PDE8A_uc010bnd.2_Intron|PDE8A_uc002blj.2_Intron|PDE8A_uc002blk.2_Intron	NM_002605	NP_002596			phosphodiesterase 8A isoform 1						cyclic nucleotide metabolic process|regulation of transcription, DNA-dependent	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding|two-component response regulator activity			ovary(2)|pancreas(1)|skin(1)	4	Colorectal(223;0.227)		BRCA - Breast invasive adenocarcinoma(143;0.0608)															---	---	---	---
AKAP13	11214	broad.mit.edu	37	15	85958947	85958947	+	Intron	DEL	T	-	-	rs35819058		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85958947delT	uc002blv.1	+						AKAP13_uc002bls.2_Intron|AKAP13_uc002blt.1_Intron|AKAP13_uc002blu.1_Intron	NM_007200	NP_009131			A-kinase anchor protein 13 isoform 2						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|membrane|membrane fraction|nucleus	cAMP-dependent protein kinase activity|metal ion binding|protein binding|Rho guanyl-nucleotide exchange factor activity|signal transducer activity			central_nervous_system(3)|kidney(2)|urinary_tract(1)|liver(1)|skin(1)|ovary(1)	9																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	86672505	86672506	+	IGR	DEL	TG	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:86672505_86672506delTG								KLHL25 (334316 upstream) : AGBL1 (12736 downstream)																																			---	---	---	---
POLG	5428	broad.mit.edu	37	15	89877405	89877405	+	Intron	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:89877405delT	uc002bns.3	-						POLG_uc002bnr.3_Intron	NM_002693	NP_002684			DNA-directed DNA polymerase gamma						base-excision repair, gap-filling|cell death|DNA-dependent DNA replication	mitochondrial nucleoid	DNA binding|DNA-directed DNA polymerase activity|protease binding			ovary(1)|lung(1)	2	Lung NSC(78;0.0472)|all_lung(78;0.089)		STAD - Stomach adenocarcinoma(125;0.165)										DNA_polymerases_(catalytic_subunits)					---	---	---	---
Unknown	0	broad.mit.edu	37	15	90845285	90845285	+	5'Flank	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90845285delA	uc002bpi.1	-						uc002bpj.1_5'Flank					DQ571566																														---	---	---	---
VPS33B	26276	broad.mit.edu	37	15	91567026	91567026	+	5'Flank	DEL	C	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:91567026delC	uc002bqp.1	-						VPS33B_uc002bqq.1_5'Flank|VPS33B_uc010uqu.1_5'Flank|uc002bqr.1_RNA|uc002bqs.1_Intron	NM_018668	NP_061138			vacuolar protein sorting 33B (yeast homolog))						cellular membrane fusion|lysosome localization|melanosome localization|platelet alpha granule organization|protein transport|vesicle docking involved in exocytosis	late endosome membrane|lysosomal membrane|perinuclear region of cytoplasm|platelet alpha granule	protein binding			ovary(2)	2	Lung NSC(78;0.0987)|all_lung(78;0.175)																	---	---	---	---
Unknown	0	broad.mit.edu	37	15	95443712	95443715	+	IGR	DEL	ATTA	-	-	rs145890110		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:95443712_95443715delATTA								MCTP2 (416532 upstream) : LOC145820 (532607 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	95450215	95450215	+	IGR	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:95450215delT								MCTP2 (423035 upstream) : LOC145820 (526107 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	95732960	95732961	+	IGR	DEL	TG	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:95732960_95732961delTG								MCTP2 (705780 upstream) : LOC145820 (243361 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	96207726	96207727	+	IGR	INS	-	T	T	rs34164696		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:96207726_96207727insT								LOC145820 (156652 upstream) : NR2F2 (661430 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	97401477	97401478	+	IGR	DEL	GC	-	-	rs57522029		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:97401477_97401478delGC								SPATA8 (72633 upstream) : LOC91948 (884368 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	97944999	97945000	+	IGR	INS	-	AAT	AAT	rs139701994	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:97944999_97945000insAAT								SPATA8 (616155 upstream) : LOC91948 (340846 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	98193043	98193043	+	IGR	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:98193043delA								SPATA8 (864199 upstream) : LOC91948 (92803 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	98900853	98900853	+	IGR	DEL	A	-	-	rs34912725		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:98900853delA								ARRDC4 (383786 upstream) : FAM169B (79538 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	99125598	99125599	+	IGR	INS	-	AAT	AAT	rs146706414	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:99125598_99125599insAAT								FAM169B (67987 upstream) : IGF1R (67162 downstream)																																			---	---	---	---
IGF1R	3480	broad.mit.edu	37	15	99204310	99204326	+	Intron	DEL	GAGAGAGATGGAGATTT	-	-	rs71149406		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:99204310_99204326delGAGAGAGATGGAGATTT	uc002bul.2	+						IGF1R_uc010urq.1_Intron|IGF1R_uc010bon.2_Intron	NM_000875	NP_000866			insulin-like growth factor 1 receptor precursor						anti-apoptosis|immune response|insulin receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of cell migration|positive regulation of cell proliferation|positive regulation of DNA replication|protein autophosphorylation|protein tetramerization	microsome	ATP binding|identical protein binding|insulin binding|insulin receptor binding|insulin receptor substrate binding|insulin-like growth factor I binding|insulin-like growth factor receptor activity|metal ion binding|phosphatidylinositol 3-kinase binding			lung(3)|kidney(3)|ovary(1)|central_nervous_system(1)	8	all_cancers(4;4.17e-14)|all_epithelial(3;4.34e-15)|Lung NSC(78;0.00175)|all_lung(78;0.00351)|Melanoma(26;0.00505)|Medulloblastoma(229;0.163)		Epithelial(2;1.94e-12)|all cancers(5;6.83e-11)|BRCA - Breast invasive adenocarcinoma(2;2.88e-09)|OV - Ovarian serous cystadenocarcinoma(32;0.00261)		Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Mecasermin(DB01277)													---	---	---	---
Unknown	0	broad.mit.edu	37	15	100434744	100434746	+	IGR	DEL	AGG	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:100434744_100434746delAGG								C15orf51 (87612 upstream) : ADAMTS17 (76897 downstream)																																			---	---	---	---
UBE2I	7329	broad.mit.edu	37	16	1356344	1356367	+	5'Flank	DEL	ACCTGCTCCATGACCCTCACCCCT	-	-	rs61151448	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1356344_1356367delACCTGCTCCATGACCCTCACCCCT	uc002clc.1	+						uc010uuy.1_RNA|UBE2I_uc002cld.1_5'Flank	NM_194261	NP_919237			ubiquitin-conjugating enzyme E2I						cell division|chromosome segregation|interspecies interaction between organisms|mitosis|negative regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|protein sumoylation	cytoplasm|PML body|synaptonemal complex	ATP binding|enzyme binding|ubiquitin-protein ligase activity			breast(1)|skin(1)	2		Hepatocellular(780;0.00369)																---	---	---	---
Unknown	0	broad.mit.edu	37	16	9431047	9431054	+	IGR	DEL	ACACACAT	-	-	rs12446647		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:9431047_9431054delACACACAT								C16orf72 (217502 upstream) : GRIN2A (416213 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	10366564	10366565	+	IGR	INS	-	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:10366564_10366565insT								GRIN2A (89953 upstream) : ATF7IP2 (113347 downstream)																																			---	---	---	---
ATF7IP2	80063	broad.mit.edu	37	16	10505208	10505209	+	Intron	INS	-	T	T	rs116173003		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:10505208_10505209insT	uc002czu.2	+						ATF7IP2_uc002czv.2_Intron|ATF7IP2_uc010uyo.1_Intron|ATF7IP2_uc010uyp.1_Intron	NM_024997	NP_079273			activating transcription factor 7 interacting						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	11494057	11494057	+	IGR	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:11494057delT								C16orf75 (48440 upstream) : LITAF (147525 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	12712474	12712475	+	IGR	INS	-	A	A	rs146515330	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:12712474_12712475insA								SNX29 (44329 upstream) : CPPED1 (41182 downstream)																																			---	---	---	---
MKL2	57496	broad.mit.edu	37	16	14265357	14265357	+	Intron	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:14265357delA	uc010uza.1	+						MKL2_uc002dcg.2_Intron	NM_014048	NP_054767			megakaryoblastic leukemia 2 protein						cell differentiation|muscle organ development|positive regulation of striated muscle tissue development|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent		identical protein binding|nucleic acid binding|transcription coactivator activity			ovary(3)|kidney(1)|pancreas(1)	5																		---	---	---	---
ABCC6	368	broad.mit.edu	37	16	16266070	16266072	+	Intron	DEL	TGA	-	-	rs139070219	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:16266070_16266072delTGA	uc002den.3	-						ABCC6_uc010bvo.2_Intron	NM_001171	NP_001162			ATP-binding cassette, sub-family C, member 6						response to drug|visual perception	integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			skin(2)|ovary(1)	3				UCEC - Uterine corpus endometrioid carcinoma (3;0.123)														---	---	---	---
Unknown	0	broad.mit.edu	37	16	16727303	16727304	+	IGR	INS	-	T	T	rs140064834	by1000genomes;by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:16727303_16727304insT								LOC339047 (282866 upstream) : XYLT1 (468879 downstream)																																			---	---	---	---
XYLT1	64131	broad.mit.edu	37	16	17421789	17421789	+	Intron	DEL	C	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:17421789delC	uc002dfa.2	-							NM_022166	NP_071449			xylosyltransferase I						glycosaminoglycan biosynthetic process	endoplasmic reticulum membrane|extracellular region|Golgi membrane|integral to membrane	acetylglucosaminyltransferase activity|protein xylosyltransferase activity			ovary(4)	4																		---	---	---	---
XYLT1	64131	broad.mit.edu	37	16	17479118	17479119	+	Intron	INS	-	AC	AC	rs149517758	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:17479118_17479119insAC	uc002dfa.2	-							NM_022166	NP_071449			xylosyltransferase I						glycosaminoglycan biosynthetic process	endoplasmic reticulum membrane|extracellular region|Golgi membrane|integral to membrane	acetylglucosaminyltransferase activity|protein xylosyltransferase activity			ovary(4)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	17679489	17679490	+	IGR	DEL	AG	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:17679489_17679490delAG								XYLT1 (114751 upstream) : NOMO2 (831693 downstream)																																			---	---	---	---
SMG1	23049	broad.mit.edu	37	16	18937506	18937508	+	5'UTR	DEL	AGG	-	-	rs12929094	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:18937506_18937508delAGG	uc002dfm.2	-	1						NM_015092	NP_055907			PI-3-kinase-related kinase SMG-1						DNA repair|mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|peptidyl-serine phosphorylation|phosphatidylinositol phosphorylation|protein autophosphorylation	cytoplasm|nucleus	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			breast(5)|stomach(4)|lung(4)|kidney(2)|ovary(1)	16																		---	---	---	---
C16orf62	57020	broad.mit.edu	37	16	19643281	19643281	+	Intron	DEL	T	-	-	rs35363007		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:19643281delT	uc002dgn.1	+						C16orf62_uc002dgo.1_Intron|C16orf62_uc002dgp.1_Intron	NM_020314	NP_064710			hypothetical protein LOC57020							integral to membrane				ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	21890632	21890632	+	Intron	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:21890632delA	uc002djr.3	-						uc002djs.3_Intron|uc010vbo.1_RNA	NM_130464	NP_569731			nuclear pore complex interacting protein-like 3																														---	---	---	---
Unknown	0	broad.mit.edu	37	16	22408861	22408862	+	IGR	INS	-	GA	GA	rs146453598	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:22408861_22408862insGA								CDR2 (22923 upstream) : RRN3P3 (22005 downstream)																																			---	---	---	---
GSG1L	146395	broad.mit.edu	37	16	28071243	28071243	+	Intron	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28071243delA	uc002doz.2	-						GSG1L_uc010bya.1_Intron	NM_001109763	NP_001103233			GSG1-like isoform 1							integral to membrane				ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	29325500	29325500	+	Intron	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:29325500delT	uc010vct.1	-											RecName: Full=Nuclear pore complex-interacting protein-like 2; Flags: Precursor;																														---	---	---	---
ZNF267	10308	broad.mit.edu	37	16	31886307	31886307	+	Intron	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31886307delT	uc002ecs.3	+							NM_003414	NP_003405			zinc finger protein 267						multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)|breast(1)|skin(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	32345896	32345897	+	IGR	INS	-	AT	AT			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32345896_32345897insAT								HERC2P4 (182022 upstream) : TP53TG3B (338944 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	32426437	32426438	+	IGR	DEL	AA	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32426437_32426438delAA								HERC2P4 (262563 upstream) : TP53TG3B (258403 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	32545928	32545929	+	IGR	INS	-	C	C	rs145733522		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32545928_32545929insC								HERC2P4 (382054 upstream) : TP53TG3B (138912 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	32842387	32842387	+	IGR	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32842387delT								TP53TG3B (153509 upstream) : SLC6A10P (46410 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33052524	33052524	+	IGR	DEL	C	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33052524delC								SLC6A10P (156061 upstream) : MIR1826 (912984 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33387786	33387787	+	IGR	INS	-	T	T	rs143929480		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33387786_33387787insT								SLC6A10P (491323 upstream) : MIR1826 (577721 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33535692	33535703	+	IGR	DEL	AGAGAGAGAGAG	-	-	rs71234822		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33535692_33535703delAGAGAGAGAGAG								SLC6A10P (639229 upstream) : MIR1826 (429805 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33899797	33899801	+	IGR	DEL	CTATG	-	-	rs58293438		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33899797_33899801delCTATG								None (None upstream) : MIR1826 (65707 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33947228	33947229	+	IGR	DEL	AA	-	-	rs111797998		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33947228_33947229delAA								None (None upstream) : MIR1826 (18279 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33951194	33951197	+	IGR	DEL	TCTT	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33951194_33951197delTCTT								None (None upstream) : MIR1826 (14311 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33983679	33983679	+	IGR	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33983679delA								MIR1826 (18087 upstream) : UBE2MP1 (420123 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	49519873	49519874	+	IGR	DEL	TC	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:49519873_49519874delTC								C16orf78 (86556 upstream) : ZNF423 (4648 downstream)																																			---	---	---	---
PAPD5	64282	broad.mit.edu	37	16	50263428	50263428	+	3'UTR	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:50263428delA	uc010vgo.1	+	13					PAPD5_uc010cbi.2_Intron|PAPD5_uc002efz.2_3'UTR|PAPD5_uc002ega.2_3'UTR	NM_001040284	NP_001035374			PAP associated domain containing 5 isoform a						cell division|DNA replication|histone mRNA catabolic process|mitosis	cytoplasm|nucleus	DNA binding|DNA-directed DNA polymerase activity|metal ion binding				0		all_cancers(37;0.0452)		BRCA - Breast invasive adenocarcinoma(181;0.0843)|GBM - Glioblastoma multiforme(240;0.231)														---	---	---	---
Unknown	0	broad.mit.edu	37	16	51162856	51162857	+	IGR	DEL	GT	-	-	rs113239801		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:51162856_51162857delGT								CYLD (327010 upstream) : SALL1 (7029 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	52114341	52114342	+	IGR	INS	-	A	A	rs138387897	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:52114341_52114342insA								SALL1 (929158 upstream) : TOX3 (357576 downstream)																																			---	---	---	---
FTO	79068	broad.mit.edu	37	16	54101886	54101887	+	Intron	INS	-	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:54101886_54101887insT	uc002ehr.2	+						FTO_uc010vha.1_Intron|FTO_uc010cbz.2_Intron|FTO_uc002ehs.2_Intron	NM_001080432	NP_001073901			fat mass and obesity associated						DNA dealkylation involved in DNA repair|oxidative single-stranded DNA demethylation|oxidative single-stranded RNA demethylation|RNA repair	nucleus	DNA-N1-methyladenine dioxygenase activity|ferrous iron binding|oxidative DNA demethylase activity|oxidative RNA demethylase activity|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	55005974	55005975	+	IGR	INS	-	TC	TC	rs71146778		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:55005974_55005975insTC								IRX5 (37581 upstream) : IRX6 (352496 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	55482682	55482683	+	IGR	INS	-	GAAG	GAAG	rs138737506	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:55482682_55482683insGAAG								IRX6 (118011 upstream) : MMP2 (30398 downstream)																																			---	---	---	---
SLC12A3	6559	broad.mit.edu	37	16	56921123	56921123	+	Intron	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:56921123delT	uc010ccm.2	+						SLC12A3_uc002ekd.3_Intron|SLC12A3_uc010ccn.2_Intron	NM_001126108	NP_001119580			solute carrier family 12, member 3 isoform 3						sodium ion transmembrane transport	apical plasma membrane|integral to plasma membrane|membrane fraction	sodium:chloride symporter activity			ovary(2)|breast(1)	3					Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Chlorothiazide(DB00880)|Diazoxide(DB01119)|Hydrochlorothiazide(DB00999)|Metolazone(DB00524)|Polythiazide(DB01324)|Quinethazone(DB01325)													---	---	---	---
Unknown	0	broad.mit.edu	37	16	56957325	56957326	+	IGR	INS	-	T	T	rs35295485		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:56957325_56957326insT								SLC12A3 (7565 upstream) : HERPUD1 (8422 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	58900921	58900922	+	IGR	INS	-	AGT	AGT	rs138215391	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:58900921_58900922insAGT								GOT2 (132675 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	59351773	59351774	+	IGR	INS	-	TG	TG	rs144233258	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:59351773_59351774insTG								GOT2 (583527 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	59632063	59632072	+	IGR	DEL	TTTCTTTCTT	-	-	rs71388610		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:59632063_59632072delTTTCTTTCTT								GOT2 (863817 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	64888794	64888794	+	IGR	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:64888794delA								None (None upstream) : CDH11 (91891 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	64955502	64955503	+	IGR	INS	-	TCTTCT	TCTTCT	rs150639934	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:64955502_64955503insTCTTCT								None (None upstream) : CDH11 (25182 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	65834082	65834083	+	IGR	DEL	TG	-	-	rs71985706		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:65834082_65834083delTG								LOC283867 (223879 upstream) : CDH5 (566442 downstream)																																			---	---	---	---
ZFHX3	463	broad.mit.edu	37	16	72961885	72961886	+	Intron	INS	-	G	G	rs147485760	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:72961885_72961886insG	uc002fck.2	-						ZFHX3_uc002fcl.2_Intron	NM_006885	NP_008816			zinc finger homeobox 3 isoform A						muscle organ development|negative regulation of myoblast differentiation|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|positive regulation of myoblast differentiation	transcription factor complex	enzyme binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|transcription regulatory region DNA binding|zinc ion binding			ovary(2)|skin(2)	4		Ovarian(137;0.13)																---	---	---	---
GLG1	2734	broad.mit.edu	37	16	74631024	74631025	+	Intron	INS	-	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74631024_74631025insA	uc002fcy.3	-						GLG1_uc002fcx.2_Intron|GLG1_uc002fcw.3_Intron|GLG1_uc002fcz.3_Intron	NM_001145667	NP_001139139			golgi apparatus protein 1 isoform 3							Golgi membrane|integral to membrane	receptor binding			ovary(1)|breast(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	76092338	76092341	+	IGR	DEL	TGTA	-	-	rs72402605		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:76092338_76092341delTGTA								TERF2IP (401010 upstream) : CNTNAP4 (218835 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	77481022	77481022	+	IGR	DEL	C	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:77481022delC								ADAMTS18 (12011 upstream) : NUDT7 (275389 downstream)																																			---	---	---	---
CENPN	55839	broad.mit.edu	37	16	81062489	81062490	+	3'UTR	DEL	AT	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81062489_81062490delAT	uc002ffx.2	+	11					CENPN_uc010vnl.1_3'UTR|CENPN_uc010vnm.1_3'UTR|CENPN_uc002ffy.3_Intron	NM_001100624	NP_001094094			centromere protein N isoform 2						CenH3-containing nucleosome assembly at centromere|mitotic prometaphase	condensed chromosome kinetochore|cytosol|nucleoplasm					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	82618254	82618256	+	IGR	DEL	AGA	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:82618254_82618256delAGA								MPHOSPH6 (414425 upstream) : CDH13 (42322 downstream)																																			---	---	---	---
CDH13	1012	broad.mit.edu	37	16	82739723	82739724	+	Intron	INS	-	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:82739723_82739724insT	uc002fgx.2	+						CDH13_uc010chh.2_Intron|CDH13_uc010vns.1_Intron|CDH13_uc010vnt.1_Intron|CDH13_uc010vnu.1_Intron	NM_001257	NP_001248			cadherin 13 preproprotein						adherens junction organization|calcium-dependent cell-cell adhesion|cell junction assembly|endothelial cell migration|homophilic cell adhesion|keratinocyte proliferation|lamellipodium assembly|localization within membrane|low-density lipoprotein particle mediated signaling|negative regulation of cell adhesion|negative regulation of cell proliferation|positive regulation of calcium-mediated signaling|positive regulation of cell migration|positive regulation of cell-matrix adhesion|positive regulation of endothelial cell proliferation|positive regulation of positive chemotaxis|positive regulation of smooth muscle cell proliferation|positive regulation of survival gene product expression|Rac protein signal transduction|regulation of endocytosis|regulation of epidermal growth factor receptor signaling pathway|Rho protein signal transduction|sprouting angiogenesis	anchored to membrane|caveola|extracellular space|integral to membrane|neuron projection	adiponectin binding|cadherin binding|calcium ion binding|low-density lipoprotein particle binding			large_intestine(1)	1		all_cancers(2;1.34e-11)|all_epithelial(2;4.3e-09)		COAD - Colon adenocarcinoma(5;0.0268)														---	---	---	---
HSBP1	3281	broad.mit.edu	37	16	83843068	83843068	+	Intron	DEL	T	-	-	rs149539074		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:83843068delT	uc002fgy.1	+							NM_001537	NP_001528			heat shock factor binding protein 1						negative regulation of transcription from RNA polymerase II promoter	nucleus	transcription corepressor activity				0		all_cancers(2;0.00573)|all_epithelial(2;0.0309)		BRCA - Breast invasive adenocarcinoma(80;0.0404)														---	---	---	---
Unknown	0	broad.mit.edu	37	16	87617788	87617788	+	IGR	DEL	G	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:87617788delG								ZCCHC14 (92328 upstream) : JPH3 (17653 downstream)																																			---	---	---	---
ANKRD11	29123	broad.mit.edu	37	16	89525923	89525923	+	Intron	DEL	C	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89525923delC	uc002fmx.1	-						ANKRD11_uc002fmy.1_Intron|ANKRD11_uc002fnc.1_Intron|ANKRD11_uc002fne.2_Intron|ANKRD11_uc002fng.1_Intron	NM_013275	NP_037407			ankyrin repeat domain 11							nucleus				ovary(4)|large_intestine(1)|central_nervous_system(1)	6		all_hematologic(23;0.00824)|Colorectal(91;0.0475)		Epithelial(1;5.33e-11)|all cancers(4;2.6e-09)|OV - Ovarian serous cystadenocarcinoma(4;2.29e-07)|BRCA - Breast invasive adenocarcinoma(80;0.0142)														---	---	---	---
DPEP1	1800	broad.mit.edu	37	16	89700980	89700980	+	Intron	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89700980delT	uc010cin.2	+						DPEP1_uc002fnr.3_Intron|DPEP1_uc002fns.3_Intron	NM_001128141	NP_001121613			dipeptidase 1 precursor						proteolysis	anchored to membrane|apical plasma membrane|microvillus membrane	dipeptidase activity|dipeptidyl-peptidase activity|metal ion binding|metalloexopeptidase activity|protein binding			large_intestine(1)	1		all_lung(18;0.0054)|all_hematologic(23;0.094)		BRCA - Breast invasive adenocarcinoma(80;0.0258)	Cilastatin(DB01597)													---	---	---	---
TUBB3	10381	broad.mit.edu	37	16	89996502	89996505	+	Intron	DEL	TTCC	-	-	rs113176575		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89996502_89996505delTTCC	uc002fph.1	+						TUBB3_uc002fpf.2_Intron|TUBB3_uc010ciz.1_Intron|TUBB3_uc010cja.1_Intron|TUBB3_uc002fpg.1_Intron|TUBB3_uc002fpi.1_Intron|TUBB3_uc002fpj.1_5'Flank|TUBB3_uc010cjb.1_5'Flank	NM_006086	NP_006077			tubulin, beta, 4						'de novo' posttranslational protein folding|axon guidance|microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|structural molecule activity			ovary(2)|pancreas(1)	3		all_cancers(9;1.69e-11)|Lung NSC(15;8.94e-06)|all_lung(18;1.39e-05)|all_neural(9;0.00581)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.0273)														---	---	---	---
RPH3AL	9501	broad.mit.edu	37	17	165110	165110	+	Intron	DEL	C	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:165110delC	uc002frd.1	-						RPH3AL_uc010vpy.1_Intron|RPH3AL_uc002fre.1_Intron|RPH3AL_uc002frf.1_Intron|RPH3AL_uc010cjl.1_Intron	NM_006987	NP_008918			rabphilin 3A-like (without C2 domains)						exocytosis|intracellular protein transport	transport vesicle membrane	cytoskeletal protein binding|Rab GTPase binding|zinc ion binding			skin(1)	1				UCEC - Uterine corpus endometrioid carcinoma (25;0.023)|all cancers(1;4.96e-06)|Epithelial(1;2.86e-05)|BRCA - Breast invasive adenocarcinoma(1;0.00453)|OV - Ovarian serous cystadenocarcinoma(1;0.0716)|LUAD - Lung adenocarcinoma(1115;0.102)|COAD - Colon adenocarcinoma(4;0.107)														---	---	---	---
NXN	64359	broad.mit.edu	37	17	713301	713302	+	Intron	DEL	CC	-	-	rs66481229		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:713301_713302delCC	uc002fsa.2	-						NXN_uc010vqd.1_Intron|NXN_uc002frz.2_Intron|NXN_uc010vqe.1_Intron	NM_022463	NP_071908			nucleoredoxin						cell differentiation|cell redox homeostasis|multicellular organismal development|Wnt receptor signaling pathway	cytosol|nucleus	protein-disulfide reductase activity			ovary(2)|breast(1)|pancreas(1)	4				UCEC - Uterine corpus endometrioid carcinoma (25;0.0237)														---	---	---	---
ABR	29	broad.mit.edu	37	17	1020957	1020958	+	Intron	INS	-	T	T	rs72023524		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1020957_1020958insT	uc002fsd.2	-						ABR_uc002fse.2_Intron|ABR_uc010cjq.1_Intron	NM_021962	NP_068781			active breakpoint cluster region-related						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|protein binding|Rho guanyl-nucleotide exchange factor activity			upper_aerodigestive_tract(1)	1				UCEC - Uterine corpus endometrioid carcinoma (25;0.0228)														---	---	---	---
RPA1	6117	broad.mit.edu	37	17	1779217	1779218	+	Intron	DEL	TT	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1779217_1779218delTT	uc002fto.2	+							NM_002945	NP_002936			replication protein A1						cell cycle checkpoint|DNA recombinase assembly|DNA strand elongation involved in DNA replication|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|nucleotide-excision repair, DNA damage removal|nucleotide-excision repair, DNA gap filling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	actin cytoskeleton|cytoplasm|DNA replication factor A complex|PML body	metal ion binding|protein binding|single-stranded DNA binding				0													NER					---	---	---	---
Unknown	0	broad.mit.edu	37	17	3111469	3111476	+	IGR	DEL	ATATATAG	-	-	rs11278780		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3111469_3111476delATATATAG								OR1A2 (9727 upstream) : OR1A1 (7439 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	3906841	3906841	+	IGR	DEL	C	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3906841delC								ATP2A3 (39105 upstream) : ZZEF1 (899 downstream)																																			---	---	---	---
DULLARD	23399	broad.mit.edu	37	17	7147350	7147351	+	3'UTR	INS	-	C	C	rs147084197	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7147350_7147351insC	uc002gfd.2	-	8					GABARAP_uc002gfb.2_5'Flank|DULLARD_uc002gfe.2_3'UTR|DULLARD_uc002gff.2_3'UTR|DULLARD_uc002gfc.2_Intron	NM_001143775	NP_001137247			dullard homolog						nuclear envelope organization|protein dephosphorylation	endoplasmic reticulum membrane|integral to membrane|nuclear membrane	protein serine/threonine phosphatase activity				0																		---	---	---	---
CLDN7	1366	broad.mit.edu	37	17	7166254	7166255	+	5'Flank	INS	-	T	T	rs137931761	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7166254_7166255insT	uc002gfm.3	-						CLDN7_uc010cmc.2_5'Flank|CLDN7_uc002gfn.3_Intron	NM_001307	NP_001298			claudin 7						calcium-independent cell-cell adhesion	integral to membrane|lateral plasma membrane|tight junction	identical protein binding|structural molecule activity			ovary(1)	1																		---	---	---	---
ALOX12B	242	broad.mit.edu	37	17	7990546	7990557	+	Intron	DEL	ACACACACAGAC	-	-	rs72449480		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7990546_7990557delACACACACAGAC	uc002gjy.1	-						hsa-mir-4314|MI0015846_5'Flank	NM_001139	NP_001130			arachidonate 12-lipoxygenase, 12R type						epidermis development|leukotriene biosynthetic process		arachidonate 12-lipoxygenase activity|iron ion binding|lipoxygenase activity				0															Multiple Myeloma(8;0.094)			---	---	---	---
Unknown	0	broad.mit.edu	37	17	8698649	8698649	+	IGR	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8698649delT								SPDYE4 (36772 upstream) : MFSD6L (1832 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	10749990	10749992	+	IGR	DEL	GAT	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10749990_10749992delGAT								PIRT (8572 upstream) : SHISA6 (394748 downstream)																																			---	---	---	---
DNAH9	1770	broad.mit.edu	37	17	11866752	11866752	+	Intron	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:11866752delA	uc002gne.2	+						DNAH9_uc010coo.2_Intron|DNAH9_uc002gnf.2_Intron	NM_001372	NP_001363			dynein, axonemal, heavy chain 9 isoform 2						cell projection organization|cellular component movement|microtubule-based movement|spermatogenesis	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			skin(10)|ovary(4)|breast(3)|central_nervous_system(2)|pancreas(1)	20		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)														---	---	---	---
Unknown	0	broad.mit.edu	37	17	13334867	13334870	+	IGR	DEL	TGTG	-	-	rs112517145		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:13334867_13334870delTGTG								ELAC2 (413508 upstream) : HS3ST3A1 (64136 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	13699706	13699707	+	IGR	DEL	CA	-	-	rs113936975		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:13699706_13699707delCA								HS3ST3A1 (194462 upstream) : CDRT15P (228108 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	14319225	14319226	+	IGR	INS	-	CTTCTTTC	CTTCTTTC	rs113224009	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:14319225_14319226insCTTCTTTC								HS3ST3B1 (69733 upstream) : PMP22 (813871 downstream)																																			---	---	---	---
KCNJ12	3768	broad.mit.edu	37	17	21306585	21306586	+	Intron	INS	-	T	T	rs146345094		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21306585_21306586insT	uc002gyv.1	+							NM_021012	NP_066292			potassium inwardly-rectifying channel, subfamily						blood circulation|muscle contraction|regulation of heart contraction|synaptic transmission	integral to membrane	inward rectifier potassium channel activity|ion channel inhibitor activity|potassium channel regulator activity			ovary(3)|skin(1)	4				Colorectal(15;0.0183)|COAD - Colon adenocarcinoma(3;0.0732)	Dofetilide(DB00204)										Prostate(3;0.18)			---	---	---	---
Unknown	0	broad.mit.edu	37	17	21339354	21339355	+	IGR	INS	-	GCAG	GCAG	rs34586616		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21339354_21339355insGCAG								KCNJ12 (16175 upstream) : C17orf51 (92217 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	21348188	21348191	+	IGR	DEL	TTCT	-	-	rs113461161		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21348188_21348191delTTCT								KCNJ12 (25009 upstream) : C17orf51 (83381 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	21520240	21520241	+	IGR	INS	-	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21520240_21520241insA								C17orf51 (42509 upstream) : FAM27L (305129 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	25293258	25293258	+	IGR	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25293258delA								None (None upstream) : WSB1 (327848 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	25296183	25296183	+	IGR	DEL	C	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25296183delC								None (None upstream) : WSB1 (324923 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	25302928	25302928	+	IGR	DEL	C	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25302928delC								None (None upstream) : WSB1 (318178 downstream)																																			---	---	---	---
MYO1D	4642	broad.mit.edu	37	17	30879420	30879423	+	Intron	DEL	ATCC	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:30879420_30879423delATCC	uc002hho.1	-							NM_015194	NP_056009			myosin ID							myosin complex	actin binding|ATP binding|calmodulin binding			large_intestine(1)|ovary(1)|central_nervous_system(1)	3			BRCA - Breast invasive adenocarcinoma(9;0.0362)															---	---	---	---
ACCN1	40	broad.mit.edu	37	17	32253952	32253952	+	Intron	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:32253952delT	uc002hhu.2	-							NM_001094	NP_001085			amiloride-sensitive cation channel 1, neuronal						central nervous system development|peripheral nervous system development|synaptic transmission	integral to plasma membrane	ligand-gated sodium channel activity|protein binding			ovary(2)|large_intestine(1)|central_nervous_system(1)	4		Breast(31;0.042)|Ovarian(249;0.202)		UCEC - Uterine corpus endometrioid carcinoma (308;0.13)|BRCA - Breast invasive adenocarcinoma(366;0.215)	Amiloride(DB00594)													---	---	---	---
SLFN13	146857	broad.mit.edu	37	17	33774886	33774887	+	5'Flank	INS	-	TTGTT	TTGTT	rs147743994	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:33774886_33774887insTTGTT	uc002hjk.1	-						SLFN13_uc010wch.1_5'Flank|SLFN13_uc002hjl.2_Intron|SLFN13_uc010ctt.2_Intron|SLFN13_uc002hjm.2_Intron	NM_144682	NP_653283			schlafen family member 13							intracellular	ATP binding			ovary(1)|breast(1)	2				UCEC - Uterine corpus endometrioid carcinoma (308;0.0185)														---	---	---	---
Unknown	0	broad.mit.edu	37	17	33780126	33780127	+	IGR	DEL	CA	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:33780126_33780127delCA								SLFN13 (4270 upstream) : SLFN12L (21799 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	37023028	37023029	+	IGR	INS	-	AAAC	AAAC	rs138607830	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37023028_37023029insAAAC								RPL23 (12975 upstream) : LASP1 (3083 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	38155334	38155334	+	IGR	DEL	A	-	-	rs138541083		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38155334delA								PSMD3 (1122 upstream) : CSF3 (16354 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	39063596	39063597	+	IGR	INS	-	CCTT	CCTT	rs75186134	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39063596_39063597insCCTT								KRT20 (22117 upstream) : KRT23 (15355 downstream)																																			---	---	---	---
JUP	3728	broad.mit.edu	37	17	39894805	39894806	+	Intron	INS	-	A	A	rs147913732	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39894805_39894806insA	uc010wfs.1	-							NM_021991	NP_068831			junction plakoglobin						adherens junction organization|atrioventricular valve morphogenesis|cell migration|cell morphogenesis|cellular response to indole-3-methanol|cytoskeletal anchoring at plasma membrane|detection of mechanical stimulus|ectoderm development|endothelial cell-cell adhesion|gastrulation|morphogenesis of embryonic epithelium|negative regulation of heart induction by canonical Wnt receptor signaling pathway|negative regulation of Wnt receptor signaling pathway involved in heart development|nervous system development|oocyte development|positive regulation of protein import into nucleus|positive regulation of sequence-specific DNA binding transcription factor activity|skin development	actin cytoskeleton|Axin-APC-beta-catenin-GSK3B complex|basolateral plasma membrane|catenin complex|desmosome|fascia adherens|gamma-catenin-TCF7L2 complex|internal side of plasma membrane|nucleus|protein-DNA complex|Z disc|zonula adherens	alpha-catenin binding|cadherin binding|protein homodimerization activity|protein kinase binding|protein phosphatase binding|RPTP-like protein binding|specific RNA polymerase II transcription factor activity|transcription coactivator activity			ovary(2)|lung(2)|breast(1)	5		Breast(137;0.000162)	BRCA - Breast invasive adenocarcinoma(4;0.233)	BRCA - Breast invasive adenocarcinoma(366;0.15)														---	---	---	---
