Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	validation_status	validation_method	validation_tumor_sample	validation_alt_allele
UTS2	10911	broad.mit.edu	37	1	7907620	7907621	+	Intron	INS	-	TAAT	TAAT	rs143440682	by1000genomes	TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:7907620_7907621insTAAT	uc001aoq.2	-							NM_006786	NP_006777			urotensin 2 isoform b preproprotein						muscle contraction|regulation of blood pressure|synaptic transmission	extracellular space	hormone activity				0	Ovarian(185;0.0634)|all_lung(157;0.178)	all_epithelial(116;1.38e-20)|all_lung(118;1.29e-06)|Lung NSC(185;7.5e-06)|Renal(390;0.000147)|Breast(348;0.00086)|Colorectal(325;0.000959)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;9.26e-71)|GBM - Glioblastoma multiforme(8;5.15e-36)|Colorectal(212;1.27e-07)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(185;4.89e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000386)|KIRC - Kidney renal clear cell carcinoma(229;0.000894)|STAD - Stomach adenocarcinoma(132;0.000951)|READ - Rectum adenocarcinoma(331;0.0642)														---	---	---	---
RCAN3	11123	broad.mit.edu	37	1	24859465	24859466	+	Intron	DEL	AG	-	-			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:24859465_24859466delAG	uc001bjj.2	+						RCAN3_uc009vrd.2_Intron|RCAN3_uc009vre.2_Intron|RCAN3_uc009vrf.2_Intron|RCAN3_uc009vrg.2_Intron	NM_013441	NP_038469			Down syndrome critical region gene 1-like 2						anatomical structure morphogenesis|calcium-mediated signaling		nucleotide binding|RNA binding|troponin I binding				0		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000946)|all_lung(284;0.00125)|Ovarian(437;0.00473)|Breast(348;0.0148)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.19)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0427)|OV - Ovarian serous cystadenocarcinoma(117;1.13e-24)|Colorectal(126;6.09e-08)|COAD - Colon adenocarcinoma(152;3.33e-06)|GBM - Glioblastoma multiforme(114;0.000923)|BRCA - Breast invasive adenocarcinoma(304;0.0018)|KIRC - Kidney renal clear cell carcinoma(1967;0.00359)|STAD - Stomach adenocarcinoma(196;0.00493)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.14)														---	---	---	---
BRDT	676	broad.mit.edu	37	1	92457969	92457970	+	Intron	DEL	CA	-	-	rs150514940		TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:92457969_92457970delCA	uc001dok.3	+						BRDT_uc001dol.3_Intron|BRDT_uc010osz.1_Intron|BRDT_uc009wdf.2_Intron|BRDT_uc010ota.1_Intron|BRDT_uc010otb.1_Intron|BRDT_uc001dom.3_Intron	NM_207189	NP_997072			testis-specific bromodomain protein						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein serine/threonine kinase activity|transcription coactivator activity			stomach(2)|ovary(1)|lung(1)	4		all_lung(203;0.00531)|Lung NSC(277;0.0194)		all cancers(265;0.0228)|Epithelial(280;0.133)														---	---	---	---
IQGAP3	128239	broad.mit.edu	37	1	156539320	156539321	+	Intron	INS	-	T	T	rs66488910		TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156539320_156539321insT	uc001fpf.2	-						IQGAP3_uc009wsb.1_Intron	NM_178229	NP_839943			IQ motif containing GTPase activating protein 3						small GTPase mediated signal transduction	intracellular	calmodulin binding|Ras GTPase activator activity			ovary(5)|skin(1)	6	all_hematologic(923;0.088)|Hepatocellular(266;0.158)																	---	---	---	---
NKTR	4820	broad.mit.edu	37	3	42676571	42676571	+	Intron	DEL	G	-	-			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:42676571delG	uc003clo.2	+						NKTR_uc003clm.1_Intron|NKTR_uc003clp.2_Intron|NKTR_uc011azp.1_Intron|NKTR_uc003clq.1_Intron|NKTR_uc003clr.1_Intron|NKTR_uc003cls.2_Intron	NM_005385	NP_005376			natural killer-tumor recognition sequence						protein folding	membrane	cyclosporin A binding|peptidyl-prolyl cis-trans isomerase activity			ovary(2)|skin(1)	3				KIRC - Kidney renal clear cell carcinoma(284;0.24)														---	---	---	---
ABCC5	10057	broad.mit.edu	37	3	183696103	183696103	+	Intron	DEL	T	-	-	rs67116575		TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183696103delT	uc003fmg.2	-						ABCC5_uc011bqt.1_Intron|ABCC5_uc010hxl.2_Intron	NM_005688	NP_005679			ATP-binding cassette, sub-family C, member 5							integral to plasma membrane|membrane fraction	ATP binding|ATPase activity, coupled to transmembrane movement of substances|organic anion transmembrane transporter activity			ovary(2)|large_intestine(1)|central_nervous_system(1)	4	all_cancers(143;1.85e-10)|Ovarian(172;0.0303)		Epithelial(37;1.74e-35)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)															---	---	---	---
SKIV2L2	23517	broad.mit.edu	37	5	54603686	54603687	+	5'UTR	INS	-	A	A	rs77094835		TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:54603686_54603687insA	uc003jpy.3	+	1					SKIV2L2_uc011cqi.1_5'UTR|DHX29_uc003jpx.2_5'Flank|DHX29_uc010ivw.2_5'Flank	NM_015360	NP_056175			superkiller viralicidic activity 2-like 2						maturation of 5.8S rRNA	catalytic step 2 spliceosome|nucleolus	ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding			ovary(1)|skin(1)	2		Lung NSC(810;0.000744)|Breast(144;0.181)|Prostate(74;0.194)																---	---	---	---
RAC1	5879	broad.mit.edu	37	7	6442143	6442144	+	3'UTR	INS	-	A	A	rs59685280		TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6442143_6442144insA	uc003spx.2	+	6					RAC1_uc003spw.2_3'UTR	NM_006908	NP_008839			ras-related C3 botulinum toxin substrate 1						actin filament polymerization|apoptosis|axon guidance|cell motility|cell-matrix adhesion|induction of apoptosis by extracellular signals|inflammatory response|lamellipodium assembly|localization within membrane|negative regulation of interleukin-23 production|negative regulation of receptor-mediated endocytosis|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of lamellipodium assembly|positive regulation of Rho protein signal transduction|regulation of cell migration|regulation of defense response to virus by virus|regulation of hydrogen peroxide metabolic process|regulation of respiratory burst|ruffle organization|small GTPase mediated signal transduction|T cell costimulation|viral reproduction	cytosol|melanosome|plasma membrane	GTP binding|GTP-dependent protein binding|GTPase activity|thioesterase binding			lung(2)	2		Ovarian(82;0.0776)		UCEC - Uterine corpus endometrioid carcinoma (126;0.104)	Pravastatin(DB00175)|Simvastatin(DB00641)													---	---	---	---
Unknown	0	broad.mit.edu	37	7	62915937	62915938	+	IGR	DEL	AT	-	-			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:62915937_62915938delAT								LOC100287704 (103786 upstream) : ZNF727 (589883 downstream)																																			---	---	---	---
SRRM3	222183	broad.mit.edu	37	7	75912537	75912537	+	Intron	DEL	G	-	-	rs3839766		TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:75912537delG	uc010ldi.2	+						SRRM3_uc003uet.1_Intron	NM_001110199	NP_001103669			serine/arginine repetitive matrix 3												0																		---	---	---	---
SNAI2	6591	broad.mit.edu	37	8	49834010	49834011	+	5'Flank	INS	-	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:49834010_49834011insT	uc003xqp.2	-							NM_003068	NP_003059			snail 2						canonical Wnt receptor signaling pathway|ectoderm and mesoderm interaction|multicellular organismal development|negative regulation of transcription from RNA polymerase II promoter|osteoblast differentiation|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2		all_cancers(86;0.0368)|all_epithelial(80;0.000624)|Lung NSC(129;0.0019)|all_lung(136;0.00502)																---	---	---	---
KIAA0368	23392	broad.mit.edu	37	9	114170786	114170786	+	Intron	DEL	A	-	-			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:114170786delA	uc004bfe.1	-							NM_001080398	NP_001073867			KIAA0368 protein												0																		---	---	---	---
TCF7L2	6934	broad.mit.edu	37	10	114710508	114710508	+	5'UTR	DEL	A	-	-			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:114710508delA	uc001lae.3	+	1					TCF7L2_uc001lac.3_5'UTR|TCF7L2_uc010qrk.1_5'UTR|TCF7L2_uc010qrl.1_5'UTR|TCF7L2_uc010qrm.1_5'UTR|TCF7L2_uc010qrn.1_5'UTR|TCF7L2_uc001lad.3_5'UTR|TCF7L2_uc001lag.3_5'UTR|TCF7L2_uc001laf.3_5'UTR|TCF7L2_uc010qro.1_5'UTR|TCF7L2_uc001lah.2_5'UTR|TCF7L2_uc010qrp.1_5'UTR|TCF7L2_uc010qrq.1_5'UTR|TCF7L2_uc010qrr.1_5'Flank|TCF7L2_uc010qrs.1_5'Flank|TCF7L2_uc010qrt.1_5'Flank	NM_001146274	NP_001139746			transcription factor 7-like 2 isoform 1						anti-apoptosis|blood vessel development|canonical Wnt receptor signaling pathway involved in positive regulation of epithelial to mesenchymal transition|cell cycle arrest|cell proliferation|fat cell differentiation|glucose homeostasis|maintenance of DNA repeat elements|myoblast cell fate commitment|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|pancreas development|positive regulation of heparan sulfate proteoglycan biosynthetic process|positive regulation of insulin secretion|positive regulation of protein binding|positive regulation of protein export from nucleus|positive regulation of protein kinase B signaling cascade|positive regulation of transcription from RNA polymerase II promoter|regulation of hormone metabolic process|regulation of smooth muscle cell proliferation|response to glucose stimulus	beta-catenin-TCF7L2 complex|PML body|protein-DNA complex	armadillo repeat domain binding|beta-catenin binding|gamma-catenin binding|nuclear hormone receptor binding|protein kinase binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding|transcription regulatory region DNA binding			large_intestine(3)|ovary(1)	4		Breast(234;0.058)|Colorectal(252;0.0615)		Epithelial(162;0.00554)|all cancers(201;0.02)														---	---	---	---
C10orf119	79892	broad.mit.edu	37	10	121602280	121602280	+	Intron	DEL	T	-	-	rs71935400		TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:121602280delT	uc001ler.2	-						C10orf119_uc001leq.1_Intron|C10orf119_uc001les.1_Intron	NM_024834	NP_079110			chromosome 10 open reading frame 119						cell division|DNA-dependent DNA replication|mitosis|S phase of mitotic cell cycle|sister chromatid cohesion	nucleus	chromatin binding				0		Lung NSC(174;0.109)|all_lung(145;0.142)		all cancers(201;0.0044)														---	---	---	---
UBE4A	9354	broad.mit.edu	37	11	118247606	118247607	+	Intron	INS	-	A	A	rs1784239		TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118247606_118247607insA	uc001psw.2	+						UBE4A_uc001psv.2_Intron	NM_004788	NP_004779			ubiquitination factor E4A						ubiquitin-dependent protein catabolic process	ubiquitin ligase complex	protein binding			ovary(2)|upper_aerodigestive_tract(1)|breast(1)|kidney(1)	5	all_hematologic(175;0.046)	Medulloblastoma(222;0.0425)|Breast(348;0.181)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.28e-05)														---	---	---	---
KDM2B	84678	broad.mit.edu	37	12	122018158	122018158	+	Intron	DEL	G	-	-			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122018158delG	uc001uat.2	-						KDM2B_uc001uas.2_5'UTR|KDM2B_uc001uau.2_Intron|KDM2B_uc001uav.3_Intron	NM_032590	NP_115979			F-box and leucine-rich repeat protein 10 isoform						embryonic camera-type eye morphogenesis|fourth ventricle development|histone H2A monoubiquitination|initiation of neural tube closure|lateral ventricle development|midbrain development|midbrain-hindbrain boundary morphogenesis|negative regulation of neural precursor cell proliferation|negative regulation of neuron apoptosis|negative regulation of transcription from RNA polymerase II promoter|spermatogenesis|third ventricle development|transcription, DNA-dependent	nucleolus	DNA binding|histone demethylase activity (H3-K36 specific)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|rRNA binding|zinc ion binding			ovary(1)|skin(1)	2																		---	---	---	---
ATP6V0A2	23545	broad.mit.edu	37	12	124205737	124205738	+	Intron	INS	-	TGTTT	TGTTT	rs142454152	by1000genomes	TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124205737_124205738insTGTTT	uc001ufr.2	+						ATP6V0A2_uc001ufq.1_Intron	NM_012463	NP_036595			ATPase, H+ transporting, lysosomal V0 subunit						ATP hydrolysis coupled proton transport|cellular iron ion homeostasis|immune response|insulin receptor signaling pathway|transferrin transport	endosome membrane|integral to membrane|plasma membrane|proton-transporting two-sector ATPase complex, proton-transporting domain	hydrogen ion transmembrane transporter activity|protein binding			ovary(2)	2	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000224)|Epithelial(86;0.000625)|all cancers(50;0.00775)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	66684350	66684350	+	IGR	DEL	A	-	-	rs75457079		TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:66684350delA								FUT8 (474389 upstream) : C14orf53 (268759 downstream)																																			---	---	---	---
VIPAR	63894	broad.mit.edu	37	14	77910667	77910668	+	Frame_Shift_Del	DEL	TC	-	-			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:77910667_77910668delTC	uc001xtt.1	-	9	859_860	c.521_522delGA	c.(520-522)AGAfs	p.R174fs	VIPAR_uc001xtu.1_Frame_Shift_Del_p.R174fs|VIPAR_uc010tvj.1_Frame_Shift_Del_p.R125fs|VIPAR_uc001xtv.1_Frame_Shift_Del_p.R174fs	NM_022067	NP_071350	Q9H9C1	VIPAR_HUMAN	hypothetical protein LOC63894	174					endosome to lysosome transport|intracellular protein transport|regulation of transcription, DNA-dependent|transcription, DNA-dependent	early endosome|late endosome|recycling endosome	protein binding			central_nervous_system(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	22566684	22566684	+	IGR	DEL	A	-	-			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22566684delA								MIR1268 (53404 upstream) : GOLGA8DP (135601 downstream)																																			---	---	---	---
IGDCC3	9543	broad.mit.edu	37	15	65623124	65623125	+	Intron	INS	-	TCTA	TCTA	rs150339477	by1000genomes	TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65623124_65623125insTCTA	uc002aos.2	-						IGDCC3_uc002aor.1_5'Flank	NM_004884	NP_004875			putative neuronal cell adhesion molecule											ovary(3)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	27088724	27088725	+	IGR	INS	-	CTTTCTTTCTTT	CTTTCTTTCTTT	rs113132535	by1000genomes	TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:27088724_27088725insCTTTCTTTCTTT								C16orf82 (8238 upstream) : JMJD5 (126082 downstream)																																			---	---	---	---
ABCA5	23461	broad.mit.edu	37	17	67246495	67246496	+	Intron	INS	-	AT	AT	rs147076066	by1000genomes	TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:67246495_67246496insAT	uc002jif.2	-						ABCA5_uc002jib.2_Intron|ABCA5_uc002jic.2_Intron|ABCA5_uc002jid.2_Intron|ABCA5_uc002jie.2_Intron|ABCA5_uc002jig.2_Intron	NM_018672	NP_061142			ATP-binding cassette, sub-family A , member 5						cholesterol efflux|high-density lipoprotein particle remodeling|negative regulation of macrophage derived foam cell differentiation	Golgi membrane|integral to membrane|late endosome membrane|lysosomal membrane	ATP binding|ATPase activity			ovary(2)|central_nervous_system(1)|skin(1)	4	Breast(10;3.72e-11)																	---	---	---	---
ZSWIM4	65249	broad.mit.edu	37	19	13915460	13915461	+	Intron	INS	-	A	A	rs112805755		TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13915460_13915461insA	uc002mxh.1	+						ZSWIM4_uc010xng.1_5'Flank	NM_023072	NP_075560			zinc finger, SWIM-type containing 4								zinc ion binding			central_nervous_system(2)	2			OV - Ovarian serous cystadenocarcinoma(19;2.94e-23)|Epithelial(5;4.58e-19)															---	---	---	---
CYP4F22	126410	broad.mit.edu	37	19	15658800	15658807	+	Intron	DEL	GAGAGAGG	-	-	rs145247351	by1000genomes	TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15658800_15658807delGAGAGAGG	uc002nbh.3	+							NM_173483	NP_775754			cytochrome P450, family 4, subfamily F,							endoplasmic reticulum membrane|microsome	electron carrier activity|heme binding|monooxygenase activity|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen			ovary(1)|pancreas(1)	2																		---	---	---	---
MLL4	9757	broad.mit.edu	37	19	36229073	36229075	+	In_Frame_Del	DEL	AGA	-	-			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36229073_36229075delAGA	uc010eei.2	+	37	7853_7855	c.7853_7855delAGA	c.(7852-7857)GAGAAG>GAG	p.K2619del		NM_014727	NP_055542	Q9UMN6	MLL4_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 4	2619	SET.				chromatin-mediated maintenance of transcription		DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			central_nervous_system(6)|breast(2)|ovary(1)|kidney(1)|skin(1)	11	all_lung(56;3.33e-07)|Lung NSC(56;5.02e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)															---	---	---	---
STAU1	6780	broad.mit.edu	37	20	47782357	47782358	+	Intron	DEL	CT	-	-	rs72593076		TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47782357_47782358delCT	uc002xud.2	-						STAU1_uc002xua.2_Intron|STAU1_uc002xub.2_Intron|STAU1_uc002xuc.2_Intron|STAU1_uc002xue.2_Intron|STAU1_uc002xuf.2_Intron|STAU1_uc002xug.2_Intron	NM_017453	NP_059347			staufen isoform b							microtubule associated complex|rough endoplasmic reticulum|stress granule	double-stranded RNA binding			ovary(4)|kidney(1)	5			BRCA - Breast invasive adenocarcinoma(12;0.000644)|Colorectal(8;0.198)															---	---	---	---
TMPRSS2	7113	broad.mit.edu	37	21	42837923	42837924	+	3'UTR	DEL	AG	-	-			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:42837923_42837924delAG	uc002yzj.2	-	14					TMPRSS2_uc010gor.2_3'UTR	NM_005656	NP_005647			transmembrane protease, serine 2 isoform 2						proteolysis	cytoplasm|extracellular region|integral to plasma membrane	scavenger receptor activity|serine-type endopeptidase activity		TMPRSS2/ERG(2499)|TMPRSS2/ETV1(24)	prostate(2523)|central_nervous_system(1)	2524		Prostate(19;4.48e-07)|all_epithelial(19;0.031)						T	ERG|ETV1|ETV4|ETV5	prostate 								---	---	---	---
psiTPTE22	387590	broad.mit.edu	37	22	17131430	17131432	+	Intron	DEL	CAC	-	-	rs142037179		TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:17131430_17131432delCAC	uc002zls.1	+						psiTPTE22_uc002zlt.2_Intron					Homo sapiens cDNA FLJ10437 fis, clone NT2RP1000581.												0																		---	---	---	---
DYNLT3	6990	broad.mit.edu	37	X	37699961	37699962	+	Intron	DEL	AT	-	-			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:37699961_37699962delAT	uc004dds.2	-							NM_006520	NP_006511			dynein, light chain, Tctex-type 3						cell division|mitosis|regulation of mitotic cell cycle|transport	condensed chromosome kinetochore|cytoplasmic dynein complex|microtubule|nucleus|plasma membrane	motor activity				0																		---	---	---	---
COL4A5	1287	broad.mit.edu	37	X	107825926	107825926	+	Intron	DEL	T	-	-	rs34190918		TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:107825926delT	uc004enz.1	+						COL4A5_uc011mso.1_Intron|COL4A5_uc004eob.1_5'UTR	NM_033380	NP_203699			type IV collagen alpha 5 isoform 2 precursor						axon guidance	collagen type IV	extracellular matrix structural constituent|protein binding			ovary(3)|central_nervous_system(1)	4														Alport_syndrome_with_Diffuse_Leiomyomatosis				---	---	---	---
BRDT	676	broad.mit.edu	37	1	92457969	92457970	+	Intron	DEL	CA	-	-	rs150514940		TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:92457969_92457970delCA	uc001dok.3	+						BRDT_uc001dol.3_Intron|BRDT_uc010osz.1_Intron|BRDT_uc009wdf.2_Intron|BRDT_uc010ota.1_Intron|BRDT_uc010otb.1_Intron|BRDT_uc001dom.3_Intron	NM_207189	NP_997072			testis-specific bromodomain protein						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein serine/threonine kinase activity|transcription coactivator activity			stomach(2)|ovary(1)|lung(1)	4		all_lung(203;0.00531)|Lung NSC(277;0.0194)		all cancers(265;0.0228)|Epithelial(280;0.133)														---	---	---	---
PDE4DIP	9659	broad.mit.edu	37	1	144853333	144853334	+	Intron	INS	-	AA	AA	rs149112816		TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144853333_144853334insAA	uc001elw.3	-						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001elx.3_Intron|PDE4DIP_uc001elv.3_Intron	NM_014644	NP_055459			phosphodiesterase 4D interacting protein isoform						cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)				T	PDGFRB	MPD								---	---	---	---
Unknown	0	broad.mit.edu	37	2	73956941	73956941	+	IGR	DEL	T	-	-			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:73956941delT								NAT8B (28474 upstream) : TPRKB (16 downstream)																																			---	---	---	---
RGPD5	84220	broad.mit.edu	37	2	113147931	113147933	+	Intron	DEL	ATG	-	-			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:113147931_113147933delATG	uc002ths.1	-						RGPD8_uc010fkk.1_Intron|RGPD5_uc002tht.1_Intron	NM_005054	NP_005045			RANBP2-like and GRIP domain containing 5 isoform						intracellular transport	cytoplasm	binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	133018713	133018714	+	IGR	DEL	GG	-	-	rs144729406		TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133018713_133018714delGG								NCRNA00164 (3171 upstream) : GPR39 (155433 downstream)																																			---	---	---	---
IPO11	51194	broad.mit.edu	37	5	61763288	61763290	+	Intron	DEL	ATA	-	-	rs143944846		TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:61763288_61763290delATA	uc003jtc.2	+						IPO11_uc011cqr.1_Intron|IPO11_uc003jtb.1_Intron	NM_016338	NP_057422			Ran binding protein 11 isoform 2							cytoplasm|nucleus	protein binding			lung(2)|skin(2)	4		Lung NSC(810;8.99e-06)|Prostate(74;0.0235)|Ovarian(174;0.0511)|Breast(144;0.077)		Lung(70;0.0613)														---	---	---	---
PPWD1	23398	broad.mit.edu	37	5	64859431	64859450	+	Intron	DEL	GTGCCCTCAGAACAGAGGGC	-	-	rs149293765	by1000genomes	TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:64859431_64859450delGTGCCCTCAGAACAGAGGGC	uc003jtv.3	+						PPWD1_uc011cqv.1_Intron|PPWD1_uc011cqw.1_Intron|CENPK_uc003jts.2_5'Flank|CENPK_uc003jtt.2_5'Flank|CENPK_uc003jtu.2_5'Flank	NM_015342	NP_056157			peptidylprolyl isomerase domain and WD repeat						protein folding	catalytic step 2 spliceosome	peptidyl-prolyl cis-trans isomerase activity			ovary(1)	1		Lung NSC(167;7.21e-05)|Prostate(74;0.0174)|Ovarian(174;0.186)		Lung(70;0.00451)														---	---	---	---
RAC1	5879	broad.mit.edu	37	7	6442143	6442144	+	3'UTR	INS	-	A	A	rs59685280		TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6442143_6442144insA	uc003spx.2	+	6					RAC1_uc003spw.2_3'UTR	NM_006908	NP_008839			ras-related C3 botulinum toxin substrate 1						actin filament polymerization|apoptosis|axon guidance|cell motility|cell-matrix adhesion|induction of apoptosis by extracellular signals|inflammatory response|lamellipodium assembly|localization within membrane|negative regulation of interleukin-23 production|negative regulation of receptor-mediated endocytosis|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of lamellipodium assembly|positive regulation of Rho protein signal transduction|regulation of cell migration|regulation of defense response to virus by virus|regulation of hydrogen peroxide metabolic process|regulation of respiratory burst|ruffle organization|small GTPase mediated signal transduction|T cell costimulation|viral reproduction	cytosol|melanosome|plasma membrane	GTP binding|GTP-dependent protein binding|GTPase activity|thioesterase binding			lung(2)	2		Ovarian(82;0.0776)		UCEC - Uterine corpus endometrioid carcinoma (126;0.104)	Pravastatin(DB00175)|Simvastatin(DB00641)													---	---	---	---
DFNA5	1687	broad.mit.edu	37	7	24783982	24783982	+	Intron	DEL	C	-	-	rs71582854		TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:24783982delC	uc010kus.1	-						DFNA5_uc003swz.2_Intron|DFNA5_uc003sxa.1_Intron|DFNA5_uc010kut.1_Intron|DFNA5_uc003sxb.2_Intron|DFNA5_uc003sxc.2_3'UTR	NM_001127453	NP_001120925			deafness, autosomal dominant 5 protein isoform						sensory perception of sound					ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	68728773	68728775	+	Intron	DEL	ATG	-	-	rs62554276		TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68728773_68728775delATG	uc004aez.1	+						uc004afa.1_Intron|uc010mnp.1_Intron					Homo sapiens cDNA, FLJ18209.																														---	---	---	---
DENND1A	57706	broad.mit.edu	37	9	126414137	126414137	+	Intron	DEL	A	-	-	rs35363899		TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:126414137delA	uc004bnz.1	-						DENND1A_uc011lzl.1_Intron|DENND1A_uc004bny.1_Intron|DENND1A_uc011lzm.1_Intron|DENND1A_uc004boa.1_Intron|DENND1A_uc004bob.1_Intron|DENND1A_uc004boc.2_Intron	NM_020946	NP_065997			DENN/MADD domain containing 1A isoform 1							cell junction|clathrin coated vesicle membrane|presynaptic membrane	guanyl-nucleotide exchange factor activity			ovary(2)	2																		---	---	---	---
TCF7L2	6934	broad.mit.edu	37	10	114710508	114710508	+	5'UTR	DEL	A	-	-			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:114710508delA	uc001lae.3	+	1					TCF7L2_uc001lac.3_5'UTR|TCF7L2_uc010qrk.1_5'UTR|TCF7L2_uc010qrl.1_5'UTR|TCF7L2_uc010qrm.1_5'UTR|TCF7L2_uc010qrn.1_5'UTR|TCF7L2_uc001lad.3_5'UTR|TCF7L2_uc001lag.3_5'UTR|TCF7L2_uc001laf.3_5'UTR|TCF7L2_uc010qro.1_5'UTR|TCF7L2_uc001lah.2_5'UTR|TCF7L2_uc010qrp.1_5'UTR|TCF7L2_uc010qrq.1_5'UTR|TCF7L2_uc010qrr.1_5'Flank|TCF7L2_uc010qrs.1_5'Flank|TCF7L2_uc010qrt.1_5'Flank	NM_001146274	NP_001139746			transcription factor 7-like 2 isoform 1						anti-apoptosis|blood vessel development|canonical Wnt receptor signaling pathway involved in positive regulation of epithelial to mesenchymal transition|cell cycle arrest|cell proliferation|fat cell differentiation|glucose homeostasis|maintenance of DNA repeat elements|myoblast cell fate commitment|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|pancreas development|positive regulation of heparan sulfate proteoglycan biosynthetic process|positive regulation of insulin secretion|positive regulation of protein binding|positive regulation of protein export from nucleus|positive regulation of protein kinase B signaling cascade|positive regulation of transcription from RNA polymerase II promoter|regulation of hormone metabolic process|regulation of smooth muscle cell proliferation|response to glucose stimulus	beta-catenin-TCF7L2 complex|PML body|protein-DNA complex	armadillo repeat domain binding|beta-catenin binding|gamma-catenin binding|nuclear hormone receptor binding|protein kinase binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding|transcription regulatory region DNA binding			large_intestine(3)|ovary(1)	4		Breast(234;0.058)|Colorectal(252;0.0615)		Epithelial(162;0.00554)|all cancers(201;0.02)														---	---	---	---
XRRA1	143570	broad.mit.edu	37	11	74641436	74641437	+	Intron	INS	-	A	A	rs113880146		TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:74641436_74641437insA	uc009yub.2	-						XRRA1_uc001ovm.2_Intron|XRRA1_uc001ovo.2_Intron|XRRA1_uc001ovq.3_Intron|XRRA1_uc001ovp.3_Intron|XRRA1_uc001ovr.2_Intron	NM_182969	NP_892014			X-ray radiation resistance associated 1						response to X-ray	cytoplasm|nucleus				central_nervous_system(1)	1																		---	---	---	---
KDM5A	5927	broad.mit.edu	37	12	415910	415910	+	Intron	DEL	A	-	-			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:415910delA	uc001qif.1	-						KDM5A_uc001qie.1_Intron	NM_001042603	NP_001036068			retinoblastoma binding protein 2 isoform 1						chromatin modification|multicellular organismal development|positive regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	cytoplasm|nucleolus	DNA binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(2)|ovary(1)	3								T 	NUP98	AML								---	---	---	---
KDM2B	84678	broad.mit.edu	37	12	122018158	122018158	+	Intron	DEL	G	-	-			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122018158delG	uc001uat.2	-						KDM2B_uc001uas.2_5'UTR|KDM2B_uc001uau.2_Intron|KDM2B_uc001uav.3_Intron	NM_032590	NP_115979			F-box and leucine-rich repeat protein 10 isoform						embryonic camera-type eye morphogenesis|fourth ventricle development|histone H2A monoubiquitination|initiation of neural tube closure|lateral ventricle development|midbrain development|midbrain-hindbrain boundary morphogenesis|negative regulation of neural precursor cell proliferation|negative regulation of neuron apoptosis|negative regulation of transcription from RNA polymerase II promoter|spermatogenesis|third ventricle development|transcription, DNA-dependent	nucleolus	DNA binding|histone demethylase activity (H3-K36 specific)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|rRNA binding|zinc ion binding			ovary(1)|skin(1)	2																		---	---	---	---
FNTB	2342	broad.mit.edu	37	14	65507348	65507348	+	Intron	DEL	G	-	-			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:65507348delG	uc001xia.2	+						FNTB_uc010tsl.1_Intron|FNTB_uc010tsm.1_Intron|MAX_uc001xic.1_Intron|FNTB_uc001xid.2_Intron|FNTB_uc010tso.1_Intron	NM_002028	NP_002019			farnesyltransferase, CAAX box, beta						protein farnesylation	microtubule associated complex	protein binding|protein farnesyltransferase activity			ovary(1)	1				all cancers(60;0.00115)|OV - Ovarian serous cystadenocarcinoma(108;0.00412)|BRCA - Breast invasive adenocarcinoma(234;0.011)														---	---	---	---
VIPAR	63894	broad.mit.edu	37	14	77910667	77910668	+	Frame_Shift_Del	DEL	TC	-	-			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:77910667_77910668delTC	uc001xtt.1	-	9	859_860	c.521_522delGA	c.(520-522)AGAfs	p.R174fs	VIPAR_uc001xtu.1_Frame_Shift_Del_p.R174fs|VIPAR_uc010tvj.1_Frame_Shift_Del_p.R125fs|VIPAR_uc001xtv.1_Frame_Shift_Del_p.R174fs	NM_022067	NP_071350	Q9H9C1	VIPAR_HUMAN	hypothetical protein LOC63894	174					endosome to lysosome transport|intracellular protein transport|regulation of transcription, DNA-dependent|transcription, DNA-dependent	early endosome|late endosome|recycling endosome	protein binding			central_nervous_system(1)	1																		---	---	---	---
TMC7	79905	broad.mit.edu	37	16	19020932	19020932	+	Intron	DEL	A	-	-			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:19020932delA	uc002dfq.2	+						TMC7_uc010vao.1_Intron|TMC7_uc002dfp.2_Intron|TMC7_uc010vap.1_Intron	NM_024847	NP_079123			transmembrane channel-like 7 isoform a							integral to membrane				skin(2)|ovary(1)	3																		---	---	---	---
BOLA2	552900	broad.mit.edu	37	16	29565636	29565637	+	Intron	INS	-	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:29565636_29565637insA	uc010bzb.1	-						LOC440354_uc002dsp.3_Intron|uc002dtf.2_Intron|LOC440354_uc010bza.1_Intron|LOC440354_uc002dtj.2_Intron|LOC440354_uc010vds.1_Intron					SubName: Full=Putative uncharacterized protein ENSP00000369970; Flags: Fragment;												0																		---	---	---	---
CDH3	1001	broad.mit.edu	37	16	68713597	68713598	+	Intron	INS	-	AA	AA	rs71382055		TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:68713597_68713598insAA	uc002ewf.2	+						CDH3_uc010vli.1_Intron	NM_001793	NP_001784			cadherin 3, type 1 preproprotein						adherens junction organization|cell junction assembly|homophilic cell adhesion|response to stimulus|visual perception	integral to membrane	calcium ion binding	p.?(1)		ovary(3)|breast(1)|skin(1)	5		Ovarian(137;0.0564)		OV - Ovarian serous cystadenocarcinoma(108;0.000782)|Epithelial(162;0.0054)|all cancers(182;0.0384)														---	---	---	---
ARID3A	1820	broad.mit.edu	37	19	966459	966459	+	Intron	DEL	A	-	-	rs71335324		TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:966459delA	uc002lql.2	+							NM_005224	NP_005215			AT rich interactive domain 3A (BRIGHT- like)							cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity				0		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)														---	---	---	---
AKAP8	10270	broad.mit.edu	37	19	15473194	15473195	+	Intron	INS	-	TT	TT	rs12980485		TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15473194_15473195insTT	uc002nav.2	-						AKAP8_uc010dzy.2_Intron|AKAP8_uc010dzz.1_Intron|AKAP8_uc010xog.1_Intron	NM_005858	NP_005849			A-kinase anchor protein 8						signal transduction	nuclear matrix				ovary(1)|breast(1)	2																		---	---	---	---
UNC13A	23025	broad.mit.edu	37	19	17750845	17750846	+	Intron	INS	-	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17750845_17750846insT	uc002nhd.2	-							NM_001080421	NP_001073890			unc-13 homolog A						exocytosis|intracellular signal transduction	cell junction|cytoplasm|presynaptic membrane	metal ion binding			ovary(3)	3																		---	---	---	---
MLL4	9757	broad.mit.edu	37	19	36229073	36229075	+	In_Frame_Del	DEL	AGA	-	-			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36229073_36229075delAGA	uc010eei.2	+	37	7853_7855	c.7853_7855delAGA	c.(7852-7857)GAGAAG>GAG	p.K2619del		NM_014727	NP_055542	Q9UMN6	MLL4_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 4	2619	SET.				chromatin-mediated maintenance of transcription		DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			central_nervous_system(6)|breast(2)|ovary(1)|kidney(1)|skin(1)	11	all_lung(56;3.33e-07)|Lung NSC(56;5.02e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)															---	---	---	---
KCNQ2	3785	broad.mit.edu	37	20	62074046	62074048	+	Intron	DEL	CAC	-	-			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62074046_62074048delCAC	uc002yey.1	-						KCNQ2_uc002yez.1_Intron|KCNQ2_uc002yfa.1_Intron|KCNQ2_uc002yfb.1_Intron|KCNQ2_uc011aax.1_Intron|KCNQ2_uc002yfc.1_Intron	NM_172107	NP_742105			potassium voltage-gated channel KQT-like protein						axon guidance|synaptic transmission	voltage-gated potassium channel complex	voltage-gated potassium channel activity			upper_aerodigestive_tract(1)|ovary(1)	2	all_cancers(38;1.24e-11)		BRCA - Breast invasive adenocarcinoma(10;1.04e-05)		Amitriptyline(DB00321)													---	---	---	---
TMPRSS2	7113	broad.mit.edu	37	21	42837923	42837924	+	3'UTR	DEL	AG	-	-			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:42837923_42837924delAG	uc002yzj.2	-	14					TMPRSS2_uc010gor.2_3'UTR	NM_005656	NP_005647			transmembrane protease, serine 2 isoform 2						proteolysis	cytoplasm|extracellular region|integral to plasma membrane	scavenger receptor activity|serine-type endopeptidase activity		TMPRSS2/ERG(2499)|TMPRSS2/ETV1(24)	prostate(2523)|central_nervous_system(1)	2524		Prostate(19;4.48e-07)|all_epithelial(19;0.031)						T	ERG|ETV1|ETV4|ETV5	prostate 								---	---	---	---
MEI1	150365	broad.mit.edu	37	22	42101712	42101713	+	Intron	INS	-	T	T	rs71946635		TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42101712_42101713insT	uc003baz.1	+						MEI1_uc003bay.3_Intron|MEI1_uc011apd.1_Intron	NM_152513	NP_689726			meiosis defective 1								binding			central_nervous_system(1)|skin(1)	2																		---	---	---	---
NUP62CL	54830	broad.mit.edu	37	X	106397637	106397637	+	Intron	DEL	A	-	-	rs67091647		TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:106397637delA	uc004ena.2	-						NUP62CL_uc004enb.2_Intron	NM_017681	NP_060151			nucleoporin 62kDa C-terminal like						protein transport	nuclear pore	structural constituent of nuclear pore				0																		---	---	---	---
BRDT	676	broad.mit.edu	37	1	92457969	92457970	+	Intron	DEL	CA	-	-	rs150514940		TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:92457969_92457970delCA	uc001dok.3	+						BRDT_uc001dol.3_Intron|BRDT_uc010osz.1_Intron|BRDT_uc009wdf.2_Intron|BRDT_uc010ota.1_Intron|BRDT_uc010otb.1_Intron|BRDT_uc001dom.3_Intron	NM_207189	NP_997072			testis-specific bromodomain protein						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein serine/threonine kinase activity|transcription coactivator activity			stomach(2)|ovary(1)|lung(1)	4		all_lung(203;0.00531)|Lung NSC(277;0.0194)		all cancers(265;0.0228)|Epithelial(280;0.133)														---	---	---	---
PDE4DIP	9659	broad.mit.edu	37	1	144853333	144853334	+	Intron	INS	-	AA	AA	rs149112816		TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144853333_144853334insAA	uc001elw.3	-						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001elx.3_Intron|PDE4DIP_uc001elv.3_Intron	NM_014644	NP_055459			phosphodiesterase 4D interacting protein isoform						cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)				T	PDGFRB	MPD								---	---	---	---
Unknown	0	broad.mit.edu	37	2	73956941	73956941	+	IGR	DEL	T	-	-			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:73956941delT								NAT8B (28474 upstream) : TPRKB (16 downstream)																																			---	---	---	---
RGPD5	84220	broad.mit.edu	37	2	113147931	113147933	+	Intron	DEL	ATG	-	-			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:113147931_113147933delATG	uc002ths.1	-						RGPD8_uc010fkk.1_Intron|RGPD5_uc002tht.1_Intron	NM_005054	NP_005045			RANBP2-like and GRIP domain containing 5 isoform						intracellular transport	cytoplasm	binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	133018713	133018714	+	IGR	DEL	GG	-	-	rs144729406		TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133018713_133018714delGG								NCRNA00164 (3171 upstream) : GPR39 (155433 downstream)																																			---	---	---	---
IPO11	51194	broad.mit.edu	37	5	61763288	61763290	+	Intron	DEL	ATA	-	-	rs143944846		TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:61763288_61763290delATA	uc003jtc.2	+						IPO11_uc011cqr.1_Intron|IPO11_uc003jtb.1_Intron	NM_016338	NP_057422			Ran binding protein 11 isoform 2							cytoplasm|nucleus	protein binding			lung(2)|skin(2)	4		Lung NSC(810;8.99e-06)|Prostate(74;0.0235)|Ovarian(174;0.0511)|Breast(144;0.077)		Lung(70;0.0613)														---	---	---	---
PPWD1	23398	broad.mit.edu	37	5	64859431	64859450	+	Intron	DEL	GTGCCCTCAGAACAGAGGGC	-	-	rs149293765	by1000genomes	TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:64859431_64859450delGTGCCCTCAGAACAGAGGGC	uc003jtv.3	+						PPWD1_uc011cqv.1_Intron|PPWD1_uc011cqw.1_Intron|CENPK_uc003jts.2_5'Flank|CENPK_uc003jtt.2_5'Flank|CENPK_uc003jtu.2_5'Flank	NM_015342	NP_056157			peptidylprolyl isomerase domain and WD repeat						protein folding	catalytic step 2 spliceosome	peptidyl-prolyl cis-trans isomerase activity			ovary(1)	1		Lung NSC(167;7.21e-05)|Prostate(74;0.0174)|Ovarian(174;0.186)		Lung(70;0.00451)														---	---	---	---
RAC1	5879	broad.mit.edu	37	7	6442143	6442144	+	3'UTR	INS	-	A	A	rs59685280		TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6442143_6442144insA	uc003spx.2	+	6					RAC1_uc003spw.2_3'UTR	NM_006908	NP_008839			ras-related C3 botulinum toxin substrate 1						actin filament polymerization|apoptosis|axon guidance|cell motility|cell-matrix adhesion|induction of apoptosis by extracellular signals|inflammatory response|lamellipodium assembly|localization within membrane|negative regulation of interleukin-23 production|negative regulation of receptor-mediated endocytosis|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of lamellipodium assembly|positive regulation of Rho protein signal transduction|regulation of cell migration|regulation of defense response to virus by virus|regulation of hydrogen peroxide metabolic process|regulation of respiratory burst|ruffle organization|small GTPase mediated signal transduction|T cell costimulation|viral reproduction	cytosol|melanosome|plasma membrane	GTP binding|GTP-dependent protein binding|GTPase activity|thioesterase binding			lung(2)	2		Ovarian(82;0.0776)		UCEC - Uterine corpus endometrioid carcinoma (126;0.104)	Pravastatin(DB00175)|Simvastatin(DB00641)													---	---	---	---
DFNA5	1687	broad.mit.edu	37	7	24783982	24783982	+	Intron	DEL	C	-	-	rs71582854		TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:24783982delC	uc010kus.1	-						DFNA5_uc003swz.2_Intron|DFNA5_uc003sxa.1_Intron|DFNA5_uc010kut.1_Intron|DFNA5_uc003sxb.2_Intron|DFNA5_uc003sxc.2_3'UTR	NM_001127453	NP_001120925			deafness, autosomal dominant 5 protein isoform						sensory perception of sound					ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	68728773	68728775	+	Intron	DEL	ATG	-	-	rs62554276		TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68728773_68728775delATG	uc004aez.1	+						uc004afa.1_Intron|uc010mnp.1_Intron					Homo sapiens cDNA, FLJ18209.																														---	---	---	---
DENND1A	57706	broad.mit.edu	37	9	126414137	126414137	+	Intron	DEL	A	-	-	rs35363899		TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:126414137delA	uc004bnz.1	-						DENND1A_uc011lzl.1_Intron|DENND1A_uc004bny.1_Intron|DENND1A_uc011lzm.1_Intron|DENND1A_uc004boa.1_Intron|DENND1A_uc004bob.1_Intron|DENND1A_uc004boc.2_Intron	NM_020946	NP_065997			DENN/MADD domain containing 1A isoform 1							cell junction|clathrin coated vesicle membrane|presynaptic membrane	guanyl-nucleotide exchange factor activity			ovary(2)	2																		---	---	---	---
TCF7L2	6934	broad.mit.edu	37	10	114710508	114710508	+	5'UTR	DEL	A	-	-			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:114710508delA	uc001lae.3	+	1					TCF7L2_uc001lac.3_5'UTR|TCF7L2_uc010qrk.1_5'UTR|TCF7L2_uc010qrl.1_5'UTR|TCF7L2_uc010qrm.1_5'UTR|TCF7L2_uc010qrn.1_5'UTR|TCF7L2_uc001lad.3_5'UTR|TCF7L2_uc001lag.3_5'UTR|TCF7L2_uc001laf.3_5'UTR|TCF7L2_uc010qro.1_5'UTR|TCF7L2_uc001lah.2_5'UTR|TCF7L2_uc010qrp.1_5'UTR|TCF7L2_uc010qrq.1_5'UTR|TCF7L2_uc010qrr.1_5'Flank|TCF7L2_uc010qrs.1_5'Flank|TCF7L2_uc010qrt.1_5'Flank	NM_001146274	NP_001139746			transcription factor 7-like 2 isoform 1						anti-apoptosis|blood vessel development|canonical Wnt receptor signaling pathway involved in positive regulation of epithelial to mesenchymal transition|cell cycle arrest|cell proliferation|fat cell differentiation|glucose homeostasis|maintenance of DNA repeat elements|myoblast cell fate commitment|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|pancreas development|positive regulation of heparan sulfate proteoglycan biosynthetic process|positive regulation of insulin secretion|positive regulation of protein binding|positive regulation of protein export from nucleus|positive regulation of protein kinase B signaling cascade|positive regulation of transcription from RNA polymerase II promoter|regulation of hormone metabolic process|regulation of smooth muscle cell proliferation|response to glucose stimulus	beta-catenin-TCF7L2 complex|PML body|protein-DNA complex	armadillo repeat domain binding|beta-catenin binding|gamma-catenin binding|nuclear hormone receptor binding|protein kinase binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding|transcription regulatory region DNA binding			large_intestine(3)|ovary(1)	4		Breast(234;0.058)|Colorectal(252;0.0615)		Epithelial(162;0.00554)|all cancers(201;0.02)														---	---	---	---
XRRA1	143570	broad.mit.edu	37	11	74641436	74641437	+	Intron	INS	-	A	A	rs113880146		TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:74641436_74641437insA	uc009yub.2	-						XRRA1_uc001ovm.2_Intron|XRRA1_uc001ovo.2_Intron|XRRA1_uc001ovq.3_Intron|XRRA1_uc001ovp.3_Intron|XRRA1_uc001ovr.2_Intron	NM_182969	NP_892014			X-ray radiation resistance associated 1						response to X-ray	cytoplasm|nucleus				central_nervous_system(1)	1																		---	---	---	---
KDM5A	5927	broad.mit.edu	37	12	415910	415910	+	Intron	DEL	A	-	-			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:415910delA	uc001qif.1	-						KDM5A_uc001qie.1_Intron	NM_001042603	NP_001036068			retinoblastoma binding protein 2 isoform 1						chromatin modification|multicellular organismal development|positive regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	cytoplasm|nucleolus	DNA binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(2)|ovary(1)	3								T 	NUP98	AML								---	---	---	---
KDM2B	84678	broad.mit.edu	37	12	122018158	122018158	+	Intron	DEL	G	-	-			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122018158delG	uc001uat.2	-						KDM2B_uc001uas.2_5'UTR|KDM2B_uc001uau.2_Intron|KDM2B_uc001uav.3_Intron	NM_032590	NP_115979			F-box and leucine-rich repeat protein 10 isoform						embryonic camera-type eye morphogenesis|fourth ventricle development|histone H2A monoubiquitination|initiation of neural tube closure|lateral ventricle development|midbrain development|midbrain-hindbrain boundary morphogenesis|negative regulation of neural precursor cell proliferation|negative regulation of neuron apoptosis|negative regulation of transcription from RNA polymerase II promoter|spermatogenesis|third ventricle development|transcription, DNA-dependent	nucleolus	DNA binding|histone demethylase activity (H3-K36 specific)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|rRNA binding|zinc ion binding			ovary(1)|skin(1)	2																		---	---	---	---
FNTB	2342	broad.mit.edu	37	14	65507348	65507348	+	Intron	DEL	G	-	-			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:65507348delG	uc001xia.2	+						FNTB_uc010tsl.1_Intron|FNTB_uc010tsm.1_Intron|MAX_uc001xic.1_Intron|FNTB_uc001xid.2_Intron|FNTB_uc010tso.1_Intron	NM_002028	NP_002019			farnesyltransferase, CAAX box, beta						protein farnesylation	microtubule associated complex	protein binding|protein farnesyltransferase activity			ovary(1)	1				all cancers(60;0.00115)|OV - Ovarian serous cystadenocarcinoma(108;0.00412)|BRCA - Breast invasive adenocarcinoma(234;0.011)														---	---	---	---
VIPAR	63894	broad.mit.edu	37	14	77910667	77910668	+	Frame_Shift_Del	DEL	TC	-	-			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:77910667_77910668delTC	uc001xtt.1	-	9	859_860	c.521_522delGA	c.(520-522)AGAfs	p.R174fs	VIPAR_uc001xtu.1_Frame_Shift_Del_p.R174fs|VIPAR_uc010tvj.1_Frame_Shift_Del_p.R125fs|VIPAR_uc001xtv.1_Frame_Shift_Del_p.R174fs	NM_022067	NP_071350	Q9H9C1	VIPAR_HUMAN	hypothetical protein LOC63894	174					endosome to lysosome transport|intracellular protein transport|regulation of transcription, DNA-dependent|transcription, DNA-dependent	early endosome|late endosome|recycling endosome	protein binding			central_nervous_system(1)	1																		---	---	---	---
TMC7	79905	broad.mit.edu	37	16	19020932	19020932	+	Intron	DEL	A	-	-			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:19020932delA	uc002dfq.2	+						TMC7_uc010vao.1_Intron|TMC7_uc002dfp.2_Intron|TMC7_uc010vap.1_Intron	NM_024847	NP_079123			transmembrane channel-like 7 isoform a							integral to membrane				skin(2)|ovary(1)	3																		---	---	---	---
BOLA2	552900	broad.mit.edu	37	16	29565636	29565637	+	Intron	INS	-	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:29565636_29565637insA	uc010bzb.1	-						LOC440354_uc002dsp.3_Intron|uc002dtf.2_Intron|LOC440354_uc010bza.1_Intron|LOC440354_uc002dtj.2_Intron|LOC440354_uc010vds.1_Intron					SubName: Full=Putative uncharacterized protein ENSP00000369970; Flags: Fragment;												0																		---	---	---	---
CDH3	1001	broad.mit.edu	37	16	68713597	68713598	+	Intron	INS	-	AA	AA	rs71382055		TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:68713597_68713598insAA	uc002ewf.2	+						CDH3_uc010vli.1_Intron	NM_001793	NP_001784			cadherin 3, type 1 preproprotein						adherens junction organization|cell junction assembly|homophilic cell adhesion|response to stimulus|visual perception	integral to membrane	calcium ion binding	p.?(1)		ovary(3)|breast(1)|skin(1)	5		Ovarian(137;0.0564)		OV - Ovarian serous cystadenocarcinoma(108;0.000782)|Epithelial(162;0.0054)|all cancers(182;0.0384)														---	---	---	---
ARID3A	1820	broad.mit.edu	37	19	966459	966459	+	Intron	DEL	A	-	-	rs71335324		TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:966459delA	uc002lql.2	+							NM_005224	NP_005215			AT rich interactive domain 3A (BRIGHT- like)							cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity				0		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)														---	---	---	---
AKAP8	10270	broad.mit.edu	37	19	15473194	15473195	+	Intron	INS	-	TT	TT	rs12980485		TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15473194_15473195insTT	uc002nav.2	-						AKAP8_uc010dzy.2_Intron|AKAP8_uc010dzz.1_Intron|AKAP8_uc010xog.1_Intron	NM_005858	NP_005849			A-kinase anchor protein 8						signal transduction	nuclear matrix				ovary(1)|breast(1)	2																		---	---	---	---
UNC13A	23025	broad.mit.edu	37	19	17750845	17750846	+	Intron	INS	-	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17750845_17750846insT	uc002nhd.2	-							NM_001080421	NP_001073890			unc-13 homolog A						exocytosis|intracellular signal transduction	cell junction|cytoplasm|presynaptic membrane	metal ion binding			ovary(3)	3																		---	---	---	---
MLL4	9757	broad.mit.edu	37	19	36229073	36229075	+	In_Frame_Del	DEL	AGA	-	-			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36229073_36229075delAGA	uc010eei.2	+	37	7853_7855	c.7853_7855delAGA	c.(7852-7857)GAGAAG>GAG	p.K2619del		NM_014727	NP_055542	Q9UMN6	MLL4_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 4	2619	SET.				chromatin-mediated maintenance of transcription		DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			central_nervous_system(6)|breast(2)|ovary(1)|kidney(1)|skin(1)	11	all_lung(56;3.33e-07)|Lung NSC(56;5.02e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)															---	---	---	---
KCNQ2	3785	broad.mit.edu	37	20	62074046	62074048	+	Intron	DEL	CAC	-	-			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62074046_62074048delCAC	uc002yey.1	-						KCNQ2_uc002yez.1_Intron|KCNQ2_uc002yfa.1_Intron|KCNQ2_uc002yfb.1_Intron|KCNQ2_uc011aax.1_Intron|KCNQ2_uc002yfc.1_Intron	NM_172107	NP_742105			potassium voltage-gated channel KQT-like protein						axon guidance|synaptic transmission	voltage-gated potassium channel complex	voltage-gated potassium channel activity			upper_aerodigestive_tract(1)|ovary(1)	2	all_cancers(38;1.24e-11)		BRCA - Breast invasive adenocarcinoma(10;1.04e-05)		Amitriptyline(DB00321)													---	---	---	---
TMPRSS2	7113	broad.mit.edu	37	21	42837923	42837924	+	3'UTR	DEL	AG	-	-			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:42837923_42837924delAG	uc002yzj.2	-	14					TMPRSS2_uc010gor.2_3'UTR	NM_005656	NP_005647			transmembrane protease, serine 2 isoform 2						proteolysis	cytoplasm|extracellular region|integral to plasma membrane	scavenger receptor activity|serine-type endopeptidase activity		TMPRSS2/ERG(2499)|TMPRSS2/ETV1(24)	prostate(2523)|central_nervous_system(1)	2524		Prostate(19;4.48e-07)|all_epithelial(19;0.031)						T	ERG|ETV1|ETV4|ETV5	prostate 								---	---	---	---