ACLY	47	broad.mit.edu	37	17	40043691	40043691	+	Intron	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40043691delA	uc002hyg.2	-						ACLY_uc002hyh.2_Intron|ACLY_uc002hyi.2_Intron|ACLY_uc010wfx.1_Intron|ACLY_uc010wfy.1_Intron	NM_001096	NP_001087			ATP citrate lyase isoform 1						ATP catabolic process|cellular carbohydrate metabolic process|citrate metabolic process|coenzyme A metabolic process|energy reserve metabolic process|long-chain fatty-acyl-CoA biosynthetic process|positive regulation of cellular metabolic process|triglyceride biosynthetic process	citrate lyase complex|cytosol|nucleus	ATP binding|ATP citrate synthase activity|citrate (pro-3S)-lyase activity|metal ion binding|protein binding|succinate-CoA ligase (ADP-forming) activity			ovary(2)|central_nervous_system(1)	3		Breast(137;0.000143)																---	---	---	---
Unknown	0	broad.mit.edu	37	17	41383176	41383177	+	Intron	INS	-	A	A	rs113021295		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41383176_41383177insA	uc002ido.2	-											Homo sapiens cDNA clone IMAGE:5169062, partial cds.																														---	---	---	---
LSM12	124801	broad.mit.edu	37	17	42131983	42131983	+	Intron	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42131983delT	uc002iev.2	-						LSM12_uc010wit.1_Intron|LSM12_uc002iew.1_Intron	NM_152344	NP_689557			LSM12 homolog								protein binding				0		Breast(137;0.0313)|Prostate(33;0.0861)		BRCA - Breast invasive adenocarcinoma(366;0.115)														---	---	---	---
Unknown	0	broad.mit.edu	37	17	42675844	42675845	+	IGR	DEL	TA	-	-	rs150952024		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42675844_42675845delTA								FZD2 (38937 upstream) : C17orf104 (58137 downstream)																																			---	---	---	---
DCAKD	79877	broad.mit.edu	37	17	43109780	43109780	+	Intron	DEL	C	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43109780delC	uc002ihx.2	-						DCAKD_uc010daa.1_Intron|DCAKD_uc010dab.1_Intron	NM_024819	NP_079095			dephospho-CoA kinase domain containing						coenzyme A biosynthetic process		ATP binding|dephospho-CoA kinase activity				0		Prostate(33;0.155)																---	---	---	---
LOC644172	644172	broad.mit.edu	37	17	43679861	43679864	+	5'Flank	DEL	TTTC	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43679861_43679864delTTTC	uc010wjw.1	-							NR_026901				Homo sapiens cDNA clone IMAGE:3941904, partial cds.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	17	46771352	46771352	+	IGR	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46771352delT								MIR196A1 (61431 upstream) : PRAC (27740 downstream)																																			---	---	---	---
MYCBPAP	84073	broad.mit.edu	37	17	48602072	48602073	+	Intron	INS	-	GT	GT			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48602072_48602073insGT	uc010wmr.1	+						MYCBPAP_uc002iqz.2_Intron	NM_032133	NP_115509			Myc-binding protein-associated protein						cell differentiation|multicellular organismal development|spermatogenesis|synaptic transmission	cytoplasm|membrane	protein binding			urinary_tract(2)|skin(2)|ovary(1)|pancreas(1)	6	Breast(11;1.23e-18)		BRCA - Breast invasive adenocarcinoma(22;1.23e-09)															---	---	---	---
NME1-NME2	654364	broad.mit.edu	37	17	49245465	49245466	+	Intron	DEL	TA	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:49245465_49245466delTA	uc002itk.2	+						NME1-NME2_uc002itj.2_Intron|NME2_uc002itl.2_Intron|NME2_uc002itm.2_Intron|NME2_uc002itn.2_Intron|NME2_uc002ito.2_Intron	NM_002512	NP_002503			nucleoside diphosphate kinase B						cell adhesion|CTP biosynthetic process|GTP biosynthetic process|negative regulation of apoptosis|nucleobase, nucleoside and nucleotide interconversion|positive regulation of epithelial cell proliferation|positive regulation of keratinocyte differentiation|UTP biosynthetic process	cytosol|lamellipodium|nucleus|ruffle	ATP binding|DNA binding|metal ion binding|nucleoside diphosphate kinase activity|protein binding|protein histidine kinase activity|sequence-specific DNA binding transcription factor activity				0			BRCA - Breast invasive adenocarcinoma(22;1.54e-08)															---	---	---	---
Unknown	0	broad.mit.edu	37	17	49687954	49687954	+	IGR	DEL	C	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:49687954delC								UTP18 (312664 upstream) : CA10 (19721 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	50353722	50353723	+	IGR	INS	-	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:50353722_50353723insT								CA10 (116345 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	54097348	54097348	+	IGR	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:54097348delT								PCTP (242601 upstream) : ANKFN1 (133488 downstream)																																			---	---	---	---
MSI2	124540	broad.mit.edu	37	17	55598778	55598778	+	Intron	DEL	A	-	-	rs112170390		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:55598778delA	uc002iuz.1	+						MSI2_uc010wnm.1_Intron|MSI2_uc002iva.2_Intron	NM_138962	NP_620412			musashi 2 isoform a							cytoplasm	nucleotide binding|RNA binding			central_nervous_system(1)|pancreas(1)	2	Breast(9;1.78e-08)			GBM - Glioblastoma multiforme(1;0.0025)				T	HOXA9	CML								---	---	---	---
CUEDC1	404093	broad.mit.edu	37	17	55973845	55973846	+	Intron	INS	-	GG	GG			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:55973845_55973846insGG	uc002ivd.1	-						CUEDC1_uc002ive.1_Intron	NM_017949	NP_060419			CUE domain-containing 1											skin(2)	2																		---	---	---	---
BCAS3	54828	broad.mit.edu	37	17	59392140	59392140	+	Intron	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:59392140delA	uc002iyv.3	+						BCAS3_uc002iyu.3_Intron|BCAS3_uc002iyw.3_Intron|BCAS3_uc002iyy.3_Intron|BCAS3_uc002iyz.3_Intron|BCAS3_uc002iza.3_Intron|BCAS3_uc002izb.3_Intron|BCAS3_uc002izc.3_Intron	NM_001099432	NP_001092902			breast carcinoma amplified sequence 3 isoform 1							nucleus				ovary(2)|central_nervous_system(2)|skin(1)	5			BRCA - Breast invasive adenocarcinoma(1;3.11e-12)|Epithelial(12;8.2e-07)|all cancers(12;5.33e-06)													OREG0024628	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
TBX2	6909	broad.mit.edu	37	17	59480289	59480308	+	Intron	DEL	GATAGAGAGAGAGAGAGAGA	-	-	rs72277883		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:59480289_59480308delGATAGAGAGAGAGAGAGAGA	uc010wox.1	+						TBX2_uc002ize.2_Intron|TBX2_uc002izg.2_Intron	NM_005994	NP_005985			T-box 2						cell aging|positive regulation of cell proliferation		sequence-specific DNA binding				0																		---	---	---	---
TLK2	11011	broad.mit.edu	37	17	60547573	60547576	+	Intron	DEL	GTGT	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:60547573_60547576delGTGT	uc002izx.3	+											SubName: Full=Putative uncharacterized protein TLK1; Flags: Fragment;						cell cycle|chromatin modification|intracellular signal transduction|regulation of chromatin assembly or disassembly|response to DNA damage stimulus	nucleus	ATP binding|protein binding|protein serine/threonine kinase activity			stomach(1)|kidney(1)	2																		---	---	---	---
TANC2	26115	broad.mit.edu	37	17	61097276	61097279	+	Intron	DEL	TTTG	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61097276_61097279delTTTG	uc002jal.3	+							NM_025185	NP_079461			tetratricopeptide repeat, ankyrin repeat and								binding			ovary(2)	2																		---	---	---	---
TANC2	26115	broad.mit.edu	37	17	61233781	61233782	+	Intron	INS	-	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61233781_61233782insA	uc002jal.3	+							NM_025185	NP_079461			tetratricopeptide repeat, ankyrin repeat and								binding			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	17	62366123	62366123	+	IGR	DEL	C	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62366123delC								TEX2 (25470 upstream) : PECAM1 (33741 downstream)																																			---	---	---	---
CCDC46	201134	broad.mit.edu	37	17	63895814	63895815	+	Intron	INS	-	C	C	rs138059106	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:63895814_63895815insC	uc002jfl.2	-						CCDC46_uc010deo.2_Intron|CCDC46_uc002jfm.2_Intron|CCDC46_uc010dep.2_Intron	NM_145036	NP_659473			coiled-coil domain containing 46 isoform a							centrosome					0			BRCA - Breast invasive adenocarcinoma(6;1.53e-06)															---	---	---	---
CACNG4	27092	broad.mit.edu	37	17	64992369	64992370	+	Intron	INS	-	T	T	rs149993749	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:64992369_64992370insT	uc002jft.1	+							NM_014405	NP_055220			voltage-dependent calcium channel gamma-4						membrane depolarization|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|endocytic vesicle membrane	voltage-gated calcium channel activity			central_nervous_system(1)	1	all_cancers(12;9.86e-11)		BRCA - Breast invasive adenocarcinoma(6;1.35e-07)															---	---	---	---
ARSG	22901	broad.mit.edu	37	17	66336431	66336432	+	Intron	DEL	TG	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:66336431_66336432delTG	uc002jhc.2	+						ARSG_uc002jhb.1_Intron	NM_014960	NP_055775			Arylsulfatase G precursor						sulfur compound metabolic process	endoplasmic reticulum|extracellular space|lysosome	arylsulfatase activity|metal ion binding			ovary(1)	1			BRCA - Breast invasive adenocarcinoma(8;5.34e-07)|LUSC - Lung squamous cell carcinoma(166;0.24)															---	---	---	---
Unknown	0	broad.mit.edu	37	17	67724409	67724409	+	IGR	DEL	T	-	-	rs77625696		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:67724409delT								MAP2K6 (185947 upstream) : KCNJ16 (347017 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	68547138	68547139	+	IGR	INS	-	GG	GG	rs71381051		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:68547138_68547139insGG								KCNJ2 (370957 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	68566335	68566335	+	IGR	DEL	T	-	-	rs34077265		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:68566335delT								KCNJ2 (390154 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	69455672	69455672	+	IGR	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:69455672delT								None (None upstream) : SOX9 (661489 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	70206736	70206737	+	IGR	DEL	AC	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:70206736_70206737delAC								SOX9 (84184 upstream) : SLC39A11 (435349 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	70347822	70347826	+	IGR	DEL	TGGCA	-	-	rs150945614		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:70347822_70347826delTGGCA								SOX9 (225270 upstream) : SLC39A11 (294260 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	70458986	70458986	+	Intron	DEL	T	-	-	rs35349336		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:70458986delT	uc002jix.2	-						uc002jiz.1_Intron					Homo sapiens cDNA FLJ20470 fis, clone KAT06815.																														---	---	---	---
Unknown	0	broad.mit.edu	37	17	70625018	70625019	+	IGR	DEL	AG	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:70625018_70625019delAG								SOX9 (502466 upstream) : SLC39A11 (17067 downstream)																																			---	---	---	---
CD300A	11314	broad.mit.edu	37	17	72470328	72470329	+	Intron	INS	-	G	G	rs150146870	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72470328_72470329insG	uc002jkv.2	+						CD300A_uc002jkw.2_Intron|CD300A_uc010dfr.2_Intron|CD300A_uc010dfs.2_Intron	NM_007261	NP_009192			leukocyte membrane antigen						cell adhesion	integral to membrane|plasma membrane	receptor activity			ovary(1)|skin(1)	2																		---	---	---	---
ICT1	3396	broad.mit.edu	37	17	73012667	73012668	+	Intron	INS	-	AG	AG	rs148294506	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73012667_73012668insAG	uc002jmm.2	+							NM_001545	NP_001536			immature colon carcinoma transcript 1 precursor						mitochondrial translational termination	mitochondrial large ribosomal subunit	aminoacyl-tRNA hydrolase activity|translation release factor activity, codon nonspecific			ovary(1)|central_nervous_system(1)	2	all_lung(278;0.226)																	---	---	---	---
Unknown	0	broad.mit.edu	37	17	73880540	73880541	+	IGR	INS	-	A	A	rs145556707		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73880540_73880541insA								TRIM47 (5884 upstream) : TRIM65 (4501 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	74648132	74648133	+	IGR	INS	-	AATG	AATG	rs141491864	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74648132_74648133insAATG								ST6GALNAC1 (8238 upstream) : MXRA7 (23676 downstream)																																			---	---	---	---
MFSD11	79157	broad.mit.edu	37	17	74736093	74736093	+	Intron	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74736093delA	uc002jta.2	+						SFRS2_uc002jsv.2_5'Flank|SFRS2_uc002jsx.1_5'Flank|SFRS2_uc002jsy.3_5'Flank|SFRS2_uc010wtg.1_5'Flank|MFSD11_uc002jtb.2_Intron|MFSD11_uc010dha.2_Intron|MFSD11_uc002jtc.2_Intron|MFSD11_uc002jtd.3_Intron|MFSD11_uc010dhb.2_Intron|MFSD11_uc002jte.2_Intron	NM_024311	NP_077287			major facilitator superfamily domain containing							integral to membrane				ovary(1)	1																		---	---	---	---
BAIAP2	10458	broad.mit.edu	37	17	79066420	79066420	+	Intron	DEL	G	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79066420delG	uc002jzg.2	+						BAIAP2_uc002jyz.3_Intron|BAIAP2_uc002jza.2_Intron|BAIAP2_uc002jzc.2_Intron|BAIAP2_uc002jzb.2_Intron|BAIAP2_uc002jzd.2_Intron|BAIAP2_uc002jzf.2_Intron|BAIAP2_uc002jze.2_Intron|BAIAP2_uc010wuh.1_Intron|BAIAP2_uc002jzh.2_Intron	NM_017451	NP_059345			BAI1-associated protein 2 isoform 2						axonogenesis|filopodium assembly|insulin receptor signaling pathway|regulation of actin cytoskeleton organization|response to bacterium	cell junction|cytoskeleton|cytosol|filopodium|nucleus|ruffle	cytoskeletal adaptor activity|proline-rich region binding|protein C-terminus binding|SH3 domain binding				0	all_neural(118;0.101)		BRCA - Breast invasive adenocarcinoma(99;0.0228)|OV - Ovarian serous cystadenocarcinoma(97;0.0524)															---	---	---	---
Unknown	0	broad.mit.edu	37	17	79366051	79366052	+	IGR	INS	-	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79366051_79366052insA								TMEM105 (61577 upstream) : BAHCC1 (7488 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	79368899	79368900	+	IGR	DEL	TG	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79368899_79368900delTG								TMEM105 (64425 upstream) : BAHCC1 (4640 downstream)																																			---	---	---	---
BAHCC1	57597	broad.mit.edu	37	17	79392610	79392611	+	Intron	INS	-	GTGTGT	GTGTGT	rs28706812		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79392610_79392611insGTGTGT	uc002kaf.2	+							NM_001080519	NP_001073988			BAH domain and coiled-coil containing 1								DNA binding			ovary(1)	1	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0224)|OV - Ovarian serous cystadenocarcinoma(97;0.116)															---	---	---	---
P4HB	5034	broad.mit.edu	37	17	79813989	79813989	+	Intron	DEL	C	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79813989delC	uc002kbn.1	-						P4HB_uc002kbm.1_Intron	NM_000918	NP_000909			prolyl 4-hydroxylase, beta subunit precursor						cell redox homeostasis|glycerol ether metabolic process|lipid metabolic process|lipoprotein metabolic process|peptidyl-proline hydroxylation to 4-hydroxy-L-proline	cell surface|endoplasmic reticulum lumen|ER-Golgi intermediate compartment|extracellular region|melanosome|plasma membrane	electron carrier activity|procollagen-proline 4-dioxygenase activity|protein disulfide isomerase activity|protein disulfide oxidoreductase activity				0	all_neural(118;0.0878)|Ovarian(332;0.12)		BRCA - Breast invasive adenocarcinoma(99;0.013)|OV - Ovarian serous cystadenocarcinoma(97;0.0509)															---	---	---	---
TBCD	6904	broad.mit.edu	37	17	80760650	80760651	+	Intron	INS	-	TGCTT	TGCTT	rs112352238		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80760650_80760651insTGCTT	uc002kfz.2	+						TBCD_uc002kfx.1_Intron|TBCD_uc002kfy.1_Intron	NM_005993	NP_005984			beta-tubulin cofactor D						'de novo' posttranslational protein folding|adherens junction assembly|negative regulation of cell-substrate adhesion|negative regulation of microtubule polymerization|post-chaperonin tubulin folding pathway|tight junction assembly	adherens junction|cytoplasm|lateral plasma membrane|microtubule|tight junction	beta-tubulin binding|chaperone binding|GTPase activator activity				0	Breast(20;0.000523)|all_neural(118;0.0779)	all_cancers(8;0.0266)|all_epithelial(8;0.0696)	OV - Ovarian serous cystadenocarcinoma(97;0.0868)|BRCA - Breast invasive adenocarcinoma(99;0.18)															---	---	---	---
B3GNTL1	146712	broad.mit.edu	37	17	81006865	81006866	+	Intron	INS	-	A	A	rs146617389	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:81006865_81006866insA	uc002kgg.1	-						B3GNTL1_uc002kgf.1_5'UTR	NM_001009905	NP_001009905			UDP-GlcNAc:betaGal								transferase activity, transferring glycosyl groups			ovary(1)|pancreas(1)	2	Breast(20;0.000443)|all_neural(118;0.0779)	all_cancers(8;0.0396)|all_epithelial(8;0.0556)	BRCA - Breast invasive adenocarcinoma(99;0.0517)|OV - Ovarian serous cystadenocarcinoma(97;0.0868)															---	---	---	---
B3GNTL1	146712	broad.mit.edu	37	17	81007152	81007152	+	Intron	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:81007152delA	uc002kgg.1	-						B3GNTL1_uc002kgf.1_5'Flank	NM_001009905	NP_001009905			UDP-GlcNAc:betaGal								transferase activity, transferring glycosyl groups			ovary(1)|pancreas(1)	2	Breast(20;0.000443)|all_neural(118;0.0779)	all_cancers(8;0.0396)|all_epithelial(8;0.0556)	BRCA - Breast invasive adenocarcinoma(99;0.0517)|OV - Ovarian serous cystadenocarcinoma(97;0.0868)															---	---	---	---
Unknown	0	broad.mit.edu	37	18	2127382	2127383	+	IGR	INS	-	CAAAA	CAAAA	rs140676314	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:2127382_2127383insCAAAA								C18orf2 (720201 upstream) : METTL4 (410142 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	2822085	2822091	+	IGR	DEL	GATGGAA	-	-	rs78324831		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:2822085_2822091delGATGGAA								SMCHD1 (17071 upstream) : EMILIN2 (24937 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	3343717	3343717	+	IGR	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:3343717delT								MYL12B (65437 upstream) : TGIF1 (68355 downstream)																																			---	---	---	---
DLGAP1	9229	broad.mit.edu	37	18	3512064	3512064	+	Intron	DEL	T	-	-	rs66524606		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:3512064delT	uc002kmf.2	-						DLGAP1_uc010wyz.1_Intron|DLGAP1_uc002kme.1_Intron|DLGAP1_uc010dkn.2_Intron|DLGAP1_uc010wyw.1_Intron|DLGAP1_uc010wyx.1_Intron|DLGAP1_uc010wyy.1_Intron|DLGAP1_uc002kmg.2_Intron	NM_004746	NP_004737			discs large homolog-associated protein 1 isoform						synaptic transmission	cell junction|postsynaptic density|postsynaptic membrane				ovary(2)|pancreas(1)|skin(1)	4		Colorectal(8;0.0257)																---	---	---	---
Unknown	0	broad.mit.edu	37	18	4465883	4465884	+	IGR	INS	-	A	A	rs148948151	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:4465883_4465884insA								DLGAP1 (10617 upstream) : LOC642597 (677788 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	4599147	4599148	+	IGR	INS	-	TG	TG	rs145125686	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:4599147_4599148insTG								DLGAP1 (143881 upstream) : LOC642597 (544524 downstream)																																			---	---	---	---
LOC642597	642597	broad.mit.edu	37	18	5162624	5162625	+	Intron	INS	-	GT	GT	rs150673471	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:5162624_5162625insGT	uc010wzc.1	-							NM_001145194	NP_001138666			hypothetical protein LOC642597												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	18	5312388	5312390	+	IGR	DEL	AAA	-	-	rs72395351		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:5312388_5312390delAAA								ZFP161 (16349 upstream) : EPB41L3 (79998 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	5831094	5831095	+	IGR	DEL	AA	-	-	rs72436586		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:5831094_5831095delAA								EPB41L3 (200452 upstream) : TMEM200C (59089 downstream)																																			---	---	---	---
LAMA1	284217	broad.mit.edu	37	18	7067250	7067250	+	Intron	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:7067250delA	uc002knm.2	-						LAMA1_uc010wzj.1_Intron	NM_005559	NP_005550			laminin, alpha 1 precursor						axon guidance|cell adhesion|cell surface receptor linked signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	extracellular space|laminin-1 complex|laminin-3 complex	extracellular matrix structural constituent|receptor binding			ovary(8)|large_intestine(4)|upper_aerodigestive_tract(2)|breast(2)|skin(2)|pancreas(2)|central_nervous_system(1)	21		Colorectal(10;0.172)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)													---	---	---	---
PTPRM	5797	broad.mit.edu	37	18	8193812	8193812	+	Intron	DEL	C	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:8193812delC	uc002knn.3	+						PTPRM_uc010dkv.2_Intron|PTPRM_uc010wzl.1_Intron	NM_002845	NP_002836			protein tyrosine phosphatase, receptor type, M						homophilic cell adhesion|negative regulation of angiogenesis|negative regulation of endothelial cell migration|negative regulation of endothelial cell proliferation|response to drug|retina layer formation|retinal ganglion cell axon guidance	cell-cell adherens junction|integral to plasma membrane|lamellipodium|perinuclear region of cytoplasm	cadherin binding|transmembrane receptor protein tyrosine phosphatase activity			lung(3)|ovary(2)|central_nervous_system(1)	6		Colorectal(10;0.234)																---	---	---	---
Unknown	0	broad.mit.edu	37	18	9626971	9626972	+	IGR	INS	-	A	A	rs11376696		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:9626971_9626972insA								PPP4R1 (12371 upstream) : RAB31 (81256 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	10314951	10314952	+	IGR	INS	-	TTT	TTT	rs72090069		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:10314951_10314952insTTT								VAPA (354934 upstream) : APCDD1 (139673 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	10349109	10349112	+	IGR	DEL	TTCA	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:10349109_10349112delTTCA								VAPA (389092 upstream) : APCDD1 (105513 downstream)																																			---	---	---	---
GNAL	2774	broad.mit.edu	37	18	11703795	11703798	+	Intron	DEL	CACA	-	-	rs72308098		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:11703795_11703798delCACA	uc002kqc.2	+							NM_182978	NP_892023			guanine nucleotide binding protein (G protein),						activation of adenylate cyclase activity by dopamine receptor signaling pathway|inhibition of adenylate cyclase activity by G-protein signaling pathway|sensory perception of smell|synaptic transmission	heterotrimeric G-protein complex	adenylate cyclase activity|G-protein beta/gamma-subunit complex binding|G-protein-coupled receptor binding|GTP binding|GTPase activity|signal transducer activity			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	18	13168766	13168767	+	IGR	INS	-	CAAA	CAAA	rs140576415	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:13168766_13168767insCAAA								CEP192 (43717 upstream) : C18orf1 (50019 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	14864600	14864600	+	IGR	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:14864600delA								ANKRD30B (11863 upstream) : LOC644669 (448955 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	19792893	19792893	+	IGR	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:19792893delT								GATA6 (10666 upstream) : CTAGE1 (200671 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	20606828	20606829	+	IGR	INS	-	T	T	rs72889653		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:20606828_20606829insT								RBBP8 (383 upstream) : CABLES1 (107699 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	20632277	20632280	+	IGR	DEL	AGAA	-	-	rs144897727		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:20632277_20632280delAGAA								RBBP8 (25832 upstream) : CABLES1 (82248 downstream)																																			---	---	---	---
TTC39C	125488	broad.mit.edu	37	18	21585809	21585809	+	Intron	DEL	A	-	-	rs71746829		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:21585809delA	uc002kuu.2	+							NM_153211	NP_694943			tetratricopeptide repeat domain 39C isoform 2								binding			ovary(1)	1																		---	---	---	---
TTC39C	125488	broad.mit.edu	37	18	21636819	21636819	+	Intron	DEL	T	-	-	rs75726094		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:21636819delT	uc002kuw.2	+						TTC39C_uc002kuu.2_Intron	NM_001135993	NP_001129465			tetratricopeptide repeat domain 39C isoform 1								binding			ovary(1)	1																		---	---	---	---
KCTD1	284252	broad.mit.edu	37	18	24197893	24197893	+	Intron	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:24197893delA	uc010xbk.1	-							NM_198991	NP_945342			potassium channel tetramerisation domain						negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus|voltage-gated potassium channel complex	transcription corepressor activity|transcription factor binding|voltage-gated potassium channel activity			ovary(1)	1	all_cancers(21;0.00191)|Lung NSC(5;0.000698)|all_lung(6;0.0019)|Ovarian(20;0.0848)		Epithelial(2;7.8e-06)|OV - Ovarian serous cystadenocarcinoma(3;9.02e-06)|all cancers(3;3.37e-05)															---	---	---	---
Unknown	0	broad.mit.edu	37	18	24956462	24956463	+	Intron	INS	-	TT	TT	rs148728268	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:24956462_24956463insTT	uc002kwf.1	-											Homo sapiens cDNA FLJ45994 fis, clone SKMUS2009557.																														---	---	---	---
Unknown	0	broad.mit.edu	37	18	27701154	27701155	+	IGR	INS	-	A	A	rs148893414	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:27701154_27701155insA								None (None upstream) : MIR302F (177721 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	28783612	28783613	+	IGR	INS	-	C	C			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:28783612_28783613insC								DSC1 (40793 upstream) : DSG1 (114439 downstream)																																			---	---	---	---
C18orf34	374864	broad.mit.edu	37	18	30750021	30750022	+	Intron	DEL	TG	-	-	rs35832872		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:30750021_30750022delTG	uc002kxn.2	-						C18orf34_uc010dme.1_Intron|C18orf34_uc010xbr.1_Intron|C18orf34_uc010dmf.1_Intron|C18orf34_uc002kxo.2_Intron|C18orf34_uc002kxp.2_Intron	NM_001105528	NP_001098998			hypothetical protein LOC374864 isoform 1											ovary(1)	1																		---	---	---	---
ZNF397	84307	broad.mit.edu	37	18	32824786	32824786	+	Intron	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:32824786delT	uc010dmp.2	+						ZNF397_uc010dmq.2_Intron|ZNF397_uc010dmr.2_Intron|ZNF397_uc002kyj.2_Intron	NM_001135178	NP_001128650			zinc finger protein 397 isoform 1						viral reproduction	cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0																		---	---	---	---
GALNT1	2589	broad.mit.edu	37	18	33235208	33235210	+	Intron	DEL	GTT	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:33235208_33235210delGTT	uc010dmu.2	+						GALNT1_uc002kyz.3_Intron|GALNT1_uc002kza.2_Intron|GALNT1_uc002kzb.2_Intron	NM_020474	NP_065207			polypeptide N-acetylgalactosaminyltransferase 1						protein O-linked glycosylation via serine|protein O-linked glycosylation via threonine	extracellular region|Golgi cisterna membrane|integral to membrane|perinuclear region of cytoplasm	manganese ion binding|polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	18	37500553	37500553	+	IGR	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:37500553delT								LOC647946 (120271 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	38536602	38536629	+	IGR	DEL	GTGTGTGTGTGTGTGTGTGTGTGTGTGT	-	-	rs72494708		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:38536602_38536629delGTGTGTGTGTGTGTGTGTGTGTGTGTGT								None (None upstream) : KC6 (523609 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	38564128	38564130	+	IGR	DEL	CTT	-	-	rs148720964		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:38564128_38564130delCTT								None (None upstream) : KC6 (496108 downstream)																																			---	---	---	---
RIT2	6014	broad.mit.edu	37	18	40688140	40688140	+	Intron	DEL	A	-	-	rs35014387		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:40688140delA	uc002lav.2	-						RIT2_uc010dnf.2_Intron	NM_002930	NP_002921			Ras-like without CAAX 2						nerve growth factor receptor signaling pathway|small GTPase mediated signal transduction|synaptic transmission	intracellular|plasma membrane	calmodulin binding|GTP binding|GTPase activity			ovary(1)	1																		---	---	---	---
PIAS2	9063	broad.mit.edu	37	18	44412944	44412944	+	Intron	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:44412944delA	uc002lck.2	-						PIAS2_uc010dnp.2_Intron|PIAS2_uc002lcl.2_Intron|PIAS2_uc010xda.1_Intron|PIAS2_uc002lcm.2_Intron	NM_004671	NP_004662			protein inhibitor of activated STAT X isoform						androgen receptor signaling pathway|negative regulation of androgen receptor signaling pathway|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear speck|PML body	androgen receptor binding|DNA binding|protein binding|SUMO ligase activity|transcription coactivator activity|zinc ion binding			ovary(2)|breast(1)|skin(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	18	48666735	48666735	+	IGR	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:48666735delA								SMAD4 (55326 upstream) : MEX3C (34187 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	58794213	58794213	+	IGR	DEL	C	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:58794213delC								MC4R (754212 upstream) : CDH20 (206775 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	63778855	63778858	+	IGR	DEL	GAAG	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:63778855_63778858delGAAG								CDH7 (230681 upstream) : CDH19 (392463 downstream)																																			---	---	---	---
ZNF516	9658	broad.mit.edu	37	18	74170952	74170953	+	Intron	DEL	GT	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:74170952_74170953delGT	uc010dqx.1	-						ZNF516_uc002lme.2_Intron	NM_014643	NP_055458			zinc finger protein 516						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Prostate(75;0.0869)|Esophageal squamous(42;0.129)		OV - Ovarian serous cystadenocarcinoma(15;7.64e-06)|BRCA - Breast invasive adenocarcinoma(31;0.238)														---	---	---	---
Unknown	0	broad.mit.edu	37	18	76205653	76205653	+	IGR	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:76205653delA								None (None upstream) : SALL3 (534622 downstream)																																			---	---	---	---
ATP9B	374868	broad.mit.edu	37	18	77132245	77132266	+	Intron	DEL	CCTGCCTCCTGCCCCCTCGTCA	-	-	rs11273932		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:77132245_77132266delCCTGCCTCCTGCCCCCTCGTCA	uc002lmx.2	+						ATP9B_uc002lmw.1_Intron|ATP9B_uc002lna.2_Intron|ATP9B_uc002lnb.1_Intron|ATP9B_uc010drb.2_Intron	NM_198531	NP_940933			ATPase, class II, type 9B						ATP biosynthetic process	integral to membrane	aminophospholipid transporter activity|ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|cation-transporting ATPase activity|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(3)	3		Esophageal squamous(42;0.018)|Melanoma(33;0.0964)|Prostate(75;0.171)		OV - Ovarian serous cystadenocarcinoma(15;1.44e-07)|BRCA - Breast invasive adenocarcinoma(31;0.0405)														---	---	---	---
Unknown	0	broad.mit.edu	37	18	77351988	77351989	+	IGR	INS	-	AAAT	AAAT	rs150582513	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:77351988_77351989insAAAT								NFATC1 (62666 upstream) : CTDP1 (87812 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	2487337	2487337	+	IGR	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2487337delA								GADD45B (9080 upstream) : GNG7 (23881 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	3131446	3131446	+	IGR	DEL	C	-	-	rs66993077		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3131446delC								GNA11 (9994 upstream) : GNA15 (4745 downstream)																																			---	---	---	---
TMEM146	257062	broad.mit.edu	37	19	5778219	5778219	+	Intron	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5778219delA	uc002mda.2	+							NM_152784	NP_689997			transmembrane protein 146 precursor							integral to membrane				ovary(1)|central_nervous_system(1)|pancreas(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	19	6653969	6653969	+	IGR	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6653969delA								CD70 (62806 upstream) : TNFSF14 (10597 downstream)																																			---	---	---	---
ARHGEF18	23370	broad.mit.edu	37	19	7512872	7512873	+	Intron	DEL	AC	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7512872_7512873delAC	uc002mgi.2	+						ARHGEF18_uc010xjm.1_Intron|ARHGEF18_uc002mgh.2_Intron|ARHGEF18_uc002mgj.1_Intron	NM_001130955	NP_001124427			Rho/Rac guanine nucleotide exchange factor 18						actin cytoskeleton organization|apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of cell shape|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	Rho guanyl-nucleotide exchange factor activity			ovary(1)	1		Renal(5;0.0902)																---	---	---	---
OR1M1	125963	broad.mit.edu	37	19	9203785	9203786	+	5'Flank	INS	-	ACAT	ACAT	rs4804096	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9203785_9203786insACAT	uc010xkj.1	+							NM_001004456	NP_001004456			olfactory receptor, family 1, subfamily M,						sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(3)	3																		---	---	---	---
EMR2	30817	broad.mit.edu	37	19	14887789	14887792	+	Intron	DEL	CACA	-	-	rs71166800	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14887789_14887792delCACA	uc002mzp.1	-						EMR2_uc010xnw.1_5'Flank|EMR2_uc002mzo.1_Intron|EMR2_uc002mzq.1_Intron|EMR2_uc002mzr.1_Intron|EMR2_uc002mzs.1_Intron|EMR2_uc002mzt.1_Intron|EMR2_uc002mzu.1_Intron|EMR2_uc010xny.1_5'Flank	NM_013447	NP_038475			egf-like module containing, mucin-like, hormone						cell adhesion|neuropeptide signaling pathway	integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			lung(2)|ovary(1)|skin(1)	4																		---	---	---	---
BRD4	23476	broad.mit.edu	37	19	15374772	15374772	+	Intron	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15374772delA	uc002nar.2	-						BRD4_uc002nas.2_Intron|BRD4_uc002nat.3_Intron|BRD4_uc002nau.3_Intron	NM_058243	NP_490597			bromodomain-containing protein 4 isoform long						interspecies interaction between organisms|positive regulation of G2/M transition of mitotic cell cycle|positive regulation of transcription elongation from RNA polymerase II promoter|regulation of transcription involved in G1 phase of mitotic cell cycle	condensed nuclear chromosome|cytoplasm	protein binding			ovary(2)	2			OV - Ovarian serous cystadenocarcinoma(3;3.02e-24)|Epithelial(3;4.71e-20)|all cancers(3;2.26e-18)					T	NUT|C15orf55	lethal midline carcinoma of young people						OREG0025319	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
Unknown	0	broad.mit.edu	37	19	16415392	16415392	+	IGR	DEL	A	-	-	rs34068514		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16415392delA								AP1M1 (69236 upstream) : KLF2 (20259 downstream)																																			---	---	---	---
SLC27A1	376497	broad.mit.edu	37	19	17594890	17594890	+	Intron	DEL	C	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17594890delC	uc002ngu.1	+						SLC27A1_uc002ngt.1_Intron|SLC27A1_uc010xpp.1_5'UTR	NM_198580	NP_940982			solute carrier family 27, member 1						cardiolipin biosynthetic process|fatty acid metabolic process|long-chain fatty acid transport|negative regulation of phospholipid biosynthetic process|phosphatidic acid biosynthetic process|phosphatidylcholine biosynthetic process|phosphatidylethanolamine biosynthetic process|phosphatidylinositol biosynthetic process|phosphatidylserine biosynthetic process|transmembrane transport	endomembrane system|integral to membrane	fatty acid transporter activity|nucleotide binding				0																		---	---	---	---
GLT25D1	79709	broad.mit.edu	37	19	17685141	17685142	+	Intron	INS	-	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17685141_17685142insT	uc002nhc.1	+						GLT25D1_uc010eax.1_Intron	NM_024656	NP_078932			glycosyltransferase 25 domain containing 1						lipopolysaccharide biosynthetic process	endoplasmic reticulum lumen	procollagen galactosyltransferase activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	19	21044701	21044703	+	IGR	DEL	CTG	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:21044701_21044703delCTG								ZNF626 (200299 upstream) : ZNF85 (61377 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	21817605	21817605	+	IGR	DEL	G	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:21817605delG								ZNF429 (78537 upstream) : ZNF100 (89239 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	23792943	23792943	+	IGR	DEL	A	-	-	rs35464765		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:23792943delA								ZNF91 (214674 upstream) : ZNF675 (42766 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	27805557	27805558	+	IGR	INS	-	C	C			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:27805557_27805558insC								None (None upstream) : LOC148189 (475844 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	31460425	31460426	+	IGR	DEL	AC	-	-	rs71333495		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:31460425_31460426delAC								ZNF536 (411460 upstream) : DKFZp566F0947 (180357 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	32287329	32287330	+	IGR	INS	-	AC	AC	rs143093305	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:32287329_32287330insAC								TSHZ3 (447139 upstream) : ZNF507 (549184 downstream)																																			---	---	---	---