MEI1	150365	broad.mit.edu	37	22	42101712	42101713	+	Intron	INS	-	T	T	rs71946635		TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42101712_42101713insT	uc003baz.1	+						MEI1_uc003bay.3_Intron|MEI1_uc011apd.1_Intron	NM_152513	NP_689726			meiosis defective 1								binding			central_nervous_system(1)|skin(1)	2																		---	---	---	---
NUP62CL	54830	broad.mit.edu	37	X	106397637	106397637	+	Intron	DEL	A	-	-	rs67091647		TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:106397637delA	uc004ena.2	-						NUP62CL_uc004enb.2_Intron	NM_017681	NP_060151			nucleoporin 62kDa C-terminal like						protein transport	nuclear pore	structural constituent of nuclear pore				0																		---	---	---	---
CLCN6	1185	broad.mit.edu	37	1	11889289	11889289	+	Silent	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11889289C>A	uc001ate.3	+	13	1271	c.1158C>A	c.(1156-1158)ACC>ACA	p.T386T	CLCN6_uc009vnh.1_Missense_Mutation_p.R331S|CLCN6_uc010oat.1_Silent_p.T102T|CLCN6_uc010oau.1_Silent_p.T364T	NM_001286	NP_001277	P51797	CLCN6_HUMAN	chloride channel 6 isoform ClC-6a	386	Helical; (By similarity).				cell volume homeostasis|signal transduction	endosome membrane|integral to membrane	antiporter activity|ATP binding|voltage-gated chloride channel activity				0	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.13e-06)|COAD - Colon adenocarcinoma(227;0.000274)|BRCA - Breast invasive adenocarcinoma(304;0.000311)|Kidney(185;0.000816)|KIRC - Kidney renal clear cell carcinoma(229;0.00268)|STAD - Stomach adenocarcinoma(313;0.00743)|READ - Rectum adenocarcinoma(331;0.0649)														---	---	---	---
AGMAT	79814	broad.mit.edu	37	1	15901266	15901266	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:15901266G>T	uc001awv.1	-	6	1114	c.971C>A	c.(970-972)CCG>CAG	p.P324Q	DNAJC16_uc001awu.2_RNA	NM_024758	NP_079034	Q9BSE5	SPEB_HUMAN	agmatine ureohydrolase (agmatinase) precursor	324					putrescine biosynthetic process|spermidine biosynthetic process	mitochondrion	agmatinase activity|metal ion binding			skin(1)	1		Breast(348;0.000207)|Colorectal(325;0.000258)|Lung NSC(340;0.000359)|all_lung(284;0.000486)|Renal(390;0.000518)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.93e-07)|COAD - Colon adenocarcinoma(227;3.91e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000121)|KIRC - Kidney renal clear cell carcinoma(229;0.00257)|STAD - Stomach adenocarcinoma(313;0.00734)|READ - Rectum adenocarcinoma(331;0.0649)														---	---	---	---
PQLC2	54896	broad.mit.edu	37	1	19644335	19644335	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:19644335C>A	uc001bby.2	+	3	516	c.164C>A	c.(163-165)CCC>CAC	p.P55H	PQLC2_uc001bbz.2_Intron|PQLC2_uc001bca.2_Missense_Mutation_p.P55H|PQLC2_uc001bcb.2_Intron|PQLC2_uc001bcc.2_5'UTR	NM_017765	NP_060235	Q6ZP29	PQLC2_HUMAN	PQ loop repeat containing 2 isoform 1	55	PQ-loop 1.|Helical; (Potential).					integral to membrane					0		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Breast(348;0.00049)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00466)|BRCA - Breast invasive adenocarcinoma(304;1.89e-05)|Kidney(64;0.000177)|GBM - Glioblastoma multiforme(114;0.00124)|KIRC - Kidney renal clear cell carcinoma(64;0.00262)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)														---	---	---	---
PLA2G5	5322	broad.mit.edu	37	1	20417065	20417065	+	Silent	SNP	C	A	A	rs139841773	byFrequency	TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:20417065C>A	uc001bcy.2	+	5	565	c.297C>A	c.(295-297)CCC>CCA	p.P99P	PLA2G5_uc001bcw.2_RNA|PLA2G5_uc001bcx.2_Silent_p.P130P	NM_000929	NP_000920	P39877	PA2G5_HUMAN	phospholipase A2, group V precursor	99					lipid catabolic process	extracellular region	calcium ion binding|calcium-dependent phospholipase A2 activity			skin(1)	1		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000249)|Lung NSC(340;0.000287)|Breast(348;0.000812)|Ovarian(437;0.00328)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|COAD - Colon adenocarcinoma(152;1.22e-05)|BRCA - Breast invasive adenocarcinoma(304;8.15e-05)|Kidney(64;0.000184)|GBM - Glioblastoma multiforme(114;0.00089)|KIRC - Kidney renal clear cell carcinoma(64;0.0027)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0652)														---	---	---	---
PTPRU	10076	broad.mit.edu	37	1	29631906	29631906	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:29631906C>A	uc001bru.2	+	19	2926	c.2816C>A	c.(2815-2817)CCC>CAC	p.P939H	PTPRU_uc001brv.2_Missense_Mutation_p.P929H|PTPRU_uc001brw.2_Missense_Mutation_p.P929H|PTPRU_uc009vtq.2_Missense_Mutation_p.P929H|PTPRU_uc009vtr.2_Missense_Mutation_p.P929H	NM_005704	NP_005695	Q92729	PTPRU_HUMAN	protein tyrosine phosphatase, receptor type, U	939	Tyrosine-protein phosphatase 1.|Cytoplasmic (Potential).				canonical Wnt receptor signaling pathway|cell differentiation|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of transcription, DNA-dependent|protein localization at cell surface|transmembrane receptor protein tyrosine phosphatase signaling pathway	cell-cell junction|integral to plasma membrane	beta-catenin binding|transmembrane receptor protein tyrosine phosphatase activity			large_intestine(3)|ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	7		Colorectal(325;0.000399)|Lung NSC(340;0.00953)|all_lung(284;0.0112)|Breast(348;0.0126)|all_neural(195;0.0199)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;6.99e-07)|COAD - Colon adenocarcinoma(152;3.18e-05)|STAD - Stomach adenocarcinoma(196;0.0234)|READ - Rectum adenocarcinoma(331;0.0686)|BRCA - Breast invasive adenocarcinoma(304;0.0871)														---	---	---	---
MACF1	23499	broad.mit.edu	37	1	39812874	39812874	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39812874C>A	uc010oiu.1	+	5	6258	c.6127C>A	c.(6127-6129)CTG>ATG	p.L2043M	MACF1_uc010ois.1_Intron|MACF1_uc001cda.1_Intron|MACF1_uc001cdc.1_Intron|MACF1_uc001cdb.1_Intron	NM_033044	NP_149033	Q9UPN3	MACF1_HUMAN	microfilament and actin filament cross-linker	3608					cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding			ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)															---	---	---	---
MED8	112950	broad.mit.edu	37	1	43851858	43851858	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43851858G>A	uc001cjg.3	-	6	581	c.533C>T	c.(532-534)ACT>ATT	p.T178I	MED8_uc001cje.1_Missense_Mutation_p.T178I|MED8_uc001cjf.3_Missense_Mutation_p.T89I	NM_201542	NP_963836	Q96G25	MED8_HUMAN	mediator complex subunit 8 isoform 1	178					regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	mediator complex					0	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)																---	---	---	---
ASB17	127247	broad.mit.edu	37	1	76397883	76397883	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:76397883G>T	uc001dhe.1	-	1	234	c.94C>A	c.(94-96)CTA>ATA	p.L32I	ASB17_uc001dhf.1_RNA	NM_080868	NP_543144	Q8WXJ9	ASB17_HUMAN	ankyrin repeat and SOCS box-containing 17	32					intracellular signal transduction					ovary(1)	1																		---	---	---	---
ABCD3	5825	broad.mit.edu	37	1	94933463	94933463	+	Intron	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:94933463G>T	uc001dqn.3	+						ABCD3_uc001dqm.3_Intron|ABCD3_uc010oto.1_Intron|ABCD3_uc010otp.1_Intron|ABCD3_uc009wdr.2_Intron	NM_002858	NP_002849			ATP-binding cassette, sub-family D, member 3						peroxisomal long-chain fatty acid import|peroxisome organization	cytosol|integral to peroxisomal membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			skin(1)	1		all_lung(203;0.000434)|Lung NSC(277;0.0019)		all cancers(265;0.0261)|Epithelial(280;0.165)														---	---	---	---
RBM15	64783	broad.mit.edu	37	1	110884012	110884012	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:110884012C>A	uc001dzl.1	+	1	2068	c.1985C>A	c.(1984-1986)CCA>CAA	p.P662Q	RBM15_uc001dzm.1_Missense_Mutation_p.P662Q|uc001dzj.2_5'Flank	NM_022768	NP_073605	Q96T37	RBM15_HUMAN	RNA binding motif protein 15	662	Arg-rich.				interspecies interaction between organisms	nucleus	nucleotide binding|protein binding|RNA binding			ovary(3)	3		all_cancers(81;2.89e-06)|all_epithelial(167;2.96e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)|Breast(1374;0.0634)		BRCA - Breast invasive adenocarcinoma(282;0.000224)|Epithelial(280;0.000476)|Kidney(133;0.000539)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|all cancers(265;0.00144)|Lung(183;0.0238)|Colorectal(144;0.103)|LUSC - Lung squamous cell carcinoma(189;0.135)				T	MKL1	acute megakaryocytic leukemia								---	---	---	---
CHI3L2	1117	broad.mit.edu	37	1	111781383	111781383	+	Silent	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:111781383G>T	uc001eam.2	+	8	818	c.747G>T	c.(745-747)GTG>GTT	p.V249V	CHI3L2_uc001ean.2_Silent_p.V239V|CHI3L2_uc001eao.2_Silent_p.V170V|CHI3L2_uc009wga.2_Silent_p.V170V	NM_004000	NP_003991	Q15782	CH3L2_HUMAN	chitinase 3-like 2 isoform a	249					chitin catabolic process	extracellular space	cation binding|chitinase activity			central_nervous_system(1)	1		all_cancers(81;1.89e-05)|all_epithelial(167;7.36e-06)|all_lung(203;0.00018)|Lung NSC(277;0.000359)		Lung(183;0.0171)|Colorectal(144;0.0387)|all cancers(265;0.0464)|LUSC - Lung squamous cell carcinoma(189;0.0872)|Epithelial(280;0.0994)|COAD - Colon adenocarcinoma(174;0.141)														---	---	---	---
PI4KB	5298	broad.mit.edu	37	1	151271323	151271323	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151271323C>A	uc001ext.2	-	9	2391	c.1976G>T	c.(1975-1977)GGG>GTG	p.G659V	PI4KB_uc001exr.2_Missense_Mutation_p.G671V|PI4KB_uc001exs.2_Missense_Mutation_p.G644V|PI4KB_uc001exu.2_Missense_Mutation_p.G644V|PI4KB_uc010pcw.1_Missense_Mutation_p.G327V	NM_002651	NP_002642	Q9UBF8	PI4KB_HUMAN	catalytic phosphatidylinositol 4-kinase beta	659	PI3K/PI4K.				phosphatidylinositol biosynthetic process|phosphatidylinositol-mediated signaling|receptor-mediated endocytosis	endosome|Golgi apparatus|mitochondrial outer membrane|perinuclear region of cytoplasm|rough endoplasmic reticulum membrane	1-phosphatidylinositol 4-kinase activity|ATP binding|protein binding			ovary(2)|skin(2)	4	Lung SC(34;0.00471)|Ovarian(49;0.0147)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)															---	---	---	---
SMCP	4184	broad.mit.edu	37	1	152857173	152857173	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152857173C>A	uc001fat.2	+	2	420	c.275C>A	c.(274-276)CCG>CAG	p.P92Q		NM_030663	NP_109588	P49901	MCSP_HUMAN	sperm mitochondria-associated cysteine-rich	92					penetration of zona pellucida|sperm motility	mitochondrial membrane					0	Lung NSC(65;3.97e-29)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)															---	---	---	---
LMNA	4000	broad.mit.edu	37	1	156104721	156104721	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156104721G>T	uc001fni.2	+	4	1014	c.765G>T	c.(763-765)CAG>CAT	p.Q255H	LMNA_uc001fnf.1_Missense_Mutation_p.Q255H|LMNA_uc001fng.2_Missense_Mutation_p.Q255H|LMNA_uc001fnh.2_Missense_Mutation_p.Q255H|LMNA_uc009wro.1_Missense_Mutation_p.Q255H|LMNA_uc010pgz.1_Missense_Mutation_p.Q143H|LMNA_uc001fnj.2_Missense_Mutation_p.Q174H|LMNA_uc001fnk.2_Missense_Mutation_p.Q156H|LMNA_uc009wrp.2_5'Flank|LMNA_uc010pha.1_5'Flank	NM_170707	NP_733821	P02545	LMNA_HUMAN	lamin A/C isoform 1 precursor	255	Coil 2.|Rod.				cellular component disassembly involved in apoptosis|cellular response to hypoxia|establishment or maintenance of microtubule cytoskeleton polarity|muscle organ development|positive regulation of cell aging|regulation of apoptosis|regulation of cell migration	cytoplasm|lamin filament|nuclear envelope|nuclear envelope|perinuclear region of cytoplasm	protein binding|structural molecule activity|structural molecule activity			ovary(2)	2	Hepatocellular(266;0.158)													Werner_syndrome|Hutchinson-Gilford_Progeria_Syndrome				---	---	---	---
IFI16	3428	broad.mit.edu	37	1	158990198	158990198	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158990198G>T	uc001ftg.2	+	6	1330	c.1040G>T	c.(1039-1041)GGG>GTG	p.G347V	IFI16_uc010pis.1_Missense_Mutation_p.G291V	NM_005531	NP_005522	Q16666	IF16_HUMAN	interferon, gamma-inducible protein 16	347	HIN-200 1.				cell proliferation|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|monocyte differentiation|negative regulation of transcription, DNA-dependent|response to virus|transcription, DNA-dependent	cytoplasm|nuclear speck|nucleolus	double-stranded DNA binding|protein binding			ovary(1)	1	all_hematologic(112;0.0429)																	---	---	---	---
LY9	4063	broad.mit.edu	37	1	160783561	160783561	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160783561A>G	uc001fwu.2	+	3	640	c.590A>G	c.(589-591)CAT>CGT	p.H197R	LY9_uc010pjs.1_Missense_Mutation_p.H197R|LY9_uc001fwv.2_Missense_Mutation_p.H197R|LY9_uc001fww.2_Missense_Mutation_p.H197R|LY9_uc001fwx.2_Missense_Mutation_p.H197R|LY9_uc001fwy.1_Missense_Mutation_p.H99R|LY9_uc001fwz.2_5'Flank	NM_002348	NP_002339	Q9HBG7	LY9_HUMAN	lymphocyte antigen 9 isoform a	197	Extracellular (Potential).|Ig-like C2-type 1.				cell adhesion|immunoglobulin mediated immune response	integral to membrane				ovary(1)	1	all_cancers(52;2.72e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00737)															---	---	---	---
USF1	7391	broad.mit.edu	37	1	161009753	161009753	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161009753C>A	uc001fxi.2	-	11	1085	c.890G>T	c.(889-891)CGG>CTG	p.R297L	F11R_uc010pjw.1_5'Flank|F11R_uc001fxf.3_5'Flank|TSTD1_uc010pjx.1_5'Flank|TSTD1_uc009wtw.2_5'Flank|TSTD1_uc001fxh.3_5'Flank|USF1_uc001fxj.2_Missense_Mutation_p.R238L	NM_007122	NP_009053	P22415	USF1_HUMAN	upstream stimulatory factor 1 isoform 1	297					cellular response to insulin stimulus|glucose homeostasis|late viral mRNA transcription|lipid homeostasis|positive regulation of transcription from RNA polymerase II promoter by glucose|response to hypoxia|response to UV	transcription factor complex	bHLH transcription factor binding|histone deacetylase binding|protein heterodimerization activity|protein homodimerization activity|protein kinase binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity			upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	3	all_cancers(52;6.73e-18)|Breast(13;0.012)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00122)															---	---	---	---
OLFML2B	25903	broad.mit.edu	37	1	161968122	161968122	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161968122C>A	uc001gbu.2	-	6	1391	c.967G>T	c.(967-969)GGT>TGT	p.G323C	OLFML2B_uc010pkq.1_Missense_Mutation_p.G324C	NM_015441	NP_056256	Q68BL8	OLM2B_HUMAN	olfactomedin-like 2B precursor	323										skin(1)	1	all_hematologic(112;0.156)		BRCA - Breast invasive adenocarcinoma(70;0.0172)															---	---	---	---
SCYL3	57147	broad.mit.edu	37	1	169831833	169831833	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169831833C>A	uc001ggs.2	-	10	1259	c.1061G>T	c.(1060-1062)CGG>CTG	p.R354L	SCYL3_uc010plw.1_5'UTR|SCYL3_uc001ggt.2_Missense_Mutation_p.R354L|SCYL3_uc001ggu.2_RNA	NM_181093	NP_851607	Q8IZE3	PACE1_HUMAN	SCY1-like 3 isoform 2	354	HEAT 3.				cell migration	Golgi apparatus|lamellipodium	ATP binding|protein binding|protein kinase activity			ovary(1)|skin(1)	2	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)																	---	---	---	---
MYOC	4653	broad.mit.edu	37	1	171605172	171605172	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:171605172G>T	uc001ghu.2	-	3	1430	c.1408C>A	c.(1408-1410)CGC>AGC	p.R470S	MYOC_uc010pmk.1_Missense_Mutation_p.R412S	NM_000261	NP_000252	Q99972	MYOC_HUMAN	myocilin precursor	470	Olfactomedin-like.		R -> C (in GLC1A).|R -> H.		anatomical structure morphogenesis	cilium|extracellular space|rough endoplasmic reticulum	structural molecule activity			lung(1)	1	all_cancers(6;5.47e-10)|all_hematologic(923;0.088)|Acute lymphoblastic leukemia(37;0.181)																	---	---	---	---
DHX9	1660	broad.mit.edu	37	1	182853798	182853798	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:182853798G>T	uc001gpr.2	+	27	3474	c.3311G>T	c.(3310-3312)CGG>CTG	p.R1104L	DHX9_uc001gps.2_Missense_Mutation_p.R890L|DHX9_uc001gpt.2_Missense_Mutation_p.R383L|DHX9_uc009wyd.2_Missense_Mutation_p.R69L	NM_001357	NP_001348	Q08211	DHX9_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 9	1104					CRD-mediated mRNA stabilization|nuclear mRNA splicing, via spliceosome	centrosome|CRD-mediated mRNA stability complex|nucleolus|nucleoplasm|ribonucleoprotein complex	ATP binding|ATP-dependent DNA helicase activity|ATP-dependent RNA helicase activity|DNA binding|double-stranded RNA binding|protein binding			ovary(2)	2																		---	---	---	---
GLT25D2	23127	broad.mit.edu	37	1	183908174	183908174	+	Intron	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:183908174G>T	uc001gqr.2	-						GLT25D2_uc010poj.1_Intron|GLT25D2_uc001gqp.2_Intron|GLT25D2_uc001gqq.2_Intron|GLT25D2_uc001gqs.2_Intron	NM_015101	NP_055916			glycosyltransferase 25 domain containing 2						lipopolysaccharide biosynthetic process	endoplasmic reticulum lumen	procollagen galactosyltransferase activity			ovary(1)|breast(1)	2																		---	---	---	---
TPR	7175	broad.mit.edu	37	1	186330996	186330996	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186330996C>A	uc001grv.2	-	8	1092	c.795G>T	c.(793-795)AAG>AAT	p.K265N	TPR_uc010pop.1_Missense_Mutation_p.K341N	NM_003292	NP_003283	P12270	TPR_HUMAN	nuclear pore complex-associated protein TPR	265	Potential.				carbohydrate metabolic process|glucose transport|mitotic cell cycle spindle assembly checkpoint|mRNA transport|protein import into nucleus|regulation of glucose transport|seryl-tRNA aminoacylation|transmembrane transport|viral reproduction	condensed chromosome kinetochore|cytoplasm|nuclear membrane|nuclear pore|nucleoplasm	ATP binding|protein binding|serine-tRNA ligase activity			ovary(2)|lung(2)|urinary_tract(1)|central_nervous_system(1)|skin(1)	7		Breast(1374;0.000659)|Lung SC(1967;0.0262)|Prostate(1639;0.157)		Colorectal(1306;1.12e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00553)				T	NTRK1	papillary thyroid								---	---	---	---
LGR6	59352	broad.mit.edu	37	1	202249902	202249902	+	Intron	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:202249902C>A	uc001gxu.2	+						LGR6_uc001gxv.2_Intron|LGR6_uc009xab.2_Intron|LGR6_uc001gxw.2_Intron|LGR6_uc009xac.1_Intron	NM_001017403	NP_001017403			leucine-rich repeat-containing G protein-coupled							integral to membrane|plasma membrane	protein-hormone receptor activity			large_intestine(4)|ovary(3)|skin(2)|pancreas(1)	10																		---	---	---	---
PPP1R15B	84919	broad.mit.edu	37	1	204380537	204380537	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:204380537C>G	uc001hav.3	-	1	408	c.3G>C	c.(1-3)ATG>ATC	p.M1I		NM_032833	NP_116222	Q5SWA1	PR15B_HUMAN	protein phosphatase 1, regulatory subunit 15B	1					regulation of translation					ovary(1)|pancreas(1)	2	all_cancers(21;0.0032)|all_neural(3;0.0218)|Glioma(3;0.0382)|Breast(84;0.179)|all_epithelial(62;0.193)|Prostate(682;0.227)		all cancers(3;1.14e-29)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.139)															---	---	---	---
CNTN2	6900	broad.mit.edu	37	1	205038689	205038689	+	Silent	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:205038689G>T	uc001hbr.2	+	17	2465	c.2196G>T	c.(2194-2196)ACG>ACT	p.T732T	CNTN2_uc001hbq.1_Silent_p.T623T|CNTN2_uc001hbs.2_Silent_p.T520T	NM_005076	NP_005067	Q02246	CNTN2_HUMAN	contactin 2 precursor	732	Fibronectin type-III 2.				axon guidance|clustering of voltage-gated potassium channels	anchored to membrane|juxtaparanode region of axon|myelin sheath|node of Ranvier|synapse part	identical protein binding			ovary(1)	1	all_cancers(21;0.144)|Breast(84;0.0437)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)															---	---	---	---
PLXNA2	5362	broad.mit.edu	37	1	208270138	208270138	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:208270138C>A	uc001hgz.2	-	7	2580	c.1822G>T	c.(1822-1824)GGG>TGG	p.G608W		NM_025179	NP_079455	O75051	PLXA2_HUMAN	plexin A2 precursor	608	Extracellular (Potential).				axon guidance	integral to membrane|intracellular|plasma membrane				ovary(2)|central_nervous_system(1)	3				OV - Ovarian serous cystadenocarcinoma(81;0.199)														---	---	---	---
OBSCN	84033	broad.mit.edu	37	1	228466620	228466620	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:228466620G>T	uc009xez.1	+	26	7134	c.7090G>T	c.(7090-7092)GGT>TGT	p.G2364C	OBSCN_uc001hsn.2_Missense_Mutation_p.G2364C|OBSCN_uc001hsp.1_Missense_Mutation_p.G63C|OBSCN_uc001hsq.1_5'Flank	NM_001098623	NP_001092093	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and	2364	Ig-like 23.				apoptosis|cell differentiation|induction of apoptosis by extracellular signals|multicellular organismal development|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|M band|Z disc	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity|Rho guanyl-nucleotide exchange factor activity|structural constituent of muscle|titin binding			stomach(8)|large_intestine(7)|breast(5)|ovary(4)|skin(2)|central_nervous_system(1)|pancreas(1)	28		Prostate(94;0.0405)																---	---	---	---
EXO1	9156	broad.mit.edu	37	1	242016726	242016726	+	Silent	SNP	A	G	G			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:242016726A>G	uc001hzh.2	+	6	888	c.348A>G	c.(346-348)CGA>CGG	p.R116R	EXO1_uc001hzi.2_Silent_p.R116R|EXO1_uc001hzj.2_Silent_p.R116R|EXO1_uc009xgq.2_Silent_p.R116R	NM_130398	NP_569082	Q9UQ84	EXO1_HUMAN	exonuclease 1 isoform b	116					meiosis|mismatch repair	nucleus	double-stranded DNA specific 5'-3' exodeoxyribonuclease activity|flap endonuclease activity|metal ion binding|protein binding|protein binding|ribonuclease H activity|single-stranded DNA specific 5'-3' exodeoxyribonuclease activity			ovary(2)|lung(2)|skin(1)	5	Ovarian(103;0.103)	all_cancers(173;0.0555)	OV - Ovarian serous cystadenocarcinoma(106;0.0107)										Direct_reversal_of_damage|Editing_and_processing_nucleases					---	---	---	---
PXDN	7837	broad.mit.edu	37	2	1643143	1643143	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1643143C>G	uc002qxa.2	-	20	4068	c.4004G>C	c.(4003-4005)AGA>ACA	p.R1335T		NM_012293	NP_036425	Q92626	PXDN_HUMAN	peroxidasin precursor	1335					extracellular matrix organization|hydrogen peroxide catabolic process|immune response	endoplasmic reticulum|extracellular space|proteinaceous extracellular matrix	extracellular matrix structural constituent|heme binding|interleukin-1 receptor antagonist activity|peroxidase activity			pancreas(6)|ovary(2)	8	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.0845)|Lung NSC(108;0.00641)|all_epithelial(98;0.00716)		all cancers(51;0.0492)|OV - Ovarian serous cystadenocarcinoma(76;0.0973)|Epithelial(75;0.17)|GBM - Glioblastoma multiforme(21;0.228)														---	---	---	---
NBAS	51594	broad.mit.edu	37	2	15359013	15359013	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:15359013G>T	uc002rcc.1	-	48	6342	c.6316C>A	c.(6316-6318)CGC>AGC	p.R2106S	NBAS_uc002rcb.1_Intron|NBAS_uc010exl.1_Missense_Mutation_p.R1178S|NBAS_uc002rcd.1_Intron	NM_015909	NP_056993	A2RRP1	NBAS_HUMAN	neuroblastoma-amplified protein	2106										ovary(2)|liver(1)|skin(1)	4																		---	---	---	---
SDC1	6382	broad.mit.edu	37	2	20402700	20402700	+	Intron	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:20402700G>T	uc002rdo.1	-						SDC1_uc002rdp.1_Intron|SDC1_uc010exv.2_Intron	NM_002997	NP_002988			syndecan 1 precursor						lipid metabolic process|lipoprotein metabolic process|myoblast development|striated muscle cell development	cytoplasm|extracellular region|focal adhesion|integral to plasma membrane	cytoskeletal protein binding|protein C-terminus binding			ovary(4)|skin(1)	5	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)			OV - Ovarian serous cystadenocarcinoma(76;0.221)														---	---	---	---
SRD5A2	6716	broad.mit.edu	37	2	31754489	31754489	+	Missense_Mutation	SNP	C	A	A	rs121434250		TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:31754489C>A	uc002rnw.1	-	5	657	c.586G>T	c.(586-588)GGT>TGT	p.G196C		NM_000348	NP_000339	P31213	S5A2_HUMAN	3-oxo-5 alpha-steroid 4-dehydrogenase 2	196			G -> S (in PPSH).		androgen biosynthetic process|cell differentiation|cell-cell signaling|male gonad development	endoplasmic reticulum membrane|integral to membrane|microsome	3-oxo-5-alpha-steroid 4-dehydrogenase activity|sterol 5-alpha reductase activity				0	Acute lymphoblastic leukemia(172;0.155)				Azelaic Acid(DB00548)|Dutasteride(DB01126)													---	---	---	---
KLRAQ1	129285	broad.mit.edu	37	2	48688357	48688357	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:48688357C>A	uc002rwm.2	+	7	865	c.680C>A	c.(679-681)CCT>CAT	p.P227H	KLRAQ1_uc002rwi.1_Missense_Mutation_p.P227H|KLRAQ1_uc002rwj.2_Missense_Mutation_p.P227H|KLRAQ1_uc002rwl.2_Missense_Mutation_p.P181H|KLRAQ1_uc002rwk.2_Missense_Mutation_p.P227H|KLRAQ1_uc010yok.1_Missense_Mutation_p.P227H	NM_001135629	NP_001129101	Q6ZMI0	KLRAQ_HUMAN	KLRAQ motif containing 1 isoform 1	227										ovary(1)	1																		---	---	---	---
PSME4	23198	broad.mit.edu	37	2	54148152	54148152	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:54148152C>A	uc002rxp.2	-	18	2192	c.2136G>T	c.(2134-2136)CAG>CAT	p.Q712H	PSME4_uc010yop.1_Missense_Mutation_p.Q598H|PSME4_uc010yoq.1_RNA|PSME4_uc010fbu.1_Missense_Mutation_p.Q87H|PSME4_uc010fbv.1_Intron	NM_014614	NP_055429	Q14997	PSME4_HUMAN	proteasome (prosome, macropain) activator	712					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|cell differentiation|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|M/G1 transition of mitotic cell cycle|mRNA metabolic process|multicellular organismal development|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|spermatogenesis|viral reproduction	nuclear speck|proteasome complex	binding			ovary(2)|breast(2)|pancreas(1)	5			Lung(47;0.125)|LUSC - Lung squamous cell carcinoma(58;0.181)															---	---	---	---
PAX8	7849	broad.mit.edu	37	2	114002207	114002207	+	Intron	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:114002207C>A	uc010yxt.1	-						PAX8_uc010yxu.1_Intron|PAX8_uc010yxv.1_Intron|PAX8_uc002tjm.2_Intron|PAX8_uc002tjn.2_Intron|PAX8_uc010fku.1_Intron|LOC654433_uc002tjq.3_Intron|LOC654433_uc010fks.2_Intron|LOC654433_uc010fkt.2_Intron|LOC654433_uc002tjr.3_Intron	NM_003466	NP_003457			paired box 8 isoform PAX8A						branching involved in ureteric bud morphogenesis|cellular response to gonadotropin stimulus|central nervous system development|mesenchymal to epithelial transition involved in metanephros morphogenesis|mesonephros development|metanephric collecting duct development|metanephric comma-shaped body morphogenesis|metanephric distal convoluted tubule development|metanephric nephron tubule formation|metanephric S-shaped body morphogenesis|negative regulation of mesenchymal stem cell apoptosis involved in metanephric nephron morphogenesis|otic vesicle development|positive regulation of branching involved in ureteric bud morphogenesis|positive regulation of mesenchymal to epithelial transition involved in metanephros morphogenesis|positive regulation of metanephric DCT cell differentiation|positive regulation of thyroid hormone generation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|pronephric field specification|regulation of metanephric nephron tubule epithelial cell differentiation|regulation of thyroid-stimulating hormone secretion|thyroid gland development|transcription, DNA-dependent	nucleoplasm	protein binding|RNA polymerase II core promoter sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|thyroid-stimulating hormone receptor activity			ovary(1)|lung(1)	2								T	PPARG	follicular thyroid		Thyroid dysgenesis 						---	---	---	---
TMEM177	80775	broad.mit.edu	37	2	120438868	120438868	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:120438868C>A	uc010flg.1	+	2	912	c.439C>A	c.(439-441)CGT>AGT	p.R147S	TMEM177_uc002tme.2_Intron|TMEM177_uc002tmc.1_Missense_Mutation_p.R147S|TMEM177_uc002tmd.2_Missense_Mutation_p.R147S|TMEM177_uc010flh.2_Intron	NM_001105198	NP_001098668	Q53S58	TM177_HUMAN	transmembrane protein 177	147						integral to membrane				ovary(1)	1	Colorectal(110;0.196)																	---	---	---	---
LY75	4065	broad.mit.edu	37	2	160639873	160639873	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:160639873G>T	uc002ubb.3	-	35	5167	c.5098C>A	c.(5098-5100)CAT>AAT	p.H1700N	LY75_uc010fos.2_Missense_Mutation_p.H1644N|CD302_uc002uba.2_Missense_Mutation_p.H59N|CD302_uc010zco.1_Missense_Mutation_p.H59N	NM_002349	NP_002340	O60449	LY75_HUMAN	lymphocyte antigen 75 precursor	1568	Extracellular (Potential).|C-type lectin 10.				endocytosis|immune response|inflammatory response	integral to plasma membrane	receptor activity|sugar binding				0				COAD - Colon adenocarcinoma(177;0.132)														---	---	---	---
TTN	7273	broad.mit.edu	37	2	179596607	179596607	+	Silent	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179596607G>T	uc010zfg.1	-	55	13487	c.13263C>A	c.(13261-13263)CCC>CCA	p.P4421P	TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Silent_p.P1082P	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	5348							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)															---	---	---	---
CERKL	375298	broad.mit.edu	37	2	182521684	182521684	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:182521684C>A	uc002unx.2	-	1	151	c.50G>T	c.(49-51)CGG>CTG	p.R17L	CERKL_uc002uny.2_Missense_Mutation_p.R17L|CERKL_uc010zfm.1_Missense_Mutation_p.R17L|CERKL_uc002unz.2_5'UTR|CERKL_uc002uoa.2_Missense_Mutation_p.R17L|CERKL_uc002uob.2_5'UTR|CERKL_uc002uoc.2_Missense_Mutation_p.R17L|CERKL_uc010frk.2_RNA|CERKL_uc002uod.1_Intron|CERKL_uc002uoe.2_Missense_Mutation_p.R17L	NM_001030311	NP_001025482	Q49MI3	CERKL_HUMAN	ceramide kinase-like isoform b	17					activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|anti-apoptosis	endoplasmic reticulum|endoplasmic reticulum|Golgi apparatus|Golgi apparatus|nucleolus|nucleolus	diacylglycerol kinase activity			ovary(2)|kidney(1)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.088)															---	---	---	---
SMARCAL1	50485	broad.mit.edu	37	2	217340038	217340038	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:217340038G>T	uc002vgc.3	+	15	2621	c.2291G>T	c.(2290-2292)CGG>CTG	p.R764L	SMARCAL1_uc010fvf.2_RNA|SMARCAL1_uc002vgd.3_Missense_Mutation_p.R764L|SMARCAL1_uc010fvg.2_Missense_Mutation_p.R742L	NM_014140	NP_054859	Q9NZC9	SMAL1_HUMAN	SWI/SNF-related matrix-associated	764	Helicase C-terminal.		R -> Q (in SIOD; abolishes annealing helicase activity but still binds selectively to fork DNA relative to ssDNA or dsDNA).		chromatin modification|DNA metabolic process|regulation of transcription from RNA polymerase II promoter	nucleus	ATP binding|DNA binding|DNA helicase activity|DNA-dependent ATPase activity			ovary(3)|breast(3)|skin(1)	7		Renal(323;0.0458)		Epithelial(149;9.48e-06)|all cancers(144;0.000621)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0111)										Schimke_Immuno-Osseous_Dysplasia				---	---	---	---
COL4A4	1286	broad.mit.edu	37	2	227896951	227896951	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:227896951C>A	uc010zlt.1	-	39	4273	c.3619G>T	c.(3619-3621)GGG>TGG	p.G1207W		NM_000092	NP_000083	P53420	CO4A4_HUMAN	alpha 4 type IV collagen precursor	1207	Triple-helical region.	Cleavage; by collagenase (By similarity).			axon guidance|glomerular basement membrane development	basal lamina|collagen type IV	extracellular matrix structural constituent|protein binding			ovary(5)|central_nervous_system(3)|pancreas(1)|breast(1)|skin(1)	11		Renal(207;0.00844)|all_lung(227;0.0187)|Lung NSC(271;0.0879)|all_hematologic(139;0.21)|Esophageal squamous(248;0.242)		Epithelial(121;6.7e-11)|all cancers(144;5.39e-08)|Lung(261;0.0132)|LUSC - Lung squamous cell carcinoma(224;0.0181)														---	---	---	---
TM4SF20	79853	broad.mit.edu	37	2	228243827	228243827	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:228243827G>T	uc002vpb.2	-	1	196	c.158C>A	c.(157-159)CCA>CAA	p.P53Q		NM_024795	NP_079071	Q53R12	T4S20_HUMAN	transmembrane 4 L six family member 20	53	Helical; (Potential).					integral to membrane|plasma membrane					0		Renal(207;0.025)|all_lung(227;0.123)|Esophageal squamous(248;0.23)|all_hematologic(139;0.248)		Epithelial(121;3.8e-11)|all cancers(144;2.57e-08)|Lung(261;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.0115)														---	---	---	---
SP100	6672	broad.mit.edu	37	2	231379989	231379989	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:231379989G>T	uc002vqt.2	+	25	2415	c.2274G>T	c.(2272-2274)GAG>GAT	p.E758D	SP100_uc002vqu.1_Intron|SP100_uc010fxp.1_Intron	NM_003113	NP_003104	P23497	SP100_HUMAN	nuclear antigen Sp100 isoform 2	758					DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|interspecies interaction between organisms|negative regulation of cellular component movement|negative regulation of DNA binding|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|negative regulation of transcription, DNA-dependent|negative regulation of viral transcription|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|response to cytokine stimulus|response to retinoic acid|response to type I interferon	cytoplasm|nuclear periphery|nucleolus|PML body	chromo shadow domain binding|DNA binding|identical protein binding|kinase binding|protein homodimerization activity|transcription coactivator activity|transcription corepressor activity|transcription factor binding			ovary(4)|central_nervous_system(1)	5		Renal(207;0.0112)|all_lung(227;0.0335)|all_hematologic(139;0.0749)|Lung NSC(271;0.142)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.13e-12)|all cancers(144;2.71e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)														---	---	---	---
GRIP2	80852	broad.mit.edu	37	3	14562040	14562040	+	Silent	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:14562040C>A	uc011avi.1	-	9	1008	c.1008G>T	c.(1006-1008)ACG>ACT	p.T336T	GRIP2_uc011avh.1_5'UTR	NM_001080423	NP_001073892	Q9C0E4	GRIP2_HUMAN	glutamate receptor interacting protein 2	239					synaptic transmission	cytosol|plasma membrane	protein binding			pancreas(1)	1																		---	---	---	---
SCN11A	11280	broad.mit.edu	37	3	38941492	38941492	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:38941492G>A	uc011ays.1	-	13	2114	c.1915C>T	c.(1915-1917)CGA>TGA	p.R639*		NM_014139	NP_054858	Q9UI33	SCNBA_HUMAN	sodium channel, voltage-gated, type XI, alpha	639	II.				response to drug	voltage-gated sodium channel complex	voltage-gated sodium channel activity			skin(6)|ovary(1)|haematopoietic_and_lymphoid_tissue(1)|pancreas(1)	9				Kidney(284;0.00202)|KIRC - Kidney renal clear cell carcinoma(284;0.00226)	Cocaine(DB00907)													---	---	---	---
ZNF620	253639	broad.mit.edu	37	3	40557659	40557659	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:40557659G>T	uc003ckk.2	+	5	723	c.574G>T	c.(574-576)GGT>TGT	p.G192C	ZNF620_uc003ckl.2_Missense_Mutation_p.G78C	NM_175888	NP_787084	Q6ZNG0	ZN620_HUMAN	zinc finger protein 620	192					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1				KIRC - Kidney renal clear cell carcinoma(284;0.0519)|Kidney(284;0.0653)														---	---	---	---
HHATL	57467	broad.mit.edu	37	3	42735277	42735277	+	Silent	SNP	G	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:42735277G>A	uc003clw.2	-	11	1227	c.1080C>T	c.(1078-1080)TCC>TCT	p.S360S	HHATL_uc003clx.2_Silent_p.S360S	NM_020707	NP_065758	Q9HCP6	HHATL_HUMAN	hedgehog acyltransferase-like	360					negative regulation of N-terminal protein palmitoylation	endoplasmic reticulum membrane|integral to membrane|perinuclear region of cytoplasm				ovary(3)	3				KIRC - Kidney renal clear cell carcinoma(284;0.215)														---	---	---	---
ABHD5	51099	broad.mit.edu	37	3	43756528	43756528	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:43756528C>A	uc003cmx.2	+	5	861	c.751C>A	c.(751-753)CAC>AAC	p.H251N		NM_016006	NP_057090	Q8WTS1	ABHD5_HUMAN	abhydrolase domain containing 5	251					cell differentiation|fatty acid metabolic process|negative regulation of sequestering of triglyceride|phosphatidic acid biosynthetic process|positive regulation of triglyceride catabolic process|triglyceride catabolic process	cytosol|lipid particle	1-acylglycerol-3-phosphate O-acyltransferase activity|lysophosphatidic acid acyltransferase activity			ovary(1)	1		Renal(3;0.0134)		KIRC - Kidney renal clear cell carcinoma(197;0.0546)|Kidney(197;0.0687)														---	---	---	---
COL7A1	1294	broad.mit.edu	37	3	48605932	48605932	+	Silent	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48605932C>A	uc003ctz.2	-	104	7795	c.7794G>T	c.(7792-7794)CCG>CCT	p.P2598P		NM_000094	NP_000085	Q02388	CO7A1_HUMAN	alpha 1 type VII collagen precursor	2598	Triple-helical region.				cell adhesion|epidermis development	basement membrane|collagen type VII	protein binding|serine-type endopeptidase inhibitor activity			ovary(4)|breast(3)|skin(3)|central_nervous_system(1)	11				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)														---	---	---	---
ITIH4	3700	broad.mit.edu	37	3	52858258	52858258	+	Silent	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52858258G>T	uc003dfz.2	-	9	1155	c.1119C>A	c.(1117-1119)CCC>CCA	p.P373P	ITIH4_uc011bel.1_Silent_p.P103P|ITIH4_uc003dfy.2_Silent_p.P237P|ITIH4_uc011bem.1_Silent_p.P373P|ITIH4_uc011ben.1_Silent_p.P373P	NM_002218	NP_002209	Q14624	ITIH4_HUMAN	inter-alpha (globulin) inhibitor H4	373	VWFA.				acute-phase response|hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity			ovary(2)|central_nervous_system(1)	3				BRCA - Breast invasive adenocarcinoma(193;7e-05)|Kidney(197;0.000656)|KIRC - Kidney renal clear cell carcinoma(197;0.000794)|OV - Ovarian serous cystadenocarcinoma(275;0.0496)														---	---	---	---
SLMAP	7871	broad.mit.edu	37	3	57882659	57882659	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:57882659G>T	uc003dje.1	+	15	1655	c.1450G>T	c.(1450-1452)GAT>TAT	p.D484Y	SLMAP_uc003djc.1_Missense_Mutation_p.G480C|SLMAP_uc003djd.1_Missense_Mutation_p.D467Y|SLMAP_uc003djf.1_Missense_Mutation_p.D446Y|SLMAP_uc003djg.1_Missense_Mutation_p.D78Y|SLMAP_uc011bez.1_Missense_Mutation_p.A18S|SLMAP_uc011bfa.1_Missense_Mutation_p.D18Y|SLMAP_uc003djh.2_Missense_Mutation_p.A18S|SLMAP_uc003dji.1_Missense_Mutation_p.D18Y|SLMAP_uc011bfb.1_Missense_Mutation_p.D18Y|SLMAP_uc011bfc.1_Missense_Mutation_p.A18S	NM_007159	NP_009090	Q14BN4	SLMAP_HUMAN	sarcolemma associated protein	484	Cytoplasmic (Potential).|Potential.				muscle contraction|protein folding	integral to plasma membrane|microtubule organizing center|prefoldin complex|sarcolemma|smooth endoplasmic reticulum	unfolded protein binding				0				BRCA - Breast invasive adenocarcinoma(55;0.000271)|KIRC - Kidney renal clear cell carcinoma(284;0.0602)|Kidney(284;0.0754)|OV - Ovarian serous cystadenocarcinoma(275;0.182)														---	---	---	---
GPR15	2838	broad.mit.edu	37	3	98251350	98251350	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:98251350G>T	uc011bgy.1	+	1	473	c.473G>T	c.(472-474)TGG>TTG	p.W158L		NM_005290	NP_005281	P49685	GPR15_HUMAN	G protein-coupled receptor 15	158	Helical; Name=4; (Potential).					integral to plasma membrane	purinergic nucleotide receptor activity, G-protein coupled			ovary(1)	1		Lung NSC(201;7.93e-06)|all_neural(597;0.00172)|Hepatocellular(537;0.00825)|Myeloproliferative disorder(1037;0.0255)		Lung(72;0.246)														---	---	---	---
IMPG2	50939	broad.mit.edu	37	3	100961575	100961575	+	Silent	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:100961575G>T	uc003duq.1	-	14	3182	c.2979C>A	c.(2977-2979)ACC>ACA	p.T993T	IMPG2_uc011bhe.1_Silent_p.T856T	NM_016247	NP_057331	Q9BZV3	IMPG2_HUMAN	interphotoreceptor matrix proteoglycan 2	993	Extracellular (Potential).|SEA 2.				visual perception	integral to membrane|proteinaceous extracellular matrix	extracellular matrix structural constituent|heparin binding|hyaluronic acid binding|receptor activity			ovary(2)|haematopoietic_and_lymphoid_tissue(1)	3																		---	---	---	---
IGSF11	152404	broad.mit.edu	37	3	118645024	118645024	+	Silent	SNP	C	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:118645024C>T	uc003ebw.2	-	4	751	c.504G>A	c.(502-504)GAG>GAA	p.E168E	IGSF11_uc011biv.1_Silent_p.E168E|IGSF11_uc003ebx.2_Silent_p.E168E|IGSF11_uc003eby.2_Silent_p.E167E|IGSF11_uc003ebz.2_Silent_p.E167E|IGSF11_uc010hqs.2_Silent_p.E167E	NM_001015887	NP_001015887	Q5DX21	IGS11_HUMAN	immunoglobulin superfamily, member 11 isoform b	168	Ig-like C2-type.|Extracellular (Potential).				cell adhesion|regulation of growth	integral to membrane|plasma membrane	receptor activity				0																		---	---	---	---
ARHGAP31	57514	broad.mit.edu	37	3	119112366	119112366	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:119112366C>T	uc003ecj.3	+	8	1466	c.934C>T	c.(934-936)CGT>TGT	p.R312C		NM_020754	NP_065805	Q2M1Z3	RHG31_HUMAN	Cdc42 GTPase-activating protein	312					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|focal adhesion|lamellipodium	GTPase activator activity			ovary(2)	2																		---	---	---	---
GPR156	165829	broad.mit.edu	37	3	119887107	119887107	+	Missense_Mutation	SNP	G	T	T	rs113424982		TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:119887107G>T	uc011bjf.1	-	9	1217	c.1217C>A	c.(1216-1218)CCG>CAG	p.P406Q	GPR156_uc011bjg.1_Missense_Mutation_p.P402Q	NM_153002	NP_694547	Q8NFN8	GP156_HUMAN	G protein-coupled receptor 156	406	Cytoplasmic (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity|GABA-B receptor activity			ovary(1)|skin(1)	2				GBM - Glioblastoma multiforme(114;0.19)														---	---	---	---
TMCC1	23023	broad.mit.edu	37	3	129389972	129389972	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:129389972G>T	uc003emz.3	-	5	1213	c.712C>A	c.(712-714)CAG>AAG	p.Q238K	TMCC1_uc003emy.3_5'UTR|TMCC1_uc011blc.1_Missense_Mutation_p.Q59K|TMCC1_uc010htg.2_Missense_Mutation_p.Q124K	NM_001017395	NP_001017395	O94876	TMCC1_HUMAN	transmembrane and coiled-coil domain family 1	238	Potential.					integral to membrane				skin(1)	1																		---	---	---	---
TMEM108	66000	broad.mit.edu	37	3	133114803	133114803	+	Silent	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:133114803G>T	uc003eph.2	+	6	1975	c.1701G>T	c.(1699-1701)GTG>GTT	p.V567V	TMEM108_uc003epi.2_Silent_p.V567V|TMEM108_uc003epk.2_Silent_p.V97V|TMEM108_uc003epm.2_Silent_p.V518V	NM_023943	NP_076432	Q6UXF1	TM108_HUMAN	transmembrane protein 108 precursor	567	Cytoplasmic (Potential).					integral to membrane				ovary(2)|skin(2)	4																		---	---	---	---
LRRC31	79782	broad.mit.edu	37	3	169557996	169557996	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:169557996C>A	uc003fgc.1	-	9	1510	c.1433G>T	c.(1432-1434)CGG>CTG	p.R478L	LRRC31_uc010hwp.1_Missense_Mutation_p.R422L	NM_024727	NP_079003	Q6UY01	LRC31_HUMAN	leucine rich repeat containing 31	478										ovary(2)|skin(1)	3	all_cancers(22;2.76e-22)|all_epithelial(15;4.73e-27)|all_lung(20;9.24e-17)|Lung NSC(18;3.85e-16)|Ovarian(172;0.000223)|Breast(254;0.197)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.00943)															---	---	---	---
TNIK	23043	broad.mit.edu	37	3	170858222	170858222	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:170858222C>A	uc003fhh.2	-	13	1643	c.1298G>T	c.(1297-1299)CGG>CTG	p.R433L	TNIK_uc003fhi.2_Missense_Mutation_p.R433L|TNIK_uc003fhj.2_Missense_Mutation_p.R433L|TNIK_uc003fhk.2_Missense_Mutation_p.R433L|TNIK_uc003fhl.2_Missense_Mutation_p.R433L|TNIK_uc003fhm.2_Missense_Mutation_p.R433L|TNIK_uc003fhn.2_Missense_Mutation_p.R433L|TNIK_uc003fho.2_Missense_Mutation_p.R433L	NM_015028	NP_055843	Q9UKE5	TNIK_HUMAN	TRAF2 and NCK interacting kinase isoform 1	433	Mediates interaction with NEDD4.				actin cytoskeleton reorganization|activation of JNKK activity|protein autophosphorylation|regulation of dendrite morphogenesis|Wnt receptor signaling pathway	cytoskeleton|nucleus|recycling endosome	ATP binding|protein binding|protein serine/threonine kinase activity|small GTPase regulator activity			ovary(4)|large_intestine(1)	5	all_cancers(22;2.55e-19)|all_lung(20;2.22e-14)|Ovarian(172;0.00197)|Breast(254;0.122)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)															---	---	---	---
HTR3D	200909	broad.mit.edu	37	3	183756624	183756624	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183756624G>T	uc011bqv.1	+	8	1226	c.1226G>T	c.(1225-1227)CGG>CTG	p.R409L	HTR3D_uc003fmj.2_Missense_Mutation_p.R234L|HTR3D_uc011bqu.1_Missense_Mutation_p.R359L|HTR3D_uc010hxp.2_Missense_Mutation_p.R188L	NM_001163646	NP_001157118	Q70Z44	5HT3D_HUMAN	5-hydroxytryptamine receptor 3 subunit D isoform	409	Cytoplasmic (Potential).					integral to membrane|plasma membrane	extracellular ligand-gated ion channel activity|receptor activity				0	all_cancers(143;2.33e-10)|Ovarian(172;0.0303)		Epithelial(37;6.23e-36)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)															---	---	---	---
ATP13A4	84239	broad.mit.edu	37	3	193166019	193166019	+	Silent	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:193166019G>T	uc003ftd.2	-	18	2236	c.2128C>A	c.(2128-2130)CGG>AGG	p.R710R	ATP13A4_uc003fte.1_Silent_p.R710R|ATP13A4_uc011bsr.1_Silent_p.R181R|ATP13A4_uc010hzi.2_RNA	NM_032279	NP_115655	Q4VNC1	AT134_HUMAN	ATPase type 13A4	710	Extracellular (Potential).				ATP biosynthetic process|cation transport	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|metal ion binding			ovary(2)	2	all_cancers(143;1.76e-08)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;2.72e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;0.000109)														---	---	---	---
TFRC	7037	broad.mit.edu	37	3	195802018	195802018	+	Intron	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195802018G>T	uc003fvz.3	-						TFRC_uc003fwa.3_Intron|TFRC_uc010hzy.2_Intron|TFRC_uc011btr.1_Intron	NM_003234	NP_003225			transferrin receptor						cellular iron ion homeostasis|endocytosis|interspecies interaction between organisms|proteolysis|transferrin transport|transmembrane transport	coated pit|endosome|integral to plasma membrane|melanosome	peptidase activity|transferrin receptor activity			ovary(3)	3	all_cancers(143;1.94e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		Epithelial(36;1.36e-24)|all cancers(36;3.34e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.17e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00233)				T	BCL6	NHL								---	---	---	---
REST	5978	broad.mit.edu	37	4	57797479	57797479	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:57797479G>T	uc003hch.2	+	4	2802	c.2455G>T	c.(2455-2457)GAT>TAT	p.D819Y	REST_uc003hci.2_Missense_Mutation_p.D819Y|REST_uc010ihf.2_Missense_Mutation_p.D493Y	NM_005612	NP_005603	Q13127	REST_HUMAN	RE1-silencing transcription factor	819					cardiac muscle cell myoblast differentiation|cellular response to drug|cellular response to electrical stimulus|cellular response to glucocorticoid stimulus|histone H4 deacetylation|negative regulation by host of viral transcription|negative regulation of aldosterone biosynthetic process|negative regulation of calcium ion-dependent exocytosis|negative regulation of cell proliferation|negative regulation of cortisol biosynthetic process|negative regulation of dense core granule biogenesis|negative regulation of insulin secretion|negative regulation of mesenchymal stem cell differentiation|negative regulation of neurogenesis|negative regulation of neuron differentiation|positive regulation of apoptosis|positive regulation of caspase activity|positive regulation of transcription, DNA-dependent	cytoplasm|transcriptional repressor complex	calcium channel activity|chromatin binding|core promoter proximal region sequence-specific DNA binding|core promoter sequence-specific DNA binding|outward rectifier potassium channel activity|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription|zinc ion binding			skin(5)|upper_aerodigestive_tract(1)|ovary(1)|lung(1)|central_nervous_system(1)	9	Glioma(25;0.08)|all_neural(26;0.181)																	---	---	---	---
PDHA2	5161	broad.mit.edu	37	4	96761323	96761323	+	Missense_Mutation	SNP	C	A	A	rs140695896	byFrequency	TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:96761323C>A	uc003htr.3	+	1	85	c.22C>A	c.(22-24)CGC>AGC	p.R8S		NM_005390	NP_005381	P29803	ODPAT_HUMAN	pyruvate dehydrogenase E1 alpha 2 precursor	8					glycolysis	mitochondrial matrix	pyruvate dehydrogenase (acetyl-transferring) activity			central_nervous_system(1)	1		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;1.23e-06)	NADH(DB00157)													---	---	---	---
NEK1	4750	broad.mit.edu	37	4	170327836	170327836	+	Silent	SNP	G	T	T	rs140408058	by1000genomes	TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:170327836G>T	uc003isb.1	-	30	3693	c.3201C>A	c.(3199-3201)CCC>CCA	p.P1067P	NEK1_uc003isc.1_Silent_p.P1023P|NEK1_uc003isd.1_Silent_p.P1095P|NEK1_uc003ise.1_Silent_p.P1051P|NEK1_uc003isf.1_Silent_p.P998P	NM_012224	NP_036356	Q96PY6	NEK1_HUMAN	NIMA-related kinase 1	1067					cell division|cilium assembly|mitosis	nucleus|pericentriolar material	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			lung(3)|ovary(2)|large_intestine(1)	6		Prostate(90;0.00601)|Renal(120;0.0183)		GBM - Glioblastoma multiforme(119;0.0287)|KIRC - Kidney renal clear cell carcinoma(143;0.0325)|Kidney(143;0.0385)|LUSC - Lung squamous cell carcinoma(193;0.14)														---	---	---	---
FASTKD3	79072	broad.mit.edu	37	5	7867597	7867597	+	Silent	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:7867597C>A	uc003jeb.2	-	2	737	c.600G>T	c.(598-600)CTG>CTT	p.L200L	FASTKD3_uc011cmp.1_Intron|FASTKD3_uc003jec.2_Intron|MTRR_uc010itn.1_5'Flank|MTRR_uc003jee.3_5'Flank|MTRR_uc003jed.2_5'Flank|MTRR_uc003jef.3_5'Flank|MTRR_uc003jeg.3_5'Flank|MTRR_uc010ito.2_5'Flank	NM_024091	NP_076996	Q14CZ7	FAKD3_HUMAN	FAST kinase domains 3	200					apoptosis|cellular respiration	mitochondrion	ATP binding|protein kinase activity			ovary(2)|breast(1)|pancreas(1)	4																		---	---	---	---