DPY19L3	147991	broad.mit.edu	37	19	32949027	32949029	+	In_Frame_Del	DEL	GAT	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:32949027_32949029delGAT	uc002ntg.2	+	11	1287_1289	c.1111_1113delGAT	c.(1111-1113)GATdel	p.D371del	DPY19L3_uc002nth.1_In_Frame_Del_p.D371del|DPY19L3_uc002nti.1_RNA	NM_207325	NP_997208	Q6ZPD9	D19L3_HUMAN	dpy-19-like 3	371						integral to membrane				ovary(4)	4	Esophageal squamous(110;0.162)																	---	---	---	---
GPATCH1	55094	broad.mit.edu	37	19	33589807	33589807	+	Intron	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33589807delT	uc002nug.1	+							NM_018025	NP_060495			G patch domain containing 1							catalytic step 2 spliceosome	nucleic acid binding			skin(1)	1	Esophageal squamous(110;0.137)																	---	---	---	---
GPATCH1	55094	broad.mit.edu	37	19	33601312	33601312	+	Intron	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33601312delA	uc002nug.1	+						GPATCH1_uc002nuh.1_5'Flank	NM_018025	NP_060495			G patch domain containing 1							catalytic step 2 spliceosome	nucleic acid binding			skin(1)	1	Esophageal squamous(110;0.137)																	---	---	---	---
Unknown	0	broad.mit.edu	37	19	37001115	37001115	+	IGR	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37001115delA								ZNF566 (20652 upstream) : ZNF260 (479 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	37253764	37253764	+	Intron	DEL	T	-	-	rs73037146	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37253764delT	uc010efc.2	-						uc010xtm.1_Intron					Homo sapiens zinc finger protein 850 pseudogene, mRNA (cDNA clone IMAGE:6082150).																														---	---	---	---
Unknown	0	broad.mit.edu	37	19	38353026	38353028	+	IGR	DEL	AGG	-	-	rs72471952		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38353026_38353028delAGG								ZNF573 (45086 upstream) : WDR87 (22444 downstream)																																			---	---	---	---
PAK4	10298	broad.mit.edu	37	19	39614021	39614021	+	5'Flank	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39614021delA	uc002okj.1	+						PAK4_uc002okl.1_5'Flank|PAK4_uc002okn.1_5'Flank|PAK4_uc002okm.1_5'Flank|PAK4_uc002oko.1_5'Flank|PAK4_uc002okp.1_5'Flank	NM_001014831	NP_001014831			p21-activated kinase 4 isoform 1						cellular component movement|signal transduction	Golgi apparatus	ATP binding|protein binding|protein serine/threonine kinase activity			lung(3)|ovary(1)	4	all_cancers(60;1.03e-07)|all_epithelial(25;9.66e-08)|all_lung(34;1.58e-07)|Lung NSC(34;1.88e-07)|Ovarian(47;0.0454)		Epithelial(26;4.82e-25)|all cancers(26;2.94e-22)|Lung(45;0.000797)|LUSC - Lung squamous cell carcinoma(53;0.00113)															---	---	---	---
Unknown	0	broad.mit.edu	37	19	40165743	40165743	+	IGR	DEL	G	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40165743delG								LOC100129935 (32702 upstream) : LOC400696 (4271 downstream)																																			---	---	---	---
TTC9B	148014	broad.mit.edu	37	19	40722626	40722627	+	Intron	DEL	CA	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40722626_40722627delCA	uc002onc.2	-							NM_152479	NP_689692			tetratricopeptide repeat domain 9B								binding				0																		---	---	---	---
ITPKC	80271	broad.mit.edu	37	19	41230869	41230869	+	Intron	DEL	G	-	-	rs67214886		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41230869delG	uc002oot.2	+							NM_025194	NP_079470			inositol 1,4,5-trisphosphate 3-kinase C							cytoplasm|nucleus	ATP binding|calmodulin binding|inositol trisphosphate 3-kinase activity				0			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)															---	---	---	---
ATP1A3	478	broad.mit.edu	37	19	42491471	42491472	+	Intron	DEL	TG	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42491471_42491472delTG	uc002osg.2	-						ATP1A3_uc010xwf.1_Intron|ATP1A3_uc010xwg.1_Intron|ATP1A3_uc010xwh.1_Intron|ATP1A3_uc002osh.2_Intron	NM_152296	NP_689509			Na+/K+ -ATPase alpha 3 subunit						ATP biosynthetic process	endoplasmic reticulum|Golgi apparatus	ATP binding|metal ion binding|sodium:potassium-exchanging ATPase activity			ovary(1)|pancreas(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	19	45700757	45700758	+	IGR	INS	-	A	A	rs35735109		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45700757_45700758insA								BLOC1S3 (15700 upstream) : EXOC3L2 (15121 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	46669702	46669702	+	IGR	DEL	G	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46669702delG								IGFL2 (5143 upstream) : DKFZp434J0226 (36981 downstream)																																			---	---	---	---
SULT2B1	6820	broad.mit.edu	37	19	49068593	49068594	+	Intron	DEL	GT	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49068593_49068594delGT	uc002pjl.2	+							NM_177973	NP_814444			sulfotransferase family, cytosolic, 2B, member 1						3'-phosphoadenosine 5'-phosphosulfate metabolic process|steroid metabolic process|xenobiotic metabolic process	cytosol	alcohol sulfotransferase activity|protein binding|steroid sulfotransferase activity			skin(1)	1		all_epithelial(76;2.38e-06)|all_lung(116;4.89e-06)|Lung NSC(112;9.34e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000115)|all cancers(93;0.000147)|GBM - Glioblastoma multiforme(486;0.00707)|Epithelial(262;0.0178)														---	---	---	---
MAMSTR	284358	broad.mit.edu	37	19	49216326	49216326	+	3'UTR	DEL	G	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49216326delG	uc002pkg.2	-	10					MAMSTR_uc002pkf.2_3'UTR	NM_001130915	NP_001124387			MEF2 activating motif and SAP domain containing						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding			ovary(1)	1																OREG0025608	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
Unknown	0	broad.mit.edu	37	19	49715884	49715884	+	IGR	DEL	C	-	-	rs56237325		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49715884delC								TRPM4 (793 upstream) : SLC6A16 (77010 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	50571554	50571554	+	IGR	DEL	G	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50571554delG								FLJ26850 (1505 upstream) : SNAR-A4 (49423 downstream)																																			---	---	---	---
MYH14	79784	broad.mit.edu	37	19	50749386	50749387	+	Intron	INS	-	TCCT	TCCT			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50749386_50749387insTCCT	uc002prr.1	+						MYH14_uc010enu.1_Intron|MYH14_uc002prq.1_Intron	NM_024729	NP_079005			myosin, heavy chain 14 isoform 2						axon guidance|regulation of cell shape	myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			central_nervous_system(1)	1		all_neural(266;0.0571)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00389)|GBM - Glioblastoma multiforme(134;0.0195)														---	---	---	---
ZNF468	90333	broad.mit.edu	37	19	53345827	53345829	+	Intron	DEL	ACA	-	-	rs147824444		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53345827_53345829delACA	uc002qaf.2	-						ZNF468_uc002qae.2_Intron	NM_001008801	NP_001008801			zinc finger protein ZNF468 isoform 2						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2				GBM - Glioblastoma multiforme(134;0.0358)														---	---	---	---
PRKCG	5582	broad.mit.edu	37	19	54409295	54409295	+	Intron	DEL	C	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54409295delC	uc002qcq.1	+						PRKCG_uc010yeg.1_Intron|PRKCG_uc010yeh.1_Intron	NM_002739	NP_002730			protein kinase C, gamma						activation of phospholipase C activity|cell death|intracellular signal transduction|negative regulation of protein catabolic process|negative regulation of protein ubiquitination|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of mismatch repair|synaptic transmission	cytosol	ATP binding|protein kinase C activity|zinc ion binding			lung(4)|ovary(2)|pancreas(2)|large_intestine(1)	9	all_cancers(19;0.0462)|all_epithelial(19;0.0258)|all_lung(19;0.185)|Ovarian(34;0.19)|Lung NSC(19;0.218)			GBM - Glioblastoma multiforme(134;0.0521)														---	---	---	---
LILRB3	11025	broad.mit.edu	37	19	54729941	54729942	+	5'Flank	DEL	AC	-	-	rs3037211		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54729941_54729942delAC	uc002qef.1	-						LILRB3_uc002qee.1_5'Flank|LILRB3_uc002qeh.1_Intron|LILRB3_uc002qeg.1_Intron|LILRB3_uc002qei.1_Intron|LILRA6_uc002qek.1_Intron|LILRB3_uc010erh.1_Intron|LILRB3_uc002qej.1_Intron|LILRA6_uc002qel.1_Intron|LILRA6_uc002qem.1_Intron|LILRB3_uc002qen.1_Intron|LILRB3_uc002qeo.1_Intron|LILRB3_uc002qep.1_Intron|LILRB3_uc002qeq.1_Intron|LILRB3_uc002qer.1_Intron|LILRB3_uc002qes.1_Intron|LILRA6_uc010yep.1_Intron|LILRA6_uc010yeq.1_Intron	NM_006864	NP_006855			leukocyte immunoglobulin-like receptor,						cell surface receptor linked signaling pathway|defense response	integral to plasma membrane	transmembrane receptor activity			skin(2)|ovary(1)	3	all_cancers(19;0.00723)|all_epithelial(19;0.00389)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)														---	---	---	---
Unknown	0	broad.mit.edu	37	19	56641421	56641422	+	IGR	INS	-	A	A	rs79515451	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56641421_56641422insA								ZNF787 (8772 upstream) : ZNF444 (11134 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	57777400	57777400	+	IGR	DEL	T	-	-	rs34519858		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57777400delT								ZNF805 (3295 upstream) : ZNF460 (14019 downstream)																																			---	---	---	---
ZNF329	79673	broad.mit.edu	37	19	58652532	58652533	+	Intron	INS	-	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58652532_58652533insT	uc002qrn.2	-						ZNF329_uc010euk.1_Intron|ZNF329_uc002qro.1_Intron|ZNF329_uc002qrp.1_Intron	NM_024620	NP_078896			zinc finger protein 329						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(1)	1		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Breast(46;0.029)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.017)|Lung(386;0.216)														---	---	---	---
Unknown	0	broad.mit.edu	37	20	2430944	2430947	+	IGR	DEL	TGTG	-	-	rs112467963		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:2430944_2430947delTGTG								TGM6 (17545 upstream) : SNRPB (11334 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	2513630	2513630	+	IGR	DEL	C	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:2513630delC								ZNF343 (8465 upstream) : TMC2 (3623 downstream)																																			---	---	---	---
TMC2	117532	broad.mit.edu	37	20	2617416	2617419	+	Intron	DEL	TGCA	-	-	rs10555997		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:2617416_2617419delTGCA	uc002wgf.1	+						TMC2_uc002wgg.1_Intron	NM_080751	NP_542789			transmembrane cochlear-expressed protein 2							integral to membrane				ovary(3)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	2662898	2662900	+	IGR	DEL	GAA	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:2662898_2662900delGAA								IDH3B (18055 upstream) : EBF4 (10624 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	4758242	4758243	+	IGR	DEL	AT	-	-	rs61343089		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:4758242_4758243delAT								PRNT (36928 upstream) : RASSF2 (2427 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	7238203	7238204	+	IGR	DEL	CA	-	-	rs11468449		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:7238203_7238204delCA								BMP2 (477293 upstream) : HAO1 (625427 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	7844107	7844108	+	IGR	INS	-	AA	AA	rs142841530	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:7844107_7844108insAA								None (None upstream) : HAO1 (19523 downstream)																																			---	---	---	---
ISM1	140862	broad.mit.edu	37	20	13225626	13225626	+	Intron	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:13225626delT	uc010gce.1	+							NM_080826	NP_543016			isthmin 1 homolog precursor							extracellular region					0																		---	---	---	---
MACROD2	140733	broad.mit.edu	37	20	15758083	15758084	+	Intron	INS	-	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:15758083_15758084insT	uc002wou.2	+						MACROD2_uc002wot.2_Intron|MACROD2_uc002woz.2_Intron|MACROD2_uc002wpb.2_Intron	NM_080676	NP_542407			MACRO domain containing 2 isoform 1												0		all_neural(2;0.0381)|Acute lymphoblastic leukemia(2;0.175)																---	---	---	---
Unknown	0	broad.mit.edu	37	20	20365276	20365276	+	IGR	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:20365276delA								INSM1 (13686 upstream) : RALGAPA2 (8136 downstream)																																			---	---	---	---
PLK1S1	55857	broad.mit.edu	37	20	21196122	21196122	+	Intron	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:21196122delA	uc002wsb.2	+						PLK1S1_uc010zsh.1_Intron|PLK1S1_uc010zsi.1_Intron|PLK1S1_uc010zsj.1_Intron|uc002wsc.2_Intron|PLK1S1_uc002wsd.2_Intron|uc002wse.2_Intron	NM_018474	NP_060944			polo-like kinase 1 substrate 1 isoform 1						spindle organization	centrosome	protein kinase binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	22647438	22647438	+	IGR	DEL	C	-	-	rs73620325		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:22647438delC								FOXA2 (81337 upstream) : SSTR4 (368619 downstream)																																			---	---	---	---
NINL	22981	broad.mit.edu	37	20	25509911	25509911	+	Intron	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25509911delA	uc002wux.1	-						NINL_uc010gdn.1_Intron|NINL_uc010gdo.1_Intron|NINL_uc010ztf.1_Intron	NM_025176	NP_079452			ninein-like						G2/M transition of mitotic cell cycle	cytosol|microtubule|microtubule organizing center	calcium ion binding			ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	25858966	25858967	+	IGR	INS	-	A	A	rs57493078		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25858966_25858967insA								FAM182B (10180 upstream) : LOC100134868 (131468 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	26110694	26110695	+	IGR	INS	-	AG	AG			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:26110694_26110695insAG								C20orf191 (16017 upstream) : MIR663 (78127 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	26303304	26303304	+	IGR	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:26303304delT								MIR663 (114390 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	29423140	29423140	+	IGR	DEL	A	-	-	rs111708884		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29423140delA								None (None upstream) : FRG1B (188739 downstream)																																			---	---	---	---
FRG1B	284802	broad.mit.edu	37	20	29624291	29624292	+	Intron	INS	-	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29624291_29624292insT	uc010ztl.1	+						FRG1B_uc002wvm.1_Intron|FRG1B_uc010ztj.1_Intron|FRG1B_uc010gdr.1_Intron|FRG1B_uc010ztk.1_Intron					Homo sapiens cDNA FLJ32537 fis, clone SMINT2000400, highly similar to Homo sapiens FRG1 mRNA.												0																		---	---	---	---
TPX2	22974	broad.mit.edu	37	20	30352763	30352764	+	Intron	INS	-	T	T	rs111384414		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30352763_30352764insT	uc002wwp.1	+						TPX2_uc010gdv.1_Intron	NM_012112	NP_036244			TPX2, microtubule-associated protein homolog						activation of protein kinase activity|apoptosis|cell division|cell proliferation|mitosis|regulation of mitotic spindle organization	cytoplasm|microtubule|nucleus|spindle pole	ATP binding|GTP binding|protein kinase binding			large_intestine(1)|ovary(1)	2			Epithelial(4;0.000771)|Colorectal(19;0.00306)|all cancers(5;0.004)|COAD - Colon adenocarcinoma(19;0.0347)|OV - Ovarian serous cystadenocarcinoma(3;0.0656)															---	---	---	---
Unknown	0	broad.mit.edu	37	20	31932690	31932691	+	IGR	INS	-	A	A	rs141134417		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31932690_31932691insA								C20orf114 (35006 upstream) : CDK5RAP1 (13956 downstream)																																			---	---	---	---
EIF2S2	8894	broad.mit.edu	37	20	32691517	32691517	+	Intron	DEL	T	-	-	rs6119451		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:32691517delT	uc002xaf.2	-						EIF2S2_uc002xag.2_Intron|EIF2S2_uc010ges.2_Intron	NM_003908	NP_003899			eukaryotic translation initiation factor 2 beta							cytosol|eukaryotic translation initiation factor 2 complex	metal ion binding|protein binding|translation initiation factor activity			large_intestine(1)	1																		---	---	---	---
MAP1LC3A	84557	broad.mit.edu	37	20	33147980	33147987	+	3'UTR	DEL	CTGCCTGT	-	-	rs112954375	by1000genomes;by1000genomes;by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33147980_33147987delCTGCCTGT	uc002xaq.1	+	4					MAP1LC3A_uc002xap.1_3'UTR	NM_032514	NP_115903			microtubule-associated protein 1 light chain 3						autophagic vacuole assembly	autophagic vacuole membrane|cytoplasmic vesicle|cytosol|endomembrane system|microtubule	phosphatidylethanolamine binding|protein binding				0																		---	---	---	---
NCOA6	23054	broad.mit.edu	37	20	33363109	33363110	+	Intron	DEL	GT	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33363109_33363110delGT	uc002xav.2	-						NCOA6_uc002xaw.2_Intron|NCOA6_uc010gew.1_Intron	NM_014071	NP_054790			nuclear receptor coactivator 6						brain development|cellular lipid metabolic process|DNA recombination|DNA repair|DNA replication|estrogen receptor signaling pathway|glucocorticoid receptor signaling pathway|heart development|myeloid cell differentiation|positive regulation of transcription from RNA polymerase II promoter|response to hormone stimulus|transcription initiation from RNA polymerase II promoter	transcription factor complex	chromatin binding|enzyme binding|estrogen receptor binding|ligand-dependent nuclear receptor transcription coactivator activity|retinoid X receptor binding|thyroid hormone receptor binding			ovary(3)|breast(3)|central_nervous_system(1)	7																		---	---	---	---
NCOA6	23054	broad.mit.edu	37	20	33366234	33366235	+	Intron	INS	-	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33366234_33366235insT	uc002xav.2	-						NCOA6_uc002xaw.2_Intron|NCOA6_uc010gew.1_Intron	NM_014071	NP_054790			nuclear receptor coactivator 6						brain development|cellular lipid metabolic process|DNA recombination|DNA repair|DNA replication|estrogen receptor signaling pathway|glucocorticoid receptor signaling pathway|heart development|myeloid cell differentiation|positive regulation of transcription from RNA polymerase II promoter|response to hormone stimulus|transcription initiation from RNA polymerase II promoter	transcription factor complex	chromatin binding|enzyme binding|estrogen receptor binding|ligand-dependent nuclear receptor transcription coactivator activity|retinoid X receptor binding|thyroid hormone receptor binding			ovary(3)|breast(3)|central_nervous_system(1)	7																		---	---	---	---
TRPC4AP	26133	broad.mit.edu	37	20	33656763	33656764	+	Intron	INS	-	ACA	ACA	rs72350296		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33656763_33656764insACA	uc002xbk.2	-						TRPC4AP_uc002xbl.2_Intron|TRPC4AP_uc010zur.1_Intron|TRPC4AP_uc002xbm.1_Intron	NM_015638	NP_056453			TRPC4-associated protein isoform a						protein ubiquitination|ubiquitin-dependent protein catabolic process	Cul4A-RING ubiquitin ligase complex	protein binding			central_nervous_system(1)|skin(1)	2			BRCA - Breast invasive adenocarcinoma(18;0.00936)															---	---	---	---
PHF20	51230	broad.mit.edu	37	20	34504993	34504994	+	Intron	DEL	AC	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:34504993_34504994delAC	uc002xek.1	+							NM_016436	NP_057520			PHD finger protein 20						regulation of transcription, DNA-dependent|transcription, DNA-dependent	MLL1 complex	DNA binding|zinc ion binding			ovary(1)	1	Breast(12;0.00631)|all_lung(11;0.0145)																	---	---	---	---
LPIN3	64900	broad.mit.edu	37	20	39969742	39969742	+	Intron	DEL	G	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:39969742delG	uc002xjx.2	+						LPIN3_uc010ggh.2_Intron|LPIN3_uc010zwf.1_Intron	NM_022896	NP_075047			lipin 3						fatty acid metabolic process	nucleus	phosphatidate phosphatase activity			ovary(3)|central_nervous_system(1)	4		Myeloproliferative disorder(115;0.000739)																---	---	---	---
PTPRT	11122	broad.mit.edu	37	20	41329729	41329730	+	Intron	INS	-	T	T	rs145287785	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:41329729_41329730insT	uc002xkg.2	-						PTPRT_uc010ggj.2_Intron	NM_007050	NP_008981			protein tyrosine phosphatase, receptor type, T						homophilic cell adhesion|transmembrane receptor protein tyrosine kinase signaling pathway	cell surface|integral to membrane|plasma membrane	alpha-catenin binding|beta-catenin binding|cadherin binding|delta-catenin binding|gamma-catenin binding|protein tyrosine phosphatase activity|receptor activity			skin(8)|ovary(7)|lung(5)	20		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)																---	---	---	---
Unknown	0	broad.mit.edu	37	20	42402837	42402838	+	IGR	INS	-	A	A	rs144933366		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:42402837_42402838insA								GTSF1L (47195 upstream) : TOX2 (140654 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	43470046	43470046	+	IGR	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:43470046delA								RIMS4 (31134 upstream) : YWHAB (44298 downstream)																																			---	---	---	---
SPINLW1	57119	broad.mit.edu	37	20	44177246	44177247	+	5'Flank	INS	-	CTCTT	CTCTT	rs147873482	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44177246_44177247insCTCTT	uc002xou.2	-						SPINLW1_uc010zxc.1_5'Flank|SPINLW1_uc002xot.2_5'Flank|SPINLW1_uc002xov.1_5'Flank	NM_020398	NP_065131			serine peptidase inhibitor-like, with Kunitz and							extracellular region	serine-type endopeptidase inhibitor activity			pancreas(1)	1		Myeloproliferative disorder(115;0.0122)																---	---	---	---
SLC12A5	57468	broad.mit.edu	37	20	44648605	44648606	+	5'Flank	INS	-	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44648605_44648606insT	uc010zxl.1	+							NM_001134771	NP_001128243			solute carrier family 12 (potassium-chloride						potassium ion transport|sodium ion transport	integral to membrane	potassium:chloride symporter activity			ovary(2)|large_intestine(1)|central_nervous_system(1)|skin(1)	5		Myeloproliferative disorder(115;0.0122)			Bumetanide(DB00887)|Potassium Chloride(DB00761)													---	---	---	---
EYA2	2139	broad.mit.edu	37	20	45697161	45697163	+	Intron	DEL	TTG	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:45697161_45697163delTTG	uc002xsm.2	+						EYA2_uc010ghp.2_Intron|EYA2_uc002xsn.2_Intron|EYA2_uc002xso.2_Intron|EYA2_uc002xsp.2_Intron|EYA2_uc002xsq.2_Intron	NM_005244	NP_005235			eyes absent 2 isoform a						DNA repair|histone dephosphorylation|mesodermal cell fate specification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	magnesium ion binding|protein binding|protein tyrosine phosphatase activity			ovary(1)	1		Myeloproliferative disorder(115;0.0241)																---	---	---	---
Unknown	0	broad.mit.edu	37	20	47019864	47019864	+	IGR	DEL	G	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47019864delG								LOC284749 (20483 upstream) : PREX1 (220929 downstream)																																			---	---	---	---
PREX1	57580	broad.mit.edu	37	20	47373007	47373009	+	Intron	DEL	TTT	-	-	rs35640416		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47373007_47373009delTTT	uc002xtw.1	-							NM_020820	NP_065871			phosphatidylinositol-3,4,						actin filament polymerization|apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|neutrophil activation|small GTPase mediated signal transduction|superoxide metabolic process	cytosol|plasma membrane	enzyme binding|phospholipid binding|Rho GTPase activator activity|Rho guanyl-nucleotide exchange factor activity			lung(3)|ovary(2)|pancreas(1)	6			BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)															---	---	---	---
PTGIS	5740	broad.mit.edu	37	20	48139039	48139039	+	Intron	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:48139039delT	uc002xut.2	-						PTGIS_uc010zyi.1_Intron	NM_000961	NP_000952			prostaglandin I2 synthase						hormone biosynthetic process|prostaglandin biosynthetic process|xenobiotic metabolic process	endoplasmic reticulum lumen|endoplasmic reticulum membrane|integral to membrane	electron carrier activity|heme binding|monooxygenase activity|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen|prostaglandin-I synthase activity			skin(2)|ovary(1)	3			BRCA - Breast invasive adenocarcinoma(12;2.37e-05)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)		Phenylbutazone(DB00812)													---	---	---	---
Unknown	0	broad.mit.edu	37	20	48223237	48223237	+	IGR	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:48223237delT								PTGIS (38530 upstream) : B4GALT5 (26248 downstream)																																			---	---	---	---
NFATC2	4773	broad.mit.edu	37	20	50017880	50017880	+	Intron	DEL	T	-	-	rs2426298	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:50017880delT	uc002xwd.2	-						NFATC2_uc002xwc.2_Intron|NFATC2_uc010zyv.1_Intron|NFATC2_uc010zyw.1_Intron|NFATC2_uc010zyx.1_Intron|NFATC2_uc010zyy.1_Intron|NFATC2_uc010zyz.1_Intron|NFATC2_uc002xwe.2_Intron	NM_173091	NP_775114			nuclear factor of activated T-cells,						B cell receptor signaling pathway|positive regulation of B cell proliferation|response to DNA damage stimulus|response to drug	actin cytoskeleton|nucleus|plasma membrane	protein binding|sequence-specific DNA binding transcription factor activity			ovary(2)	2	Hepatocellular(150;0.248)																	---	---	---	---
NFATC2	4773	broad.mit.edu	37	20	50050296	50050297	+	Intron	INS	-	TG	TG	rs149675221	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:50050296_50050297insTG	uc002xwd.2	-						NFATC2_uc002xwc.2_Intron|NFATC2_uc010zyv.1_Intron|NFATC2_uc010zyw.1_Intron|NFATC2_uc010zyx.1_Intron|NFATC2_uc010zyy.1_Intron|NFATC2_uc010zyz.1_Intron|NFATC2_uc002xwe.2_Intron	NM_173091	NP_775114			nuclear factor of activated T-cells,						B cell receptor signaling pathway|positive regulation of B cell proliferation|response to DNA damage stimulus|response to drug	actin cytoskeleton|nucleus|plasma membrane	protein binding|sequence-specific DNA binding transcription factor activity			ovary(2)	2	Hepatocellular(150;0.248)																	---	---	---	---
ATP9A	10079	broad.mit.edu	37	20	50224649	50224649	+	Intron	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:50224649delA	uc002xwg.1	-						ATP9A_uc010gih.1_Intron|ATP9A_uc002xwf.1_Intron	NM_006045	NP_006036			ATPase, class II, type 9A						ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(4)	4																		---	---	---	---
ATP9A	10079	broad.mit.edu	37	20	50269660	50269660	+	Intron	DEL	C	-	-	rs78516032		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:50269660delC	uc002xwg.1	-						ATP9A_uc010gih.1_Intron|ATP9A_uc002xwf.1_Intron	NM_006045	NP_006036			ATPase, class II, type 9A						ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(4)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	50683239	50683240	+	IGR	INS	-	A	A	rs79488632		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:50683239_50683240insA								SALL4 (264191 upstream) : ZFP64 (17311 downstream)																																			---	---	---	---
TSHZ2	128553	broad.mit.edu	37	20	51588866	51588868	+	5'Flank	DEL	GAG	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:51588866_51588868delGAG	uc002xwo.2	+							NM_173485	NP_775756			teashirt zinc finger homeobox 2						multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|haematopoietic_and_lymphoid_tissue(1)	6			STAD - Stomach adenocarcinoma(23;0.1)															---	---	---	---
TSHZ2	128553	broad.mit.edu	37	20	51733669	51733669	+	Intron	DEL	C	-	-	rs112580828		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:51733669delC	uc002xwo.2	+							NM_173485	NP_775756			teashirt zinc finger homeobox 2						multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|haematopoietic_and_lymphoid_tissue(1)	6			STAD - Stomach adenocarcinoma(23;0.1)															---	---	---	---
Unknown	0	broad.mit.edu	37	20	52138579	52138586	+	IGR	DEL	GAAGGAGG	-	-	rs74179204		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:52138579_52138586delGAAGGAGG								TSHZ2 (34614 upstream) : ZNF217 (45026 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	52153715	52153716	+	IGR	INS	-	A	A	rs11482019		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:52153715_52153716insA								TSHZ2 (49750 upstream) : ZNF217 (29896 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	52760956	52760956	+	IGR	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:52760956delT								BCAS1 (73652 upstream) : CYP24A1 (9032 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	55658474	55658475	+	IGR	DEL	TG	-	-	rs72046343		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:55658474_55658475delTG								TFAP2C (444138 upstream) : BMP7 (85334 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	55736209	55736209	+	IGR	DEL	G	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:55736209delG								TFAP2C (521873 upstream) : BMP7 (7600 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	56327348	56327348	+	IGR	DEL	T	-	-	rs138994757		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:56327348delT								PMEPA1 (40807 upstream) : C20orf85 (398635 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	56598937	56598937	+	IGR	DEL	G	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:56598937delG								PMEPA1 (312396 upstream) : C20orf85 (127046 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	57388510	57388511	+	IGR	INS	-	GC	GC			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57388510_57388511insGC								NPEPL1 (97143 upstream) : MIR296 (4159 downstream)																																			---	---	---	---
TH1L	51497	broad.mit.edu	37	20	57567904	57567905	+	Intron	DEL	AA	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57567904_57567905delAA	uc002yag.2	+						TH1L_uc002yaf.1_Intron|TH1L_uc002yah.2_Intron	NM_198976	NP_945327			TH1-like protein						negative regulation of transcription, DNA-dependent|positive regulation of viral transcription|transcription elongation from RNA polymerase II promoter|viral reproduction	nucleoplasm	protein binding			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3	all_lung(29;0.00711)		Colorectal(105;0.109)															---	---	---	---
Unknown	0	broad.mit.edu	37	20	57968351	57968352	+	IGR	INS	-	TCCA	TCCA	rs141405403	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57968351_57968352insTCCA								EDN3 (67305 upstream) : PHACTR3 (184212 downstream)																																			---	---	---	---
PHACTR3	116154	broad.mit.edu	37	20	58304011	58304013	+	Intron	DEL	AAG	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:58304011_58304013delAAG	uc002yau.2	+						PHACTR3_uc002yat.2_Intron|PHACTR3_uc010zzw.1_Intron|PHACTR3_uc002yav.2_Intron|PHACTR3_uc002yaw.2_Intron|PHACTR3_uc002yax.2_Intron	NM_080672	NP_542403			phosphatase and actin regulator 3 isoform 1							nuclear matrix	actin binding|protein phosphatase inhibitor activity			ovary(2)|pancreas(1)	3	all_lung(29;0.00344)		BRCA - Breast invasive adenocarcinoma(7;2.76e-09)															---	---	---	---
Unknown	0	broad.mit.edu	37	20	58622995	58622996	+	IGR	INS	-	T	T	rs143254699	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:58622995_58622996insT								CDH26 (14166 upstream) : C20orf197 (7984 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	59639062	59639063	+	IGR	INS	-	T	T	rs138647652	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:59639062_59639063insT								MIR646 (755437 upstream) : CDH4 (188496 downstream)																																			---	---	---	---
CDH4	1002	broad.mit.edu	37	20	59925770	59925771	+	Intron	DEL	CC	-	-	rs10534860		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:59925770_59925771delCC	uc002ybn.1	+							NM_001794	NP_001785			cadherin 4, type 1 preproprotein						adherens junction organization|cell junction assembly		calcium ion binding			lung(3)|ovary(2)|skin(1)	6			BRCA - Breast invasive adenocarcinoma(19;2.36e-08)															---	---	---	---
TAF4	6874	broad.mit.edu	37	20	60557124	60557124	+	Intron	DEL	C	-	-	rs112352725		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60557124delC	uc002ybs.2	-							NM_003185	NP_003176			TBP-associated factor 4						interspecies interaction between organisms|positive regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|viral reproduction	cytoplasm|MLL1 complex|transcription factor TFIID complex|transcription factor TFTC complex	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity			ovary(2)|pancreas(1)	3	Breast(26;1e-08)		BRCA - Breast invasive adenocarcinoma(19;3.1e-07)															---	---	---	---
Unknown	0	broad.mit.edu	37	20	60662724	60662725	+	IGR	INS	-	GCACAC	GCACAC	rs138111603	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60662724_60662725insGCACAC								TAF4 (21858 upstream) : LSM14B (34792 downstream)																																			---	---	---	---
CABLES2	81928	broad.mit.edu	37	20	60972983	60972984	+	Intron	INS	-	GGTGGTGGTGATGGC	GGTGGTGGTGATGGC	rs146308567	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60972983_60972984insGGTGGTGGTGATGGC	uc002ycv.2	-							NM_031215	NP_112492			Cdk5 and Abl enzyme substrate 2						cell cycle|cell division|regulation of cell cycle|regulation of cell division		cyclin-dependent protein kinase regulator activity			pancreas(1)	1	Breast(26;2.05e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)															---	---	---	---
C20orf200	253868	broad.mit.edu	37	20	61144699	61144700	+	Intron	INS	-	G	G	rs150279870	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61144699_61144700insG	uc002ycz.1	-						C20orf200_uc002ycy.2_Intron|C20orf166_uc011aaj.1_5'Flank	NM_152757	NP_689970			hypothetical protein LOC253868												0	Breast(26;2.05e-08)		BRCA - Breast invasive adenocarcinoma(19;7.17e-06)															---	---	---	---
Unknown	0	broad.mit.edu	37	20	61189005	61189006	+	IGR	INS	-	TG	TG	rs138065359	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61189005_61189006insTG								C20orf166 (21035 upstream) : SLCO4A1 (84791 downstream)																																			---	---	---	---
DIDO1	11083	broad.mit.edu	37	20	61526812	61526812	+	Intron	DEL	A	-	-	rs11086145		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61526812delA	uc002ydr.1	-						DIDO1_uc002yds.1_Intron|DIDO1_uc002ydt.1_Intron|DIDO1_uc002ydu.1_Intron	NM_033081	NP_149072			death inducer-obliterator 1 isoform c						apoptosis|transcription, DNA-dependent	cytoplasm|nucleus	zinc ion binding			ovary(3)|skin(3)	6	Breast(26;5.68e-08)																	---	---	---	---
Unknown	0	broad.mit.edu	37	20	61680511	61680511	+	Intron	DEL	C	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61680511delC	uc002yec.1	+											Homo sapiens cDNA FLJ46471 fis, clone THYMU3023394.																														---	---	---	---
Unknown	0	broad.mit.edu	37	20	61707372	61707374	+	Intron	DEL	AAA	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61707372_61707374delAAA	uc002yec.1	+											Homo sapiens cDNA FLJ46471 fis, clone THYMU3023394.																														---	---	---	---
HAR1A	768096	broad.mit.edu	37	20	61734770	61734772	+	Intron	DEL	AGG	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61734770_61734772delAGG	uc002yef.1	+						HAR1B_uc002yee.1_5'Flank	NR_003244				Homo sapiens cDNA clone IMAGE:4812795.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	61820557	61820558	+	IGR	INS	-	G	G	rs145366606		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61820557_61820558insG								MIR124-3 (10619 upstream) : YTHDF1 (6226 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	62027278	62027279	+	5'Flank	INS	-	T	T	rs148732981	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62027278_62027279insT	uc002yew.1	-											Homo sapiens cDNA FLJ31705 fis, clone NT2RI2006183, weakly similar to Proline-rich protein M14 precursor.																														---	---	---	---
GMEB2	26205	broad.mit.edu	37	20	62240631	62240633	+	Intron	DEL	CCA	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62240631_62240633delCCA	uc002yfp.1	-						GMEB2_uc002yfq.1_Intron	NM_012384	NP_036516			glucocorticoid modulatory element binding						regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	cytoplasm|nucleus	DNA binding|metal ion binding				0	all_cancers(38;2.51e-11)|all_epithelial(29;8.27e-13)		Epithelial(9;4.79e-09)|all cancers(9;2.76e-08)|BRCA - Breast invasive adenocarcinoma(10;5.15e-06)|OV - Ovarian serous cystadenocarcinoma(5;0.0114)															---	---	---	---
SOX18	54345	broad.mit.edu	37	20	62683303	62683303	+	5'Flank	DEL	G	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62683303delG	uc002yhs.2	-							NM_018419	NP_060889			SRY-box 18						angiogenesis|blood vessel endothelial cell migration|endocardial cell differentiation|endocardium formation|establishment of endothelial barrier|heart looping|lymphangiogenesis|lymphatic endothelial cell differentiation|negative regulation of transcription, DNA-dependent|outflow tract morphogenesis|positive regulation of transcription from RNA polymerase II promoter|vasculogenesis	nucleus	transcription regulatory region DNA binding				0	all_cancers(38;3.45e-11)|all_epithelial(29;9.12e-13)|Lung NSC(23;2e-09)|all_lung(23;6.77e-09)																	---	---	---	---
Unknown	0	broad.mit.edu	37	20	62946857	62946858	+	IGR	INS	-	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62946857_62946858insT								PCMTD2 (39279 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	9576271	9576271	+	IGR	DEL	C	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:9576271delC								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	10534467	10534467	+	Intron	DEL	T	-	-	rs71261237		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10534467delT	uc011abv.1	-											Homo sapiens cDNA, FLJ18615.																														---	---	---	---