FAM105B	90268	broad.mit.edu	37	5	14693066	14693066	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:14693066C>A	uc003jfk.2	+	7	1120	c.968C>A	c.(967-969)CCA>CAA	p.P323Q		NM_138348	NP_612357	Q96BN8	F105B_HUMAN	hypothetical protein LOC90268	323										ovary(2)	2	Lung NSC(4;0.00696)																	---	---	---	---
ADAMTS12	81792	broad.mit.edu	37	5	33561157	33561157	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:33561157C>A	uc003jia.1	-	20	4263	c.4100G>T	c.(4099-4101)GGC>GTC	p.G1367V	ADAMTS12_uc010iuq.1_Missense_Mutation_p.G1282V	NM_030955	NP_112217	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1	1367					proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)	9															HNSCC(64;0.19)			---	---	---	---
HEATR7B2	133558	broad.mit.edu	37	5	41054930	41054930	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:41054930C>A	uc003jmj.3	-	11	1536	c.1046G>T	c.(1045-1047)AGG>ATG	p.R349M	HEATR7B2_uc003jmi.3_Intron	NM_173489	NP_775760	Q7Z745	HTRB2_HUMAN	HEAT repeat family member 7B2	349							binding			ovary(6)|central_nervous_system(2)	8																		---	---	---	---
ZNF366	167465	broad.mit.edu	37	5	71757157	71757157	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:71757157C>A	uc003kce.1	-	2	353	c.167G>T	c.(166-168)CGG>CTG	p.R56L		NM_152625	NP_689838	Q8N895	ZN366_HUMAN	zinc finger protein 366	56					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			central_nervous_system(1)|skin(1)	2		Lung NSC(167;0.0247)|Ovarian(174;0.0908)|Prostate(461;0.155)		OV - Ovarian serous cystadenocarcinoma(47;2.51e-53)														---	---	---	---
SPZ1	84654	broad.mit.edu	37	5	79616623	79616623	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:79616623C>A	uc003kgn.2	+	1	834	c.589C>A	c.(589-591)CAG>AAG	p.Q197K	uc011ctk.1_RNA	NM_032567	NP_115956	Q9BXG8	SPZ1_HUMAN	spermatogenic leucine zipper 1	197	Basic motif (By similarity).				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding			ovary(1)	1		Lung NSC(167;0.0393)|all_lung(232;0.0428)|Ovarian(174;0.113)		OV - Ovarian serous cystadenocarcinoma(54;3.43e-47)|Epithelial(54;2.25e-41)|all cancers(79;4.19e-36)														---	---	---	---
ZFYVE16	9765	broad.mit.edu	37	5	79769675	79769675	+	Silent	SNP	C	A	A	rs145745171	byFrequency	TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:79769675C>A	uc003kgr.3	+	17	4592	c.4290C>A	c.(4288-4290)ACC>ACA	p.T1430T	ZFYVE16_uc003kgq.3_Silent_p.T1430T|ZFYVE16_uc003kgs.3_Silent_p.T1430T|ZFYVE16_uc003kgt.3_Silent_p.T518T|ZFYVE16_uc003kgu.3_Silent_p.T182T	NM_001105251	NP_001098721	Q7Z3T8	ZFY16_HUMAN	zinc finger, FYVE domain containing 16	1430					BMP signaling pathway|endosome transport|protein targeting to lysosome|regulation of endocytosis|vesicle organization	early endosome membrane	1-phosphatidylinositol binding|metal ion binding|phosphatidylinositol-3,4,5-trisphosphate binding|protein binding|protein transporter activity				0		Lung NSC(167;0.00428)|all_lung(232;0.00455)|Ovarian(174;0.0261)		OV - Ovarian serous cystadenocarcinoma(54;1.6e-46)|Epithelial(54;2.02e-41)|all cancers(79;5.05e-36)														---	---	---	---
GPR98	84059	broad.mit.edu	37	5	89938526	89938526	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:89938526C>T	uc003kju.2	+	12	2410	c.2314C>T	c.(2314-2316)CCT>TCT	p.P772S	GPR98_uc003kjt.2_5'UTR	NM_032119	NP_115495	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98 precursor	772	Extracellular (Potential).				cell communication|cell-cell adhesion|maintenance of organ identity|neuropeptide signaling pathway|photoreceptor cell maintenance	cell surface|cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(11)|central_nervous_system(3)|pancreas(2)	16		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)														---	---	---	---
FAM13B	51306	broad.mit.edu	37	5	137289940	137289940	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137289940G>T	uc003lbz.2	-	14	2101	c.1567C>A	c.(1567-1569)CGC>AGC	p.R523S	FAM13B_uc003lcb.2_Missense_Mutation_p.R427S|FAM13B_uc003lca.2_Missense_Mutation_p.R523S	NM_016603	NP_057687	Q9NYF5	FA13B_HUMAN	hypothetical protein LOC51306 isoform 1	523					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity				0																		---	---	---	---
PCDHGA1	56114	broad.mit.edu	37	5	140712464	140712464	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140712464C>T	uc003lji.1	+	1	2213	c.2213C>T	c.(2212-2214)TCG>TTG	p.S738L	PCDHGA1_uc011dan.1_Missense_Mutation_p.S738L	NM_018912	NP_061735	Q9Y5H4	PCDG1_HUMAN	protocadherin gamma subfamily A, 1 isoform 1	738	Cytoplasmic (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(1)|breast(1)|pancreas(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)															---	---	---	---
PCDHGA3	56112	broad.mit.edu	37	5	140724252	140724252	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140724252G>T	uc003ljm.1	+	1	652	c.652G>T	c.(652-654)GGC>TGC	p.G218C	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc010jfx.1_5'UTR|PCDHGA3_uc011dap.1_Missense_Mutation_p.G218C	NM_018916	NP_061739	Q9Y5H0	PCDG3_HUMAN	protocadherin gamma subfamily A, 3 isoform 1	218	Extracellular (Potential).|Cadherin 2.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)															---	---	---	---
KIAA1191	57179	broad.mit.edu	37	5	175775365	175775365	+	Intron	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:175775365C>A	uc003mdw.2	-						KIAA1191_uc003mdx.2_Intron|KIAA1191_uc003mdy.2_Intron|KIAA1191_uc003mea.2_Intron|KIAA1191_uc003mdz.2_Intron	NM_020444	NP_065177			hypothetical protein LOC57179 isoform a								protein binding			ovary(1)	1	all_cancers(89;0.00575)|Renal(175;0.000269)|Lung NSC(126;0.0105)|all_lung(126;0.0168)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	Kidney(146;0.101)														---	---	---	---
GPRIN1	114787	broad.mit.edu	37	5	176026581	176026581	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176026581G>T	uc003meo.1	-	2	430	c.255C>A	c.(253-255)GAC>GAA	p.D85E		NM_052899	NP_443131	Q7Z2K8	GRIN1_HUMAN	G protein-regulated inducer of neurite outgrowth	85						growth cone|plasma membrane				ovary(2)	2	all_cancers(89;0.00263)|Renal(175;0.000269)|Lung NSC(126;0.00902)|all_lung(126;0.0142)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)															---	---	---	---
TAP2	6891	broad.mit.edu	37	6	32797282	32797282	+	Silent	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32797282C>A	uc003occ.2	-	10	1858	c.1827G>T	c.(1825-1827)GCG>GCT	p.A609A	TAP2_uc011dqf.1_Silent_p.A609A|TAP2_uc003ocb.1_Silent_p.A609A|TAP2_uc003ocd.2_Silent_p.A609A	NM_018833	NP_061313	Q03519	TAP2_HUMAN	transporter 2, ATP-binding cassette, sub-family	609	ABC transporter.|Cytoplasmic (Potential).				antigen processing and presentation of endogenous peptide antigen via MHC class I via ER pathway, TAP-dependent|antigen processing and presentation of endogenous peptide antigen via MHC class Ib via ER pathway, TAP-dependent|antigen processing and presentation of exogenous protein antigen via MHC class Ib, TAP-dependent|cytosol to ER transport|intracellular transport of viral proteins in host cell|peptide antigen transport|positive regulation of antigen processing and presentation of peptide antigen via MHC class I|positive regulation of T cell mediated cytotoxicity	nucleus|plasma membrane|TAP complex	ATP binding|MHC class I protein binding|oligopeptide-transporting ATPase activity|peptide antigen binding|peptide antigen-transporting ATPase activity|TAP1 binding|TAP2 binding|tapasin binding				0																		---	---	---	---
HLA-DPA1	3113	broad.mit.edu	37	6	33037072	33037072	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33037072G>T	uc003ocs.1	-	3	383	c.352C>A	c.(352-354)CCT>ACT	p.P118T	HLA-DPA1_uc010juk.2_Missense_Mutation_p.P118T|HLA-DPA1_uc003oct.1_Missense_Mutation_p.P118T	NM_033554	NP_291032	P20036	DPA1_HUMAN	major histocompatibility complex, class II, DP	118	Alpha-2.|Ig-like C1-type.|Extracellular (Potential).				antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|interferon-gamma-mediated signaling pathway|T cell costimulation|T cell receptor signaling pathway	endoplasmic reticulum membrane|endosome membrane|Golgi apparatus|integral to plasma membrane|lysosomal membrane|MHC class II protein complex	MHC class II receptor activity			skin(1)	1																		---	---	---	---
VPS52	6293	broad.mit.edu	37	6	33219410	33219410	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33219410C>A	uc003odm.1	-	19	2120	c.1910G>T	c.(1909-1911)CGG>CTG	p.R637L	VPS52_uc003odn.1_Missense_Mutation_p.R448L	NM_022553	NP_072047	Q8N1B4	VPS52_HUMAN	vacuolar protein sorting 52	637					protein transport	endosome membrane|Golgi apparatus				ovary(4)|skin(1)	5																		---	---	---	---
SPDEF	25803	broad.mit.edu	37	6	34508858	34508858	+	Silent	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:34508858C>A	uc003ojq.1	-	3	952	c.537G>T	c.(535-537)GCG>GCT	p.A179A	SPDEF_uc011dsq.1_Silent_p.A179A	NM_012391	NP_036523	O95238	SPDEF_HUMAN	SAM pointed domain containing ets transcription	179	PNT.				negative regulation of survival gene product expression|negative regulation of transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			skin(3)|ovary(1)|central_nervous_system(1)	5																		---	---	---	---
ANKS1A	23294	broad.mit.edu	37	6	35051202	35051202	+	Silent	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:35051202G>T	uc003ojx.3	+	20	3058	c.2916G>T	c.(2914-2916)ACG>ACT	p.T972T	ANKS1A_uc011dss.1_Intron|ANKS1A_uc011dst.1_Silent_p.T512T|ANKS1A_uc010jvp.1_Silent_p.T346T	NM_015245	NP_056060	Q92625	ANS1A_HUMAN	ankyrin repeat and sterile alpha motif domain	972	PID.					cytoplasm	protein binding			ovary(3)|upper_aerodigestive_tract(1)	4																		---	---	---	---
CAPN11	11131	broad.mit.edu	37	6	44148203	44148203	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:44148203G>T	uc003owt.1	+	15	1685	c.1647G>T	c.(1645-1647)TTG>TTT	p.L549F	CAPN11_uc011dvn.1_Missense_Mutation_p.L203F	NM_007058	NP_008989	Q9UMQ6	CAN11_HUMAN	calpain 11	549	Domain III.				proteolysis	acrosomal vesicle	calcium ion binding|calcium-dependent cysteine-type endopeptidase activity			ovary(1)|breast(1)	2	all_cancers(18;3.19e-06)|Lung NSC(15;0.00108)|all_lung(25;0.00278)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)															---	---	---	---
DST	667	broad.mit.edu	37	6	56380299	56380299	+	Silent	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:56380299G>T	uc003pdf.2	-	66	12196	c.12168C>A	c.(12166-12168)CCC>CCA	p.P4056P	DST_uc003pcz.3_Silent_p.P3878P|DST_uc011dxj.1_Silent_p.P3907P|DST_uc011dxk.1_Silent_p.P3918P|DST_uc003pcy.3_Silent_p.P3552P	NM_001144769	NP_001138241	Q03001	DYST_HUMAN	dystonin isoform 2	5964	Spectrin 11.				cell adhesion|cell cycle arrest|cell motility|hemidesmosome assembly|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization|maintenance of cell polarity|microtubule cytoskeleton organization|response to wounding	actin cytoskeleton|axon|axon part|basement membrane|cell cortex|cell leading edge|cytoplasmic membrane-bounded vesicle|endoplasmic reticulum membrane|hemidesmosome|hemidesmosome|integral to membrane|intermediate filament|intermediate filament cytoskeleton|microtubule cytoskeleton|microtubule plus end|nuclear envelope|sarcomere|Z disc	actin binding|calcium ion binding|integrin binding|microtubule plus-end binding|protein binding|protein C-terminus binding|protein homodimerization activity			ovary(7)|central_nervous_system(6)|upper_aerodigestive_tract(1)	14	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)															---	---	---	---
KCNQ5	56479	broad.mit.edu	37	6	73900332	73900332	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:73900332G>T	uc003pgk.2	+	12	1961	c.1614G>T	c.(1612-1614)AAG>AAT	p.K538N	KCNQ5_uc011dyh.1_Missense_Mutation_p.K557N|KCNQ5_uc011dyi.1_Missense_Mutation_p.K548N|KCNQ5_uc010kat.2_Missense_Mutation_p.K529N|KCNQ5_uc011dyj.1_Missense_Mutation_p.K428N|KCNQ5_uc011dyk.1_Missense_Mutation_p.K288N	NM_019842	NP_062816	Q9NR82	KCNQ5_HUMAN	potassium voltage-gated channel, KQT-like	538					protein complex assembly|synaptic transmission	voltage-gated potassium channel complex	inward rectifier potassium channel activity			ovary(4)|large_intestine(2)|skin(1)	7		all_epithelial(107;0.116)|Lung NSC(302;0.219)		COAD - Colon adenocarcinoma(1;0.0107)|Colorectal(1;0.0583)														---	---	---	---
C6orf174	387104	broad.mit.edu	37	6	127767833	127767833	+	3'UTR	SNP	G	T	T	rs112232003		TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:127767833G>T	uc003qbd.2	-	11					C6orf174_uc003qbc.2_Missense_Mutation_p.P544Q|C6orf174_uc003qba.2_Intron|C6orf174_uc003qbb.2_Missense_Mutation_p.P427Q|KIAA0408_uc011ebs.1_Missense_Mutation_p.P544Q	NM_001012279	NP_001012279			hypothetical protein LOC387104 precursor							integral to membrane				breast(3)|ovary(2)|skin(1)	6				GBM - Glioblastoma multiforme(226;0.026)|all cancers(137;0.161)														---	---	---	---
NUP43	348995	broad.mit.edu	37	6	150067563	150067563	+	Silent	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:150067563C>A	uc003qmz.2	-	1	126	c.69G>T	c.(67-69)CCG>CCT	p.P23P	NUP43_uc011eee.1_RNA|NUP43_uc011eef.1_Silent_p.P23P	NM_198887	NP_942590	Q8NFH3	NUP43_HUMAN	nucleoporin 43kDa	23	WD 1.				carbohydrate metabolic process|cell division|chromosome segregation|glucose transport|mitotic prometaphase|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	condensed chromosome kinetochore|cytosol|Nup107-160 complex	protein binding			upper_aerodigestive_tract(1)	1		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;4.71e-13)|GBM - Glioblastoma multiforme(68;0.101)												OREG0017720	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
MAD1L1	8379	broad.mit.edu	37	7	2054198	2054198	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2054198C>A	uc003slh.1	-	13	1564	c.1298G>T	c.(1297-1299)CGG>CTG	p.R433L	MAD1L1_uc003sle.1_Missense_Mutation_p.R162L|MAD1L1_uc003slf.1_Missense_Mutation_p.R433L|MAD1L1_uc003slg.1_Missense_Mutation_p.R433L|MAD1L1_uc010ksh.1_Missense_Mutation_p.R433L|MAD1L1_uc003sli.1_Missense_Mutation_p.R341L|MAD1L1_uc010ksi.1_Missense_Mutation_p.R386L|MAD1L1_uc010ksj.2_Missense_Mutation_p.R433L	NM_001013836	NP_001013858	Q9Y6D9	MD1L1_HUMAN	MAD1-like 1 protein	433	Necessary for interaction with NEK2.|Potential.				cell division|mitotic anaphase|mitotic cell cycle spindle assembly checkpoint|mitotic metaphase|mitotic prometaphase|mitotic telophase	actin cytoskeleton|centrosome|condensed chromosome kinetochore|cytosol|mitochondrion|nucleus|spindle	protein binding			lung(1)|central_nervous_system(1)	2		Ovarian(82;0.0272)		UCEC - Uterine corpus endometrioid carcinoma (27;0.134)|OV - Ovarian serous cystadenocarcinoma(56;3.63e-14)														---	---	---	---
C7orf31	136895	broad.mit.edu	37	7	25176248	25176248	+	Silent	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:25176248G>T	uc003sxn.1	-	10	1677	c.1116C>A	c.(1114-1116)CCC>CCA	p.P372P	C7orf31_uc003sxm.1_Silent_p.P214P	NM_138811	NP_620166	Q8N865	CG031_HUMAN	hypothetical protein LOC136895	372											0																		---	---	---	---
CDK14	5218	broad.mit.edu	37	7	90747439	90747439	+	Missense_Mutation	SNP	C	T	T	rs145303395		TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:90747439C>T	uc003uky.2	+	14	1576	c.1354C>T	c.(1354-1356)CGG>TGG	p.R452W	CDK14_uc003ukz.1_Missense_Mutation_p.R434W|CDK14_uc010les.1_Missense_Mutation_p.R406W|CDK14_uc011khl.1_Missense_Mutation_p.R323W	NM_012395	NP_036527	O94921	CDK14_HUMAN	PFTAIRE protein kinase 1	452					cell division|G2/M transition of mitotic cell cycle|regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	cytoplasmic cyclin-dependent protein kinase holoenzyme complex|nucleus|plasma membrane	ATP binding|cyclin binding|cyclin-dependent protein kinase activity			lung(3)|ovary(1)	4																		---	---	---	---
CPSF4	10898	broad.mit.edu	37	7	99051674	99051674	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99051674C>A	uc003uqj.2	+	7	799	c.656C>A	c.(655-657)CCG>CAG	p.P219Q	PTCD1_uc011kiw.1_Intron|CPSF4_uc003uqi.2_Missense_Mutation_p.P194Q|CPSF4_uc003uqk.2_Missense_Mutation_p.P193Q|CPSF4_uc011kix.1_Missense_Mutation_p.P141Q	NM_006693	NP_006684	O95639	CPSF4_HUMAN	cleavage and polyadenylation specific factor 4,	219					modification by virus of host mRNA processing|mRNA processing|viral infectious cycle	mRNA cleavage and polyadenylation specificity factor complex	RNA binding|zinc ion binding			central_nervous_system(1)	1	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)																	---	---	---	---
OR2AE1	81392	broad.mit.edu	37	7	99474142	99474142	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99474142C>A	uc003usc.1	-	1	515	c.515G>T	c.(514-516)CGG>CTG	p.R172L		NM_001005276	NP_001005276	Q8NHA4	O2AE1_HUMAN	olfactory receptor, family 2, subfamily AE,	172	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	Esophageal squamous(72;0.0166)|Lung NSC(181;0.0211)|all_lung(186;0.0323)																	---	---	---	---
ZNF277	11179	broad.mit.edu	37	7	111977891	111977891	+	Intron	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:111977891C>A	uc003vge.2	+						ZNF277_uc003vgf.2_Intron|ZNF277_uc003vgg.2_Intron	NM_021994	NP_068834			zinc finger protein (C2H2 type) 277							nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)|breast(2)	4																		---	---	---	---
TMEM140	55281	broad.mit.edu	37	7	134849551	134849551	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:134849551C>A	uc003vsi.2	+	2	639	c.358C>A	c.(358-360)CTG>ATG	p.L120M	C7orf49_uc003vsh.2_Intron	NM_018295	NP_060765	Q9NV12	TM140_HUMAN	transmembrane protein 140	120	Helical; (Potential).					integral to membrane				large_intestine(1)	1																		---	---	---	---
KIAA1549	57670	broad.mit.edu	37	7	138583725	138583725	+	Silent	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:138583725G>T	uc011kql.1	-	9	3872	c.3823C>A	c.(3823-3825)CGA>AGA	p.R1275R	KIAA1549_uc011kqi.1_Silent_p.R59R|KIAA1549_uc003vuk.3_Silent_p.R1225R|KIAA1549_uc011kqj.1_Silent_p.R1275R|KIAA1549_uc011kqk.1_Silent_p.R59R	NM_020910	NP_065961	Q9HCM3	K1549_HUMAN	hypothetical protein LOC57670 isoform 1	1275						integral to membrane			KIAA1549/BRAF(229)	central_nervous_system(229)|pancreas(1)	230								O	BRAF	pilocytic astrocytoma								---	---	---	---
PTK2B	2185	broad.mit.edu	37	8	27291644	27291644	+	Silent	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:27291644C>A	uc003xfn.1	+	17	1948	c.1140C>A	c.(1138-1140)CCC>CCA	p.P380P	PTK2B_uc003xfo.1_Silent_p.P380P|PTK2B_uc003xfp.1_Silent_p.P380P|PTK2B_uc003xfq.1_Silent_p.P380P|PTK2B_uc010luq.1_Silent_p.P138P|PTK2B_uc003xfr.1_Silent_p.P126P	NM_173174	NP_775266	Q14289	FAK2_HUMAN	PTK2B protein tyrosine kinase 2 beta isoform a	380					apoptosis|bone resorption|positive regulation of cell proliferation|signal complex assembly	cytosol	ATP binding|non-membrane spanning protein tyrosine kinase activity|signal transducer activity			lung(3)|ovary(1)|skin(1)	5		Ovarian(32;2.72e-05)		UCEC - Uterine corpus endometrioid carcinoma (27;0.023)|Epithelial(17;6.61e-10)|BRCA - Breast invasive adenocarcinoma(99;0.226)|Colorectal(74;0.229)														---	---	---	---
C8orf80	389643	broad.mit.edu	37	8	27925065	27925065	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:27925065G>T	uc003xgm.3	-	6	820	c.677C>A	c.(676-678)CCC>CAC	p.P226H		NM_001010906	NP_001010906	Q68CJ6	SLIP_HUMAN	speckled-like pattern in the germinal center	226						nucleus	GTP binding|GTPase activity			ovary(1)|central_nervous_system(1)	2		Ovarian(32;0.0218)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0228)|KIRC - Kidney renal clear cell carcinoma(542;0.126)|Kidney(114;0.15)|Colorectal(74;0.181)														---	---	---	---
DDHD2	23259	broad.mit.edu	37	8	38109430	38109430	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38109430G>T	uc003xlb.2	+	12	1722	c.1345G>T	c.(1345-1347)GGT>TGT	p.G449C	DDHD2_uc003xlc.2_Missense_Mutation_p.G449C|DDHD2_uc003xld.2_Missense_Mutation_p.G68C	NM_015214	NP_056029	O94830	DDHD2_HUMAN	DDHD domain containing 2 isoform 1	449					lipid catabolic process	centrosome	hydrolase activity|metal ion binding			large_intestine(1)|ovary(1)	2	Colorectal(12;0.000442)	all_lung(54;0.0657)|Lung NSC(58;0.175)	BRCA - Breast invasive adenocarcinoma(5;3.76e-25)|COAD - Colon adenocarcinoma(9;0.0977)															---	---	---	---
FAM110B	90362	broad.mit.edu	37	8	59059521	59059521	+	Silent	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:59059521G>T	uc003xtj.1	+	5	1612	c.732G>T	c.(730-732)GTG>GTT	p.V244V		NM_147189	NP_671722	Q8TC76	F110B_HUMAN	hypothetical protein LOC90362	244						microtubule organizing center|mitochondrion|nucleus				large_intestine(1)	1		all_epithelial(80;0.025)|all_lung(136;0.0274)|Lung NSC(129;0.0355)																---	---	---	---
KCNS2	3788	broad.mit.edu	37	8	99440792	99440792	+	Silent	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:99440792G>T	uc003yin.2	+	2	935	c.585G>T	c.(583-585)CTG>CTT	p.L195L		NM_020697	NP_065748	Q9ULS6	KCNS2_HUMAN	potassium voltage-gated channel,	195	Helical; Name=Segment S1; (Potential).					voltage-gated potassium channel complex	voltage-gated potassium channel activity			ovary(1)	1	Breast(36;2.4e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.0448)															---	---	---	---
TG	7038	broad.mit.edu	37	8	133900554	133900554	+	Silent	SNP	G	A	A	rs138731686		TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:133900554G>A	uc003ytw.2	+	10	2543	c.2502G>A	c.(2500-2502)CCG>CCA	p.P834P		NM_003235	NP_003226	P01266	THYG_HUMAN	thyroglobulin precursor	834	Thyroglobulin type-1 7.				hormone biosynthetic process|signal transduction|thyroid gland development|thyroid hormone generation	extracellular space	hormone activity			ovary(8)|breast(4)|pancreas(1)|central_nervous_system(1)|skin(1)	15	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)														---	---	---	---
EIF2C2	27161	broad.mit.edu	37	8	141549487	141549487	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:141549487C>A	uc003yvn.2	-	16	2141	c.2101G>T	c.(2101-2103)GGG>TGG	p.G701W	EIF2C2_uc010men.2_Missense_Mutation_p.G624W|EIF2C2_uc010meo.2_Missense_Mutation_p.G701W	NM_012154	NP_036286	Q9UKV8	AGO2_HUMAN	argonaute 2 isoform 1	701	Piwi.				mRNA cleavage involved in gene silencing by miRNA|negative regulation of translation involved in gene silencing by miRNA|negative regulation of translational initiation|pre-miRNA processing|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasmic mRNA processing body|cytosol|micro-ribonucleoprotein complex|mRNA cap binding complex|nucleus|polysome|RNA-induced silencing complex	endoribonuclease activity, cleaving siRNA-paired mRNA|metal ion binding|protein binding|RNA 7-methylguanosine cap binding|siRNA binding|translation initiation factor activity				0	all_cancers(97;2.54e-14)|all_epithelial(106;5.99e-13)|Lung NSC(106;1.45e-05)|all_lung(105;2.07e-05)|Ovarian(258;0.0154)|Acute lymphoblastic leukemia(118;0.155)	Breast(495;0.159)	BRCA - Breast invasive adenocarcinoma(115;0.158)															---	---	---	---
ADAMTSL1	92949	broad.mit.edu	37	9	18706968	18706968	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:18706968G>T	uc003zne.3	+	14	1925	c.1798G>T	c.(1798-1800)GGT>TGT	p.G600C		NM_001040272	NP_001035362	Q8N6G6	ATL1_HUMAN	ADAMTS-like 1 isoform 4 precursor	600						proteinaceous extracellular matrix	metallopeptidase activity|zinc ion binding			ovary(3)|upper_aerodigestive_tract(1)|lung(1)	5				GBM - Glioblastoma multiforme(50;1.29e-17)														---	---	---	---
DNAJB5	25822	broad.mit.edu	37	9	34996681	34996681	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:34996681C>A	uc003zvt.2	+	3	769	c.631C>A	c.(631-633)CTG>ATG	p.L211M	DNAJB5_uc003zvs.2_Missense_Mutation_p.L245M|DNAJB5_uc011los.1_Missense_Mutation_p.L283M	NM_012266	NP_036398	O75953	DNJB5_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 5	211					protein folding|response to unfolded protein		heat shock protein binding|unfolded protein binding				0			LUSC - Lung squamous cell carcinoma(32;0.00575)															---	---	---	---
FRMPD1	22844	broad.mit.edu	37	9	37740876	37740876	+	Missense_Mutation	SNP	C	A	A	rs144670594		TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:37740876C>A	uc004aag.1	+	15	2395	c.2351C>A	c.(2350-2352)CCG>CAG	p.P784Q	FRMPD1_uc004aah.1_Missense_Mutation_p.P784Q|FRMPD1_uc011lqm.1_Missense_Mutation_p.P606Q|FRMPD1_uc011lqn.1_Missense_Mutation_p.P653Q	NM_014907	NP_055722	Q5SYB0	FRPD1_HUMAN	FERM and PDZ domain containing 1	784						cytoskeleton|cytosol|plasma membrane				ovary(4)|central_nervous_system(2)|skin(2)|breast(1)	9				GBM - Glioblastoma multiforme(29;0.00655)														---	---	---	---
MAMDC2	256691	broad.mit.edu	37	9	72785504	72785504	+	Silent	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:72785504C>A	uc004ahm.2	+	11	2225	c.1608C>A	c.(1606-1608)CCC>CCA	p.P536P	MAMDC2_uc004ahn.2_RNA|uc004aho.1_Intron|uc004ahp.1_RNA	NM_153267	NP_694999	Q7Z304	MAMC2_HUMAN	MAM domain containing 2 precursor	536	MAM 4.					endoplasmic reticulum|membrane				central_nervous_system(1)|pancreas(1)	2																		---	---	---	---
TRIM14	9830	broad.mit.edu	37	9	100857266	100857266	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:100857266C>A	uc004ayd.2	-	4	601	c.583G>T	c.(583-585)GGG>TGG	p.G195W	TRIM14_uc004ayf.1_Missense_Mutation_p.G102W|TRIM14_uc011luz.1_5'Flank|TRIM14_uc011lva.1_5'Flank|TRIM14_uc004ayg.1_Missense_Mutation_p.G195W|TRIM14_uc004ayh.1_Missense_Mutation_p.G195W|TRIM14_uc004ayi.1_Missense_Mutation_p.G195W|TRIM14_uc004ayj.1_Missense_Mutation_p.G102W	NM_033220	NP_150089	Q14142	TRI14_HUMAN	tripartite motif protein TRIM14 isoform alpha	195						cytoplasm|intracellular	zinc ion binding			central_nervous_system(1)	1		Acute lymphoblastic leukemia(62;0.0559)																---	---	---	---
SLC31A2	1318	broad.mit.edu	37	9	115923802	115923802	+	Silent	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:115923802G>T	uc004bgq.2	+	3	204	c.87G>T	c.(85-87)TCG>TCT	p.S29S	SLC31A2_uc011lxb.1_Silent_p.S29S	NM_001860	NP_001851	O15432	COPT2_HUMAN	solute carrier family 31 (copper transporters),	29	Helical; (Potential).					integral to plasma membrane	copper ion transmembrane transporter activity				0																		---	---	---	---
TNC	3371	broad.mit.edu	37	9	117808831	117808831	+	Silent	SNP	A	C	C			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:117808831A>C	uc004bjj.3	-	17	5345	c.4983T>G	c.(4981-4983)TCT>TCG	p.S1661S	TNC_uc010mvf.2_Intron	NM_002160	NP_002151	P24821	TENA_HUMAN	tenascin C precursor	1661	Fibronectin type-III 12.				cell adhesion|response to wounding|signal transduction	extracellular space	receptor binding|syndecan binding			central_nervous_system(4)|upper_aerodigestive_tract(1)|ovary(1)|skin(1)	7																		---	---	---	---
LRRC8A	56262	broad.mit.edu	37	9	131671599	131671599	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131671599G>T	uc004bwl.3	+	3	2410	c.2156G>T	c.(2155-2157)CGG>CTG	p.R719L	LRRC8A_uc010myp.2_Missense_Mutation_p.R719L|LRRC8A_uc010myq.2_Missense_Mutation_p.R719L	NM_019594	NP_062540	Q8IWT6	LRC8A_HUMAN	leucine rich repeat containing 8 family, member	719	LRR 15.				pre-B cell differentiation	integral to membrane					0																		---	---	---	---
MTPAP	55149	broad.mit.edu	37	10	30615481	30615481	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:30615481T>G	uc001iva.3	-	5	927	c.864A>C	c.(862-864)TTA>TTC	p.L288F	MTPAP_uc001ivb.3_Missense_Mutation_p.L418F	NM_018109	NP_060579	Q9NVV4	PAPD1_HUMAN	PAP associated domain containing 1 precursor	288					cell death|histone mRNA catabolic process|mRNA polyadenylation|transcription, DNA-dependent	mitochondrion	ATP binding|magnesium ion binding|manganese ion binding|polynucleotide adenylyltransferase activity|protein homodimerization activity|RNA binding|UTP binding			ovary(1)	1																		---	---	---	---
RTKN2	219790	broad.mit.edu	37	10	63957802	63957802	+	Silent	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:63957802G>T	uc001jlw.2	-	12	1792	c.1695C>A	c.(1693-1695)GCC>GCA	p.A565A	RTKN2_uc009xpf.1_Intron|RTKN2_uc001jlv.2_Silent_p.A219A	NM_145307	NP_660350	Q8IZC4	RTKN2_HUMAN	rhotekin 2	565					signal transduction	intracellular					0	Prostate(12;0.0297)|all_hematologic(501;0.215)																	---	---	---	---
CCAR1	55749	broad.mit.edu	37	10	70514470	70514470	+	Splice_Site	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:70514470G>T	uc001joo.2	+	12	1464	c.1345_splice	c.e12-1	p.V449_splice	CCAR1_uc001jol.1_Splice_Site|CCAR1_uc001jom.1_Splice_Site_p.V254_splice|CCAR1_uc009xpx.1_Splice_Site_p.V423_splice|CCAR1_uc001jon.1_Splice_Site_p.V395_splice|CCAR1_uc010qiz.1_Splice_Site_p.V434_splice|CCAR1_uc010qja.1_Splice_Site_p.V434_splice|CCAR1_uc010qjb.1_Splice_Site|SNORD98_uc001jop.1_5'Flank	NM_018237	NP_060707			cell-cycle and apoptosis regulatory protein 1						apoptosis|cell cycle|nuclear mRNA splicing, via spliceosome|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleoplasm|perinuclear region of cytoplasm	calcium ion binding|nucleic acid binding|protein binding			ovary(6)|large_intestine(1)	7																		---	---	---	---
ADAMTS14	140766	broad.mit.edu	37	10	72492004	72492004	+	Intron	SNP	C	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:72492004C>T	uc001jrh.2	+						ADAMTS14_uc001jrg.2_Intron|ADAMTS14_uc001jri.1_5'Flank	NM_080722	NP_542453			ADAM metallopeptidase with thrombospondin type 1						collagen catabolic process|proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(5)|upper_aerodigestive_tract(1)	6																		---	---	---	---
SLIT1	6585	broad.mit.edu	37	10	98764541	98764541	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:98764541C>A	uc001kmw.2	-	33	3871	c.3619G>T	c.(3619-3621)GGG>TGG	p.G1207W		NM_003061	NP_003052	O75093	SLIT1_HUMAN	slit homolog 1 precursor	1207	Laminin G-like.				axon extension involved in axon guidance|forebrain morphogenesis|motor axon guidance|negative chemotaxis|negative regulation of synaptogenesis	cytoplasm|extracellular space	calcium ion binding|Roundabout binding			ovary(4)	4		Colorectal(252;0.162)		Epithelial(162;2.02e-08)|all cancers(201;1.5e-06)														---	---	---	---
CPN1	1369	broad.mit.edu	37	10	101829528	101829528	+	Silent	SNP	G	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:101829528G>A	uc001kql.2	-	3	779	c.519C>T	c.(517-519)AAC>AAT	p.N173N		NM_001308	NP_001299	P15169	CBPN_HUMAN	carboxypeptidase N, polypeptide 1 precursor	173	Catalytic.				proteolysis	extracellular space	metallocarboxypeptidase activity|zinc ion binding			central_nervous_system(3)|pancreas(1)	4		Colorectal(252;0.234)		Epithelial(162;4.77e-10)|all cancers(201;3.82e-08)														---	---	---	---
CHUK	1147	broad.mit.edu	37	10	101980440	101980440	+	Intron	SNP	A	G	G			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:101980440A>G	uc001kqp.2	-							NM_001278	NP_001269			conserved helix-loop-helix ubiquitous kinase						I-kappaB phosphorylation|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	CD40 receptor complex|cytosol|internal side of plasma membrane|nucleus	ATP binding|identical protein binding|IkappaB kinase activity			ovary(2)|central_nervous_system(2)|large_intestine(1)|lung(1)|breast(1)	7		Colorectal(252;0.117)		Epithelial(162;2.05e-10)|all cancers(201;1.91e-08)														---	---	---	---
TECTB	6975	broad.mit.edu	37	10	114045879	114045879	+	Silent	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:114045879C>A	uc001kzr.1	+	3	318	c.318C>A	c.(316-318)ACC>ACA	p.T106T		NM_058222	NP_478129	Q96PL2	TECTB_HUMAN	tectorin beta precursor	106	ZP.					anchored to membrane|plasma membrane|proteinaceous extracellular matrix					0		Colorectal(252;0.198)		Epithelial(162;0.0143)|all cancers(201;0.0242)														---	---	---	---
NRAP	4892	broad.mit.edu	37	10	115389485	115389485	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:115389485C>A	uc001laj.2	-	19	2066	c.1902G>T	c.(1900-1902)ATG>ATT	p.M634I	NRAP_uc009xyb.2_5'Flank|NRAP_uc001lak.2_Missense_Mutation_p.M599I|NRAP_uc001lal.3_Missense_Mutation_p.M634I	NM_198060	NP_932326	Q86VF7	NRAP_HUMAN	nebulin-related anchoring protein isoform S	634	Nebulin 15.					fascia adherens|muscle tendon junction	actin binding|muscle alpha-actinin binding|zinc ion binding			ovary(6)|central_nervous_system(3)|upper_aerodigestive_tract(1)	10		Colorectal(252;0.0233)|Breast(234;0.188)		Epithelial(162;0.00392)|all cancers(201;0.00569)														---	---	---	---
NRAP	4892	broad.mit.edu	37	10	115409896	115409896	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:115409896C>A	uc001laj.2	-	9	952	c.788G>T	c.(787-789)AGG>ATG	p.R263M	NRAP_uc001lak.2_Missense_Mutation_p.R263M|NRAP_uc001lal.3_Missense_Mutation_p.R263M	NM_198060	NP_932326	Q86VF7	NRAP_HUMAN	nebulin-related anchoring protein isoform S	263	Nebulin 5.					fascia adherens|muscle tendon junction	actin binding|muscle alpha-actinin binding|zinc ion binding			ovary(6)|central_nervous_system(3)|upper_aerodigestive_tract(1)	10		Colorectal(252;0.0233)|Breast(234;0.188)		Epithelial(162;0.00392)|all cancers(201;0.00569)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	134671135	134671135	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134671135C>A	uc010qux.1	-	31	4711	c.4711G>T	c.(4711-4713)GGG>TGG	p.G1571W		NM_017609	NP_060079			Homo sapiens cDNA, FLJ17989.																														---	---	---	---
CDHR5	53841	broad.mit.edu	37	11	619492	619492	+	Silent	SNP	C	A	A	rs61732112	byFrequency;by1000genomes	TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:619492C>A	uc001lqj.2	-	11	1380	c.1275G>T	c.(1273-1275)GCG>GCT	p.A425A	CDHR5_uc001lqk.2_Silent_p.A425A|CDHR5_uc009ycc.2_Silent_p.A259A|CDHR5_uc009ycd.2_Silent_p.A425A|CDHR5_uc001lql.2_Silent_p.A425A|CDHR5_uc001lqm.2_Silent_p.A259A|CDHR5_uc009yce.1_Silent_p.A394A	NM_021924	NP_068743	Q9HBB8	CDHR5_HUMAN	mucin and cadherin-like isoform 1	425	Cadherin 4.|Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0																		---	---	---	---
TALDO1	6888	broad.mit.edu	37	11	755949	755949	+	Silent	SNP	C	A	A	rs2234021		TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:755949C>A	uc001lqz.2	+	2	218	c.168C>A	c.(166-168)CCC>CCA	p.P56P	TALDO1_uc010qwl.1_Silent_p.P56P|TALDO1_uc001lra.2_Silent_p.P56P	NM_006755	NP_006746	P37837	TALDO_HUMAN	transaldolase 1	56					energy reserve metabolic process|xylulose biosynthetic process	cytosol	protein binding|sedoheptulose-7-phosphate:D-glyceraldehyde-3-phosphate glyceronetransferase activity				0		all_cancers(49;1.13e-08)|all_epithelial(84;2.95e-05)|Breast(177;0.000286)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.159)|all_lung(207;0.198)		all cancers(45;4.66e-26)|Epithelial(43;2.97e-25)|OV - Ovarian serous cystadenocarcinoma(40;1.48e-19)|BRCA - Breast invasive adenocarcinoma(625;4.41e-05)|Lung(200;0.0595)|LUSC - Lung squamous cell carcinoma(625;0.0712)														---	---	---	---
AMPD3	272	broad.mit.edu	37	11	10500274	10500274	+	Silent	SNP	C	A	A	rs117002871	by1000genomes	TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:10500274C>A	uc001mio.1	+	3	758	c.423C>A	c.(421-423)GCC>GCA	p.A141A	AMPD3_uc010rbz.1_Intron|AMPD3_uc001min.1_Silent_p.A150A|AMPD3_uc009yfw.1_RNA|AMPD3_uc009yfx.1_Silent_p.A141A|AMPD3_uc009yfz.2_RNA|AMPD3_uc001mip.1_Silent_p.A148A|AMPD3_uc009yfy.2_Silent_p.A141A	NM_001025389	NP_001020560	Q01432	AMPD3_HUMAN	adenosine monophosphate deaminase 3 isoform 1B	141					AMP catabolic process|purine base metabolic process|purine ribonucleoside monophosphate biosynthetic process|purine-containing compound salvage	cytosol	AMP deaminase activity|metal ion binding			large_intestine(1)|ovary(1)	2				all cancers(16;1.14e-08)|Epithelial(150;2.83e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0291)														---	---	---	---
PDE3B	5140	broad.mit.edu	37	11	14840755	14840755	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:14840755G>T	uc001mln.2	+	7	2160	c.1807G>T	c.(1807-1809)GGT>TGT	p.G603C	PDE3B_uc010rcr.1_Missense_Mutation_p.G552C	NM_000922	NP_000913	Q13370	PDE3B_HUMAN	phosphodiesterase 3B	603					cAMP catabolic process|insulin receptor signaling pathway|negative regulation of lipid catabolic process|platelet activation	cytosol|endoplasmic reticulum|Golgi apparatus|guanyl-nucleotide exchange factor complex|integral to membrane|microsome	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity|metal ion binding|protein kinase B binding				0																		---	---	---	---
SOX6	55553	broad.mit.edu	37	11	16036526	16036526	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:16036526G>T	uc001mme.2	-	13	1766	c.1733C>A	c.(1732-1734)CCA>CAA	p.P578Q	SOX6_uc001mmd.2_Missense_Mutation_p.P541Q|SOX6_uc001mmf.2_Missense_Mutation_p.P538Q|SOX6_uc001mmg.2_Missense_Mutation_p.P565Q	NM_001145819	NP_001139291	P35712	SOX6_HUMAN	SRY (sex determining region Y)-box 6 isoform 4	565					muscle organ development	nucleus	sequence-specific DNA binding transcription factor activity			ovary(3)	3																		---	---	---	---
LRRC4C	57689	broad.mit.edu	37	11	40137715	40137715	+	Missense_Mutation	SNP	C	A	A	rs141998335		TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:40137715C>A	uc001mxa.1	-	2	2092	c.128G>T	c.(127-129)CGG>CTG	p.R43L	LRRC4C_uc001mxc.1_Missense_Mutation_p.R39L|LRRC4C_uc001mxd.1_Missense_Mutation_p.R39L|LRRC4C_uc001mxb.1_Missense_Mutation_p.R39L	NM_020929	NP_065980	Q9HCJ2	LRC4C_HUMAN	netrin-G1 ligand precursor	43					regulation of axonogenesis	integral to membrane	protein binding			ovary(4)|skin(3)|central_nervous_system(1)	8		all_lung(304;0.0575)|Lung NSC(402;0.138)																---	---	---	---
ALX4	60529	broad.mit.edu	37	11	44296944	44296944	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:44296944C>A	uc001myb.2	-	2	835	c.731G>T	c.(730-732)CGG>CTG	p.R244L		NM_021926	NP_068745	Q9H161	ALX4_HUMAN	aristaless-like homeobox 4	244	Homeobox.				hair follicle development						0																		---	---	---	---
F2	2147	broad.mit.edu	37	11	46748166	46748166	+	Silent	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:46748166G>T	uc001ndf.3	+	8	1036	c.993G>T	c.(991-993)TCG>TCT	p.S331S	F2_uc001ndg.3_RNA	NM_000506	NP_000497	P00734	THRB_HUMAN	coagulation factor II preproprotein	331					activation of caspase activity|acute-phase response|blood coagulation, intrinsic pathway|cell surface receptor linked signaling pathway|cytosolic calcium ion homeostasis|fibrinolysis|leukocyte migration|negative regulation of astrocyte differentiation|negative regulation of fibrinolysis|negative regulation of platelet activation|negative regulation of proteolysis|peptidyl-glutamic acid carboxylation|platelet activation|positive regulation of collagen biosynthetic process|positive regulation of protein phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of release of sequestered calcium ion into cytosol|post-translational protein modification|proteolysis|STAT protein import into nucleus|tyrosine phosphorylation of STAT protein	cytosol|endoplasmic reticulum lumen|extracellular space|Golgi lumen|plasma membrane|soluble fraction	calcium ion binding|growth factor activity|serine-type endopeptidase activity|thrombospondin receptor activity			ovary(3)	3		all_lung(304;0.000414)|Lung NSC(402;0.0011)		BRCA - Breast invasive adenocarcinoma(625;0.146)	Antihemophilic Factor(DB00025)|Argatroban(DB00278)|Bivalirudin(DB00006)|Coagulation Factor IX(DB00100)|Drotrecogin alfa(DB00055)|Enoxaparin(DB01225)|Heparin(DB01109)|Lepirudin(DB00001)|Menadione(DB00170)|Proflavine(DB01123)|Simvastatin(DB00641)|Suramin(DB04786)|Warfarin(DB00682)|Ximelagatran(DB04898)													---	---	---	---
CKAP5	9793	broad.mit.edu	37	11	46799806	46799806	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:46799806C>A	uc001ndi.1	-	22	2741	c.2631G>T	c.(2629-2631)AGG>AGT	p.R877S	CKAP5_uc009ylg.1_Missense_Mutation_p.R763S|CKAP5_uc001ndj.1_Missense_Mutation_p.R877S	NM_001008938	NP_001008938	Q14008	CKAP5_HUMAN	colonic and hepatic tumor over-expressed protein	877	HEAT 5.				cell division|centrosome organization|establishment or maintenance of microtubule cytoskeleton polarity|G2/M transition of mitotic cell cycle|mitotic prometaphase|RNA transport|spindle organization	centrosome|cytosol	protein binding|protein binding			ovary(1)|skin(1)	2																		---	---	---	---
MS4A7	58475	broad.mit.edu	37	11	60161301	60161301	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60161301G>T	uc001npe.2	+	7	835	c.690G>T	c.(688-690)CAG>CAT	p.Q230H	MS4A7_uc001npf.2_Missense_Mutation_p.Q230H|MS4A7_uc001npg.2_Missense_Mutation_p.Q185H|MS4A7_uc001nph.2_Missense_Mutation_p.Q185H|MS4A14_uc001npi.2_Intron	NM_206939	NP_996822	Q9GZW8	MS4A7_HUMAN	membrane-spanning 4-domains, subfamily A, member	230	Cytoplasmic (Potential).					integral to membrane	receptor activity			ovary(1)|central_nervous_system(1)	2																		---	---	---	---
VWCE	220001	broad.mit.edu	37	11	61053823	61053823	+	Silent	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61053823C>A	uc001nra.2	-	5	783	c.504G>T	c.(502-504)CCG>CCT	p.P168P	VWCE_uc001nrb.2_RNA	NM_152718	NP_689931	Q96DN2	VWCE_HUMAN	von Willebrand factor C and EGF domains	168	EGF-like 2; calcium-binding (Potential).					extracellular region	calcium ion binding			ovary(1)	1																		---	---	---	---
FERMT3	83706	broad.mit.edu	37	11	63988607	63988607	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:63988607G>T	uc001nyl.2	+	13	1826	c.1677G>T	c.(1675-1677)ATG>ATT	p.M559I	FERMT3_uc001nym.2_Missense_Mutation_p.M555I	NM_178443	NP_848537	Q86UX7	URP2_HUMAN	fermitin family homolog 3 long form	559					integrin activation|leukocyte cell-cell adhesion|platelet aggregation|regulation of cell-cell adhesion mediated by integrin	cell junction|cell projection|podosome	integrin binding			ovary(1)	1																		---	---	---	---
NUDT22	84304	broad.mit.edu	37	11	63997452	63997452	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:63997452C>A	uc001nyp.3	+	6	1082	c.902C>A	c.(901-903)CCG>CAG	p.P301Q	NUDT22_uc009ype.2_Missense_Mutation_p.P301Q|NUDT22_uc001nyq.3_Missense_Mutation_p.P268Q|NUDT22_uc010rng.1_RNA|uc001nyr.1_3'UTR|DNAJC4_uc001nys.2_5'Flank|DNAJC4_uc001nyt.2_5'Flank|DNAJC4_uc001nyu.2_5'Flank	NM_032344	NP_115720	Q9BRQ3	NUD22_HUMAN	nudix (nucleoside diphosphate linked moiety	301							hydrolase activity				0																		---	---	---	---
C11orf2	738	broad.mit.edu	37	11	64876935	64876935	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64876935C>A	uc001ocr.1	+	6	1667	c.1627C>A	c.(1627-1629)CTC>ATC	p.L543I	TM7SF2_uc001oct.2_5'Flank|TM7SF2_uc010rny.1_5'Flank|TM7SF2_uc001ocu.2_5'Flank|TM7SF2_uc001ocv.2_5'Flank|C11orf2_uc001ocs.1_Missense_Mutation_p.L419I	NM_013265	NP_037397	Q9UID3	FFR_HUMAN	chromosome 11 open reading frame 2	543					lipid transport|protein transport	Golgi apparatus|integral to membrane					0																		---	---	---	---
XRRA1	143570	broad.mit.edu	37	11	74556172	74556172	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:74556172C>A	uc009yub.2	-	16	2181	c.1849G>T	c.(1849-1851)GGC>TGC	p.G617C	XRRA1_uc001ovm.2_RNA|XRRA1_uc001ovn.2_Missense_Mutation_p.G240C|XRRA1_uc001ovo.2_Missense_Mutation_p.G225C|XRRA1_uc001ovq.3_Missense_Mutation_p.G530C|XRRA1_uc001ovp.3_Missense_Mutation_p.G342C|XRRA1_uc001ovr.2_Missense_Mutation_p.G240C|XRRA1_uc001ovs.1_Missense_Mutation_p.G219C	NM_182969	NP_892014	Q6P2D8	XRRA1_HUMAN	X-ray radiation resistance associated 1	617					response to X-ray	cytoplasm|nucleus				central_nervous_system(1)	1																		---	---	---	---
PRCP	5547	broad.mit.edu	37	11	82536019	82536019	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:82536019G>T	uc001ozs.2	-	9	1533	c.1420C>A	c.(1420-1422)CGC>AGC	p.R474S	PRCP_uc001ozr.2_Missense_Mutation_p.R495S	NM_005040	NP_005031	P42785	PCP_HUMAN	prolylcarboxypeptidase isoform 1 preproprotein	474					blood coagulation, intrinsic pathway|proteolysis	lysosome|plasma membrane	protein binding|serine-type carboxypeptidase activity			skin(1)	1																		---	---	---	---
PRCP	5547	broad.mit.edu	37	11	82536114	82536114	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:82536114G>T	uc001ozs.2	-	9	1438	c.1325C>A	c.(1324-1326)ACA>AAA	p.T442K	PRCP_uc001ozr.2_Missense_Mutation_p.T463K	NM_005040	NP_005031	P42785	PCP_HUMAN	prolylcarboxypeptidase isoform 1 preproprotein	442					blood coagulation, intrinsic pathway|proteolysis	lysosome|plasma membrane	protein binding|serine-type carboxypeptidase activity			skin(1)	1																		---	---	---	---
SYTL2	54843	broad.mit.edu	37	11	85406313	85406313	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:85406313C>A	uc010rth.1	-	18	3006	c.2730G>T	c.(2728-2730)ATG>ATT	p.M910I	SYTL2_uc010rtg.1_Missense_Mutation_p.M911I|SYTL2_uc010rti.1_Missense_Mutation_p.M886I|SYTL2_uc010rtj.1_Missense_Mutation_p.M878I|SYTL2_uc001pav.2_Missense_Mutation_p.M352I|SYTL2_uc010rte.1_Missense_Mutation_p.M312I|SYTL2_uc001pax.2_Missense_Mutation_p.M352I|SYTL2_uc001paz.2_Missense_Mutation_p.M231I|SYTL2_uc001pba.2_Missense_Mutation_p.M295I|SYTL2_uc001pay.2_Missense_Mutation_p.M341I|SYTL2_uc001paw.2_Missense_Mutation_p.M312I|SYTL2_uc009yvj.2_RNA|SYTL2_uc001pbd.2_Missense_Mutation_p.M1208I|SYTL2_uc001pbb.2_Missense_Mutation_p.M1248I|SYTL2_uc001pbc.2_Missense_Mutation_p.M1232I|SYTL2_uc010rtf.1_Missense_Mutation_p.M728I	NM_001162951	NP_001156423	Q9HCH5	SYTL2_HUMAN	synaptotagmin-like 2 isoform g	910					intracellular protein transport|vesicle docking involved in exocytosis	exocytic vesicle|extrinsic to plasma membrane|melanosome|membrane fraction	neurexin binding|phosphatidylinositol-4,5-bisphosphate binding|phosphatidylserine binding|Rab GTPase binding			ovary(2)|large_intestine(1)	3		Acute lymphoblastic leukemia(157;4.19e-06)|all_hematologic(158;0.0033)		KIRC - Kidney renal clear cell carcinoma(183;0.202)|Kidney(183;0.237)														---	---	---	---
MMP20	9313	broad.mit.edu	37	11	102496027	102496027	+	Silent	SNP	G	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:102496027G>A	uc001phc.2	-	1	37	c.24C>T	c.(22-24)GGC>GGT	p.G8G		NM_004771	NP_004762	O60882	MMP20_HUMAN	matrix metalloproteinase 20 preproprotein	8					proteolysis|regulation of enamel mineralization	extracellular space|proteinaceous extracellular matrix	calcium ion binding|metalloendopeptidase activity|protein binding|zinc ion binding			urinary_tract(1)|skin(1)	2	all_cancers(8;8.95e-05)|all_epithelial(12;0.00227)|Lung NSC(15;0.139)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0033)	Epithelial(9;0.0216)|Lung(13;0.0711)|all cancers(10;0.0889)|LUSC - Lung squamous cell carcinoma(19;0.13)	BRCA - Breast invasive adenocarcinoma(274;0.0161)														---	---	---	---
MMP8	4317	broad.mit.edu	37	11	102584178	102584178	+	Missense_Mutation	SNP	A	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:102584178A>T	uc001phe.2	-	10	1404	c.1305T>A	c.(1303-1305)CAT>CAA	p.H435Q	MMP8_uc010rut.1_3'UTR|MMP8_uc010ruu.1_Missense_Mutation_p.H412Q	NM_002424	NP_002415	P22894	MMP8_HUMAN	matrix metalloproteinase 8 preproprotein	435	Hemopexin-like 4.				collagen catabolic process|proteolysis	extracellular space|proteinaceous extracellular matrix	metalloendopeptidase activity|serine-type endopeptidase activity|zinc ion binding			ovary(3)|breast(1)	4	all_cancers(8;0.00092)|all_epithelial(12;0.00389)|Lung NSC(15;0.227)	all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)	Epithelial(9;0.0555)|Lung(13;0.0828)|LUSC - Lung squamous cell carcinoma(19;0.151)|all cancers(10;0.189)	BRCA - Breast invasive adenocarcinoma(274;0.0141)														---	---	---	---
DYNC2H1	79659	broad.mit.edu	37	11	103270478	103270478	+	Missense_Mutation	SNP	A	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:103270478A>T	uc001pho.2	+	84	12388	c.12244A>T	c.(12244-12246)AAT>TAT	p.N4082Y	DYNC2H1_uc001phn.1_Missense_Mutation_p.N4089Y|DYNC2H1_uc009yxe.1_Intron	NM_001080463	NP_001073932	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1	4082					cell projection organization|Golgi organization|microtubule-based movement|multicellular organismal development	cilium axoneme|dynein complex|Golgi apparatus|microtubule|plasma membrane	ATP binding|ATPase activity|microtubule motor activity				0		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	124120492	124120492	+	IGR	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124120492C>A								OR8G2 (24182 upstream) : OR8D1 (59245 downstream)																																			---	---	---	---
FLI1	2313	broad.mit.edu	37	11	128680436	128680436	+	Silent	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:128680436G>T	uc010sbu.1	+	9	1253	c.912G>T	c.(910-912)GGG>GGT	p.G304G	FLI1_uc010sbt.1_Silent_p.G111G|FLI1_uc010sbv.1_Silent_p.G271G|FLI1_uc009zci.2_Silent_p.G238G	NM_002017	NP_002008	Q01543	FLI1_HUMAN	Friend leukemia virus integration 1	304	ETS.				hemostasis|organ morphogenesis	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity		EWSR1/FLI1(2266)	bone(2210)|soft_tissue(48)|autonomic_ganglia(4)|central_nervous_system(4)|lung(3)|ovary(2)|pancreas(2)	2273	all_hematologic(175;0.0641)	Lung NSC(97;0.00588)|all_lung(97;0.00764)|Breast(109;0.0115)|Medulloblastoma(222;0.0523)|all_neural(223;0.0862)|all_hematologic(192;0.182)		OV - Ovarian serous cystadenocarcinoma(99;0.01)|LUSC - Lung squamous cell carcinoma(976;0.0324)|Lung(977;0.0327)				T	EWSR1	Ewing sarcoma								---	---	---	---
ERC1	23085	broad.mit.edu	37	12	1137575	1137575	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:1137575G>T	uc001qjb.2	+	2	747	c.506G>T	c.(505-507)CGG>CTG	p.R169L	ERC1_uc001qiz.2_RNA|ERC1_uc001qjc.2_Missense_Mutation_p.R169L|ERC1_uc001qja.2_RNA|ERC1_uc001qjd.2_RNA|ERC1_uc001qjf.2_Missense_Mutation_p.R169L	NM_178040	NP_829884	Q8IUD2	RB6I2_HUMAN	RAB6-interacting protein 2 isoform epsilon	169	Potential.				I-kappaB phosphorylation|multicellular organismal development|positive regulation of anti-apoptosis|positive regulation of NF-kappaB transcription factor activity|protein transport	Golgi membrane|IkappaB kinase complex|presynaptic membrane	leucine zipper domain binding			ovary(2)|lung(2)|breast(1)	5	all_epithelial(11;0.0698)|Ovarian(42;0.107)		OV - Ovarian serous cystadenocarcinoma(31;0.00239)|BRCA - Breast invasive adenocarcinoma(9;0.0567)															---	---	---	---