Unknown	0	broad.mit.edu	37	21	10637207	10637207	+	IGR	DEL	G	-	-	rs71243290		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10637207delG								None (None upstream) : TPTE (269536 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	10854220	10854220	+	IGR	DEL	C	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10854220delC								None (None upstream) : TPTE (52523 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	11116167	11116168	+	IGR	INS	-	AG	AG	rs138129426		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11116167_11116168insAG								BAGE (17230 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	11132925	11132926	+	IGR	INS	-	GC	GC	rs144829107		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11132925_11132926insGC								BAGE (33988 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	14343742	14343743	+	IGR	INS	-	AG	AG			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:14343742_14343743insAG								None (None upstream) : C21orf99 (66744 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	15608757	15608758	+	IGR	INS	-	AA	AA	rs148453557	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:15608757_15608758insAA								RBM11 (8066 upstream) : ABCC13 (37362 downstream)																																			---	---	---	---
SAMSN1	64092	broad.mit.edu	37	21	15865279	15865279	+	Intron	DEL	C	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:15865279delC	uc002yju.1	-						SAMSN1_uc010gky.1_Intron|SAMSN1_uc002yjv.1_Intron	NM_022136	NP_071419			SAM domain, SH3 domain and nuclear localization						negative regulation of adaptive immune response|negative regulation of B cell activation|negative regulation of peptidyl-tyrosine phosphorylation	cytoplasm|nucleus|ruffle	phosphotyrosine binding			ovary(3)|pancreas(1)	4				Epithelial(23;0.000155)|COAD - Colon adenocarcinoma(22;0.00118)|Colorectal(24;0.00961)|Lung(58;0.164)														---	---	---	---
Unknown	0	broad.mit.edu	37	21	16078147	16078148	+	IGR	INS	-	AGAG	AGAG	rs137988774	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:16078147_16078148insAGAG								SAMSN1 (122424 upstream) : NRIP1 (255408 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	19067384	19067384	+	IGR	DEL	T	-	-	rs74185385		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:19067384delT								BTG3 (82116 upstream) : C21orf91 (82339 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	29188230	29188231	+	IGR	INS	-	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:29188230_29188231insT								NCRNA00113 (64678 upstream) : C21orf94 (197451 downstream)																																			---	---	---	---
TIAM1	7074	broad.mit.edu	37	21	32884577	32884577	+	Intron	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:32884577delT	uc002yow.1	-						TIAM1_uc002yox.1_Intron	NM_003253	NP_003244			T-cell lymphoma invasion and metastasis 1						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cell-cell junction|cytosol	receptor signaling protein activity|Rho guanyl-nucleotide exchange factor activity			lung(3)|breast(3)|ovary(2)|large_intestine(2)	10																		---	---	---	---
RUNX1	861	broad.mit.edu	37	21	36578002	36578003	+	Intron	INS	-	GT	GT			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:36578002_36578003insGT	uc002yut.1	-											Synthetic construct DNA, clone: pF1KB4846, Homo sapiens RUNX1 gene for runt-related transcription factor 1, complete cds, without stop codon, in Flexi system.						myeloid cell differentiation|negative regulation of granulocyte differentiation|positive regulation of angiogenesis|positive regulation of granulocyte differentiation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent	nucleus|nucleus	ATP binding|calcium ion binding|DNA binding|DNA binding|protein binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|sequence-specific DNA binding transcription factor activity|transcription factor binding			haematopoietic_and_lymphoid_tissue(383)|lung(2)|ovary(1)|central_nervous_system(1)	387								T	RPL22|MDS1|EVI1|CBFA2T3|CBFA2T1|ETV6|LAF4	AML|preB- ALL|T-ALL				Platelet_disorder_associated_with_Myeloid_Malignancies				---	---	---	---
Unknown	0	broad.mit.edu	37	21	40463472	40463474	+	IGR	DEL	CTC	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:40463472_40463474delCTC								ETS2 (266596 upstream) : PSMG1 (83916 downstream)																																			---	---	---	---
IGSF5	150084	broad.mit.edu	37	21	41153959	41153960	+	Intron	INS	-	T	T	rs150964215	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:41153959_41153960insT	uc002yyo.2	+							NM_001080444	NP_001073913			immunoglobulin superfamily 5 like							integral to membrane|tight junction					0		Prostate(19;5.35e-06)																---	---	---	---
DSCAM	1826	broad.mit.edu	37	21	41719496	41719497	+	Intron	INS	-	G	G			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:41719496_41719497insG	uc002yyq.1	-						DSCAM_uc002yyr.1_Intron	NM_001389	NP_001380			Down syndrome cell adhesion molecule isoform						cell adhesion|dendrite self-avoidance|negative regulation of cell adhesion|positive regulation of axon extension involved in axon guidance|positive regulation of phosphorylation	axon|extracellular region|growth cone|integral to plasma membrane|membrane fraction	protein binding			ovary(6)|skin(4)|upper_aerodigestive_tract(1)	11		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)																---	---	---	---
CRKL	1399	broad.mit.edu	37	22	21294078	21294078	+	Intron	DEL	T	-	-	rs66778367		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:21294078delT	uc002ztf.2	+						CRKL_uc002ztg.1_Intron	NM_005207	NP_005198			v-crk sarcoma virus CT10 oncogene homolog						JNK cascade|Ras protein signal transduction	cytosol	protein tyrosine kinase activity|SH3/SH2 adaptor activity|signal transducer activity				0	all_cancers(11;1.16e-25)|all_epithelial(7;3.37e-24)|Lung NSC(8;7.25e-16)|all_lung(8;1.37e-14)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000204)|Lung(15;0.00494)|Epithelial(17;0.176)															---	---	---	---
P2RX6	9127	broad.mit.edu	37	22	21382151	21382151	+	3'UTR	DEL	G	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:21382151delG	uc010gsu.1	+	12					P2RX6_uc002ztz.2_3'UTR|P2RX6_uc002zua.2_RNA|P2RX6_uc002zuc.1_RNA	NM_005446	NP_005437			purinergic receptor P2X6 isoform 1						muscle contraction|protein homooligomerization	cell junction|cytoplasm|integral to plasma membrane	ATP binding|extracellular ATP-gated cation channel activity|identical protein binding|purinergic nucleotide receptor activity				0																		---	---	---	---
LOC96610	96610	broad.mit.edu	37	22	22659452	22659452	+	Intron	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22659452delA	uc011aim.1	+						LOC96610_uc011aiq.1_Intron|LOC96610_uc011aip.1_Intron|LOC96610_uc010gto.2_Intron					Parts of antibodies, mostly variable regions.												0																		---	---	---	---
CABIN1	23523	broad.mit.edu	37	22	24420185	24420185	+	Intron	DEL	G	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24420185delG	uc002zzi.1	+						CABIN1_uc002zzj.1_Intron|CABIN1_uc002zzl.1_Intron|CABIN1_uc010guk.1_Intron|CABIN1_uc002zzk.1_Intron	NM_012295	NP_036427			calcineurin binding protein 1						cell surface receptor linked signaling pathway|chromatin modification	nucleus	protein phosphatase inhibitor activity			ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	5																		---	---	---	---
ADRBK2	157	broad.mit.edu	37	22	26110806	26110806	+	Intron	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26110806delT	uc003abx.3	+						ADRBK2_uc003aby.3_Intron	NM_005160	NP_005151			beta-adrenergic receptor kinase 2								ATP binding|beta-adrenergic receptor kinase activity|signal transducer activity			lung(3)|ovary(2)|stomach(1)|central_nervous_system(1)	7					Adenosine triphosphate(DB00171)													---	---	---	---
SEZ6L	23544	broad.mit.edu	37	22	26605954	26605957	+	Intron	DEL	AGGG	-	-	rs5752279		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26605954_26605957delAGGG	uc003acb.2	+						SEZ6L_uc003acc.2_Intron|SEZ6L_uc011akc.1_Intron|SEZ6L_uc003acd.2_Intron|SEZ6L_uc011akd.1_Intron|SEZ6L_uc003ace.2_Intron	NM_021115	NP_066938			seizure related 6 homolog (mouse)-like							endoplasmic reticulum membrane|integral to membrane				ovary(4)|central_nervous_system(1)|pancreas(1)	6																		---	---	---	---
SEZ6L	23544	broad.mit.edu	37	22	26744480	26744483	+	Intron	DEL	GAAG	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26744480_26744483delGAAG	uc003acb.2	+						SEZ6L_uc003acc.2_Intron|SEZ6L_uc011akc.1_Intron|SEZ6L_uc003acd.2_Intron|SEZ6L_uc011akd.1_Intron|SEZ6L_uc003ace.2_Intron|SEZ6L_uc003acf.1_Intron|SEZ6L_uc010gvc.1_Intron|SEZ6L_uc011ake.1_Intron	NM_021115	NP_066938			seizure related 6 homolog (mouse)-like							endoplasmic reticulum membrane|integral to membrane				ovary(4)|central_nervous_system(1)|pancreas(1)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	22	27565905	27565905	+	IGR	DEL	A	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:27565905delA								MIAT (450956 upstream) : MN1 (578361 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	27755436	27755437	+	IGR	INS	-	TG	TG	rs141246301	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:27755436_27755437insTG								MIAT (640487 upstream) : MN1 (388829 downstream)																																			---	---	---	---
LIF	3976	broad.mit.edu	37	22	30644005	30644005	+	5'Flank	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:30644005delT	uc003agz.2	-						LIF_uc011aks.1_5'Flank	NM_002309	NP_002300			leukemia inhibitory factor (cholinergic						immune response|leukemia inhibitory factor signaling pathway|negative regulation of hormone secretion|positive regulation of cell proliferation|positive regulation of macrophage differentiation|positive regulation of MAPKKK cascade|positive regulation of mesenchymal to epithelial transition involved in metanephros morphogenesis|positive regulation of peptidyl-serine phosphorylation of STAT protein|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tyrosine phosphorylation of Stat1 protein|positive regulation of tyrosine phosphorylation of Stat3 protein|regulation of metanephric nephron tubule epithelial cell differentiation		cytokine activity|growth factor activity|leukemia inhibitory factor receptor binding				0			Epithelial(10;0.171)															---	---	---	---
RNF185	91445	broad.mit.edu	37	22	31562544	31562545	+	Intron	INS	-	TTC	TTC	rs146468764	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:31562544_31562545insTTC	uc003akb.2	+						RNF185_uc010gwh.2_Intron|RNF185_uc011alm.1_Intron|RNF185_uc003akc.2_Intron|RNF185_uc003ake.2_Intron	NM_152267	NP_689480			ring finger protein 185 isoform 1							integral to membrane	zinc ion binding				0																		---	---	---	---
C22orf30	253143	broad.mit.edu	37	22	32084257	32084257	+	Intron	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32084257delT	uc003alp.3	-						C22orf30_uc003alo.1_Intron|C22orf30_uc010gwj.1_Intron	NM_173566	NP_775837			hypothetical protein LOC253143												0																		---	---	---	---
SLC5A1	6523	broad.mit.edu	37	22	32448708	32448708	+	Intron	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32448708delT	uc003amc.2	+							NM_000343	NP_000334			solute carrier family 5 (sodium/glucose						carbohydrate metabolic process	integral to plasma membrane	glucose:sodium symporter activity|protein binding			skin(1)	1																		---	---	---	---
APOL1	8542	broad.mit.edu	37	22	36651357	36651358	+	Intron	DEL	CT	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:36651357_36651358delCT	uc003apf.2	+						APOL1_uc011amn.1_Intron|APOL1_uc003apc.2_Intron|APOL1_uc003ape.2_Intron|APOL1_uc011amo.1_Intron|APOL1_uc011amp.1_Intron|APOL1_uc011amq.1_Intron|APOL1_uc010gwx.2_Intron	NM_003661	NP_003652			apolipoprotein L1 isoform a precursor						cholesterol metabolic process|cytolysis|innate immune response|killing of cells of other organism|lipid transport|lipoprotein metabolic process	high-density lipoprotein particle|very-low-density lipoprotein particle	chloride channel activity|lipid binding|protein binding			breast(2)|ovary(1)	3																		---	---	---	---
CYTH4	27128	broad.mit.edu	37	22	37677416	37677419	+	5'Flank	DEL	TTCA	-	-	rs67645329		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:37677416_37677419delTTCA	uc003arf.2	+						CYTH4_uc003ard.3_5'Flank|CYTH4_uc003are.2_5'Flank|CYTH4_uc011amw.1_5'Flank|CYTH4_uc010gxe.2_5'Flank	NM_013385	NP_037517			cytohesin 4						regulation of ARF protein signal transduction|regulation of cell adhesion	cytoplasm|plasma membrane	ARF guanyl-nucleotide exchange factor activity			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	22	37743026	37743026	+	IGR	DEL	T	-	-	rs5845334		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:37743026delT								CYTH4 (31638 upstream) : ELFN2 (20953 downstream)																																			---	---	---	---
PACSIN2	11252	broad.mit.edu	37	22	43300724	43300724	+	Intron	DEL	C	-	-	rs11306443		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:43300724delC	uc010gzg.2	-						PACSIN2_uc003bdg.3_Intron|PACSIN2_uc003bde.3_Intron|PACSIN2_uc003bdf.3_Intron	NM_007229	NP_009160			protein kinase C and casein kinase substrate in						actin cytoskeleton organization|endocytosis	cytoplasmic membrane-bounded vesicle	transporter activity				0		Glioma(61;0.222)																---	---	---	---
EFCAB6	64800	broad.mit.edu	37	22	44126142	44126143	+	Intron	INS	-	GAT	GAT			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:44126142_44126143insGAT	uc003bdy.1	-						EFCAB6_uc003bdz.1_Intron|EFCAB6_uc010gzi.1_Intron|EFCAB6_uc010gzk.1_Intron|EFCAB6_uc011aqa.1_Intron|EFCAB6_uc003bea.1_Intron|EFCAB6_uc003beb.3_Intron	NM_022785	NP_073622			CAP-binding protein complex interacting protein						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	calcium ion binding			ovary(3)|skin(2)|upper_aerodigestive_tract(1)|pancreas(1)	7		Ovarian(80;0.0247)|all_neural(38;0.025)																---	---	---	---
PRR5-ARHGAP8	553158	broad.mit.edu	37	22	45206820	45206821	+	Intron	INS	-	CA	CA	rs147770214	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:45206820_45206821insCA	uc003bfd.2	+						PRR5-ARHGAP8_uc003bfc.2_Intron|PRR5-ARHGAP8_uc011aqi.1_Intron|PRR5-ARHGAP8_uc011aqj.1_Intron|ARHGAP8_uc003bfi.2_Intron|ARHGAP8_uc010gzv.2_Intron|ARHGAP8_uc003bfj.2_Intron|ARHGAP8_uc003bfk.2_Intron|ARHGAP8_uc003bfl.2_Intron	NM_181335	NP_851852			Rho GTPase activating protein 8 isoform 2											skin(2)	2																		---	---	---	---
FBLN1	2192	broad.mit.edu	37	22	45935086	45935086	+	Intron	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:45935086delT	uc003bgj.1	+						FBLN1_uc003bgg.1_Intron|FBLN1_uc003bgh.2_Intron|FBLN1_uc010gzz.2_Intron|FBLN1_uc003bgi.1_Intron	NM_006486	NP_006477			fibulin 1 isoform D						interspecies interaction between organisms	extracellular space|soluble fraction	calcium ion binding|extracellular matrix structural constituent|protein binding			ovary(1)|central_nervous_system(1)	2		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0182)														---	---	---	---
FAM19A5	25817	broad.mit.edu	37	22	48980465	48980466	+	Intron	DEL	CA	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:48980465_48980466delCA	uc003bim.3	+						FAM19A5_uc003bio.3_Intron	NM_001082967	NP_001076436			family with sequence similarity 19 (chemokine							extracellular region|integral to membrane				large_intestine(1)	1		all_cancers(38;2.95e-11)|all_epithelial(38;3.07e-10)|all_lung(38;2.89e-05)|Breast(42;0.000396)|Lung NSC(38;0.000471)|Ovarian(80;0.00934)|Lung SC(80;0.195)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0227)|BRCA - Breast invasive adenocarcinoma(115;0.119)														---	---	---	---
Unknown	0	broad.mit.edu	37	X	361310	361310	+	IGR	DEL	C	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:361310delC								PPP2R3B (13683 upstream) : SHOX (223769 downstream)																																			---	---	---	---
P2RY8	286530	broad.mit.edu	37	X	1643783	1643784	+	Intron	INS	-	ATCC	ATCC			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1643783_1643784insATCC	uc004cpz.2	-							NM_178129	NP_835230			G-protein coupled purinergic receptor P2Y8							integral to membrane|plasma membrane	purinergic nucleotide receptor activity, G-protein coupled			lung(5)	5		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)						T	CRLF2	B-ALL|Downs associated ALL								---	---	---	---
Unknown	0	broad.mit.edu	37	X	24254890	24254890	+	IGR	DEL	C	-	-	rs78857891		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:24254890delC								ZFX (22263 upstream) : FAM48B2 (74090 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	61793987	61793987	+	IGR	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:61793987delT								None (None upstream) : SPIN4 (773121 downstream)																																			---	---	---	---
MTMR8	55613	broad.mit.edu	37	X	63568642	63568643	+	Frame_Shift_Del	DEL	AG	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:63568642_63568643delAG	uc004dvs.2	-	6	697_698	c.629_630delCT	c.(628-630)TCTfs	p.S210fs	MTMR8_uc011mou.1_Frame_Shift_Del_p.S210fs|MTMR8_uc004dvt.1_Frame_Shift_Del_p.S210fs	NM_017677	NP_060147	Q96EF0	MTMR8_HUMAN	myotubularin related protein 8	210	Myotubularin phosphatase.					nuclear envelope	protein tyrosine phosphatase activity			ovary(2)|breast(2)	4																		---	---	---	---
NHSL2	340527	broad.mit.edu	37	X	71149598	71149599	+	Intron	INS	-	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:71149598_71149599insT	uc011mqa.1	+							NM_001013627	NP_001013649			NHS-like 2												0	Renal(35;0.156)																	---	---	---	---
NXF4	55999	broad.mit.edu	37	X	101804817	101804818	+	5'Flank	INS	-	C	C	rs112443744		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:101804817_101804818insC	uc004ejf.1	+							NR_002216				Homo sapiens cDNA FLJ42710 fis, clone BRAMY3007609, moderately similar to Homo sapiens nuclear RNA export factor 2 (NXF2).												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	X	113736013	113736014	+	IGR	INS	-	AC	AC			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:113736013_113736014insAC								None (None upstream) : HTR2C (82537 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	122028899	122028902	+	IGR	DEL	ACAC	-	-	rs113897347		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:122028899_122028902delACAC								None (None upstream) : GRIA3 (289194 downstream)																																			---	---	---	---
ODZ1	10178	broad.mit.edu	37	X	123727740	123727740	+	Intron	DEL	G	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:123727740delG	uc004euj.2	-						ODZ1_uc011muj.1_Intron|ODZ1_uc010nqy.2_Intron	NM_014253	NP_055068			odz, odd Oz/ten-m homolog 1 isoform 3						immune response|negative regulation of cell proliferation|nervous system development|signal transduction	extracellular region	heparin binding			ovary(11)|breast(4)|large_intestine(2)|skin(2)|pancreas(2)|upper_aerodigestive_tract(1)|lung(1)	23																		---	---	---	---
Unknown	0	broad.mit.edu	37	X	127593162	127593162	+	IGR	DEL	C	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:127593162delC								ACTRT1 (406780 upstream) : SMARCA1 (987318 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	127752592	127752595	+	IGR	DEL	ACAT	-	-	rs68132694	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:127752592_127752595delACAT								ACTRT1 (566210 upstream) : SMARCA1 (827885 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	128740968	128740983	+	IGR	DEL	GAAGGAAGGAAGTAAG	-	-	rs72092281		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:128740968_128740983delGAAGGAAGGAAGTAAG								OCRL (14440 upstream) : APLN (38343 downstream)																																			---	---	---	---
IGSF1	3547	broad.mit.edu	37	X	130669705	130669705	+	Intron	DEL	T	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:130669705delT	uc004ewf.2	-							NM_001555	NP_001546			immunoglobulin superfamily, member 1 isoform 1						regulation of transcription, DNA-dependent	extracellular region|integral to membrane	inhibin beta-A binding|inhibin beta-B binding			ovary(3)|lung(1)|central_nervous_system(1)	5																		---	---	---	---
HS6ST2	90161	broad.mit.edu	37	X	131890848	131890849	+	Intron	INS	-	GT	GT	rs3065679		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:131890848_131890849insGT	uc011mve.1	-						HS6ST2_uc011mvb.1_Intron|HS6ST2_uc011mvc.1_Intron|HS6ST2_uc011mvd.1_Intron	NM_147175	NP_671704			heparan sulfate 6-O-sulfotransferase 2 isoform							integral to membrane	sulfotransferase activity				0	Acute lymphoblastic leukemia(192;0.000127)																	---	---	---	---
GPC3	2719	broad.mit.edu	37	X	132684515	132684515	+	Intron	DEL	C	-	-			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:132684515delC	uc004exe.1	-						GPC3_uc004exd.1_Intron|GPC3_uc010nrn.1_Intron|GPC3_uc011mvh.1_Intron|GPC3_uc010nro.1_Intron	NM_004484	NP_004475			glypican 3 isoform 2 precursor							extracellular space|integral to plasma membrane|proteinaceous extracellular matrix	heparan sulfate proteoglycan binding|peptidyl-dipeptidase inhibitor activity			lung(2)|prostate(1)|breast(1)|skin(1)	5	Acute lymphoblastic leukemia(192;0.000127)							T|D|Mis|N|F|S			Wilms tumour			Simpson-Golabi-Behmel_syndrome				---	---	---	---
HPRT1	3251	broad.mit.edu	37	X	133614836	133614837	+	Intron	DEL	TG	-	-	rs111997872		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:133614836_133614837delTG	uc004exl.3	+						HPRT1_uc010nrs.2_Intron	NM_000194	NP_000185			hypoxanthine phosphoribosyltransferase 1						adenine salvage|central nervous system neuron development|cerebral cortex neuron differentiation|cytolysis|dendrite morphogenesis|GMP catabolic process|GMP salvage|grooming behavior|guanine salvage|hypoxanthine salvage|IMP salvage|lymphocyte proliferation|positive regulation of dopamine metabolic process|protein homotetramerization|purine ribonucleoside salvage|response to amphetamine|striatum development	cytosol	guanine phosphoribosyltransferase activity|hypoxanthine phosphoribosyltransferase activity|magnesium ion binding|nucleotide binding|protein homodimerization activity				0	Acute lymphoblastic leukemia(192;0.000127)				Mercaptopurine(DB01033)|Thioguanine(DB00352)													---	---	---	---
Unknown	0	broad.mit.edu	37	Y	13637596	13637597	+	IGR	INS	-	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:13637596_13637597insT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	1855315	1855315	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1855315C>T	uc001aik.2	-	7	1136	c.286G>A	c.(286-288)GTC>ATC	p.V96I	uc001ail.2_Missense_Mutation_p.V96I					RecName: Full=Uncharacterized protein C1orf222;																														---	---	---	---
CNR2	1269	broad.mit.edu	37	1	24201571	24201571	+	Silent	SNP	G	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:24201571G>A	uc001bif.2	-	2	664	c.537C>T	c.(535-537)TGC>TGT	p.C179C		NM_001841	NP_001832	P34972	CNR2_HUMAN	cannabinoid receptor 2 (macrophage)	179	Extracellular (Potential).				behavior|G-protein signaling, coupled to cyclic nucleotide second messenger|immune response|inflammatory response	dendrite|integral to plasma membrane|perikaryon	cannabinoid receptor activity			skin(2)|central_nervous_system(1)	3		Colorectal(325;3.46e-05)|Renal(390;0.000219)|Lung NSC(340;0.000233)|all_lung(284;0.000321)|Ovarian(437;0.00348)|Breast(348;0.00957)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;1.32e-24)|Colorectal(126;6.09e-08)|COAD - Colon adenocarcinoma(152;3.33e-06)|GBM - Glioblastoma multiforme(114;2.9e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00101)|KIRC - Kidney renal clear cell carcinoma(1967;0.00359)|STAD - Stomach adenocarcinoma(196;0.0131)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.146)	Nabilone(DB00486)													---	---	---	---
SNIP1	79753	broad.mit.edu	37	1	38003393	38003393	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:38003393C>G	uc001cbi.2	-	4	1220	c.1147G>C	c.(1147-1149)GAT>CAT	p.D383H	SNIP1_uc010oid.1_RNA	NM_024700	NP_078976	Q8TAD8	SNIP1_HUMAN	Smad nuclear interacting protein	383					production of miRNAs involved in gene silencing by miRNA	nucleus	protein binding			upper_aerodigestive_tract(1)|lung(1)	2		Myeloproliferative disorder(586;0.0393)																---	---	---	---
MACF1	23499	broad.mit.edu	37	1	39749838	39749838	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39749838A>C	uc010ois.1	+	11	1236	c.1031A>C	c.(1030-1032)CAA>CCA	p.Q344P	MACF1_uc001cda.1_Missense_Mutation_p.Q252P	NM_012090	NP_036222	Q9UPN3	MACF1_HUMAN	microfilament and actin filament cross-linker	344					cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding			ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)															---	---	---	---
IFI44	10561	broad.mit.edu	37	1	79128567	79128567	+	Intron	SNP	G	C	C			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:79128567G>C	uc001dip.3	+							NM_006417	NP_006408			interferon-induced, hepatitis C-associated						response to virus	cytoplasm				ovary(1)|central_nervous_system(1)	2																		---	---	---	---
ELTD1	64123	broad.mit.edu	37	1	79357383	79357383	+	Intron	SNP	A	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:79357383A>T	uc001diq.3	-							NM_022159	NP_071442			EGF, latrophilin and seven transmembrane domain						neuropeptide signaling pathway	integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(1)|skin(1)	2				COAD - Colon adenocarcinoma(225;0.0905)|Colorectal(170;0.103)|all cancers(265;0.105)|Epithelial(280;0.148)														---	---	---	---
SH3GLB1	51100	broad.mit.edu	37	1	87190089	87190089	+	Splice_Site	SNP	G	C	C			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:87190089G>C	uc001dlw.2	+	5	896	c.570_splice	c.e5+1	p.S190_splice	SH3GLB1_uc001dlx.2_Splice_Site_p.S190_splice|SH3GLB1_uc001dly.2_Splice_Site_p.S190_splice|SH3GLB1_uc001dlz.2_Splice_Site_p.S90_splice	NM_016009	NP_057093			SH3-containing protein SH3GLB1						anti-apoptosis|filopodium assembly|signal transduction	Golgi membrane|mitochondrial outer membrane	cytoskeletal adaptor activity|protein homodimerization activity|SH3 domain binding				0		Lung NSC(277;0.209)		all cancers(265;0.0136)|Epithelial(280;0.0414)														---	---	---	---
PPIAL4G	644591	broad.mit.edu	37	1	143767465	143767465	+	Silent	SNP	G	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:143767465G>A	uc001ejt.2	-	1	417	c.384C>T	c.(382-384)GCC>GCT	p.A128A		NM_001123068	NP_001116540	A2BFH1	PAL4G_HUMAN	peptidylprolyl isomerase A (cyclophilin A)-like	128	PPIase cyclophilin-type.				protein folding	cytoplasm	peptidyl-prolyl cis-trans isomerase activity				0																		---	---	---	---
POLR3C	10623	broad.mit.edu	37	1	145606349	145606349	+	Silent	SNP	T	G	G			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145606349T>G	uc001eoh.2	-	5	765	c.604A>C	c.(604-606)AGG>CGG	p.R202R	NBPF10_uc001emp.3_Intron|POLR3C_uc001eog.2_Silent_p.R215R|POLR3C_uc001eoi.2_RNA|POLR3C_uc009wix.2_Silent_p.R202R	NM_006468	NP_006459	Q9BUI4	RPC3_HUMAN	polymerase (RNA) III (DNA directed) polypeptide	202					innate immune response|positive regulation of innate immune response|positive regulation of interferon-beta production|regulation of transcription from RNA polymerase III promoter|response to virus	DNA-directed RNA polymerase III complex	DNA binding|DNA-directed RNA polymerase activity			ovary(1)	1	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)		Epithelial(2;7.55e-13)															---	---	---	---
BCL9	607	broad.mit.edu	37	1	147095649	147095649	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:147095649G>A	uc001epq.2	+	10	3910	c.3170G>A	c.(3169-3171)GGC>GAC	p.G1057D	BCL9_uc010ozr.1_Intron	NM_004326	NP_004317	O00512	BCL9_HUMAN	B-cell CLL/lymphoma 9	1057	Pro-rich.				Wnt receptor signaling pathway	nucleus	protein binding			ovary(2)|large_intestine(2)|breast(1)|skin(1)	6	all_hematologic(923;0.115)							T	IGH@|IGL@	B-ALL								---	---	---	---
SNX27	81609	broad.mit.edu	37	1	151641106	151641106	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151641106C>T	uc001eyn.1	+	7	1160	c.1144C>T	c.(1144-1146)CAT>TAT	p.H382Y	SNX27_uc001eyo.2_Missense_Mutation_p.H289Y|SNX27_uc001eyp.2_Missense_Mutation_p.H196Y	NM_030918	NP_112180	Q96L92	SNX27_HUMAN	sorting nexin family member 27	382					cell communication|protein transport|signal transduction	cytosol|early endosome	phosphatidylinositol binding|protein binding			ovary(2)|central_nervous_system(1)	3	Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		LUSC - Lung squamous cell carcinoma(543;0.181)															---	---	---	---
TCHH	7062	broad.mit.edu	37	1	152081195	152081195	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152081195C>T	uc001ezp.2	-	2	4498	c.4498G>A	c.(4498-4500)GAC>AAC	p.D1500N	TCHH_uc009wne.1_Missense_Mutation_p.D1500N	NM_007113	NP_009044	Q07283	TRHY_HUMAN	trichohyalin	1500	23 X 26 AA approximate tandem repeats.				keratinization	cytoskeleton	calcium ion binding			ovary(3)|kidney(1)|central_nervous_system(1)	5	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)															---	---	---	---
FLG	2312	broad.mit.edu	37	1	152280083	152280083	+	Missense_Mutation	SNP	C	T	T	rs150216268		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152280083C>T	uc001ezu.1	-	3	7315	c.7279G>A	c.(7279-7281)GCC>ACC	p.A2427T		NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	2427	Ser-rich.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)											Ichthyosis				---	---	---	---
OR10J3	441911	broad.mit.edu	37	1	159284018	159284018	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:159284018T>G	uc010piu.1	-	1	432	c.432A>C	c.(430-432)CAA>CAC	p.Q144H		NM_001004467	NP_001004467	Q5JRS4	O10J3_HUMAN	olfactory receptor, family 10, subfamily J,	144	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2	all_hematologic(112;0.0429)																	---	---	---	---
DEDD	9191	broad.mit.edu	37	1	161093743	161093743	+	Intron	SNP	G	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161093743G>T	uc001fxz.2	-						NIT1_uc001fxw.2_Intron|DEDD_uc009wty.2_Intron|DEDD_uc001fya.2_Intron|DEDD_uc001fyb.2_Intron|DEDD_uc010pkb.1_Intron|DEDD_uc001fyc.2_Intron	NM_001039712	NP_001034801			death effector domain-containing protein						apoptosis|induction of apoptosis via death domain receptors|negative regulation of transcription, DNA-dependent|spermatogenesis|transcription, DNA-dependent	cytoplasm|nucleolus	DNA binding|protein binding				0	all_cancers(52;3.39e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00165)															---	---	---	---
IVNS1ABP	10625	broad.mit.edu	37	1	185277943	185277943	+	Silent	SNP	G	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:185277943G>T	uc001grl.2	-	5	969	c.346C>A	c.(346-348)CGA>AGA	p.R116R	IVNS1ABP_uc001grj.2_5'Flank|IVNS1ABP_uc009wyj.2_5'UTR|IVNS1ABP_uc009wyk.2_RNA	NM_006469	NP_006460	Q9Y6Y0	NS1BP_HUMAN	influenza virus NS1A binding protein	116					interspecies interaction between organisms|response to virus|RNA splicing|transcription from RNA polymerase III promoter	cytoplasm|cytoskeleton|spliceosomal complex|transcription factor complex				ovary(4)|central_nervous_system(1)	5																		---	---	---	---
IGFN1	91156	broad.mit.edu	37	1	201195075	201195075	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201195075G>A	uc001gwc.2	+	11	2862	c.2090G>A	c.(2089-2091)CGC>CAC	p.R697H	IGFN1_uc001gwb.2_RNA	NM_178275	NP_840059			RecName: Full=Immunoglobulin-like and fibronectin type III domain-containing protein 1; AltName: Full=EEF1A2-binding protein 1; AltName: Full=KY-interacting protein 1;											ovary(2)|pancreas(1)	3																		---	---	---	---
PPFIA4	8497	broad.mit.edu	37	1	203025583	203025583	+	Silent	SNP	G	T	T	rs61748818	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203025583G>T	uc001gyz.2	+	5	1262	c.669G>T	c.(667-669)ACG>ACT	p.T223T	PPFIA4_uc009xaj.2_Silent_p.T854T|PPFIA4_uc010pqf.1_Silent_p.T436T|PPFIA4_uc001gza.2_Silent_p.T223T|PPFIA4_uc001gzb.1_5'Flank	NM_015053	NP_055868	O75335	LIPA4_HUMAN	protein tyrosine phosphatase, receptor type, f	223					cell communication	cell surface|cytoplasm	protein binding			ovary(4)|skin(1)	5																		---	---	---	---
FMOD	2331	broad.mit.edu	37	1	203317347	203317347	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203317347C>T	uc001gzr.2	-	2	188	c.52G>A	c.(52-54)GCC>ACC	p.A18T	FMOD_uc010pqi.1_RNA	NM_002023	NP_002014	Q06828	FMOD_HUMAN	fibromodulin precursor	18					transforming growth factor beta receptor complex assembly	extracellular space|proteinaceous extracellular matrix				ovary(2)|breast(1)	3			BRCA - Breast invasive adenocarcinoma(75;0.171)															---	---	---	---
PXDN	7837	broad.mit.edu	37	2	1691444	1691444	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1691444C>T	uc002qxa.2	-	4	440	c.376G>A	c.(376-378)GAC>AAC	p.D126N	PXDN_uc002qxb.1_Missense_Mutation_p.D126N|PXDN_uc002qxc.1_Intron	NM_012293	NP_036425	Q92626	PXDN_HUMAN	peroxidasin precursor	126	LRR 2.				extracellular matrix organization|hydrogen peroxide catabolic process|immune response	endoplasmic reticulum|extracellular space|proteinaceous extracellular matrix	extracellular matrix structural constituent|heme binding|interleukin-1 receptor antagonist activity|peroxidase activity			pancreas(6)|ovary(2)	8	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.0845)|Lung NSC(108;0.00641)|all_epithelial(98;0.00716)		all cancers(51;0.0492)|OV - Ovarian serous cystadenocarcinoma(76;0.0973)|Epithelial(75;0.17)|GBM - Glioblastoma multiforme(21;0.228)														---	---	---	---
KIDINS220	57498	broad.mit.edu	37	2	8891763	8891763	+	Missense_Mutation	SNP	T	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:8891763T>A	uc002qzc.2	-	23	3205	c.3023A>T	c.(3022-3024)AAT>ATT	p.N1008I	KIDINS220_uc010yiv.1_Missense_Mutation_p.N774I|KIDINS220_uc002qzd.2_Missense_Mutation_p.N966I|KIDINS220_uc010yiw.1_Missense_Mutation_p.N1009I|KIDINS220_uc002qzb.2_5'Flank|KIDINS220_uc002qze.2_Missense_Mutation_p.N13I	NM_020738	NP_065789	Q9ULH0	KDIS_HUMAN	kinase D-interacting substrate of 220 kDa	1008	Cytoplasmic (Potential).				activation of MAPKK activity|nerve growth factor receptor signaling pathway	cytosol|integral to membrane				ovary(3)|central_nervous_system(1)	4	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)																	---	---	---	---
WDR35	57539	broad.mit.edu	37	2	20178593	20178593	+	Missense_Mutation	SNP	G	T	T	rs140308808	byFrequency	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:20178593G>T	uc002rdi.2	-	5	463	c.355C>A	c.(355-357)CGC>AGC	p.R119S	WDR35_uc002rdj.2_Missense_Mutation_p.R119S|WDR35_uc010ext.2_RNA	NM_001006657	NP_001006658	Q9P2L0	WDR35_HUMAN	WD repeat domain 35 isoform 1	119	WD 3.									ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)																	---	---	---	---
CAD	790	broad.mit.edu	37	2	27456582	27456582	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27456582A>G	uc002rji.2	+	21	3467	c.3305A>G	c.(3304-3306)TAC>TGC	p.Y1102C	CAD_uc010eyw.2_Missense_Mutation_p.Y1039C	NM_004341	NP_004332	P27708	PYR1_HUMAN	carbamoylphosphate synthetase 2/aspartate	1102	CPSase B.|ATP-grasp 2.|CPSase (Carbamoyl-phosphate synthase).				'de novo' pyrimidine base biosynthetic process|drug metabolic process|glutamine metabolic process|peptidyl-threonine phosphorylation|protein autophosphorylation|pyrimidine nucleoside biosynthetic process|pyrimidine nucleotide biosynthetic process	cytosol|neuronal cell body|nuclear matrix|terminal button	aspartate binding|aspartate carbamoyltransferase activity|ATP binding|carbamoyl-phosphate synthase (glutamine-hydrolyzing) activity|dihydroorotase activity|enzyme binding|identical protein binding|metal ion binding|protein kinase activity			ovary(4)|large_intestine(2)|kidney(2)|lung(1)|pancreas(1)	10	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				L-Aspartic Acid(DB00128)|L-Glutamine(DB00130)													---	---	---	---
PLB1	151056	broad.mit.edu	37	2	28718990	28718990	+	Silent	SNP	G	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:28718990G>A	uc002rmb.1	+	1	9	c.9G>A	c.(7-9)CTG>CTA	p.L3L	PLB1_uc010ezj.1_Silent_p.L3L	NM_153021	NP_694566	Q6P1J6	PLB1_HUMAN	phospholipase B1 precursor	3					lipid catabolic process|retinoid metabolic process|steroid metabolic process	apical plasma membrane|integral to membrane	lysophospholipase activity|phospholipase A2 activity|retinyl-palmitate esterase activity			ovary(4)|large_intestine(2)|skin(2)|breast(1)	9	Acute lymphoblastic leukemia(172;0.155)																	---	---	---	---
ATP6V1B1	525	broad.mit.edu	37	2	71191631	71191631	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71191631G>A	uc002shj.2	+	12	1294	c.1207G>A	c.(1207-1209)GGC>AGC	p.G403S	ATP6V1B1_uc010fdv.2_Missense_Mutation_p.G386S|ATP6V1B1_uc010fdw.2_RNA|ATP6V1B1_uc010fdx.2_Missense_Mutation_p.G361S	NM_001692	NP_001683	P15313	VATB1_HUMAN	ATPase, H+ transporting, lysosomal 56/58kDa, V1	403					ATP hydrolysis coupled proton transport|calcium ion homeostasis|cellular iron ion homeostasis|excretion|inner ear morphogenesis|insulin receptor signaling pathway|ossification|pH reduction|sensory perception of sound|transferrin transport	apical plasma membrane|basolateral plasma membrane|cytosol|endomembrane system|lateral plasma membrane|microvillus|proton-transporting V-type ATPase, V1 domain|vacuolar proton-transporting V-type ATPase complex	ATP binding|hydrogen ion transporting ATP synthase activity, rotational mechanism|proton-transporting ATPase activity, rotational mechanism			skin(1)	1																OREG0014686	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
SMYD5	10322	broad.mit.edu	37	2	73453064	73453064	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:73453064C>T	uc002siw.2	+	13	1276	c.1247C>T	c.(1246-1248)ACT>ATT	p.T416I	SMYD5_uc010yre.1_Missense_Mutation_p.T300I|SMYD5_uc002six.1_RNA	NM_006062	NP_006053	Q6GMV2	SMYD5_HUMAN	SMYD family member 5	416							metal ion binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	89266224	89266224	+	RNA	SNP	G	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:89266224G>A	uc010ytr.1	-	94		c.7468C>T			uc002stl.2_Intron					Parts of antibodies, mostly variable regions.																														---	---	---	---
TMEM131	23505	broad.mit.edu	37	2	98428986	98428986	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:98428986G>C	uc002syh.3	-	17	1990	c.1761C>G	c.(1759-1761)GAC>GAG	p.D587E		NM_015348	NP_056163	Q92545	TM131_HUMAN	RW1 protein	587						integral to membrane				ovary(4)|central_nervous_system(2)	6																		---	---	---	---
LONRF2	164832	broad.mit.edu	37	2	100906807	100906807	+	Silent	SNP	C	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:100906807C>T	uc002tal.3	-	10	2473	c.1833G>A	c.(1831-1833)GCG>GCA	p.A611A	LONRF2_uc010yvs.1_RNA	NM_198461	NP_940863	Q1L5Z9	LONF2_HUMAN	LON peptidase N-terminal domain and ring finger	611	Lon.				proteolysis		ATP-dependent peptidase activity|zinc ion binding			large_intestine(1)|skin(1)	2																		---	---	---	---