USP5	8078	broad.mit.edu	37	12	6975192	6975192	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6975192C>A	uc001qri.3	+	20	2587	c.2528C>A	c.(2527-2529)CCG>CAG	p.P843Q	USP5_uc001qrh.3_Missense_Mutation_p.P820Q|TPI1_uc001qrk.2_5'Flank|TPI1_uc010sfo.1_5'Flank	NM_001098536	NP_001092006	P45974	UBP5_HUMAN	ubiquitin specific peptidase 5 isoform 1	843					positive regulation of proteasomal ubiquitin-dependent protein catabolic process|protein K48-linked deubiquitination|ubiquitin-dependent protein catabolic process	lysosome	cysteine-type endopeptidase activity|omega peptidase activity|protein binding|ubiquitin thiolesterase activity|zinc ion binding			lung(2)|breast(1)|skin(1)	4																		---	---	---	---
H2AFJ	55766	broad.mit.edu	37	12	14927567	14927567	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:14927567G>T	uc009zia.2	+	1	298	c.163G>T	c.(163-165)GTG>TTG	p.V55L	H2AFJ_uc001rch.3_RNA	NM_177925	NP_808760	Q9BTM1	H2AJ_HUMAN	H2A histone family, member J	55					nucleosome assembly	nucleosome|nucleus	DNA binding			ovary(1)	1																		---	---	---	---
DDX11	1663	broad.mit.edu	37	12	31242080	31242080	+	Silent	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:31242080C>A	uc001rjt.1	+	7	1038	c.787C>A	c.(787-789)CGG>AGG	p.R263R	DDX11_uc010sjw.1_Silent_p.R263R|DDX11_uc010sjx.1_RNA|DDX11_uc001rjr.1_Silent_p.R263R|DDX11_uc001rjs.1_Silent_p.R263R|DDX11_uc001rju.1_5'UTR|DDX11_uc001rjv.1_Silent_p.R263R|DDX11_uc001rjw.1_Silent_p.R237R|DDX11_uc001rjx.1_5'UTR|DDX11_uc009zjn.1_RNA	NM_152438	NP_689651	Q96FC9	DDX11_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11	263	Helicase ATP-binding.				G2/M transition of mitotic cell cycle|interspecies interaction between organisms|mitotic sister chromatid segregation|positive regulation of cell proliferation|S phase of mitotic cell cycle|sister chromatid cohesion	midbody|nuclear chromatin|nucleolus|spindle pole	ATP binding|ATP-dependent DNA helicase activity|DNA binding|protein binding|RNA binding			breast(3)	3	all_cancers(9;1.77e-11)|all_lung(12;6.21e-11)|all_epithelial(9;6.49e-11)|Lung NSC(12;1.06e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Lung SC(12;0.0592)|Esophageal squamous(101;0.233)														Multiple Myeloma(12;0.14)			---	---	---	---
LRRK2	120892	broad.mit.edu	37	12	40671789	40671789	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:40671789T>C	uc001rmg.3	+	17	2162	c.2041T>C	c.(2041-2043)TCC>CCC	p.S681P	LRRK2_uc001rmh.1_Missense_Mutation_p.S303P	NM_198578	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	681					activation of MAPKK activity|determination of adult lifespan|exploration behavior|intracellular distribution of mitochondria|negative regulation of branching morphogenesis of a nerve|negative regulation of dendritic spine morphogenesis|negative regulation of neuroblast proliferation|negative regulation of neuron maturation|neuromuscular junction development|neuron death|peptidyl-serine phosphorylation|positive regulation of autophagy|positive regulation of dopamine receptor signaling pathway|positive regulation of programmed cell death|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein phosphorylation|positive regulation of protein ubiquitination|protein autophosphorylation|regulation of kidney size|regulation of locomotion|regulation of membrane potential|response to oxidative stress|small GTPase mediated signal transduction|tangential migration from the subventricular zone to the olfactory bulb	external side of mitochondrial outer membrane	ATP binding|GTP binding|GTP-dependent protein kinase activity|GTPase activator activity|MAP kinase kinase activity|protein homodimerization activity|tubulin binding			ovary(12)|stomach(5)|upper_aerodigestive_tract(2)|lung(2)|large_intestine(1)|urinary_tract(1)|pancreas(1)	24	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)																---	---	---	---
DBX2	440097	broad.mit.edu	37	12	45444623	45444623	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:45444623C>T	uc001rok.1	-	1	260	c.88G>A	c.(88-90)GGC>AGC	p.G30S		NM_001004329	NP_001004329	Q6ZNG2	DBX2_HUMAN	developing brain homeobox 2	30						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0	Lung SC(27;0.192)	Lung NSC(34;0.142)		GBM - Glioblastoma multiforme(48;0.0515)														---	---	---	---
KRT80	144501	broad.mit.edu	37	12	52565271	52565271	+	Silent	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52565271G>T	uc001rzx.2	-	9	1368	c.1270C>A	c.(1270-1272)CGA>AGA	p.R424R	KRT80_uc001rzw.2_Silent_p.R459R|KRT80_uc001rzy.2_3'UTR	NM_182507	NP_872313	Q6KB66	K2C80_HUMAN	keratin 80 isoform a	424	Tail.					keratin filament	structural molecule activity				0				BRCA - Breast invasive adenocarcinoma(357;0.108)														---	---	---	---
LEMD3	23592	broad.mit.edu	37	12	65639954	65639954	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:65639954C>A	uc001ssl.1	+	13	2591	c.2585C>A	c.(2584-2586)ACA>AAA	p.T862K	LEMD3_uc009zqo.1_Missense_Mutation_p.T861K	NM_014319	NP_055134	Q9Y2U8	MAN1_HUMAN	LEM domain containing 3	862	Interaction with SMAD1, SMAD2, SMAD3 and SMAD5.				negative regulation of activin receptor signaling pathway|negative regulation of BMP signaling pathway|negative regulation of transforming growth factor beta receptor signaling pathway	integral to nuclear inner membrane|membrane fraction	DNA binding|nucleotide binding|protein binding			central_nervous_system(3)|ovary(1)	4			LUAD - Lung adenocarcinoma(6;0.0234)|LUSC - Lung squamous cell carcinoma(43;0.0975)	GBM - Glioblastoma multiforme(28;0.0104)														---	---	---	---
PTPRB	5787	broad.mit.edu	37	12	70988373	70988373	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:70988373C>A	uc001swb.3	-	4	766	c.736G>T	c.(736-738)GGT>TGT	p.G246C	PTPRB_uc010sto.1_Missense_Mutation_p.G246C|PTPRB_uc010stp.1_Missense_Mutation_p.G246C|PTPRB_uc001swc.3_Missense_Mutation_p.G464C|PTPRB_uc001swa.3_Missense_Mutation_p.G464C|PTPRB_uc001swd.3_Missense_Mutation_p.G463C|PTPRB_uc009zrr.1_Missense_Mutation_p.G343C|PTPRB_uc001swe.2_Missense_Mutation_p.G464C	NM_002837	NP_002828	P23467	PTPRB_HUMAN	protein tyrosine phosphatase, receptor type, B	246	Fibronectin type-III 3.|Extracellular (Potential).				angiogenesis	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(2)|skin(1)	3	Renal(347;0.236)		GBM - Glioblastoma multiforme(2;2.17e-05)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00306)|STAD - Stomach adenocarcinoma(21;0.149)															---	---	---	---
PAH	5053	broad.mit.edu	37	12	103260378	103260378	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:103260378G>T	uc001tjq.1	-	6	977	c.505C>A	c.(505-507)CGC>AGC	p.R169S	PAH_uc010swc.1_Missense_Mutation_p.R169S	NM_000277	NP_000268	P00439	PH4H_HUMAN	phenylalanine hydroxylase	169			R -> H (in PKU).		catecholamine biosynthetic process|L-phenylalanine catabolic process|neurotransmitter biosynthetic process	cytosol	phenylalanine 4-monooxygenase activity			ovary(4)	4					Epinephrine(DB00668)|L-Phenylalanine(DB00120)|Levodopa(DB01235)|Norepinephrine(DB00368)|Tetrahydrobiopterin(DB00360)													---	---	---	---
FOXN4	121643	broad.mit.edu	37	12	109719324	109719324	+	Silent	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109719324C>A	uc001toe.3	-	9	1287	c.1182G>T	c.(1180-1182)CCG>CCT	p.P394P	FOXN4_uc009zvg.2_Silent_p.P191P|FOXN4_uc001tof.3_Silent_p.P214P	NM_213596	NP_998761	Q96NZ1	FOXN4_HUMAN	forkhead box N4	394					axon extension|embryo development|organ development|pattern specification process|regulation of heart contraction|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			ovary(1)|lung(1)	2																		---	---	---	---
DNAH10	196385	broad.mit.edu	37	12	124359850	124359850	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124359850C>A	uc001uft.3	+	46	7682	c.7657C>A	c.(7657-7659)CGT>AGT	p.R2553S		NM_207437	NP_997320	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	2553	AAA 3 (By similarity).				microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(3)|skin(2)|central_nervous_system(1)	6	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)														---	---	---	---
TMEM132D	121256	broad.mit.edu	37	12	130185027	130185027	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:130185027G>T	uc009zyl.1	-	2	624	c.296C>A	c.(295-297)CCT>CAT	p.P99H		NM_133448	NP_597705	Q14C87	T132D_HUMAN	transmembrane protein 132D precursor	99	Extracellular (Potential).					integral to membrane				ovary(10)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	14	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)														---	---	---	---
COL4A1	1282	broad.mit.edu	37	13	110861227	110861227	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:110861227C>T	uc001vqw.3	-	12	784	c.662G>A	c.(661-663)GGC>GAC	p.G221D	COL4A1_uc010agl.2_Missense_Mutation_p.G221D	NM_001845	NP_001836	P02462	CO4A1_HUMAN	alpha 1 type IV collagen preproprotein	221	Triple-helical region.				angiogenesis|axon guidance		extracellular matrix structural constituent|platelet-derived growth factor binding			ovary(3)|lung(1)|central_nervous_system(1)|pancreas(1)	6	all_cancers(4;9.8e-13)|all_epithelial(4;9.66e-08)|all_lung(23;3.75e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00178)|all_neural(89;0.00459)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0604)	Breast(118;0.2)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.145)															---	---	---	---
NEDD8	4738	broad.mit.edu	37	14	24686353	24686353	+	Nonsense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24686353C>A	uc001wnn.2	-	4	329	c.226G>T	c.(226-228)GGA>TGA	p.G76*	TM9SF1_uc010tob.1_5'Flank|CHMP4A_uc010toc.1_5'Flank|CHMP4A_uc001wnj.2_5'Flank|MDP1_uc001wnk.1_5'Flank|CHMP4A_uc001wnm.1_5'Flank|MDP1_uc001wnl.1_5'Flank|NEDD8_uc001wno.2_RNA	NM_006156	NP_006147	Q15843	NEDD8_HUMAN	neural precursor cell expressed, developmentally	76					anatomical structure morphogenesis|protein neddylation|ubiquitin-dependent protein catabolic process	nucleus	ubiquitin protein ligase binding				0				GBM - Glioblastoma multiforme(265;0.0186)														---	---	---	---
G2E3	55632	broad.mit.edu	37	14	31061605	31061605	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:31061605C>A	uc001wqk.2	+	5	468	c.314C>A	c.(313-315)CCA>CAA	p.P105Q	G2E3_uc010tpe.1_Missense_Mutation_p.P59Q|G2E3_uc010tpf.1_Missense_Mutation_p.P59Q	NM_017769	NP_060239	Q7L622	G2E3_HUMAN	G2/M-phase specific E3 ubiquitin ligase	105	PHD-type 1.				apoptosis|multicellular organismal development|protein modification process	Golgi apparatus|nucleolus	acid-amino acid ligase activity|protein binding|zinc ion binding			ovary(2)|skin(1)	3																		---	---	---	---
EGLN3	112399	broad.mit.edu	37	14	34400401	34400401	+	Silent	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:34400401C>A	uc001wsa.3	-	2	704	c.378G>T	c.(376-378)CCG>CCT	p.P126P	EGLN3_uc001wry.2_Silent_p.P32P|EGLN3_uc001wrz.2_Silent_p.P126P	NM_022073	NP_071356	Q9H6Z9	EGLN3_HUMAN	egl nine homolog 3	126	Fe2OG dioxygenase.				apoptosis	cytoplasm|nucleus	iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding				0	Breast(36;0.0303)|Hepatocellular(127;0.133)		LUAD - Lung adenocarcinoma(48;0.000246)|Lung(238;0.000959)|Epithelial(34;0.155)	GBM - Glioblastoma multiforme(112;0.0118)	Vitamin C(DB00126)													---	---	---	---
NIN	51199	broad.mit.edu	37	14	51226755	51226755	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:51226755C>A	uc001wym.2	-	17	2410	c.2219G>T	c.(2218-2220)CGG>CTG	p.R740L	NIN_uc001wyi.2_Missense_Mutation_p.R740L|NIN_uc001wyj.2_RNA|NIN_uc001wyk.2_Missense_Mutation_p.R740L|NIN_uc010tqp.1_Missense_Mutation_p.R746L|NIN_uc001wyo.2_Missense_Mutation_p.R740L	NM_182946	NP_891991	Q8N4C6	NIN_HUMAN	ninein isoform 5	740	Potential.				centrosome localization	centrosome|microtubule	calcium ion binding|GTP binding|protein binding			skin(3)|ovary(1)|kidney(1)|central_nervous_system(1)	6	all_epithelial(31;0.00244)|Breast(41;0.127)							T	PDGFRB	MPD								---	---	---	---
KTN1	3895	broad.mit.edu	37	14	56086004	56086004	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:56086004G>T	uc001xcb.2	+	6	1239	c.937G>T	c.(937-939)GGT>TGT	p.G313C	KTN1_uc001xce.2_Missense_Mutation_p.G313C|KTN1_uc001xcc.2_Missense_Mutation_p.G313C|KTN1_uc001xcd.2_Missense_Mutation_p.G313C|KTN1_uc010trb.1_Missense_Mutation_p.G313C|KTN1_uc001xcf.1_Missense_Mutation_p.G313C	NM_182926	NP_891556	Q86UP2	KTN1_HUMAN	kinectin 1 isoform a	313	Lumenal (Potential).				microtubule-based movement	endoplasmic reticulum membrane|integral to plasma membrane|membrane fraction				breast(3)|ovary(2)|lung(1)|central_nervous_system(1)	7								T	RET	papillary thryoid								---	---	---	---
FUT8	2530	broad.mit.edu	37	14	66191053	66191053	+	Intron	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:66191053C>A	uc001xin.2	+						FUT8_uc001xio.2_Intron|FUT8_uc010tsp.1_Intron|FUT8_uc001xir.3_Intron|FUT8_uc001xip.2_Intron|FUT8_uc001xiq.2_Intron|FUT8_uc001xis.2_Intron	NM_178155	NP_835368			fucosyltransferase 8 isoform a						in utero embryonic development|L-fucose catabolic process|N-glycan processing|oligosaccharide biosynthetic process|post-translational protein modification|protein glycosylation in Golgi|protein N-linked glycosylation via asparagine	Golgi cisterna membrane|integral to membrane	glycoprotein 6-alpha-L-fucosyltransferase activity|SH3 domain binding			ovary(1)	1				all cancers(60;0.00109)|OV - Ovarian serous cystadenocarcinoma(108;0.00242)|BRCA - Breast invasive adenocarcinoma(234;0.0114)														---	---	---	---
C14orf1	11161	broad.mit.edu	37	14	76123764	76123764	+	Silent	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:76123764G>T	uc001xrt.2	-	2	528	c.82C>A	c.(82-84)CGA>AGA	p.R28R	C14orf1_uc001xru.2_RNA	NM_007176	NP_009107	Q9UKR5	ERG28_HUMAN	ergosterol biosynthetic protein 28	28					sterol biosynthetic process	endoplasmic reticulum membrane|integral to membrane|transport vesicle					0		all_epithelial(191;0.125)|all_neural(303;0.13)|Myeloproliferative disorder(585;0.163)		BRCA - Breast invasive adenocarcinoma(234;0.00147)														---	---	---	---
TC2N	123036	broad.mit.edu	37	14	92258810	92258810	+	Silent	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92258810G>T	uc001xzu.3	-	9	1139	c.948C>A	c.(946-948)CCC>CCA	p.P316P	TC2N_uc001xzt.3_Silent_p.P316P|TC2N_uc010auc.2_Intron|TC2N_uc001xzv.3_Silent_p.P316P	NM_001128595	NP_001122067	Q8N9U0	TAC2N_HUMAN	tandem C2 domains, nuclear	316						nucleus				upper_aerodigestive_tract(1)	1				COAD - Colon adenocarcinoma(157;0.218)														---	---	---	---
PPP4R4	57718	broad.mit.edu	37	14	94712764	94712764	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94712764G>T	uc001ycs.1	+	14	1653	c.1499G>T	c.(1498-1500)TGG>TTG	p.W500L		NM_058237	NP_478144	Q6NUP7	PP4R4_HUMAN	HEAT-like repeat-containing protein isoform 1	500						cytoplasm|protein serine/threonine phosphatase complex	protein binding			skin(3)|upper_aerodigestive_tract(1)	4																		---	---	---	---
EML1	2009	broad.mit.edu	37	14	100317368	100317368	+	Silent	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:100317368C>A	uc001ygs.2	+	2	315	c.246C>A	c.(244-246)ACC>ACA	p.T82T	EML1_uc010avt.1_Silent_p.T69T|EML1_uc010tww.1_Silent_p.T51T|EML1_uc001ygq.2_Silent_p.T82T|EML1_uc001ygr.2_Silent_p.T82T	NM_004434	NP_004425	O00423	EMAL1_HUMAN	echinoderm microtubule associated protein like 1	82						cytoplasm|microtubule|microtubule associated complex	calcium ion binding|protein binding			large_intestine(2)|pancreas(1)|ovary(1)|skin(1)	5		Melanoma(154;0.0879)|all_epithelial(191;0.216)																---	---	---	---
ASPG	374569	broad.mit.edu	37	14	104570831	104570831	+	Intron	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:104570831C>A	uc001yoq.1	+						ASPG_uc001yoo.1_Intron|ASPG_uc001yop.1_Intron|ASPG_uc001yor.1_Intron	NM_001080464	NP_001073933			60 kDa lysophospholipase						lipid catabolic process		1-alkyl-2-acetylglycerophosphocholine esterase activity|asparaginase activity|lysophospholipase activity				0																		---	---	---	---
ATP10A	57194	broad.mit.edu	37	15	25953436	25953436	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25953436C>A	uc010ayu.2	-	11	2462	c.2356G>T	c.(2356-2358)GGG>TGG	p.G786W		NM_024490	NP_077816	O60312	AT10A_HUMAN	ATPase, class V, type 10A	786	Cytoplasmic (Potential).				ATP biosynthetic process|regulation of cell shape	integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			pancreas(2)|ovary(1)|breast(1)|liver(1)	5		all_cancers(20;5.16e-25)|all_lung(180;1.51e-14)|Acute lymphoblastic leukemia(1;2.53e-05)|all_hematologic(1;0.000267)|Breast(32;0.00125)		all cancers(64;9.48e-07)|Epithelial(43;1.69e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0252)|Lung(196;0.244)														---	---	---	---
MTMR15	22909	broad.mit.edu	37	15	31206255	31206255	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:31206255G>T	uc001zff.2	+	5	2063	c.1772G>T	c.(1771-1773)CGG>CTG	p.R591L	MTMR15_uc001zfe.2_Missense_Mutation_p.R196L	NM_014967	NP_055782	Q9Y2M0	FAN1_HUMAN	myotubularin related protein 15 isoform a	591					double-strand break repair via homologous recombination|nucleotide-excision repair, DNA incision	nucleus	5'-3' exonuclease activity|5'-flap endonuclease activity|DNA binding|magnesium ion binding|phosphodiesterase I activity|ubiquitin binding				0		all_lung(180;2.23e-09)		all cancers(64;4.72e-15)|Epithelial(43;5.4e-11)|GBM - Glioblastoma multiforme(186;0.000136)|BRCA - Breast invasive adenocarcinoma(123;0.00402)|Lung(196;0.168)									Direct_reversal_of_damage|Editing_and_processing_nucleases					---	---	---	---
SLC12A1	6557	broad.mit.edu	37	15	48527094	48527094	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:48527094T>G	uc001zwn.3	+	9	1324	c.1108T>G	c.(1108-1110)TTT>GTT	p.F370V	SLC12A1_uc010uew.1_Missense_Mutation_p.F176V|SLC12A1_uc010bem.2_Missense_Mutation_p.F370V|SLC12A1_uc010uex.1_Missense_Mutation_p.F370V|SLC12A1_uc001zwq.3_Missense_Mutation_p.F141V|SLC12A1_uc001zwr.3_Missense_Mutation_p.F97V	NM_000338	NP_000329	Q13621	S12A1_HUMAN	sodium potassium chloride cotransporter 2	370					potassium ion transport|sodium ion transport	integral to membrane|membrane fraction	sodium:potassium:chloride symporter activity			ovary(1)|central_nervous_system(1)	2		all_lung(180;0.00219)		all cancers(107;1.76e-09)|GBM - Glioblastoma multiforme(94;1.48e-06)	Bumetanide(DB00887)|Chlormerodrin(DB00534)|Chlorthalidone(DB00310)|Ethacrynic acid(DB00903)|Furosemide(DB00695)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Metolazone(DB00524)|Potassium Chloride(DB00761)|Torasemide(DB00214)|Trichlormethiazide(DB01021)													---	---	---	---
AP4E1	23431	broad.mit.edu	37	15	51233738	51233738	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:51233738C>A	uc001zyx.1	+	9	1073	c.1043C>A	c.(1042-1044)CCT>CAT	p.P348H	AP4E1_uc010ufi.1_Missense_Mutation_p.P348H|AP4E1_uc010ufj.1_RNA|AP4E1_uc010ufk.1_RNA|LOC100132724_uc010ufl.1_5'Flank	NM_007347	NP_031373	Q9UPM8	AP4E1_HUMAN	adaptor-related protein complex 4, epsilon 1	348					intracellular protein transport|vesicle-mediated transport	COPI vesicle coat	binding|structural molecule activity				0				all cancers(107;0.000893)|GBM - Glioblastoma multiforme(94;0.00364)														---	---	---	---
RFX7	64864	broad.mit.edu	37	15	56388002	56388002	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:56388002C>A	uc010bfn.2	-	9	1924	c.1924G>T	c.(1924-1926)GGT>TGT	p.G642C	RFX7_uc010ugk.1_RNA|RFX7_uc002adn.1_Missense_Mutation_p.G456C	NM_022841	NP_073752	Q2KHR2	RFX7_HUMAN	regulatory factor X domain containing 2	545					regulation of transcription, DNA-dependent	nucleus	DNA binding				0																		---	---	---	---
DENND4A	10260	broad.mit.edu	37	15	65983706	65983706	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65983706G>T	uc002aph.2	-	22	3472	c.3094C>A	c.(3094-3096)CGT>AGT	p.R1032S	DENND4A_uc002api.2_Missense_Mutation_p.R1075S|DENND4A_uc002apj.3_Missense_Mutation_p.R1032S	NM_005848	NP_005839	Q7Z401	MYCPP_HUMAN	DENN/MADD domain containing 4A isoform 2	1032					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	4																		---	---	---	---
LRRC49	54839	broad.mit.edu	37	15	71329532	71329532	+	Missense_Mutation	SNP	G	T	T	rs149509591		TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:71329532G>T	uc002asw.2	+	15	1965	c.1718G>T	c.(1717-1719)CGG>CTG	p.R573L	LRRC49_uc002asu.2_Missense_Mutation_p.R563L|LRRC49_uc002asx.2_Missense_Mutation_p.R529L|LRRC49_uc010ukf.1_Missense_Mutation_p.R578L|LRRC49_uc002asy.2_Missense_Mutation_p.R279L|LRRC49_uc002asz.2_Missense_Mutation_p.R545L	NM_017691	NP_060161	Q8IUZ0	LRC49_HUMAN	leucine rich repeat containing 49	573						cytoplasm|microtubule				ovary(1)	1																		---	---	---	---
STARD5	80765	broad.mit.edu	37	15	81610813	81610813	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:81610813G>T	uc002bgm.2	-	5	515	c.431C>A	c.(430-432)CCG>CAG	p.P144Q	STARD5_uc002bgn.2_Missense_Mutation_p.P37Q	NM_181900	NP_871629	Q9NSY2	STAR5_HUMAN	StAR-related lipid transfer protein 5	144	START.				C21-steroid hormone biosynthetic process|lipid transport	cytosol	lipid binding			ovary(1)	1																		---	---	---	---
LRRK1	79705	broad.mit.edu	37	15	101549122	101549122	+	Silent	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:101549122G>T	uc002bwr.2	+	7	1162	c.843G>T	c.(841-843)ACG>ACT	p.T281T	LRRK1_uc010usb.1_RNA|LRRK1_uc010usc.1_RNA	NM_024652	NP_078928	Q38SD2	LRRK1_HUMAN	leucine-rich repeat kinase 1	281	LRR 1.				small GTPase mediated signal transduction	mitochondrion	ATP binding|GTP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			ovary(4)|lung(4)|central_nervous_system(3)|large_intestine(1)	12	Melanoma(26;0.00505)|Lung NSC(78;0.00793)|all_lung(78;0.0094)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)													OREG0023521	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
MLST8	64223	broad.mit.edu	37	16	2258520	2258520	+	Silent	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2258520G>T	uc002coz.2	+	8	887	c.768G>T	c.(766-768)ACG>ACT	p.T256T	MLST8_uc002coy.2_Silent_p.T256T|MLST8_uc002cpa.2_Silent_p.T72T|MLST8_uc002cpb.2_Silent_p.T255T|MLST8_uc010uvx.1_Silent_p.T190T|MLST8_uc002cpc.2_Silent_p.T256T|MLST8_uc002cpd.2_Silent_p.T190T|MLST8_uc002cpe.2_Silent_p.T256T|MLST8_uc002cpg.2_Silent_p.T275T|MLST8_uc002cph.2_RNA|MLST8_uc002cpf.2_Silent_p.T256T	NM_022372	NP_071767	Q9BVC4	LST8_HUMAN	G protein beta subunit-like	256	WD 6.				insulin receptor signaling pathway|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of TOR signaling cascade|T cell costimulation	cytosol	protein binding				0																		---	---	---	---
ZNF597	146434	broad.mit.edu	37	16	3490843	3490843	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3490843C>A	uc002cvd.2	-	3	308	c.124G>T	c.(124-126)GGT>TGT	p.G42C	NAT15_uc002cvh.3_5'Flank|NAT15_uc010uxb.1_5'Flank	NM_152457	NP_689670	Q96LX8	ZN597_HUMAN	zinc finger protein 597	42	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0																		---	---	---	---
ITPRIPL2	162073	broad.mit.edu	37	16	19126666	19126666	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:19126666C>A	uc002dfu.3	+	1	1413	c.883C>A	c.(883-885)CGC>AGC	p.R295S	ITPRIPL2_uc002dft.2_5'UTR	NM_001034841	NP_001030013	Q3MIP1	IPIL2_HUMAN	inositol 1,4,5-triphosphate receptor interacting	295	Cytoplasmic (Potential).					integral to membrane				skin(2)	2																OREG0023657	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
ACSM2B	348158	broad.mit.edu	37	16	20554576	20554576	+	Silent	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20554576G>T	uc002dhj.3	-	12	1500	c.1290C>A	c.(1288-1290)CCC>CCA	p.P430P	ACSM2B_uc002dhk.3_Silent_p.P430P|ACSM2B_uc010bwf.1_Silent_p.P430P	NM_182617	NP_872423	Q68CK6	ACS2B_HUMAN	acyl-CoA synthetase medium-chain family member	430					fatty acid metabolic process|xenobiotic metabolic process	mitochondrial matrix	ATP binding|butyrate-CoA ligase activity|CoA-ligase activity|metal ion binding			skin(3)|ovary(1)|central_nervous_system(1)	5																		---	---	---	---
EEF2K	29904	broad.mit.edu	37	16	22262558	22262558	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:22262558G>T	uc002dki.2	+	6	1018	c.533G>T	c.(532-534)CGG>CTG	p.R178L	EEF2K_uc002dkh.2_RNA	NM_013302	NP_037434	O00418	EF2K_HUMAN	elongation factor-2 kinase	178	Alpha-type protein kinase.				insulin receptor signaling pathway|translational elongation	cytosol	ATP binding|calcium ion binding|calmodulin binding|elongation factor-2 kinase activity|translation factor activity, nucleic acid binding			large_intestine(1)	1				GBM - Glioblastoma multiforme(48;0.0223)														---	---	---	---
SCNN1B	6338	broad.mit.edu	37	16	23366787	23366787	+	Silent	SNP	C	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:23366787C>T	uc002dln.2	+	4	929	c.753C>T	c.(751-753)TTC>TTT	p.F251F		NM_000336	NP_000327	P51168	SCNNB_HUMAN	sodium channel, nonvoltage-gated 1, beta	251	Extracellular (By similarity).				excretion|sensory perception of taste	apical plasma membrane	ligand-gated sodium channel activity|WW domain binding			ovary(3)|breast(2)|large_intestine(1)|pancreas(1)	7				GBM - Glioblastoma multiforme(48;0.0465)	Amiloride(DB00594)|Triamterene(DB00384)													---	---	---	---
SLC5A2	6524	broad.mit.edu	37	16	31500611	31500611	+	Silent	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31500611C>A	uc002ecf.3	+	12	1636	c.1617C>A	c.(1615-1617)CTC>CTA	p.L539L	SLC5A2_uc010car.2_RNA|C16orf58_uc002ecg.2_RNA	NM_003041	NP_003032	P31639	SC5A2_HUMAN	solute carrier family 5 (sodium/glucose	539	Helical; (Potential).				carbohydrate metabolic process	integral to membrane	low-affinity glucose:sodium symporter activity			ovary(1)	1																		---	---	---	---
RPGRIP1L	23322	broad.mit.edu	37	16	53671740	53671740	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:53671740C>A	uc002ehp.2	-	21	3151	c.3087G>T	c.(3085-3087)GAG>GAT	p.E1029D	RPGRIP1L_uc002eho.3_Missense_Mutation_p.E995D|RPGRIP1L_uc010vgy.1_Missense_Mutation_p.E1029D|RPGRIP1L_uc010cbx.2_Missense_Mutation_p.E995D|RPGRIP1L_uc010vgz.1_Missense_Mutation_p.E1029D	NM_015272	NP_056087	Q68CZ1	FTM_HUMAN	RPGRIP1-like isoform a	1029					negative regulation of G-protein coupled receptor protein signaling pathway	cell-cell junction|centrosome|cilium axoneme|microtubule basal body	thromboxane A2 receptor binding			ovary(1)	1		all_cancers(37;0.0973)																---	---	---	---
OGFOD1	55239	broad.mit.edu	37	16	56510089	56510089	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:56510089G>T	uc002ejb.2	+	13	1702	c.1601G>T	c.(1600-1602)TGG>TTG	p.W534L	OGFOD1_uc002ejc.2_Missense_Mutation_p.W394L	NM_018233	NP_060703	Q8N543	OGFD1_HUMAN	2-oxoglutarate and iron-dependent oxygenase	534							iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			skin(1)	1					Vitamin C(DB00126)													---	---	---	---
NLRC5	84166	broad.mit.edu	37	16	57115521	57115521	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57115521C>A	uc002ekk.1	+	48	5713	c.5488C>A	c.(5488-5490)CGC>AGC	p.R1830S	NLRC5_uc010ccr.1_RNA|NLRC5_uc010ccs.1_RNA|NLRC5_uc002eko.1_RNA|NLRC5_uc002ekq.1_Missense_Mutation_p.R372S|NLRC5_uc002ekr.1_Missense_Mutation_p.R717S	NM_032206	NP_115582	Q86WI3	NLRC5_HUMAN	nucleotide-binding oligomerization domains 27	1830					defense response to virus|innate immune response|negative regulation of NF-kappaB transcription factor activity|negative regulation of type I interferon production|negative regulation of type I interferon-mediated signaling pathway|positive regulation of interferon-gamma-mediated signaling pathway|positive regulation of MHC class I biosynthetic process|positive regulation of transcription from RNA polymerase II promoter|positive regulation of type I interferon-mediated signaling pathway|regulation of kinase activity	cytosol|nucleus	ATP binding|protein binding|RNA polymerase II core promoter sequence-specific DNA binding			ovary(4)|skin(2)|breast(1)	7		all_neural(199;0.225)																---	---	---	---
FAM192A	80011	broad.mit.edu	37	16	57188396	57188396	+	Nonsense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57188396C>A	uc010vhk.1	-	7	830	c.571G>T	c.(571-573)GGA>TGA	p.G191*	FAM192A_uc002ekz.3_Nonsense_Mutation_p.G190*|FAM192A_uc002ekv.3_Nonsense_Mutation_p.G113*|FAM192A_uc002ekw.3_Nonsense_Mutation_p.G190*|FAM192A_uc002ekx.3_Nonsense_Mutation_p.G190*|FAM192A_uc002eky.3_Nonsense_Mutation_p.G190*	NM_024946	NP_079222	Q9GZU8	F192A_HUMAN	NEFA-interacting nuclear protein NIP30	191						nucleus					0																		---	---	---	---
TUBB3	10381	broad.mit.edu	37	16	90002056	90002056	+	Silent	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:90002056G>T	uc002fph.1	+	4	1262	c.1197G>T	c.(1195-1197)ACG>ACT	p.T399T	TUBB3_uc002fpf.2_Silent_p.T746T|TUBB3_uc010ciz.1_Silent_p.T327T|TUBB3_uc002fpg.1_Silent_p.T253T|TUBB3_uc002fpi.1_Silent_p.T327T|TUBB3_uc002fpj.1_Silent_p.T327T|TUBB3_uc010cjb.1_Silent_p.T253T|TUBB3_uc002fpk.1_Silent_p.T253T	NM_006086	NP_006077	Q13509	TBB3_HUMAN	tubulin, beta, 4	399					'de novo' posttranslational protein folding|axon guidance|microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|structural molecule activity			ovary(2)|pancreas(1)	3		all_cancers(9;1.69e-11)|Lung NSC(15;8.94e-06)|all_lung(18;1.39e-05)|all_neural(9;0.00581)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.0273)														---	---	---	---
TIMM22	29928	broad.mit.edu	37	17	904323	904323	+	Silent	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:904323C>A	uc002fsc.2	+	4	606	c.580C>A	c.(580-582)CGG>AGG	p.R194R		NM_013337	NP_037469	Q9Y584	TIM22_HUMAN	translocase of inner mitochondrial membrane 22	194					transmembrane transport	integral to membrane|mitochondrial inner membrane	protein transporter activity				0				UCEC - Uterine corpus endometrioid carcinoma (25;0.022)														---	---	---	---
RAP1GAP2	23108	broad.mit.edu	37	17	2908679	2908679	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:2908679G>T	uc010ckd.2	+	15	1307	c.1217G>T	c.(1216-1218)CGG>CTG	p.R406L	RAP1GAP2_uc010cke.2_Missense_Mutation_p.R391L	NM_015085	NP_055900	Q684P5	RPGP2_HUMAN	RAP1 GTPase activating protein 2 isoform 1	406	Rap-GAP.				regulation of small GTPase mediated signal transduction	centrosome|cytosol|perinuclear region of cytoplasm	GTPase activator activity			ovary(1)	1																		---	---	---	---
ALOX12	239	broad.mit.edu	37	17	6902654	6902654	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:6902654G>A	uc002gdx.3	+	6	729	c.676G>A	c.(676-678)GAG>AAG	p.E226K		NM_000697	NP_000688	P18054	LOX12_HUMAN	arachidonate 12-lipoxygenase	226	Lipoxygenase.				anti-apoptosis|cellular component movement|fatty acid oxidation|leukotriene biosynthetic process|positive regulation of cell adhesion|positive regulation of cell growth|positive regulation of cell proliferation|superoxide anion generation	cytosol|sarcolemma	arachidonate 12-lipoxygenase activity|hepoxilin-epoxide hydrolase activity|iron ion binding|lipoxygenase activity|protein binding			central_nervous_system(1)	1																		---	---	---	---
TP53	7157	broad.mit.edu	37	17	7578271	7578271	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7578271T>C	uc002gim.2	-	6	772	c.578A>G	c.(577-579)CAT>CGT	p.H193R	TP53_uc002gig.1_Missense_Mutation_p.H193R|TP53_uc002gih.2_Missense_Mutation_p.H193R|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.H61R|TP53_uc010cng.1_Missense_Mutation_p.H61R|TP53_uc002gii.1_Missense_Mutation_p.H61R|TP53_uc010cnh.1_Missense_Mutation_p.H193R|TP53_uc010cni.1_Missense_Mutation_p.H193R|TP53_uc002gij.2_Missense_Mutation_p.H193R|TP53_uc010cnj.1_Intron|TP53_uc002gin.2_Missense_Mutation_p.H100R|TP53_uc002gio.2_Missense_Mutation_p.H61R|TP53_uc010vug.1_Missense_Mutation_p.H154R	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	193	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		H -> D (in sporadic cancers; somatic mutation).|H -> Q (in sporadic cancers; somatic mutation).|H -> Y (in sporadic cancers; somatic mutation).|QH -> HN (in a sporadic cancer; somatic mutation).|H -> N (in sporadic cancers; somatic mutation).|QH -> HY (in a sporadic cancer; somatic mutation).|H -> L (in sporadic cancers; somatic mutation).|H -> P (in sporadic cancers; somatic mutation).|H -> R (in LFS; germline mutation and in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.H193R(67)|p.H193L(31)|p.H193Y(26)|p.H193P(12)|p.0?(7)|p.H193D(7)|p.H193N(4)|p.A189_V197delAPPQHLIRV(4)|p.H193fs*16(3)|p.H193H(2)|p.P191fs*53(2)|p.K164_P219del(1)|p.P191fs*15(1)|p.P191fs*6(1)|p.H100L(1)|p.H61L(1)|p.H193_I195delHLI(1)|p.H193_I195>AP(1)|p.A189fs*53(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)			111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			---	---	---	---
ULK2	9706	broad.mit.edu	37	17	19699025	19699025	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:19699025C>A	uc002gwm.3	-	20	2520	c.2011G>T	c.(2011-2013)GGG>TGG	p.G671W	ULK2_uc002gwn.2_Missense_Mutation_p.G671W	NM_001142610	NP_001136082	Q8IYT8	ULK2_HUMAN	unc-51-like kinase 2	671					signal transduction		ATP binding|protein binding|protein serine/threonine kinase activity			skin(2)|large_intestine(1)|stomach(1)	4	all_cancers(12;4.97e-05)|all_epithelial(12;0.00362)|Breast(13;0.186)																	---	---	---	---
NOS2	4843	broad.mit.edu	37	17	26105786	26105786	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26105786T>C	uc002gzu.2	-	11	1475	c.1211A>G	c.(1210-1212)CAC>CGC	p.H404R	NOS2_uc010crh.1_Missense_Mutation_p.H404R|NOS2_uc010wab.1_Missense_Mutation_p.H404R	NM_000625	NP_000616	P35228	NOS2_HUMAN	nitric oxide synthase 2A	404					arginine catabolic process|defense response to Gram-negative bacterium|innate immune response in mucosa|nitric oxide biosynthetic process|peptidyl-cysteine S-nitrosylation|platelet activation|positive regulation of killing of cells of other organism|positive regulation of leukocyte mediated cytotoxicity|regulation of cellular respiration|regulation of insulin secretion|superoxide metabolic process	cytosol|nucleus	arginine binding|calmodulin binding|flavin adenine dinucleotide binding|FMN binding|heme binding|NADP binding|nitric-oxide synthase activity|protein homodimerization activity|tetrahydrobiopterin binding			skin(2)|ovary(1)|breast(1)	4					Dexamethasone(DB01234)|Hydrocortisone(DB00741)|L-Arginine(DB00125)|L-Citrulline(DB00155)													---	---	---	---
PSMD11	5717	broad.mit.edu	37	17	30781647	30781647	+	Intron	SNP	A	G	G			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:30781647A>G	uc010cta.1	+						PSMD11_uc010wbz.1_Intron|PSMD11_uc002hhm.2_Intron	NM_002815	NP_002806			proteasome 26S non-ATPase subunit 11						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	proteasome complex	protein binding			ovary(1)	1		Breast(31;0.159)|Ovarian(249;0.182)	BRCA - Breast invasive adenocarcinoma(9;0.109)															---	---	---	---
PSMB3	5691	broad.mit.edu	37	17	36916765	36916765	+	Silent	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:36916765C>A	uc002hqr.2	+	4	456	c.378C>A	c.(376-378)CTC>CTA	p.L126L		NM_002795	NP_002786	P49720	PSB3_HUMAN	proteasome beta 3 subunit	126					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|interspecies interaction between organisms|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	cytoplasm|nucleus|proteasome core complex	protein binding|threonine-type endopeptidase activity				0																		---	---	---	---
EFCAB3	146779	broad.mit.edu	37	17	60484458	60484458	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:60484458G>T	uc002izu.1	+	8	830	c.752G>T	c.(751-753)GGG>GTG	p.G251V	EFCAB3_uc010wpc.1_Missense_Mutation_p.G303V	NM_173503	NP_775774	Q8N7B9	EFCB3_HUMAN	EF-hand calcium binding domain 3 isoform b	251							calcium ion binding			skin(1)	1			BRCA - Breast invasive adenocarcinoma(2;2.27e-11)															---	---	---	---
PSMD12	5718	broad.mit.edu	37	17	65362549	65362549	+	Silent	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:65362549G>T	uc002jfy.2	-	1	173	c.87C>A	c.(85-87)CCC>CCA	p.P29P	PSMD12_uc002jga.2_Silent_p.P29P|PSMD12_uc002jfz.2_5'UTR|PSMD12_uc010det.1_Silent_p.P29P	NM_002816	NP_002807	O00232	PSD12_HUMAN	proteasome 26S non-ATPase subunit 12 isoform 1	29					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	proteasome regulatory particle	protein binding				0	all_cancers(12;2.38e-11)|all_epithelial(3;8.27e-13)																	---	---	---	---
CDH7	1005	broad.mit.edu	37	18	63481782	63481782	+	Silent	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:63481782C>A	uc002ljz.2	+	4	892	c.567C>A	c.(565-567)GCC>GCA	p.A189A	CDH7_uc002lka.2_Silent_p.A189A|CDH7_uc002lkb.2_Silent_p.A189A	NM_033646	NP_387450	Q9ULB5	CADH7_HUMAN	cadherin 7, type 2 preproprotein	189	Extracellular (Potential).|Cadherin 2.				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)|pancreas(1)|skin(1)	4		Esophageal squamous(42;0.129)																---	---	---	---
TSHZ1	10194	broad.mit.edu	37	18	72998359	72998359	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:72998359C>A	uc002lly.2	+	2	1425	c.862C>A	c.(862-864)CAG>AAG	p.Q288K		NM_005786	NP_005777	Q6ZSZ6	TSH1_HUMAN	teashirt family zinc finger 1	333						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		Esophageal squamous(42;0.129)|Prostate(75;0.142)|Melanoma(33;0.211)		Colorectal(1;0.000501)|READ - Rectum adenocarcinoma(2;0.00226)|BRCA - Breast invasive adenocarcinoma(31;0.246)														---	---	---	---
ZNF236	7776	broad.mit.edu	37	18	74607031	74607031	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:74607031C>A	uc002lmi.2	+	10	1672	c.1474C>A	c.(1474-1476)CGC>AGC	p.R492S	ZNF236_uc002lmj.2_RNA	NM_007345	NP_031371	Q9UL36	ZN236_HUMAN	zinc finger protein 236	492	C2H2-type 10.				cellular response to glucose stimulus	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(4)	4		Prostate(75;0.0405)|Esophageal squamous(42;0.129)|Melanoma(33;0.132)		OV - Ovarian serous cystadenocarcinoma(15;4.36e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0686)														---	---	---	---
REXO1	57455	broad.mit.edu	37	19	1819035	1819035	+	Silent	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1819035G>T	uc002lua.3	-	8	2841	c.2746C>A	c.(2746-2748)CGG>AGG	p.R916R	REXO1_uc010dsq.2_Silent_p.R225R|REXO1_uc010xgs.1_5'UTR|MIR1909_hsa-mir-1909|MI0008330_5'Flank|REXO1_uc010dsp.1_RNA	NM_020695	NP_065746	Q8N1G1	REXO1_HUMAN	transcription elongation factor B polypeptide 3	916						nucleus	exonuclease activity|nucleic acid binding				0		Ovarian(11;1.78e-06)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)														---	---	---	---
TBXA2R	6915	broad.mit.edu	37	19	3600596	3600596	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3600596G>A	uc002lyg.1	-	2	251	c.37C>T	c.(37-39)CGG>TGG	p.R13W	TBXA2R_uc002lye.1_Missense_Mutation_p.R13W	NM_001060	NP_001051	P21731	TA2R_HUMAN	thromboxane A2 receptor isoform alpha	13	Extracellular (Potential).				platelet activation	integral to plasma membrane	guanyl-nucleotide exchange factor activity|protein binding|thromboxane A2 receptor activity				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00253)|STAD - Stomach adenocarcinoma(1328;0.18)	Ridogrel(DB01207)													---	---	---	---
MATK	4145	broad.mit.edu	37	19	3789316	3789316	+	5'Flank	SNP	T	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3789316T>A	uc002lyt.2	-						MATK_uc002lyv.2_Missense_Mutation_p.R10S|MATK_uc002lyu.2_5'Flank|MATK_uc010dtq.2_5'Flank	NM_139355	NP_647612			megakaryocyte-associated tyrosine kinase isoform						cell proliferation|mesoderm development|positive regulation of cell proliferation	cytoplasm|nucleus	ATP binding|non-membrane spanning protein tyrosine kinase activity			stomach(2)|ovary(1)|lung(1)|large_intestine(1)	5		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00461)|STAD - Stomach adenocarcinoma(1328;0.18)														---	---	---	---
MUC16	94025	broad.mit.edu	37	19	9057759	9057759	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9057759G>C	uc002mkp.2	-	3	29891	c.29687C>G	c.(29686-29688)GCA>GGA	p.A9896G		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	9898	Ser-rich.|Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57																		---	---	---	---
MUC16	94025	broad.mit.edu	37	19	9060801	9060801	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9060801C>A	uc002mkp.2	-	3	26849	c.26645G>T	c.(26644-26646)CGG>CTG	p.R8882L		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	8884	Ser-rich.|Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57																		---	---	---	---
AKAP8	10270	broad.mit.edu	37	19	15483885	15483885	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15483885G>T	uc002nav.2	-	5	699	c.638C>A	c.(637-639)CCC>CAC	p.P213H	AKAP8_uc010dzy.2_5'UTR|AKAP8_uc010dzz.1_RNA|AKAP8_uc010xog.1_Missense_Mutation_p.P27H	NM_005858	NP_005849	O43823	AKAP8_HUMAN	A-kinase anchor protein 8	213					signal transduction	nuclear matrix				ovary(1)|breast(1)	2																		---	---	---	---
FAM129C	199786	broad.mit.edu	37	19	17641671	17641671	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17641671G>A	uc010xpr.1	+	3	394	c.256G>A	c.(256-258)GGA>AGA	p.G86R	FAM129C_uc010xpq.1_Missense_Mutation_p.G86R|FAM129C_uc010xps.1_Missense_Mutation_p.G55R|FAM129C_uc010xpt.1_Intron	NM_173544	NP_775815	Q86XR2	NIBL2_HUMAN	B-cell novel protein 1 isoform a	86											0																		---	---	---	---
PTH2	113091	broad.mit.edu	37	19	49926533	49926533	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49926533G>C	uc002pnn.1	-	1	166	c.64C>G	c.(64-66)CTG>GTG	p.L22V		NM_178449	NP_848544	Q96A98	TIP39_HUMAN	parathyroid hormone 2 preproprotein	22					neuropeptide signaling pathway	extracellular region					0				OV - Ovarian serous cystadenocarcinoma(262;0.0015)|GBM - Glioblastoma multiforme(486;0.044)|Lung(386;0.0785)|LUSC - Lung squamous cell carcinoma(496;0.0836)														---	---	---	---
ZNF665	79788	broad.mit.edu	37	19	53669357	53669357	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53669357C>T	uc010eqm.1	-	4	486	c.386G>A	c.(385-387)AGA>AAA	p.R129K		NM_024733	NP_079009	Q9H7R5	ZN665_HUMAN	zinc finger protein 665	64					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2				GBM - Glioblastoma multiforme(134;0.0196)														---	---	---	---
SIRPA	140885	broad.mit.edu	37	20	1903284	1903284	+	Silent	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:1903284C>A	uc002wfq.2	+	5	1440	c.1080C>A	c.(1078-1080)ACC>ACA	p.T360T	SIRPA_uc010zps.1_Silent_p.T340T|SIRPA_uc002wfr.2_Silent_p.T360T|SIRPA_uc002wfs.2_Silent_p.T360T|SIRPA_uc002wft.2_Silent_p.T360T	NM_001040022	NP_001035111	P78324	SHPS1_HUMAN	signal-regulatory protein alpha precursor	360	Extracellular (Potential).				blood coagulation|cell adhesion|cell junction assembly|leukocyte migration	integral to membrane|plasma membrane	SH3 domain binding			ovary(1)	1				Colorectal(46;0.018)|READ - Rectum adenocarcinoma(1;0.0556)														---	---	---	---
SLC4A11	83959	broad.mit.edu	37	20	3211459	3211459	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3211459C>A	uc002wig.2	-	10	1297	c.1249G>T	c.(1249-1251)GGG>TGG	p.G417W	SLC4A11_uc010zqe.1_Missense_Mutation_p.G444W|SLC4A11_uc002wih.2_RNA|SLC4A11_uc010zqf.1_Missense_Mutation_p.G401W	NM_032034	NP_114423	Q8NBS3	S4A11_HUMAN	solute carrier family 4 member 11	417	Helical; (Potential).|Membrane (bicarbonate transporter).				cellular cation homeostasis|fluid transport|phosphoenolpyruvate-dependent sugar phosphotransferase system	basolateral plasma membrane|integral to membrane	bicarbonate transmembrane transporter activity|borate transmembrane transporter activity|hydrogen ion channel activity|inorganic anion exchanger activity|sodium channel activity|sugar:hydrogen symporter activity			ovary(1)	1																		---	---	---	---
BFSP1	631	broad.mit.edu	37	20	17475023	17475023	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:17475023C>A	uc002wpo.2	-	8	1733	c.1694G>T	c.(1693-1695)CGG>CTG	p.R565L	BFSP1_uc002wpp.2_Missense_Mutation_p.R440L|BFSP1_uc010zrn.1_Missense_Mutation_p.R426L|BFSP1_uc010zro.1_Missense_Mutation_p.R426L	NM_001195	NP_001186	Q12934	BFSP1_HUMAN	filensin isoform 1	565	Tail.					cytoplasm|intermediate filament|membrane	structural constituent of cytoskeleton|structural constituent of eye lens			central_nervous_system(1)	1																		---	---	---	---
C20orf70	140683	broad.mit.edu	37	20	31768358	31768358	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31768358C>A	uc002wyo.1	+	8	813	c.742C>A	c.(742-744)CTC>ATC	p.L248I		NM_080574	NP_542141	Q96DR5	SPLC2_HUMAN	chromosome 20 open reading frame 70 precursor	248						extracellular region	lipid binding			ovary(1)|central_nervous_system(1)	2																		---	---	---	---
ITCH	83737	broad.mit.edu	37	20	33012331	33012331	+	Missense_Mutation	SNP	G	T	T	rs112357913		TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33012331G>T	uc010geu.1	+	8	836	c.644G>T	c.(643-645)AGA>ATA	p.R215I	ITCH_uc002xak.2_Missense_Mutation_p.R174I|ITCH_uc010zuj.1_Missense_Mutation_p.R64I	NM_031483	NP_113671	Q96J02	ITCH_HUMAN	itchy homolog E3 ubiquitin protein ligase	215					apoptosis|entry of virus into host cell|inflammatory response|innate immune response|negative regulation of apoptosis|negative regulation of defense response to virus|negative regulation of JNK cascade|negative regulation of NF-kappaB transcription factor activity|negative regulation of type I interferon production|protein K29-linked ubiquitination|protein K48-linked ubiquitination|protein K63-linked ubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of cell growth|regulation of protein deubiquitination|response to virus	cytosol|nucleus|plasma membrane	CXCR chemokine receptor binding|ribonucleoprotein binding|ubiquitin-protein ligase activity			breast(4)|lung(1)|central_nervous_system(1)	6																		---	---	---	---
C20orf152	140894	broad.mit.edu	37	20	34560550	34560550	+	Splice_Site	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:34560550G>T	uc002xes.1	+	2	208	c.52_splice	c.e2-1	p.G18_splice	C20orf152_uc002xer.1_Splice_Site_p.G18_splice|C20orf152_uc010gfp.1_Splice_Site					SubName: Full=C20orf152 protein;												0	Breast(12;0.00631)																	---	---	---	---
FAM83D	81610	broad.mit.edu	37	20	37580887	37580887	+	Silent	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37580887C>A	uc002xjg.2	+	4	1613	c.1572C>A	c.(1570-1572)CCC>CCA	p.P524P		NM_030919	NP_112181	Q9H4H8	FA83D_HUMAN	hypothetical protein LOC81610	494	Ser-rich.				cell division|mitosis	cytoplasm|spindle pole				ovary(3)	3		Myeloproliferative disorder(115;0.00878)																---	---	---	---
RBPJL	11317	broad.mit.edu	37	20	43945435	43945435	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:43945435G>T	uc002xns.2	+	12	1462	c.1390G>T	c.(1390-1392)GGG>TGG	p.G464W	RBPJL_uc002xnt.2_Missense_Mutation_p.R467L	NM_014276	NP_055091	Q9UBG7	RBPJL_HUMAN	recombining binding protein L	464	IPT/TIG.				signal transduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1		Myeloproliferative disorder(115;0.0122)																---	---	---	---
PIGT	51604	broad.mit.edu	37	20	44045146	44045146	+	Intron	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44045146C>A	uc002xoh.1	+						PIGT_uc010ghb.1_Intron|PIGT_uc010zwt.1_Intron|PIGT_uc010ghd.1_Intron|PIGT_uc010ghc.1_Intron|PIGT_uc010ghe.1_Intron|PIGT_uc010ghf.1_Intron|PIGT_uc002xoj.1_Intron|PIGT_uc002xok.1_Intron|PIGT_uc010zwu.1_Intron|PIGT_uc002xoi.1_Intron|PIGT_uc010zwv.1_Intron|PIGT_uc010zww.1_Intron|PIGT_uc010zwx.1_Intron|PIGT_uc010zwy.1_Intron|PIGT_uc010zwz.1_Intron|PIGT_uc010zxa.1_Intron|PIGT_uc002xol.1_5'Flank	NM_015937	NP_057021			phosphatidylinositol glycan anchor biosynthesis,						attachment of GPI anchor to protein|C-terminal protein lipidation	GPI-anchor transamidase complex	protein binding			pancreas(1)	1		Myeloproliferative disorder(115;0.0122)																---	---	---	---
GTPBP5	26164	broad.mit.edu	37	20	60770880	60770880	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60770880G>T	uc002yce.3	+	3	265	c.227G>T	c.(226-228)CGG>CTG	p.R76L	GTPBP5_uc011aab.1_5'UTR|GTPBP5_uc011aac.1_5'UTR|GTPBP5_uc011aad.1_5'UTR|GTPBP5_uc011aae.1_5'UTR|GTPBP5_uc011aaf.1_Missense_Mutation_p.R76L|GTPBP5_uc011aag.1_Missense_Mutation_p.R76L	NM_015666	NP_056481	Q9H4K7	GTPB5_HUMAN	GTP binding protein 5	76	Localized in the mitocondria.|Not localized in the mitocondria.				ribosome biogenesis	mitochondrion	GTP binding|GTPase activity|magnesium ion binding				0	Breast(26;3.52e-09)		BRCA - Breast invasive adenocarcinoma(19;2.5e-08)															---	---	---	---
PPDPF	79144	broad.mit.edu	37	20	62153190	62153190	+	Silent	SNP	C	A	A	rs113534342	byFrequency;by1000genomes	TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62153190C>A	uc002yff.2	+	4	443	c.303C>A	c.(301-303)CCC>CCA	p.P101P		NM_024299	NP_077275	Q9H3Y8	PPDPF_HUMAN	pancreatic progenitor cell differentiation and	101					cell differentiation|multicellular organismal development						0																		---	---	---	---
PRIC285	85441	broad.mit.edu	37	20	62200806	62200806	+	Silent	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62200806C>A	uc002yfm.2	-	5	1675	c.783G>T	c.(781-783)CCG>CCT	p.P261P	PRIC285_uc002yfl.1_5'Flank	NM_001037335	NP_001032412	Q9BYK8	PR285_HUMAN	PPAR-alpha interacting complex protein 285	261					cellular lipid metabolic process|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleoplasm	ATP binding|DNA binding|helicase activity|ribonuclease activity|RNA binding|transcription coactivator activity|zinc ion binding			central_nervous_system(2)	2	all_cancers(38;2.51e-11)|all_epithelial(29;8.27e-13)		Epithelial(9;1.27e-08)|all cancers(9;7.32e-08)|BRCA - Breast invasive adenocarcinoma(10;5.15e-06)															---	---	---	---
KRTAP21-1	337977	broad.mit.edu	37	21	32127495	32127495	+	Silent	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:32127495G>T	uc011adi.1	-	1	202	c.202C>A	c.(202-204)CGG>AGG	p.R68R		NM_181619	NP_853650	Q3LI58	KR211_HUMAN	keratin associated protein 21-1	68						intermediate filament				breast(1)	1																		---	---	---	---
KRTAP10-4	386672	broad.mit.edu	37	21	45994736	45994736	+	Silent	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45994736C>A	uc002zfk.1	+	1	1131	c.1101C>A	c.(1099-1101)CCC>CCA	p.P367P	C21orf29_uc002zfe.1_Intron|C21orf29_uc010gpv.1_Intron	NM_198687	NP_941960	P60372	KR104_HUMAN	keratin associated protein 10-4	367	36 X 5 AA repeats of C-C-X(3).					keratin filament					0																		---	---	---	---