LRP2	4036	broad.mit.edu	37	2	170038058	170038058	+	Missense_Mutation	SNP	A	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170038058A>T	uc002ues.2	-	52	10282	c.10069T>A	c.(10069-10071)TCT>ACT	p.S3357T		NM_004525	NP_004516	P98164	LRP2_HUMAN	low density lipoprotein-related protein 2	3357	Extracellular (Potential).|LDL-receptor class B 32.				hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding			ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)													---	---	---	---
MYO3B	140469	broad.mit.edu	37	2	171264299	171264299	+	Silent	SNP	A	G	G			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:171264299A>G	uc002ufy.2	+	22	2738	c.2595A>G	c.(2593-2595)AGA>AGG	p.R865R	MYO3B_uc002ufv.2_Silent_p.R852R|MYO3B_uc010fqb.1_Silent_p.R852R|MYO3B_uc002ufz.2_Silent_p.R865R|MYO3B_uc002ufw.2_RNA|MYO3B_uc002ufx.2_RNA|MYO3B_uc002ugb.2_RNA	NM_138995	NP_620482	Q8WXR4	MYO3B_HUMAN	myosin IIIB isoform 2	865	Myosin head-like.				response to stimulus|visual perception	cytoplasm|myosin complex	actin binding|ATP binding|motor activity|protein serine/threonine kinase activity			lung(8)|ovary(6)|skin(4)|central_nervous_system(1)	19																		---	---	---	---
WIPF1	7456	broad.mit.edu	37	2	175437055	175437055	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:175437055C>A	uc002uiy.2	-	6	810	c.478G>T	c.(478-480)GGT>TGT	p.G160C	uc002uiw.2_Intron|uc002uix.1_Intron|WIPF1_uc002uja.2_Missense_Mutation_p.G160C|WIPF1_uc010fqt.1_Missense_Mutation_p.G160C|WIPF1_uc002ujc.1_Missense_Mutation_p.G160C|WIPF1_uc002uiz.2_Missense_Mutation_p.G160C|WIPF1_uc002ujb.1_Missense_Mutation_p.G160C|WIPF1_uc010zep.1_Missense_Mutation_p.G160C	NM_003387	NP_003378	O43516	WIPF1_HUMAN	WAS/WASL interacting protein family, member 1	160					actin polymerization or depolymerization|protein complex assembly	cytoplasmic membrane-bounded vesicle	actin binding|profilin binding			ovary(1)|skin(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	186671020	186671020	+	Intron	SNP	C	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:186671020C>T	uc002upm.2	+						uc010zfu.1_Nonsense_Mutation_p.Q161*					Homo sapiens cDNA FLJ44048 fis, clone TESTI4030669.																														---	---	---	---
DNAH7	56171	broad.mit.edu	37	2	196756511	196756511	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:196756511G>T	uc002utj.3	-	31	5015	c.4914C>A	c.(4912-4914)AAC>AAA	p.N1638K		NM_018897	NP_061720	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	1638	AAA 2 (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			skin(10)|ovary(2)	12																		---	---	---	---
BOLL	66037	broad.mit.edu	37	2	198593310	198593310	+	Intron	SNP	G	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:198593310G>A	uc002uus.2	-						uc002uup.2_Intron|BOLL_uc002uur.2_Intron|BOLL_uc002uut.2_Intron|BOLL_uc010zha.1_Intron|BOLL_uc002uuu.1_Intron	NM_033030	NP_149019			boule isoform 2						cell differentiation|meiosis|multicellular organismal development|positive regulation of translational initiation|spermatogenesis	cytoplasm	nucleotide binding|protein binding|RNA binding|translation activator activity			ovary(2)	2																		---	---	---	---
CTLA4	1493	broad.mit.edu	37	2	204737525	204737525	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:204737525C>A	uc002vak.1	+	4	819	c.662C>A	c.(661-663)CCC>CAC	p.P221H	CTLA4_uc002val.1_3'UTR|CTLA4_uc010fty.1_3'UTR|CTLA4_uc010ftz.1_RNA	NM_005214	NP_005205	P16410	CTLA4_HUMAN	cytotoxic T-lymphocyte-associated protein 4	221	Cytoplasmic (Potential).				B cell receptor signaling pathway|immune response|negative regulation of B cell proliferation|negative regulation of regulatory T cell differentiation|positive regulation of apoptosis|response to DNA damage stimulus|T cell costimulation	clathrin-coated endocytic vesicle|external side of plasma membrane|Golgi apparatus|integral to plasma membrane|perinuclear region of cytoplasm					0					Abatacept(DB01281)													---	---	---	---
SMARCAL1	50485	broad.mit.edu	37	2	217285023	217285023	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:217285023G>A	uc002vgc.3	+	5	1194	c.864G>A	c.(862-864)ATG>ATA	p.M288I	SMARCAL1_uc010fvf.2_RNA|SMARCAL1_uc002vgd.3_Missense_Mutation_p.M288I|SMARCAL1_uc010fvg.2_Missense_Mutation_p.M288I	NM_014140	NP_054859	Q9NZC9	SMAL1_HUMAN	SWI/SNF-related matrix-associated	288	HARP 1.				chromatin modification|DNA metabolic process|regulation of transcription from RNA polymerase II promoter	nucleus	ATP binding|DNA binding|DNA helicase activity|DNA-dependent ATPase activity			ovary(3)|breast(3)|skin(1)	7		Renal(323;0.0458)		Epithelial(149;9.48e-06)|all cancers(144;0.000621)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0111)										Schimke_Immuno-Osseous_Dysplasia				---	---	---	---
C2orf62	375307	broad.mit.edu	37	2	219231774	219231774	+	Silent	SNP	C	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219231774C>T	uc002vhr.2	+	8	812	c.783C>T	c.(781-783)GGC>GGT	p.G261G	C2orf62_uc002vhs.2_RNA|uc002vht.2_Intron	NM_198559	NP_940961	Q7Z7H3	CB062_HUMAN	hypothetical protein LOC375307	261											0		Renal(207;0.0915)		Epithelial(149;8.08e-07)|all cancers(144;0.000146)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)														---	---	---	---
DNER	92737	broad.mit.edu	37	2	230282862	230282862	+	Missense_Mutation	SNP	A	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:230282862A>T	uc002vpv.2	-	9	1718	c.1571T>A	c.(1570-1572)GTT>GAT	p.V524D		NM_139072	NP_620711	Q8NFT8	DNER_HUMAN	delta-notch-like EGF repeat-containing	524	EGF-like 8; calcium-binding (Potential).|Extracellular (Potential).				central nervous system development|endocytosis|neuron migration|Notch signaling pathway|synapse assembly	dendrite|early endosome|integral to membrane|plasma membrane	calcium ion binding|clathrin binding|transmembrane receptor activity			lung(5)|ovary(2)|skin(1)	8		all_lung(227;0.00413)|Renal(207;0.0113)|Lung NSC(271;0.0211)|all_hematologic(139;0.105)|Acute lymphoblastic leukemia(138;0.175)		Epithelial(121;1.4e-11)|all cancers(144;7.7e-09)|LUSC - Lung squamous cell carcinoma(224;0.034)|Lung(119;0.0375)														---	---	---	---
CHL1	10752	broad.mit.edu	37	3	432428	432428	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:432428A>C	uc003bou.2	+	20	2738	c.2467A>C	c.(2467-2469)AGT>CGT	p.S823R	CHL1_uc003bot.2_Missense_Mutation_p.S839R|CHL1_uc003bow.1_Missense_Mutation_p.S823R|CHL1_uc011asi.1_Missense_Mutation_p.S839R	NM_006614	NP_006605	O00533	CHL1_HUMAN	cell adhesion molecule with homology to L1CAM	823	Fibronectin type-III 3.|Extracellular (Potential).				axon guidance|cell adhesion|signal transduction	integral to membrane|plasma membrane|proteinaceous extracellular matrix				skin(5)|central_nervous_system(4)|large_intestine(2)|ovary(1)	12		all_cancers(2;1.14e-06)|all_epithelial(2;0.00367)|all_lung(1;0.061)|Lung NSC(2;0.201)		Epithelial(13;5.36e-06)|all cancers(10;1.4e-05)|OV - Ovarian serous cystadenocarcinoma(96;0.00323)|COAD - Colon adenocarcinoma(1;0.00925)|Colorectal(20;0.0198)														---	---	---	---
ITPR1	3708	broad.mit.edu	37	3	4810221	4810221	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:4810221G>A	uc003bqa.2	+	43	5956	c.5608G>A	c.(5608-5610)GAA>AAA	p.E1870K	ITPR1_uc010hca.1_Missense_Mutation_p.E1855K|ITPR1_uc011asu.1_Intron|ITPR1_uc003bqc.2_Missense_Mutation_p.E840K	NM_001099952	NP_001093422	Q14643	ITPR1_HUMAN	inositol 1,4,5-triphosphate receptor, type 1	1918	Cytoplasmic (Potential).				activation of phospholipase C activity|cell death|energy reserve metabolic process|nerve growth factor receptor signaling pathway|platelet activation|regulation of insulin secretion|response to hypoxia	endoplasmic reticulum membrane|integral to membrane|platelet dense granule membrane|platelet dense tubular network membrane	calcium ion transmembrane transporter activity|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity|intracellular ligand-gated calcium channel activity|phosphatidylinositol binding|protein binding			lung(7)|breast(5)|ovary(4)|large_intestine(1)|liver(1)|skin(1)|kidney(1)|pancreas(1)	21				Epithelial(13;0.0199)|OV - Ovarian serous cystadenocarcinoma(96;0.0361)|all cancers(10;0.0982)														---	---	---	---
TGFBR2	7048	broad.mit.edu	37	3	30729923	30729923	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:30729923C>A	uc003ceo.2	+	6	1826	c.1444C>A	c.(1444-1446)CCC>ACC	p.P482T	TGFBR2_uc003cen.2_Missense_Mutation_p.P507T	NM_003242	NP_003233	P37173	TGFR2_HUMAN	transforming growth factor, beta receptor II	482	Protein kinase.|Cytoplasmic (Potential).				activation of protein kinase activity|brain development|embryonic cranial skeleton morphogenesis|embryonic hemopoiesis|heart development|myeloid dendritic cell differentiation|palate development|pathway-restricted SMAD protein phosphorylation|patterning of blood vessels|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|positive regulation of B cell tolerance induction|positive regulation of mesenchymal cell proliferation|positive regulation of NK T cell differentiation|positive regulation of reactive oxygen species metabolic process|positive regulation of T cell tolerance induction|positive regulation of tolerance induction to self antigen|response to cholesterol|response to drug|transforming growth factor beta receptor signaling pathway|transforming growth factor beta receptor signaling pathway|vasculogenesis	caveola|external side of plasma membrane	ATP binding|glycosaminoglycan binding|metal ion binding|protein binding|receptor signaling protein serine/threonine kinase activity|SMAD binding|transforming growth factor beta binding|transforming growth factor beta receptor activity, type II|type I transforming growth factor beta receptor binding|type I transforming growth factor beta receptor binding|type III transforming growth factor beta receptor binding			pancreas(9)|large_intestine(6)|stomach(4)|lung(3)|ovary(3)|central_nervous_system(1)	26																		---	---	---	---
CSRNP1	64651	broad.mit.edu	37	3	39186708	39186708	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:39186708C>A	uc003cjg.2	-	3	459	c.245G>T	c.(244-246)GGC>GTC	p.G82V	CSRNP1_uc003cjh.2_Missense_Mutation_p.G82V	NM_033027	NP_149016	Q96S65	CSRN1_HUMAN	AXIN1 up-regulated 1	82					apoptosis|positive regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(4)|skin(1)	5																		---	---	---	---
LYZL4	131375	broad.mit.edu	37	3	42445586	42445586	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:42445586A>C	uc003cle.2	-	4	572	c.323T>G	c.(322-324)ATT>AGT	p.I108S		NM_144634	NP_653235	Q96KX0	LYZL4_HUMAN	lysozyme-like 4 precursor	108					cell wall macromolecule catabolic process	extracellular region	lysozyme activity			central_nervous_system(1)	1				KIRC - Kidney renal clear cell carcinoma(284;0.222)														---	---	---	---
SETD2	29072	broad.mit.edu	37	3	47098523	47098523	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:47098523C>G	uc003cqs.2	-	15	6804	c.6751G>C	c.(6751-6753)GAC>CAC	p.D2251H	SETD2_uc003cqv.2_Missense_Mutation_p.D2318H|SETD2_uc003cqt.1_Intron	NM_014159	NP_054878	Q9BYW2	SETD2_HUMAN	SET domain containing 2	2251	Low charge region.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleus	DNA binding|histone-lysine N-methyltransferase activity|oxidoreductase activity|transition metal ion binding			kidney(24)|ovary(5)|skin(1)|central_nervous_system(1)|breast(1)	32		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)				N|F|S|Mis		clear cell renal carcinoma								---	---	---	---
C3orf54	389119	broad.mit.edu	37	3	49842367	49842367	+	Missense_Mutation	SNP	A	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49842367A>T	uc003cxq.1	+	2	944	c.811A>T	c.(811-813)ATG>TTG	p.M271L		NM_203370	NP_976248	Q96EL1	CC054_HUMAN	hypothetical protein LOC389119	269											0				BRCA - Breast invasive adenocarcinoma(193;3.55e-06)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00605)														---	---	---	---
DOCK3	1795	broad.mit.edu	37	3	50971444	50971444	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:50971444C>A	uc011bds.1	+	5	274	c.251C>A	c.(250-252)TCT>TAT	p.S84Y		NM_004947	NP_004938	Q8IZD9	DOCK3_HUMAN	dedicator of cytokinesis 3	84						cytoplasm	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity|SH3 domain binding				0				BRCA - Breast invasive adenocarcinoma(193;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00449)|Kidney(197;0.00518)														---	---	---	---
ALAS1	211	broad.mit.edu	37	3	52233254	52233254	+	5'UTR	SNP	G	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52233254G>A	uc003dcy.1	+	3					ALAS1_uc003dcx.1_5'UTR|ALAS1_uc003dcz.1_5'UTR|ALAS1_uc011bec.1_Silent_p.L16L	NM_000688	NP_000679			5-aminolevulinate synthase 1 precursor						heme biosynthetic process	mitochondrial matrix	5-aminolevulinate synthase activity|pyridoxal phosphate binding|transferase activity, transferring nitrogenous groups			ovary(2)|upper_aerodigestive_tract(1)	3				BRCA - Breast invasive adenocarcinoma(193;5.13e-05)|Kidney(197;0.000583)|KIRC - Kidney renal clear cell carcinoma(197;0.000751)	Glycine(DB00145)|Pyridoxal Phosphate(DB00114)													---	---	---	---
ALAS1	211	broad.mit.edu	37	3	52240613	52240613	+	Silent	SNP	G	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52240613G>A	uc003dcy.1	+	8	1348	c.1011G>A	c.(1009-1011)GGG>GGA	p.G337G	ALAS1_uc003dcz.1_Silent_p.G337G|ALAS1_uc011bec.1_Silent_p.G354G	NM_000688	NP_000679	P13196	HEM1_HUMAN	5-aminolevulinate synthase 1 precursor	337					heme biosynthetic process	mitochondrial matrix	5-aminolevulinate synthase activity|pyridoxal phosphate binding|transferase activity, transferring nitrogenous groups			ovary(2)|upper_aerodigestive_tract(1)	3				BRCA - Breast invasive adenocarcinoma(193;5.13e-05)|Kidney(197;0.000583)|KIRC - Kidney renal clear cell carcinoma(197;0.000751)	Glycine(DB00145)|Pyridoxal Phosphate(DB00114)													---	---	---	---
STAB1	23166	broad.mit.edu	37	3	52551576	52551576	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52551576G>C	uc003dej.2	+	44	4648	c.4574G>C	c.(4573-4575)AGC>ACC	p.S1525T	STAB1_uc003dek.1_5'Flank	NM_015136	NP_055951	Q9NY15	STAB1_HUMAN	stabilin 1 precursor	1525	EGF-like 12.|Extracellular (Potential).				cell adhesion|cell-cell signaling|defense response to bacterium|inflammatory response|negative regulation of angiogenesis|receptor-mediated endocytosis	integral to plasma membrane	bacterial cell surface binding|hyaluronic acid binding|low-density lipoprotein receptor activity|protein disulfide oxidoreductase activity|scavenger receptor activity			large_intestine(3)|upper_aerodigestive_tract(2)|central_nervous_system(1)|breast(1)|skin(1)|pancreas(1)	9				BRCA - Breast invasive adenocarcinoma(193;1.73e-05)|Kidney(197;0.00182)|KIRC - Kidney renal clear cell carcinoma(197;0.00205)|OV - Ovarian serous cystadenocarcinoma(275;0.0482)														---	---	---	---
PTPRG	5793	broad.mit.edu	37	3	62253086	62253086	+	Silent	SNP	T	C	C			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:62253086T>C	uc003dlb.2	+	18	3377	c.2658T>C	c.(2656-2658)TAT>TAC	p.Y886Y	PTPRG_uc003dlc.2_Silent_p.Y857Y|PTPRG_uc011bfi.1_Silent_p.Y132Y|uc010hno.2_Intron|uc003dld.3_Intron|uc010hnp.2_Intron|uc003dle.3_Intron	NM_002841	NP_002832	P23470	PTPRG_HUMAN	protein tyrosine phosphatase, receptor type, G	886	Cytoplasmic (Potential).|Tyrosine-protein phosphatase 1.				transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	identical protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(5)|lung(2)	7				BRCA - Breast invasive adenocarcinoma(55;0.000376)|KIRC - Kidney renal clear cell carcinoma(10;0.0499)|Kidney(10;0.065)														---	---	---	---
CRYBG3	131544	broad.mit.edu	37	3	97634450	97634450	+	Intron	SNP	T	C	C			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:97634450T>C	uc003drx.2	+							NM_153605	NP_705833			beta-gamma crystallin domain containing 3												0																		---	---	---	---
C3orf17	25871	broad.mit.edu	37	3	112732835	112732835	+	Silent	SNP	G	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:112732835G>T	uc003dzr.2	-	3	367	c.306C>A	c.(304-306)GGC>GGA	p.G102G	GTPBP8_uc011bhy.1_Intron|C3orf17_uc011bhz.1_Intron|C3orf17_uc010hqh.2_5'UTR|C3orf17_uc003dzt.2_Silent_p.G5G|C3orf17_uc003dzs.2_5'UTR|C3orf17_uc010hqg.2_5'UTR|C3orf17_uc011bia.1_5'UTR|C3orf17_uc003dzu.2_Silent_p.G101G|C3orf17_uc011bib.1_Silent_p.G5G|C3orf17_uc011bic.1_Silent_p.G5G|C3orf17_uc011bid.1_RNA	NM_015412	NP_056227	Q6NW34	CC017_HUMAN	hypothetical protein LOC25871	102						integral to membrane					0																		---	---	---	---
NR1I2	8856	broad.mit.edu	37	3	119501683	119501683	+	Intron	SNP	G	A	A	rs147582230	by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:119501683G>A	uc003edj.2	+						NR1I2_uc003edi.2_Intron|NR1I2_uc003edk.2_Missense_Mutation_p.E27K	NM_003889	NP_003880			nuclear receptor subfamily 1, group I, member 2						drug export|exogenous drug catabolic process|negative regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|steroid metabolic process|xenobiotic metabolic process|xenobiotic transport	nucleoplasm	drug binding|protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|transcription coactivator activity|zinc ion binding			ovary(2)	2				GBM - Glioblastoma multiforme(114;0.175)	Estradiol(DB00783)|Ethinyl Estradiol(DB00977)|Rifampin(DB01045)|Vitamin E(DB00163)													---	---	---	---
H1FX	8971	broad.mit.edu	37	3	129034479	129034479	+	Silent	SNP	G	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:129034479G>A	uc003elx.2	-	1	642	c.267C>T	c.(265-267)CTC>CTT	p.L89L	C3orf47_uc011bkv.1_5'Flank	NM_006026	NP_006017	Q92522	H1X_HUMAN	H1 histone family, member X	89	H15.				nucleosome assembly	nucleosome|nucleus	DNA binding				0																		---	---	---	---
EPHB1	2047	broad.mit.edu	37	3	134873004	134873004	+	Silent	SNP	C	G	G			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:134873004C>G	uc003eqt.2	+	6	1528	c.1308C>G	c.(1306-1308)ACC>ACG	p.T436T	EPHB1_uc003equ.2_5'UTR	NM_004441	NP_004432	P54762	EPHB1_HUMAN	ephrin receptor EphB1 precursor	436	Fibronectin type-III 2.|Extracellular (Potential).					integral to plasma membrane	ATP binding|ephrin receptor activity|protein binding			lung(11)|ovary(6)|stomach(4)|breast(3)|central_nervous_system(2)|skin(2)|large_intestine(1)|pancreas(1)	30																		---	---	---	---
TMEM22	80723	broad.mit.edu	37	3	136573484	136573484	+	Missense_Mutation	SNP	T	C	C	rs116801228	byFrequency;by1000genomes	TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:136573484T>C	uc003erf.3	+	2	396	c.182T>C	c.(181-183)ATG>ACG	p.M61T	TMEM22_uc003erg.3_Missense_Mutation_p.M61T|TMEM22_uc010hub.2_Missense_Mutation_p.M61T	NM_001097600	NP_001091069	Q8TBE7	TMM22_HUMAN	transmembrane protein 22	61						Golgi apparatus|integral to membrane				ovary(1)	1																		---	---	---	---
SOX14	8403	broad.mit.edu	37	3	137483819	137483819	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:137483819C>T	uc003erm.1	+	1	241	c.193C>T	c.(193-195)CGC>TGC	p.R65C		NM_004189	NP_004180	O95416	SOX14_HUMAN	SRY-box 14	65	HMG box.				negative regulation of transcription from RNA polymerase II promoter|nervous system development|transcription, DNA-dependent	nucleus	sequence-specific DNA binding				0																		---	---	---	---
MECOM	2122	broad.mit.edu	37	3	168833682	168833682	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:168833682C>G	uc003ffi.3	-	7	1683	c.1414G>C	c.(1414-1416)GAT>CAT	p.D472H	MECOM_uc010hwk.1_Missense_Mutation_p.D495H|MECOM_uc003ffj.3_Missense_Mutation_p.D537H|MECOM_uc011bpi.1_Missense_Mutation_p.D473H|MECOM_uc003ffn.3_Missense_Mutation_p.D472H|MECOM_uc003ffk.2_Missense_Mutation_p.D472H|MECOM_uc003ffl.2_Missense_Mutation_p.D632H|MECOM_uc011bpj.1_Missense_Mutation_p.D660H|MECOM_uc011bpk.1_Missense_Mutation_p.D462H|MECOM_uc010hwn.2_Missense_Mutation_p.D660H	NM_005241	NP_005232	Q03112	EVI1_HUMAN	MDS1 and EVI1 complex locus isoform b	472					apoptosis|cell differentiation|hemopoietic stem cell proliferation|negative regulation of JNK cascade|negative regulation of programmed cell death|negative regulation of transcription, DNA-dependent|regulation of cell cycle	nuclear speck	DNA binding|protein binding|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(5)|skin(5)|upper_aerodigestive_tract(1)|central_nervous_system(1)|ovary(1)|pancreas(1)	14																		---	---	---	---
MYNN	55892	broad.mit.edu	37	3	169492270	169492270	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:169492270C>G	uc003fft.2	+	2	616	c.187C>G	c.(187-189)CTT>GTT	p.L63V	MYNN_uc011bpm.1_Intron|MYNN_uc003ffu.2_Missense_Mutation_p.L63V|MYNN_uc003ffv.2_5'UTR|MYNN_uc010hwo.2_Missense_Mutation_p.L63V	NM_018657	NP_061127	Q9NPC7	MYNN_HUMAN	myoneurin	63	BTB.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(1)	1	all_cancers(22;9.55e-22)|all_epithelial(15;2.04e-26)|all_lung(20;5.05e-16)|Lung NSC(18;2.19e-15)|Ovarian(172;0.000223)|Breast(254;0.197)		Epithelial(2;4.03e-64)|all cancers(2;2.19e-58)|Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.00676)															---	---	---	---
TTC14	151613	broad.mit.edu	37	3	180321029	180321029	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:180321029C>G	uc003fkk.2	+	3	536	c.404C>G	c.(403-405)TCT>TGT	p.S135C	TTC14_uc003fkl.2_Missense_Mutation_p.S135C|TTC14_uc003fkm.2_Missense_Mutation_p.S135C	NM_133462	NP_597719	Q96N46	TTC14_HUMAN	tetratricopeptide repeat domain 14 isoform a	135	S1 motif.						RNA binding			ovary(1)	1	all_cancers(143;9.31e-15)|Ovarian(172;0.0212)		OV - Ovarian serous cystadenocarcinoma(80;5.62e-23)|GBM - Glioblastoma multiforme(14;0.000558)															---	---	---	---
TTC14	151613	broad.mit.edu	37	3	180321108	180321108	+	Silent	SNP	C	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:180321108C>T	uc003fkk.2	+	3	615	c.483C>T	c.(481-483)ATC>ATT	p.I161I	TTC14_uc003fkl.2_Silent_p.I161I|TTC14_uc003fkm.2_Silent_p.I161I	NM_133462	NP_597719	Q96N46	TTC14_HUMAN	tetratricopeptide repeat domain 14 isoform a	161	S1 motif.						RNA binding			ovary(1)	1	all_cancers(143;9.31e-15)|Ovarian(172;0.0212)		OV - Ovarian serous cystadenocarcinoma(80;5.62e-23)|GBM - Glioblastoma multiforme(14;0.000558)															---	---	---	---
TTC14	151613	broad.mit.edu	37	3	180322068	180322068	+	Nonsense_Mutation	SNP	C	G	G			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:180322068C>G	uc003fkk.2	+	4	674	c.542C>G	c.(541-543)TCA>TGA	p.S181*	TTC14_uc003fkl.2_Nonsense_Mutation_p.S181*|TTC14_uc003fkm.2_Nonsense_Mutation_p.S181*	NM_133462	NP_597719	Q96N46	TTC14_HUMAN	tetratricopeptide repeat domain 14 isoform a	181	S1 motif.						RNA binding			ovary(1)	1	all_cancers(143;9.31e-15)|Ovarian(172;0.0212)		OV - Ovarian serous cystadenocarcinoma(80;5.62e-23)|GBM - Glioblastoma multiforme(14;0.000558)															---	---	---	---
TTC14	151613	broad.mit.edu	37	3	180322109	180322109	+	Intron	SNP	C	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:180322109C>A	uc003fkk.2	+						TTC14_uc003fkl.2_Intron|TTC14_uc003fkm.2_Intron	NM_133462	NP_597719			tetratricopeptide repeat domain 14 isoform a								RNA binding			ovary(1)	1	all_cancers(143;9.31e-15)|Ovarian(172;0.0212)		OV - Ovarian serous cystadenocarcinoma(80;5.62e-23)|GBM - Glioblastoma multiforme(14;0.000558)															---	---	---	---
TTC14	151613	broad.mit.edu	37	3	180322807	180322807	+	Intron	SNP	C	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:180322807C>T	uc003fkk.2	+						TTC14_uc003fkl.2_Intron|TTC14_uc003fkm.2_Intron	NM_133462	NP_597719			tetratricopeptide repeat domain 14 isoform a								RNA binding			ovary(1)	1	all_cancers(143;9.31e-15)|Ovarian(172;0.0212)		OV - Ovarian serous cystadenocarcinoma(80;5.62e-23)|GBM - Glioblastoma multiforme(14;0.000558)															---	---	---	---
CCDC39	339829	broad.mit.edu	37	3	180397081	180397081	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:180397081G>A	uc010hxe.2	-	1	203	c.88C>T	c.(88-90)CAG>TAG	p.Q30*	CCDC39_uc003fkn.2_RNA	NM_181426	NP_852091	Q9UFE4	CCD39_HUMAN	coiled-coil domain containing 39	30	Potential.				axonemal dynein complex assembly|ciliary cell motility|cilium movement involved in determination of left/right asymmetry|flagellar cell motility	cilium axoneme|cytoplasm|cytoskeleton				ovary(4)	4	all_cancers(143;9.31e-15)|Ovarian(172;0.0212)		OV - Ovarian serous cystadenocarcinoma(80;5.62e-23)|GBM - Glioblastoma multiforme(14;0.000558)															---	---	---	---
DVL3	1857	broad.mit.edu	37	3	183884725	183884725	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183884725C>A	uc003fms.2	+	11	1300	c.1160C>A	c.(1159-1161)ACC>AAC	p.T387N	DVL3_uc011bqw.1_Missense_Mutation_p.T370N|DVL3_uc003fmt.2_Missense_Mutation_p.T58N|DVL3_uc003fmu.2_Missense_Mutation_p.T219N	NM_004423	NP_004414	Q92997	DVL3_HUMAN	dishevelled 3	387					canonical Wnt receptor signaling pathway|intracellular signal transduction|positive regulation of JUN kinase activity|positive regulation of protein phosphorylation|positive regulation of transcription, DNA-dependent	cytoplasm	beta-catenin binding|frizzled binding|protease binding|protein heterodimerization activity|signal transducer activity			ovary(1)|lung(1)|breast(1)	3	all_cancers(143;1.12e-10)|Ovarian(172;0.0339)		Epithelial(37;2.08e-34)|OV - Ovarian serous cystadenocarcinoma(80;1.31e-22)															---	---	---	---
DVL3	1857	broad.mit.edu	37	3	183884726	183884726	+	Silent	SNP	C	G	G			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183884726C>G	uc003fms.2	+	11	1301	c.1161C>G	c.(1159-1161)ACC>ACG	p.T387T	DVL3_uc011bqw.1_Silent_p.T370T|DVL3_uc003fmt.2_Silent_p.T58T|DVL3_uc003fmu.2_Silent_p.T219T	NM_004423	NP_004414	Q92997	DVL3_HUMAN	dishevelled 3	387					canonical Wnt receptor signaling pathway|intracellular signal transduction|positive regulation of JUN kinase activity|positive regulation of protein phosphorylation|positive regulation of transcription, DNA-dependent	cytoplasm	beta-catenin binding|frizzled binding|protease binding|protein heterodimerization activity|signal transducer activity			ovary(1)|lung(1)|breast(1)	3	all_cancers(143;1.12e-10)|Ovarian(172;0.0339)		Epithelial(37;2.08e-34)|OV - Ovarian serous cystadenocarcinoma(80;1.31e-22)															---	---	---	---
AP2M1	1173	broad.mit.edu	37	3	183898981	183898981	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183898981A>G	uc011bqx.1	+	7	831	c.674A>G	c.(673-675)CAG>CGG	p.Q225R	AP2M1_uc003fmw.2_Missense_Mutation_p.Q223R|AP2M1_uc003fmx.2_Missense_Mutation_p.Q153R|AP2M1_uc003fmy.2_Missense_Mutation_p.Q223R|AP2M1_uc011bqy.1_Missense_Mutation_p.Q95R|AP2M1_uc011bqz.1_Missense_Mutation_p.Q41R	NM_004068	NP_004059	Q96CW1	AP2M1_HUMAN	adaptor-related protein complex 2, mu 1 subunit	225	MHD.				axon guidance|cellular membrane organization|epidermal growth factor receptor signaling pathway|intracellular protein transport|negative regulation of epidermal growth factor receptor signaling pathway|nerve growth factor receptor signaling pathway|regulation of defense response to virus by virus|synaptic transmission|vesicle-mediated transport|viral reproduction	clathrin adaptor complex|clathrin coat of coated pit|cytosol|endocytic vesicle membrane|peroxisomal membrane	lipid binding|protein binding|transporter activity				0	all_cancers(143;1.12e-10)|Ovarian(172;0.0339)		Epithelial(37;2.92e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)															---	---	---	---
ECE2	9718	broad.mit.edu	37	3	183976353	183976353	+	Intron	SNP	T	C	C			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183976353T>C	uc003fni.3	+						ECE2_uc003fnh.3_Missense_Mutation_p.I253T	NM_014693	NP_055508			endothelin converting enzyme 2 isoform A						brain development|cardioblast differentiation|cell-cell signaling|peptide hormone processing	cytoplasmic vesicle membrane|Golgi membrane|integral to membrane	metal ion binding|metalloendopeptidase activity|methyltransferase activity			ovary(2)|skin(2)	4	all_cancers(143;1.39e-10)|Ovarian(172;0.0339)		Epithelial(37;8.28e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)															---	---	---	---
FGF12	2257	broad.mit.edu	37	3	192053245	192053245	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:192053245T>G	uc003fsx.2	-	3	1145	c.319A>C	c.(319-321)AAT>CAT	p.N107H	FGF12_uc003fsy.2_Missense_Mutation_p.N45H	NM_021032	NP_066360	P61328	FGF12_HUMAN	fibroblast growth factor 12 isoform 1	107					cell-cell signaling|heart development|JNK cascade|nervous system development|signal transduction	extracellular space|nucleus	growth factor activity|heparin binding			ovary(1)|skin(1)|lung(1)|pancreas(1)	4	all_cancers(143;1.72e-08)|Ovarian(172;0.0634)|Breast(254;0.247)	Lung NSC(153;0.21)	LUSC - Lung squamous cell carcinoma(58;5.45e-06)|Lung(62;6.17e-06)	GBM - Glioblastoma multiforme(46;0.00032)														---	---	---	---
HAUS3	79441	broad.mit.edu	37	4	2242050	2242050	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:2242050C>G	uc003ges.1	-	2	854	c.624G>C	c.(622-624)GAG>GAC	p.E208D	POLN_uc011bvi.1_Intron|HAUS3_uc011bvj.1_Missense_Mutation_p.E208D|HAUS3_uc003get.1_Missense_Mutation_p.E208D	NM_024511	NP_078787	Q68CZ6	HAUS3_HUMAN	HAUS augmin-like complex, subunit 3	208					cell division|centrosome organization|mitosis|spindle assembly	centrosome|HAUS complex|microtubule|spindle				large_intestine(2)|breast(2)	4																		---	---	---	---
OTOP1	133060	broad.mit.edu	37	4	4199436	4199436	+	Silent	SNP	G	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:4199436G>A	uc003ghp.1	-	5	1155	c.1125C>T	c.(1123-1125)GAC>GAT	p.D375D		NM_177998	NP_819056	Q7RTM1	OTOP1_HUMAN	otopetrin 1	375					biomineral tissue development	extracellular space|integral to membrane				ovary(2)|central_nervous_system(1)	3				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)														---	---	---	---
HNRPDL	9987	broad.mit.edu	37	4	83350569	83350569	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:83350569G>T	uc003hmr.2	-	1	810	c.275C>A	c.(274-276)TCC>TAC	p.S92Y	ENOPH1_uc003hmv.2_5'Flank|ENOPH1_uc003hmw.2_5'Flank|ENOPH1_uc003hmx.2_5'Flank|HNRPDL_uc003hmq.2_RNA|HNRPDL_uc003hms.2_RNA|HNRPDL_uc003hmt.2_Missense_Mutation_p.S92Y	NM_031372	NP_112740	O14979	HNRDL_HUMAN	heterogeneous nuclear ribonucleoprotein D-like	92					regulation of transcription, DNA-dependent|RNA processing|transcription, DNA-dependent	cytoplasm|heterogeneous nuclear ribonucleoprotein complex	double-stranded DNA binding|nucleotide binding|poly(A) RNA binding|protein binding|single-stranded DNA binding			skin(1)	1		Hepatocellular(203;0.114)																---	---	---	---
WDFY3	23001	broad.mit.edu	37	4	85664946	85664946	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:85664946G>T	uc003hpd.2	-	37	6388	c.5980C>A	c.(5980-5982)CCT>ACT	p.P1994T		NM_014991	NP_055806	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3 isoform	1994						cytoplasmic part|extrinsic to membrane|nuclear envelope	1-phosphatidylinositol binding|metal ion binding|protein binding			ovary(2)|central_nervous_system(1)	3		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)														---	---	---	---
GPRIN3	285513	broad.mit.edu	37	4	90170468	90170468	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:90170468G>T	uc003hsm.1	-	2	1313	c.794C>A	c.(793-795)CCT>CAT	p.P265H		NM_198281	NP_938022	Q6ZVF9	GRIN3_HUMAN	G protein-regulated inducer of neurite outgrowth	265										ovary(3)	3		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;5.67e-05)														---	---	---	---
TRIM60	166655	broad.mit.edu	37	4	165962340	165962340	+	Silent	SNP	T	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:165962340T>A	uc003iqy.1	+	3	1286	c.1116T>A	c.(1114-1116)CTT>CTA	p.L372L	TRIM60_uc010iqx.1_Silent_p.L372L	NM_152620	NP_689833	Q495X7	TRI60_HUMAN	ring finger protein 129	372	B30.2/SPRY.					intracellular	zinc ion binding			skin(1)	1	all_hematologic(180;0.221)	Prostate(90;0.0959)|Melanoma(52;0.18)		GBM - Glioblastoma multiforme(119;0.0844)														---	---	---	---
ADAMTS16	170690	broad.mit.edu	37	5	5200343	5200343	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:5200343G>T	uc003jdl.2	+	9	1550	c.1412G>T	c.(1411-1413)TGG>TTG	p.W471L	ADAMTS16_uc003jdk.1_Missense_Mutation_p.W471L|ADAMTS16_uc003jdj.1_Missense_Mutation_p.W471L	NM_139056	NP_620687	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1	471	Peptidase M12B.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(3)|lung(2)|large_intestine(1)|breast(1)|pancreas(1)	8																		---	---	---	---
MRPS30	10884	broad.mit.edu	37	5	44815308	44815308	+	3'UTR	SNP	A	G	G			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:44815308A>G	uc003joh.2	+	5						NM_016640	NP_057724			mitochondrial ribosomal protein S30						apoptosis|translation	mitochondrion|ribosome	structural constituent of ribosome				0	Lung NSC(6;8.08e-07)																	---	---	---	---
MOCS2	4338	broad.mit.edu	37	5	52397195	52397195	+	3'UTR	SNP	C	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:52397195C>T	uc011cqf.1	-	5					MOCS2_uc003joz.2_Missense_Mutation_p.R124K	NM_176806	NP_789776			molybdopterin synthase small subunit MOCS2A						Mo-molybdopterin cofactor biosynthetic process|water-soluble vitamin metabolic process	cytosol|molybdopterin synthase complex	nucleotide binding				0		Lung NSC(810;3.08e-05)|Breast(144;0.0848)																---	---	---	---
BDP1	55814	broad.mit.edu	37	5	70820113	70820113	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:70820113A>C	uc003kbp.1	+	25	5998	c.5735A>C	c.(5734-5736)GAA>GCA	p.E1912A	BDP1_uc003kbo.2_Missense_Mutation_p.E1912A|BDP1_uc003kbq.1_RNA	NM_018429	NP_060899	A6H8Y1	BDP1_HUMAN	transcription factor-like nuclear regulator	1912					regulation of transcription, DNA-dependent|transcription from RNA polymerase III promoter	nucleoplasm	DNA binding			skin(2)	2		Lung NSC(167;0.000422)|Prostate(74;0.00815)|Ovarian(174;0.0176)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;5.28e-56)|Epithelial(20;2.31e-50)														---	---	---	---
RASGRF2	5924	broad.mit.edu	37	5	80476075	80476075	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:80476075G>T	uc003kha.1	+	18	2768	c.2768G>T	c.(2767-2769)CGT>CTT	p.R923L	RASGRF2_uc011ctn.1_RNA	NM_006909	NP_008840	O14827	RGRF2_HUMAN	Ras protein-specific guanine	923					apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|synaptic transmission	cytosol|endoplasmic reticulum membrane|plasma membrane	protein binding|Rho guanyl-nucleotide exchange factor activity			breast(5)|ovary(3)|large_intestine(2)|central_nervous_system(1)|skin(1)	12		Lung NSC(167;0.00498)|all_lung(232;0.00531)|Ovarian(174;0.0357)		OV - Ovarian serous cystadenocarcinoma(54;4.22e-42)|Epithelial(54;4.04e-35)|all cancers(79;2.52e-29)														---	---	---	---
VCAN	1462	broad.mit.edu	37	5	82876166	82876166	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:82876166A>C	uc003kii.3	+	15	10460	c.10104A>C	c.(10102-10104)AAA>AAC	p.K3368N	VCAN_uc003kij.3_Missense_Mutation_p.K2381N|VCAN_uc010jau.2_Missense_Mutation_p.K1614N|VCAN_uc003kik.3_Missense_Mutation_p.K627N|VCAN_uc003kil.3_Missense_Mutation_p.K2032N	NM_004385	NP_004376	P13611	CSPG2_HUMAN	versican isoform 1 precursor	3368					cell adhesion|cell recognition|glial cell migration	extracellular space|proteinaceous extracellular matrix	calcium ion binding|hyaluronic acid binding|sugar binding			ovary(7)|skin(6)|lung(2)|central_nervous_system(1)	16		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)														---	---	---	---
DMXL1	1657	broad.mit.edu	37	5	118469883	118469883	+	Intron	SNP	C	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:118469883C>A	uc003ksd.2	+						DMXL1_uc010jcl.1_Intron	NM_005509	NP_005500			Dmx-like 1											ovary(2)	2		all_cancers(142;0.0314)|all_epithelial(76;0.00559)|Prostate(80;0.11)|Breast(839;0.231)		OV - Ovarian serous cystadenocarcinoma(64;0.000563)|Epithelial(69;0.00179)|all cancers(49;0.0243)														---	---	---	---
CEP120	153241	broad.mit.edu	37	5	122724215	122724215	+	Silent	SNP	T	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:122724215T>A	uc003ktk.2	-	10	1423	c.1341A>T	c.(1339-1341)GTA>GTT	p.V447V	CEP120_uc011cwq.1_Silent_p.V256V|CEP120_uc010jcz.1_Silent_p.V421V	NM_153223	NP_694955	Q8N960	CE120_HUMAN	coiled-coil domain containing 100	447						centrosome				ovary(1)	1																		---	---	---	---
FBN2	2201	broad.mit.edu	37	5	127648476	127648476	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:127648476C>A	uc003kuu.2	-	37	5168	c.4729G>T	c.(4729-4731)GGC>TGC	p.G1577C		NM_001999	NP_001990	P35556	FBN2_HUMAN	fibrillin 2 precursor	1577	TB 6.				bone trabecula formation|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|positive regulation of bone mineralization|positive regulation of osteoblast differentiation	microfibril	calcium ion binding|extracellular matrix structural constituent			ovary(8)|large_intestine(4)|pancreas(1)|kidney(1)|skin(1)	15		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)														---	---	---	---
HARS	3035	broad.mit.edu	37	5	140056692	140056692	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140056692G>C	uc003lgv.2	-	9	915	c.833C>G	c.(832-834)TCC>TGC	p.S278C	HARS_uc003lgu.2_Missense_Mutation_p.S209C|HARS_uc011czm.1_Missense_Mutation_p.S238C|HARS_uc003lgw.2_Missense_Mutation_p.S258C|HARS_uc011czn.1_Missense_Mutation_p.S218C|HARS_uc010jfu.2_Missense_Mutation_p.S278C|HARS_uc011czo.1_Missense_Mutation_p.S204C|HARS_uc011czp.1_Missense_Mutation_p.S164C|HARS_uc011czq.1_Missense_Mutation_p.S168C	NM_002109	NP_002100	P12081	SYHC_HUMAN	histidyl-tRNA synthetase	278					histidyl-tRNA aminoacylation	cytosol	ATP binding|histidine-tRNA ligase activity			ovary(1)|skin(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		L-Histidine(DB00117)													---	---	---	---
ARAP3	64411	broad.mit.edu	37	5	141033869	141033869	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:141033869G>A	uc003llm.2	-	33	4361	c.4283C>T	c.(4282-4284)ACA>ATA	p.T1428I	ARAP3_uc003lll.2_Missense_Mutation_p.T379I|ARAP3_uc011dbe.1_Missense_Mutation_p.T1077I|ARAP3_uc003lln.2_Missense_Mutation_p.T1259I	NM_022481	NP_071926	Q8WWN8	ARAP3_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH	1428			T -> P (in a breast cancer sample; somatic mutation).		cytoskeleton organization|negative regulation of cell migration|negative regulation of Rho protein signal transduction|regulation of ARF GTPase activity|regulation of cell shape|small GTPase mediated signal transduction|vesicle-mediated transport	cytoskeleton|cytosol|lamellipodium|plasma membrane|ruffle	ARF GTPase activator activity|phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3,4-bisphosphate binding|Rho GTPase activator activity|zinc ion binding	p.T1428P(1)		breast(5)|ovary(1)|large_intestine(1)	7																		---	---	---	---