PITPNB	23760	broad.mit.edu	37	22	28292625	28292625	+	Intron	SNP	C	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:28292625C>T	uc003adk.2	-						PITPNB_uc011akh.1_Intron|PITPNB_uc003adl.2_Intron	NM_012399	NP_036531			phosphatidylinositol transfer protein, beta						lipid metabolic process|transport	Golgi apparatus	lipid binding			skin(1)	1																		---	---	---	---
SCUBE1	80274	broad.mit.edu	37	22	43610231	43610231	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:43610231C>A	uc003bdt.1	-	16	2006	c.1918G>T	c.(1918-1920)GGT>TGT	p.G640C		NM_173050	NP_766638	Q8IWY4	SCUB1_HUMAN	signal peptide, CUB domain, EGF-like 1	640					adult heart development|blood coagulation|endothelial cell differentiation|inflammatory response|post-embryonic development|protein homooligomerization	external side of plasma membrane|extracellular space|extrinsic to plasma membrane	calcium ion binding|identical protein binding|protein heterodimerization activity			central_nervous_system(2)|ovary(1)|lung(1)|skin(1)	5		all_neural(38;0.0414)|Ovarian(80;0.07)																---	---	---	---
SFRS17A	8227	broad.mit.edu	37	X	1719899	1719899	+	Silent	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1719899G>T	uc004cqa.2	+	5	1696	c.1500G>T	c.(1498-1500)CCG>CCT	p.P500P	SFRS17A_uc004cqb.2_RNA|ASMT_uc004cqd.2_Intron	NM_005088	NP_005079	Q02040	AK17A_HUMAN	DNA segment on chromosome X and Y (unique) 155	500				P -> A (in Ref. 1; AAA61303 and 4; AAI10497).	B cell activation|mRNA processing|regulation of transcription, DNA-dependent|RNA splicing|signal transduction	nuclear speck|spliceosomal complex	nucleotide binding|protein binding|RNA binding				0		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)																---	---	---	---
APOO	79135	broad.mit.edu	37	X	23886763	23886763	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:23886763G>T	uc004dax.2	-	5	566	c.335C>A	c.(334-336)CCG>CAG	p.P112Q	APOO_uc004daw.2_RNA|APOO_uc004day.3_RNA	NM_024122	NP_077027	Q9BUR5	APOO_HUMAN	apolipoprotein O precursor	112	Helical; (Potential).				lipid transport	high-density lipoprotein particle|integral to membrane|low-density lipoprotein particle|very-low-density lipoprotein particle					0																		---	---	---	---
MAGEB10	139422	broad.mit.edu	37	X	27840456	27840456	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:27840456C>A	uc004dbw.2	+	3	1260	c.1033C>A	c.(1033-1035)CAA>AAA	p.Q345K		NM_182506	NP_872312	Q96LZ2	MAGBA_HUMAN	melanoma antigen family B, 10	345										lung(1)|breast(1)|central_nervous_system(1)	3																		---	---	---	---
SYTL5	94122	broad.mit.edu	37	X	37985932	37985932	+	Silent	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:37985932C>A	uc004ddu.2	+	18	2676	c.2142C>A	c.(2140-2142)CCC>CCA	p.P714P	SYTL5_uc004ddv.2_Silent_p.P714P|SYTL5_uc004ddx.2_Silent_p.P736P	NM_001163335	NP_001156807	Q8TDW5	SYTL5_HUMAN	synaptotagmin-like 5 isoform 1	714					intracellular protein transport	membrane	metal ion binding|Rab GTPase binding			skin(1)	1																		---	---	---	---
USP9X	8239	broad.mit.edu	37	X	41010251	41010251	+	Silent	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:41010251C>A	uc004dfb.2	+	13	2337	c.1704C>A	c.(1702-1704)CCC>CCA	p.P568P	USP9X_uc004dfc.2_Silent_p.P568P	NM_001039590	NP_001034679	Q93008	USP9X_HUMAN	ubiquitin specific protease 9, X-linked isoform	568					BMP signaling pathway|cell division|chromosome segregation|female gamete generation|mitosis|protein deubiquitination|transforming growth factor beta receptor signaling pathway|ubiquitin-dependent protein catabolic process	cytoplasm	co-SMAD binding|cysteine-type endopeptidase activity|ubiquitin thiolesterase activity			lung(3)|breast(2)|ovary(1)	6																		---	---	---	---
ZNF81	347344	broad.mit.edu	37	X	47755321	47755321	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:47755321C>A	uc010nhy.1	+	5	627	c.259C>A	c.(259-261)CCA>ACA	p.P87T		NM_007137	NP_009068	P51508	ZNF81_HUMAN	zinc finger protein 81	87	KRAB.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		all_lung(315;0.0973)																---	---	---	---
ZXDB	158586	broad.mit.edu	37	X	57619829	57619829	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:57619829G>T	uc004dvd.2	+	1	1561	c.1348G>T	c.(1348-1350)GGC>TGC	p.G450C		NM_007157	NP_009088	P98169	ZXDB_HUMAN	zinc finger, X-linked, duplicated B	450	Required for interaction with ZXDC (By similarity).				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding|zinc ion binding				0																		---	---	---	---
STARD8	9754	broad.mit.edu	37	X	67943490	67943490	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:67943490G>A	uc004dxa.2	+	12	2954	c.2582G>A	c.(2581-2583)CGG>CAG	p.R861Q	STARD8_uc004dxb.2_Missense_Mutation_p.R941Q|STARD8_uc004dxc.3_Missense_Mutation_p.R861Q	NM_014725	NP_055540	Q92502	STAR8_HUMAN	StAR-related lipid transfer (START) domain	861	START.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|focal adhesion	GTPase activator activity			breast(3)|ovary(2)|pancreas(1)	6																		---	---	---	---
KIF4A	24137	broad.mit.edu	37	X	69637775	69637775	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:69637775G>T	uc004dyg.2	+	29	3420	c.3293G>T	c.(3292-3294)GGG>GTG	p.G1098V	KIF4A_uc010nkw.2_Missense_Mutation_p.G1098V	NM_012310	NP_036442	O95239	KIF4A_HUMAN	kinesin family member 4	1098	Globular.|Interaction with PRC1.				anterograde axon cargo transport|axon guidance|blood coagulation|organelle organization	chromosome|cytosol|midbody|nuclear matrix|spindle microtubule	ATP binding|DNA binding|microtubule motor activity|protein binding			ovary(4)	4																		---	---	---	---
FLJ44635	392490	broad.mit.edu	37	X	71380091	71380091	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:71380091C>A	uc004eal.1	+	2	760	c.412C>A	c.(412-414)CAG>AAG	p.Q138K		NM_207422	NP_997305	Q56UQ5	TPT1L_HUMAN	hypothetical protein LOC392490	138										lung(1)	1	Renal(35;0.156)																	---	---	---	---
ERCC6L	54821	broad.mit.edu	37	X	71427358	71427358	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:71427358C>A	uc004eaq.1	-	2	1356	c.1259G>T	c.(1258-1260)CGG>CTG	p.R420L	PIN4_uc004eao.1_Intron|ERCC6L_uc004eap.1_Missense_Mutation_p.R297L	NM_017669	NP_060139	Q2NKX8	ERC6L_HUMAN	excision repair protein ERCC6-like	420					cell division|mitotic prometaphase	condensed chromosome kinetochore|cytosol	ATP binding|DNA binding|helicase activity|protein binding			ovary(3)	3	Renal(35;0.156)																	---	---	---	---
POF1B	79983	broad.mit.edu	37	X	84634245	84634245	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:84634245C>A	uc004eer.2	-	2	361	c.215G>T	c.(214-216)CGG>CTG	p.R72L	POF1B_uc004ees.2_Missense_Mutation_p.R72L	NM_024921	NP_079197	Q8WVV4	POF1B_HUMAN	premature ovarian failure, 1B	72							actin binding				0																		---	---	---	---
CENPI	2491	broad.mit.edu	37	X	100383802	100383802	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:100383802G>T	uc004egx.2	+	11	1442	c.1172G>T	c.(1171-1173)TGG>TTG	p.W391L	CENPI_uc011mrg.1_Missense_Mutation_p.W391L|CENPI_uc004egy.2_Missense_Mutation_p.W391L	NM_006733	NP_006724	Q92674	CENPI_HUMAN	centromere protein I	391					CenH3-containing nucleosome assembly at centromere|mitotic prometaphase	cytosol|kinetochore|nucleoplasm	protein binding			skin(1)	1																		---	---	---	---
RGAG1	57529	broad.mit.edu	37	X	109695526	109695526	+	Silent	SNP	T	C	C			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:109695526T>C	uc004eor.1	+	3	1927	c.1681T>C	c.(1681-1683)TTG>CTG	p.L561L	RGAG1_uc011msr.1_Silent_p.L561L	NM_020769	NP_065820	Q8NET4	RGAG1_HUMAN	retrotransposon gag domain containing 1	561										lung(2)|upper_aerodigestive_tract(1)|ovary(1)	4																		---	---	---	---
THOC2	57187	broad.mit.edu	37	X	122744807	122744807	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:122744807A>G	uc004etu.2	-	38	4794	c.4762T>C	c.(4762-4764)TCC>CCC	p.S1588P	THOC2_uc004etv.3_RNA	NM_001081550	NP_001075019	Q8NI27	THOC2_HUMAN	THO complex 2	1588	Lys-rich.				intronless viral mRNA export from host nucleus|mRNA processing|RNA splicing	THO complex part of transcription export complex	protein binding|RNA binding			ovary(3)	3																		---	---	---	---
RAB33A	9363	broad.mit.edu	37	X	129318434	129318434	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:129318434C>A	uc004evl.2	+	2	698	c.434C>A	c.(433-435)CCC>CAC	p.P145H	RAB33A_uc010nre.2_RNA	NM_004794	NP_004785	Q14088	RB33A_HUMAN	Ras-related protein Rab-33A	145					protein transport|small GTPase mediated signal transduction	plasma membrane	GTP binding|GTPase activity|protein binding				0																		---	---	---	---
PHF6	84295	broad.mit.edu	37	X	133527606	133527606	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:133527606C>A	uc004exj.2	+	4	518	c.316C>A	c.(316-318)CAC>AAC	p.H106N	PHF6_uc004exk.2_Missense_Mutation_p.H106N|PHF6_uc011mvk.1_Missense_Mutation_p.H72N|PHF6_uc004exh.2_Missense_Mutation_p.H106N|PHF6_uc010nrr.2_Missense_Mutation_p.H106N|PHF6_uc004exi.2_Missense_Mutation_p.H106N	NM_001015877	NP_001015877	Q8IWS0	PHF6_HUMAN	PHD finger protein 6 isoform 1	106	PHD-type 1; degenerate.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleolus	zinc ion binding			ovary(1)	1	Acute lymphoblastic leukemia(192;0.000127)																	---	---	---	---
ARHGEF6	9459	broad.mit.edu	37	X	135772764	135772764	+	Intron	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:135772764C>A	uc004fab.2	-						ARHGEF6_uc011mwd.1_Intron|ARHGEF6_uc011mwe.1_Intron	NM_004840	NP_004831			Rac/Cdc42 guanine nucleotide exchange factor 6						apoptosis|cell junction assembly|induction of apoptosis by extracellular signals|JNK cascade|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|Rho guanyl-nucleotide exchange factor activity				0	Acute lymphoblastic leukemia(192;0.000127)																	---	---	---	---
MTM1	4534	broad.mit.edu	37	X	149814302	149814302	+	Silent	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:149814302C>A	uc004fef.3	+	9	901	c.825C>A	c.(823-825)ACC>ACA	p.T275T	MTM1_uc011mxx.1_RNA|MTM1_uc011mxy.1_Silent_p.T238T|MTM1_uc011mxz.1_Silent_p.T160T|MTM1_uc010nte.2_Silent_p.T143T	NM_000252	NP_000243	Q13496	MTM1_HUMAN	myotubularin	275	Myotubularin phosphatase.				endosome to lysosome transport|intermediate filament organization|mitochondrion distribution|mitochondrion morphogenesis|phosphatidylinositol dephosphorylation|protein transport|regulation of vacuole organization	filopodium|late endosome|plasma membrane|ruffle	intermediate filament binding|phosphatidylinositol binding|phosphatidylinositol-3,5-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein tyrosine phosphatase activity			upper_aerodigestive_tract(1)|ovary(1)|kidney(1)	3	Acute lymphoblastic leukemia(192;6.56e-05)																	---	---	---	---
GABRQ	55879	broad.mit.edu	37	X	151808925	151808925	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-10A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:151808925G>T	uc004ffp.1	+	2	256	c.236G>T	c.(235-237)GGA>GTA	p.G79V		NM_018558	NP_061028	Q9UN88	GBRT_HUMAN	gamma-aminobutyric acid (GABA) receptor, theta	79	Extracellular (Potential).					cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity|neurotransmitter transporter activity			ovary(2)|pancreas(1)	3	Acute lymphoblastic leukemia(192;6.56e-05)																	---	---	---	---
CLCN6	1185	broad.mit.edu	37	1	11889289	11889289	+	Silent	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11889289C>A	uc001ate.3	+	13	1271	c.1158C>A	c.(1156-1158)ACC>ACA	p.T386T	CLCN6_uc009vnh.1_Missense_Mutation_p.R331S|CLCN6_uc010oat.1_Silent_p.T102T|CLCN6_uc010oau.1_Silent_p.T364T	NM_001286	NP_001277	P51797	CLCN6_HUMAN	chloride channel 6 isoform ClC-6a	386	Helical; (By similarity).				cell volume homeostasis|signal transduction	endosome membrane|integral to membrane	antiporter activity|ATP binding|voltage-gated chloride channel activity				0	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.13e-06)|COAD - Colon adenocarcinoma(227;0.000274)|BRCA - Breast invasive adenocarcinoma(304;0.000311)|Kidney(185;0.000816)|KIRC - Kidney renal clear cell carcinoma(229;0.00268)|STAD - Stomach adenocarcinoma(313;0.00743)|READ - Rectum adenocarcinoma(331;0.0649)														---	---	---	---
AGMAT	79814	broad.mit.edu	37	1	15901266	15901266	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:15901266G>T	uc001awv.1	-	6	1114	c.971C>A	c.(970-972)CCG>CAG	p.P324Q	DNAJC16_uc001awu.2_RNA	NM_024758	NP_079034	Q9BSE5	SPEB_HUMAN	agmatine ureohydrolase (agmatinase) precursor	324					putrescine biosynthetic process|spermidine biosynthetic process	mitochondrion	agmatinase activity|metal ion binding			skin(1)	1		Breast(348;0.000207)|Colorectal(325;0.000258)|Lung NSC(340;0.000359)|all_lung(284;0.000486)|Renal(390;0.000518)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.93e-07)|COAD - Colon adenocarcinoma(227;3.91e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000121)|KIRC - Kidney renal clear cell carcinoma(229;0.00257)|STAD - Stomach adenocarcinoma(313;0.00734)|READ - Rectum adenocarcinoma(331;0.0649)														---	---	---	---
PQLC2	54896	broad.mit.edu	37	1	19644335	19644335	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:19644335C>A	uc001bby.2	+	3	516	c.164C>A	c.(163-165)CCC>CAC	p.P55H	PQLC2_uc001bbz.2_Intron|PQLC2_uc001bca.2_Missense_Mutation_p.P55H|PQLC2_uc001bcb.2_Intron|PQLC2_uc001bcc.2_5'UTR	NM_017765	NP_060235	Q6ZP29	PQLC2_HUMAN	PQ loop repeat containing 2 isoform 1	55	PQ-loop 1.|Helical; (Potential).					integral to membrane					0		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Breast(348;0.00049)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00466)|BRCA - Breast invasive adenocarcinoma(304;1.89e-05)|Kidney(64;0.000177)|GBM - Glioblastoma multiforme(114;0.00124)|KIRC - Kidney renal clear cell carcinoma(64;0.00262)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)														---	---	---	---
PLA2G5	5322	broad.mit.edu	37	1	20417065	20417065	+	Silent	SNP	C	A	A	rs139841773	byFrequency	TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:20417065C>A	uc001bcy.2	+	5	565	c.297C>A	c.(295-297)CCC>CCA	p.P99P	PLA2G5_uc001bcw.2_RNA|PLA2G5_uc001bcx.2_Silent_p.P130P	NM_000929	NP_000920	P39877	PA2G5_HUMAN	phospholipase A2, group V precursor	99					lipid catabolic process	extracellular region	calcium ion binding|calcium-dependent phospholipase A2 activity			skin(1)	1		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000249)|Lung NSC(340;0.000287)|Breast(348;0.000812)|Ovarian(437;0.00328)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|COAD - Colon adenocarcinoma(152;1.22e-05)|BRCA - Breast invasive adenocarcinoma(304;8.15e-05)|Kidney(64;0.000184)|GBM - Glioblastoma multiforme(114;0.00089)|KIRC - Kidney renal clear cell carcinoma(64;0.0027)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0652)														---	---	---	---
PTPRU	10076	broad.mit.edu	37	1	29631906	29631906	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:29631906C>A	uc001bru.2	+	19	2926	c.2816C>A	c.(2815-2817)CCC>CAC	p.P939H	PTPRU_uc001brv.2_Missense_Mutation_p.P929H|PTPRU_uc001brw.2_Missense_Mutation_p.P929H|PTPRU_uc009vtq.2_Missense_Mutation_p.P929H|PTPRU_uc009vtr.2_Missense_Mutation_p.P929H	NM_005704	NP_005695	Q92729	PTPRU_HUMAN	protein tyrosine phosphatase, receptor type, U	939	Tyrosine-protein phosphatase 1.|Cytoplasmic (Potential).				canonical Wnt receptor signaling pathway|cell differentiation|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of transcription, DNA-dependent|protein localization at cell surface|transmembrane receptor protein tyrosine phosphatase signaling pathway	cell-cell junction|integral to plasma membrane	beta-catenin binding|transmembrane receptor protein tyrosine phosphatase activity			large_intestine(3)|ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	7		Colorectal(325;0.000399)|Lung NSC(340;0.00953)|all_lung(284;0.0112)|Breast(348;0.0126)|all_neural(195;0.0199)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;6.99e-07)|COAD - Colon adenocarcinoma(152;3.18e-05)|STAD - Stomach adenocarcinoma(196;0.0234)|READ - Rectum adenocarcinoma(331;0.0686)|BRCA - Breast invasive adenocarcinoma(304;0.0871)														---	---	---	---
MACF1	23499	broad.mit.edu	37	1	39812874	39812874	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39812874C>A	uc010oiu.1	+	5	6258	c.6127C>A	c.(6127-6129)CTG>ATG	p.L2043M	MACF1_uc010ois.1_Intron|MACF1_uc001cda.1_Intron|MACF1_uc001cdc.1_Intron|MACF1_uc001cdb.1_Intron	NM_033044	NP_149033	Q9UPN3	MACF1_HUMAN	microfilament and actin filament cross-linker	3608					cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding			ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)															---	---	---	---
MED8	112950	broad.mit.edu	37	1	43851858	43851858	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43851858G>A	uc001cjg.3	-	6	581	c.533C>T	c.(532-534)ACT>ATT	p.T178I	MED8_uc001cje.1_Missense_Mutation_p.T178I|MED8_uc001cjf.3_Missense_Mutation_p.T89I	NM_201542	NP_963836	Q96G25	MED8_HUMAN	mediator complex subunit 8 isoform 1	178					regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	mediator complex					0	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)																---	---	---	---
ASB17	127247	broad.mit.edu	37	1	76397883	76397883	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:76397883G>T	uc001dhe.1	-	1	234	c.94C>A	c.(94-96)CTA>ATA	p.L32I	ASB17_uc001dhf.1_RNA	NM_080868	NP_543144	Q8WXJ9	ASB17_HUMAN	ankyrin repeat and SOCS box-containing 17	32					intracellular signal transduction					ovary(1)	1																		---	---	---	---
ABCD3	5825	broad.mit.edu	37	1	94933463	94933463	+	Intron	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:94933463G>T	uc001dqn.3	+						ABCD3_uc001dqm.3_Intron|ABCD3_uc010oto.1_Intron|ABCD3_uc010otp.1_Intron|ABCD3_uc009wdr.2_Intron	NM_002858	NP_002849			ATP-binding cassette, sub-family D, member 3						peroxisomal long-chain fatty acid import|peroxisome organization	cytosol|integral to peroxisomal membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			skin(1)	1		all_lung(203;0.000434)|Lung NSC(277;0.0019)		all cancers(265;0.0261)|Epithelial(280;0.165)														---	---	---	---
RBM15	64783	broad.mit.edu	37	1	110884012	110884012	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:110884012C>A	uc001dzl.1	+	1	2068	c.1985C>A	c.(1984-1986)CCA>CAA	p.P662Q	RBM15_uc001dzm.1_Missense_Mutation_p.P662Q|uc001dzj.2_5'Flank	NM_022768	NP_073605	Q96T37	RBM15_HUMAN	RNA binding motif protein 15	662	Arg-rich.				interspecies interaction between organisms	nucleus	nucleotide binding|protein binding|RNA binding			ovary(3)	3		all_cancers(81;2.89e-06)|all_epithelial(167;2.96e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)|Breast(1374;0.0634)		BRCA - Breast invasive adenocarcinoma(282;0.000224)|Epithelial(280;0.000476)|Kidney(133;0.000539)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|all cancers(265;0.00144)|Lung(183;0.0238)|Colorectal(144;0.103)|LUSC - Lung squamous cell carcinoma(189;0.135)				T	MKL1	acute megakaryocytic leukemia								---	---	---	---
CHI3L2	1117	broad.mit.edu	37	1	111781383	111781383	+	Silent	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:111781383G>T	uc001eam.2	+	8	818	c.747G>T	c.(745-747)GTG>GTT	p.V249V	CHI3L2_uc001ean.2_Silent_p.V239V|CHI3L2_uc001eao.2_Silent_p.V170V|CHI3L2_uc009wga.2_Silent_p.V170V	NM_004000	NP_003991	Q15782	CH3L2_HUMAN	chitinase 3-like 2 isoform a	249					chitin catabolic process	extracellular space	cation binding|chitinase activity			central_nervous_system(1)	1		all_cancers(81;1.89e-05)|all_epithelial(167;7.36e-06)|all_lung(203;0.00018)|Lung NSC(277;0.000359)		Lung(183;0.0171)|Colorectal(144;0.0387)|all cancers(265;0.0464)|LUSC - Lung squamous cell carcinoma(189;0.0872)|Epithelial(280;0.0994)|COAD - Colon adenocarcinoma(174;0.141)														---	---	---	---
PI4KB	5298	broad.mit.edu	37	1	151271323	151271323	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151271323C>A	uc001ext.2	-	9	2391	c.1976G>T	c.(1975-1977)GGG>GTG	p.G659V	PI4KB_uc001exr.2_Missense_Mutation_p.G671V|PI4KB_uc001exs.2_Missense_Mutation_p.G644V|PI4KB_uc001exu.2_Missense_Mutation_p.G644V|PI4KB_uc010pcw.1_Missense_Mutation_p.G327V	NM_002651	NP_002642	Q9UBF8	PI4KB_HUMAN	catalytic phosphatidylinositol 4-kinase beta	659	PI3K/PI4K.				phosphatidylinositol biosynthetic process|phosphatidylinositol-mediated signaling|receptor-mediated endocytosis	endosome|Golgi apparatus|mitochondrial outer membrane|perinuclear region of cytoplasm|rough endoplasmic reticulum membrane	1-phosphatidylinositol 4-kinase activity|ATP binding|protein binding			ovary(2)|skin(2)	4	Lung SC(34;0.00471)|Ovarian(49;0.0147)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)															---	---	---	---
SMCP	4184	broad.mit.edu	37	1	152857173	152857173	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152857173C>A	uc001fat.2	+	2	420	c.275C>A	c.(274-276)CCG>CAG	p.P92Q		NM_030663	NP_109588	P49901	MCSP_HUMAN	sperm mitochondria-associated cysteine-rich	92					penetration of zona pellucida|sperm motility	mitochondrial membrane					0	Lung NSC(65;3.97e-29)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)															---	---	---	---
LMNA	4000	broad.mit.edu	37	1	156104721	156104721	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156104721G>T	uc001fni.2	+	4	1014	c.765G>T	c.(763-765)CAG>CAT	p.Q255H	LMNA_uc001fnf.1_Missense_Mutation_p.Q255H|LMNA_uc001fng.2_Missense_Mutation_p.Q255H|LMNA_uc001fnh.2_Missense_Mutation_p.Q255H|LMNA_uc009wro.1_Missense_Mutation_p.Q255H|LMNA_uc010pgz.1_Missense_Mutation_p.Q143H|LMNA_uc001fnj.2_Missense_Mutation_p.Q174H|LMNA_uc001fnk.2_Missense_Mutation_p.Q156H|LMNA_uc009wrp.2_5'Flank|LMNA_uc010pha.1_5'Flank	NM_170707	NP_733821	P02545	LMNA_HUMAN	lamin A/C isoform 1 precursor	255	Coil 2.|Rod.				cellular component disassembly involved in apoptosis|cellular response to hypoxia|establishment or maintenance of microtubule cytoskeleton polarity|muscle organ development|positive regulation of cell aging|regulation of apoptosis|regulation of cell migration	cytoplasm|lamin filament|nuclear envelope|nuclear envelope|perinuclear region of cytoplasm	protein binding|structural molecule activity|structural molecule activity			ovary(2)	2	Hepatocellular(266;0.158)													Werner_syndrome|Hutchinson-Gilford_Progeria_Syndrome				---	---	---	---
IFI16	3428	broad.mit.edu	37	1	158990198	158990198	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158990198G>T	uc001ftg.2	+	6	1330	c.1040G>T	c.(1039-1041)GGG>GTG	p.G347V	IFI16_uc010pis.1_Missense_Mutation_p.G291V	NM_005531	NP_005522	Q16666	IF16_HUMAN	interferon, gamma-inducible protein 16	347	HIN-200 1.				cell proliferation|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|monocyte differentiation|negative regulation of transcription, DNA-dependent|response to virus|transcription, DNA-dependent	cytoplasm|nuclear speck|nucleolus	double-stranded DNA binding|protein binding			ovary(1)	1	all_hematologic(112;0.0429)																	---	---	---	---
LY9	4063	broad.mit.edu	37	1	160783561	160783561	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160783561A>G	uc001fwu.2	+	3	640	c.590A>G	c.(589-591)CAT>CGT	p.H197R	LY9_uc010pjs.1_Missense_Mutation_p.H197R|LY9_uc001fwv.2_Missense_Mutation_p.H197R|LY9_uc001fww.2_Missense_Mutation_p.H197R|LY9_uc001fwx.2_Missense_Mutation_p.H197R|LY9_uc001fwy.1_Missense_Mutation_p.H99R|LY9_uc001fwz.2_5'Flank	NM_002348	NP_002339	Q9HBG7	LY9_HUMAN	lymphocyte antigen 9 isoform a	197	Extracellular (Potential).|Ig-like C2-type 1.				cell adhesion|immunoglobulin mediated immune response	integral to membrane				ovary(1)	1	all_cancers(52;2.72e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00737)															---	---	---	---
USF1	7391	broad.mit.edu	37	1	161009753	161009753	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161009753C>A	uc001fxi.2	-	11	1085	c.890G>T	c.(889-891)CGG>CTG	p.R297L	F11R_uc010pjw.1_5'Flank|F11R_uc001fxf.3_5'Flank|TSTD1_uc010pjx.1_5'Flank|TSTD1_uc009wtw.2_5'Flank|TSTD1_uc001fxh.3_5'Flank|USF1_uc001fxj.2_Missense_Mutation_p.R238L	NM_007122	NP_009053	P22415	USF1_HUMAN	upstream stimulatory factor 1 isoform 1	297					cellular response to insulin stimulus|glucose homeostasis|late viral mRNA transcription|lipid homeostasis|positive regulation of transcription from RNA polymerase II promoter by glucose|response to hypoxia|response to UV	transcription factor complex	bHLH transcription factor binding|histone deacetylase binding|protein heterodimerization activity|protein homodimerization activity|protein kinase binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity			upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	3	all_cancers(52;6.73e-18)|Breast(13;0.012)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00122)															---	---	---	---
OLFML2B	25903	broad.mit.edu	37	1	161968122	161968122	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161968122C>A	uc001gbu.2	-	6	1391	c.967G>T	c.(967-969)GGT>TGT	p.G323C	OLFML2B_uc010pkq.1_Missense_Mutation_p.G324C	NM_015441	NP_056256	Q68BL8	OLM2B_HUMAN	olfactomedin-like 2B precursor	323										skin(1)	1	all_hematologic(112;0.156)		BRCA - Breast invasive adenocarcinoma(70;0.0172)															---	---	---	---
SCYL3	57147	broad.mit.edu	37	1	169831833	169831833	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169831833C>A	uc001ggs.2	-	10	1259	c.1061G>T	c.(1060-1062)CGG>CTG	p.R354L	SCYL3_uc010plw.1_5'UTR|SCYL3_uc001ggt.2_Missense_Mutation_p.R354L|SCYL3_uc001ggu.2_RNA	NM_181093	NP_851607	Q8IZE3	PACE1_HUMAN	SCY1-like 3 isoform 2	354	HEAT 3.				cell migration	Golgi apparatus|lamellipodium	ATP binding|protein binding|protein kinase activity			ovary(1)|skin(1)	2	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)																	---	---	---	---
MYOC	4653	broad.mit.edu	37	1	171605172	171605172	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:171605172G>T	uc001ghu.2	-	3	1430	c.1408C>A	c.(1408-1410)CGC>AGC	p.R470S	MYOC_uc010pmk.1_Missense_Mutation_p.R412S	NM_000261	NP_000252	Q99972	MYOC_HUMAN	myocilin precursor	470	Olfactomedin-like.		R -> C (in GLC1A).|R -> H.		anatomical structure morphogenesis	cilium|extracellular space|rough endoplasmic reticulum	structural molecule activity			lung(1)	1	all_cancers(6;5.47e-10)|all_hematologic(923;0.088)|Acute lymphoblastic leukemia(37;0.181)																	---	---	---	---
DHX9	1660	broad.mit.edu	37	1	182853798	182853798	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:182853798G>T	uc001gpr.2	+	27	3474	c.3311G>T	c.(3310-3312)CGG>CTG	p.R1104L	DHX9_uc001gps.2_Missense_Mutation_p.R890L|DHX9_uc001gpt.2_Missense_Mutation_p.R383L|DHX9_uc009wyd.2_Missense_Mutation_p.R69L	NM_001357	NP_001348	Q08211	DHX9_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 9	1104					CRD-mediated mRNA stabilization|nuclear mRNA splicing, via spliceosome	centrosome|CRD-mediated mRNA stability complex|nucleolus|nucleoplasm|ribonucleoprotein complex	ATP binding|ATP-dependent DNA helicase activity|ATP-dependent RNA helicase activity|DNA binding|double-stranded RNA binding|protein binding			ovary(2)	2																		---	---	---	---
GLT25D2	23127	broad.mit.edu	37	1	183908174	183908174	+	Intron	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:183908174G>T	uc001gqr.2	-						GLT25D2_uc010poj.1_Intron|GLT25D2_uc001gqp.2_Intron|GLT25D2_uc001gqq.2_Intron|GLT25D2_uc001gqs.2_Intron	NM_015101	NP_055916			glycosyltransferase 25 domain containing 2						lipopolysaccharide biosynthetic process	endoplasmic reticulum lumen	procollagen galactosyltransferase activity			ovary(1)|breast(1)	2																		---	---	---	---
TPR	7175	broad.mit.edu	37	1	186330996	186330996	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186330996C>A	uc001grv.2	-	8	1092	c.795G>T	c.(793-795)AAG>AAT	p.K265N	TPR_uc010pop.1_Missense_Mutation_p.K341N	NM_003292	NP_003283	P12270	TPR_HUMAN	nuclear pore complex-associated protein TPR	265	Potential.				carbohydrate metabolic process|glucose transport|mitotic cell cycle spindle assembly checkpoint|mRNA transport|protein import into nucleus|regulation of glucose transport|seryl-tRNA aminoacylation|transmembrane transport|viral reproduction	condensed chromosome kinetochore|cytoplasm|nuclear membrane|nuclear pore|nucleoplasm	ATP binding|protein binding|serine-tRNA ligase activity			ovary(2)|lung(2)|urinary_tract(1)|central_nervous_system(1)|skin(1)	7		Breast(1374;0.000659)|Lung SC(1967;0.0262)|Prostate(1639;0.157)		Colorectal(1306;1.12e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00553)				T	NTRK1	papillary thyroid								---	---	---	---
LGR6	59352	broad.mit.edu	37	1	202249902	202249902	+	Intron	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:202249902C>A	uc001gxu.2	+						LGR6_uc001gxv.2_Intron|LGR6_uc009xab.2_Intron|LGR6_uc001gxw.2_Intron|LGR6_uc009xac.1_Intron	NM_001017403	NP_001017403			leucine-rich repeat-containing G protein-coupled							integral to membrane|plasma membrane	protein-hormone receptor activity			large_intestine(4)|ovary(3)|skin(2)|pancreas(1)	10																		---	---	---	---
PPP1R15B	84919	broad.mit.edu	37	1	204380537	204380537	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:204380537C>G	uc001hav.3	-	1	408	c.3G>C	c.(1-3)ATG>ATC	p.M1I		NM_032833	NP_116222	Q5SWA1	PR15B_HUMAN	protein phosphatase 1, regulatory subunit 15B	1					regulation of translation					ovary(1)|pancreas(1)	2	all_cancers(21;0.0032)|all_neural(3;0.0218)|Glioma(3;0.0382)|Breast(84;0.179)|all_epithelial(62;0.193)|Prostate(682;0.227)		all cancers(3;1.14e-29)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.139)															---	---	---	---
CNTN2	6900	broad.mit.edu	37	1	205038689	205038689	+	Silent	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:205038689G>T	uc001hbr.2	+	17	2465	c.2196G>T	c.(2194-2196)ACG>ACT	p.T732T	CNTN2_uc001hbq.1_Silent_p.T623T|CNTN2_uc001hbs.2_Silent_p.T520T	NM_005076	NP_005067	Q02246	CNTN2_HUMAN	contactin 2 precursor	732	Fibronectin type-III 2.				axon guidance|clustering of voltage-gated potassium channels	anchored to membrane|juxtaparanode region of axon|myelin sheath|node of Ranvier|synapse part	identical protein binding			ovary(1)	1	all_cancers(21;0.144)|Breast(84;0.0437)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)															---	---	---	---
PLXNA2	5362	broad.mit.edu	37	1	208270138	208270138	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:208270138C>A	uc001hgz.2	-	7	2580	c.1822G>T	c.(1822-1824)GGG>TGG	p.G608W		NM_025179	NP_079455	O75051	PLXA2_HUMAN	plexin A2 precursor	608	Extracellular (Potential).				axon guidance	integral to membrane|intracellular|plasma membrane				ovary(2)|central_nervous_system(1)	3				OV - Ovarian serous cystadenocarcinoma(81;0.199)														---	---	---	---
OBSCN	84033	broad.mit.edu	37	1	228466620	228466620	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:228466620G>T	uc009xez.1	+	26	7134	c.7090G>T	c.(7090-7092)GGT>TGT	p.G2364C	OBSCN_uc001hsn.2_Missense_Mutation_p.G2364C|OBSCN_uc001hsp.1_Missense_Mutation_p.G63C|OBSCN_uc001hsq.1_5'Flank	NM_001098623	NP_001092093	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and	2364	Ig-like 23.				apoptosis|cell differentiation|induction of apoptosis by extracellular signals|multicellular organismal development|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|M band|Z disc	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity|Rho guanyl-nucleotide exchange factor activity|structural constituent of muscle|titin binding			stomach(8)|large_intestine(7)|breast(5)|ovary(4)|skin(2)|central_nervous_system(1)|pancreas(1)	28		Prostate(94;0.0405)																---	---	---	---
EXO1	9156	broad.mit.edu	37	1	242016726	242016726	+	Silent	SNP	A	G	G			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:242016726A>G	uc001hzh.2	+	6	888	c.348A>G	c.(346-348)CGA>CGG	p.R116R	EXO1_uc001hzi.2_Silent_p.R116R|EXO1_uc001hzj.2_Silent_p.R116R|EXO1_uc009xgq.2_Silent_p.R116R	NM_130398	NP_569082	Q9UQ84	EXO1_HUMAN	exonuclease 1 isoform b	116					meiosis|mismatch repair	nucleus	double-stranded DNA specific 5'-3' exodeoxyribonuclease activity|flap endonuclease activity|metal ion binding|protein binding|protein binding|ribonuclease H activity|single-stranded DNA specific 5'-3' exodeoxyribonuclease activity			ovary(2)|lung(2)|skin(1)	5	Ovarian(103;0.103)	all_cancers(173;0.0555)	OV - Ovarian serous cystadenocarcinoma(106;0.0107)										Direct_reversal_of_damage|Editing_and_processing_nucleases					---	---	---	---
PXDN	7837	broad.mit.edu	37	2	1643143	1643143	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1643143C>G	uc002qxa.2	-	20	4068	c.4004G>C	c.(4003-4005)AGA>ACA	p.R1335T		NM_012293	NP_036425	Q92626	PXDN_HUMAN	peroxidasin precursor	1335					extracellular matrix organization|hydrogen peroxide catabolic process|immune response	endoplasmic reticulum|extracellular space|proteinaceous extracellular matrix	extracellular matrix structural constituent|heme binding|interleukin-1 receptor antagonist activity|peroxidase activity			pancreas(6)|ovary(2)	8	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.0845)|Lung NSC(108;0.00641)|all_epithelial(98;0.00716)		all cancers(51;0.0492)|OV - Ovarian serous cystadenocarcinoma(76;0.0973)|Epithelial(75;0.17)|GBM - Glioblastoma multiforme(21;0.228)														---	---	---	---
NBAS	51594	broad.mit.edu	37	2	15359013	15359013	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:15359013G>T	uc002rcc.1	-	48	6342	c.6316C>A	c.(6316-6318)CGC>AGC	p.R2106S	NBAS_uc002rcb.1_Intron|NBAS_uc010exl.1_Missense_Mutation_p.R1178S|NBAS_uc002rcd.1_Intron	NM_015909	NP_056993	A2RRP1	NBAS_HUMAN	neuroblastoma-amplified protein	2106										ovary(2)|liver(1)|skin(1)	4																		---	---	---	---
SDC1	6382	broad.mit.edu	37	2	20402700	20402700	+	Intron	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:20402700G>T	uc002rdo.1	-						SDC1_uc002rdp.1_Intron|SDC1_uc010exv.2_Intron	NM_002997	NP_002988			syndecan 1 precursor						lipid metabolic process|lipoprotein metabolic process|myoblast development|striated muscle cell development	cytoplasm|extracellular region|focal adhesion|integral to plasma membrane	cytoskeletal protein binding|protein C-terminus binding			ovary(4)|skin(1)	5	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)			OV - Ovarian serous cystadenocarcinoma(76;0.221)														---	---	---	---
SRD5A2	6716	broad.mit.edu	37	2	31754489	31754489	+	Missense_Mutation	SNP	C	A	A	rs121434250		TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:31754489C>A	uc002rnw.1	-	5	657	c.586G>T	c.(586-588)GGT>TGT	p.G196C		NM_000348	NP_000339	P31213	S5A2_HUMAN	3-oxo-5 alpha-steroid 4-dehydrogenase 2	196			G -> S (in PPSH).		androgen biosynthetic process|cell differentiation|cell-cell signaling|male gonad development	endoplasmic reticulum membrane|integral to membrane|microsome	3-oxo-5-alpha-steroid 4-dehydrogenase activity|sterol 5-alpha reductase activity				0	Acute lymphoblastic leukemia(172;0.155)				Azelaic Acid(DB00548)|Dutasteride(DB01126)													---	---	---	---
KLRAQ1	129285	broad.mit.edu	37	2	48688357	48688357	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:48688357C>A	uc002rwm.2	+	7	865	c.680C>A	c.(679-681)CCT>CAT	p.P227H	KLRAQ1_uc002rwi.1_Missense_Mutation_p.P227H|KLRAQ1_uc002rwj.2_Missense_Mutation_p.P227H|KLRAQ1_uc002rwl.2_Missense_Mutation_p.P181H|KLRAQ1_uc002rwk.2_Missense_Mutation_p.P227H|KLRAQ1_uc010yok.1_Missense_Mutation_p.P227H	NM_001135629	NP_001129101	Q6ZMI0	KLRAQ_HUMAN	KLRAQ motif containing 1 isoform 1	227										ovary(1)	1																		---	---	---	---
PSME4	23198	broad.mit.edu	37	2	54148152	54148152	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:54148152C>A	uc002rxp.2	-	18	2192	c.2136G>T	c.(2134-2136)CAG>CAT	p.Q712H	PSME4_uc010yop.1_Missense_Mutation_p.Q598H|PSME4_uc010yoq.1_RNA|PSME4_uc010fbu.1_Missense_Mutation_p.Q87H|PSME4_uc010fbv.1_Intron	NM_014614	NP_055429	Q14997	PSME4_HUMAN	proteasome (prosome, macropain) activator	712					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|cell differentiation|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|M/G1 transition of mitotic cell cycle|mRNA metabolic process|multicellular organismal development|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|spermatogenesis|viral reproduction	nuclear speck|proteasome complex	binding			ovary(2)|breast(2)|pancreas(1)	5			Lung(47;0.125)|LUSC - Lung squamous cell carcinoma(58;0.181)															---	---	---	---
PAX8	7849	broad.mit.edu	37	2	114002207	114002207	+	Intron	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:114002207C>A	uc010yxt.1	-						PAX8_uc010yxu.1_Intron|PAX8_uc010yxv.1_Intron|PAX8_uc002tjm.2_Intron|PAX8_uc002tjn.2_Intron|PAX8_uc010fku.1_Intron|LOC654433_uc002tjq.3_Intron|LOC654433_uc010fks.2_Intron|LOC654433_uc010fkt.2_Intron|LOC654433_uc002tjr.3_Intron	NM_003466	NP_003457			paired box 8 isoform PAX8A						branching involved in ureteric bud morphogenesis|cellular response to gonadotropin stimulus|central nervous system development|mesenchymal to epithelial transition involved in metanephros morphogenesis|mesonephros development|metanephric collecting duct development|metanephric comma-shaped body morphogenesis|metanephric distal convoluted tubule development|metanephric nephron tubule formation|metanephric S-shaped body morphogenesis|negative regulation of mesenchymal stem cell apoptosis involved in metanephric nephron morphogenesis|otic vesicle development|positive regulation of branching involved in ureteric bud morphogenesis|positive regulation of mesenchymal to epithelial transition involved in metanephros morphogenesis|positive regulation of metanephric DCT cell differentiation|positive regulation of thyroid hormone generation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|pronephric field specification|regulation of metanephric nephron tubule epithelial cell differentiation|regulation of thyroid-stimulating hormone secretion|thyroid gland development|transcription, DNA-dependent	nucleoplasm	protein binding|RNA polymerase II core promoter sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|thyroid-stimulating hormone receptor activity			ovary(1)|lung(1)	2								T	PPARG	follicular thyroid		Thyroid dysgenesis 						---	---	---	---
TMEM177	80775	broad.mit.edu	37	2	120438868	120438868	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:120438868C>A	uc010flg.1	+	2	912	c.439C>A	c.(439-441)CGT>AGT	p.R147S	TMEM177_uc002tme.2_Intron|TMEM177_uc002tmc.1_Missense_Mutation_p.R147S|TMEM177_uc002tmd.2_Missense_Mutation_p.R147S|TMEM177_uc010flh.2_Intron	NM_001105198	NP_001098668	Q53S58	TM177_HUMAN	transmembrane protein 177	147						integral to membrane				ovary(1)	1	Colorectal(110;0.196)																	---	---	---	---
LY75	4065	broad.mit.edu	37	2	160639873	160639873	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:160639873G>T	uc002ubb.3	-	35	5167	c.5098C>A	c.(5098-5100)CAT>AAT	p.H1700N	LY75_uc010fos.2_Missense_Mutation_p.H1644N|CD302_uc002uba.2_Missense_Mutation_p.H59N|CD302_uc010zco.1_Missense_Mutation_p.H59N	NM_002349	NP_002340	O60449	LY75_HUMAN	lymphocyte antigen 75 precursor	1568	Extracellular (Potential).|C-type lectin 10.				endocytosis|immune response|inflammatory response	integral to plasma membrane	receptor activity|sugar binding				0				COAD - Colon adenocarcinoma(177;0.132)														---	---	---	---
TTN	7273	broad.mit.edu	37	2	179596607	179596607	+	Silent	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179596607G>T	uc010zfg.1	-	55	13487	c.13263C>A	c.(13261-13263)CCC>CCA	p.P4421P	TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Silent_p.P1082P	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	5348							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)															---	---	---	---
CERKL	375298	broad.mit.edu	37	2	182521684	182521684	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:182521684C>A	uc002unx.2	-	1	151	c.50G>T	c.(49-51)CGG>CTG	p.R17L	CERKL_uc002uny.2_Missense_Mutation_p.R17L|CERKL_uc010zfm.1_Missense_Mutation_p.R17L|CERKL_uc002unz.2_5'UTR|CERKL_uc002uoa.2_Missense_Mutation_p.R17L|CERKL_uc002uob.2_5'UTR|CERKL_uc002uoc.2_Missense_Mutation_p.R17L|CERKL_uc010frk.2_RNA|CERKL_uc002uod.1_Intron|CERKL_uc002uoe.2_Missense_Mutation_p.R17L	NM_001030311	NP_001025482	Q49MI3	CERKL_HUMAN	ceramide kinase-like isoform b	17					activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|anti-apoptosis	endoplasmic reticulum|endoplasmic reticulum|Golgi apparatus|Golgi apparatus|nucleolus|nucleolus	diacylglycerol kinase activity			ovary(2)|kidney(1)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.088)															---	---	---	---
COL4A4	1286	broad.mit.edu	37	2	227896951	227896951	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:227896951C>A	uc010zlt.1	-	39	4273	c.3619G>T	c.(3619-3621)GGG>TGG	p.G1207W		NM_000092	NP_000083	P53420	CO4A4_HUMAN	alpha 4 type IV collagen precursor	1207	Triple-helical region.	Cleavage; by collagenase (By similarity).			axon guidance|glomerular basement membrane development	basal lamina|collagen type IV	extracellular matrix structural constituent|protein binding			ovary(5)|central_nervous_system(3)|pancreas(1)|breast(1)|skin(1)	11		Renal(207;0.00844)|all_lung(227;0.0187)|Lung NSC(271;0.0879)|all_hematologic(139;0.21)|Esophageal squamous(248;0.242)		Epithelial(121;6.7e-11)|all cancers(144;5.39e-08)|Lung(261;0.0132)|LUSC - Lung squamous cell carcinoma(224;0.0181)														---	---	---	---
TM4SF20	79853	broad.mit.edu	37	2	228243827	228243827	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:228243827G>T	uc002vpb.2	-	1	196	c.158C>A	c.(157-159)CCA>CAA	p.P53Q		NM_024795	NP_079071	Q53R12	T4S20_HUMAN	transmembrane 4 L six family member 20	53	Helical; (Potential).					integral to membrane|plasma membrane					0		Renal(207;0.025)|all_lung(227;0.123)|Esophageal squamous(248;0.23)|all_hematologic(139;0.248)		Epithelial(121;3.8e-11)|all cancers(144;2.57e-08)|Lung(261;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.0115)														---	---	---	---
SP100	6672	broad.mit.edu	37	2	231379989	231379989	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:231379989G>T	uc002vqt.2	+	25	2415	c.2274G>T	c.(2272-2274)GAG>GAT	p.E758D	SP100_uc002vqu.1_Intron|SP100_uc010fxp.1_Intron	NM_003113	NP_003104	P23497	SP100_HUMAN	nuclear antigen Sp100 isoform 2	758					DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|interspecies interaction between organisms|negative regulation of cellular component movement|negative regulation of DNA binding|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|negative regulation of transcription, DNA-dependent|negative regulation of viral transcription|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|response to cytokine stimulus|response to retinoic acid|response to type I interferon	cytoplasm|nuclear periphery|nucleolus|PML body	chromo shadow domain binding|DNA binding|identical protein binding|kinase binding|protein homodimerization activity|transcription coactivator activity|transcription corepressor activity|transcription factor binding			ovary(4)|central_nervous_system(1)	5		Renal(207;0.0112)|all_lung(227;0.0335)|all_hematologic(139;0.0749)|Lung NSC(271;0.142)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.13e-12)|all cancers(144;2.71e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)														---	---	---	---
GRIP2	80852	broad.mit.edu	37	3	14562040	14562040	+	Silent	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:14562040C>A	uc011avi.1	-	9	1008	c.1008G>T	c.(1006-1008)ACG>ACT	p.T336T	GRIP2_uc011avh.1_5'UTR	NM_001080423	NP_001073892	Q9C0E4	GRIP2_HUMAN	glutamate receptor interacting protein 2	239					synaptic transmission	cytosol|plasma membrane	protein binding			pancreas(1)	1																		---	---	---	---
SCN11A	11280	broad.mit.edu	37	3	38941492	38941492	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:38941492G>A	uc011ays.1	-	13	2114	c.1915C>T	c.(1915-1917)CGA>TGA	p.R639*		NM_014139	NP_054858	Q9UI33	SCNBA_HUMAN	sodium channel, voltage-gated, type XI, alpha	639	II.				response to drug	voltage-gated sodium channel complex	voltage-gated sodium channel activity			skin(6)|ovary(1)|haematopoietic_and_lymphoid_tissue(1)|pancreas(1)	9				Kidney(284;0.00202)|KIRC - Kidney renal clear cell carcinoma(284;0.00226)	Cocaine(DB00907)													---	---	---	---
ZNF620	253639	broad.mit.edu	37	3	40557659	40557659	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:40557659G>T	uc003ckk.2	+	5	723	c.574G>T	c.(574-576)GGT>TGT	p.G192C	ZNF620_uc003ckl.2_Missense_Mutation_p.G78C	NM_175888	NP_787084	Q6ZNG0	ZN620_HUMAN	zinc finger protein 620	192					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1				KIRC - Kidney renal clear cell carcinoma(284;0.0519)|Kidney(284;0.0653)														---	---	---	---
HHATL	57467	broad.mit.edu	37	3	42735277	42735277	+	Silent	SNP	G	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:42735277G>A	uc003clw.2	-	11	1227	c.1080C>T	c.(1078-1080)TCC>TCT	p.S360S	HHATL_uc003clx.2_Silent_p.S360S	NM_020707	NP_065758	Q9HCP6	HHATL_HUMAN	hedgehog acyltransferase-like	360					negative regulation of N-terminal protein palmitoylation	endoplasmic reticulum membrane|integral to membrane|perinuclear region of cytoplasm				ovary(3)	3				KIRC - Kidney renal clear cell carcinoma(284;0.215)														---	---	---	---
ABHD5	51099	broad.mit.edu	37	3	43756528	43756528	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:43756528C>A	uc003cmx.2	+	5	861	c.751C>A	c.(751-753)CAC>AAC	p.H251N		NM_016006	NP_057090	Q8WTS1	ABHD5_HUMAN	abhydrolase domain containing 5	251					cell differentiation|fatty acid metabolic process|negative regulation of sequestering of triglyceride|phosphatidic acid biosynthetic process|positive regulation of triglyceride catabolic process|triglyceride catabolic process	cytosol|lipid particle	1-acylglycerol-3-phosphate O-acyltransferase activity|lysophosphatidic acid acyltransferase activity			ovary(1)	1		Renal(3;0.0134)		KIRC - Kidney renal clear cell carcinoma(197;0.0546)|Kidney(197;0.0687)														---	---	---	---
COL7A1	1294	broad.mit.edu	37	3	48605932	48605932	+	Silent	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48605932C>A	uc003ctz.2	-	104	7795	c.7794G>T	c.(7792-7794)CCG>CCT	p.P2598P		NM_000094	NP_000085	Q02388	CO7A1_HUMAN	alpha 1 type VII collagen precursor	2598	Triple-helical region.				cell adhesion|epidermis development	basement membrane|collagen type VII	protein binding|serine-type endopeptidase inhibitor activity			ovary(4)|breast(3)|skin(3)|central_nervous_system(1)	11				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)														---	---	---	---
ITIH4	3700	broad.mit.edu	37	3	52858258	52858258	+	Silent	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52858258G>T	uc003dfz.2	-	9	1155	c.1119C>A	c.(1117-1119)CCC>CCA	p.P373P	ITIH4_uc011bel.1_Silent_p.P103P|ITIH4_uc003dfy.2_Silent_p.P237P|ITIH4_uc011bem.1_Silent_p.P373P|ITIH4_uc011ben.1_Silent_p.P373P	NM_002218	NP_002209	Q14624	ITIH4_HUMAN	inter-alpha (globulin) inhibitor H4	373	VWFA.				acute-phase response|hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity			ovary(2)|central_nervous_system(1)	3				BRCA - Breast invasive adenocarcinoma(193;7e-05)|Kidney(197;0.000656)|KIRC - Kidney renal clear cell carcinoma(197;0.000794)|OV - Ovarian serous cystadenocarcinoma(275;0.0496)														---	---	---	---
SLMAP	7871	broad.mit.edu	37	3	57882659	57882659	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:57882659G>T	uc003dje.1	+	15	1655	c.1450G>T	c.(1450-1452)GAT>TAT	p.D484Y	SLMAP_uc003djc.1_Missense_Mutation_p.G480C|SLMAP_uc003djd.1_Missense_Mutation_p.D467Y|SLMAP_uc003djf.1_Missense_Mutation_p.D446Y|SLMAP_uc003djg.1_Missense_Mutation_p.D78Y|SLMAP_uc011bez.1_Missense_Mutation_p.A18S|SLMAP_uc011bfa.1_Missense_Mutation_p.D18Y|SLMAP_uc003djh.2_Missense_Mutation_p.A18S|SLMAP_uc003dji.1_Missense_Mutation_p.D18Y|SLMAP_uc011bfb.1_Missense_Mutation_p.D18Y|SLMAP_uc011bfc.1_Missense_Mutation_p.A18S	NM_007159	NP_009090	Q14BN4	SLMAP_HUMAN	sarcolemma associated protein	484	Cytoplasmic (Potential).|Potential.				muscle contraction|protein folding	integral to plasma membrane|microtubule organizing center|prefoldin complex|sarcolemma|smooth endoplasmic reticulum	unfolded protein binding				0				BRCA - Breast invasive adenocarcinoma(55;0.000271)|KIRC - Kidney renal clear cell carcinoma(284;0.0602)|Kidney(284;0.0754)|OV - Ovarian serous cystadenocarcinoma(275;0.182)														---	---	---	---
GPR15	2838	broad.mit.edu	37	3	98251350	98251350	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:98251350G>T	uc011bgy.1	+	1	473	c.473G>T	c.(472-474)TGG>TTG	p.W158L		NM_005290	NP_005281	P49685	GPR15_HUMAN	G protein-coupled receptor 15	158	Helical; Name=4; (Potential).					integral to plasma membrane	purinergic nucleotide receptor activity, G-protein coupled			ovary(1)	1		Lung NSC(201;7.93e-06)|all_neural(597;0.00172)|Hepatocellular(537;0.00825)|Myeloproliferative disorder(1037;0.0255)		Lung(72;0.246)														---	---	---	---
IMPG2	50939	broad.mit.edu	37	3	100961575	100961575	+	Silent	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:100961575G>T	uc003duq.1	-	14	3182	c.2979C>A	c.(2977-2979)ACC>ACA	p.T993T	IMPG2_uc011bhe.1_Silent_p.T856T	NM_016247	NP_057331	Q9BZV3	IMPG2_HUMAN	interphotoreceptor matrix proteoglycan 2	993	Extracellular (Potential).|SEA 2.				visual perception	integral to membrane|proteinaceous extracellular matrix	extracellular matrix structural constituent|heparin binding|hyaluronic acid binding|receptor activity			ovary(2)|haematopoietic_and_lymphoid_tissue(1)	3																		---	---	---	---
IGSF11	152404	broad.mit.edu	37	3	118645024	118645024	+	Silent	SNP	C	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:118645024C>T	uc003ebw.2	-	4	751	c.504G>A	c.(502-504)GAG>GAA	p.E168E	IGSF11_uc011biv.1_Silent_p.E168E|IGSF11_uc003ebx.2_Silent_p.E168E|IGSF11_uc003eby.2_Silent_p.E167E|IGSF11_uc003ebz.2_Silent_p.E167E|IGSF11_uc010hqs.2_Silent_p.E167E	NM_001015887	NP_001015887	Q5DX21	IGS11_HUMAN	immunoglobulin superfamily, member 11 isoform b	168	Ig-like C2-type.|Extracellular (Potential).				cell adhesion|regulation of growth	integral to membrane|plasma membrane	receptor activity				0																		---	---	---	---