KIAA0141	9812	broad.mit.edu	37	5	141314074	141314074	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:141314074G>T	uc003lls.2	+	10	1194	c.1072G>T	c.(1072-1074)GGG>TGG	p.G358W	KIAA0141_uc003llt.2_Missense_Mutation_p.G358W|KIAA0141_uc003llu.1_RNA	NM_001142603	NP_001136075	Q14154	DELE_HUMAN	hypothetical protein LOC9812 precursor	358	TPR 5.				apoptosis|regulation of caspase activity	mitochondrion	protein binding			skin(1)	1		all_hematologic(541;0.118)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)															---	---	---	---
SPARC	6678	broad.mit.edu	37	5	151043744	151043744	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:151043744C>T	uc003luh.2	-	8	811	c.787G>A	c.(787-789)GAG>AAG	p.E263K	GM2A_uc011dcs.1_Intron|SPARC_uc003lug.2_Missense_Mutation_p.E97K|SPARC_uc003lui.2_Missense_Mutation_p.E263K	NM_003118	NP_003109	P09486	SPRC_HUMAN	secreted protein, acidic, cysteine-rich	263	EF-hand.			E->A: Loss of collagen binding.	ossification|platelet activation|platelet degranulation|signal transduction	basement membrane|extracellular space|platelet alpha granule lumen	calcium ion binding|collagen binding			central_nervous_system(1)	1		Medulloblastoma(196;0.109)|all_hematologic(541;0.122)	Kidney(363;0.000171)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)	OV - Ovarian serous cystadenocarcinoma(192;0.00118)	Becaplermin(DB00102)													---	---	---	---
DOCK2	1794	broad.mit.edu	37	5	169141060	169141060	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:169141060G>A	uc003maf.2	+	18	1768	c.1688G>A	c.(1687-1689)AGC>AAC	p.S563N	DOCK2_uc011der.1_RNA|DOCK2_uc010jjm.2_Missense_Mutation_p.S55N|DOCK2_uc010jjl.1_Missense_Mutation_p.S81N	NM_004946	NP_004937	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	563	DHR-1.				actin cytoskeleton organization|regulation of defense response to virus by virus|viral reproduction	cytoskeleton|cytosol|endomembrane system|membrane	electron carrier activity|GTP binding|GTPase binding|heme binding|Rac guanyl-nucleotide exchange factor activity|T cell receptor binding			ovary(5)|pancreas(2)	7	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)															---	---	---	---
DOCK2	1794	broad.mit.edu	37	5	169141061	169141061	+	Silent	SNP	C	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:169141061C>T	uc003maf.2	+	18	1769	c.1689C>T	c.(1687-1689)AGC>AGT	p.S563S	DOCK2_uc011der.1_RNA|DOCK2_uc010jjm.2_Silent_p.S55S|DOCK2_uc010jjl.1_Silent_p.S81S	NM_004946	NP_004937	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	563	DHR-1.				actin cytoskeleton organization|regulation of defense response to virus by virus|viral reproduction	cytoskeleton|cytosol|endomembrane system|membrane	electron carrier activity|GTP binding|GTPase binding|heme binding|Rac guanyl-nucleotide exchange factor activity|T cell receptor binding			ovary(5)|pancreas(2)	7	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)															---	---	---	---
FOXI1	2299	broad.mit.edu	37	5	169533040	169533040	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:169533040G>A	uc003mai.3	+	1	124	c.79G>A	c.(79-81)GAG>AAG	p.E27K	FOXI1_uc003maj.3_Missense_Mutation_p.E27K	NM_012188	NP_036320	Q12951	FOXI1_HUMAN	forkhead box I1 isoform a	27	Pro-rich.				epidermal cell fate specification|otic placode formation|pattern specification process|positive regulation of transcription from RNA polymerase II promoter|regulation of sequence-specific DNA binding transcription factor activity	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding|transcription regulatory region DNA binding			breast(3)|central_nervous_system(1)	4	Renal(175;0.000159)|Lung NSC(126;0.0267)|all_lung(126;0.04)	Medulloblastoma(196;0.0109)|all_neural(177;0.0298)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)											Pendred_syndrome				---	---	---	---
RREB1	6239	broad.mit.edu	37	6	7211167	7211167	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:7211167G>A	uc003mxc.2	+	7	946	c.556G>A	c.(556-558)GCA>ACA	p.A186T	RREB1_uc010jnw.2_Missense_Mutation_p.A186T|RREB1_uc003mxb.2_Missense_Mutation_p.A186T|RREB1_uc010jnx.2_Missense_Mutation_p.A186T|RREB1_uc003mxd.2_Missense_Mutation_p.A186T	NM_001003698	NP_001003698	Q92766	RREB1_HUMAN	ras responsive element binding protein 1 isoform	186					multicellular organismal development|positive regulation of transcription, DNA-dependent|Ras protein signal transduction|transcription from RNA polymerase II promoter	cytoplasm|nuclear speck	DNA binding|zinc ion binding			ovary(4)|large_intestine(2)|pancreas(2)|skin(2)|breast(1)	11	Ovarian(93;0.0398)	all_hematologic(90;0.0384)|Prostate(151;0.191)																---	---	---	---
NEDD9	4739	broad.mit.edu	37	6	11191199	11191199	+	Silent	SNP	G	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:11191199G>A	uc003mzv.2	-	5	1070	c.903C>T	c.(901-903)CAC>CAT	p.H301H	NEDD9_uc010joz.2_Silent_p.H301H|NEDD9_uc003mzw.3_Silent_p.H155H	NM_006403	NP_006394	Q14511	CASL_HUMAN	neural precursor cell expressed, developmentally	301					actin filament bundle assembly|cell adhesion|cell division|integrin-mediated signaling pathway|mitosis|regulation of growth	cell cortex|focal adhesion|Golgi apparatus|lamellipodium|nucleus	protein binding				0	Breast(50;0.0768)|Ovarian(93;0.152)	all_hematologic(90;0.135)	Epithelial(50;0.0647)|all cancers(50;0.179)															---	---	---	---
ATXN1	6310	broad.mit.edu	37	6	16327558	16327558	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:16327558C>T	uc003nbt.2	-	8	1955	c.984G>A	c.(982-984)ATG>ATA	p.M328I	ATXN1_uc010jpi.2_Missense_Mutation_p.M328I|ATXN1_uc010jpj.1_Intron	NM_000332	NP_000323	P54253	ATX1_HUMAN	ataxin 1	328					cell death|negative regulation of transcription, DNA-dependent|nuclear export|RNA processing	cytoplasm|nuclear inclusion body|nuclear matrix|nucleoplasm	identical protein binding|poly(G) RNA binding|poly(U) RNA binding|protein binding|protein C-terminus binding|protein self-association			skin(3)|central_nervous_system(1)	4	Breast(50;0.063)|Ovarian(93;0.0733)	all_hematologic(90;0.000682)|Ovarian(999;0.00973)																---	---	---	---
FLOT1	10211	broad.mit.edu	37	6	30697834	30697834	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30697834T>G	uc003nrm.2	-	12	1383	c.1219A>C	c.(1219-1221)AGT>CGT	p.S407R	FLOT1_uc011dmr.1_Missense_Mutation_p.S359R	NM_005803	NP_005794	O75955	FLOT1_HUMAN	flotillin 1	407						centriolar satellite|endosome|integral to membrane|melanosome|membrane fraction					0																		---	---	---	---
TNXB	7148	broad.mit.edu	37	6	32032696	32032696	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32032696G>A	uc003nzl.2	-	19	6945	c.6743C>T	c.(6742-6744)ACC>ATC	p.T2248I		NM_019105	NP_061978	P22105	TENX_HUMAN	tenascin XB isoform 1 precursor	2320	Fibronectin type-III 15.				actin cytoskeleton organization|cell adhesion|collagen metabolic process|elastic fiber assembly|signal transduction	extracellular space|intracellular|proteinaceous extracellular matrix	heparin binding|integrin binding				0																		---	---	---	---
KIF6	221458	broad.mit.edu	37	6	39602738	39602738	+	Intron	SNP	A	G	G			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:39602738A>G	uc003oot.2	-						KIF6_uc010jxa.1_Intron|KIF6_uc011dua.1_Intron|KIF6_uc010jxb.1_Intron	NM_145027	NP_659464			kinesin family member 6						microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity|protein binding			breast(2)|central_nervous_system(1)	3																		---	---	---	---
TREML2	79865	broad.mit.edu	37	6	41162572	41162572	+	Splice_Site	SNP	C	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:41162572C>T	uc010jxm.1	-	3	556	c.377_splice	c.e3-1	p.A126_splice		NM_024807	NP_079083			triggering receptor expressed on myeloid						T cell activation	cell surface|integral to membrane|plasma membrane	protein binding|receptor activity			ovary(1)|central_nervous_system(1)	2	Ovarian(28;0.0418)|Colorectal(47;0.196)																	---	---	---	---
ZNF318	24149	broad.mit.edu	37	6	43323884	43323884	+	Splice_Site	SNP	C	G	G			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43323884C>G	uc003oux.2	-	4	1267	c.1189_splice	c.e4-1	p.L397_splice	ZNF318_uc003ouw.2_Splice_Site	NM_014345	NP_055160			zinc finger protein 318						meiosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	nucleic acid binding|zinc ion binding			ovary(3)|breast(2)|central_nervous_system(1)|skin(1)	7			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0171)|OV - Ovarian serous cystadenocarcinoma(102;0.0579)															---	---	---	---
PKHD1	5314	broad.mit.edu	37	6	51513896	51513896	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:51513896A>C	uc003pah.1	-	62	11573	c.11297T>G	c.(11296-11298)TTT>TGT	p.F3766C		NM_138694	NP_619639	P08F94	PKHD1_HUMAN	fibrocystin isoform 1	3766	Extracellular (Potential).				cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity			lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44	Lung NSC(77;0.0605)																	---	---	---	---
SLC35A1	10559	broad.mit.edu	37	6	88210354	88210354	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:88210354C>G	uc011dzj.1	+	3	402	c.323C>G	c.(322-324)GCT>GGT	p.A108G	SLC35A1_uc003plx.2_RNA|SLC35A1_uc010kbw.2_5'UTR|SLC35A1_uc003plz.2_Intron|SLC35A1_uc011dzi.1_Intron|SLC35A1_uc003ply.2_RNA|SLC35A1_uc010kbx.2_Missense_Mutation_p.A108G|SLC35A1_uc010kby.2_RNA	NM_006416	NP_006407	P78382	S35A1_HUMAN	solute carrier family 35 (CMP-sialic acid	108	Helical; (Potential).				carbohydrate metabolic process|protein modification process	Golgi membrane|integral to plasma membrane	CMP-N-acetylneuraminate transmembrane transporter activity|sugar:hydrogen symporter activity				0		all_cancers(76;3.93e-06)|Acute lymphoblastic leukemia(125;3.55e-10)|Prostate(29;3.51e-09)|all_hematologic(105;3.29e-06)|all_epithelial(107;0.00575)		BRCA - Breast invasive adenocarcinoma(108;0.0429)														---	---	---	---
RTN4IP1	84816	broad.mit.edu	37	6	107067186	107067186	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:107067186T>G	uc003prj.2	-	4	988	c.511A>C	c.(511-513)AAA>CAA	p.K171Q	RTN4IP1_uc010kdd.2_Missense_Mutation_p.K171Q|RTN4IP1_uc003prk.2_Missense_Mutation_p.K71Q	NM_032730	NP_116119	Q8WWV3	RT4I1_HUMAN	reticulon 4 interacting protein 1 precursor	171						mitochondrion	oxidoreductase activity|zinc ion binding				0	Breast(9;0.0107)|all_epithelial(6;0.14)	all_cancers(87;9.45e-05)|Acute lymphoblastic leukemia(125;2.13e-07)|all_hematologic(75;5.28e-06)|all_epithelial(87;0.0144)	Epithelial(6;0.000873)|all cancers(7;0.00363)|BRCA - Breast invasive adenocarcinoma(8;0.00721)|OV - Ovarian serous cystadenocarcinoma(5;0.0394)	all cancers(137;0.113)|BRCA - Breast invasive adenocarcinoma(108;0.127)|Epithelial(106;0.144)														---	---	---	---
FIG4	9896	broad.mit.edu	37	6	110048374	110048374	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:110048374G>A	uc003ptt.2	+	4	567	c.352G>A	c.(352-354)GAT>AAT	p.D118N	FIG4_uc011eau.1_Intron	NM_014845	NP_055660	Q92562	FIG4_HUMAN	Sac domain-containing inositol phosphatase 3	118					cell death	endosome membrane	protein binding			ovary(1)	1		all_cancers(87;8.63e-07)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.000124)|all_lung(197;0.0187)|Colorectal(196;0.0492)|Lung SC(18;0.0548)		OV - Ovarian serous cystadenocarcinoma(136;0.0355)|Epithelial(106;0.038)|all cancers(137;0.0425)|BRCA - Breast invasive adenocarcinoma(108;0.079)														---	---	---	---
LAMA2	3908	broad.mit.edu	37	6	129635947	129635947	+	Intron	SNP	A	C	C			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:129635947A>C	uc003qbn.2	+						LAMA2_uc003qbo.2_Intron	NM_000426	NP_000417			laminin alpha 2 subunit isoform a precursor						cell adhesion|muscle organ development|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	receptor binding|structural molecule activity			ovary(8)|breast(1)|skin(1)	10				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)														---	---	---	---
FGL2	10875	broad.mit.edu	37	7	76825675	76825675	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:76825675C>A	uc003ugb.2	-	2	1281	c.1241G>T	c.(1240-1242)AGT>ATT	p.S414I	CCDC146_uc003ufz.1_Intron|CCDC146_uc003uga.2_Intron	NM_006682	NP_006673	Q14314	FGL2_HUMAN	fibrinogen-like 2 precursor	414	Fibrinogen C-terminal.				signal transduction	fibrinogen complex	receptor binding			skin(2)	2																		---	---	---	---
SEMA3E	9723	broad.mit.edu	37	7	83021901	83021901	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:83021901C>T	uc003uhy.1	-	14	2103	c.1637G>A	c.(1636-1638)CGG>CAG	p.R546Q		NM_012431	NP_036563	O15041	SEM3E_HUMAN	semaphorin 3E precursor	546					axon guidance	extracellular space|membrane	receptor activity			ovary(3)	3		Medulloblastoma(109;0.109)																---	---	---	---
PPP1R9A	55607	broad.mit.edu	37	7	94750141	94750141	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:94750141G>T	uc003unp.2	+	4	1928	c.1646G>T	c.(1645-1647)GGC>GTC	p.G549V	PPP1R9A_uc010lfj.2_Missense_Mutation_p.G549V|PPP1R9A_uc011kif.1_Missense_Mutation_p.G549V|PPP1R9A_uc003unq.2_Missense_Mutation_p.G549V|PPP1R9A_uc011kig.1_Missense_Mutation_p.G549V	NM_017650	NP_060120	Q9ULJ8	NEB1_HUMAN	protein phosphatase 1, regulatory (inhibitor)	549	PDZ.					cell junction|synapse|synaptosome	actin binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	4	all_cancers(62;9.12e-11)|all_epithelial(64;4.34e-09)		STAD - Stomach adenocarcinoma(171;0.0031)												HNSCC(28;0.073)			---	---	---	---
OR2AE1	81392	broad.mit.edu	37	7	99474447	99474447	+	Silent	SNP	A	G	G			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99474447A>G	uc003usc.1	-	1	210	c.210T>C	c.(208-210)GAT>GAC	p.D70D		NM_001005276	NP_001005276	Q8NHA4	O2AE1_HUMAN	olfactory receptor, family 2, subfamily AE,	70	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	Esophageal squamous(72;0.0166)|Lung NSC(181;0.0211)|all_lung(186;0.0323)																	---	---	---	---
GIGYF1	64599	broad.mit.edu	37	7	100283967	100283967	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100283967C>G	uc003uwg.1	-	8	1793	c.784G>C	c.(784-786)GGT>CGT	p.G262R		NM_022574	NP_072096	O75420	PERQ1_HUMAN	PERQ amino acid rich, with GYF domain 1	262										large_intestine(1)|central_nervous_system(1)	2	Lung NSC(181;0.035)|all_lung(186;0.0509)|Esophageal squamous(72;0.0817)																	---	---	---	---
COG5	10466	broad.mit.edu	37	7	106871079	106871079	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:106871079G>C	uc003ved.2	-	18	2704	c.2179C>G	c.(2179-2181)CGG>GGG	p.R727G	COG5_uc003vec.2_Missense_Mutation_p.R748G|COG5_uc003vee.2_Missense_Mutation_p.R748G	NM_181733	NP_859422	Q9UP83	COG5_HUMAN	component of oligomeric golgi complex 5 isoform	727					intra-Golgi vesicle-mediated transport|protein transport	cytosol|Golgi membrane|Golgi transport complex|nucleus	protein binding			central_nervous_system(2)|skin(2)	4																		---	---	---	---
CAV1	857	broad.mit.edu	37	7	116199067	116199067	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:116199067G>C	uc003vif.1	+	3	541	c.263G>C	c.(262-264)AGC>ACC	p.S88T	CAV1_uc010lkd.1_Missense_Mutation_p.S57T|CAV1_uc010lke.1_Missense_Mutation_p.S57T|CAV1_uc003vig.1_RNA|CAV1_uc003vih.2_Missense_Mutation_p.S57T|CAV1_uc010lkf.1_Missense_Mutation_p.S57T	NM_001753	NP_001744	Q03135	CAV1_HUMAN	caveolin 1	88	Cytoplasmic (Potential).				blood coagulation|calcium ion transport|caveola assembly|cellular response to starvation|cholesterol homeostasis|cytosolic calcium ion homeostasis|inactivation of MAPK activity|interspecies interaction between organisms|leukocyte migration|lipid storage|maintenance of protein location in cell|mammary gland involution|membrane depolarization|negative regulation of BMP signaling pathway|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of endothelial cell proliferation|negative regulation of epithelial cell differentiation|negative regulation of nitric oxide biosynthetic process|negative regulation of peptidyl-serine phosphorylation|negative regulation of protein binding|negative regulation of transcription from RNA polymerase II promoter|nitric oxide homeostasis|nitric oxide metabolic process|positive regulation of calcium ion transport into cytosol|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of metalloenzyme activity|positive regulation of peptidyl-serine phosphorylation|positive regulation of vasoconstriction|protein homooligomerization|receptor internalization|regulation of blood coagulation|regulation of fatty acid metabolic process|regulation of nitric-oxide synthase activity|regulation of smooth muscle contraction|response to calcium ion|response to estrogen stimulus|response to hypoxia|response to progesterone stimulus|skeletal muscle tissue development|T cell costimulation|triglyceride metabolic process|vasculogenesis|vesicle organization	apical plasma membrane|basolateral plasma membrane|caveola|caveola|cytosol|endoplasmic reticulum|endosome|Golgi membrane|lipid particle|perinuclear region of cytoplasm	cholesterol binding|nitric-oxide synthase binding|peptidase activator activity|protein binding|protein complex scaffold|receptor binding				0	all_epithelial(6;1.42e-06)|Lung NSC(10;0.0056)|all_lung(10;0.00609)		STAD - Stomach adenocarcinoma(10;0.00878)															---	---	---	---
PLXNA4	91584	broad.mit.edu	37	7	132192842	132192842	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:132192842A>C	uc003vra.3	-	2	840	c.611T>G	c.(610-612)CTG>CGG	p.L204R	PLXNA4_uc003vrc.2_Missense_Mutation_p.L204R|PLXNA4_uc003vrb.2_Missense_Mutation_p.L204R	NM_020911	NP_065962	Q9HCM2	PLXA4_HUMAN	plexin A4 isoform 1	204	Extracellular (Potential).|Sema.					integral to membrane|intracellular|plasma membrane				ovary(1)	1																		---	---	---	---
STRA8	346673	broad.mit.edu	37	7	134927608	134927608	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:134927608G>T	uc011kpx.1	+	3	334	c.334G>T	c.(334-336)GCA>TCA	p.A112S		NM_182489	NP_872295	Q7Z7C7	STRA8_HUMAN	STRA8	112	Potential.				DNA replication|regulation of transcription, DNA-dependent	cytoplasm|nucleus					0																		---	---	---	---
LUC7L2	51631	broad.mit.edu	37	7	139106914	139106914	+	Nonsense_Mutation	SNP	C	G	G			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:139106914C>G	uc003vux.2	+	10	1381	c.1007C>G	c.(1006-1008)TCA>TGA	p.S336*	LUC7L2_uc011kqs.1_Nonsense_Mutation_p.S333*|LUC7L2_uc011kqt.1_Nonsense_Mutation_p.S402*|LUC7L2_uc003vuy.2_Nonsense_Mutation_p.S335*|LUC7L2_uc003vva.2_Nonsense_Mutation_p.S283*	NM_016019	NP_057103	Q9Y383	LC7L2_HUMAN	LUC7-like 2	336	Arg/Ser-rich.						enzyme binding|metal ion binding				0	Melanoma(164;0.242)																	---	---	---	---
TAS2R60	338398	broad.mit.edu	37	7	143140947	143140947	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:143140947G>T	uc011ktg.1	+	1	402	c.402G>T	c.(400-402)AAG>AAT	p.K134N	uc003wda.2_Intron	NM_177437	NP_803186	P59551	T2R60_HUMAN	taste receptor, type 2, member 60	134	Helical; Name=4; (Potential).				sensory perception of bitter taste	integral to membrane	G-protein coupled receptor activity			skin(6)	6	Melanoma(164;0.172)																	---	---	---	---
KCNH2	3757	broad.mit.edu	37	7	150645985	150645985	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150645985G>C	uc003wic.2	-	10	2564	c.2551C>G	c.(2551-2553)CAC>GAC	p.H851D	KCNH2_uc003wib.2_Missense_Mutation_p.H511D|KCNH2_uc011kux.1_Missense_Mutation_p.H755D	NM_000238	NP_000229	Q12809	KCNH2_HUMAN	voltage-gated potassium channel, subfamily H,	851	Cytoplasmic (Potential).				blood circulation|muscle contraction|regulation of heart contraction|regulation of transcription, DNA-dependent	voltage-gated potassium channel complex	delayed rectifier potassium channel activity|two-component sensor activity			skin(3)|ovary(1)	4	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	Amiodarone(DB01118)|Amsacrine(DB00276)|Astemizole(DB00637)|Carvedilol(DB01136)|Cisapride(DB00604)|Dofetilide(DB00204)|Halofantrine(DB01218)|Ibutilide(DB00308)|Pimozide(DB01100)|Propafenone(DB01182)|Quinidine(DB00908)|Sertindole(DB06144)|Sotalol(DB00489)|Terfenadine(DB00342)|Verapamil(DB00661)													---	---	---	---
NAT2	10	broad.mit.edu	37	8	18258347	18258347	+	Silent	SNP	T	C	C			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:18258347T>C	uc003wyw.1	+	2	941	c.834T>C	c.(832-834)AAT>AAC	p.N278N		NM_000015	NP_000006	P11245	ARY2_HUMAN	N-acetyltransferase 2	278					xenobiotic metabolic process	cytosol	arylamine N-acetyltransferase activity			ovary(1)|skin(1)	2				Colorectal(111;0.0531)|COAD - Colon adenocarcinoma(73;0.21)										Naso-/Oropharyngeal/Laryngeal_Cancer_Familial_Clustering_of				---	---	---	---
ADAM9	8754	broad.mit.edu	37	8	38865450	38865450	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38865450C>A	uc003xmr.2	+	2	221	c.143C>A	c.(142-144)CCT>CAT	p.P48H	ADAM9_uc011lcf.1_RNA|ADAM9_uc011lcg.1_RNA|ADAM9_uc010lwr.2_RNA|ADAM9_uc003xmo.1_Missense_Mutation_p.P48H|ADAM9_uc003xmp.2_Missense_Mutation_p.P48H	NM_003816	NP_003807	Q13443	ADAM9_HUMAN	ADAM metallopeptidase domain 9 isoform 1	48	Extracellular (Potential).			Missing (in Ref. 2; no nucleotide entry).	activation of MAPKK activity|cell-cell adhesion mediated by integrin|cell-matrix adhesion|keratinocyte differentiation|monocyte activation|PMA-inducible membrane protein ectodomain proteolysis|PMA-inducible membrane protein ectodomain proteolysis|positive regulation of cell adhesion mediated by integrin|positive regulation of keratinocyte migration|positive regulation of macrophage fusion|positive regulation of membrane protein ectodomain proteolysis|positive regulation of protein secretion|response to calcium ion|response to glucocorticoid stimulus|response to hydrogen peroxide|response to manganese ion|response to tumor necrosis factor|transforming growth factor beta receptor signaling pathway	extracellular space|extracellular space|integral to membrane|intrinsic to external side of plasma membrane	collagen binding|integrin binding|laminin binding|metalloendopeptidase activity|protein kinase C binding|SH3 domain binding|zinc ion binding			ovary(1)|central_nervous_system(1)	2		all_lung(54;0.00292)|Lung NSC(58;0.0115)|Hepatocellular(245;0.0153)	LUSC - Lung squamous cell carcinoma(45;2.74e-07)															---	---	---	---
ZFHX4	79776	broad.mit.edu	37	8	77763156	77763156	+	Silent	SNP	T	G	G			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:77763156T>G	uc003yav.2	+	10	4251	c.3864T>G	c.(3862-3864)GGT>GGG	p.G1288G	ZFHX4_uc003yau.1_Silent_p.G1333G|ZFHX4_uc003yaw.1_Silent_p.G1288G	NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	zinc finger homeodomain 4	1288						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|large_intestine(4)|breast(2)|lung(1)	15			BRCA - Breast invasive adenocarcinoma(89;0.0895)												HNSCC(33;0.089)			---	---	---	---
CDH17	1015	broad.mit.edu	37	8	95186418	95186418	+	Nonsense_Mutation	SNP	G	C	C	rs139340016		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:95186418G>C	uc003ygh.2	-	6	620	c.495C>G	c.(493-495)TAC>TAG	p.Y165*	CDH17_uc011lgo.1_Intron|CDH17_uc011lgp.1_Nonsense_Mutation_p.Y165*	NM_004063	NP_004054	Q12864	CAD17_HUMAN	cadherin 17 precursor	165	Extracellular (Potential).|Cadherin 2.					integral to membrane	calcium ion binding			ovary(5)|skin(1)	6	Breast(36;4.65e-06)		BRCA - Breast invasive adenocarcinoma(8;0.00691)															---	---	---	---
PGCP	10404	broad.mit.edu	37	8	97797143	97797143	+	Silent	SNP	C	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:97797143C>T	uc003yhw.2	+	2	184	c.18C>T	c.(16-18)TTC>TTT	p.F6F	PGCP_uc010mbe.2_Silent_p.F6F	NM_016134	NP_057218	Q9Y646	PGCP_HUMAN	plasma glutamate carboxypeptidase precursor	6					peptide metabolic process|proteolysis	cytoplasm|extracellular space	metal ion binding|metallocarboxypeptidase activity			upper_aerodigestive_tract(1)	1	Breast(36;1.86e-05)																	---	---	---	---
POP1	10940	broad.mit.edu	37	8	99148887	99148887	+	Nonsense_Mutation	SNP	A	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:99148887A>T	uc003yij.3	+	8	1289	c.1189A>T	c.(1189-1191)AAA>TAA	p.K397*	POP1_uc011lgv.1_Nonsense_Mutation_p.K397*|POP1_uc003yik.2_Nonsense_Mutation_p.K397*	NM_001145860	NP_001139332	Q99575	POP1_HUMAN	processing of precursor 1	397					tRNA 5'-leader removal|tRNA catabolic process	nucleolar ribonuclease P complex|ribonuclease MRP complex	identical protein binding|ribonuclease MRP activity|ribonuclease P activity			ovary(1)|breast(1)	2	Breast(36;1.78e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.145)															---	---	---	---
RGS22	26166	broad.mit.edu	37	8	101105676	101105676	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:101105676G>T	uc003yjb.1	-	3	311	c.116C>A	c.(115-117)CCA>CAA	p.P39Q	RGS22_uc003yja.1_5'UTR|RGS22_uc003yjc.1_Missense_Mutation_p.P39Q|RGS22_uc010mbo.1_RNA	NM_015668	NP_056483	Q8NE09	RGS22_HUMAN	regulator of G-protein signaling 22	39					negative regulation of signal transduction	cytoplasm|plasma membrane	GTPase activator activity|signal transducer activity			ovary(3)|skin(2)|breast(1)|central_nervous_system(1)	7			Epithelial(11;6.71e-08)|all cancers(13;4.19e-06)|OV - Ovarian serous cystadenocarcinoma(57;0.000469)|STAD - Stomach adenocarcinoma(118;0.169)															---	---	---	---
PKHD1L1	93035	broad.mit.edu	37	8	110416883	110416883	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110416883G>C	uc003yne.2	+	15	1578	c.1474G>C	c.(1474-1476)GAT>CAT	p.D492H		NM_177531	NP_803875	Q86WI1	PKHL1_HUMAN	fibrocystin L precursor	492	Extracellular (Potential).				immune response	cytosol|extracellular space|integral to membrane	receptor activity			ovary(9)|central_nervous_system(2)|large_intestine(1)|breast(1)|pancreas(1)	14			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)												HNSCC(38;0.096)			---	---	---	---
CSMD3	114788	broad.mit.edu	37	8	113694835	113694835	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113694835C>G	uc003ynu.2	-	16	2672	c.2513G>C	c.(2512-2514)GGA>GCA	p.G838A	CSMD3_uc003yns.2_Missense_Mutation_p.G110A|CSMD3_uc003ynt.2_Missense_Mutation_p.G798A|CSMD3_uc011lhx.1_Missense_Mutation_p.G734A	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	838	Sushi 4.|Extracellular (Potential).					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63															HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			---	---	---	---
TRPS1	7227	broad.mit.edu	37	8	116426704	116426704	+	Silent	SNP	C	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:116426704C>T	uc003ynz.2	-	6	3852	c.3393G>A	c.(3391-3393)GTG>GTA	p.V1131V	TRPS1_uc011lhy.1_Silent_p.V1135V|TRPS1_uc003yny.2_Silent_p.V1144V|TRPS1_uc010mcy.2_Silent_p.V1131V	NM_014112	NP_054831	Q9UHF7	TRPS1_HUMAN	zinc finger transcription factor TRPS1	1131	Mediates interaction with RNF4 (By similarity).				negative regulation of transcription from RNA polymerase II promoter|NLS-bearing substrate import into nucleus|regulation of chondrocyte differentiation|skeletal system development|transcription from RNA polymerase II promoter	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)|skin(2)|pancreas(1)|lung(1)|kidney(1)	7	all_cancers(13;5.44e-23)|all_epithelial(1;2.14e-27)|Lung NSC(37;2.55e-05)|Ovarian(258;0.0219)		Epithelial(1;9.78e-37)|all cancers(1;3.14e-31)|BRCA - Breast invasive adenocarcinoma(1;2.56e-12)											Langer-Giedion_syndrome				---	---	---	---
ZNF16	7564	broad.mit.edu	37	8	146156265	146156265	+	Missense_Mutation	SNP	T	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:146156265T>A	uc003zet.2	-	4	2095	c.1908A>T	c.(1906-1908)AAA>AAT	p.K636N	ZNF16_uc003zeu.2_Missense_Mutation_p.K636N	NM_001029976	NP_001025147	P17020	ZNF16_HUMAN	zinc finger protein 16	636	C2H2-type 16.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(5)	5	all_cancers(97;8.72e-12)|all_epithelial(106;1.07e-10)|Lung NSC(106;7.18e-05)|all_lung(105;0.00021)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)	Acute lymphoblastic leukemia(644;0.136)	Epithelial(56;3.45e-38)|all cancers(56;3.04e-33)|BRCA - Breast invasive adenocarcinoma(115;0.0424)|Colorectal(110;0.055)	GBM - Glioblastoma multiforme(99;0.02)|KIRC - Kidney renal clear cell carcinoma(644;0.0486)														---	---	---	---
PRKACG	5568	broad.mit.edu	37	9	71628351	71628351	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:71628351C>T	uc004agy.2	-	1	689	c.658G>A	c.(658-660)GTG>ATG	p.V220M		NM_002732	NP_002723	P22612	KAPCG_HUMAN	protein kinase, cAMP-dependent, catalytic,	220	Protein kinase.				activation of phospholipase C activity|activation of protein kinase A activity|blood coagulation|cellular response to glucagon stimulus|energy reserve metabolic process|gluconeogenesis|intracellular protein kinase cascade|male gonad development|nerve growth factor receptor signaling pathway|regulation of insulin secretion|spermatogenesis|transmembrane transport|triglyceride catabolic process|water transport	cytosol|nucleoplasm	ATP binding|cAMP-dependent protein kinase activity			ovary(1)|pancreas(1)|skin(1)	3																		---	---	---	---
TRPM6	140803	broad.mit.edu	37	9	77362838	77362838	+	Intron	SNP	A	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:77362838A>T	uc004ajl.1	-						TRPM6_uc004ajk.1_Intron|TRPM6_uc010mpb.1_Intron|TRPM6_uc010mpc.1_Intron|TRPM6_uc010mpd.1_Intron|TRPM6_uc010mpe.1_Intron|TRPM6_uc004ajj.1_Intron	NM_017662	NP_060132			transient receptor potential cation channel,						response to toxin	integral to membrane	ATP binding|calcium channel activity|metal ion binding|protein binding|protein serine/threonine kinase activity			lung(3)|stomach(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|skin(1)	8																		---	---	---	---
C9orf103	414328	broad.mit.edu	37	9	86258577	86258577	+	Missense_Mutation	SNP	A	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:86258577A>T	uc004amu.1	+	5	460	c.446A>T	c.(445-447)CAG>CTG	p.Q149L	C9orf103_uc004amt.1_Missense_Mutation_p.Q103L|C9orf103_uc010mpv.1_Missense_Mutation_p.Q103L	NM_001001551	NP_001001551	Q5T6J7	GNTK_HUMAN	gluconokinase-like protein	149					carbohydrate metabolic process	cytoplasm	ATP binding|gluconokinase activity|shikimate kinase activity				0																		---	---	---	---
ZNF169	169841	broad.mit.edu	37	9	97062923	97062923	+	Silent	SNP	C	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:97062923C>T	uc004aum.1	+	5	1188	c.1083C>T	c.(1081-1083)CTC>CTT	p.L361L		NM_194320	NP_919301	Q14929	ZN169_HUMAN	zinc finger protein 169	361	C2H2-type 5.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)	2		Acute lymphoblastic leukemia(62;0.136)																---	---	---	---
SVEP1	79987	broad.mit.edu	37	9	113261451	113261451	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:113261451C>A	uc010mtz.2	-	7	1888	c.1551G>T	c.(1549-1551)CAG>CAT	p.Q517H	SVEP1_uc010mua.1_Missense_Mutation_p.Q517H|SVEP1_uc004beu.2_Missense_Mutation_p.Q517H	NM_153366	NP_699197	Q4LDE5	SVEP1_HUMAN	polydom	517	Sushi 3.				cell adhesion	cytoplasm|extracellular region|membrane	calcium ion binding			ovary(7)	7																		---	---	---	---
CDK5RAP2	55755	broad.mit.edu	37	9	123330664	123330664	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:123330664G>A	uc004bkf.2	-	3	311	c.130C>T	c.(130-132)CTC>TTC	p.L44F	CDK5RAP2_uc004bkg.2_Missense_Mutation_p.L44F|CDK5RAP2_uc011lxw.1_5'UTR|CDK5RAP2_uc011lxx.1_RNA|CDK5RAP2_uc011lxy.1_RNA|CDK5RAP2_uc011lxz.1_5'UTR|CDK5RAP2_uc011lya.1_5'UTR|CDK5RAP2_uc004bkh.1_Missense_Mutation_p.L44F	NM_018249	NP_060719	Q96SN8	CK5P2_HUMAN	CDK5 regulatory subunit associated protein 2	44					brain development|centrosome organization|chromosome segregation|G2/M transition of mitotic cell cycle|microtubule bundle formation|negative regulation of centriole replication|positive regulation of transcription, DNA-dependent|regulation of neuron differentiation|regulation of spindle checkpoint	cytosol|Golgi apparatus|microtubule|pericentriolar material|perinuclear region of cytoplasm|spindle pole	calmodulin binding|microtubule binding|neuronal Cdc2-like kinase binding|transcription regulatory region DNA binding			ovary(2)|lung(1)|skin(1)	4																		---	---	---	---
ASB6	140459	broad.mit.edu	37	9	132400887	132400887	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:132400887T>C	uc004byf.1	-	5	729	c.563A>G	c.(562-564)CAC>CGC	p.H188R	ASB6_uc004bye.1_Missense_Mutation_p.H113R|ASB6_uc004byg.1_Missense_Mutation_p.T152A|ASB6_uc011mbt.1_Missense_Mutation_p.H109R|ASB6_uc010myx.1_Intron	NM_017873	NP_060343	Q9NWX5	ASB6_HUMAN	ankyrin repeat and SOCS box-containing 6 isoform	188	ANK 4.				intracellular signal transduction	cytoplasm					0		Ovarian(14;0.00556)																---	---	---	---
BAT2L1	84726	broad.mit.edu	37	9	134350951	134350951	+	Silent	SNP	C	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:134350951C>A	uc004can.3	+	15	3490	c.3435C>A	c.(3433-3435)CCC>CCA	p.P1145P	BAT2L1_uc010mzj.1_Silent_p.P728P|BAT2L1_uc004cao.3_Silent_p.P503P	NM_013318	NP_037450	Q5JSZ5	PRC2B_HUMAN	HLA-B associated transcript 2-like	1145							protein binding				0																		---	---	---	---
BRD3	8019	broad.mit.edu	37	9	136907050	136907050	+	Silent	SNP	G	C	C			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136907050G>C	uc004cew.2	-	8	1427	c.1239C>G	c.(1237-1239)GCC>GCG	p.A413A	BRD3_uc004cex.2_Silent_p.A413A	NM_007371	NP_031397	Q15059	BRD3_HUMAN	bromodomain containing protein 3	413						nucleus	protein binding		BRD3/C15orf55(3)	stomach(4)|midline_organs(3)|kidney(1)	8				OV - Ovarian serous cystadenocarcinoma(145;1.43e-08)|Epithelial(140;8.41e-08)|all cancers(34;5.21e-07)				T	NUT|C15orf55	lethal midline carcinoma of young people								---	---	---	---
ITIH5	80760	broad.mit.edu	37	10	7608346	7608346	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:7608346A>G	uc001ijq.2	-	13	2253	c.2174T>C	c.(2173-2175)ATT>ACT	p.I725T	ITIH5_uc001ijp.2_Missense_Mutation_p.I511T	NM_030569	NP_085046	Q86UX2	ITIH5_HUMAN	inter-alpha trypsin inhibitor heavy chain	725					hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity			ovary(2)|central_nervous_system(2)	4																		---	---	---	---
BMI1	648	broad.mit.edu	37	10	22617625	22617625	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:22617625C>G	uc001irh.2	+	8	1207	c.568C>G	c.(568-570)CAG>GAG	p.Q190E	BMI1_uc009xkg.2_Missense_Mutation_p.Q333E	NM_005180	NP_005171	P35226	BMI1_HUMAN	BMI1 polycomb ring finger oncogene	190	Interaction with E4F1.				hemopoiesis|negative regulation of transcription from RNA polymerase II promoter|positive regulation of fibroblast proliferation|positive regulation of ubiquitin-protein ligase activity|segment specification|transcription, DNA-dependent	cytoplasm|nucleolus|PcG protein complex|ubiquitin ligase complex	RING-like zinc finger domain binding|zinc ion binding			ovary(1)|skin(1)	2																		---	---	---	---
STOX1	219736	broad.mit.edu	37	10	70645583	70645583	+	Silent	SNP	C	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:70645583C>A	uc001jos.2	+	3	2118	c.2031C>A	c.(2029-2031)GGC>GGA	p.G677G	STOX1_uc001jor.2_Intron|STOX1_uc009xpy.2_Intron|STOX1_uc001joq.2_Silent_p.G567G	NM_001130161	NP_001123633	Q6ZVD7	STOX1_HUMAN	storkhead box 1 isoform a	677						cytoplasm|nucleolus	DNA binding			kidney(1)|skin(1)	2																		---	---	---	---
AIFM2	84883	broad.mit.edu	37	10	71876517	71876517	+	Silent	SNP	G	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:71876517G>A	uc010qjg.1	-	6	643	c.630C>T	c.(628-630)AGC>AGT	p.S210S	AIFM2_uc001jqp.1_Silent_p.S210S	NM_032797	NP_116186	Q9BRQ8	AIFM2_HUMAN	apoptosis-inducing factor (AIF)-like	210					apoptotic mitochondrial changes|chromosome condensation|induction of apoptosis	cytosol|integral to membrane|mitochondrial outer membrane	DNA binding|electron-transferring-flavoprotein dehydrogenase activity|flavin adenine dinucleotide binding			central_nervous_system(1)	1																OREG0020234	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
KIAA0913	23053	broad.mit.edu	37	10	75549954	75549954	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75549954C>T	uc009xrl.2	+	7	877	c.845C>T	c.(844-846)TCG>TTG	p.S282L	KIAA0913_uc001jve.2_Missense_Mutation_p.S282L|KIAA0913_uc001jvf.2_Missense_Mutation_p.S282L|KIAA0913_uc001jvh.2_5'Flank|KIAA0913_uc001jvi.2_5'Flank|KIAA0913_uc010qkr.1_5'Flank|KIAA0913_uc001jvj.2_5'Flank	NM_015037	NP_055852	A7E2V4	K0913_HUMAN	hypothetical protein LOC23053	282							zinc ion binding			breast(1)	1	Prostate(51;0.0112)																	---	---	---	---
GRID1	2894	broad.mit.edu	37	10	87484277	87484277	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:87484277C>A	uc001kdl.1	-	11	1791	c.1690G>T	c.(1690-1692)GCT>TCT	p.A564S	GRID1_uc009xsu.1_RNA|GRID1_uc010qmf.1_Missense_Mutation_p.A135S	NM_017551	NP_060021	Q9ULK0	GRID1_HUMAN	glutamate receptor, ionotropic, delta 1	564	Helical; (Potential).					cell junction|integral to membrane|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|ionotropic glutamate receptor activity			ovary(5)|upper_aerodigestive_tract(2)|large_intestine(2)|central_nervous_system(1)	10					L-Glutamic Acid(DB00142)										Multiple Myeloma(13;0.14)			---	---	---	---
IFIT3	3437	broad.mit.edu	37	10	91099742	91099742	+	Missense_Mutation	SNP	C	T	T	rs113402097		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:91099742C>T	uc001kgf.2	+	2	1559	c.1330C>T	c.(1330-1332)CGC>TGC	p.R444C	LIPA_uc001kgb.3_Intron|LIPA_uc001kgc.3_Intron|uc001kgd.2_Intron|IFIT3_uc001kgg.2_Missense_Mutation_p.R444C	NM_001549	NP_001540	O14879	IFIT3_HUMAN	interferon-induced protein with	444	TPR 7.				type I interferon-mediated signaling pathway		protein binding			central_nervous_system(1)	1																		---	---	---	---
C10orf12	26148	broad.mit.edu	37	10	98741419	98741419	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:98741419G>T	uc001kmv.2	+	1	379	c.272G>T	c.(271-273)AGA>ATA	p.R91I	C10orf12_uc009xvg.1_Missense_Mutation_p.R401I	NM_015652	NP_056467	Q8N655	CJ012_HUMAN	hypothetical protein LOC26148	91										skin(2)	2		Colorectal(252;0.172)		Epithelial(162;6.35e-09)|all cancers(201;3.21e-07)														---	---	---	---