ARHGAP31	57514	broad.mit.edu	37	3	119112366	119112366	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:119112366C>T	uc003ecj.3	+	8	1466	c.934C>T	c.(934-936)CGT>TGT	p.R312C		NM_020754	NP_065805	Q2M1Z3	RHG31_HUMAN	Cdc42 GTPase-activating protein	312					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|focal adhesion|lamellipodium	GTPase activator activity			ovary(2)	2																		---	---	---	---
GPR156	165829	broad.mit.edu	37	3	119887107	119887107	+	Missense_Mutation	SNP	G	T	T	rs113424982		TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:119887107G>T	uc011bjf.1	-	9	1217	c.1217C>A	c.(1216-1218)CCG>CAG	p.P406Q	GPR156_uc011bjg.1_Missense_Mutation_p.P402Q	NM_153002	NP_694547	Q8NFN8	GP156_HUMAN	G protein-coupled receptor 156	406	Cytoplasmic (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity|GABA-B receptor activity			ovary(1)|skin(1)	2				GBM - Glioblastoma multiforme(114;0.19)														---	---	---	---
TMCC1	23023	broad.mit.edu	37	3	129389972	129389972	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:129389972G>T	uc003emz.3	-	5	1213	c.712C>A	c.(712-714)CAG>AAG	p.Q238K	TMCC1_uc003emy.3_5'UTR|TMCC1_uc011blc.1_Missense_Mutation_p.Q59K|TMCC1_uc010htg.2_Missense_Mutation_p.Q124K	NM_001017395	NP_001017395	O94876	TMCC1_HUMAN	transmembrane and coiled-coil domain family 1	238	Potential.					integral to membrane				skin(1)	1																		---	---	---	---
TMEM108	66000	broad.mit.edu	37	3	133114803	133114803	+	Silent	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:133114803G>T	uc003eph.2	+	6	1975	c.1701G>T	c.(1699-1701)GTG>GTT	p.V567V	TMEM108_uc003epi.2_Silent_p.V567V|TMEM108_uc003epk.2_Silent_p.V97V|TMEM108_uc003epm.2_Silent_p.V518V	NM_023943	NP_076432	Q6UXF1	TM108_HUMAN	transmembrane protein 108 precursor	567	Cytoplasmic (Potential).					integral to membrane				ovary(2)|skin(2)	4																		---	---	---	---
LRRC31	79782	broad.mit.edu	37	3	169557996	169557996	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:169557996C>A	uc003fgc.1	-	9	1510	c.1433G>T	c.(1432-1434)CGG>CTG	p.R478L	LRRC31_uc010hwp.1_Missense_Mutation_p.R422L	NM_024727	NP_079003	Q6UY01	LRC31_HUMAN	leucine rich repeat containing 31	478										ovary(2)|skin(1)	3	all_cancers(22;2.76e-22)|all_epithelial(15;4.73e-27)|all_lung(20;9.24e-17)|Lung NSC(18;3.85e-16)|Ovarian(172;0.000223)|Breast(254;0.197)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.00943)															---	---	---	---
HTR3D	200909	broad.mit.edu	37	3	183756624	183756624	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183756624G>T	uc011bqv.1	+	8	1226	c.1226G>T	c.(1225-1227)CGG>CTG	p.R409L	HTR3D_uc003fmj.2_Missense_Mutation_p.R234L|HTR3D_uc011bqu.1_Missense_Mutation_p.R359L|HTR3D_uc010hxp.2_Missense_Mutation_p.R188L	NM_001163646	NP_001157118	Q70Z44	5HT3D_HUMAN	5-hydroxytryptamine receptor 3 subunit D isoform	409	Cytoplasmic (Potential).					integral to membrane|plasma membrane	extracellular ligand-gated ion channel activity|receptor activity				0	all_cancers(143;2.33e-10)|Ovarian(172;0.0303)		Epithelial(37;6.23e-36)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)															---	---	---	---
ATP13A4	84239	broad.mit.edu	37	3	193166019	193166019	+	Silent	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:193166019G>T	uc003ftd.2	-	18	2236	c.2128C>A	c.(2128-2130)CGG>AGG	p.R710R	ATP13A4_uc003fte.1_Silent_p.R710R|ATP13A4_uc011bsr.1_Silent_p.R181R|ATP13A4_uc010hzi.2_RNA	NM_032279	NP_115655	Q4VNC1	AT134_HUMAN	ATPase type 13A4	710	Extracellular (Potential).				ATP biosynthetic process|cation transport	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|metal ion binding			ovary(2)	2	all_cancers(143;1.76e-08)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;2.72e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;0.000109)														---	---	---	---
TFRC	7037	broad.mit.edu	37	3	195802018	195802018	+	Intron	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195802018G>T	uc003fvz.3	-						TFRC_uc003fwa.3_Intron|TFRC_uc010hzy.2_Intron|TFRC_uc011btr.1_Intron	NM_003234	NP_003225			transferrin receptor						cellular iron ion homeostasis|endocytosis|interspecies interaction between organisms|proteolysis|transferrin transport|transmembrane transport	coated pit|endosome|integral to plasma membrane|melanosome	peptidase activity|transferrin receptor activity			ovary(3)	3	all_cancers(143;1.94e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		Epithelial(36;1.36e-24)|all cancers(36;3.34e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.17e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00233)				T	BCL6	NHL								---	---	---	---
REST	5978	broad.mit.edu	37	4	57797479	57797479	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:57797479G>T	uc003hch.2	+	4	2802	c.2455G>T	c.(2455-2457)GAT>TAT	p.D819Y	REST_uc003hci.2_Missense_Mutation_p.D819Y|REST_uc010ihf.2_Missense_Mutation_p.D493Y	NM_005612	NP_005603	Q13127	REST_HUMAN	RE1-silencing transcription factor	819					cardiac muscle cell myoblast differentiation|cellular response to drug|cellular response to electrical stimulus|cellular response to glucocorticoid stimulus|histone H4 deacetylation|negative regulation by host of viral transcription|negative regulation of aldosterone biosynthetic process|negative regulation of calcium ion-dependent exocytosis|negative regulation of cell proliferation|negative regulation of cortisol biosynthetic process|negative regulation of dense core granule biogenesis|negative regulation of insulin secretion|negative regulation of mesenchymal stem cell differentiation|negative regulation of neurogenesis|negative regulation of neuron differentiation|positive regulation of apoptosis|positive regulation of caspase activity|positive regulation of transcription, DNA-dependent	cytoplasm|transcriptional repressor complex	calcium channel activity|chromatin binding|core promoter proximal region sequence-specific DNA binding|core promoter sequence-specific DNA binding|outward rectifier potassium channel activity|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription|zinc ion binding			skin(5)|upper_aerodigestive_tract(1)|ovary(1)|lung(1)|central_nervous_system(1)	9	Glioma(25;0.08)|all_neural(26;0.181)																	---	---	---	---
PDHA2	5161	broad.mit.edu	37	4	96761323	96761323	+	Missense_Mutation	SNP	C	A	A	rs140695896	byFrequency	TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:96761323C>A	uc003htr.3	+	1	85	c.22C>A	c.(22-24)CGC>AGC	p.R8S		NM_005390	NP_005381	P29803	ODPAT_HUMAN	pyruvate dehydrogenase E1 alpha 2 precursor	8					glycolysis	mitochondrial matrix	pyruvate dehydrogenase (acetyl-transferring) activity			central_nervous_system(1)	1		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;1.23e-06)	NADH(DB00157)													---	---	---	---
NEK1	4750	broad.mit.edu	37	4	170327836	170327836	+	Silent	SNP	G	T	T	rs140408058	by1000genomes	TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:170327836G>T	uc003isb.1	-	30	3693	c.3201C>A	c.(3199-3201)CCC>CCA	p.P1067P	NEK1_uc003isc.1_Silent_p.P1023P|NEK1_uc003isd.1_Silent_p.P1095P|NEK1_uc003ise.1_Silent_p.P1051P|NEK1_uc003isf.1_Silent_p.P998P	NM_012224	NP_036356	Q96PY6	NEK1_HUMAN	NIMA-related kinase 1	1067					cell division|cilium assembly|mitosis	nucleus|pericentriolar material	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			lung(3)|ovary(2)|large_intestine(1)	6		Prostate(90;0.00601)|Renal(120;0.0183)		GBM - Glioblastoma multiforme(119;0.0287)|KIRC - Kidney renal clear cell carcinoma(143;0.0325)|Kidney(143;0.0385)|LUSC - Lung squamous cell carcinoma(193;0.14)														---	---	---	---
FASTKD3	79072	broad.mit.edu	37	5	7867597	7867597	+	Silent	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:7867597C>A	uc003jeb.2	-	2	737	c.600G>T	c.(598-600)CTG>CTT	p.L200L	FASTKD3_uc011cmp.1_Intron|FASTKD3_uc003jec.2_Intron|MTRR_uc010itn.1_5'Flank|MTRR_uc003jee.3_5'Flank|MTRR_uc003jed.2_5'Flank|MTRR_uc003jef.3_5'Flank|MTRR_uc003jeg.3_5'Flank|MTRR_uc010ito.2_5'Flank	NM_024091	NP_076996	Q14CZ7	FAKD3_HUMAN	FAST kinase domains 3	200					apoptosis|cellular respiration	mitochondrion	ATP binding|protein kinase activity			ovary(2)|breast(1)|pancreas(1)	4																		---	---	---	---
FAM105B	90268	broad.mit.edu	37	5	14693066	14693066	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:14693066C>A	uc003jfk.2	+	7	1120	c.968C>A	c.(967-969)CCA>CAA	p.P323Q		NM_138348	NP_612357	Q96BN8	F105B_HUMAN	hypothetical protein LOC90268	323										ovary(2)	2	Lung NSC(4;0.00696)																	---	---	---	---
ADAMTS12	81792	broad.mit.edu	37	5	33561157	33561157	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:33561157C>A	uc003jia.1	-	20	4263	c.4100G>T	c.(4099-4101)GGC>GTC	p.G1367V	ADAMTS12_uc010iuq.1_Missense_Mutation_p.G1282V	NM_030955	NP_112217	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1	1367					proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)	9															HNSCC(64;0.19)			---	---	---	---
HEATR7B2	133558	broad.mit.edu	37	5	41054930	41054930	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:41054930C>A	uc003jmj.3	-	11	1536	c.1046G>T	c.(1045-1047)AGG>ATG	p.R349M	HEATR7B2_uc003jmi.3_Intron	NM_173489	NP_775760	Q7Z745	HTRB2_HUMAN	HEAT repeat family member 7B2	349							binding			ovary(6)|central_nervous_system(2)	8																		---	---	---	---
ZNF366	167465	broad.mit.edu	37	5	71757157	71757157	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:71757157C>A	uc003kce.1	-	2	353	c.167G>T	c.(166-168)CGG>CTG	p.R56L		NM_152625	NP_689838	Q8N895	ZN366_HUMAN	zinc finger protein 366	56					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			central_nervous_system(1)|skin(1)	2		Lung NSC(167;0.0247)|Ovarian(174;0.0908)|Prostate(461;0.155)		OV - Ovarian serous cystadenocarcinoma(47;2.51e-53)														---	---	---	---
SPZ1	84654	broad.mit.edu	37	5	79616623	79616623	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:79616623C>A	uc003kgn.2	+	1	834	c.589C>A	c.(589-591)CAG>AAG	p.Q197K	uc011ctk.1_RNA	NM_032567	NP_115956	Q9BXG8	SPZ1_HUMAN	spermatogenic leucine zipper 1	197	Basic motif (By similarity).				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding			ovary(1)	1		Lung NSC(167;0.0393)|all_lung(232;0.0428)|Ovarian(174;0.113)		OV - Ovarian serous cystadenocarcinoma(54;3.43e-47)|Epithelial(54;2.25e-41)|all cancers(79;4.19e-36)														---	---	---	---
ZFYVE16	9765	broad.mit.edu	37	5	79769675	79769675	+	Silent	SNP	C	A	A	rs145745171	byFrequency	TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:79769675C>A	uc003kgr.3	+	17	4592	c.4290C>A	c.(4288-4290)ACC>ACA	p.T1430T	ZFYVE16_uc003kgq.3_Silent_p.T1430T|ZFYVE16_uc003kgs.3_Silent_p.T1430T|ZFYVE16_uc003kgt.3_Silent_p.T518T|ZFYVE16_uc003kgu.3_Silent_p.T182T	NM_001105251	NP_001098721	Q7Z3T8	ZFY16_HUMAN	zinc finger, FYVE domain containing 16	1430					BMP signaling pathway|endosome transport|protein targeting to lysosome|regulation of endocytosis|vesicle organization	early endosome membrane	1-phosphatidylinositol binding|metal ion binding|phosphatidylinositol-3,4,5-trisphosphate binding|protein binding|protein transporter activity				0		Lung NSC(167;0.00428)|all_lung(232;0.00455)|Ovarian(174;0.0261)		OV - Ovarian serous cystadenocarcinoma(54;1.6e-46)|Epithelial(54;2.02e-41)|all cancers(79;5.05e-36)														---	---	---	---
GPR98	84059	broad.mit.edu	37	5	89938526	89938526	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:89938526C>T	uc003kju.2	+	12	2410	c.2314C>T	c.(2314-2316)CCT>TCT	p.P772S	GPR98_uc003kjt.2_5'UTR	NM_032119	NP_115495	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98 precursor	772	Extracellular (Potential).				cell communication|cell-cell adhesion|maintenance of organ identity|neuropeptide signaling pathway|photoreceptor cell maintenance	cell surface|cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(11)|central_nervous_system(3)|pancreas(2)	16		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)														---	---	---	---
FAM13B	51306	broad.mit.edu	37	5	137289940	137289940	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137289940G>T	uc003lbz.2	-	14	2101	c.1567C>A	c.(1567-1569)CGC>AGC	p.R523S	FAM13B_uc003lcb.2_Missense_Mutation_p.R427S|FAM13B_uc003lca.2_Missense_Mutation_p.R523S	NM_016603	NP_057687	Q9NYF5	FA13B_HUMAN	hypothetical protein LOC51306 isoform 1	523					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity				0																		---	---	---	---
PCDHGA1	56114	broad.mit.edu	37	5	140712464	140712464	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140712464C>T	uc003lji.1	+	1	2213	c.2213C>T	c.(2212-2214)TCG>TTG	p.S738L	PCDHGA1_uc011dan.1_Missense_Mutation_p.S738L	NM_018912	NP_061735	Q9Y5H4	PCDG1_HUMAN	protocadherin gamma subfamily A, 1 isoform 1	738	Cytoplasmic (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(1)|breast(1)|pancreas(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)															---	---	---	---
PCDHGA3	56112	broad.mit.edu	37	5	140724252	140724252	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140724252G>T	uc003ljm.1	+	1	652	c.652G>T	c.(652-654)GGC>TGC	p.G218C	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc010jfx.1_5'UTR|PCDHGA3_uc011dap.1_Missense_Mutation_p.G218C	NM_018916	NP_061739	Q9Y5H0	PCDG3_HUMAN	protocadherin gamma subfamily A, 3 isoform 1	218	Extracellular (Potential).|Cadherin 2.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)															---	---	---	---
KIAA1191	57179	broad.mit.edu	37	5	175775365	175775365	+	Intron	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:175775365C>A	uc003mdw.2	-						KIAA1191_uc003mdx.2_Intron|KIAA1191_uc003mdy.2_Intron|KIAA1191_uc003mea.2_Intron|KIAA1191_uc003mdz.2_Intron	NM_020444	NP_065177			hypothetical protein LOC57179 isoform a								protein binding			ovary(1)	1	all_cancers(89;0.00575)|Renal(175;0.000269)|Lung NSC(126;0.0105)|all_lung(126;0.0168)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	Kidney(146;0.101)														---	---	---	---
GPRIN1	114787	broad.mit.edu	37	5	176026581	176026581	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176026581G>T	uc003meo.1	-	2	430	c.255C>A	c.(253-255)GAC>GAA	p.D85E		NM_052899	NP_443131	Q7Z2K8	GRIN1_HUMAN	G protein-regulated inducer of neurite outgrowth	85						growth cone|plasma membrane				ovary(2)	2	all_cancers(89;0.00263)|Renal(175;0.000269)|Lung NSC(126;0.00902)|all_lung(126;0.0142)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)															---	---	---	---
TAP2	6891	broad.mit.edu	37	6	32797282	32797282	+	Silent	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32797282C>A	uc003occ.2	-	10	1858	c.1827G>T	c.(1825-1827)GCG>GCT	p.A609A	TAP2_uc011dqf.1_Silent_p.A609A|TAP2_uc003ocb.1_Silent_p.A609A|TAP2_uc003ocd.2_Silent_p.A609A	NM_018833	NP_061313	Q03519	TAP2_HUMAN	transporter 2, ATP-binding cassette, sub-family	609	ABC transporter.|Cytoplasmic (Potential).				antigen processing and presentation of endogenous peptide antigen via MHC class I via ER pathway, TAP-dependent|antigen processing and presentation of endogenous peptide antigen via MHC class Ib via ER pathway, TAP-dependent|antigen processing and presentation of exogenous protein antigen via MHC class Ib, TAP-dependent|cytosol to ER transport|intracellular transport of viral proteins in host cell|peptide antigen transport|positive regulation of antigen processing and presentation of peptide antigen via MHC class I|positive regulation of T cell mediated cytotoxicity	nucleus|plasma membrane|TAP complex	ATP binding|MHC class I protein binding|oligopeptide-transporting ATPase activity|peptide antigen binding|peptide antigen-transporting ATPase activity|TAP1 binding|TAP2 binding|tapasin binding				0																		---	---	---	---
HLA-DPA1	3113	broad.mit.edu	37	6	33037072	33037072	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33037072G>T	uc003ocs.1	-	3	383	c.352C>A	c.(352-354)CCT>ACT	p.P118T	HLA-DPA1_uc010juk.2_Missense_Mutation_p.P118T|HLA-DPA1_uc003oct.1_Missense_Mutation_p.P118T	NM_033554	NP_291032	P20036	DPA1_HUMAN	major histocompatibility complex, class II, DP	118	Alpha-2.|Ig-like C1-type.|Extracellular (Potential).				antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|interferon-gamma-mediated signaling pathway|T cell costimulation|T cell receptor signaling pathway	endoplasmic reticulum membrane|endosome membrane|Golgi apparatus|integral to plasma membrane|lysosomal membrane|MHC class II protein complex	MHC class II receptor activity			skin(1)	1																		---	---	---	---
VPS52	6293	broad.mit.edu	37	6	33219410	33219410	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33219410C>A	uc003odm.1	-	19	2120	c.1910G>T	c.(1909-1911)CGG>CTG	p.R637L	VPS52_uc003odn.1_Missense_Mutation_p.R448L	NM_022553	NP_072047	Q8N1B4	VPS52_HUMAN	vacuolar protein sorting 52	637					protein transport	endosome membrane|Golgi apparatus				ovary(4)|skin(1)	5																		---	---	---	---
SPDEF	25803	broad.mit.edu	37	6	34508858	34508858	+	Silent	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:34508858C>A	uc003ojq.1	-	3	952	c.537G>T	c.(535-537)GCG>GCT	p.A179A	SPDEF_uc011dsq.1_Silent_p.A179A	NM_012391	NP_036523	O95238	SPDEF_HUMAN	SAM pointed domain containing ets transcription	179	PNT.				negative regulation of survival gene product expression|negative regulation of transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			skin(3)|ovary(1)|central_nervous_system(1)	5																		---	---	---	---
ANKS1A	23294	broad.mit.edu	37	6	35051202	35051202	+	Silent	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:35051202G>T	uc003ojx.3	+	20	3058	c.2916G>T	c.(2914-2916)ACG>ACT	p.T972T	ANKS1A_uc011dss.1_Intron|ANKS1A_uc011dst.1_Silent_p.T512T|ANKS1A_uc010jvp.1_Silent_p.T346T	NM_015245	NP_056060	Q92625	ANS1A_HUMAN	ankyrin repeat and sterile alpha motif domain	972	PID.					cytoplasm	protein binding			ovary(3)|upper_aerodigestive_tract(1)	4																		---	---	---	---
CAPN11	11131	broad.mit.edu	37	6	44148203	44148203	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:44148203G>T	uc003owt.1	+	15	1685	c.1647G>T	c.(1645-1647)TTG>TTT	p.L549F	CAPN11_uc011dvn.1_Missense_Mutation_p.L203F	NM_007058	NP_008989	Q9UMQ6	CAN11_HUMAN	calpain 11	549	Domain III.				proteolysis	acrosomal vesicle	calcium ion binding|calcium-dependent cysteine-type endopeptidase activity			ovary(1)|breast(1)	2	all_cancers(18;3.19e-06)|Lung NSC(15;0.00108)|all_lung(25;0.00278)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)															---	---	---	---
DST	667	broad.mit.edu	37	6	56380299	56380299	+	Silent	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:56380299G>T	uc003pdf.2	-	66	12196	c.12168C>A	c.(12166-12168)CCC>CCA	p.P4056P	DST_uc003pcz.3_Silent_p.P3878P|DST_uc011dxj.1_Silent_p.P3907P|DST_uc011dxk.1_Silent_p.P3918P|DST_uc003pcy.3_Silent_p.P3552P	NM_001144769	NP_001138241	Q03001	DYST_HUMAN	dystonin isoform 2	5964	Spectrin 11.				cell adhesion|cell cycle arrest|cell motility|hemidesmosome assembly|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization|maintenance of cell polarity|microtubule cytoskeleton organization|response to wounding	actin cytoskeleton|axon|axon part|basement membrane|cell cortex|cell leading edge|cytoplasmic membrane-bounded vesicle|endoplasmic reticulum membrane|hemidesmosome|hemidesmosome|integral to membrane|intermediate filament|intermediate filament cytoskeleton|microtubule cytoskeleton|microtubule plus end|nuclear envelope|sarcomere|Z disc	actin binding|calcium ion binding|integrin binding|microtubule plus-end binding|protein binding|protein C-terminus binding|protein homodimerization activity			ovary(7)|central_nervous_system(6)|upper_aerodigestive_tract(1)	14	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)															---	---	---	---
KCNQ5	56479	broad.mit.edu	37	6	73900332	73900332	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:73900332G>T	uc003pgk.2	+	12	1961	c.1614G>T	c.(1612-1614)AAG>AAT	p.K538N	KCNQ5_uc011dyh.1_Missense_Mutation_p.K557N|KCNQ5_uc011dyi.1_Missense_Mutation_p.K548N|KCNQ5_uc010kat.2_Missense_Mutation_p.K529N|KCNQ5_uc011dyj.1_Missense_Mutation_p.K428N|KCNQ5_uc011dyk.1_Missense_Mutation_p.K288N	NM_019842	NP_062816	Q9NR82	KCNQ5_HUMAN	potassium voltage-gated channel, KQT-like	538					protein complex assembly|synaptic transmission	voltage-gated potassium channel complex	inward rectifier potassium channel activity			ovary(4)|large_intestine(2)|skin(1)	7		all_epithelial(107;0.116)|Lung NSC(302;0.219)		COAD - Colon adenocarcinoma(1;0.0107)|Colorectal(1;0.0583)														---	---	---	---
C6orf174	387104	broad.mit.edu	37	6	127767833	127767833	+	3'UTR	SNP	G	T	T	rs112232003		TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:127767833G>T	uc003qbd.2	-	11					C6orf174_uc003qbc.2_Missense_Mutation_p.P544Q|C6orf174_uc003qba.2_Intron|C6orf174_uc003qbb.2_Missense_Mutation_p.P427Q|KIAA0408_uc011ebs.1_Missense_Mutation_p.P544Q	NM_001012279	NP_001012279			hypothetical protein LOC387104 precursor							integral to membrane				breast(3)|ovary(2)|skin(1)	6				GBM - Glioblastoma multiforme(226;0.026)|all cancers(137;0.161)														---	---	---	---
NUP43	348995	broad.mit.edu	37	6	150067563	150067563	+	Silent	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:150067563C>A	uc003qmz.2	-	1	126	c.69G>T	c.(67-69)CCG>CCT	p.P23P	NUP43_uc011eee.1_RNA|NUP43_uc011eef.1_Silent_p.P23P	NM_198887	NP_942590	Q8NFH3	NUP43_HUMAN	nucleoporin 43kDa	23	WD 1.				carbohydrate metabolic process|cell division|chromosome segregation|glucose transport|mitotic prometaphase|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	condensed chromosome kinetochore|cytosol|Nup107-160 complex	protein binding			upper_aerodigestive_tract(1)	1		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;4.71e-13)|GBM - Glioblastoma multiforme(68;0.101)												OREG0017720	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
MAD1L1	8379	broad.mit.edu	37	7	2054198	2054198	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2054198C>A	uc003slh.1	-	13	1564	c.1298G>T	c.(1297-1299)CGG>CTG	p.R433L	MAD1L1_uc003sle.1_Missense_Mutation_p.R162L|MAD1L1_uc003slf.1_Missense_Mutation_p.R433L|MAD1L1_uc003slg.1_Missense_Mutation_p.R433L|MAD1L1_uc010ksh.1_Missense_Mutation_p.R433L|MAD1L1_uc003sli.1_Missense_Mutation_p.R341L|MAD1L1_uc010ksi.1_Missense_Mutation_p.R386L|MAD1L1_uc010ksj.2_Missense_Mutation_p.R433L	NM_001013836	NP_001013858	Q9Y6D9	MD1L1_HUMAN	MAD1-like 1 protein	433	Necessary for interaction with NEK2.|Potential.				cell division|mitotic anaphase|mitotic cell cycle spindle assembly checkpoint|mitotic metaphase|mitotic prometaphase|mitotic telophase	actin cytoskeleton|centrosome|condensed chromosome kinetochore|cytosol|mitochondrion|nucleus|spindle	protein binding			lung(1)|central_nervous_system(1)	2		Ovarian(82;0.0272)		UCEC - Uterine corpus endometrioid carcinoma (27;0.134)|OV - Ovarian serous cystadenocarcinoma(56;3.63e-14)														---	---	---	---
C7orf31	136895	broad.mit.edu	37	7	25176248	25176248	+	Silent	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:25176248G>T	uc003sxn.1	-	10	1677	c.1116C>A	c.(1114-1116)CCC>CCA	p.P372P	C7orf31_uc003sxm.1_Silent_p.P214P	NM_138811	NP_620166	Q8N865	CG031_HUMAN	hypothetical protein LOC136895	372											0																		---	---	---	---
CDK14	5218	broad.mit.edu	37	7	90747439	90747439	+	Missense_Mutation	SNP	C	T	T	rs145303395		TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:90747439C>T	uc003uky.2	+	14	1576	c.1354C>T	c.(1354-1356)CGG>TGG	p.R452W	CDK14_uc003ukz.1_Missense_Mutation_p.R434W|CDK14_uc010les.1_Missense_Mutation_p.R406W|CDK14_uc011khl.1_Missense_Mutation_p.R323W	NM_012395	NP_036527	O94921	CDK14_HUMAN	PFTAIRE protein kinase 1	452					cell division|G2/M transition of mitotic cell cycle|regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	cytoplasmic cyclin-dependent protein kinase holoenzyme complex|nucleus|plasma membrane	ATP binding|cyclin binding|cyclin-dependent protein kinase activity			lung(3)|ovary(1)	4																		---	---	---	---
OR2AE1	81392	broad.mit.edu	37	7	99474142	99474142	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99474142C>A	uc003usc.1	-	1	515	c.515G>T	c.(514-516)CGG>CTG	p.R172L		NM_001005276	NP_001005276	Q8NHA4	O2AE1_HUMAN	olfactory receptor, family 2, subfamily AE,	172	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	Esophageal squamous(72;0.0166)|Lung NSC(181;0.0211)|all_lung(186;0.0323)																	---	---	---	---
ZNF277	11179	broad.mit.edu	37	7	111977891	111977891	+	Intron	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:111977891C>A	uc003vge.2	+						ZNF277_uc003vgf.2_Intron|ZNF277_uc003vgg.2_Intron	NM_021994	NP_068834			zinc finger protein (C2H2 type) 277							nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)|breast(2)	4																		---	---	---	---
TMEM140	55281	broad.mit.edu	37	7	134849551	134849551	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:134849551C>A	uc003vsi.2	+	2	639	c.358C>A	c.(358-360)CTG>ATG	p.L120M	C7orf49_uc003vsh.2_Intron	NM_018295	NP_060765	Q9NV12	TM140_HUMAN	transmembrane protein 140	120	Helical; (Potential).					integral to membrane				large_intestine(1)	1																		---	---	---	---
KIAA1549	57670	broad.mit.edu	37	7	138583725	138583725	+	Silent	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:138583725G>T	uc011kql.1	-	9	3872	c.3823C>A	c.(3823-3825)CGA>AGA	p.R1275R	KIAA1549_uc011kqi.1_Silent_p.R59R|KIAA1549_uc003vuk.3_Silent_p.R1225R|KIAA1549_uc011kqj.1_Silent_p.R1275R|KIAA1549_uc011kqk.1_Silent_p.R59R	NM_020910	NP_065961	Q9HCM3	K1549_HUMAN	hypothetical protein LOC57670 isoform 1	1275						integral to membrane			KIAA1549/BRAF(229)	central_nervous_system(229)|pancreas(1)	230								O	BRAF	pilocytic astrocytoma								---	---	---	---
PTK2B	2185	broad.mit.edu	37	8	27291644	27291644	+	Silent	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:27291644C>A	uc003xfn.1	+	17	1948	c.1140C>A	c.(1138-1140)CCC>CCA	p.P380P	PTK2B_uc003xfo.1_Silent_p.P380P|PTK2B_uc003xfp.1_Silent_p.P380P|PTK2B_uc003xfq.1_Silent_p.P380P|PTK2B_uc010luq.1_Silent_p.P138P|PTK2B_uc003xfr.1_Silent_p.P126P	NM_173174	NP_775266	Q14289	FAK2_HUMAN	PTK2B protein tyrosine kinase 2 beta isoform a	380					apoptosis|bone resorption|positive regulation of cell proliferation|signal complex assembly	cytosol	ATP binding|non-membrane spanning protein tyrosine kinase activity|signal transducer activity			lung(3)|ovary(1)|skin(1)	5		Ovarian(32;2.72e-05)		UCEC - Uterine corpus endometrioid carcinoma (27;0.023)|Epithelial(17;6.61e-10)|BRCA - Breast invasive adenocarcinoma(99;0.226)|Colorectal(74;0.229)														---	---	---	---
C8orf80	389643	broad.mit.edu	37	8	27925065	27925065	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:27925065G>T	uc003xgm.3	-	6	820	c.677C>A	c.(676-678)CCC>CAC	p.P226H		NM_001010906	NP_001010906	Q68CJ6	SLIP_HUMAN	speckled-like pattern in the germinal center	226						nucleus	GTP binding|GTPase activity			ovary(1)|central_nervous_system(1)	2		Ovarian(32;0.0218)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0228)|KIRC - Kidney renal clear cell carcinoma(542;0.126)|Kidney(114;0.15)|Colorectal(74;0.181)														---	---	---	---
DDHD2	23259	broad.mit.edu	37	8	38109430	38109430	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38109430G>T	uc003xlb.2	+	12	1722	c.1345G>T	c.(1345-1347)GGT>TGT	p.G449C	DDHD2_uc003xlc.2_Missense_Mutation_p.G449C|DDHD2_uc003xld.2_Missense_Mutation_p.G68C	NM_015214	NP_056029	O94830	DDHD2_HUMAN	DDHD domain containing 2 isoform 1	449					lipid catabolic process	centrosome	hydrolase activity|metal ion binding			large_intestine(1)|ovary(1)	2	Colorectal(12;0.000442)	all_lung(54;0.0657)|Lung NSC(58;0.175)	BRCA - Breast invasive adenocarcinoma(5;3.76e-25)|COAD - Colon adenocarcinoma(9;0.0977)															---	---	---	---
FAM110B	90362	broad.mit.edu	37	8	59059521	59059521	+	Silent	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:59059521G>T	uc003xtj.1	+	5	1612	c.732G>T	c.(730-732)GTG>GTT	p.V244V		NM_147189	NP_671722	Q8TC76	F110B_HUMAN	hypothetical protein LOC90362	244						microtubule organizing center|mitochondrion|nucleus				large_intestine(1)	1		all_epithelial(80;0.025)|all_lung(136;0.0274)|Lung NSC(129;0.0355)																---	---	---	---
KCNS2	3788	broad.mit.edu	37	8	99440792	99440792	+	Silent	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:99440792G>T	uc003yin.2	+	2	935	c.585G>T	c.(583-585)CTG>CTT	p.L195L		NM_020697	NP_065748	Q9ULS6	KCNS2_HUMAN	potassium voltage-gated channel,	195	Helical; Name=Segment S1; (Potential).					voltage-gated potassium channel complex	voltage-gated potassium channel activity			ovary(1)	1	Breast(36;2.4e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.0448)															---	---	---	---
TG	7038	broad.mit.edu	37	8	133900554	133900554	+	Silent	SNP	G	A	A	rs138731686		TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:133900554G>A	uc003ytw.2	+	10	2543	c.2502G>A	c.(2500-2502)CCG>CCA	p.P834P		NM_003235	NP_003226	P01266	THYG_HUMAN	thyroglobulin precursor	834	Thyroglobulin type-1 7.				hormone biosynthetic process|signal transduction|thyroid gland development|thyroid hormone generation	extracellular space	hormone activity			ovary(8)|breast(4)|pancreas(1)|central_nervous_system(1)|skin(1)	15	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)														---	---	---	---
EIF2C2	27161	broad.mit.edu	37	8	141549487	141549487	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:141549487C>A	uc003yvn.2	-	16	2141	c.2101G>T	c.(2101-2103)GGG>TGG	p.G701W	EIF2C2_uc010men.2_Missense_Mutation_p.G624W|EIF2C2_uc010meo.2_Missense_Mutation_p.G701W	NM_012154	NP_036286	Q9UKV8	AGO2_HUMAN	argonaute 2 isoform 1	701	Piwi.				mRNA cleavage involved in gene silencing by miRNA|negative regulation of translation involved in gene silencing by miRNA|negative regulation of translational initiation|pre-miRNA processing|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasmic mRNA processing body|cytosol|micro-ribonucleoprotein complex|mRNA cap binding complex|nucleus|polysome|RNA-induced silencing complex	endoribonuclease activity, cleaving siRNA-paired mRNA|metal ion binding|protein binding|RNA 7-methylguanosine cap binding|siRNA binding|translation initiation factor activity				0	all_cancers(97;2.54e-14)|all_epithelial(106;5.99e-13)|Lung NSC(106;1.45e-05)|all_lung(105;2.07e-05)|Ovarian(258;0.0154)|Acute lymphoblastic leukemia(118;0.155)	Breast(495;0.159)	BRCA - Breast invasive adenocarcinoma(115;0.158)															---	---	---	---
ADAMTSL1	92949	broad.mit.edu	37	9	18706968	18706968	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:18706968G>T	uc003zne.3	+	14	1925	c.1798G>T	c.(1798-1800)GGT>TGT	p.G600C		NM_001040272	NP_001035362	Q8N6G6	ATL1_HUMAN	ADAMTS-like 1 isoform 4 precursor	600						proteinaceous extracellular matrix	metallopeptidase activity|zinc ion binding			ovary(3)|upper_aerodigestive_tract(1)|lung(1)	5				GBM - Glioblastoma multiforme(50;1.29e-17)														---	---	---	---
DNAJB5	25822	broad.mit.edu	37	9	34996681	34996681	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:34996681C>A	uc003zvt.2	+	3	769	c.631C>A	c.(631-633)CTG>ATG	p.L211M	DNAJB5_uc003zvs.2_Missense_Mutation_p.L245M|DNAJB5_uc011los.1_Missense_Mutation_p.L283M	NM_012266	NP_036398	O75953	DNJB5_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 5	211					protein folding|response to unfolded protein		heat shock protein binding|unfolded protein binding				0			LUSC - Lung squamous cell carcinoma(32;0.00575)															---	---	---	---
FRMPD1	22844	broad.mit.edu	37	9	37740876	37740876	+	Missense_Mutation	SNP	C	A	A	rs144670594		TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:37740876C>A	uc004aag.1	+	15	2395	c.2351C>A	c.(2350-2352)CCG>CAG	p.P784Q	FRMPD1_uc004aah.1_Missense_Mutation_p.P784Q|FRMPD1_uc011lqm.1_Missense_Mutation_p.P606Q|FRMPD1_uc011lqn.1_Missense_Mutation_p.P653Q	NM_014907	NP_055722	Q5SYB0	FRPD1_HUMAN	FERM and PDZ domain containing 1	784						cytoskeleton|cytosol|plasma membrane				ovary(4)|central_nervous_system(2)|skin(2)|breast(1)	9				GBM - Glioblastoma multiforme(29;0.00655)														---	---	---	---
MAMDC2	256691	broad.mit.edu	37	9	72785504	72785504	+	Silent	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:72785504C>A	uc004ahm.2	+	11	2225	c.1608C>A	c.(1606-1608)CCC>CCA	p.P536P	MAMDC2_uc004ahn.2_RNA|uc004aho.1_Intron|uc004ahp.1_RNA	NM_153267	NP_694999	Q7Z304	MAMC2_HUMAN	MAM domain containing 2 precursor	536	MAM 4.					endoplasmic reticulum|membrane				central_nervous_system(1)|pancreas(1)	2																		---	---	---	---
TRIM14	9830	broad.mit.edu	37	9	100857266	100857266	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:100857266C>A	uc004ayd.2	-	4	601	c.583G>T	c.(583-585)GGG>TGG	p.G195W	TRIM14_uc004ayf.1_Missense_Mutation_p.G102W|TRIM14_uc011luz.1_5'Flank|TRIM14_uc011lva.1_5'Flank|TRIM14_uc004ayg.1_Missense_Mutation_p.G195W|TRIM14_uc004ayh.1_Missense_Mutation_p.G195W|TRIM14_uc004ayi.1_Missense_Mutation_p.G195W|TRIM14_uc004ayj.1_Missense_Mutation_p.G102W	NM_033220	NP_150089	Q14142	TRI14_HUMAN	tripartite motif protein TRIM14 isoform alpha	195						cytoplasm|intracellular	zinc ion binding			central_nervous_system(1)	1		Acute lymphoblastic leukemia(62;0.0559)																---	---	---	---
TNC	3371	broad.mit.edu	37	9	117808831	117808831	+	Silent	SNP	A	C	C			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:117808831A>C	uc004bjj.3	-	17	5345	c.4983T>G	c.(4981-4983)TCT>TCG	p.S1661S	TNC_uc010mvf.2_Intron	NM_002160	NP_002151	P24821	TENA_HUMAN	tenascin C precursor	1661	Fibronectin type-III 12.				cell adhesion|response to wounding|signal transduction	extracellular space	receptor binding|syndecan binding			central_nervous_system(4)|upper_aerodigestive_tract(1)|ovary(1)|skin(1)	7																		---	---	---	---
LRRC8A	56262	broad.mit.edu	37	9	131671599	131671599	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131671599G>T	uc004bwl.3	+	3	2410	c.2156G>T	c.(2155-2157)CGG>CTG	p.R719L	LRRC8A_uc010myp.2_Missense_Mutation_p.R719L|LRRC8A_uc010myq.2_Missense_Mutation_p.R719L	NM_019594	NP_062540	Q8IWT6	LRC8A_HUMAN	leucine rich repeat containing 8 family, member	719	LRR 15.				pre-B cell differentiation	integral to membrane					0																		---	---	---	---
MTPAP	55149	broad.mit.edu	37	10	30615481	30615481	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:30615481T>G	uc001iva.3	-	5	927	c.864A>C	c.(862-864)TTA>TTC	p.L288F	MTPAP_uc001ivb.3_Missense_Mutation_p.L418F	NM_018109	NP_060579	Q9NVV4	PAPD1_HUMAN	PAP associated domain containing 1 precursor	288					cell death|histone mRNA catabolic process|mRNA polyadenylation|transcription, DNA-dependent	mitochondrion	ATP binding|magnesium ion binding|manganese ion binding|polynucleotide adenylyltransferase activity|protein homodimerization activity|RNA binding|UTP binding			ovary(1)	1																		---	---	---	---
RTKN2	219790	broad.mit.edu	37	10	63957802	63957802	+	Silent	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:63957802G>T	uc001jlw.2	-	12	1792	c.1695C>A	c.(1693-1695)GCC>GCA	p.A565A	RTKN2_uc009xpf.1_Intron|RTKN2_uc001jlv.2_Silent_p.A219A	NM_145307	NP_660350	Q8IZC4	RTKN2_HUMAN	rhotekin 2	565					signal transduction	intracellular					0	Prostate(12;0.0297)|all_hematologic(501;0.215)																	---	---	---	---
CCAR1	55749	broad.mit.edu	37	10	70514470	70514470	+	Splice_Site	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:70514470G>T	uc001joo.2	+	12	1464	c.1345_splice	c.e12-1	p.V449_splice	CCAR1_uc001jol.1_Splice_Site|CCAR1_uc001jom.1_Splice_Site_p.V254_splice|CCAR1_uc009xpx.1_Splice_Site_p.V423_splice|CCAR1_uc001jon.1_Splice_Site_p.V395_splice|CCAR1_uc010qiz.1_Splice_Site_p.V434_splice|CCAR1_uc010qja.1_Splice_Site_p.V434_splice|CCAR1_uc010qjb.1_Splice_Site|SNORD98_uc001jop.1_5'Flank	NM_018237	NP_060707			cell-cycle and apoptosis regulatory protein 1						apoptosis|cell cycle|nuclear mRNA splicing, via spliceosome|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleoplasm|perinuclear region of cytoplasm	calcium ion binding|nucleic acid binding|protein binding			ovary(6)|large_intestine(1)	7																		---	---	---	---
ADAMTS14	140766	broad.mit.edu	37	10	72492004	72492004	+	Intron	SNP	C	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:72492004C>T	uc001jrh.2	+						ADAMTS14_uc001jrg.2_Intron|ADAMTS14_uc001jri.1_5'Flank	NM_080722	NP_542453			ADAM metallopeptidase with thrombospondin type 1						collagen catabolic process|proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(5)|upper_aerodigestive_tract(1)	6																		---	---	---	---
SLIT1	6585	broad.mit.edu	37	10	98764541	98764541	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:98764541C>A	uc001kmw.2	-	33	3871	c.3619G>T	c.(3619-3621)GGG>TGG	p.G1207W		NM_003061	NP_003052	O75093	SLIT1_HUMAN	slit homolog 1 precursor	1207	Laminin G-like.				axon extension involved in axon guidance|forebrain morphogenesis|motor axon guidance|negative chemotaxis|negative regulation of synaptogenesis	cytoplasm|extracellular space	calcium ion binding|Roundabout binding			ovary(4)	4		Colorectal(252;0.162)		Epithelial(162;2.02e-08)|all cancers(201;1.5e-06)														---	---	---	---
CPN1	1369	broad.mit.edu	37	10	101829528	101829528	+	Silent	SNP	G	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:101829528G>A	uc001kql.2	-	3	779	c.519C>T	c.(517-519)AAC>AAT	p.N173N		NM_001308	NP_001299	P15169	CBPN_HUMAN	carboxypeptidase N, polypeptide 1 precursor	173	Catalytic.				proteolysis	extracellular space	metallocarboxypeptidase activity|zinc ion binding			central_nervous_system(3)|pancreas(1)	4		Colorectal(252;0.234)		Epithelial(162;4.77e-10)|all cancers(201;3.82e-08)														---	---	---	---
CHUK	1147	broad.mit.edu	37	10	101980440	101980440	+	Intron	SNP	A	G	G			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:101980440A>G	uc001kqp.2	-							NM_001278	NP_001269			conserved helix-loop-helix ubiquitous kinase						I-kappaB phosphorylation|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	CD40 receptor complex|cytosol|internal side of plasma membrane|nucleus	ATP binding|identical protein binding|IkappaB kinase activity			ovary(2)|central_nervous_system(2)|large_intestine(1)|lung(1)|breast(1)	7		Colorectal(252;0.117)		Epithelial(162;2.05e-10)|all cancers(201;1.91e-08)														---	---	---	---
TECTB	6975	broad.mit.edu	37	10	114045879	114045879	+	Silent	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:114045879C>A	uc001kzr.1	+	3	318	c.318C>A	c.(316-318)ACC>ACA	p.T106T		NM_058222	NP_478129	Q96PL2	TECTB_HUMAN	tectorin beta precursor	106	ZP.					anchored to membrane|plasma membrane|proteinaceous extracellular matrix					0		Colorectal(252;0.198)		Epithelial(162;0.0143)|all cancers(201;0.0242)														---	---	---	---
NRAP	4892	broad.mit.edu	37	10	115389485	115389485	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:115389485C>A	uc001laj.2	-	19	2066	c.1902G>T	c.(1900-1902)ATG>ATT	p.M634I	NRAP_uc009xyb.2_5'Flank|NRAP_uc001lak.2_Missense_Mutation_p.M599I|NRAP_uc001lal.3_Missense_Mutation_p.M634I	NM_198060	NP_932326	Q86VF7	NRAP_HUMAN	nebulin-related anchoring protein isoform S	634	Nebulin 15.					fascia adherens|muscle tendon junction	actin binding|muscle alpha-actinin binding|zinc ion binding			ovary(6)|central_nervous_system(3)|upper_aerodigestive_tract(1)	10		Colorectal(252;0.0233)|Breast(234;0.188)		Epithelial(162;0.00392)|all cancers(201;0.00569)														---	---	---	---
NRAP	4892	broad.mit.edu	37	10	115409896	115409896	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:115409896C>A	uc001laj.2	-	9	952	c.788G>T	c.(787-789)AGG>ATG	p.R263M	NRAP_uc001lak.2_Missense_Mutation_p.R263M|NRAP_uc001lal.3_Missense_Mutation_p.R263M	NM_198060	NP_932326	Q86VF7	NRAP_HUMAN	nebulin-related anchoring protein isoform S	263	Nebulin 5.					fascia adherens|muscle tendon junction	actin binding|muscle alpha-actinin binding|zinc ion binding			ovary(6)|central_nervous_system(3)|upper_aerodigestive_tract(1)	10		Colorectal(252;0.0233)|Breast(234;0.188)		Epithelial(162;0.00392)|all cancers(201;0.00569)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	134671135	134671135	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134671135C>A	uc010qux.1	-	31	4711	c.4711G>T	c.(4711-4713)GGG>TGG	p.G1571W		NM_017609	NP_060079			Homo sapiens cDNA, FLJ17989.																														---	---	---	---
CDHR5	53841	broad.mit.edu	37	11	619492	619492	+	Silent	SNP	C	A	A	rs61732112	byFrequency;by1000genomes	TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:619492C>A	uc001lqj.2	-	11	1380	c.1275G>T	c.(1273-1275)GCG>GCT	p.A425A	CDHR5_uc001lqk.2_Silent_p.A425A|CDHR5_uc009ycc.2_Silent_p.A259A|CDHR5_uc009ycd.2_Silent_p.A425A|CDHR5_uc001lql.2_Silent_p.A425A|CDHR5_uc001lqm.2_Silent_p.A259A|CDHR5_uc009yce.1_Silent_p.A394A	NM_021924	NP_068743	Q9HBB8	CDHR5_HUMAN	mucin and cadherin-like isoform 1	425	Cadherin 4.|Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0																		---	---	---	---
TALDO1	6888	broad.mit.edu	37	11	755949	755949	+	Silent	SNP	C	A	A	rs2234021		TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:755949C>A	uc001lqz.2	+	2	218	c.168C>A	c.(166-168)CCC>CCA	p.P56P	TALDO1_uc010qwl.1_Silent_p.P56P|TALDO1_uc001lra.2_Silent_p.P56P	NM_006755	NP_006746	P37837	TALDO_HUMAN	transaldolase 1	56					energy reserve metabolic process|xylulose biosynthetic process	cytosol	protein binding|sedoheptulose-7-phosphate:D-glyceraldehyde-3-phosphate glyceronetransferase activity				0		all_cancers(49;1.13e-08)|all_epithelial(84;2.95e-05)|Breast(177;0.000286)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.159)|all_lung(207;0.198)		all cancers(45;4.66e-26)|Epithelial(43;2.97e-25)|OV - Ovarian serous cystadenocarcinoma(40;1.48e-19)|BRCA - Breast invasive adenocarcinoma(625;4.41e-05)|Lung(200;0.0595)|LUSC - Lung squamous cell carcinoma(625;0.0712)														---	---	---	---
AMPD3	272	broad.mit.edu	37	11	10500274	10500274	+	Silent	SNP	C	A	A	rs117002871	by1000genomes	TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:10500274C>A	uc001mio.1	+	3	758	c.423C>A	c.(421-423)GCC>GCA	p.A141A	AMPD3_uc010rbz.1_Intron|AMPD3_uc001min.1_Silent_p.A150A|AMPD3_uc009yfw.1_RNA|AMPD3_uc009yfx.1_Silent_p.A141A|AMPD3_uc009yfz.2_RNA|AMPD3_uc001mip.1_Silent_p.A148A|AMPD3_uc009yfy.2_Silent_p.A141A	NM_001025389	NP_001020560	Q01432	AMPD3_HUMAN	adenosine monophosphate deaminase 3 isoform 1B	141					AMP catabolic process|purine base metabolic process|purine ribonucleoside monophosphate biosynthetic process|purine-containing compound salvage	cytosol	AMP deaminase activity|metal ion binding			large_intestine(1)|ovary(1)	2				all cancers(16;1.14e-08)|Epithelial(150;2.83e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0291)														---	---	---	---
PDE3B	5140	broad.mit.edu	37	11	14840755	14840755	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:14840755G>T	uc001mln.2	+	7	2160	c.1807G>T	c.(1807-1809)GGT>TGT	p.G603C	PDE3B_uc010rcr.1_Missense_Mutation_p.G552C	NM_000922	NP_000913	Q13370	PDE3B_HUMAN	phosphodiesterase 3B	603					cAMP catabolic process|insulin receptor signaling pathway|negative regulation of lipid catabolic process|platelet activation	cytosol|endoplasmic reticulum|Golgi apparatus|guanyl-nucleotide exchange factor complex|integral to membrane|microsome	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity|metal ion binding|protein kinase B binding				0																		---	---	---	---
SOX6	55553	broad.mit.edu	37	11	16036526	16036526	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:16036526G>T	uc001mme.2	-	13	1766	c.1733C>A	c.(1732-1734)CCA>CAA	p.P578Q	SOX6_uc001mmd.2_Missense_Mutation_p.P541Q|SOX6_uc001mmf.2_Missense_Mutation_p.P538Q|SOX6_uc001mmg.2_Missense_Mutation_p.P565Q	NM_001145819	NP_001139291	P35712	SOX6_HUMAN	SRY (sex determining region Y)-box 6 isoform 4	565					muscle organ development	nucleus	sequence-specific DNA binding transcription factor activity			ovary(3)	3																		---	---	---	---
LRRC4C	57689	broad.mit.edu	37	11	40137715	40137715	+	Missense_Mutation	SNP	C	A	A	rs141998335		TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:40137715C>A	uc001mxa.1	-	2	2092	c.128G>T	c.(127-129)CGG>CTG	p.R43L	LRRC4C_uc001mxc.1_Missense_Mutation_p.R39L|LRRC4C_uc001mxd.1_Missense_Mutation_p.R39L|LRRC4C_uc001mxb.1_Missense_Mutation_p.R39L	NM_020929	NP_065980	Q9HCJ2	LRC4C_HUMAN	netrin-G1 ligand precursor	43					regulation of axonogenesis	integral to membrane	protein binding			ovary(4)|skin(3)|central_nervous_system(1)	8		all_lung(304;0.0575)|Lung NSC(402;0.138)																---	---	---	---
ALX4	60529	broad.mit.edu	37	11	44296944	44296944	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:44296944C>A	uc001myb.2	-	2	835	c.731G>T	c.(730-732)CGG>CTG	p.R244L		NM_021926	NP_068745	Q9H161	ALX4_HUMAN	aristaless-like homeobox 4	244	Homeobox.				hair follicle development						0																		---	---	---	---
F2	2147	broad.mit.edu	37	11	46748166	46748166	+	Silent	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:46748166G>T	uc001ndf.3	+	8	1036	c.993G>T	c.(991-993)TCG>TCT	p.S331S	F2_uc001ndg.3_RNA	NM_000506	NP_000497	P00734	THRB_HUMAN	coagulation factor II preproprotein	331					activation of caspase activity|acute-phase response|blood coagulation, intrinsic pathway|cell surface receptor linked signaling pathway|cytosolic calcium ion homeostasis|fibrinolysis|leukocyte migration|negative regulation of astrocyte differentiation|negative regulation of fibrinolysis|negative regulation of platelet activation|negative regulation of proteolysis|peptidyl-glutamic acid carboxylation|platelet activation|positive regulation of collagen biosynthetic process|positive regulation of protein phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of release of sequestered calcium ion into cytosol|post-translational protein modification|proteolysis|STAT protein import into nucleus|tyrosine phosphorylation of STAT protein	cytosol|endoplasmic reticulum lumen|extracellular space|Golgi lumen|plasma membrane|soluble fraction	calcium ion binding|growth factor activity|serine-type endopeptidase activity|thrombospondin receptor activity			ovary(3)	3		all_lung(304;0.000414)|Lung NSC(402;0.0011)		BRCA - Breast invasive adenocarcinoma(625;0.146)	Antihemophilic Factor(DB00025)|Argatroban(DB00278)|Bivalirudin(DB00006)|Coagulation Factor IX(DB00100)|Drotrecogin alfa(DB00055)|Enoxaparin(DB01225)|Heparin(DB01109)|Lepirudin(DB00001)|Menadione(DB00170)|Proflavine(DB01123)|Simvastatin(DB00641)|Suramin(DB04786)|Warfarin(DB00682)|Ximelagatran(DB04898)													---	---	---	---
CKAP5	9793	broad.mit.edu	37	11	46799806	46799806	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:46799806C>A	uc001ndi.1	-	22	2741	c.2631G>T	c.(2629-2631)AGG>AGT	p.R877S	CKAP5_uc009ylg.1_Missense_Mutation_p.R763S|CKAP5_uc001ndj.1_Missense_Mutation_p.R877S	NM_001008938	NP_001008938	Q14008	CKAP5_HUMAN	colonic and hepatic tumor over-expressed protein	877	HEAT 5.				cell division|centrosome organization|establishment or maintenance of microtubule cytoskeleton polarity|G2/M transition of mitotic cell cycle|mitotic prometaphase|RNA transport|spindle organization	centrosome|cytosol	protein binding|protein binding			ovary(1)|skin(1)	2																		---	---	---	---
MS4A7	58475	broad.mit.edu	37	11	60161301	60161301	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60161301G>T	uc001npe.2	+	7	835	c.690G>T	c.(688-690)CAG>CAT	p.Q230H	MS4A7_uc001npf.2_Missense_Mutation_p.Q230H|MS4A7_uc001npg.2_Missense_Mutation_p.Q185H|MS4A7_uc001nph.2_Missense_Mutation_p.Q185H|MS4A14_uc001npi.2_Intron	NM_206939	NP_996822	Q9GZW8	MS4A7_HUMAN	membrane-spanning 4-domains, subfamily A, member	230	Cytoplasmic (Potential).					integral to membrane	receptor activity			ovary(1)|central_nervous_system(1)	2																		---	---	---	---
VWCE	220001	broad.mit.edu	37	11	61053823	61053823	+	Silent	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61053823C>A	uc001nra.2	-	5	783	c.504G>T	c.(502-504)CCG>CCT	p.P168P	VWCE_uc001nrb.2_RNA	NM_152718	NP_689931	Q96DN2	VWCE_HUMAN	von Willebrand factor C and EGF domains	168	EGF-like 2; calcium-binding (Potential).					extracellular region	calcium ion binding			ovary(1)	1																		---	---	---	---
FERMT3	83706	broad.mit.edu	37	11	63988607	63988607	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:63988607G>T	uc001nyl.2	+	13	1826	c.1677G>T	c.(1675-1677)ATG>ATT	p.M559I	FERMT3_uc001nym.2_Missense_Mutation_p.M555I	NM_178443	NP_848537	Q86UX7	URP2_HUMAN	fermitin family homolog 3 long form	559					integrin activation|leukocyte cell-cell adhesion|platelet aggregation|regulation of cell-cell adhesion mediated by integrin	cell junction|cell projection|podosome	integrin binding			ovary(1)	1																		---	---	---	---
NUDT22	84304	broad.mit.edu	37	11	63997452	63997452	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:63997452C>A	uc001nyp.3	+	6	1082	c.902C>A	c.(901-903)CCG>CAG	p.P301Q	NUDT22_uc009ype.2_Missense_Mutation_p.P301Q|NUDT22_uc001nyq.3_Missense_Mutation_p.P268Q|NUDT22_uc010rng.1_RNA|uc001nyr.1_3'UTR|DNAJC4_uc001nys.2_5'Flank|DNAJC4_uc001nyt.2_5'Flank|DNAJC4_uc001nyu.2_5'Flank	NM_032344	NP_115720	Q9BRQ3	NUD22_HUMAN	nudix (nucleoside diphosphate linked moiety	301							hydrolase activity				0																		---	---	---	---
C11orf2	738	broad.mit.edu	37	11	64876935	64876935	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64876935C>A	uc001ocr.1	+	6	1667	c.1627C>A	c.(1627-1629)CTC>ATC	p.L543I	TM7SF2_uc001oct.2_5'Flank|TM7SF2_uc010rny.1_5'Flank|TM7SF2_uc001ocu.2_5'Flank|TM7SF2_uc001ocv.2_5'Flank|C11orf2_uc001ocs.1_Missense_Mutation_p.L419I	NM_013265	NP_037397	Q9UID3	FFR_HUMAN	chromosome 11 open reading frame 2	543					lipid transport|protein transport	Golgi apparatus|integral to membrane					0																		---	---	---	---
XRRA1	143570	broad.mit.edu	37	11	74556172	74556172	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:74556172C>A	uc009yub.2	-	16	2181	c.1849G>T	c.(1849-1851)GGC>TGC	p.G617C	XRRA1_uc001ovm.2_RNA|XRRA1_uc001ovn.2_Missense_Mutation_p.G240C|XRRA1_uc001ovo.2_Missense_Mutation_p.G225C|XRRA1_uc001ovq.3_Missense_Mutation_p.G530C|XRRA1_uc001ovp.3_Missense_Mutation_p.G342C|XRRA1_uc001ovr.2_Missense_Mutation_p.G240C|XRRA1_uc001ovs.1_Missense_Mutation_p.G219C	NM_182969	NP_892014	Q6P2D8	XRRA1_HUMAN	X-ray radiation resistance associated 1	617					response to X-ray	cytoplasm|nucleus				central_nervous_system(1)	1																		---	---	---	---