RRP12	23223	broad.mit.edu	37	10	99140565	99140565	+	Silent	SNP	C	G	G			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:99140565C>G	uc001knf.2	-	13	1663	c.1524G>C	c.(1522-1524)GTG>GTC	p.V508V	RRP12_uc009xvm.2_Silent_p.V226V|RRP12_uc010qou.1_Silent_p.V447V|RRP12_uc009xvn.2_Silent_p.V408V	NM_015179	NP_055994	Q5JTH9	RRP12_HUMAN	ribosomal RNA processing 12 homolog isoform 1	508						integral to membrane|nuclear membrane|nucleolus	protein binding			ovary(2)|central_nervous_system(1)	3		Colorectal(252;0.162)		Epithelial(162;2.72e-09)|all cancers(201;1.76e-07)														---	---	---	---
HABP2	3026	broad.mit.edu	37	10	115340345	115340345	+	Intron	SNP	G	C	C			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:115340345G>C	uc001lai.3	+						HABP2_uc010qrz.1_Intron	NM_004132	NP_004123			hyaluronan binding protein 2 preproprotein						cell adhesion|proteolysis	extracellular space	glycosaminoglycan binding|serine-type endopeptidase activity			ovary(2)|skin(1)	3		Colorectal(252;0.0233)|Breast(234;0.0672)		Epithelial(162;0.00319)|all cancers(201;0.0112)														---	---	---	---
C10orf81	79949	broad.mit.edu	37	10	115534093	115534093	+	Splice_Site	SNP	G	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:115534093G>A	uc001lat.1	+	8	1323	c.761_splice	c.e8+1	p.Y254_splice	C10orf81_uc001lar.1_Splice_Site_p.Y260_splice|C10orf81_uc009xyc.1_Splice_Site_p.Y172_splice|C10orf81_uc001las.1_Splice_Site_p.Y172_splice|C10orf81_uc001lau.1_Splice_Site_p.Y74_splice	NM_024889	NP_079165			hypothetical protein LOC79949											central_nervous_system(1)	1		Colorectal(252;0.175)		Epithelial(162;0.0181)|all cancers(201;0.0204)														---	---	---	---
OR51B4	79339	broad.mit.edu	37	11	5323107	5323107	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5323107G>A	uc010qza.1	-	1	70	c.70C>T	c.(70-72)CGG>TGG	p.R24W	HBG2_uc001mak.1_Intron|HBE1_uc001mam.1_Intron	NM_033179	NP_149419	Q9Y5P0	O51B4_HUMAN	olfactory receptor, family 51, subfamily B,	24	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			pancreas(1)|skin(1)	2		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;2.76e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)												OREG0003718	type=REGULATORY REGION|Gene=OR51B4|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	---	---	---	---
OR51I2	390064	broad.mit.edu	37	11	5475083	5475083	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5475083G>T	uc010qzf.1	+	1	365	c.365G>T	c.(364-366)CGC>CTC	p.R122L	HBG2_uc001mak.1_Intron|HBE1_uc001mam.1_Intron|OR51B5_uc001maq.1_Intron	NM_001004754	NP_001004754	Q9H344	O51I2_HUMAN	olfactory receptor, family 51, subfamily I,	122	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(2)	4		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;1.09e-10)|BRCA - Breast invasive adenocarcinoma(625;0.135)														---	---	---	---
OR6A2	8590	broad.mit.edu	37	11	6816879	6816879	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6816879G>C	uc001mes.1	-	1	261	c.61C>G	c.(61-63)CCT>GCT	p.P21A		NM_003696	NP_003687	O95222	OR6A2_HUMAN	olfactory receptor, family 6, subfamily A,	21	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(3)|central_nervous_system(1)|pancreas(1)	5		Medulloblastoma(188;0.0523)|all_neural(188;0.236)		Epithelial(150;4.78e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)														---	---	---	---
SOX6	55553	broad.mit.edu	37	11	16007941	16007941	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:16007941G>C	uc001mme.2	-	15	2064	c.2031C>G	c.(2029-2031)AAC>AAG	p.N677K	SOX6_uc001mmd.2_Missense_Mutation_p.N640K|SOX6_uc001mmf.2_Missense_Mutation_p.N637K|SOX6_uc001mmg.2_Missense_Mutation_p.N644K	NM_001145819	NP_001139291	P35712	SOX6_HUMAN	SRY (sex determining region Y)-box 6 isoform 4	664	HMG box.				muscle organ development	nucleus	sequence-specific DNA binding transcription factor activity			ovary(3)	3																		---	---	---	---
MUC15	143662	broad.mit.edu	37	11	26587411	26587411	+	5'UTR	SNP	G	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:26587411G>T	uc001mqx.2	-	2					ANO3_uc010rdr.1_Intron|ANO3_uc001mqt.3_Intron|ANO3_uc010rds.1_Intron|ANO3_uc010rdt.1_Intron|MUC15_uc001mqw.2_Missense_Mutation_p.P26T|MUC15_uc001mqy.2_Missense_Mutation_p.P26T	NM_145650	NP_663625			mucin 15 isoform b							extracellular region|integral to membrane|plasma membrane				ovary(1)|central_nervous_system(1)|pancreas(1)	3																		---	---	---	---
ELP4	26610	broad.mit.edu	37	11	31784988	31784988	+	Intron	SNP	G	C	C			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:31784988G>C	uc001mtb.2	+						ELP4_uc001mtc.2_Missense_Mutation_p.E488Q|ELP4_uc010rdz.1_Missense_Mutation_p.E392D	NM_019040	NP_061913			elongation protein 4 homolog						histone acetylation|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|DNA-directed RNA polymerase II, holoenzyme|Elongator holoenzyme complex|transcription elongation factor complex	phosphorylase kinase regulator activity|protein binding			upper_aerodigestive_tract(1)|ovary(1)|prostate(1)	3	Lung SC(675;0.225)																	---	---	---	---
DEPDC7	91614	broad.mit.edu	37	11	33053076	33053076	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:33053076G>C	uc001mub.2	+	5	1027	c.935G>C	c.(934-936)AGT>ACT	p.S312T	DEPDC7_uc001muc.2_Missense_Mutation_p.S303T	NM_001077242	NP_001070710	Q96QD5	DEPD7_HUMAN	novel 58.3 KDA protein isoform 1	312					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity			ovary(1)|skin(1)	2																		---	---	---	---
SPTBN2	6712	broad.mit.edu	37	11	66460149	66460149	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66460149G>A	uc001ojd.2	-	25	5120	c.5048C>T	c.(5047-5049)GCT>GTT	p.A1683V		NM_006946	NP_008877	O15020	SPTN2_HUMAN	spectrin, beta, non-erythrocytic 2	1683	Spectrin 13.				actin filament capping|axon guidance|cell death|vesicle-mediated transport	cytosol|spectrin	actin binding|structural constituent of cytoskeleton			large_intestine(1)|pancreas(1)|central_nervous_system(1)|skin(1)	4																		---	---	---	---
NDUFV1	4723	broad.mit.edu	37	11	67376203	67376203	+	Intron	SNP	T	G	G			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67376203T>G	uc001omj.2	+						uc001omi.1_5'Flank|NDUFV1_uc010rpv.1_Intron|NDUFV1_uc001oml.2_Intron|NDUFV1_uc001omk.3_Intron|NDUFV1_uc009yrz.1_Intron|NDUFV1_uc010rpw.1_5'Flank	NM_007103	NP_009034			NADH dehydrogenase ubiquinone flavoprotein 1						mitochondrial electron transport, NADH to ubiquinone|transport	mitochondrial respiratory chain complex I	4 iron, 4 sulfur cluster binding|FMN binding|metal ion binding|NAD binding|NADH dehydrogenase (ubiquinone) activity			skin(1)	1					NADH(DB00157)													---	---	---	---
KCNJ1	3758	broad.mit.edu	37	11	128709348	128709348	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:128709348G>A	uc001qeo.1	-	2	899	c.848C>T	c.(847-849)GCG>GTG	p.A283V	KCNJ1_uc001qep.1_Missense_Mutation_p.A264V|KCNJ1_uc001qeq.1_Missense_Mutation_p.A264V|KCNJ1_uc001qer.1_Missense_Mutation_p.A264V|KCNJ1_uc001qes.1_Missense_Mutation_p.A264V	NM_000220	NP_000211	P48048	IRK1_HUMAN	potassium inwardly-rectifying channel J1 isoform	283	Cytoplasmic (By similarity).				excretion	voltage-gated potassium channel complex	ATP binding|inward rectifier potassium channel activity			ovary(3)|breast(1)	4	all_hematologic(175;0.0641)	all_lung(97;4.89e-06)|Lung NSC(97;9.34e-06)|Breast(109;0.00123)|all_hematologic(192;0.00793)|Renal(330;0.0112)|all_neural(223;0.0189)|Medulloblastoma(222;0.0425)		OV - Ovarian serous cystadenocarcinoma(99;4.05e-06)|LUSC - Lung squamous cell carcinoma(976;0.008)|Lung(977;0.00942)	Acetohexamide(DB00414)|Chlorpropamide(DB00672)|Glibenclamide(DB01016)|Gliclazide(DB01120)|Glimepiride(DB00222)|Glipizide(DB01067)|Glycodiazine(DB01382)|Minoxidil(DB00350)|Nateglinide(DB00731)|Repaglinide(DB00912)|Tolazamide(DB00839)|Tolbutamide(DB01124)													---	---	---	---
WNK1	65125	broad.mit.edu	37	12	922912	922912	+	Missense_Mutation	SNP	A	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:922912A>T	uc001qio.3	+	2	1371	c.864A>T	c.(862-864)GAA>GAT	p.E288D	WNK1_uc001qin.2_Missense_Mutation_p.E288D|WNK1_uc001qip.3_Missense_Mutation_p.E288D	NM_018979	NP_061852	Q9H4A3	WNK1_HUMAN	WNK lysine deficient protein kinase 1	288	Protein kinase.				intracellular protein kinase cascade|ion transport|neuron development	cytoplasm	ATP binding|protein binding|protein kinase inhibitor activity|protein serine/threonine kinase activity			stomach(6)|breast(6)|ovary(5)|lung(4)|large_intestine(1)|central_nervous_system(1)	23	all_cancers(10;0.00611)|all_epithelial(11;0.00825)|all_lung(10;0.0331)|Ovarian(42;0.0512)|Lung NSC(10;0.0632)		Epithelial(1;1.74e-08)|all cancers(1;7.04e-08)|OV - Ovarian serous cystadenocarcinoma(31;0.000423)|BRCA - Breast invasive adenocarcinoma(9;0.0149)|Colorectal(1;0.0197)															---	---	---	---
WNK1	65125	broad.mit.edu	37	12	989017	989017	+	Silent	SNP	G	T	T	rs142528714		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:989017G>T	uc001qio.3	+	11	3159	c.2652G>T	c.(2650-2652)GCG>GCT	p.A884A	WNK1_uc001qip.3_Intron|WNK1_uc001qir.3_Intron	NM_018979	NP_061852	Q9H4A3	WNK1_HUMAN	WNK lysine deficient protein kinase 1	884					intracellular protein kinase cascade|ion transport|neuron development	cytoplasm	ATP binding|protein binding|protein kinase inhibitor activity|protein serine/threonine kinase activity			stomach(6)|breast(6)|ovary(5)|lung(4)|large_intestine(1)|central_nervous_system(1)	23	all_cancers(10;0.00611)|all_epithelial(11;0.00825)|all_lung(10;0.0331)|Ovarian(42;0.0512)|Lung NSC(10;0.0632)		Epithelial(1;1.74e-08)|all cancers(1;7.04e-08)|OV - Ovarian serous cystadenocarcinoma(31;0.000423)|BRCA - Breast invasive adenocarcinoma(9;0.0149)|Colorectal(1;0.0197)															---	---	---	---
FAM90A1	55138	broad.mit.edu	37	12	8377389	8377389	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:8377389G>T	uc001qui.2	-	4	599	c.40C>A	c.(40-42)CTG>ATG	p.L14M	FAM90A1_uc001quh.2_Missense_Mutation_p.L14M	NM_018088	NP_060558	Q86YD7	F90A1_HUMAN	hypothetical protein LOC55138	14							nucleic acid binding|zinc ion binding			ovary(1)	1				Kidney(36;0.0866)														---	---	---	---
A2M	2	broad.mit.edu	37	12	9227252	9227252	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9227252C>A	uc001qvk.1	-	29	3773	c.3660G>T	c.(3658-3660)CAG>CAT	p.Q1220H	A2M_uc001qvj.1_Missense_Mutation_p.Q262H|A2M_uc009zgk.1_Missense_Mutation_p.Q1070H	NM_000014	NP_000005	P01023	A2MG_HUMAN	alpha-2-macroglobulin precursor	1220					blood coagulation, intrinsic pathway|negative regulation of complement activation, lectin pathway|platelet activation|platelet degranulation|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|extracellular space|platelet alpha granule lumen	enzyme binding|GTPase activator activity|interleukin-1 binding|interleukin-8 binding|serine-type endopeptidase inhibitor activity|tumor necrosis factor binding			central_nervous_system(4)|skin(1)	5					Bacitracin(DB00626)|Becaplermin(DB00102)													---	---	---	---
TAS2R7	50837	broad.mit.edu	37	12	10954694	10954694	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:10954694C>A	uc001qyv.2	-	1	533	c.476G>T	c.(475-477)TGT>TTT	p.C159F		NM_023919	NP_076408	Q9NYW3	TA2R7_HUMAN	taste receptor, type 2, member 7	159	Extracellular (Potential).				sensory perception of taste	integral to membrane	taste receptor activity			skin(1)	1																		---	---	---	---
GUCY2C	2984	broad.mit.edu	37	12	14804400	14804400	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:14804400C>A	uc001rcd.2	-	15	1788	c.1651G>T	c.(1651-1653)GTG>TTG	p.V551L		NM_004963	NP_004954	P25092	GUC2C_HUMAN	guanylate cyclase 2C precursor	551	Cytoplasmic (Potential).|Protein kinase.				intracellular signal transduction|receptor guanylyl cyclase signaling pathway	integral to membrane	ATP binding|GTP binding|guanylate cyclase activity|protein binding|protein kinase activity|receptor activity			ovary(4)|skin(2)	6																		---	---	---	---
PLEKHA9	51054	broad.mit.edu	37	12	45567963	45567963	+	Silent	SNP	G	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:45567963G>A	uc001rom.1	-	3	723	c.186C>T	c.(184-186)ACC>ACT	p.T62T	PLEKHA9_uc009zke.2_Silent_p.T62T	NM_015899	NP_056983			pleckstrin homology domain containing, family A												0	Lung SC(27;0.192)|Renal(347;0.236)			GBM - Glioblastoma multiforme(48;0.173)														---	---	---	---
SLC4A8	9498	broad.mit.edu	37	12	51857462	51857462	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51857462G>T	uc001rys.1	+	11	1491	c.1313G>T	c.(1312-1314)GGG>GTG	p.G438V	SLC4A8_uc010sni.1_Missense_Mutation_p.G385V|SLC4A8_uc001rym.2_Missense_Mutation_p.G385V|SLC4A8_uc001ryn.2_Missense_Mutation_p.G385V|SLC4A8_uc001ryo.2_Missense_Mutation_p.G385V|SLC4A8_uc010snj.1_Missense_Mutation_p.G465V|SLC4A8_uc001ryq.3_Missense_Mutation_p.G438V|SLC4A8_uc001ryr.2_Missense_Mutation_p.G438V|SLC4A8_uc010snk.1_Missense_Mutation_p.G385V	NM_001039960	NP_001035049	Q2Y0W8	S4A8_HUMAN	solute carrier family 4, sodium bicarbonate	438	Extracellular (Potential).				bicarbonate transport|sodium ion transport	integral to membrane|plasma membrane	inorganic anion exchanger activity			ovary(3)|pancreas(1)|skin(1)	5				BRCA - Breast invasive adenocarcinoma(357;0.15)														---	---	---	---
KRT2	3849	broad.mit.edu	37	12	53040566	53040566	+	Missense_Mutation	SNP	T	A	A	rs60537449		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53040566T>A	uc001sat.2	-	7	1460	c.1427A>T	c.(1426-1428)GAG>GTG	p.E476V		NM_000423	NP_000414	P35908	K22E_HUMAN	keratin 2	476	Coil 2.|Rod.				keratinization|keratinocyte activation|keratinocyte migration|keratinocyte proliferation	Golgi apparatus|keratin filament	protein binding|structural constituent of cytoskeleton			ovary(2)	2				BRCA - Breast invasive adenocarcinoma(357;0.19)														---	---	---	---
KRT79	338785	broad.mit.edu	37	12	53225213	53225213	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53225213G>T	uc001sbb.2	-	2	708	c.675C>A	c.(673-675)GAC>GAA	p.D225E	KRT79_uc001sba.2_5'Flank	NM_175834	NP_787028	Q5XKE5	K2C79_HUMAN	keratin 6L	225	Rod.|Coil 1B.					keratin filament	structural molecule activity			ovary(2)|skin(2)	4																		---	---	---	---
LRIG3	121227	broad.mit.edu	37	12	59279648	59279648	+	Silent	SNP	T	C	C			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:59279648T>C	uc001sqr.2	-	10	1455	c.1209A>G	c.(1207-1209)AAA>AAG	p.K403K	LRIG3_uc009zqh.2_Silent_p.K343K|LRIG3_uc010ssh.1_RNA	NM_153377	NP_700356	Q6UXM1	LRIG3_HUMAN	leucine-rich repeats and immunoglobulin-like	403	LRR 14.					integral to membrane				skin(3)|ovary(1)	4			GBM - Glioblastoma multiforme(1;1.17e-18)															---	---	---	---
MDM2	4193	broad.mit.edu	37	12	69233639	69233639	+	3'UTR	SNP	C	G	G			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:69233639C>G	uc001sui.2	+	11					MDM2_uc009zri.2_3'UTR|MDM2_uc009zqx.2_3'UTR|MDM2_uc009zqw.2_3'UTR|MDM2_uc001suk.2_Missense_Mutation_p.S97C|MDM2_uc001sun.3_3'UTR|MDM2_uc009zqz.2_3'UTR|MDM2_uc009zra.2_3'UTR|MDM2_uc009zrd.2_3'UTR|MDM2_uc009zrc.2_3'UTR|MDM2_uc009zre.2_3'UTR|MDM2_uc009zrf.2_3'UTR|MDM2_uc001suo.2_3'UTR|MDM2_uc009zrg.2_3'UTR|MDM2_uc009zrh.2_3'UTR	NM_002392	NP_002383			mouse double minute 2 homolog isoform MDM2						cellular response to hypoxia|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|establishment of protein localization|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell cycle arrest|negative regulation of DNA damage response, signal transduction by p53 class mediator|negative regulation of transcription from RNA polymerase II promoter|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of cell proliferation|positive regulation of mitotic cell cycle|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|protein complex assembly|protein destabilization|protein localization to nucleus|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|response to antibiotic|synaptic transmission	cytosol|endocytic vesicle membrane|insoluble fraction|nucleolus|nucleoplasm|plasma membrane|protein complex	enzyme binding|identical protein binding|p53 binding|ubiquitin-protein ligase activity|zinc ion binding			lung(2)|central_nervous_system(1)	3	all_cancers(1;8.46e-121)|all_epithelial(5;3.21e-36)|Lung NSC(4;2.16e-33)|all_lung(4;3.03e-31)|Glioma(1;1.9e-09)|Breast(13;1.59e-06)|all_neural(1;1.03e-05)|Melanoma(1;0.0171)|Renal(347;0.0684)		all cancers(2;8.67e-65)|GBM - Glioblastoma multiforme(2;8.89e-62)|BRCA - Breast invasive adenocarcinoma(5;2.43e-08)|Lung(24;1.5e-05)|LUAD - Lung adenocarcinoma(15;8.5e-05)|STAD - Stomach adenocarcinoma(21;0.00372)|Kidney(9;0.143)					A		sarcoma|glioma|colorectal|other								---	---	---	---
BEST3	144453	broad.mit.edu	37	12	70091576	70091576	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:70091576C>T	uc001svg.2	-	2	230	c.3G>A	c.(1-3)ATG>ATA	p.M1I	BEST3_uc001svd.1_Missense_Mutation_p.M1I|BEST3_uc001sve.1_Intron|BEST3_uc010stm.1_Intron|BEST3_uc001svh.2_Intron|BEST3_uc001svi.1_Intron	NM_032735	NP_116124	Q8N1M1	BEST3_HUMAN	vitelliform macular dystrophy 2-like 3 isoform	1	Cytoplasmic (Potential).					chloride channel complex|plasma membrane	chloride channel activity				0	Breast(13;2.31e-06)|Esophageal squamous(21;0.187)		Lung(24;0.000278)|OV - Ovarian serous cystadenocarcinoma(12;0.0019)|STAD - Stomach adenocarcinoma(21;0.00694)															---	---	---	---
NAV3	89795	broad.mit.edu	37	12	78582112	78582112	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:78582112C>T	uc001syp.2	+	32	6048	c.5875C>T	c.(5875-5877)CGT>TGT	p.R1959C	NAV3_uc001syo.2_Missense_Mutation_p.R1937C|NAV3_uc010sub.1_Missense_Mutation_p.R1416C|NAV3_uc009zsf.2_Missense_Mutation_p.R768C	NM_014903	NP_055718	Q8IVL0	NAV3_HUMAN	neuron navigator 3	1959						nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity	p.R1937C(1)		large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17															HNSCC(70;0.22)			---	---	---	---
BTBD11	121551	broad.mit.edu	37	12	108004005	108004005	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:108004005C>T	uc001tmk.1	+	5	2203	c.1682C>T	c.(1681-1683)GCG>GTG	p.A561V	BTBD11_uc009zut.1_Missense_Mutation_p.A561V|BTBD11_uc001tmj.2_Missense_Mutation_p.A561V|BTBD11_uc001tml.1_Missense_Mutation_p.A98V	NM_001018072	NP_001018082	A6QL63	BTBDB_HUMAN	BTB (POZ) domain containing 11 isoform a	561						integral to membrane	DNA binding			skin(2)|ovary(1)	3																OREG0022090	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
KNTC1	9735	broad.mit.edu	37	12	123060182	123060182	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123060182G>T	uc001ucv.2	+	28	2638	c.2475G>T	c.(2473-2475)ATG>ATT	p.M825I	KNTC1_uc010taf.1_Intron	NM_014708	NP_055523	P50748	KNTC1_HUMAN	Rough Deal homolog, centromere/kinetochore	825					cell division|mitotic cell cycle checkpoint|mitotic prometaphase|protein complex assembly|regulation of exit from mitosis	condensed chromosome kinetochore|cytosol|kinetochore microtubule|nucleus|spindle pole	protein binding			ovary(5)|kidney(3)|lung(1)|central_nervous_system(1)	10	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.21e-05)|Epithelial(86;0.000178)|BRCA - Breast invasive adenocarcinoma(302;0.217)														---	---	---	---
NCOR2	9612	broad.mit.edu	37	12	124862804	124862804	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124862804C>G	uc010tba.1	-	18	2263	c.2146G>C	c.(2146-2148)GAG>CAG	p.E716Q	NCOR2_uc010tay.1_Missense_Mutation_p.E716Q|NCOR2_uc010taz.1_Missense_Mutation_p.E716Q|NCOR2_uc010tbb.1_Missense_Mutation_p.E716Q|NCOR2_uc010tbc.1_Missense_Mutation_p.E715Q|NCOR2_uc001ugj.1_Missense_Mutation_p.E716Q	NM_001077261	NP_001070729	Q9Y618	NCOR2_HUMAN	nuclear receptor co-repressor 2 isoform 2	716					cellular lipid metabolic process|negative regulation of transcription from RNA polymerase II promoter|regulation of cellular ketone metabolic process by negative regulation of transcription from an RNA polymerase II promoter|transcription, DNA-dependent	nuclear body|nucleus|transcriptional repressor complex	DNA binding|histone deacetylase binding|Notch binding|protein N-terminus binding|transcription corepressor activity			skin(3)|ovary(1)	4	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)														---	---	---	---
RASL11A	387496	broad.mit.edu	37	13	27847365	27847365	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:27847365C>T	uc001urd.1	+	4	1081	c.463C>T	c.(463-465)CGG>TGG	p.R155W		NM_206827	NP_996563	Q6T310	RSLBA_HUMAN	RAS-like, family 11, member A	155	Small GTPase-like.				positive regulation of transcription from RNA polymerase I promoter|small GTPase mediated signal transduction|transcription, DNA-dependent	membrane|nucleolus	GTP binding|GTPase activity			breast(1)	1		Lung SC(185;0.0161)	Colorectal(13;0.00042)|READ - Rectum adenocarcinoma(15;0.105)	all cancers(112;0.0173)|GBM - Glioblastoma multiforme(144;0.0557)|OV - Ovarian serous cystadenocarcinoma(117;0.152)|Epithelial(112;0.164)														---	---	---	---
B3GALTL	145173	broad.mit.edu	37	13	31898019	31898019	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:31898019C>G	uc010aaz.2	+	14	1426	c.1316C>G	c.(1315-1317)CCT>CGT	p.P439R	B3GALTL_uc001utn.3_RNA|B3GALTL_uc001uto.3_Missense_Mutation_p.P44R	NM_194318	NP_919299	Q6Y288	B3GLT_HUMAN	beta 1,3-galactosyltransferase-like	439	Lumenal (Potential).				fucose metabolic process	endoplasmic reticulum membrane|integral to membrane	transferase activity, transferring glycosyl groups			ovary(2)	2		Lung SC(185;0.0257)		all cancers(112;0.00436)|Epithelial(112;0.0285)|OV - Ovarian serous cystadenocarcinoma(117;0.0512)|GBM - Glioblastoma multiforme(144;0.184)														---	---	---	---
ENOX1	55068	broad.mit.edu	37	13	43986166	43986166	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:43986166C>G	uc001uza.3	-	5	394	c.94G>C	c.(94-96)GCG>CCG	p.A32P	ENOX1_uc001uzb.3_Missense_Mutation_p.A32P|ENOX1_uc001uzc.3_Missense_Mutation_p.A32P	NM_001127615	NP_001121087	Q8TC92	ENOX1_HUMAN	ecto-NOX disulfide-thiol exchanger 1	32					electron transport chain|rhythmic process|transport	extracellular space|plasma membrane	nucleic acid binding|nucleotide binding|oxidoreductase activity			pancreas(1)|skin(1)	2		Lung NSC(96;0.000518)|Prostate(109;0.0233)|Hepatocellular(98;0.0268)|Lung SC(185;0.0367)|Breast(139;0.0406)		GBM - Glioblastoma multiforme(144;0.00333)|BRCA - Breast invasive adenocarcinoma(63;0.172)														---	---	---	---
CCDC122	160857	broad.mit.edu	37	13	44443470	44443470	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:44443470C>T	uc010acf.2	-	3	302	c.43G>A	c.(43-45)GAA>AAA	p.E15K	CCDC122_uc010tfn.1_Missense_Mutation_p.E15K	NM_144974	NP_659411	Q5T0U0	CC122_HUMAN	coiled-coil domain containing 122	15											0		Lung NSC(96;7.5e-06)|Breast(139;0.00765)|Hepatocellular(98;0.00826)|Prostate(109;0.0143)|Lung SC(185;0.0262)		GBM - Glioblastoma multiforme(144;0.000767)|BRCA - Breast invasive adenocarcinoma(63;0.128)														---	---	---	---
PIBF1	10464	broad.mit.edu	37	13	73547774	73547774	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:73547774A>C	uc001vjc.2	+	16	2315	c.2010A>C	c.(2008-2010)CAA>CAC	p.Q670H	PIBF1_uc001vjb.2_Missense_Mutation_p.Q670H|PIBF1_uc010aep.2_Missense_Mutation_p.Q129H	NM_006346	NP_006337	Q8WXW3	PIBF1_HUMAN	progesterone-induced blocking factor 1	670						centrosome				ovary(1)|breast(1)	2		Prostate(6;0.00191)|Breast(118;0.0736)|Acute lymphoblastic leukemia(28;0.0865)		GBM - Glioblastoma multiforme(99;0.000664)														---	---	---	---
EDNRB	1910	broad.mit.edu	37	13	78492668	78492668	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:78492668G>A	uc001vko.2	-	1	299	c.41C>T	c.(40-42)GCG>GTG	p.A14V	uc001vks.2_5'Flank|EDNRB_uc001vkq.1_Missense_Mutation_p.A14V|EDNRB_uc010aez.1_Missense_Mutation_p.A14V|EDNRB_uc001vkp.1_Missense_Mutation_p.A97V|EDNRB_uc010afa.1_Missense_Mutation_p.A14V	NM_001122659	NP_001116131	P24530	EDNRB_HUMAN	endothelin receptor type B isoform 1 precursor	14					activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|enteric nervous system development|enteric smooth muscle cell differentiation|macrophage chemotaxis|negative regulation of adenylate cyclase activity|negative regulation of cellular protein metabolic process|negative regulation of neuron maturation|negative regulation of transcription from RNA polymerase II promoter|vein smooth muscle contraction	integral to plasma membrane	endothelin-B receptor activity|peptide hormone binding				0		Acute lymphoblastic leukemia(28;0.0279)|Breast(118;0.037)		GBM - Glioblastoma multiforme(99;0.0933)	Bosentan(DB00559)											OREG0022452	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
EFNB2	1948	broad.mit.edu	37	13	107147295	107147295	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:107147295G>A	uc001vqi.2	-	4	572	c.547C>T	c.(547-549)CCA>TCA	p.P183S		NM_004093	NP_004084	P52799	EFNB2_HUMAN	ephrin B2 precursor	183	Extracellular (Potential).				cell differentiation|cell-cell signaling|interspecies interaction between organisms|nervous system development	integral to plasma membrane	ephrin receptor binding			ovary(1)	1	Lung NSC(43;0.015)|all_neural(89;0.0741)|Lung SC(71;0.14)|Medulloblastoma(90;0.169)																	---	---	---	---
ADPRHL1	113622	broad.mit.edu	37	13	114077206	114077206	+	Silent	SNP	G	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:114077206G>A	uc001vtq.1	-	7	1083	c.996C>T	c.(994-996)GAC>GAT	p.D332D	ADPRHL1_uc001vtp.1_Silent_p.D250D	NM_138430	NP_612439	Q8NDY3	ARHL1_HUMAN	ADP-ribosylhydrolase like 1 isoform 1	332					protein de-ADP-ribosylation		ADP-ribosylarginine hydrolase activity|magnesium ion binding				0	Lung NSC(43;0.0161)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0395)|all_epithelial(44;0.011)|all_lung(25;0.0271)|Lung NSC(25;0.0977)|Breast(118;0.188)	all cancers(43;0.0195)|GBM - Glioblastoma multiforme(44;0.116)															---	---	---	---
OR4N2	390429	broad.mit.edu	37	14	20295867	20295867	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20295867C>A	uc010tkv.1	+	1	260	c.260C>A	c.(259-261)TCT>TAT	p.S87Y		NM_001004723	NP_001004723	Q8NGD1	OR4N2_HUMAN	olfactory receptor, family 4, subfamily N,	87	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|central_nervous_system(1)|skin(1)	4	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)														---	---	---	---
MYH7	4625	broad.mit.edu	37	14	23884713	23884713	+	Silent	SNP	G	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23884713G>A	uc001wjx.2	-	36	5266	c.5160C>T	c.(5158-5160)AAC>AAT	p.N1720N		NM_000257	NP_000248	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta	1720	Potential.				adult heart development|muscle filament sliding|regulation of heart rate|ventricular cardiac muscle tissue morphogenesis	focal adhesion|muscle myosin complex|myosin filament|nucleus|sarcomere	actin binding|actin-dependent ATPase activity|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(3)|skin(1)	4	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)														---	---	---	---
SDR39U1	56948	broad.mit.edu	37	14	24911974	24911974	+	Missense_Mutation	SNP	A	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24911974A>T	uc001wpm.2	-	1	34	c.2T>A	c.(1-3)ATG>AAG	p.M1K	SDR39U1_uc001wpi.2_5'Flank|SDR39U1_uc001wpj.2_5'Flank|SDR39U1_uc001wpk.2_5'Flank|SDR39U1_uc001wpl.2_5'Flank|SDR39U1_uc001wpn.2_Intron|uc001wpo.1_5'Flank	NM_020195	NP_064580	Q9NRG7	D39U1_HUMAN	short chain dehydrogenase/reductase family 39U,	Error:Variant_position_missing_in_Q9NRG7_after_alignment							binding			pancreas(1)	1																		---	---	---	---
GZMH	2999	broad.mit.edu	37	14	25078787	25078787	+	Silent	SNP	A	C	C			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:25078787A>C	uc001wpr.1	-	1	78	c.33T>G	c.(31-33)CTT>CTG	p.L11L	GZMH_uc010aly.1_Silent_p.L11L|GZMH_uc010alz.1_Silent_p.L11L	NM_033423	NP_219491	P20718	GRAH_HUMAN	granzyme H precursor	11					apoptosis|cytolysis|proteolysis	cytoplasm	serine-type endopeptidase activity			ovary(1)|central_nervous_system(1)	2				GBM - Glioblastoma multiforme(265;0.0267)														---	---	---	---
NOVA1	4857	broad.mit.edu	37	14	26917367	26917367	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:26917367C>A	uc001wpy.2	-	5	1640	c.1322G>T	c.(1321-1323)GGG>GTG	p.G441V	NOVA1_uc001wpz.2_Missense_Mutation_p.G417V|NOVA1_uc001wqa.2_Missense_Mutation_p.G319V	NM_002515	NP_002506	P51513	NOVA1_HUMAN	neuro-oncological ventral antigen 1 isoform 1	444	KH 3.				locomotory behavior|RNA splicing|synaptic transmission	nucleus	RNA binding			skin(2)|upper_aerodigestive_tract(1)|breast(1)|liver(1)	5				GBM - Glioblastoma multiforme(265;0.0135)														---	---	---	---
RTN1	6252	broad.mit.edu	37	14	60069806	60069806	+	Silent	SNP	A	C	C			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:60069806A>C	uc001xen.1	-	8	2474	c.2265T>G	c.(2263-2265)ACT>ACG	p.T755T	RTN1_uc001xem.1_Silent_p.T335T|RTN1_uc001xek.1_Silent_p.T187T|RTN1_uc001xel.1_RNA|RTN1_uc010apl.1_Silent_p.T172T	NM_021136	NP_066959	Q16799	RTN1_HUMAN	reticulon 1 isoform A	755	Reticulon.				neuron differentiation	integral to endoplasmic reticulum membrane	signal transducer activity			ovary(2)|central_nervous_system(2)	4				OV - Ovarian serous cystadenocarcinoma(108;0.0968)														---	---	---	---
C14orf169	79697	broad.mit.edu	37	14	73959764	73959764	+	3'UTR	SNP	A	G	G	rs113528852		TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:73959764A>G	uc001xok.1	+	3					HEATR4_uc010tua.1_Intron	NM_024644	NP_078920			chromosome 14 open reading frame 169						negative regulation of osteoblast differentiation|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleolus|nucleoplasm	histone demethylase activity (H3-K36 specific)|histone demethylase activity (H3-K4 specific)|iron ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen				0				BRCA - Breast invasive adenocarcinoma(234;0.0033)|OV - Ovarian serous cystadenocarcinoma(108;0.215)														---	---	---	---
SMEK1	55671	broad.mit.edu	37	14	91927850	91927850	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:91927850G>C	uc001xzn.2	-	14	3088	c.2266C>G	c.(2266-2268)CTC>GTC	p.L756V	SMEK1_uc001xzm.2_Missense_Mutation_p.L743V|SMEK1_uc001xzo.2_Missense_Mutation_p.L743V|SMEK1_uc010atz.2_Missense_Mutation_p.L517V	NM_032560	NP_115949	Q6IN85	P4R3A_HUMAN	SMEK homolog 1, suppressor of mek1	756						microtubule organizing center|nucleus	protein binding				0		all_cancers(154;0.0691)|all_epithelial(191;0.219)		COAD - Colon adenocarcinoma(157;0.221)														---	---	---	---
SERPINA10	51156	broad.mit.edu	37	14	94756557	94756557	+	Missense_Mutation	SNP	T	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94756557T>A	uc001yct.2	-	2	840	c.374A>T	c.(373-375)AAG>ATG	p.K125M	SERPINA10_uc001ycu.3_Missense_Mutation_p.K125M	NM_016186	NP_057270	Q9UK55	ZPI_HUMAN	serine (or cysteine) proteinase inhibitor, clade	125					regulation of proteolysis	extracellular region	serine-type endopeptidase inhibitor activity			ovary(2)|skin(1)	3		all_cancers(154;0.105)		Epithelial(152;0.135)|COAD - Colon adenocarcinoma(157;0.207)|all cancers(159;0.221)														---	---	---	---
PACS2	23241	broad.mit.edu	37	14	105859631	105859631	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105859631G>C	uc001yqt.2	+	23	2685	c.2510G>C	c.(2509-2511)CGG>CCG	p.R837P	PACS2_uc001yqs.2_Missense_Mutation_p.R762P|PACS2_uc001yqv.2_Missense_Mutation_p.R841P|PACS2_uc001yqu.2_Missense_Mutation_p.R852P	NM_015197	NP_056012	Q86VP3	PACS2_HUMAN	phosphofurin acidic cluster sorting protein 2	837					apoptosis|interspecies interaction between organisms	endoplasmic reticulum lumen|mitochondrion				pancreas(1)	1		all_cancers(154;0.0351)|all_epithelial(191;0.153)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.0145)|Epithelial(46;0.036)	Epithelial(152;0.138)														---	---	---	---
GOLGA8E	390535	broad.mit.edu	37	15	23441160	23441160	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:23441160C>G	uc001yvu.2	+	10	1239	c.250C>G	c.(250-252)CAC>GAC	p.H84D		NM_001012423	NP_001012423			golgi autoantigen, golgin subfamily a, 8E											skin(1)	1		all_cancers(20;2.26e-25)|all_epithelial(15;2.1e-22)|Lung NSC(15;3.36e-17)|all_lung(15;1.04e-16)|Breast(32;0.000776)|Colorectal(260;0.0488)		all cancers(64;5.21e-07)|Epithelial(43;5.65e-06)|BRCA - Breast invasive adenocarcinoma(123;0.000614)														---	---	---	---
ATP10A	57194	broad.mit.edu	37	15	25924998	25924998	+	Silent	SNP	G	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25924998G>A	uc010ayu.2	-	21	4096	c.3990C>T	c.(3988-3990)CTC>CTT	p.L1330L		NM_024490	NP_077816	O60312	AT10A_HUMAN	ATPase, class V, type 10A	1330	Cytoplasmic (Potential).				ATP biosynthetic process|regulation of cell shape	integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			pancreas(2)|ovary(1)|breast(1)|liver(1)	5		all_cancers(20;5.16e-25)|all_lung(180;1.51e-14)|Acute lymphoblastic leukemia(1;2.53e-05)|all_hematologic(1;0.000267)|Breast(32;0.00125)		all cancers(64;9.48e-07)|Epithelial(43;1.69e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0252)|Lung(196;0.244)														---	---	---	---
RASGRP1	10125	broad.mit.edu	37	15	38808415	38808415	+	Missense_Mutation	SNP	A	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:38808415A>T	uc001zke.3	-	6	836	c.658T>A	c.(658-660)TCT>ACT	p.S220T	RASGRP1_uc010bbe.2_RNA|RASGRP1_uc010bbf.2_Missense_Mutation_p.S82T|RASGRP1_uc010bbg.2_Missense_Mutation_p.S82T|RASGRP1_uc001zkd.3_Missense_Mutation_p.S220T	NM_005739	NP_005730	O95267	GRP1_HUMAN	RAS guanyl releasing protein 1 isoform a	220	Ras-GEF.				cell differentiation|platelet activation|Ras protein signal transduction|regulation of small GTPase mediated signal transduction	cytosol|endoplasmic reticulum membrane|Golgi membrane|membrane fraction|plasma membrane	calcium ion binding|guanyl-nucleotide exchange factor activity|lipid binding|protein binding			large_intestine(1)|ovary(1)	2		all_cancers(109;6.38e-17)|all_epithelial(112;5.51e-15)|Lung NSC(122;2.12e-11)|all_lung(180;5.63e-10)|Melanoma(134;0.0574)		GBM - Glioblastoma multiforme(113;1.97e-07)|BRCA - Breast invasive adenocarcinoma(123;0.00248)														---	---	---	---
BUB1B	701	broad.mit.edu	37	15	40477511	40477511	+	Silent	SNP	C	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40477511C>A	uc001zkx.3	+	7	1109	c.897C>A	c.(895-897)CCC>CCA	p.P299P	BUB1B_uc010ucl.1_Silent_p.P162P	NM_001211	NP_001202	O60566	BUB1B_HUMAN	budding uninhibited by benzimidazoles 1 beta	299					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|cell division|cell proliferation|mitotic cell cycle spindle assembly checkpoint|mitotic prometaphase|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|phosphatidylinositol-mediated signaling|protein localization to kinetochore|spindle organization	anaphase-promoting complex|condensed chromosome outer kinetochore|cytosol|microtubule organizing center|perinuclear region of cytoplasm|spindle midzone	ATP binding|protein binding|protein serine/threonine kinase activity			stomach(2)|ovary(1)|kidney(1)	4		all_cancers(109;1.12e-18)|all_epithelial(112;1.61e-15)|Lung NSC(122;5.63e-11)|all_lung(180;1.4e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;1.83e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0556)				Mis|N|F|S			rhabdomyosarcoma			Mosaic_Variegated_Aneuploidy_Syndrome				---	---	---	---
FBN1	2200	broad.mit.edu	37	15	48808532	48808532	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:48808532G>A	uc001zwx.1	-	11	1503	c.1175C>T	c.(1174-1176)CCT>CTT	p.P392L		NM_000138	NP_000129	P35555	FBN1_HUMAN	fibrillin 1 precursor	392					heart development|negative regulation of BMP signaling pathway by extracellular sequestering of BMP|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|skeletal system development	basement membrane|extracellular space|microfibril	calcium ion binding|extracellular matrix structural constituent|protein binding			ovary(2)|large_intestine(1)	3		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)														---	---	---	---
DMXL2	23312	broad.mit.edu	37	15	51772201	51772201	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:51772201G>C	uc002abf.2	-	25	6925	c.6700C>G	c.(6700-6702)CTT>GTT	p.L2234V	DMXL2_uc002abd.2_Missense_Mutation_p.L304V|DMXL2_uc010ufy.1_Missense_Mutation_p.L2234V|DMXL2_uc010bfa.2_Missense_Mutation_p.L1598V	NM_015263	NP_056078	Q8TDJ6	DMXL2_HUMAN	Dmx-like 2	2234						cell junction|synaptic vesicle membrane	Rab GTPase binding			ovary(6)|skin(3)	9				all cancers(107;0.00494)														---	---	---	---
DMXL2	23312	broad.mit.edu	37	15	51790812	51790812	+	Missense_Mutation	SNP	A	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:51790812A>T	uc002abf.2	-	18	4834	c.4609T>A	c.(4609-4611)TTG>ATG	p.L1537M	DMXL2_uc010ufy.1_Missense_Mutation_p.L1537M|DMXL2_uc010bfa.2_Intron	NM_015263	NP_056078	Q8TDJ6	DMXL2_HUMAN	Dmx-like 2	1537						cell junction|synaptic vesicle membrane	Rab GTPase binding			ovary(6)|skin(3)	9				all cancers(107;0.00494)														---	---	---	---
RFX7	64864	broad.mit.edu	37	15	56388648	56388648	+	Silent	SNP	C	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:56388648C>T	uc010bfn.2	-	9	1278	c.1278G>A	c.(1276-1278)CGG>CGA	p.R426R	RFX7_uc010ugk.1_RNA|RFX7_uc002adn.1_Silent_p.R240R	NM_022841	NP_073752	Q2KHR2	RFX7_HUMAN	regulatory factor X domain containing 2	329					regulation of transcription, DNA-dependent	nucleus	DNA binding				0																		---	---	---	---
VPS13C	54832	broad.mit.edu	37	15	62352574	62352574	+	5'UTR	SNP	G	C	C			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:62352574G>C	uc002agz.2	-	1					VPS13C_uc002aha.2_5'UTR|VPS13C_uc002ahb.1_5'UTR|VPS13C_uc002ahc.1_5'UTR|uc002ahe.2_5'Flank	NM_020821	NP_065872			vacuolar protein sorting 13C protein isoform 2A						protein localization					ovary(2)	2																		---	---	---	---
IGDCC4	57722	broad.mit.edu	37	15	65684686	65684686	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65684686C>A	uc002aou.1	-	11	2118	c.1908G>T	c.(1906-1908)TTG>TTT	p.L636F	IGDCC4_uc002aot.1_Missense_Mutation_p.L224F	NM_020962	NP_066013	Q8TDY8	IGDC4_HUMAN	immunoglobulin superfamily, DCC subclass, member	636	Extracellular (Potential).|Fibronectin type-III 3.					integral to membrane|plasma membrane				ovary(1)|pancreas(1)|skin(1)	3																		---	---	---	---
ANP32A	8125	broad.mit.edu	37	15	69080154	69080154	+	Silent	SNP	G	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:69080154G>A	uc002arl.2	-	2	330	c.159C>T	c.(157-159)GGC>GGT	p.G53G		NM_006305	NP_006296	P39687	AN32A_HUMAN	acidic (leucine-rich) nuclear phosphoprotein 32	53	LRR 2.				intracellular signal transduction|mRNA metabolic process|nucleocytoplasmic transport|regulation of transcription, DNA-dependent|transcription, DNA-dependent	endoplasmic reticulum|nucleoplasm|perinuclear region of cytoplasm	protein binding				0																		---	---	---	---
PAQR5	54852	broad.mit.edu	37	15	69682011	69682011	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:69682011C>A	uc002arz.2	+	6	782	c.404C>A	c.(403-405)TCT>TAT	p.S135Y	PAQR5_uc002asa.2_Missense_Mutation_p.S135Y	NM_017705	NP_060175	Q9NXK6	MPRG_HUMAN	progestin and adipoQ receptor family member V	135	Extracellular (Potential).				cell differentiation|multicellular organismal development|oogenesis	integral to membrane	receptor activity|steroid binding			ovary(2)	2																		---	---	---	---
CSK	1445	broad.mit.edu	37	15	75091016	75091016	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:75091016C>T	uc010bkb.1	+	4	259	c.76C>T	c.(76-78)CAG>TAG	p.Q26*	CSK_uc010bka.2_Missense_Mutation_p.A96V|CSK_uc002ays.2_Nonsense_Mutation_p.Q26*|CSK_uc010bkc.1_5'Flank	NM_001127190	NP_001120662	P41240	CSK_HUMAN	c-src tyrosine kinase	26	Interaction with PTPN8 (By similarity).|SH3.				blood coagulation|epidermal growth factor receptor signaling pathway|T cell costimulation|T cell receptor signaling pathway	centrosome|cytosol|Golgi apparatus	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein C-terminus binding			lung(2)|central_nervous_system(1)	3																		---	---	---	---
SYNM	23336	broad.mit.edu	37	15	99670184	99670184	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:99670184A>G	uc002bup.2	+	6	1739	c.1619A>G	c.(1618-1620)GAA>GGA	p.E540G	SYNM_uc002buo.2_Missense_Mutation_p.E540G|SYNM_uc002buq.2_Intron	NM_145728	NP_663780	O15061	SYNEM_HUMAN	desmuslin isoform A	540	Tail.				intermediate filament cytoskeleton organization	adherens junction|costamere|intermediate filament|neurofilament cytoskeleton	intermediate filament binding|structural constituent of cytoskeleton|structural constituent of muscle|vinculin binding			ovary(3)|central_nervous_system(1)	4																		---	---	---	---
OR4F15	390649	broad.mit.edu	37	15	102359303	102359303	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:102359303T>C	uc010uts.1	+	1	914	c.914T>C	c.(913-915)CTT>CCT	p.L305P		NM_001001674	NP_001001674	Q8NGB8	O4F15_HUMAN	olfactory receptor, family 4, subfamily F,	305	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	Lung NSC(78;0.000991)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.00039)|Lung(145;0.17)|LUSC - Lung squamous cell carcinoma(107;0.187)															---	---	---	---
SRCAP	10847	broad.mit.edu	37	16	30747914	30747914	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30747914A>G	uc002dze.1	+	33	7362	c.6977A>G	c.(6976-6978)GAG>GGG	p.E2326G	SRCAP_uc002dzf.2_RNA|SRCAP_uc002dzg.1_Missense_Mutation_p.E2121G	NM_006662	NP_006653	Q6ZRS2	SRCAP_HUMAN	Snf2-related CBP activator protein	2326	Glu-rich.				interspecies interaction between organisms|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	Golgi apparatus|nucleus|protein complex	ATP binding|DNA binding|helicase activity|histone acetyltransferase activity|transcription coactivator activity			ovary(3)|skin(1)	4			Colorectal(24;0.198)															---	---	---	---
CHD9	80205	broad.mit.edu	37	16	53272298	53272298	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:53272298A>G	uc002ehb.2	+	11	2841	c.2677A>G	c.(2677-2679)ATT>GTT	p.I893V	CHD9_uc002egy.2_Missense_Mutation_p.I893V|CHD9_uc002eha.1_Missense_Mutation_p.I893V|CHD9_uc002ehc.2_Missense_Mutation_p.I893V|CHD9_uc002ehf.2_Missense_Mutation_p.I7V|CHD9_uc002ehd.2_Missense_Mutation_p.I419V|CHD9_uc002ehe.1_Missense_Mutation_p.I7V	NM_025134	NP_079410	Q3L8U1	CHD9_HUMAN	chromodomain helicase DNA binding protein 9	893	Helicase ATP-binding.				cellular lipid metabolic process|chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleoplasm	ATP binding|DNA binding|helicase activity|protein binding			lung(2)|central_nervous_system(1)|breast(1)|skin(1)|ovary(1)|kidney(1)	7		all_cancers(37;0.0212)																---	---	---	---
ATP6V0D1	9114	broad.mit.edu	37	16	67477017	67477017	+	Silent	SNP	G	C	C			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67477017G>C	uc002ete.1	-	4	646	c.546C>G	c.(544-546)CGC>CGG	p.R182R	ATP6V0D1_uc010vjo.1_Silent_p.R223R|ATP6V0D1_uc010vjn.1_Silent_p.R105R	NM_004691	NP_004682	P61421	VA0D1_HUMAN	ATPase, H+ transporting, lysosomal, V0 subunit	182					ATP hydrolysis coupled proton transport|cellular iron ion homeostasis|insulin receptor signaling pathway|transferrin transport	endosome membrane|proton-transporting V-type ATPase, V0 domain|vacuolar proton-transporting V-type ATPase complex					0		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0439)|Epithelial(162;0.101)														---	---	---	---
ACSF3	197322	broad.mit.edu	37	16	89187233	89187233	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89187233G>A	uc002fmp.2	+	7	1491	c.1151G>A	c.(1150-1152)GGA>GAA	p.G384E	ACSF3_uc010cig.1_Missense_Mutation_p.G384E|ACSF3_uc010cih.1_Missense_Mutation_p.G119E|ACSF3_uc002fmq.1_RNA|ACSF3_uc010cii.1_RNA|ACSF3_uc002fmr.1_Missense_Mutation_p.G119E	NM_174917	NP_777577	Q4G176	ACSF3_HUMAN	acyl-CoA synthetase family member 3 precursor	384					fatty acid metabolic process	mitochondrion	acid-thiol ligase activity|ATP binding				0				BRCA - Breast invasive adenocarcinoma(80;0.0281)														---	---	---	---
GAS8	2622	broad.mit.edu	37	16	90103775	90103775	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:90103775G>A	uc002fqi.1	+	7	1014	c.892G>A	c.(892-894)GCA>ACA	p.A298T	GAS8_uc010vps.1_Missense_Mutation_p.A273T|GAS8_uc002fqh.2_Missense_Mutation_p.A215T|GAS8_uc010vpt.1_3'UTR|GAS8_uc010vpu.1_3'UTR|GAS8_uc010vpv.1_Missense_Mutation_p.A269T|GAS8_uc010cjc.1_Missense_Mutation_p.A215T|GAS8_uc010vpw.1_Missense_Mutation_p.A215T|GAS8_uc002fqj.1_Missense_Mutation_p.A106T	NM_001481	NP_001472	O95995	GAS8_HUMAN	growth arrest-specific 8	298	Potential.				negative regulation of cell proliferation|sperm motility	cilium|Golgi apparatus|microtubule|microtubule basal body|microtubule-based flagellum	protein binding			ovary(1)	1		all_cancers(9;4.44e-13)|Lung NSC(15;1.56e-06)|all_lung(18;2.18e-06)|all_neural(9;0.00118)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.029)														---	---	---	---
PRPF8	10594	broad.mit.edu	37	17	1563726	1563726	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1563726C>A	uc002fte.2	-	30	4899	c.4785G>T	c.(4783-4785)CAG>CAT	p.Q1595H		NM_006445	NP_006436	Q6P2Q9	PRP8_HUMAN	U5 snRNP-specific protein	1595						catalytic step 2 spliceosome|nuclear speck|U5 snRNP	protein binding|RNA binding			lung(4)|ovary(2)	6				UCEC - Uterine corpus endometrioid carcinoma (25;0.0855)														---	---	---	---
DNAH2	146754	broad.mit.edu	37	17	7674725	7674725	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7674725G>A	uc002giu.1	+	27	4454	c.4440G>A	c.(4438-4440)TGG>TGA	p.W1480*		NM_020877	NP_065928	Q9P225	DYH2_HUMAN	dynein heavy chain domain 3	1480	Stem (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(6)|skin(6)|central_nervous_system(1)	13		all_cancers(10;4.66e-07)|Prostate(122;0.081)																---	---	---	---
ZNF287	57336	broad.mit.edu	37	17	16466545	16466545	+	Silent	SNP	T	C	C			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:16466545T>C	uc002gqi.2	-	5	1083	c.630A>G	c.(628-630)GGA>GGG	p.G210G		NM_020653	NP_065704	Q9HBT7	ZN287_HUMAN	zinc finger protein 287	203	KRAB.				viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0				UCEC - Uterine corpus endometrioid carcinoma (92;0.083)														---	---	---	---
TADA2A	6871	broad.mit.edu	37	17	35830563	35830563	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:35830563A>G	uc002hnt.2	+	13	1112	c.955A>G	c.(955-957)ATG>GTG	p.M319V	TADA2A_uc002hnv.2_Missense_Mutation_p.M319V|TADA2A_uc002hnw.2_Missense_Mutation_p.M218V|TADA2A_uc010cvb.2_Missense_Mutation_p.M115V	NM_001488	NP_001479	O75478	TAD2A_HUMAN	transcriptional adaptor 2A isoform a	319					histone H3 acetylation|transcription from RNA polymerase II promoter	chromosome|PCAF complex	DNA binding|sequence-specific DNA binding transcription factor activity|transcription cofactor activity|zinc ion binding			breast(3)|skin(1)	4																		---	---	---	---
KRT33A	3883	broad.mit.edu	37	17	39505636	39505636	+	Silent	SNP	G	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39505636G>A	uc002hwk.1	-	2	430	c.393C>T	c.(391-393)ATC>ATT	p.I131I		NM_004138	NP_004129	O76009	KT33A_HUMAN	keratin 33A	131	Rod.|Coil 1B.					intermediate filament	protein binding|structural molecule activity				0		Breast(137;0.000496)																---	---	---	---
KRT37	8688	broad.mit.edu	37	17	39579089	39579089	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39579089C>T	uc002hwp.1	-	3	720	c.673G>A	c.(673-675)GAG>AAG	p.E225K	uc002hwo.1_Intron	NM_003770	NP_003761	O76014	KRT37_HUMAN	keratin 37	225	Rod.|Coil 1B.					intermediate filament	structural molecule activity			skin(1)	1		Breast(137;0.000496)																---	---	---	---
NFE2L1	4779	broad.mit.edu	37	17	46128617	46128617	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46128617C>G	uc002imz.3	+	2	788	c.137C>G	c.(136-138)CCC>CGC	p.P46R	NFE2L1_uc002ina.3_Missense_Mutation_p.P46R|NFE2L1_uc002inb.3_Missense_Mutation_p.P46R|NFE2L1_uc002inc.1_Missense_Mutation_p.P46R	NM_003204	NP_003195	Q14494	NF2L1_HUMAN	nuclear factor erythroid 2-like 1	46					anatomical structure morphogenesis|heme biosynthetic process|inflammatory response|transcription from RNA polymerase II promoter	nucleus	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription cofactor activity			skin(1)	1																		---	---	---	---
HOXB3	3213	broad.mit.edu	37	17	46629484	46629484	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46629484C>A	uc002inn.2	-	1	753	c.353G>T	c.(352-354)GGT>GTT	p.G118V	HOXB3_uc010wlm.1_Missense_Mutation_p.G45V|HOXB3_uc010dbf.2_Missense_Mutation_p.G118V|HOXB3_uc010dbg.2_Missense_Mutation_p.G118V|HOXB3_uc002ino.2_Missense_Mutation_p.G118V|HOXB3_uc010wlk.1_Intron|HOXB3_uc010wll.1_Missense_Mutation_p.G45V	NM_002146	NP_002137	P14651	HXB3_HUMAN	homeobox B3	118					angiogenesis	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0																		---	---	---	---
B4GALNT2	124872	broad.mit.edu	37	17	47219490	47219490	+	Silent	SNP	G	C	C			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47219490G>C	uc002ion.2	+	3	548	c.489G>C	c.(487-489)GCG>GCC	p.A163A	B4GALNT2_uc010wlt.1_Silent_p.A77A|B4GALNT2_uc010wlu.1_Silent_p.A103A	NM_153446	NP_703147	Q8NHY0	B4GN2_HUMAN	beta-1,4-N-acetyl-galactosaminyl transferase 2	163	Lumenal (Potential).				lipid glycosylation|negative regulation of cell-cell adhesion|UDP-N-acetylgalactosamine metabolic process	integral to Golgi membrane	acetylgalactosaminyltransferase activity			large_intestine(1)|ovary(1)	2			all cancers(6;0.000316)															---	---	---	---
ABI3	51225	broad.mit.edu	37	17	47295217	47295217	+	Silent	SNP	G	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47295217G>A	uc002iop.1	+	3	900	c.402G>A	c.(400-402)ACG>ACA	p.T134T	ABI3_uc002ioq.1_Silent_p.T128T	NM_016428	NP_057512	Q9P2A4	ABI3_HUMAN	NESH protein isoform 1	134					cellular component movement|regulation of cell migration	cytoplasm|lamellipodium	protein binding				0			Epithelial(5;6.37e-06)|all cancers(6;6.36e-05)												HNSCC(55;0.14)			---	---	---	---
EVPL	2125	broad.mit.edu	37	17	74004900	74004900	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74004900C>A	uc002jqi.2	-	22	4614	c.4386G>T	c.(4384-4386)ATG>ATT	p.M1462I	EVPL_uc010wss.1_Missense_Mutation_p.M1484I|EVPL_uc010wst.1_Missense_Mutation_p.M932I	NM_001988	NP_001979	Q92817	EVPL_HUMAN	envoplakin	1462	Central fibrous rod domain.				keratinization|peptide cross-linking	cornified envelope|cytoplasm|desmosome	protein binding, bridging|structural molecule activity			pancreas(2)|central_nervous_system(1)|skin(1)	4																		---	---	---	---
DNAH17	8632	broad.mit.edu	37	17	76501424	76501424	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76501424T>C	uc010wtu.1	-	5	959	c.782A>G	c.(781-783)AAG>AGG	p.K261R						full-length cDNA clone CS0DJ002YI14 of T cells (Jurkat cell line) Cot 10-normalized of Homo sapiens (human).											ovary(6)|breast(2)|skin(1)	9			BRCA - Breast invasive adenocarcinoma(99;0.00294)|OV - Ovarian serous cystadenocarcinoma(97;0.0656)															---	---	---	---
TBC1D16	125058	broad.mit.edu	37	17	77921612	77921612	+	Silent	SNP	G	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:77921612G>A	uc002jxj.2	-	9	1676	c.1560C>T	c.(1558-1560)TAC>TAT	p.Y520Y	TBC1D16_uc002jxh.2_Silent_p.Y158Y|TBC1D16_uc002jxi.2_Silent_p.Y145Y|TBC1D16_uc002jxk.1_Silent_p.Y158Y	NM_019020	NP_061893	Q8TBP0	TBC16_HUMAN	TBC1 domain family, member 16	520	Rab-GAP TBC.					intracellular	Rab GTPase activator activity				0	all_neural(118;0.167)		OV - Ovarian serous cystadenocarcinoma(97;0.00739)|BRCA - Breast invasive adenocarcinoma(99;0.0819)															---	---	---	---
COLEC12	81035	broad.mit.edu	37	18	346782	346782	+	Silent	SNP	G	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:346782G>A	uc002kkm.2	-	5	1055	c.840C>T	c.(838-840)AAC>AAT	p.N280N		NM_130386	NP_569057	Q5KU26	COL12_HUMAN	collectin sub-family member 12	280	Potential.|Extracellular (Potential).				carbohydrate mediated signaling|innate immune response|phagocytosis, recognition|protein homooligomerization	collagen|integral to membrane	galactose binding|low-density lipoprotein particle binding|metal ion binding|pattern recognition receptor activity|scavenger receptor activity			ovary(1)|pancreas(1)	2		all_cancers(4;0.0442)|Myeloproliferative disorder(11;0.0426)																---	---	---	---
MYOM1	8736	broad.mit.edu	37	18	3134758	3134758	+	Silent	SNP	C	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:3134758C>T	uc002klp.2	-	16	2608	c.2274G>A	c.(2272-2274)TCG>TCA	p.S758S	MYOM1_uc002klq.2_Silent_p.S758S	NM_003803	NP_003794	P52179	MYOM1_HUMAN	myomesin 1 isoform a	758	Fibronectin type-III 3.					striated muscle myosin thick filament	structural constituent of muscle			ovary(3)|central_nervous_system(1)|pancreas(1)	5																		---	---	---	---
DLGAP1	9229	broad.mit.edu	37	18	3879883	3879883	+	Silent	SNP	G	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:3879883G>A	uc002kmf.2	-	1	253	c.186C>T	c.(184-186)AGC>AGT	p.S62S	DLGAP1_uc010wyz.1_Silent_p.S62S|DLGAP1_uc002kmk.2_Silent_p.S62S|uc002kml.1_Intron	NM_004746	NP_004737	O14490	DLGP1_HUMAN	discs large homolog-associated protein 1 isoform	62					synaptic transmission	cell junction|postsynaptic density|postsynaptic membrane				ovary(2)|pancreas(1)|skin(1)	4		Colorectal(8;0.0257)																---	---	---	---
FAM38B	63895	broad.mit.edu	37	18	10696150	10696150	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:10696150C>T	uc002kor.3	-	5	784	c.644G>A	c.(643-645)GGA>GAA	p.G215E	FAM38B_uc002koq.2_Missense_Mutation_p.G113E	NM_022068	NP_071351	Q9H5I5	PIEZ2_HUMAN	family with sequence similarity 38, member B	2258						integral to membrane	ion channel activity			ovary(1)	1																		---	---	---	---
CEP192	55125	broad.mit.edu	37	18	13040842	13040842	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:13040842A>G	uc010xac.1	+	14	1903	c.1823A>G	c.(1822-1824)TAT>TGT	p.Y608C	CEP192_uc010dlf.1_Intron|CEP192_uc010xad.1_Missense_Mutation_p.Y133C|CEP192_uc002kru.2_RNA|CEP192_uc002krs.1_Missense_Mutation_p.Y349C	NM_032142	NP_115518	E9PF99	E9PF99_HUMAN	centrosomal protein 192kDa	608										ovary(4)|pancreas(1)	5																		---	---	---	---
DSG1	1828	broad.mit.edu	37	18	28934840	28934840	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:28934840T>G	uc002kwp.2	+	15	2893	c.2681T>G	c.(2680-2682)GTG>GGG	p.V894G	DSG1_uc010xbp.1_Missense_Mutation_p.V253G	NM_001942	NP_001933	Q02413	DSG1_HUMAN	desmoglein 1 preproprotein	894	Cytoplasmic (Potential).|Desmoglein repeat 3.				calcium-dependent cell-cell adhesion|cell-cell junction assembly|cellular component disassembly involved in apoptosis|homophilic cell adhesion|protein stabilization	cytosol|desmosome|integral to membrane|internal side of plasma membrane	calcium ion binding|gamma-catenin binding|toxin binding			skin(3)|ovary(2)|central_nervous_system(2)	7			OV - Ovarian serous cystadenocarcinoma(10;0.00559)															---	---	---	---
DSG4	147409	broad.mit.edu	37	18	28989416	28989416	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:28989416G>T	uc002kwq.2	+	13	2070	c.1935G>T	c.(1933-1935)TTG>TTT	p.L645F	DSG4_uc002kwr.2_Missense_Mutation_p.L645F	NM_177986	NP_817123	Q86SJ6	DSG4_HUMAN	desmoglein 4 isoform 2 preproprotein	645	Helical; (Potential).				homophilic cell adhesion	desmosome|integral to membrane	calcium ion binding			central_nervous_system(5)|ovary(3)	8			OV - Ovarian serous cystadenocarcinoma(10;0.00504)															---	---	---	---
MCART2	147407	broad.mit.edu	37	18	29340618	29340618	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:29340618C>T	uc002kxa.2	-	1	226	c.7G>A	c.(7-9)GAT>AAT	p.D3N		NM_001034172	NP_001029344	Q3SY17	MCAR2_HUMAN	mitochondrial carrier triple repeat 2	3					transport	integral to membrane|mitochondrial inner membrane				skin(1)	1			OV - Ovarian serous cystadenocarcinoma(10;0.0539)															---	---	---	---
KIAA1468	57614	broad.mit.edu	37	18	59928806	59928806	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:59928806G>C	uc002lil.2	+	16	2480	c.2265G>C	c.(2263-2265)TTG>TTC	p.L755F	KIAA1468_uc002lik.1_Missense_Mutation_p.L755F|KIAA1468_uc010xel.1_Missense_Mutation_p.L755F|KIAA1468_uc002lim.2_Missense_Mutation_p.L399F	NM_020854	NP_065905	Q9P260	K1468_HUMAN	hypothetical protein LOC57614	755							binding			ovary(2)|breast(2)|upper_aerodigestive_tract(1)|large_intestine(1)	6		Colorectal(73;0.186)																---	---	---	---
MBD3L1	85509	broad.mit.edu	37	19	8953560	8953560	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8953560G>T	uc002mko.2	+	1	292	c.206G>T	c.(205-207)AGG>ATG	p.R69M		NM_145208	NP_660209	Q8WWY6	MB3L1_HUMAN	methyl-CpG binding domain protein 3-like	69	Transcription repressor.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus					0																		---	---	---	---
MUC16	94025	broad.mit.edu	37	19	9084075	9084075	+	Silent	SNP	T	G	G			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9084075T>G	uc002mkp.2	-	1	7944	c.7740A>C	c.(7738-7740)ACA>ACC	p.T2580T		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	2580	Ser-rich.|Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57																		---	---	---	---
ICAM3	3385	broad.mit.edu	37	19	10449619	10449619	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10449619G>A	uc002mob.2	-	2	137	c.82C>T	c.(82-84)CAG>TAG	p.Q28*	ICAM3_uc010dxd.1_5'UTR|ICAM3_uc010xlf.1_Intron	NM_002162	NP_002153	P32942	ICAM3_HUMAN	intercellular adhesion molecule 3 precursor	28					cell-cell adhesion|regulation of immune response	integral to plasma membrane	integrin binding			upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	3			OV - Ovarian serous cystadenocarcinoma(20;6.13e-09)|Epithelial(33;9.69e-06)|all cancers(31;2.05e-05)															---	---	---	---
CACNA1A	773	broad.mit.edu	37	19	13445285	13445285	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13445285G>A	uc010dze.2	-	8	1341	c.1105C>T	c.(1105-1107)CGG>TGG	p.R369W	CACNA1A_uc002mwy.3_Missense_Mutation_p.R369W	NM_001127221	NP_001120693	O00555	CAC1A_HUMAN	calcium channel, alpha 1A subunit isoform 3	369	Cytoplasmic (Potential).				cell death|elevation of cytosolic calcium ion concentration|energy reserve metabolic process|membrane depolarization|regulation of insulin secretion	cytoplasm|nucleus	syntaxin binding			large_intestine(2)	2			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Cinnarizine(DB00568)|Loperamide(DB00836)|Nisoldipine(DB00401)|Pregabalin(DB00230)													---	---	---	---
OR7A5	26659	broad.mit.edu	37	19	14939064	14939064	+	5'UTR	SNP	T	G	G			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14939064T>G	uc002mzw.2	-	1					OR7A5_uc010xoa.1_5'UTR	NM_017506	NP_059976			olfactory receptor, family 7, subfamily A,						sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(2)	2																		---	---	---	---
ARRDC2	27106	broad.mit.edu	37	19	18119572	18119572	+	Silent	SNP	C	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18119572C>T	uc002nhv.2	+	2	470	c.327C>T	c.(325-327)AGC>AGT	p.S109S	ARRDC2_uc002nhu.2_Silent_p.S104S	NM_015683	NP_056498	Q8TBH0	ARRD2_HUMAN	arrestin domain containing 2 isoform 1	109										pancreas(1)	1																		---	---	---	---
ARMC6	93436	broad.mit.edu	37	19	19162555	19162555	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19162555G>T	uc002nld.2	+	5	752	c.404G>T	c.(403-405)GGG>GTG	p.G135V	ARMC6_uc002nlc.2_Missense_Mutation_p.G110V|ARMC6_uc010xql.1_Missense_Mutation_p.G42V|ARMC6_uc002nle.2_Missense_Mutation_p.G110V|ARMC6_uc010xqm.1_Missense_Mutation_p.G135V	NM_033415	NP_219483	Q6NXE6	ARMC6_HUMAN	armadillo repeat containing 6	135							protein binding				0			OV - Ovarian serous cystadenocarcinoma(5;5.66e-06)|Epithelial(12;0.000391)															---	---	---	---
ARMC6	93436	broad.mit.edu	37	19	19162556	19162556	+	Silent	SNP	G	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19162556G>T	uc002nld.2	+	5	753	c.405G>T	c.(403-405)GGG>GGT	p.G135G	ARMC6_uc002nlc.2_Silent_p.G110G|ARMC6_uc010xql.1_Silent_p.G42G|ARMC6_uc002nle.2_Silent_p.G110G|ARMC6_uc010xqm.1_Silent_p.G135G	NM_033415	NP_219483	Q6NXE6	ARMC6_HUMAN	armadillo repeat containing 6	135							protein binding				0			OV - Ovarian serous cystadenocarcinoma(5;5.66e-06)|Epithelial(12;0.000391)															---	---	---	---
SLC25A42	284439	broad.mit.edu	37	19	19217190	19217190	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19217190G>A	uc002nlf.1	+	6	644	c.493G>A	c.(493-495)GAA>AAA	p.E165K	SLC25A42_uc010xqn.1_Missense_Mutation_p.E217K	NM_178526	NP_848621	Q86VD7	S2542_HUMAN	solute carrier family 25, member 42	165	Solcar 2.				transmembrane transport	integral to membrane|mitochondrial inner membrane	binding				0			OV - Ovarian serous cystadenocarcinoma(5;5.4e-06)|Epithelial(12;0.000497)															---	---	---	---
CABP5	56344	broad.mit.edu	37	19	48533806	48533806	+	3'UTR	SNP	G	C	C			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48533806G>C	uc002phu.1	-	6						NM_019855	NP_062829			calcium binding protein 5						signal transduction	cytoplasm	calcium ion binding			skin(1)	1		all_cancers(25;1.86e-08)|all_lung(116;1.14e-06)|all_epithelial(76;1.16e-06)|Lung NSC(112;2.54e-06)|all_neural(266;0.0138)|Ovarian(192;0.0261)|Breast(70;0.203)		OV - Ovarian serous cystadenocarcinoma(262;4.09e-05)|all cancers(93;0.000322)|Epithelial(262;0.01)|GBM - Glioblastoma multiforme(486;0.058)														---	---	---	---
CCDC114	93233	broad.mit.edu	37	19	48807339	48807339	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48807339G>T	uc002pir.2	-	7	1296	c.613C>A	c.(613-615)CAG>AAG	p.Q205K	CCDC114_uc002piq.2_Missense_Mutation_p.Q14K|CCDC114_uc002pio.2_Missense_Mutation_p.Q242K|CCDC114_uc002pis.1_5'Flank|CCDC114_uc002pit.1_Missense_Mutation_p.Q242K|CCDC114_uc002piu.1_Missense_Mutation_p.Q242K	NM_144577	NP_653178	Q96M63	CC114_HUMAN	coiled-coil domain containing 114 isoform 2	205	Potential.									ovary(1)	1		all_epithelial(76;9.64e-05)|all_lung(116;0.000147)|Lung NSC(112;0.000251)|Prostate(7;0.0187)|all_neural(266;0.0228)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000134)|all cancers(93;0.000162)|Epithelial(262;0.0134)|GBM - Glioblastoma multiforme(486;0.0143)														---	---	---	---
GP6	51206	broad.mit.edu	37	19	55543747	55543747	+	Missense_Mutation	SNP	A	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55543747A>T	uc002qik.2	-	3	113	c.85T>A	c.(85-87)TCC>ACC	p.S29T	GP6_uc002qil.2_Missense_Mutation_p.S29T|GP6_uc010esq.2_Missense_Mutation_p.S29T|RDH13_uc010esr.1_Intron	NM_016363	NP_057447	Q9HCN6	GPVI_HUMAN	glycoprotein VI (platelet) isoform 2	29	Ig-like C2-type 1.|Extracellular (Potential).				enzyme linked receptor protein signaling pathway|leukocyte migration|platelet activation	integral to plasma membrane	collagen binding|transmembrane receptor activity			ovary(1)|central_nervous_system(1)	2			BRCA - Breast invasive adenocarcinoma(297;0.156)	GBM - Glioblastoma multiforme(193;0.0515)														---	---	---	---
SUV420H2	84787	broad.mit.edu	37	19	55855158	55855158	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55855158C>A	uc002qkj.3	+	5	745	c.497C>A	c.(496-498)ACC>AAC	p.T166N	SUV420H2_uc002qkl.2_Missense_Mutation_p.T51N	NM_032701	NP_116090	Q86Y97	SV422_HUMAN	suppressor of variegation 4-20 homolog 2	166	SET.				regulation of transcription, DNA-dependent|transcription, DNA-dependent		protein binding				0	Breast(117;0.191)		BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.044)														---	---	---	---
RALGAPA2	57186	broad.mit.edu	37	20	20563767	20563767	+	Silent	SNP	G	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:20563767G>T	uc002wrz.2	-	20	2777	c.2634C>A	c.(2632-2634)CCC>CCA	p.P878P	RALGAPA2_uc010gcx.2_Silent_p.P582P|RALGAPA2_uc010zsg.1_Silent_p.P326P	NM_020343	NP_065076	Q2PPJ7	RGPA2_HUMAN	akt substrate AS250	878					activation of Ral GTPase activity	cytosol|nucleus	protein heterodimerization activity|Ral GTPase activator activity			ovary(1)	1																		---	---	---	---
CST4	1472	broad.mit.edu	37	20	23667771	23667771	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:23667771G>T	uc002wto.1	-	2	352	c.296C>A	c.(295-297)CCC>CAC	p.P99H		NM_001899	NP_001890	P01036	CYTS_HUMAN	cystatin S precursor	99						extracellular region	cysteine-type endopeptidase inhibitor activity			breast(1)	1	Lung NSC(19;0.0789)|Colorectal(13;0.0993)|all_lung(19;0.169)																	---	---	---	---
DLGAP4	22839	broad.mit.edu	37	20	35075294	35075294	+	Silent	SNP	C	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35075294C>T	uc002xff.2	+	7	2037	c.1602C>T	c.(1600-1602)TCC>TCT	p.S534S	DLGAP4_uc010zvp.1_Silent_p.S534S	NM_014902	NP_055717	Q9Y2H0	DLGP4_HUMAN	disks large-associated protein 4 isoform a	534					cell-cell signaling	membrane	protein binding			skin(2)|ovary(1)	3	Breast(12;0.0192)	Myeloproliferative disorder(115;0.00878)																---	---	---	---
L3MBTL	26013	broad.mit.edu	37	20	42162956	42162956	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:42162956G>C	uc010zwh.1	+	15	1612	c.1566G>C	c.(1564-1566)AAG>AAC	p.K522N	L3MBTL_uc002xkl.2_Missense_Mutation_p.K454N|L3MBTL_uc002xkm.2_Missense_Mutation_p.K454N|L3MBTL_uc010ggl.2_Missense_Mutation_p.K454N|L3MBTL_uc002xkn.1_Missense_Mutation_p.K213N|L3MBTL_uc002xko.2_Missense_Mutation_p.K106N	NM_015478	NP_056293	Q9Y468	LMBL1_HUMAN	l(3)mbt-like isoform I	454	MBT 3.				chromatin modification|hemopoiesis|negative regulation of transcription, DNA-dependent|regulation of megakaryocyte differentiation|regulation of mitosis	chromatin|condensed chromosome|nucleoplasm	identical protein binding|methylated histone residue binding|nucleosomal histone binding|SAM domain binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.0031)															---	---	---	---
R3HDML	140902	broad.mit.edu	37	20	42973984	42973984	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:42973984C>T	uc002xls.1	+	4	767	c.595C>T	c.(595-597)CGG>TGG	p.R199W		NM_178491	NP_848586	Q9H3Y0	CRSPL_HUMAN	R3H domain containing-like precursor	199						extracellular region	peptidase inhibitor activity				0		Myeloproliferative disorder(115;0.028)	COAD - Colon adenocarcinoma(18;0.00189)															---	---	---	---
SERINC3	10955	broad.mit.edu	37	20	43139927	43139927	+	Intron	SNP	T	C	C			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:43139927T>C	uc002xme.2	-						SERINC3_uc002xmf.1_Intron|SERINC3_uc010ggs.1_Intron|SERINC3_uc010zwp.1_Intron	NM_198941	NP_945179			tumor differentially expressed protein 1							integral to membrane|plasma membrane	protein binding			skin(3)	3		Myeloproliferative disorder(115;0.0122)	Colorectal(3;0.000291)|COAD - Colon adenocarcinoma(18;0.00189)															---	---	---	---
ELMO2	63916	broad.mit.edu	37	20	45003240	45003240	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:45003240G>A	uc002xrt.1	-	14	1315	c.1105C>T	c.(1105-1107)CCT>TCT	p.P369S	ELMO2_uc010zxq.1_Missense_Mutation_p.P101S|ELMO2_uc002xrs.1_Missense_Mutation_p.P116S|ELMO2_uc002xru.1_Missense_Mutation_p.P369S|ELMO2_uc010zxr.1_Missense_Mutation_p.P381S|ELMO2_uc010zxs.1_Missense_Mutation_p.P186S|ELMO2_uc002xrv.1_Missense_Mutation_p.P88S|ELMO2_uc002xrw.2_Missense_Mutation_p.P186S	NM_133171	NP_573403	Q96JJ3	ELMO2_HUMAN	engulfment and cell motility 2	369	ELMO.				apoptosis|cell chemotaxis|phagocytosis	cytoskeleton|cytosol|membrane	lyase activity|receptor tyrosine kinase binding|SH3 domain binding			ovary(1)	1		Myeloproliferative disorder(115;0.0122)																---	---	---	---
ZFP64	55734	broad.mit.edu	37	20	50701719	50701719	+	Nonsense_Mutation	SNP	C	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:50701719C>A	uc002xwk.2	-	9	1664	c.1315G>T	c.(1315-1317)GAG>TAG	p.E439*	ZFP64_uc002xwj.2_Nonsense_Mutation_p.E220*	NM_199427	NP_955459	Q9NPA5	ZF64A_HUMAN	zinc finger protein 64 isoform d	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			upper_aerodigestive_tract(1)|ovary(1)	2																		---	---	---	---
ZFP64	55734	broad.mit.edu	37	20	50701720	50701720	+	Silent	SNP	C	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:50701720C>A	uc002xwk.2	-	9	1663	c.1314G>T	c.(1312-1314)GGG>GGT	p.G438G	ZFP64_uc002xwj.2_Silent_p.G219G	NM_199427	NP_955459	Q9NPA5	ZF64A_HUMAN	zinc finger protein 64 isoform d	395					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			upper_aerodigestive_tract(1)|ovary(1)	2																		---	---	---	---
LAMA5	3911	broad.mit.edu	37	20	60909066	60909066	+	Silent	SNP	G	C	C			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60909066G>C	uc002ycq.2	-	23	2836	c.2769C>G	c.(2767-2769)ACC>ACG	p.T923T		NM_005560	NP_005551	O15230	LAMA5_HUMAN	laminin alpha 5 precursor	923	Domain IV 1 (domain IV B).				angiogenesis|cell proliferation|cell recognition|cytoskeleton organization|endothelial cell differentiation|focal adhesion assembly|integrin-mediated signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development|substrate adhesion-dependent cell spreading	extracellular space|laminin-1 complex|laminin-10 complex|laminin-11 complex	integrin binding			ovary(1)|pancreas(1)|skin(1)	3	Breast(26;1.57e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)		Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)													---	---	---	---
PCNT	5116	broad.mit.edu	37	21	47801629	47801629	+	Silent	SNP	G	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47801629G>A	uc002zji.3	+	16	3293	c.3186G>A	c.(3184-3186)AAG>AAA	p.K1062K	PCNT_uc002zjj.2_Silent_p.K944K	NM_006031	NP_006022	O95613	PCNT_HUMAN	pericentrin	1062	Potential.				cilium assembly|G2/M transition of mitotic cell cycle	cytosol|microtubule	calmodulin binding			ovary(4)|breast(2)|pancreas(2)	8	Breast(49;0.112)																	---	---	---	---
LOC96610	96610	broad.mit.edu	37	22	23165508	23165508	+	RNA	SNP	C	G	G			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:23165508C>G	uc011aim.1	+	287		c.13070C>G								Parts of antibodies, mostly variable regions.												0																		---	---	---	---
GSTT2	2953	broad.mit.edu	37	22	24323218	24323218	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24323218G>C	uc002zzb.3	+	2	267	c.192G>C	c.(190-192)TTG>TTC	p.L64F	DDT_uc002zza.3_5'Flank|GSTT2_uc002zzc.3_Missense_Mutation_p.L64F	NM_000854	NP_000845	P0CG30	GSTT2_HUMAN	glutathione S-transferase theta 2	64	GST N-terminal.					cytoplasm	glutathione transferase activity				0																		---	---	---	---
PES1	23481	broad.mit.edu	37	22	30975222	30975222	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:30975222C>G	uc003aij.1	-	13	1497	c.1423G>C	c.(1423-1425)GGA>CGA	p.G475R	PES1_uc003aik.1_Missense_Mutation_p.G470R|PES1_uc003ail.1_Missense_Mutation_p.G458R|PES1_uc003aim.1_Missense_Mutation_p.G475R|PES1_uc003ain.1_Missense_Mutation_p.G336R|PES1_uc003aio.1_Missense_Mutation_p.G336R	NM_014303	NP_055118	O00541	PESC_HUMAN	pescadillo homolog 1, containing BRCT domain	475	Glu-rich.				cell proliferation|maturation of 5.8S rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|maturation of LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|regulation of cell cycle	chromosome|nucleoplasm|PeBoW complex|preribosome, large subunit precursor	protein binding				0																		---	---	---	---
MXRA5	25878	broad.mit.edu	37	X	3235405	3235405	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:3235405G>A	uc004crg.3	-	6	6474	c.6317C>T	c.(6316-6318)ACG>ATG	p.T2106M		NM_015419	NP_056234	Q9NR99	MXRA5_HUMAN	adlican precursor	2106	Ig-like C2-type 5.					extracellular region				ovary(5)|lung(1)|central_nervous_system(1)|skin(1)	8		all_lung(23;0.00031)|Lung NSC(23;0.000946)																---	---	---	---
GLRA2	2742	broad.mit.edu	37	X	14592654	14592654	+	Intron	SNP	C	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:14592654C>A	uc010nep.2	+						GLRA2_uc010neq.2_Intron|GLRA2_uc004cwe.3_Missense_Mutation_p.S81R|GLRA2_uc011mio.1_Intron|GLRA2_uc011mip.1_Intron	NM_001118885	NP_001112357			glycine receptor, alpha 2 isoform A						neuropeptide signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	extracellular-glycine-gated chloride channel activity|glycine binding|receptor activity|transmitter-gated ion channel activity			ovary(1)|lung(1)	2	Hepatocellular(33;0.128)				Ethanol(DB00898)|Glycine(DB00145)													---	---	---	---
DMD	1756	broad.mit.edu	37	X	31947780	31947780	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:31947780G>A	uc004dda.1	-	47	7089	c.6845C>T	c.(6844-6846)CCC>CTC	p.P2282L	DMD_uc004dcr.1_5'UTR|DMD_uc004dcs.1_5'UTR|DMD_uc004dct.1_5'UTR|DMD_uc004dcu.1_5'UTR|DMD_uc004dcv.1_5'UTR|DMD_uc004dcw.2_Missense_Mutation_p.P938L|DMD_uc004dcx.2_Missense_Mutation_p.P941L|DMD_uc004dcz.2_Missense_Mutation_p.P2159L|DMD_uc004dcy.1_Missense_Mutation_p.P2278L|DMD_uc004ddb.1_Missense_Mutation_p.P2274L|DMD_uc010ngn.1_Intron	NM_004006	NP_003997	P11532	DMD_HUMAN	dystrophin Dp427m isoform	2282	Spectrin 16.				muscle filament sliding|peptide biosynthetic process	cell surface|costamere|cytoskeleton|cytosol|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|dystroglycan binding|nitric-oxide synthase binding|protein binding|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding			ovary(3)|pancreas(2)|large_intestine(1)	6		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)																---	---	---	---
DMD	1756	broad.mit.edu	37	X	32834625	32834625	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:32834625A>G	uc004dda.1	-	6	734	c.490T>C	c.(490-492)TCT>CCT	p.S164P	DMD_uc004dcz.2_Missense_Mutation_p.S41P|DMD_uc004dcy.1_Missense_Mutation_p.S160P|DMD_uc004ddb.1_Missense_Mutation_p.S156P|DMD_uc010ngo.1_Intron|DMD_uc004ddf.2_Missense_Mutation_p.S156P|DMD_uc010ngp.1_Missense_Mutation_p.S41P|DMD_uc010ngq.1_Intron|DMD_uc010ngr.1_Intron	NM_004006	NP_003997	P11532	DMD_HUMAN	dystrophin Dp427m isoform	164	CH 2.|Actin-binding.				muscle filament sliding|peptide biosynthetic process	cell surface|costamere|cytoskeleton|cytosol|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|dystroglycan binding|nitric-oxide synthase binding|protein binding|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding			ovary(3)|pancreas(2)|large_intestine(1)	6		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)																---	---	---	---
RGAG4	340526	broad.mit.edu	37	X	71350836	71350836	+	Silent	SNP	G	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:71350836G>T	uc010nlh.1	-	1	916	c.555C>A	c.(553-555)GCC>GCA	p.A185A	NHSL2_uc011mqa.1_Intron|RGAG4_uc004eaj.1_RNA|NHSL2_uc004eak.1_5'Flank	NM_001024455	NP_001019626	Q5HYW3	RGAG4_HUMAN	retrotransposon gag domain containing 4	185								p.S185S(1)		ovary(2)|skin(1)	3	Renal(35;0.156)																	---	---	---	---
GPRASP1	9737	broad.mit.edu	37	X	101911869	101911869	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:101911869G>A	uc004ejj.3	+	5	3829	c.3028G>A	c.(3028-3030)GAT>AAT	p.D1010N	GPRASP1_uc004eji.3_Missense_Mutation_p.D1010N|GPRASP1_uc010nod.2_Missense_Mutation_p.D1010N	NM_014710	NP_055525	Q5JY77	GASP1_HUMAN	G protein-coupled receptor associated sorting	1010	OPRD1-binding.					cytoplasm	protein binding			ovary(1)|lung(1)	2																		---	---	---	---
CXorf61	203413	broad.mit.edu	37	X	115594028	115594028	+	5'UTR	SNP	C	T	T			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:115594028C>T	uc004eqj.1	-	1						NM_001017978	NP_001017978			chromosome X open reading frame 61							integral to membrane|plasma membrane					0																		---	---	---	---
DCAF12L1	139170	broad.mit.edu	37	X	125686084	125686084	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:125686084T>G	uc004eul.2	-	1	759	c.508A>C	c.(508-510)AAC>CAC	p.N170H		NM_178470	NP_848565	Q5VU92	DC121_HUMAN	DDB1 and CUL4 associated factor 12-like 1	170	WD 1.									skin(3)|ovary(1)	4																		---	---	---	---
OCRL	4952	broad.mit.edu	37	X	128703265	128703265	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:128703265G>C	uc004euq.2	+	15	1656	c.1491G>C	c.(1489-1491)TGG>TGC	p.W497C	OCRL_uc004eur.2_Missense_Mutation_p.W497C	NM_000276	NP_000267	Q01968	OCRL_HUMAN	phosphatidylinositol polyphosphate 5-phosphatase	497					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	clathrin-coated vesicle|cytosol|early endosome|Golgi stack|Golgi-associated vesicle	GTPase activator activity|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity|protein binding			lung(2)|ovary(1)|kidney(1)	4																		---	---	---	---
FRMD7	90167	broad.mit.edu	37	X	131220027	131220027	+	Nonsense_Mutation	SNP	T	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:131220027T>A	uc004ewn.2	-	6	596	c.418A>T	c.(418-420)AAG>TAG	p.K140*	FRMD7_uc011muy.1_Nonsense_Mutation_p.K125*	NM_194277	NP_919253	Q6ZUT3	FRMD7_HUMAN	FERM domain containing 7	140	FERM.				regulation of neuron projection development	cytoskeleton|growth cone|neuronal cell body	binding			skin(1)	1	Acute lymphoblastic leukemia(192;0.000127)																	---	---	---	---
GPR112	139378	broad.mit.edu	37	X	135405336	135405336	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4191-01A-02D-1126-08	TCGA-BR-4191-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:135405336C>A	uc004ezu.1	+	5	761	c.470C>A	c.(469-471)ACT>AAT	p.T157N	GPR112_uc010nsb.1_Intron	NM_153834	NP_722576	Q8IZF6	GP112_HUMAN	G-protein coupled receptor 112	157	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(5)|large_intestine(2)|skin(2)|lung(1)|breast(1)|pancreas(1)	12	Acute lymphoblastic leukemia(192;0.000127)																	---	---	---	---