PRCP	5547	broad.mit.edu	37	11	82536019	82536019	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:82536019G>T	uc001ozs.2	-	9	1533	c.1420C>A	c.(1420-1422)CGC>AGC	p.R474S	PRCP_uc001ozr.2_Missense_Mutation_p.R495S	NM_005040	NP_005031	P42785	PCP_HUMAN	prolylcarboxypeptidase isoform 1 preproprotein	474					blood coagulation, intrinsic pathway|proteolysis	lysosome|plasma membrane	protein binding|serine-type carboxypeptidase activity			skin(1)	1																		---	---	---	---
PRCP	5547	broad.mit.edu	37	11	82536114	82536114	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:82536114G>T	uc001ozs.2	-	9	1438	c.1325C>A	c.(1324-1326)ACA>AAA	p.T442K	PRCP_uc001ozr.2_Missense_Mutation_p.T463K	NM_005040	NP_005031	P42785	PCP_HUMAN	prolylcarboxypeptidase isoform 1 preproprotein	442					blood coagulation, intrinsic pathway|proteolysis	lysosome|plasma membrane	protein binding|serine-type carboxypeptidase activity			skin(1)	1																		---	---	---	---
SYTL2	54843	broad.mit.edu	37	11	85406313	85406313	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:85406313C>A	uc010rth.1	-	18	3006	c.2730G>T	c.(2728-2730)ATG>ATT	p.M910I	SYTL2_uc010rtg.1_Missense_Mutation_p.M911I|SYTL2_uc010rti.1_Missense_Mutation_p.M886I|SYTL2_uc010rtj.1_Missense_Mutation_p.M878I|SYTL2_uc001pav.2_Missense_Mutation_p.M352I|SYTL2_uc010rte.1_Missense_Mutation_p.M312I|SYTL2_uc001pax.2_Missense_Mutation_p.M352I|SYTL2_uc001paz.2_Missense_Mutation_p.M231I|SYTL2_uc001pba.2_Missense_Mutation_p.M295I|SYTL2_uc001pay.2_Missense_Mutation_p.M341I|SYTL2_uc001paw.2_Missense_Mutation_p.M312I|SYTL2_uc009yvj.2_RNA|SYTL2_uc001pbd.2_Missense_Mutation_p.M1208I|SYTL2_uc001pbb.2_Missense_Mutation_p.M1248I|SYTL2_uc001pbc.2_Missense_Mutation_p.M1232I|SYTL2_uc010rtf.1_Missense_Mutation_p.M728I	NM_001162951	NP_001156423	Q9HCH5	SYTL2_HUMAN	synaptotagmin-like 2 isoform g	910					intracellular protein transport|vesicle docking involved in exocytosis	exocytic vesicle|extrinsic to plasma membrane|melanosome|membrane fraction	neurexin binding|phosphatidylinositol-4,5-bisphosphate binding|phosphatidylserine binding|Rab GTPase binding			ovary(2)|large_intestine(1)	3		Acute lymphoblastic leukemia(157;4.19e-06)|all_hematologic(158;0.0033)		KIRC - Kidney renal clear cell carcinoma(183;0.202)|Kidney(183;0.237)														---	---	---	---
MMP20	9313	broad.mit.edu	37	11	102496027	102496027	+	Silent	SNP	G	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:102496027G>A	uc001phc.2	-	1	37	c.24C>T	c.(22-24)GGC>GGT	p.G8G		NM_004771	NP_004762	O60882	MMP20_HUMAN	matrix metalloproteinase 20 preproprotein	8					proteolysis|regulation of enamel mineralization	extracellular space|proteinaceous extracellular matrix	calcium ion binding|metalloendopeptidase activity|protein binding|zinc ion binding			urinary_tract(1)|skin(1)	2	all_cancers(8;8.95e-05)|all_epithelial(12;0.00227)|Lung NSC(15;0.139)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0033)	Epithelial(9;0.0216)|Lung(13;0.0711)|all cancers(10;0.0889)|LUSC - Lung squamous cell carcinoma(19;0.13)	BRCA - Breast invasive adenocarcinoma(274;0.0161)														---	---	---	---
MMP8	4317	broad.mit.edu	37	11	102584178	102584178	+	Missense_Mutation	SNP	A	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:102584178A>T	uc001phe.2	-	10	1404	c.1305T>A	c.(1303-1305)CAT>CAA	p.H435Q	MMP8_uc010rut.1_3'UTR|MMP8_uc010ruu.1_Missense_Mutation_p.H412Q	NM_002424	NP_002415	P22894	MMP8_HUMAN	matrix metalloproteinase 8 preproprotein	435	Hemopexin-like 4.				collagen catabolic process|proteolysis	extracellular space|proteinaceous extracellular matrix	metalloendopeptidase activity|serine-type endopeptidase activity|zinc ion binding			ovary(3)|breast(1)	4	all_cancers(8;0.00092)|all_epithelial(12;0.00389)|Lung NSC(15;0.227)	all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)	Epithelial(9;0.0555)|Lung(13;0.0828)|LUSC - Lung squamous cell carcinoma(19;0.151)|all cancers(10;0.189)	BRCA - Breast invasive adenocarcinoma(274;0.0141)														---	---	---	---
DYNC2H1	79659	broad.mit.edu	37	11	103270478	103270478	+	Missense_Mutation	SNP	A	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:103270478A>T	uc001pho.2	+	84	12388	c.12244A>T	c.(12244-12246)AAT>TAT	p.N4082Y	DYNC2H1_uc001phn.1_Missense_Mutation_p.N4089Y|DYNC2H1_uc009yxe.1_Intron	NM_001080463	NP_001073932	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1	4082					cell projection organization|Golgi organization|microtubule-based movement|multicellular organismal development	cilium axoneme|dynein complex|Golgi apparatus|microtubule|plasma membrane	ATP binding|ATPase activity|microtubule motor activity				0		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	124120492	124120492	+	IGR	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124120492C>A								OR8G2 (24182 upstream) : OR8D1 (59245 downstream)																																			---	---	---	---
FLI1	2313	broad.mit.edu	37	11	128680436	128680436	+	Silent	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:128680436G>T	uc010sbu.1	+	9	1253	c.912G>T	c.(910-912)GGG>GGT	p.G304G	FLI1_uc010sbt.1_Silent_p.G111G|FLI1_uc010sbv.1_Silent_p.G271G|FLI1_uc009zci.2_Silent_p.G238G	NM_002017	NP_002008	Q01543	FLI1_HUMAN	Friend leukemia virus integration 1	304	ETS.				hemostasis|organ morphogenesis	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity		EWSR1/FLI1(2266)	bone(2210)|soft_tissue(48)|autonomic_ganglia(4)|central_nervous_system(4)|lung(3)|ovary(2)|pancreas(2)	2273	all_hematologic(175;0.0641)	Lung NSC(97;0.00588)|all_lung(97;0.00764)|Breast(109;0.0115)|Medulloblastoma(222;0.0523)|all_neural(223;0.0862)|all_hematologic(192;0.182)		OV - Ovarian serous cystadenocarcinoma(99;0.01)|LUSC - Lung squamous cell carcinoma(976;0.0324)|Lung(977;0.0327)				T	EWSR1	Ewing sarcoma								---	---	---	---
ERC1	23085	broad.mit.edu	37	12	1137575	1137575	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:1137575G>T	uc001qjb.2	+	2	747	c.506G>T	c.(505-507)CGG>CTG	p.R169L	ERC1_uc001qiz.2_RNA|ERC1_uc001qjc.2_Missense_Mutation_p.R169L|ERC1_uc001qja.2_RNA|ERC1_uc001qjd.2_RNA|ERC1_uc001qjf.2_Missense_Mutation_p.R169L	NM_178040	NP_829884	Q8IUD2	RB6I2_HUMAN	RAB6-interacting protein 2 isoform epsilon	169	Potential.				I-kappaB phosphorylation|multicellular organismal development|positive regulation of anti-apoptosis|positive regulation of NF-kappaB transcription factor activity|protein transport	Golgi membrane|IkappaB kinase complex|presynaptic membrane	leucine zipper domain binding			ovary(2)|lung(2)|breast(1)	5	all_epithelial(11;0.0698)|Ovarian(42;0.107)		OV - Ovarian serous cystadenocarcinoma(31;0.00239)|BRCA - Breast invasive adenocarcinoma(9;0.0567)															---	---	---	---
USP5	8078	broad.mit.edu	37	12	6975192	6975192	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6975192C>A	uc001qri.3	+	20	2587	c.2528C>A	c.(2527-2529)CCG>CAG	p.P843Q	USP5_uc001qrh.3_Missense_Mutation_p.P820Q|TPI1_uc001qrk.2_5'Flank|TPI1_uc010sfo.1_5'Flank	NM_001098536	NP_001092006	P45974	UBP5_HUMAN	ubiquitin specific peptidase 5 isoform 1	843					positive regulation of proteasomal ubiquitin-dependent protein catabolic process|protein K48-linked deubiquitination|ubiquitin-dependent protein catabolic process	lysosome	cysteine-type endopeptidase activity|omega peptidase activity|protein binding|ubiquitin thiolesterase activity|zinc ion binding			lung(2)|breast(1)|skin(1)	4																		---	---	---	---
H2AFJ	55766	broad.mit.edu	37	12	14927567	14927567	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:14927567G>T	uc009zia.2	+	1	298	c.163G>T	c.(163-165)GTG>TTG	p.V55L	H2AFJ_uc001rch.3_RNA	NM_177925	NP_808760	Q9BTM1	H2AJ_HUMAN	H2A histone family, member J	55					nucleosome assembly	nucleosome|nucleus	DNA binding			ovary(1)	1																		---	---	---	---
DDX11	1663	broad.mit.edu	37	12	31242080	31242080	+	Silent	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:31242080C>A	uc001rjt.1	+	7	1038	c.787C>A	c.(787-789)CGG>AGG	p.R263R	DDX11_uc010sjw.1_Silent_p.R263R|DDX11_uc010sjx.1_RNA|DDX11_uc001rjr.1_Silent_p.R263R|DDX11_uc001rjs.1_Silent_p.R263R|DDX11_uc001rju.1_5'UTR|DDX11_uc001rjv.1_Silent_p.R263R|DDX11_uc001rjw.1_Silent_p.R237R|DDX11_uc001rjx.1_5'UTR|DDX11_uc009zjn.1_RNA	NM_152438	NP_689651	Q96FC9	DDX11_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11	263	Helicase ATP-binding.				G2/M transition of mitotic cell cycle|interspecies interaction between organisms|mitotic sister chromatid segregation|positive regulation of cell proliferation|S phase of mitotic cell cycle|sister chromatid cohesion	midbody|nuclear chromatin|nucleolus|spindle pole	ATP binding|ATP-dependent DNA helicase activity|DNA binding|protein binding|RNA binding			breast(3)	3	all_cancers(9;1.77e-11)|all_lung(12;6.21e-11)|all_epithelial(9;6.49e-11)|Lung NSC(12;1.06e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Lung SC(12;0.0592)|Esophageal squamous(101;0.233)														Multiple Myeloma(12;0.14)			---	---	---	---
LRRK2	120892	broad.mit.edu	37	12	40671789	40671789	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:40671789T>C	uc001rmg.3	+	17	2162	c.2041T>C	c.(2041-2043)TCC>CCC	p.S681P	LRRK2_uc001rmh.1_Missense_Mutation_p.S303P	NM_198578	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	681					activation of MAPKK activity|determination of adult lifespan|exploration behavior|intracellular distribution of mitochondria|negative regulation of branching morphogenesis of a nerve|negative regulation of dendritic spine morphogenesis|negative regulation of neuroblast proliferation|negative regulation of neuron maturation|neuromuscular junction development|neuron death|peptidyl-serine phosphorylation|positive regulation of autophagy|positive regulation of dopamine receptor signaling pathway|positive regulation of programmed cell death|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein phosphorylation|positive regulation of protein ubiquitination|protein autophosphorylation|regulation of kidney size|regulation of locomotion|regulation of membrane potential|response to oxidative stress|small GTPase mediated signal transduction|tangential migration from the subventricular zone to the olfactory bulb	external side of mitochondrial outer membrane	ATP binding|GTP binding|GTP-dependent protein kinase activity|GTPase activator activity|MAP kinase kinase activity|protein homodimerization activity|tubulin binding			ovary(12)|stomach(5)|upper_aerodigestive_tract(2)|lung(2)|large_intestine(1)|urinary_tract(1)|pancreas(1)	24	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)																---	---	---	---
KRT80	144501	broad.mit.edu	37	12	52565271	52565271	+	Silent	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52565271G>T	uc001rzx.2	-	9	1368	c.1270C>A	c.(1270-1272)CGA>AGA	p.R424R	KRT80_uc001rzw.2_Silent_p.R459R|KRT80_uc001rzy.2_3'UTR	NM_182507	NP_872313	Q6KB66	K2C80_HUMAN	keratin 80 isoform a	424	Tail.					keratin filament	structural molecule activity				0				BRCA - Breast invasive adenocarcinoma(357;0.108)														---	---	---	---
LEMD3	23592	broad.mit.edu	37	12	65639954	65639954	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:65639954C>A	uc001ssl.1	+	13	2591	c.2585C>A	c.(2584-2586)ACA>AAA	p.T862K	LEMD3_uc009zqo.1_Missense_Mutation_p.T861K	NM_014319	NP_055134	Q9Y2U8	MAN1_HUMAN	LEM domain containing 3	862	Interaction with SMAD1, SMAD2, SMAD3 and SMAD5.				negative regulation of activin receptor signaling pathway|negative regulation of BMP signaling pathway|negative regulation of transforming growth factor beta receptor signaling pathway	integral to nuclear inner membrane|membrane fraction	DNA binding|nucleotide binding|protein binding			central_nervous_system(3)|ovary(1)	4			LUAD - Lung adenocarcinoma(6;0.0234)|LUSC - Lung squamous cell carcinoma(43;0.0975)	GBM - Glioblastoma multiforme(28;0.0104)														---	---	---	---
PTPRB	5787	broad.mit.edu	37	12	70988373	70988373	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:70988373C>A	uc001swb.3	-	4	766	c.736G>T	c.(736-738)GGT>TGT	p.G246C	PTPRB_uc010sto.1_Missense_Mutation_p.G246C|PTPRB_uc010stp.1_Missense_Mutation_p.G246C|PTPRB_uc001swc.3_Missense_Mutation_p.G464C|PTPRB_uc001swa.3_Missense_Mutation_p.G464C|PTPRB_uc001swd.3_Missense_Mutation_p.G463C|PTPRB_uc009zrr.1_Missense_Mutation_p.G343C|PTPRB_uc001swe.2_Missense_Mutation_p.G464C	NM_002837	NP_002828	P23467	PTPRB_HUMAN	protein tyrosine phosphatase, receptor type, B	246	Fibronectin type-III 3.|Extracellular (Potential).				angiogenesis	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(2)|skin(1)	3	Renal(347;0.236)		GBM - Glioblastoma multiforme(2;2.17e-05)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00306)|STAD - Stomach adenocarcinoma(21;0.149)															---	---	---	---
PAH	5053	broad.mit.edu	37	12	103260378	103260378	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:103260378G>T	uc001tjq.1	-	6	977	c.505C>A	c.(505-507)CGC>AGC	p.R169S	PAH_uc010swc.1_Missense_Mutation_p.R169S	NM_000277	NP_000268	P00439	PH4H_HUMAN	phenylalanine hydroxylase	169			R -> H (in PKU).		catecholamine biosynthetic process|L-phenylalanine catabolic process|neurotransmitter biosynthetic process	cytosol	phenylalanine 4-monooxygenase activity			ovary(4)	4					Epinephrine(DB00668)|L-Phenylalanine(DB00120)|Levodopa(DB01235)|Norepinephrine(DB00368)|Tetrahydrobiopterin(DB00360)													---	---	---	---
FOXN4	121643	broad.mit.edu	37	12	109719324	109719324	+	Silent	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109719324C>A	uc001toe.3	-	9	1287	c.1182G>T	c.(1180-1182)CCG>CCT	p.P394P	FOXN4_uc009zvg.2_Silent_p.P191P|FOXN4_uc001tof.3_Silent_p.P214P	NM_213596	NP_998761	Q96NZ1	FOXN4_HUMAN	forkhead box N4	394					axon extension|embryo development|organ development|pattern specification process|regulation of heart contraction|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			ovary(1)|lung(1)	2																		---	---	---	---
DNAH10	196385	broad.mit.edu	37	12	124359850	124359850	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124359850C>A	uc001uft.3	+	46	7682	c.7657C>A	c.(7657-7659)CGT>AGT	p.R2553S		NM_207437	NP_997320	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	2553	AAA 3 (By similarity).				microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(3)|skin(2)|central_nervous_system(1)	6	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)														---	---	---	---
TMEM132D	121256	broad.mit.edu	37	12	130185027	130185027	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:130185027G>T	uc009zyl.1	-	2	624	c.296C>A	c.(295-297)CCT>CAT	p.P99H		NM_133448	NP_597705	Q14C87	T132D_HUMAN	transmembrane protein 132D precursor	99	Extracellular (Potential).					integral to membrane				ovary(10)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	14	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)														---	---	---	---
COL4A1	1282	broad.mit.edu	37	13	110861227	110861227	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:110861227C>T	uc001vqw.3	-	12	784	c.662G>A	c.(661-663)GGC>GAC	p.G221D	COL4A1_uc010agl.2_Missense_Mutation_p.G221D	NM_001845	NP_001836	P02462	CO4A1_HUMAN	alpha 1 type IV collagen preproprotein	221	Triple-helical region.				angiogenesis|axon guidance		extracellular matrix structural constituent|platelet-derived growth factor binding			ovary(3)|lung(1)|central_nervous_system(1)|pancreas(1)	6	all_cancers(4;9.8e-13)|all_epithelial(4;9.66e-08)|all_lung(23;3.75e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00178)|all_neural(89;0.00459)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0604)	Breast(118;0.2)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.145)															---	---	---	---
NEDD8	4738	broad.mit.edu	37	14	24686353	24686353	+	Nonsense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24686353C>A	uc001wnn.2	-	4	329	c.226G>T	c.(226-228)GGA>TGA	p.G76*	TM9SF1_uc010tob.1_5'Flank|CHMP4A_uc010toc.1_5'Flank|CHMP4A_uc001wnj.2_5'Flank|MDP1_uc001wnk.1_5'Flank|CHMP4A_uc001wnm.1_5'Flank|MDP1_uc001wnl.1_5'Flank|NEDD8_uc001wno.2_RNA	NM_006156	NP_006147	Q15843	NEDD8_HUMAN	neural precursor cell expressed, developmentally	76					anatomical structure morphogenesis|protein neddylation|ubiquitin-dependent protein catabolic process	nucleus	ubiquitin protein ligase binding				0				GBM - Glioblastoma multiforme(265;0.0186)														---	---	---	---
G2E3	55632	broad.mit.edu	37	14	31061605	31061605	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:31061605C>A	uc001wqk.2	+	5	468	c.314C>A	c.(313-315)CCA>CAA	p.P105Q	G2E3_uc010tpe.1_Missense_Mutation_p.P59Q|G2E3_uc010tpf.1_Missense_Mutation_p.P59Q	NM_017769	NP_060239	Q7L622	G2E3_HUMAN	G2/M-phase specific E3 ubiquitin ligase	105	PHD-type 1.				apoptosis|multicellular organismal development|protein modification process	Golgi apparatus|nucleolus	acid-amino acid ligase activity|protein binding|zinc ion binding			ovary(2)|skin(1)	3																		---	---	---	---
EGLN3	112399	broad.mit.edu	37	14	34400401	34400401	+	Silent	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:34400401C>A	uc001wsa.3	-	2	704	c.378G>T	c.(376-378)CCG>CCT	p.P126P	EGLN3_uc001wry.2_Silent_p.P32P|EGLN3_uc001wrz.2_Silent_p.P126P	NM_022073	NP_071356	Q9H6Z9	EGLN3_HUMAN	egl nine homolog 3	126	Fe2OG dioxygenase.				apoptosis	cytoplasm|nucleus	iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding				0	Breast(36;0.0303)|Hepatocellular(127;0.133)		LUAD - Lung adenocarcinoma(48;0.000246)|Lung(238;0.000959)|Epithelial(34;0.155)	GBM - Glioblastoma multiforme(112;0.0118)	Vitamin C(DB00126)													---	---	---	---
NIN	51199	broad.mit.edu	37	14	51226755	51226755	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:51226755C>A	uc001wym.2	-	17	2410	c.2219G>T	c.(2218-2220)CGG>CTG	p.R740L	NIN_uc001wyi.2_Missense_Mutation_p.R740L|NIN_uc001wyj.2_RNA|NIN_uc001wyk.2_Missense_Mutation_p.R740L|NIN_uc010tqp.1_Missense_Mutation_p.R746L|NIN_uc001wyo.2_Missense_Mutation_p.R740L	NM_182946	NP_891991	Q8N4C6	NIN_HUMAN	ninein isoform 5	740	Potential.				centrosome localization	centrosome|microtubule	calcium ion binding|GTP binding|protein binding			skin(3)|ovary(1)|kidney(1)|central_nervous_system(1)	6	all_epithelial(31;0.00244)|Breast(41;0.127)							T	PDGFRB	MPD								---	---	---	---
KTN1	3895	broad.mit.edu	37	14	56086004	56086004	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:56086004G>T	uc001xcb.2	+	6	1239	c.937G>T	c.(937-939)GGT>TGT	p.G313C	KTN1_uc001xce.2_Missense_Mutation_p.G313C|KTN1_uc001xcc.2_Missense_Mutation_p.G313C|KTN1_uc001xcd.2_Missense_Mutation_p.G313C|KTN1_uc010trb.1_Missense_Mutation_p.G313C|KTN1_uc001xcf.1_Missense_Mutation_p.G313C	NM_182926	NP_891556	Q86UP2	KTN1_HUMAN	kinectin 1 isoform a	313	Lumenal (Potential).				microtubule-based movement	endoplasmic reticulum membrane|integral to plasma membrane|membrane fraction				breast(3)|ovary(2)|lung(1)|central_nervous_system(1)	7								T	RET	papillary thryoid								---	---	---	---
FUT8	2530	broad.mit.edu	37	14	66191053	66191053	+	Intron	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:66191053C>A	uc001xin.2	+						FUT8_uc001xio.2_Intron|FUT8_uc010tsp.1_Intron|FUT8_uc001xir.3_Intron|FUT8_uc001xip.2_Intron|FUT8_uc001xiq.2_Intron|FUT8_uc001xis.2_Intron	NM_178155	NP_835368			fucosyltransferase 8 isoform a						in utero embryonic development|L-fucose catabolic process|N-glycan processing|oligosaccharide biosynthetic process|post-translational protein modification|protein glycosylation in Golgi|protein N-linked glycosylation via asparagine	Golgi cisterna membrane|integral to membrane	glycoprotein 6-alpha-L-fucosyltransferase activity|SH3 domain binding			ovary(1)	1				all cancers(60;0.00109)|OV - Ovarian serous cystadenocarcinoma(108;0.00242)|BRCA - Breast invasive adenocarcinoma(234;0.0114)														---	---	---	---
GPHN	10243	broad.mit.edu	37	14	67635649	67635649	+	Splice_Site	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:67635649G>T	uc001xiy.2	+	20	2998	c.1877_splice	c.e20-1	p.G626_splice	GPHN_uc001xix.2_Splice_Site_p.G659_splice|GPHN_uc010tss.1_Splice_Site_p.G672_splice|GPHN_uc010tst.1_Splice_Site_p.G595_splice|GPHN_uc010tsu.1_Splice_Site_p.G549_splice	NM_001024218	NP_001019389			gephyrin isoform 2						Mo-molybdopterin cofactor biosynthetic process|water-soluble vitamin metabolic process	cell junction|cytoplasm|cytoskeleton|postsynaptic membrane	ATP binding|metal ion binding|nucleotidyltransferase activity			ovary(2)	2		all_cancers(7;0.0476)|all_hematologic(31;0.0116)		Epithelial(1;1.73e-08)|all cancers(60;3.15e-07)|OV - Ovarian serous cystadenocarcinoma(108;0.000275)|BRCA - Breast invasive adenocarcinoma(234;0.00323)|Colorectal(3;0.0938)|KIRC - Kidney renal clear cell carcinoma(182;0.184)				T	MLL	AL								---	---	---	---
C14orf1	11161	broad.mit.edu	37	14	76123764	76123764	+	Silent	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:76123764G>T	uc001xrt.2	-	2	528	c.82C>A	c.(82-84)CGA>AGA	p.R28R	C14orf1_uc001xru.2_RNA	NM_007176	NP_009107	Q9UKR5	ERG28_HUMAN	ergosterol biosynthetic protein 28	28					sterol biosynthetic process	endoplasmic reticulum membrane|integral to membrane|transport vesicle					0		all_epithelial(191;0.125)|all_neural(303;0.13)|Myeloproliferative disorder(585;0.163)		BRCA - Breast invasive adenocarcinoma(234;0.00147)														---	---	---	---
TC2N	123036	broad.mit.edu	37	14	92258810	92258810	+	Silent	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92258810G>T	uc001xzu.3	-	9	1139	c.948C>A	c.(946-948)CCC>CCA	p.P316P	TC2N_uc001xzt.3_Silent_p.P316P|TC2N_uc010auc.2_Intron|TC2N_uc001xzv.3_Silent_p.P316P	NM_001128595	NP_001122067	Q8N9U0	TAC2N_HUMAN	tandem C2 domains, nuclear	316						nucleus				upper_aerodigestive_tract(1)	1				COAD - Colon adenocarcinoma(157;0.218)														---	---	---	---
PPP4R4	57718	broad.mit.edu	37	14	94712764	94712764	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94712764G>T	uc001ycs.1	+	14	1653	c.1499G>T	c.(1498-1500)TGG>TTG	p.W500L		NM_058237	NP_478144	Q6NUP7	PP4R4_HUMAN	HEAT-like repeat-containing protein isoform 1	500						cytoplasm|protein serine/threonine phosphatase complex	protein binding			skin(3)|upper_aerodigestive_tract(1)	4																		---	---	---	---
EML1	2009	broad.mit.edu	37	14	100317368	100317368	+	Silent	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:100317368C>A	uc001ygs.2	+	2	315	c.246C>A	c.(244-246)ACC>ACA	p.T82T	EML1_uc010avt.1_Silent_p.T69T|EML1_uc010tww.1_Silent_p.T51T|EML1_uc001ygq.2_Silent_p.T82T|EML1_uc001ygr.2_Silent_p.T82T	NM_004434	NP_004425	O00423	EMAL1_HUMAN	echinoderm microtubule associated protein like 1	82						cytoplasm|microtubule|microtubule associated complex	calcium ion binding|protein binding			large_intestine(2)|pancreas(1)|ovary(1)|skin(1)	5		Melanoma(154;0.0879)|all_epithelial(191;0.216)																---	---	---	---
ASPG	374569	broad.mit.edu	37	14	104570831	104570831	+	Intron	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:104570831C>A	uc001yoq.1	+						ASPG_uc001yoo.1_Intron|ASPG_uc001yop.1_Intron|ASPG_uc001yor.1_Intron	NM_001080464	NP_001073933			60 kDa lysophospholipase						lipid catabolic process		1-alkyl-2-acetylglycerophosphocholine esterase activity|asparaginase activity|lysophospholipase activity				0																		---	---	---	---
ATP10A	57194	broad.mit.edu	37	15	25953436	25953436	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25953436C>A	uc010ayu.2	-	11	2462	c.2356G>T	c.(2356-2358)GGG>TGG	p.G786W		NM_024490	NP_077816	O60312	AT10A_HUMAN	ATPase, class V, type 10A	786	Cytoplasmic (Potential).				ATP biosynthetic process|regulation of cell shape	integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			pancreas(2)|ovary(1)|breast(1)|liver(1)	5		all_cancers(20;5.16e-25)|all_lung(180;1.51e-14)|Acute lymphoblastic leukemia(1;2.53e-05)|all_hematologic(1;0.000267)|Breast(32;0.00125)		all cancers(64;9.48e-07)|Epithelial(43;1.69e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0252)|Lung(196;0.244)														---	---	---	---
MTMR15	22909	broad.mit.edu	37	15	31206255	31206255	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:31206255G>T	uc001zff.2	+	5	2063	c.1772G>T	c.(1771-1773)CGG>CTG	p.R591L	MTMR15_uc001zfe.2_Missense_Mutation_p.R196L	NM_014967	NP_055782	Q9Y2M0	FAN1_HUMAN	myotubularin related protein 15 isoform a	591					double-strand break repair via homologous recombination|nucleotide-excision repair, DNA incision	nucleus	5'-3' exonuclease activity|5'-flap endonuclease activity|DNA binding|magnesium ion binding|phosphodiesterase I activity|ubiquitin binding				0		all_lung(180;2.23e-09)		all cancers(64;4.72e-15)|Epithelial(43;5.4e-11)|GBM - Glioblastoma multiforme(186;0.000136)|BRCA - Breast invasive adenocarcinoma(123;0.00402)|Lung(196;0.168)									Direct_reversal_of_damage|Editing_and_processing_nucleases					---	---	---	---
SLC12A1	6557	broad.mit.edu	37	15	48527094	48527094	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:48527094T>G	uc001zwn.3	+	9	1324	c.1108T>G	c.(1108-1110)TTT>GTT	p.F370V	SLC12A1_uc010uew.1_Missense_Mutation_p.F176V|SLC12A1_uc010bem.2_Missense_Mutation_p.F370V|SLC12A1_uc010uex.1_Missense_Mutation_p.F370V|SLC12A1_uc001zwq.3_Missense_Mutation_p.F141V|SLC12A1_uc001zwr.3_Missense_Mutation_p.F97V	NM_000338	NP_000329	Q13621	S12A1_HUMAN	sodium potassium chloride cotransporter 2	370					potassium ion transport|sodium ion transport	integral to membrane|membrane fraction	sodium:potassium:chloride symporter activity			ovary(1)|central_nervous_system(1)	2		all_lung(180;0.00219)		all cancers(107;1.76e-09)|GBM - Glioblastoma multiforme(94;1.48e-06)	Bumetanide(DB00887)|Chlormerodrin(DB00534)|Chlorthalidone(DB00310)|Ethacrynic acid(DB00903)|Furosemide(DB00695)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Metolazone(DB00524)|Potassium Chloride(DB00761)|Torasemide(DB00214)|Trichlormethiazide(DB01021)													---	---	---	---
AP4E1	23431	broad.mit.edu	37	15	51233738	51233738	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:51233738C>A	uc001zyx.1	+	9	1073	c.1043C>A	c.(1042-1044)CCT>CAT	p.P348H	AP4E1_uc010ufi.1_Missense_Mutation_p.P348H|AP4E1_uc010ufj.1_RNA|AP4E1_uc010ufk.1_RNA|LOC100132724_uc010ufl.1_5'Flank	NM_007347	NP_031373	Q9UPM8	AP4E1_HUMAN	adaptor-related protein complex 4, epsilon 1	348					intracellular protein transport|vesicle-mediated transport	COPI vesicle coat	binding|structural molecule activity				0				all cancers(107;0.000893)|GBM - Glioblastoma multiforme(94;0.00364)														---	---	---	---
RFX7	64864	broad.mit.edu	37	15	56388002	56388002	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:56388002C>A	uc010bfn.2	-	9	1924	c.1924G>T	c.(1924-1926)GGT>TGT	p.G642C	RFX7_uc010ugk.1_RNA|RFX7_uc002adn.1_Missense_Mutation_p.G456C	NM_022841	NP_073752	Q2KHR2	RFX7_HUMAN	regulatory factor X domain containing 2	545					regulation of transcription, DNA-dependent	nucleus	DNA binding				0																		---	---	---	---
DENND4A	10260	broad.mit.edu	37	15	65983706	65983706	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65983706G>T	uc002aph.2	-	22	3472	c.3094C>A	c.(3094-3096)CGT>AGT	p.R1032S	DENND4A_uc002api.2_Missense_Mutation_p.R1075S|DENND4A_uc002apj.3_Missense_Mutation_p.R1032S	NM_005848	NP_005839	Q7Z401	MYCPP_HUMAN	DENN/MADD domain containing 4A isoform 2	1032					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	4																		---	---	---	---
LRRC49	54839	broad.mit.edu	37	15	71329532	71329532	+	Missense_Mutation	SNP	G	T	T	rs149509591		TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:71329532G>T	uc002asw.2	+	15	1965	c.1718G>T	c.(1717-1719)CGG>CTG	p.R573L	LRRC49_uc002asu.2_Missense_Mutation_p.R563L|LRRC49_uc002asx.2_Missense_Mutation_p.R529L|LRRC49_uc010ukf.1_Missense_Mutation_p.R578L|LRRC49_uc002asy.2_Missense_Mutation_p.R279L|LRRC49_uc002asz.2_Missense_Mutation_p.R545L	NM_017691	NP_060161	Q8IUZ0	LRC49_HUMAN	leucine rich repeat containing 49	573						cytoplasm|microtubule				ovary(1)	1																		---	---	---	---
STARD5	80765	broad.mit.edu	37	15	81610813	81610813	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:81610813G>T	uc002bgm.2	-	5	515	c.431C>A	c.(430-432)CCG>CAG	p.P144Q	STARD5_uc002bgn.2_Missense_Mutation_p.P37Q	NM_181900	NP_871629	Q9NSY2	STAR5_HUMAN	StAR-related lipid transfer protein 5	144	START.				C21-steroid hormone biosynthetic process|lipid transport	cytosol	lipid binding			ovary(1)	1																		---	---	---	---
LRRK1	79705	broad.mit.edu	37	15	101549122	101549122	+	Silent	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:101549122G>T	uc002bwr.2	+	7	1162	c.843G>T	c.(841-843)ACG>ACT	p.T281T	LRRK1_uc010usb.1_RNA|LRRK1_uc010usc.1_RNA	NM_024652	NP_078928	Q38SD2	LRRK1_HUMAN	leucine-rich repeat kinase 1	281	LRR 1.				small GTPase mediated signal transduction	mitochondrion	ATP binding|GTP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			ovary(4)|lung(4)|central_nervous_system(3)|large_intestine(1)	12	Melanoma(26;0.00505)|Lung NSC(78;0.00793)|all_lung(78;0.0094)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)													OREG0023521	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
MLST8	64223	broad.mit.edu	37	16	2258520	2258520	+	Silent	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2258520G>T	uc002coz.2	+	8	887	c.768G>T	c.(766-768)ACG>ACT	p.T256T	MLST8_uc002coy.2_Silent_p.T256T|MLST8_uc002cpa.2_Silent_p.T72T|MLST8_uc002cpb.2_Silent_p.T255T|MLST8_uc010uvx.1_Silent_p.T190T|MLST8_uc002cpc.2_Silent_p.T256T|MLST8_uc002cpd.2_Silent_p.T190T|MLST8_uc002cpe.2_Silent_p.T256T|MLST8_uc002cpg.2_Silent_p.T275T|MLST8_uc002cph.2_RNA|MLST8_uc002cpf.2_Silent_p.T256T	NM_022372	NP_071767	Q9BVC4	LST8_HUMAN	G protein beta subunit-like	256	WD 6.				insulin receptor signaling pathway|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of TOR signaling cascade|T cell costimulation	cytosol	protein binding				0																		---	---	---	---
ZNF597	146434	broad.mit.edu	37	16	3490843	3490843	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3490843C>A	uc002cvd.2	-	3	308	c.124G>T	c.(124-126)GGT>TGT	p.G42C	NAT15_uc002cvh.3_5'Flank|NAT15_uc010uxb.1_5'Flank	NM_152457	NP_689670	Q96LX8	ZN597_HUMAN	zinc finger protein 597	42	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0																		---	---	---	---
ITPRIPL2	162073	broad.mit.edu	37	16	19126666	19126666	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:19126666C>A	uc002dfu.3	+	1	1413	c.883C>A	c.(883-885)CGC>AGC	p.R295S	ITPRIPL2_uc002dft.2_5'UTR	NM_001034841	NP_001030013	Q3MIP1	IPIL2_HUMAN	inositol 1,4,5-triphosphate receptor interacting	295	Cytoplasmic (Potential).					integral to membrane				skin(2)	2																OREG0023657	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
EEF2K	29904	broad.mit.edu	37	16	22262558	22262558	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:22262558G>T	uc002dki.2	+	6	1018	c.533G>T	c.(532-534)CGG>CTG	p.R178L	EEF2K_uc002dkh.2_RNA	NM_013302	NP_037434	O00418	EF2K_HUMAN	elongation factor-2 kinase	178	Alpha-type protein kinase.				insulin receptor signaling pathway|translational elongation	cytosol	ATP binding|calcium ion binding|calmodulin binding|elongation factor-2 kinase activity|translation factor activity, nucleic acid binding			large_intestine(1)	1				GBM - Glioblastoma multiforme(48;0.0223)														---	---	---	---
SCNN1B	6338	broad.mit.edu	37	16	23366787	23366787	+	Silent	SNP	C	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:23366787C>T	uc002dln.2	+	4	929	c.753C>T	c.(751-753)TTC>TTT	p.F251F		NM_000336	NP_000327	P51168	SCNNB_HUMAN	sodium channel, nonvoltage-gated 1, beta	251	Extracellular (By similarity).				excretion|sensory perception of taste	apical plasma membrane	ligand-gated sodium channel activity|WW domain binding			ovary(3)|breast(2)|large_intestine(1)|pancreas(1)	7				GBM - Glioblastoma multiforme(48;0.0465)	Amiloride(DB00594)|Triamterene(DB00384)													---	---	---	---
SLC5A2	6524	broad.mit.edu	37	16	31500611	31500611	+	Silent	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31500611C>A	uc002ecf.3	+	12	1636	c.1617C>A	c.(1615-1617)CTC>CTA	p.L539L	SLC5A2_uc010car.2_RNA|C16orf58_uc002ecg.2_RNA	NM_003041	NP_003032	P31639	SC5A2_HUMAN	solute carrier family 5 (sodium/glucose	539	Helical; (Potential).				carbohydrate metabolic process	integral to membrane	low-affinity glucose:sodium symporter activity			ovary(1)	1																		---	---	---	---
RPGRIP1L	23322	broad.mit.edu	37	16	53671740	53671740	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:53671740C>A	uc002ehp.2	-	21	3151	c.3087G>T	c.(3085-3087)GAG>GAT	p.E1029D	RPGRIP1L_uc002eho.3_Missense_Mutation_p.E995D|RPGRIP1L_uc010vgy.1_Missense_Mutation_p.E1029D|RPGRIP1L_uc010cbx.2_Missense_Mutation_p.E995D|RPGRIP1L_uc010vgz.1_Missense_Mutation_p.E1029D	NM_015272	NP_056087	Q68CZ1	FTM_HUMAN	RPGRIP1-like isoform a	1029					negative regulation of G-protein coupled receptor protein signaling pathway	cell-cell junction|centrosome|cilium axoneme|microtubule basal body	thromboxane A2 receptor binding			ovary(1)	1		all_cancers(37;0.0973)																---	---	---	---
OGFOD1	55239	broad.mit.edu	37	16	56510089	56510089	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:56510089G>T	uc002ejb.2	+	13	1702	c.1601G>T	c.(1600-1602)TGG>TTG	p.W534L	OGFOD1_uc002ejc.2_Missense_Mutation_p.W394L	NM_018233	NP_060703	Q8N543	OGFD1_HUMAN	2-oxoglutarate and iron-dependent oxygenase	534							iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			skin(1)	1					Vitamin C(DB00126)													---	---	---	---
NLRC5	84166	broad.mit.edu	37	16	57115521	57115521	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57115521C>A	uc002ekk.1	+	48	5713	c.5488C>A	c.(5488-5490)CGC>AGC	p.R1830S	NLRC5_uc010ccr.1_RNA|NLRC5_uc010ccs.1_RNA|NLRC5_uc002eko.1_RNA|NLRC5_uc002ekq.1_Missense_Mutation_p.R372S|NLRC5_uc002ekr.1_Missense_Mutation_p.R717S	NM_032206	NP_115582	Q86WI3	NLRC5_HUMAN	nucleotide-binding oligomerization domains 27	1830					defense response to virus|innate immune response|negative regulation of NF-kappaB transcription factor activity|negative regulation of type I interferon production|negative regulation of type I interferon-mediated signaling pathway|positive regulation of interferon-gamma-mediated signaling pathway|positive regulation of MHC class I biosynthetic process|positive regulation of transcription from RNA polymerase II promoter|positive regulation of type I interferon-mediated signaling pathway|regulation of kinase activity	cytosol|nucleus	ATP binding|protein binding|RNA polymerase II core promoter sequence-specific DNA binding			ovary(4)|skin(2)|breast(1)	7		all_neural(199;0.225)																---	---	---	---
FAM192A	80011	broad.mit.edu	37	16	57188396	57188396	+	Nonsense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57188396C>A	uc010vhk.1	-	7	830	c.571G>T	c.(571-573)GGA>TGA	p.G191*	FAM192A_uc002ekz.3_Nonsense_Mutation_p.G190*|FAM192A_uc002ekv.3_Nonsense_Mutation_p.G113*|FAM192A_uc002ekw.3_Nonsense_Mutation_p.G190*|FAM192A_uc002ekx.3_Nonsense_Mutation_p.G190*|FAM192A_uc002eky.3_Nonsense_Mutation_p.G190*	NM_024946	NP_079222	Q9GZU8	F192A_HUMAN	NEFA-interacting nuclear protein NIP30	191						nucleus					0																		---	---	---	---
TUBB3	10381	broad.mit.edu	37	16	90002056	90002056	+	Silent	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:90002056G>T	uc002fph.1	+	4	1262	c.1197G>T	c.(1195-1197)ACG>ACT	p.T399T	TUBB3_uc002fpf.2_Silent_p.T746T|TUBB3_uc010ciz.1_Silent_p.T327T|TUBB3_uc002fpg.1_Silent_p.T253T|TUBB3_uc002fpi.1_Silent_p.T327T|TUBB3_uc002fpj.1_Silent_p.T327T|TUBB3_uc010cjb.1_Silent_p.T253T|TUBB3_uc002fpk.1_Silent_p.T253T	NM_006086	NP_006077	Q13509	TBB3_HUMAN	tubulin, beta, 4	399					'de novo' posttranslational protein folding|axon guidance|microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|structural molecule activity			ovary(2)|pancreas(1)	3		all_cancers(9;1.69e-11)|Lung NSC(15;8.94e-06)|all_lung(18;1.39e-05)|all_neural(9;0.00581)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.0273)														---	---	---	---
TIMM22	29928	broad.mit.edu	37	17	904323	904323	+	Silent	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:904323C>A	uc002fsc.2	+	4	606	c.580C>A	c.(580-582)CGG>AGG	p.R194R		NM_013337	NP_037469	Q9Y584	TIM22_HUMAN	translocase of inner mitochondrial membrane 22	194					transmembrane transport	integral to membrane|mitochondrial inner membrane	protein transporter activity				0				UCEC - Uterine corpus endometrioid carcinoma (25;0.022)														---	---	---	---
RAP1GAP2	23108	broad.mit.edu	37	17	2908679	2908679	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:2908679G>T	uc010ckd.2	+	15	1307	c.1217G>T	c.(1216-1218)CGG>CTG	p.R406L	RAP1GAP2_uc010cke.2_Missense_Mutation_p.R391L	NM_015085	NP_055900	Q684P5	RPGP2_HUMAN	RAP1 GTPase activating protein 2 isoform 1	406	Rap-GAP.				regulation of small GTPase mediated signal transduction	centrosome|cytosol|perinuclear region of cytoplasm	GTPase activator activity			ovary(1)	1																		---	---	---	---
ALOX12	239	broad.mit.edu	37	17	6902654	6902654	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:6902654G>A	uc002gdx.3	+	6	729	c.676G>A	c.(676-678)GAG>AAG	p.E226K		NM_000697	NP_000688	P18054	LOX12_HUMAN	arachidonate 12-lipoxygenase	226	Lipoxygenase.				anti-apoptosis|cellular component movement|fatty acid oxidation|leukotriene biosynthetic process|positive regulation of cell adhesion|positive regulation of cell growth|positive regulation of cell proliferation|superoxide anion generation	cytosol|sarcolemma	arachidonate 12-lipoxygenase activity|hepoxilin-epoxide hydrolase activity|iron ion binding|lipoxygenase activity|protein binding			central_nervous_system(1)	1																		---	---	---	---
TP53	7157	broad.mit.edu	37	17	7578271	7578271	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7578271T>C	uc002gim.2	-	6	772	c.578A>G	c.(577-579)CAT>CGT	p.H193R	TP53_uc002gig.1_Missense_Mutation_p.H193R|TP53_uc002gih.2_Missense_Mutation_p.H193R|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.H61R|TP53_uc010cng.1_Missense_Mutation_p.H61R|TP53_uc002gii.1_Missense_Mutation_p.H61R|TP53_uc010cnh.1_Missense_Mutation_p.H193R|TP53_uc010cni.1_Missense_Mutation_p.H193R|TP53_uc002gij.2_Missense_Mutation_p.H193R|TP53_uc010cnj.1_Intron|TP53_uc002gin.2_Missense_Mutation_p.H100R|TP53_uc002gio.2_Missense_Mutation_p.H61R|TP53_uc010vug.1_Missense_Mutation_p.H154R	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	193	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		H -> D (in sporadic cancers; somatic mutation).|H -> Q (in sporadic cancers; somatic mutation).|H -> Y (in sporadic cancers; somatic mutation).|QH -> HN (in a sporadic cancer; somatic mutation).|H -> N (in sporadic cancers; somatic mutation).|QH -> HY (in a sporadic cancer; somatic mutation).|H -> L (in sporadic cancers; somatic mutation).|H -> P (in sporadic cancers; somatic mutation).|H -> R (in LFS; germline mutation and in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.H193R(67)|p.H193L(31)|p.H193Y(26)|p.H193P(12)|p.0?(7)|p.H193D(7)|p.H193N(4)|p.A189_V197delAPPQHLIRV(4)|p.H193fs*16(3)|p.H193H(2)|p.P191fs*53(2)|p.K164_P219del(1)|p.P191fs*15(1)|p.P191fs*6(1)|p.H100L(1)|p.H61L(1)|p.H193_I195delHLI(1)|p.H193_I195>AP(1)|p.A189fs*53(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)			111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			---	---	---	---
ULK2	9706	broad.mit.edu	37	17	19699025	19699025	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:19699025C>A	uc002gwm.3	-	20	2520	c.2011G>T	c.(2011-2013)GGG>TGG	p.G671W	ULK2_uc002gwn.2_Missense_Mutation_p.G671W	NM_001142610	NP_001136082	Q8IYT8	ULK2_HUMAN	unc-51-like kinase 2	671					signal transduction		ATP binding|protein binding|protein serine/threonine kinase activity			skin(2)|large_intestine(1)|stomach(1)	4	all_cancers(12;4.97e-05)|all_epithelial(12;0.00362)|Breast(13;0.186)																	---	---	---	---
NOS2	4843	broad.mit.edu	37	17	26105786	26105786	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26105786T>C	uc002gzu.2	-	11	1475	c.1211A>G	c.(1210-1212)CAC>CGC	p.H404R	NOS2_uc010crh.1_Missense_Mutation_p.H404R|NOS2_uc010wab.1_Missense_Mutation_p.H404R	NM_000625	NP_000616	P35228	NOS2_HUMAN	nitric oxide synthase 2A	404					arginine catabolic process|defense response to Gram-negative bacterium|innate immune response in mucosa|nitric oxide biosynthetic process|peptidyl-cysteine S-nitrosylation|platelet activation|positive regulation of killing of cells of other organism|positive regulation of leukocyte mediated cytotoxicity|regulation of cellular respiration|regulation of insulin secretion|superoxide metabolic process	cytosol|nucleus	arginine binding|calmodulin binding|flavin adenine dinucleotide binding|FMN binding|heme binding|NADP binding|nitric-oxide synthase activity|protein homodimerization activity|tetrahydrobiopterin binding			skin(2)|ovary(1)|breast(1)	4					Dexamethasone(DB01234)|Hydrocortisone(DB00741)|L-Arginine(DB00125)|L-Citrulline(DB00155)													---	---	---	---
PSMD11	5717	broad.mit.edu	37	17	30781647	30781647	+	Intron	SNP	A	G	G			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:30781647A>G	uc010cta.1	+						PSMD11_uc010wbz.1_Intron|PSMD11_uc002hhm.2_Intron	NM_002815	NP_002806			proteasome 26S non-ATPase subunit 11						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	proteasome complex	protein binding			ovary(1)	1		Breast(31;0.159)|Ovarian(249;0.182)	BRCA - Breast invasive adenocarcinoma(9;0.109)															---	---	---	---
PSMB3	5691	broad.mit.edu	37	17	36916765	36916765	+	Silent	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:36916765C>A	uc002hqr.2	+	4	456	c.378C>A	c.(376-378)CTC>CTA	p.L126L		NM_002795	NP_002786	P49720	PSB3_HUMAN	proteasome beta 3 subunit	126					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|interspecies interaction between organisms|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	cytoplasm|nucleus|proteasome core complex	protein binding|threonine-type endopeptidase activity				0																		---	---	---	---
EFCAB3	146779	broad.mit.edu	37	17	60484458	60484458	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:60484458G>T	uc002izu.1	+	8	830	c.752G>T	c.(751-753)GGG>GTG	p.G251V	EFCAB3_uc010wpc.1_Missense_Mutation_p.G303V	NM_173503	NP_775774	Q8N7B9	EFCB3_HUMAN	EF-hand calcium binding domain 3 isoform b	251							calcium ion binding			skin(1)	1			BRCA - Breast invasive adenocarcinoma(2;2.27e-11)															---	---	---	---
ACE	1636	broad.mit.edu	37	17	61559937	61559937	+	Missense_Mutation	SNP	G	T	T	rs145172277	byFrequency	TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61559937G>T	uc002jau.1	+	8	1251	c.1229G>T	c.(1228-1230)CGG>CTG	p.R410L	ACE_uc010wpi.1_Missense_Mutation_p.R410L|ACE_uc010ddu.1_Missense_Mutation_p.R227L|ACE_uc002jav.1_5'Flank|ACE_uc010ddv.1_5'Flank|ACE_uc010wpj.1_5'Flank|ACE_uc002jaw.1_5'Flank|ACE_uc010wpk.1_5'Flank	NM_000789	NP_000780	P12821	ACE_HUMAN	angiotensin I converting enzyme 1 isoform 1	410	Extracellular (Potential).|Peptidase M2 1.				arachidonic acid secretion|hormone catabolic process|kidney development|peptide catabolic process|regulation of smooth muscle cell migration	endosome|external side of plasma membrane|extracellular space|integral to membrane|membrane fraction|plasma membrane	actin binding|bradykinin receptor binding|carboxypeptidase activity|chloride ion binding|drug binding|metallopeptidase activity|peptidyl-dipeptidase activity|zinc ion binding			ovary(2)|upper_aerodigestive_tract(1)|pancreas(1)	4					Benazepril(DB00542)|Captopril(DB01197)|Deserpidine(DB01089)|Enalapril(DB00584)|Fosinopril(DB00492)|Lisinopril(DB00722)|Moexipril(DB00691)|Perindopril(DB00790)|Quinapril(DB00881)|Ramipril(DB00178)|Rescinnamine(DB01180)|Spirapril(DB01348)|Trandolapril(DB00519)													---	---	---	---
PSMD12	5718	broad.mit.edu	37	17	65362549	65362549	+	Silent	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:65362549G>T	uc002jfy.2	-	1	173	c.87C>A	c.(85-87)CCC>CCA	p.P29P	PSMD12_uc002jga.2_Silent_p.P29P|PSMD12_uc002jfz.2_5'UTR|PSMD12_uc010det.1_Silent_p.P29P	NM_002816	NP_002807	O00232	PSD12_HUMAN	proteasome 26S non-ATPase subunit 12 isoform 1	29					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	proteasome regulatory particle	protein binding				0	all_cancers(12;2.38e-11)|all_epithelial(3;8.27e-13)																	---	---	---	---
TSHZ1	10194	broad.mit.edu	37	18	72998359	72998359	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:72998359C>A	uc002lly.2	+	2	1425	c.862C>A	c.(862-864)CAG>AAG	p.Q288K		NM_005786	NP_005777	Q6ZSZ6	TSH1_HUMAN	teashirt family zinc finger 1	333						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		Esophageal squamous(42;0.129)|Prostate(75;0.142)|Melanoma(33;0.211)		Colorectal(1;0.000501)|READ - Rectum adenocarcinoma(2;0.00226)|BRCA - Breast invasive adenocarcinoma(31;0.246)														---	---	---	---
ZNF236	7776	broad.mit.edu	37	18	74607031	74607031	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:74607031C>A	uc002lmi.2	+	10	1672	c.1474C>A	c.(1474-1476)CGC>AGC	p.R492S	ZNF236_uc002lmj.2_RNA	NM_007345	NP_031371	Q9UL36	ZN236_HUMAN	zinc finger protein 236	492	C2H2-type 10.				cellular response to glucose stimulus	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(4)	4		Prostate(75;0.0405)|Esophageal squamous(42;0.129)|Melanoma(33;0.132)		OV - Ovarian serous cystadenocarcinoma(15;4.36e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0686)														---	---	---	---
REXO1	57455	broad.mit.edu	37	19	1819035	1819035	+	Silent	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1819035G>T	uc002lua.3	-	8	2841	c.2746C>A	c.(2746-2748)CGG>AGG	p.R916R	REXO1_uc010dsq.2_Silent_p.R225R|REXO1_uc010xgs.1_5'UTR|MIR1909_hsa-mir-1909|MI0008330_5'Flank|REXO1_uc010dsp.1_RNA	NM_020695	NP_065746	Q8N1G1	REXO1_HUMAN	transcription elongation factor B polypeptide 3	916						nucleus	exonuclease activity|nucleic acid binding				0		Ovarian(11;1.78e-06)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)														---	---	---	---
TBXA2R	6915	broad.mit.edu	37	19	3600596	3600596	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3600596G>A	uc002lyg.1	-	2	251	c.37C>T	c.(37-39)CGG>TGG	p.R13W	TBXA2R_uc002lye.1_Missense_Mutation_p.R13W	NM_001060	NP_001051	P21731	TA2R_HUMAN	thromboxane A2 receptor isoform alpha	13	Extracellular (Potential).				platelet activation	integral to plasma membrane	guanyl-nucleotide exchange factor activity|protein binding|thromboxane A2 receptor activity				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00253)|STAD - Stomach adenocarcinoma(1328;0.18)	Ridogrel(DB01207)													---	---	---	---
MATK	4145	broad.mit.edu	37	19	3789316	3789316	+	5'Flank	SNP	T	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3789316T>A	uc002lyt.2	-						MATK_uc002lyv.2_Missense_Mutation_p.R10S|MATK_uc002lyu.2_5'Flank|MATK_uc010dtq.2_5'Flank	NM_139355	NP_647612			megakaryocyte-associated tyrosine kinase isoform						cell proliferation|mesoderm development|positive regulation of cell proliferation	cytoplasm|nucleus	ATP binding|non-membrane spanning protein tyrosine kinase activity			stomach(2)|ovary(1)|lung(1)|large_intestine(1)	5		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00461)|STAD - Stomach adenocarcinoma(1328;0.18)														---	---	---	---
MUC16	94025	broad.mit.edu	37	19	9057759	9057759	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9057759G>C	uc002mkp.2	-	3	29891	c.29687C>G	c.(29686-29688)GCA>GGA	p.A9896G		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	9898	Ser-rich.|Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57																		---	---	---	---
MUC16	94025	broad.mit.edu	37	19	9060801	9060801	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9060801C>A	uc002mkp.2	-	3	26849	c.26645G>T	c.(26644-26646)CGG>CTG	p.R8882L		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	8884	Ser-rich.|Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57																		---	---	---	---
AKAP8	10270	broad.mit.edu	37	19	15483885	15483885	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15483885G>T	uc002nav.2	-	5	699	c.638C>A	c.(637-639)CCC>CAC	p.P213H	AKAP8_uc010dzy.2_5'UTR|AKAP8_uc010dzz.1_RNA|AKAP8_uc010xog.1_Missense_Mutation_p.P27H	NM_005858	NP_005849	O43823	AKAP8_HUMAN	A-kinase anchor protein 8	213					signal transduction	nuclear matrix				ovary(1)|breast(1)	2																		---	---	---	---
FAM129C	199786	broad.mit.edu	37	19	17641671	17641671	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17641671G>A	uc010xpr.1	+	3	394	c.256G>A	c.(256-258)GGA>AGA	p.G86R	FAM129C_uc010xpq.1_Missense_Mutation_p.G86R|FAM129C_uc010xps.1_Missense_Mutation_p.G55R|FAM129C_uc010xpt.1_Intron	NM_173544	NP_775815	Q86XR2	NIBL2_HUMAN	B-cell novel protein 1 isoform a	86											0																		---	---	---	---
PTH2	113091	broad.mit.edu	37	19	49926533	49926533	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49926533G>C	uc002pnn.1	-	1	166	c.64C>G	c.(64-66)CTG>GTG	p.L22V		NM_178449	NP_848544	Q96A98	TIP39_HUMAN	parathyroid hormone 2 preproprotein	22					neuropeptide signaling pathway	extracellular region					0				OV - Ovarian serous cystadenocarcinoma(262;0.0015)|GBM - Glioblastoma multiforme(486;0.044)|Lung(386;0.0785)|LUSC - Lung squamous cell carcinoma(496;0.0836)														---	---	---	---
ZNF665	79788	broad.mit.edu	37	19	53669357	53669357	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53669357C>T	uc010eqm.1	-	4	486	c.386G>A	c.(385-387)AGA>AAA	p.R129K		NM_024733	NP_079009	Q9H7R5	ZN665_HUMAN	zinc finger protein 665	64					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2				GBM - Glioblastoma multiforme(134;0.0196)														---	---	---	---
SIRPA	140885	broad.mit.edu	37	20	1903284	1903284	+	Silent	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:1903284C>A	uc002wfq.2	+	5	1440	c.1080C>A	c.(1078-1080)ACC>ACA	p.T360T	SIRPA_uc010zps.1_Silent_p.T340T|SIRPA_uc002wfr.2_Silent_p.T360T|SIRPA_uc002wfs.2_Silent_p.T360T|SIRPA_uc002wft.2_Silent_p.T360T	NM_001040022	NP_001035111	P78324	SHPS1_HUMAN	signal-regulatory protein alpha precursor	360	Extracellular (Potential).				blood coagulation|cell adhesion|cell junction assembly|leukocyte migration	integral to membrane|plasma membrane	SH3 domain binding			ovary(1)	1				Colorectal(46;0.018)|READ - Rectum adenocarcinoma(1;0.0556)														---	---	---	---
SLC4A11	83959	broad.mit.edu	37	20	3211459	3211459	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3211459C>A	uc002wig.2	-	10	1297	c.1249G>T	c.(1249-1251)GGG>TGG	p.G417W	SLC4A11_uc010zqe.1_Missense_Mutation_p.G444W|SLC4A11_uc002wih.2_RNA|SLC4A11_uc010zqf.1_Missense_Mutation_p.G401W	NM_032034	NP_114423	Q8NBS3	S4A11_HUMAN	solute carrier family 4 member 11	417	Helical; (Potential).|Membrane (bicarbonate transporter).				cellular cation homeostasis|fluid transport|phosphoenolpyruvate-dependent sugar phosphotransferase system	basolateral plasma membrane|integral to membrane	bicarbonate transmembrane transporter activity|borate transmembrane transporter activity|hydrogen ion channel activity|inorganic anion exchanger activity|sodium channel activity|sugar:hydrogen symporter activity			ovary(1)	1																		---	---	---	---
BFSP1	631	broad.mit.edu	37	20	17475023	17475023	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:17475023C>A	uc002wpo.2	-	8	1733	c.1694G>T	c.(1693-1695)CGG>CTG	p.R565L	BFSP1_uc002wpp.2_Missense_Mutation_p.R440L|BFSP1_uc010zrn.1_Missense_Mutation_p.R426L|BFSP1_uc010zro.1_Missense_Mutation_p.R426L	NM_001195	NP_001186	Q12934	BFSP1_HUMAN	filensin isoform 1	565	Tail.					cytoplasm|intermediate filament|membrane	structural constituent of cytoskeleton|structural constituent of eye lens			central_nervous_system(1)	1																		---	---	---	---
C20orf70	140683	broad.mit.edu	37	20	31768358	31768358	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31768358C>A	uc002wyo.1	+	8	813	c.742C>A	c.(742-744)CTC>ATC	p.L248I		NM_080574	NP_542141	Q96DR5	SPLC2_HUMAN	chromosome 20 open reading frame 70 precursor	248						extracellular region	lipid binding			ovary(1)|central_nervous_system(1)	2																		---	---	---	---
ITCH	83737	broad.mit.edu	37	20	33012331	33012331	+	Missense_Mutation	SNP	G	T	T	rs112357913		TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33012331G>T	uc010geu.1	+	8	836	c.644G>T	c.(643-645)AGA>ATA	p.R215I	ITCH_uc002xak.2_Missense_Mutation_p.R174I|ITCH_uc010zuj.1_Missense_Mutation_p.R64I	NM_031483	NP_113671	Q96J02	ITCH_HUMAN	itchy homolog E3 ubiquitin protein ligase	215					apoptosis|entry of virus into host cell|inflammatory response|innate immune response|negative regulation of apoptosis|negative regulation of defense response to virus|negative regulation of JNK cascade|negative regulation of NF-kappaB transcription factor activity|negative regulation of type I interferon production|protein K29-linked ubiquitination|protein K48-linked ubiquitination|protein K63-linked ubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of cell growth|regulation of protein deubiquitination|response to virus	cytosol|nucleus|plasma membrane	CXCR chemokine receptor binding|ribonucleoprotein binding|ubiquitin-protein ligase activity			breast(4)|lung(1)|central_nervous_system(1)	6																		---	---	---	---
C20orf152	140894	broad.mit.edu	37	20	34560550	34560550	+	Splice_Site	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:34560550G>T	uc002xes.1	+	2	208	c.52_splice	c.e2-1	p.G18_splice	C20orf152_uc002xer.1_Splice_Site_p.G18_splice|C20orf152_uc010gfp.1_Splice_Site					SubName: Full=C20orf152 protein;												0	Breast(12;0.00631)																	---	---	---	---
GHRH	2691	broad.mit.edu	37	20	35879622	35879622	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35879622C>A	uc002xgr.2	-	4	321	c.321G>T	c.(319-321)CAG>CAT	p.Q107H	GHRH_uc002xgs.2_Missense_Mutation_p.Q107H|GHRH_uc002xgt.2_Missense_Mutation_p.Q106H	NM_021081	NP_066567	P01286	SLIB_HUMAN	growth hormone releasing hormone preproprotein	107					activation of adenylate cyclase activity by G-protein signaling pathway|adenohypophysis development|growth hormone secretion|positive regulation of cAMP biosynthetic process|positive regulation of cell proliferation|positive regulation of circadian sleep/wake cycle, REM sleep|positive regulation of growth hormone secretion|positive regulation of insulin-like growth factor receptor signaling pathway|positive regulation of multicellular organism growth|response to food	extracellular space|terminal button	growth hormone-releasing hormone activity|growth hormone-releasing hormone receptor binding			ovary(1)	1		Myeloproliferative disorder(115;0.00878)																---	---	---	---
FAM83D	81610	broad.mit.edu	37	20	37580887	37580887	+	Silent	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37580887C>A	uc002xjg.2	+	4	1613	c.1572C>A	c.(1570-1572)CCC>CCA	p.P524P		NM_030919	NP_112181	Q9H4H8	FA83D_HUMAN	hypothetical protein LOC81610	494	Ser-rich.				cell division|mitosis	cytoplasm|spindle pole				ovary(3)	3		Myeloproliferative disorder(115;0.00878)																---	---	---	---
RBPJL	11317	broad.mit.edu	37	20	43945435	43945435	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:43945435G>T	uc002xns.2	+	12	1462	c.1390G>T	c.(1390-1392)GGG>TGG	p.G464W	RBPJL_uc002xnt.2_Missense_Mutation_p.R467L	NM_014276	NP_055091	Q9UBG7	RBPJL_HUMAN	recombining binding protein L	464	IPT/TIG.				signal transduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1		Myeloproliferative disorder(115;0.0122)																---	---	---	---
PIGT	51604	broad.mit.edu	37	20	44045146	44045146	+	Intron	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44045146C>A	uc002xoh.1	+						PIGT_uc010ghb.1_Intron|PIGT_uc010zwt.1_Intron|PIGT_uc010ghd.1_Intron|PIGT_uc010ghc.1_Intron|PIGT_uc010ghe.1_Intron|PIGT_uc010ghf.1_Intron|PIGT_uc002xoj.1_Intron|PIGT_uc002xok.1_Intron|PIGT_uc010zwu.1_Intron|PIGT_uc002xoi.1_Intron|PIGT_uc010zwv.1_Intron|PIGT_uc010zww.1_Intron|PIGT_uc010zwx.1_Intron|PIGT_uc010zwy.1_Intron|PIGT_uc010zwz.1_Intron|PIGT_uc010zxa.1_Intron|PIGT_uc002xol.1_5'Flank	NM_015937	NP_057021			phosphatidylinositol glycan anchor biosynthesis,						attachment of GPI anchor to protein|C-terminal protein lipidation	GPI-anchor transamidase complex	protein binding			pancreas(1)	1		Myeloproliferative disorder(115;0.0122)																---	---	---	---
GTPBP5	26164	broad.mit.edu	37	20	60770880	60770880	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60770880G>T	uc002yce.3	+	3	265	c.227G>T	c.(226-228)CGG>CTG	p.R76L	GTPBP5_uc011aab.1_5'UTR|GTPBP5_uc011aac.1_5'UTR|GTPBP5_uc011aad.1_5'UTR|GTPBP5_uc011aae.1_5'UTR|GTPBP5_uc011aaf.1_Missense_Mutation_p.R76L|GTPBP5_uc011aag.1_Missense_Mutation_p.R76L	NM_015666	NP_056481	Q9H4K7	GTPB5_HUMAN	GTP binding protein 5	76	Localized in the mitocondria.|Not localized in the mitocondria.				ribosome biogenesis	mitochondrion	GTP binding|GTPase activity|magnesium ion binding				0	Breast(26;3.52e-09)		BRCA - Breast invasive adenocarcinoma(19;2.5e-08)															---	---	---	---
PPDPF	79144	broad.mit.edu	37	20	62153190	62153190	+	Silent	SNP	C	A	A	rs113534342	byFrequency;by1000genomes	TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62153190C>A	uc002yff.2	+	4	443	c.303C>A	c.(301-303)CCC>CCA	p.P101P		NM_024299	NP_077275	Q9H3Y8	PPDPF_HUMAN	pancreatic progenitor cell differentiation and	101					cell differentiation|multicellular organismal development						0																		---	---	---	---
PRIC285	85441	broad.mit.edu	37	20	62200806	62200806	+	Silent	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62200806C>A	uc002yfm.2	-	5	1675	c.783G>T	c.(781-783)CCG>CCT	p.P261P	PRIC285_uc002yfl.1_5'Flank	NM_001037335	NP_001032412	Q9BYK8	PR285_HUMAN	PPAR-alpha interacting complex protein 285	261					cellular lipid metabolic process|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleoplasm	ATP binding|DNA binding|helicase activity|ribonuclease activity|RNA binding|transcription coactivator activity|zinc ion binding			central_nervous_system(2)	2	all_cancers(38;2.51e-11)|all_epithelial(29;8.27e-13)		Epithelial(9;1.27e-08)|all cancers(9;7.32e-08)|BRCA - Breast invasive adenocarcinoma(10;5.15e-06)															---	---	---	---
KRTAP21-1	337977	broad.mit.edu	37	21	32127495	32127495	+	Silent	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:32127495G>T	uc011adi.1	-	1	202	c.202C>A	c.(202-204)CGG>AGG	p.R68R		NM_181619	NP_853650	Q3LI58	KR211_HUMAN	keratin associated protein 21-1	68						intermediate filament				breast(1)	1																		---	---	---	---
KRTAP10-4	386672	broad.mit.edu	37	21	45994736	45994736	+	Silent	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45994736C>A	uc002zfk.1	+	1	1131	c.1101C>A	c.(1099-1101)CCC>CCA	p.P367P	C21orf29_uc002zfe.1_Intron|C21orf29_uc010gpv.1_Intron	NM_198687	NP_941960	P60372	KR104_HUMAN	keratin associated protein 10-4	367	36 X 5 AA repeats of C-C-X(3).					keratin filament					0																		---	---	---	---
PITPNB	23760	broad.mit.edu	37	22	28292625	28292625	+	Intron	SNP	C	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:28292625C>T	uc003adk.2	-						PITPNB_uc011akh.1_Intron|PITPNB_uc003adl.2_Intron	NM_012399	NP_036531			phosphatidylinositol transfer protein, beta						lipid metabolic process|transport	Golgi apparatus	lipid binding			skin(1)	1																		---	---	---	---
SCUBE1	80274	broad.mit.edu	37	22	43610231	43610231	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:43610231C>A	uc003bdt.1	-	16	2006	c.1918G>T	c.(1918-1920)GGT>TGT	p.G640C		NM_173050	NP_766638	Q8IWY4	SCUB1_HUMAN	signal peptide, CUB domain, EGF-like 1	640					adult heart development|blood coagulation|endothelial cell differentiation|inflammatory response|post-embryonic development|protein homooligomerization	external side of plasma membrane|extracellular space|extrinsic to plasma membrane	calcium ion binding|identical protein binding|protein heterodimerization activity			central_nervous_system(2)|ovary(1)|lung(1)|skin(1)	5		all_neural(38;0.0414)|Ovarian(80;0.07)																---	---	---	---
SFRS17A	8227	broad.mit.edu	37	X	1719899	1719899	+	Silent	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1719899G>T	uc004cqa.2	+	5	1696	c.1500G>T	c.(1498-1500)CCG>CCT	p.P500P	SFRS17A_uc004cqb.2_RNA|ASMT_uc004cqd.2_Intron	NM_005088	NP_005079	Q02040	AK17A_HUMAN	DNA segment on chromosome X and Y (unique) 155	500				P -> A (in Ref. 1; AAA61303 and 4; AAI10497).	B cell activation|mRNA processing|regulation of transcription, DNA-dependent|RNA splicing|signal transduction	nuclear speck|spliceosomal complex	nucleotide binding|protein binding|RNA binding				0		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)																---	---	---	---
APOO	79135	broad.mit.edu	37	X	23886763	23886763	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:23886763G>T	uc004dax.2	-	5	566	c.335C>A	c.(334-336)CCG>CAG	p.P112Q	APOO_uc004daw.2_RNA|APOO_uc004day.3_RNA	NM_024122	NP_077027	Q9BUR5	APOO_HUMAN	apolipoprotein O precursor	112	Helical; (Potential).				lipid transport	high-density lipoprotein particle|integral to membrane|low-density lipoprotein particle|very-low-density lipoprotein particle					0																		---	---	---	---
MAGEB10	139422	broad.mit.edu	37	X	27840456	27840456	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:27840456C>A	uc004dbw.2	+	3	1260	c.1033C>A	c.(1033-1035)CAA>AAA	p.Q345K		NM_182506	NP_872312	Q96LZ2	MAGBA_HUMAN	melanoma antigen family B, 10	345										lung(1)|breast(1)|central_nervous_system(1)	3																		---	---	---	---
SYTL5	94122	broad.mit.edu	37	X	37985932	37985932	+	Silent	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:37985932C>A	uc004ddu.2	+	18	2676	c.2142C>A	c.(2140-2142)CCC>CCA	p.P714P	SYTL5_uc004ddv.2_Silent_p.P714P|SYTL5_uc004ddx.2_Silent_p.P736P	NM_001163335	NP_001156807	Q8TDW5	SYTL5_HUMAN	synaptotagmin-like 5 isoform 1	714					intracellular protein transport	membrane	metal ion binding|Rab GTPase binding			skin(1)	1																		---	---	---	---
USP9X	8239	broad.mit.edu	37	X	41010251	41010251	+	Silent	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:41010251C>A	uc004dfb.2	+	13	2337	c.1704C>A	c.(1702-1704)CCC>CCA	p.P568P	USP9X_uc004dfc.2_Silent_p.P568P	NM_001039590	NP_001034679	Q93008	USP9X_HUMAN	ubiquitin specific protease 9, X-linked isoform	568					BMP signaling pathway|cell division|chromosome segregation|female gamete generation|mitosis|protein deubiquitination|transforming growth factor beta receptor signaling pathway|ubiquitin-dependent protein catabolic process	cytoplasm	co-SMAD binding|cysteine-type endopeptidase activity|ubiquitin thiolesterase activity			lung(3)|breast(2)|ovary(1)	6																		---	---	---	---
ZNF81	347344	broad.mit.edu	37	X	47755321	47755321	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:47755321C>A	uc010nhy.1	+	5	627	c.259C>A	c.(259-261)CCA>ACA	p.P87T		NM_007137	NP_009068	P51508	ZNF81_HUMAN	zinc finger protein 81	87	KRAB.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		all_lung(315;0.0973)																---	---	---	---
ZXDB	158586	broad.mit.edu	37	X	57619829	57619829	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:57619829G>T	uc004dvd.2	+	1	1561	c.1348G>T	c.(1348-1350)GGC>TGC	p.G450C		NM_007157	NP_009088	P98169	ZXDB_HUMAN	zinc finger, X-linked, duplicated B	450	Required for interaction with ZXDC (By similarity).				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding|zinc ion binding				0																		---	---	---	---
STARD8	9754	broad.mit.edu	37	X	67943490	67943490	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:67943490G>A	uc004dxa.2	+	12	2954	c.2582G>A	c.(2581-2583)CGG>CAG	p.R861Q	STARD8_uc004dxb.2_Missense_Mutation_p.R941Q|STARD8_uc004dxc.3_Missense_Mutation_p.R861Q	NM_014725	NP_055540	Q92502	STAR8_HUMAN	StAR-related lipid transfer (START) domain	861	START.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|focal adhesion	GTPase activator activity			breast(3)|ovary(2)|pancreas(1)	6																		---	---	---	---
KIF4A	24137	broad.mit.edu	37	X	69637775	69637775	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:69637775G>T	uc004dyg.2	+	29	3420	c.3293G>T	c.(3292-3294)GGG>GTG	p.G1098V	KIF4A_uc010nkw.2_Missense_Mutation_p.G1098V	NM_012310	NP_036442	O95239	KIF4A_HUMAN	kinesin family member 4	1098	Globular.|Interaction with PRC1.				anterograde axon cargo transport|axon guidance|blood coagulation|organelle organization	chromosome|cytosol|midbody|nuclear matrix|spindle microtubule	ATP binding|DNA binding|microtubule motor activity|protein binding			ovary(4)	4																		---	---	---	---
FLJ44635	392490	broad.mit.edu	37	X	71380091	71380091	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:71380091C>A	uc004eal.1	+	2	760	c.412C>A	c.(412-414)CAG>AAG	p.Q138K		NM_207422	NP_997305	Q56UQ5	TPT1L_HUMAN	hypothetical protein LOC392490	138										lung(1)	1	Renal(35;0.156)																	---	---	---	---
ERCC6L	54821	broad.mit.edu	37	X	71427358	71427358	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:71427358C>A	uc004eaq.1	-	2	1356	c.1259G>T	c.(1258-1260)CGG>CTG	p.R420L	PIN4_uc004eao.1_Intron|ERCC6L_uc004eap.1_Missense_Mutation_p.R297L	NM_017669	NP_060139	Q2NKX8	ERC6L_HUMAN	excision repair protein ERCC6-like	420					cell division|mitotic prometaphase	condensed chromosome kinetochore|cytosol	ATP binding|DNA binding|helicase activity|protein binding			ovary(3)	3	Renal(35;0.156)																	---	---	---	---
POF1B	79983	broad.mit.edu	37	X	84634245	84634245	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:84634245C>A	uc004eer.2	-	2	361	c.215G>T	c.(214-216)CGG>CTG	p.R72L	POF1B_uc004ees.2_Missense_Mutation_p.R72L	NM_024921	NP_079197	Q8WVV4	POF1B_HUMAN	premature ovarian failure, 1B	72							actin binding				0																		---	---	---	---
CENPI	2491	broad.mit.edu	37	X	100383802	100383802	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:100383802G>T	uc004egx.2	+	11	1442	c.1172G>T	c.(1171-1173)TGG>TTG	p.W391L	CENPI_uc011mrg.1_Missense_Mutation_p.W391L|CENPI_uc004egy.2_Missense_Mutation_p.W391L	NM_006733	NP_006724	Q92674	CENPI_HUMAN	centromere protein I	391					CenH3-containing nucleosome assembly at centromere|mitotic prometaphase	cytosol|kinetochore|nucleoplasm	protein binding			skin(1)	1																		---	---	---	---
RGAG1	57529	broad.mit.edu	37	X	109695526	109695526	+	Silent	SNP	T	C	C			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:109695526T>C	uc004eor.1	+	3	1927	c.1681T>C	c.(1681-1683)TTG>CTG	p.L561L	RGAG1_uc011msr.1_Silent_p.L561L	NM_020769	NP_065820	Q8NET4	RGAG1_HUMAN	retrotransposon gag domain containing 1	561										lung(2)|upper_aerodigestive_tract(1)|ovary(1)	4																		---	---	---	---
THOC2	57187	broad.mit.edu	37	X	122744807	122744807	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:122744807A>G	uc004etu.2	-	38	4794	c.4762T>C	c.(4762-4764)TCC>CCC	p.S1588P	THOC2_uc004etv.3_RNA	NM_001081550	NP_001075019	Q8NI27	THOC2_HUMAN	THO complex 2	1588	Lys-rich.				intronless viral mRNA export from host nucleus|mRNA processing|RNA splicing	THO complex part of transcription export complex	protein binding|RNA binding			ovary(3)	3																		---	---	---	---
RAB33A	9363	broad.mit.edu	37	X	129318434	129318434	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:129318434C>A	uc004evl.2	+	2	698	c.434C>A	c.(433-435)CCC>CAC	p.P145H	RAB33A_uc010nre.2_RNA	NM_004794	NP_004785	Q14088	RB33A_HUMAN	Ras-related protein Rab-33A	145					protein transport|small GTPase mediated signal transduction	plasma membrane	GTP binding|GTPase activity|protein binding				0																		---	---	---	---
PHF6	84295	broad.mit.edu	37	X	133527606	133527606	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:133527606C>A	uc004exj.2	+	4	518	c.316C>A	c.(316-318)CAC>AAC	p.H106N	PHF6_uc004exk.2_Missense_Mutation_p.H106N|PHF6_uc011mvk.1_Missense_Mutation_p.H72N|PHF6_uc004exh.2_Missense_Mutation_p.H106N|PHF6_uc010nrr.2_Missense_Mutation_p.H106N|PHF6_uc004exi.2_Missense_Mutation_p.H106N	NM_001015877	NP_001015877	Q8IWS0	PHF6_HUMAN	PHD finger protein 6 isoform 1	106	PHD-type 1; degenerate.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleolus	zinc ion binding			ovary(1)	1	Acute lymphoblastic leukemia(192;0.000127)																	---	---	---	---
ARHGEF6	9459	broad.mit.edu	37	X	135772764	135772764	+	Intron	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:135772764C>A	uc004fab.2	-						ARHGEF6_uc011mwd.1_Intron|ARHGEF6_uc011mwe.1_Intron	NM_004840	NP_004831			Rac/Cdc42 guanine nucleotide exchange factor 6						apoptosis|cell junction assembly|induction of apoptosis by extracellular signals|JNK cascade|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|Rho guanyl-nucleotide exchange factor activity				0	Acute lymphoblastic leukemia(192;0.000127)																	---	---	---	---
MTM1	4534	broad.mit.edu	37	X	149814302	149814302	+	Silent	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:149814302C>A	uc004fef.3	+	9	901	c.825C>A	c.(823-825)ACC>ACA	p.T275T	MTM1_uc011mxx.1_RNA|MTM1_uc011mxy.1_Silent_p.T238T|MTM1_uc011mxz.1_Silent_p.T160T|MTM1_uc010nte.2_Silent_p.T143T	NM_000252	NP_000243	Q13496	MTM1_HUMAN	myotubularin	275	Myotubularin phosphatase.				endosome to lysosome transport|intermediate filament organization|mitochondrion distribution|mitochondrion morphogenesis|phosphatidylinositol dephosphorylation|protein transport|regulation of vacuole organization	filopodium|late endosome|plasma membrane|ruffle	intermediate filament binding|phosphatidylinositol binding|phosphatidylinositol-3,5-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein tyrosine phosphatase activity			upper_aerodigestive_tract(1)|ovary(1)|kidney(1)	3	Acute lymphoblastic leukemia(192;6.56e-05)																	---	---	---	---
GABRQ	55879	broad.mit.edu	37	X	151808925	151808925	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:151808925G>T	uc004ffp.1	+	2	256	c.236G>T	c.(235-237)GGA>GTA	p.G79V		NM_018558	NP_061028	Q9UN88	GBRT_HUMAN	gamma-aminobutyric acid (GABA) receptor, theta	79	Extracellular (Potential).					cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity|neurotransmitter transporter activity			ovary(2)|pancreas(1)	3	Acute lymphoblastic leukemia(192;6.56e-05)																	---	---	---	---
CLCN6	1185	broad.mit.edu	37	1	11889289	11889289	+	Silent	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11889289C>A	uc001ate.3	+	13	1271	c.1158C>A	c.(1156-1158)ACC>ACA	p.T386T	CLCN6_uc009vnh.1_Missense_Mutation_p.R331S|CLCN6_uc010oat.1_Silent_p.T102T|CLCN6_uc010oau.1_Silent_p.T364T	NM_001286	NP_001277	P51797	CLCN6_HUMAN	chloride channel 6 isoform ClC-6a	386	Helical; (By similarity).				cell volume homeostasis|signal transduction	endosome membrane|integral to membrane	antiporter activity|ATP binding|voltage-gated chloride channel activity				0	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.13e-06)|COAD - Colon adenocarcinoma(227;0.000274)|BRCA - Breast invasive adenocarcinoma(304;0.000311)|Kidney(185;0.000816)|KIRC - Kidney renal clear cell carcinoma(229;0.00268)|STAD - Stomach adenocarcinoma(313;0.00743)|READ - Rectum adenocarcinoma(331;0.0649)														---	---	---	---
AGMAT	79814	broad.mit.edu	37	1	15901266	15901266	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:15901266G>T	uc001awv.1	-	6	1114	c.971C>A	c.(970-972)CCG>CAG	p.P324Q	DNAJC16_uc001awu.2_RNA	NM_024758	NP_079034	Q9BSE5	SPEB_HUMAN	agmatine ureohydrolase (agmatinase) precursor	324					putrescine biosynthetic process|spermidine biosynthetic process	mitochondrion	agmatinase activity|metal ion binding			skin(1)	1		Breast(348;0.000207)|Colorectal(325;0.000258)|Lung NSC(340;0.000359)|all_lung(284;0.000486)|Renal(390;0.000518)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.93e-07)|COAD - Colon adenocarcinoma(227;3.91e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000121)|KIRC - Kidney renal clear cell carcinoma(229;0.00257)|STAD - Stomach adenocarcinoma(313;0.00734)|READ - Rectum adenocarcinoma(331;0.0649)														---	---	---	---
PQLC2	54896	broad.mit.edu	37	1	19644335	19644335	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:19644335C>A	uc001bby.2	+	3	516	c.164C>A	c.(163-165)CCC>CAC	p.P55H	PQLC2_uc001bbz.2_Intron|PQLC2_uc001bca.2_Missense_Mutation_p.P55H|PQLC2_uc001bcb.2_Intron|PQLC2_uc001bcc.2_5'UTR	NM_017765	NP_060235	Q6ZP29	PQLC2_HUMAN	PQ loop repeat containing 2 isoform 1	55	PQ-loop 1.|Helical; (Potential).					integral to membrane					0		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Breast(348;0.00049)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00466)|BRCA - Breast invasive adenocarcinoma(304;1.89e-05)|Kidney(64;0.000177)|GBM - Glioblastoma multiforme(114;0.00124)|KIRC - Kidney renal clear cell carcinoma(64;0.00262)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)														---	---	---	---
PLA2G5	5322	broad.mit.edu	37	1	20417065	20417065	+	Silent	SNP	C	A	A	rs139841773	byFrequency	TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:20417065C>A	uc001bcy.2	+	5	565	c.297C>A	c.(295-297)CCC>CCA	p.P99P	PLA2G5_uc001bcw.2_RNA|PLA2G5_uc001bcx.2_Silent_p.P130P	NM_000929	NP_000920	P39877	PA2G5_HUMAN	phospholipase A2, group V precursor	99					lipid catabolic process	extracellular region	calcium ion binding|calcium-dependent phospholipase A2 activity			skin(1)	1		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000249)|Lung NSC(340;0.000287)|Breast(348;0.000812)|Ovarian(437;0.00328)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|COAD - Colon adenocarcinoma(152;1.22e-05)|BRCA - Breast invasive adenocarcinoma(304;8.15e-05)|Kidney(64;0.000184)|GBM - Glioblastoma multiforme(114;0.00089)|KIRC - Kidney renal clear cell carcinoma(64;0.0027)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0652)														---	---	---	---
PTPRU	10076	broad.mit.edu	37	1	29631906	29631906	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:29631906C>A	uc001bru.2	+	19	2926	c.2816C>A	c.(2815-2817)CCC>CAC	p.P939H	PTPRU_uc001brv.2_Missense_Mutation_p.P929H|PTPRU_uc001brw.2_Missense_Mutation_p.P929H|PTPRU_uc009vtq.2_Missense_Mutation_p.P929H|PTPRU_uc009vtr.2_Missense_Mutation_p.P929H	NM_005704	NP_005695	Q92729	PTPRU_HUMAN	protein tyrosine phosphatase, receptor type, U	939	Tyrosine-protein phosphatase 1.|Cytoplasmic (Potential).				canonical Wnt receptor signaling pathway|cell differentiation|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of transcription, DNA-dependent|protein localization at cell surface|transmembrane receptor protein tyrosine phosphatase signaling pathway	cell-cell junction|integral to plasma membrane	beta-catenin binding|transmembrane receptor protein tyrosine phosphatase activity			large_intestine(3)|ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	7		Colorectal(325;0.000399)|Lung NSC(340;0.00953)|all_lung(284;0.0112)|Breast(348;0.0126)|all_neural(195;0.0199)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;6.99e-07)|COAD - Colon adenocarcinoma(152;3.18e-05)|STAD - Stomach adenocarcinoma(196;0.0234)|READ - Rectum adenocarcinoma(331;0.0686)|BRCA - Breast invasive adenocarcinoma(304;0.0871)														---	---	---	---
MACF1	23499	broad.mit.edu	37	1	39812874	39812874	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39812874C>A	uc010oiu.1	+	5	6258	c.6127C>A	c.(6127-6129)CTG>ATG	p.L2043M	MACF1_uc010ois.1_Intron|MACF1_uc001cda.1_Intron|MACF1_uc001cdc.1_Intron|MACF1_uc001cdb.1_Intron	NM_033044	NP_149033	Q9UPN3	MACF1_HUMAN	microfilament and actin filament cross-linker	3608					cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding			ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)															---	---	---	---
MED8	112950	broad.mit.edu	37	1	43851858	43851858	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43851858G>A	uc001cjg.3	-	6	581	c.533C>T	c.(532-534)ACT>ATT	p.T178I	MED8_uc001cje.1_Missense_Mutation_p.T178I|MED8_uc001cjf.3_Missense_Mutation_p.T89I	NM_201542	NP_963836	Q96G25	MED8_HUMAN	mediator complex subunit 8 isoform 1	178					regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	mediator complex					0	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)																---	---	---	---
ASB17	127247	broad.mit.edu	37	1	76397883	76397883	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:76397883G>T	uc001dhe.1	-	1	234	c.94C>A	c.(94-96)CTA>ATA	p.L32I	ASB17_uc001dhf.1_RNA	NM_080868	NP_543144	Q8WXJ9	ASB17_HUMAN	ankyrin repeat and SOCS box-containing 17	32					intracellular signal transduction					ovary(1)	1																		---	---	---	---
ABCD3	5825	broad.mit.edu	37	1	94933463	94933463	+	Intron	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:94933463G>T	uc001dqn.3	+						ABCD3_uc001dqm.3_Intron|ABCD3_uc010oto.1_Intron|ABCD3_uc010otp.1_Intron|ABCD3_uc009wdr.2_Intron	NM_002858	NP_002849			ATP-binding cassette, sub-family D, member 3						peroxisomal long-chain fatty acid import|peroxisome organization	cytosol|integral to peroxisomal membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			skin(1)	1		all_lung(203;0.000434)|Lung NSC(277;0.0019)		all cancers(265;0.0261)|Epithelial(280;0.165)														---	---	---	---
RBM15	64783	broad.mit.edu	37	1	110884012	110884012	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:110884012C>A	uc001dzl.1	+	1	2068	c.1985C>A	c.(1984-1986)CCA>CAA	p.P662Q	RBM15_uc001dzm.1_Missense_Mutation_p.P662Q|uc001dzj.2_5'Flank	NM_022768	NP_073605	Q96T37	RBM15_HUMAN	RNA binding motif protein 15	662	Arg-rich.				interspecies interaction between organisms	nucleus	nucleotide binding|protein binding|RNA binding			ovary(3)	3		all_cancers(81;2.89e-06)|all_epithelial(167;2.96e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)|Breast(1374;0.0634)		BRCA - Breast invasive adenocarcinoma(282;0.000224)|Epithelial(280;0.000476)|Kidney(133;0.000539)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|all cancers(265;0.00144)|Lung(183;0.0238)|Colorectal(144;0.103)|LUSC - Lung squamous cell carcinoma(189;0.135)				T	MKL1	acute megakaryocytic leukemia								---	---	---	---
CHI3L2	1117	broad.mit.edu	37	1	111781383	111781383	+	Silent	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:111781383G>T	uc001eam.2	+	8	818	c.747G>T	c.(745-747)GTG>GTT	p.V249V	CHI3L2_uc001ean.2_Silent_p.V239V|CHI3L2_uc001eao.2_Silent_p.V170V|CHI3L2_uc009wga.2_Silent_p.V170V	NM_004000	NP_003991	Q15782	CH3L2_HUMAN	chitinase 3-like 2 isoform a	249					chitin catabolic process	extracellular space	cation binding|chitinase activity			central_nervous_system(1)	1		all_cancers(81;1.89e-05)|all_epithelial(167;7.36e-06)|all_lung(203;0.00018)|Lung NSC(277;0.000359)		Lung(183;0.0171)|Colorectal(144;0.0387)|all cancers(265;0.0464)|LUSC - Lung squamous cell carcinoma(189;0.0872)|Epithelial(280;0.0994)|COAD - Colon adenocarcinoma(174;0.141)														---	---	---	---
PI4KB	5298	broad.mit.edu	37	1	151271323	151271323	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151271323C>A	uc001ext.2	-	9	2391	c.1976G>T	c.(1975-1977)GGG>GTG	p.G659V	PI4KB_uc001exr.2_Missense_Mutation_p.G671V|PI4KB_uc001exs.2_Missense_Mutation_p.G644V|PI4KB_uc001exu.2_Missense_Mutation_p.G644V|PI4KB_uc010pcw.1_Missense_Mutation_p.G327V	NM_002651	NP_002642	Q9UBF8	PI4KB_HUMAN	catalytic phosphatidylinositol 4-kinase beta	659	PI3K/PI4K.				phosphatidylinositol biosynthetic process|phosphatidylinositol-mediated signaling|receptor-mediated endocytosis	endosome|Golgi apparatus|mitochondrial outer membrane|perinuclear region of cytoplasm|rough endoplasmic reticulum membrane	1-phosphatidylinositol 4-kinase activity|ATP binding|protein binding			ovary(2)|skin(2)	4	Lung SC(34;0.00471)|Ovarian(49;0.0147)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)															---	---	---	---
SMCP	4184	broad.mit.edu	37	1	152857173	152857173	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152857173C>A	uc001fat.2	+	2	420	c.275C>A	c.(274-276)CCG>CAG	p.P92Q		NM_030663	NP_109588	P49901	MCSP_HUMAN	sperm mitochondria-associated cysteine-rich	92					penetration of zona pellucida|sperm motility	mitochondrial membrane					0	Lung NSC(65;3.97e-29)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)															---	---	---	---
LMNA	4000	broad.mit.edu	37	1	156104721	156104721	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156104721G>T	uc001fni.2	+	4	1014	c.765G>T	c.(763-765)CAG>CAT	p.Q255H	LMNA_uc001fnf.1_Missense_Mutation_p.Q255H|LMNA_uc001fng.2_Missense_Mutation_p.Q255H|LMNA_uc001fnh.2_Missense_Mutation_p.Q255H|LMNA_uc009wro.1_Missense_Mutation_p.Q255H|LMNA_uc010pgz.1_Missense_Mutation_p.Q143H|LMNA_uc001fnj.2_Missense_Mutation_p.Q174H|LMNA_uc001fnk.2_Missense_Mutation_p.Q156H|LMNA_uc009wrp.2_5'Flank|LMNA_uc010pha.1_5'Flank	NM_170707	NP_733821	P02545	LMNA_HUMAN	lamin A/C isoform 1 precursor	255	Coil 2.|Rod.				cellular component disassembly involved in apoptosis|cellular response to hypoxia|establishment or maintenance of microtubule cytoskeleton polarity|muscle organ development|positive regulation of cell aging|regulation of apoptosis|regulation of cell migration	cytoplasm|lamin filament|nuclear envelope|nuclear envelope|perinuclear region of cytoplasm	protein binding|structural molecule activity|structural molecule activity			ovary(2)	2	Hepatocellular(266;0.158)													Werner_syndrome|Hutchinson-Gilford_Progeria_Syndrome				---	---	---	---
IFI16	3428	broad.mit.edu	37	1	158990198	158990198	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158990198G>T	uc001ftg.2	+	6	1330	c.1040G>T	c.(1039-1041)GGG>GTG	p.G347V	IFI16_uc010pis.1_Missense_Mutation_p.G291V	NM_005531	NP_005522	Q16666	IF16_HUMAN	interferon, gamma-inducible protein 16	347	HIN-200 1.				cell proliferation|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|monocyte differentiation|negative regulation of transcription, DNA-dependent|response to virus|transcription, DNA-dependent	cytoplasm|nuclear speck|nucleolus	double-stranded DNA binding|protein binding			ovary(1)	1	all_hematologic(112;0.0429)																	---	---	---	---
LY9	4063	broad.mit.edu	37	1	160783561	160783561	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160783561A>G	uc001fwu.2	+	3	640	c.590A>G	c.(589-591)CAT>CGT	p.H197R	LY9_uc010pjs.1_Missense_Mutation_p.H197R|LY9_uc001fwv.2_Missense_Mutation_p.H197R|LY9_uc001fww.2_Missense_Mutation_p.H197R|LY9_uc001fwx.2_Missense_Mutation_p.H197R|LY9_uc001fwy.1_Missense_Mutation_p.H99R|LY9_uc001fwz.2_5'Flank	NM_002348	NP_002339	Q9HBG7	LY9_HUMAN	lymphocyte antigen 9 isoform a	197	Extracellular (Potential).|Ig-like C2-type 1.				cell adhesion|immunoglobulin mediated immune response	integral to membrane				ovary(1)	1	all_cancers(52;2.72e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00737)															---	---	---	---
USF1	7391	broad.mit.edu	37	1	161009753	161009753	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161009753C>A	uc001fxi.2	-	11	1085	c.890G>T	c.(889-891)CGG>CTG	p.R297L	F11R_uc010pjw.1_5'Flank|F11R_uc001fxf.3_5'Flank|TSTD1_uc010pjx.1_5'Flank|TSTD1_uc009wtw.2_5'Flank|TSTD1_uc001fxh.3_5'Flank|USF1_uc001fxj.2_Missense_Mutation_p.R238L	NM_007122	NP_009053	P22415	USF1_HUMAN	upstream stimulatory factor 1 isoform 1	297					cellular response to insulin stimulus|glucose homeostasis|late viral mRNA transcription|lipid homeostasis|positive regulation of transcription from RNA polymerase II promoter by glucose|response to hypoxia|response to UV	transcription factor complex	bHLH transcription factor binding|histone deacetylase binding|protein heterodimerization activity|protein homodimerization activity|protein kinase binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity			upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	3	all_cancers(52;6.73e-18)|Breast(13;0.012)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00122)															---	---	---	---
OLFML2B	25903	broad.mit.edu	37	1	161968122	161968122	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161968122C>A	uc001gbu.2	-	6	1391	c.967G>T	c.(967-969)GGT>TGT	p.G323C	OLFML2B_uc010pkq.1_Missense_Mutation_p.G324C	NM_015441	NP_056256	Q68BL8	OLM2B_HUMAN	olfactomedin-like 2B precursor	323										skin(1)	1	all_hematologic(112;0.156)		BRCA - Breast invasive adenocarcinoma(70;0.0172)															---	---	---	---
SCYL3	57147	broad.mit.edu	37	1	169831833	169831833	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169831833C>A	uc001ggs.2	-	10	1259	c.1061G>T	c.(1060-1062)CGG>CTG	p.R354L	SCYL3_uc010plw.1_5'UTR|SCYL3_uc001ggt.2_Missense_Mutation_p.R354L|SCYL3_uc001ggu.2_RNA	NM_181093	NP_851607	Q8IZE3	PACE1_HUMAN	SCY1-like 3 isoform 2	354	HEAT 3.				cell migration	Golgi apparatus|lamellipodium	ATP binding|protein binding|protein kinase activity			ovary(1)|skin(1)	2	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)																	---	---	---	---
MYOC	4653	broad.mit.edu	37	1	171605172	171605172	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:171605172G>T	uc001ghu.2	-	3	1430	c.1408C>A	c.(1408-1410)CGC>AGC	p.R470S	MYOC_uc010pmk.1_Missense_Mutation_p.R412S	NM_000261	NP_000252	Q99972	MYOC_HUMAN	myocilin precursor	470	Olfactomedin-like.		R -> C (in GLC1A).|R -> H.		anatomical structure morphogenesis	cilium|extracellular space|rough endoplasmic reticulum	structural molecule activity			lung(1)	1	all_cancers(6;5.47e-10)|all_hematologic(923;0.088)|Acute lymphoblastic leukemia(37;0.181)																	---	---	---	---
DHX9	1660	broad.mit.edu	37	1	182853798	182853798	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:182853798G>T	uc001gpr.2	+	27	3474	c.3311G>T	c.(3310-3312)CGG>CTG	p.R1104L	DHX9_uc001gps.2_Missense_Mutation_p.R890L|DHX9_uc001gpt.2_Missense_Mutation_p.R383L|DHX9_uc009wyd.2_Missense_Mutation_p.R69L	NM_001357	NP_001348	Q08211	DHX9_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 9	1104					CRD-mediated mRNA stabilization|nuclear mRNA splicing, via spliceosome	centrosome|CRD-mediated mRNA stability complex|nucleolus|nucleoplasm|ribonucleoprotein complex	ATP binding|ATP-dependent DNA helicase activity|ATP-dependent RNA helicase activity|DNA binding|double-stranded RNA binding|protein binding			ovary(2)	2																		---	---	---	---
GLT25D2	23127	broad.mit.edu	37	1	183908174	183908174	+	Intron	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:183908174G>T	uc001gqr.2	-						GLT25D2_uc010poj.1_Intron|GLT25D2_uc001gqp.2_Intron|GLT25D2_uc001gqq.2_Intron|GLT25D2_uc001gqs.2_Intron	NM_015101	NP_055916			glycosyltransferase 25 domain containing 2						lipopolysaccharide biosynthetic process	endoplasmic reticulum lumen	procollagen galactosyltransferase activity			ovary(1)|breast(1)	2																		---	---	---	---
TPR	7175	broad.mit.edu	37	1	186330996	186330996	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186330996C>A	uc001grv.2	-	8	1092	c.795G>T	c.(793-795)AAG>AAT	p.K265N	TPR_uc010pop.1_Missense_Mutation_p.K341N	NM_003292	NP_003283	P12270	TPR_HUMAN	nuclear pore complex-associated protein TPR	265	Potential.				carbohydrate metabolic process|glucose transport|mitotic cell cycle spindle assembly checkpoint|mRNA transport|protein import into nucleus|regulation of glucose transport|seryl-tRNA aminoacylation|transmembrane transport|viral reproduction	condensed chromosome kinetochore|cytoplasm|nuclear membrane|nuclear pore|nucleoplasm	ATP binding|protein binding|serine-tRNA ligase activity			ovary(2)|lung(2)|urinary_tract(1)|central_nervous_system(1)|skin(1)	7		Breast(1374;0.000659)|Lung SC(1967;0.0262)|Prostate(1639;0.157)		Colorectal(1306;1.12e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00553)				T	NTRK1	papillary thyroid								---	---	---	---
LGR6	59352	broad.mit.edu	37	1	202249902	202249902	+	Intron	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:202249902C>A	uc001gxu.2	+						LGR6_uc001gxv.2_Intron|LGR6_uc009xab.2_Intron|LGR6_uc001gxw.2_Intron|LGR6_uc009xac.1_Intron	NM_001017403	NP_001017403			leucine-rich repeat-containing G protein-coupled							integral to membrane|plasma membrane	protein-hormone receptor activity			large_intestine(4)|ovary(3)|skin(2)|pancreas(1)	10																		---	---	---	---
PPP1R15B	84919	broad.mit.edu	37	1	204380537	204380537	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:204380537C>G	uc001hav.3	-	1	408	c.3G>C	c.(1-3)ATG>ATC	p.M1I		NM_032833	NP_116222	Q5SWA1	PR15B_HUMAN	protein phosphatase 1, regulatory subunit 15B	1					regulation of translation					ovary(1)|pancreas(1)	2	all_cancers(21;0.0032)|all_neural(3;0.0218)|Glioma(3;0.0382)|Breast(84;0.179)|all_epithelial(62;0.193)|Prostate(682;0.227)		all cancers(3;1.14e-29)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.139)															---	---	---	---
CNTN2	6900	broad.mit.edu	37	1	205038689	205038689	+	Silent	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:205038689G>T	uc001hbr.2	+	17	2465	c.2196G>T	c.(2194-2196)ACG>ACT	p.T732T	CNTN2_uc001hbq.1_Silent_p.T623T|CNTN2_uc001hbs.2_Silent_p.T520T	NM_005076	NP_005067	Q02246	CNTN2_HUMAN	contactin 2 precursor	732	Fibronectin type-III 2.				axon guidance|clustering of voltage-gated potassium channels	anchored to membrane|juxtaparanode region of axon|myelin sheath|node of Ranvier|synapse part	identical protein binding			ovary(1)	1	all_cancers(21;0.144)|Breast(84;0.0437)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)															---	---	---	---
PLXNA2	5362	broad.mit.edu	37	1	208270138	208270138	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:208270138C>A	uc001hgz.2	-	7	2580	c.1822G>T	c.(1822-1824)GGG>TGG	p.G608W		NM_025179	NP_079455	O75051	PLXA2_HUMAN	plexin A2 precursor	608	Extracellular (Potential).				axon guidance	integral to membrane|intracellular|plasma membrane				ovary(2)|central_nervous_system(1)	3				OV - Ovarian serous cystadenocarcinoma(81;0.199)														---	---	---	---
OBSCN	84033	broad.mit.edu	37	1	228466620	228466620	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:228466620G>T	uc009xez.1	+	26	7134	c.7090G>T	c.(7090-7092)GGT>TGT	p.G2364C	OBSCN_uc001hsn.2_Missense_Mutation_p.G2364C|OBSCN_uc001hsp.1_Missense_Mutation_p.G63C|OBSCN_uc001hsq.1_5'Flank	NM_001098623	NP_001092093	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and	2364	Ig-like 23.				apoptosis|cell differentiation|induction of apoptosis by extracellular signals|multicellular organismal development|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|M band|Z disc	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity|Rho guanyl-nucleotide exchange factor activity|structural constituent of muscle|titin binding			stomach(8)|large_intestine(7)|breast(5)|ovary(4)|skin(2)|central_nervous_system(1)|pancreas(1)	28		Prostate(94;0.0405)																---	---	---	---
EXO1	9156	broad.mit.edu	37	1	242016726	242016726	+	Silent	SNP	A	G	G			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:242016726A>G	uc001hzh.2	+	6	888	c.348A>G	c.(346-348)CGA>CGG	p.R116R	EXO1_uc001hzi.2_Silent_p.R116R|EXO1_uc001hzj.2_Silent_p.R116R|EXO1_uc009xgq.2_Silent_p.R116R	NM_130398	NP_569082	Q9UQ84	EXO1_HUMAN	exonuclease 1 isoform b	116					meiosis|mismatch repair	nucleus	double-stranded DNA specific 5'-3' exodeoxyribonuclease activity|flap endonuclease activity|metal ion binding|protein binding|protein binding|ribonuclease H activity|single-stranded DNA specific 5'-3' exodeoxyribonuclease activity			ovary(2)|lung(2)|skin(1)	5	Ovarian(103;0.103)	all_cancers(173;0.0555)	OV - Ovarian serous cystadenocarcinoma(106;0.0107)										Direct_reversal_of_damage|Editing_and_processing_nucleases					---	---	---	---
PXDN	7837	broad.mit.edu	37	2	1643143	1643143	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1643143C>G	uc002qxa.2	-	20	4068	c.4004G>C	c.(4003-4005)AGA>ACA	p.R1335T		NM_012293	NP_036425	Q92626	PXDN_HUMAN	peroxidasin precursor	1335					extracellular matrix organization|hydrogen peroxide catabolic process|immune response	endoplasmic reticulum|extracellular space|proteinaceous extracellular matrix	extracellular matrix structural constituent|heme binding|interleukin-1 receptor antagonist activity|peroxidase activity			pancreas(6)|ovary(2)	8	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.0845)|Lung NSC(108;0.00641)|all_epithelial(98;0.00716)		all cancers(51;0.0492)|OV - Ovarian serous cystadenocarcinoma(76;0.0973)|Epithelial(75;0.17)|GBM - Glioblastoma multiforme(21;0.228)														---	---	---	---
NBAS	51594	broad.mit.edu	37	2	15359013	15359013	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:15359013G>T	uc002rcc.1	-	48	6342	c.6316C>A	c.(6316-6318)CGC>AGC	p.R2106S	NBAS_uc002rcb.1_Intron|NBAS_uc010exl.1_Missense_Mutation_p.R1178S|NBAS_uc002rcd.1_Intron	NM_015909	NP_056993	A2RRP1	NBAS_HUMAN	neuroblastoma-amplified protein	2106										ovary(2)|liver(1)|skin(1)	4																		---	---	---	---
SDC1	6382	broad.mit.edu	37	2	20402700	20402700	+	Intron	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:20402700G>T	uc002rdo.1	-						SDC1_uc002rdp.1_Intron|SDC1_uc010exv.2_Intron	NM_002997	NP_002988			syndecan 1 precursor						lipid metabolic process|lipoprotein metabolic process|myoblast development|striated muscle cell development	cytoplasm|extracellular region|focal adhesion|integral to plasma membrane	cytoskeletal protein binding|protein C-terminus binding			ovary(4)|skin(1)	5	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)			OV - Ovarian serous cystadenocarcinoma(76;0.221)														---	---	---	---
SRD5A2	6716	broad.mit.edu	37	2	31754489	31754489	+	Missense_Mutation	SNP	C	A	A	rs121434250		TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:31754489C>A	uc002rnw.1	-	5	657	c.586G>T	c.(586-588)GGT>TGT	p.G196C		NM_000348	NP_000339	P31213	S5A2_HUMAN	3-oxo-5 alpha-steroid 4-dehydrogenase 2	196			G -> S (in PPSH).		androgen biosynthetic process|cell differentiation|cell-cell signaling|male gonad development	endoplasmic reticulum membrane|integral to membrane|microsome	3-oxo-5-alpha-steroid 4-dehydrogenase activity|sterol 5-alpha reductase activity				0	Acute lymphoblastic leukemia(172;0.155)				Azelaic Acid(DB00548)|Dutasteride(DB01126)													---	---	---	---
KLRAQ1	129285	broad.mit.edu	37	2	48688357	48688357	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:48688357C>A	uc002rwm.2	+	7	865	c.680C>A	c.(679-681)CCT>CAT	p.P227H	KLRAQ1_uc002rwi.1_Missense_Mutation_p.P227H|KLRAQ1_uc002rwj.2_Missense_Mutation_p.P227H|KLRAQ1_uc002rwl.2_Missense_Mutation_p.P181H|KLRAQ1_uc002rwk.2_Missense_Mutation_p.P227H|KLRAQ1_uc010yok.1_Missense_Mutation_p.P227H	NM_001135629	NP_001129101	Q6ZMI0	KLRAQ_HUMAN	KLRAQ motif containing 1 isoform 1	227										ovary(1)	1																		---	---	---	---
PSME4	23198	broad.mit.edu	37	2	54148152	54148152	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:54148152C>A	uc002rxp.2	-	18	2192	c.2136G>T	c.(2134-2136)CAG>CAT	p.Q712H	PSME4_uc010yop.1_Missense_Mutation_p.Q598H|PSME4_uc010yoq.1_RNA|PSME4_uc010fbu.1_Missense_Mutation_p.Q87H|PSME4_uc010fbv.1_Intron	NM_014614	NP_055429	Q14997	PSME4_HUMAN	proteasome (prosome, macropain) activator	712					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|cell differentiation|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|M/G1 transition of mitotic cell cycle|mRNA metabolic process|multicellular organismal development|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|spermatogenesis|viral reproduction	nuclear speck|proteasome complex	binding			ovary(2)|breast(2)|pancreas(1)	5			Lung(47;0.125)|LUSC - Lung squamous cell carcinoma(58;0.181)															---	---	---	---
PAX8	7849	broad.mit.edu	37	2	114002207	114002207	+	Intron	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:114002207C>A	uc010yxt.1	-						PAX8_uc010yxu.1_Intron|PAX8_uc010yxv.1_Intron|PAX8_uc002tjm.2_Intron|PAX8_uc002tjn.2_Intron|PAX8_uc010fku.1_Intron|LOC654433_uc002tjq.3_Intron|LOC654433_uc010fks.2_Intron|LOC654433_uc010fkt.2_Intron|LOC654433_uc002tjr.3_Intron	NM_003466	NP_003457			paired box 8 isoform PAX8A						branching involved in ureteric bud morphogenesis|cellular response to gonadotropin stimulus|central nervous system development|mesenchymal to epithelial transition involved in metanephros morphogenesis|mesonephros development|metanephric collecting duct development|metanephric comma-shaped body morphogenesis|metanephric distal convoluted tubule development|metanephric nephron tubule formation|metanephric S-shaped body morphogenesis|negative regulation of mesenchymal stem cell apoptosis involved in metanephric nephron morphogenesis|otic vesicle development|positive regulation of branching involved in ureteric bud morphogenesis|positive regulation of mesenchymal to epithelial transition involved in metanephros morphogenesis|positive regulation of metanephric DCT cell differentiation|positive regulation of thyroid hormone generation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|pronephric field specification|regulation of metanephric nephron tubule epithelial cell differentiation|regulation of thyroid-stimulating hormone secretion|thyroid gland development|transcription, DNA-dependent	nucleoplasm	protein binding|RNA polymerase II core promoter sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|thyroid-stimulating hormone receptor activity			ovary(1)|lung(1)	2								T	PPARG	follicular thyroid		Thyroid dysgenesis 						---	---	---	---
TMEM177	80775	broad.mit.edu	37	2	120438868	120438868	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:120438868C>A	uc010flg.1	+	2	912	c.439C>A	c.(439-441)CGT>AGT	p.R147S	TMEM177_uc002tme.2_Intron|TMEM177_uc002tmc.1_Missense_Mutation_p.R147S|TMEM177_uc002tmd.2_Missense_Mutation_p.R147S|TMEM177_uc010flh.2_Intron	NM_001105198	NP_001098668	Q53S58	TM177_HUMAN	transmembrane protein 177	147						integral to membrane				ovary(1)	1	Colorectal(110;0.196)																	---	---	---	---
LY75	4065	broad.mit.edu	37	2	160639873	160639873	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:160639873G>T	uc002ubb.3	-	35	5167	c.5098C>A	c.(5098-5100)CAT>AAT	p.H1700N	LY75_uc010fos.2_Missense_Mutation_p.H1644N|CD302_uc002uba.2_Missense_Mutation_p.H59N|CD302_uc010zco.1_Missense_Mutation_p.H59N	NM_002349	NP_002340	O60449	LY75_HUMAN	lymphocyte antigen 75 precursor	1568	Extracellular (Potential).|C-type lectin 10.				endocytosis|immune response|inflammatory response	integral to plasma membrane	receptor activity|sugar binding				0				COAD - Colon adenocarcinoma(177;0.132)														---	---	---	---
TTN	7273	broad.mit.edu	37	2	179596607	179596607	+	Silent	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179596607G>T	uc010zfg.1	-	55	13487	c.13263C>A	c.(13261-13263)CCC>CCA	p.P4421P	TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Silent_p.P1082P	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	5348							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)															---	---	---	---
CERKL	375298	broad.mit.edu	37	2	182521684	182521684	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:182521684C>A	uc002unx.2	-	1	151	c.50G>T	c.(49-51)CGG>CTG	p.R17L	CERKL_uc002uny.2_Missense_Mutation_p.R17L|CERKL_uc010zfm.1_Missense_Mutation_p.R17L|CERKL_uc002unz.2_5'UTR|CERKL_uc002uoa.2_Missense_Mutation_p.R17L|CERKL_uc002uob.2_5'UTR|CERKL_uc002uoc.2_Missense_Mutation_p.R17L|CERKL_uc010frk.2_RNA|CERKL_uc002uod.1_Intron|CERKL_uc002uoe.2_Missense_Mutation_p.R17L	NM_001030311	NP_001025482	Q49MI3	CERKL_HUMAN	ceramide kinase-like isoform b	17					activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|anti-apoptosis	endoplasmic reticulum|endoplasmic reticulum|Golgi apparatus|Golgi apparatus|nucleolus|nucleolus	diacylglycerol kinase activity			ovary(2)|kidney(1)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.088)															---	---	---	---
COL4A4	1286	broad.mit.edu	37	2	227896951	227896951	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:227896951C>A	uc010zlt.1	-	39	4273	c.3619G>T	c.(3619-3621)GGG>TGG	p.G1207W		NM_000092	NP_000083	P53420	CO4A4_HUMAN	alpha 4 type IV collagen precursor	1207	Triple-helical region.	Cleavage; by collagenase (By similarity).			axon guidance|glomerular basement membrane development	basal lamina|collagen type IV	extracellular matrix structural constituent|protein binding			ovary(5)|central_nervous_system(3)|pancreas(1)|breast(1)|skin(1)	11		Renal(207;0.00844)|all_lung(227;0.0187)|Lung NSC(271;0.0879)|all_hematologic(139;0.21)|Esophageal squamous(248;0.242)		Epithelial(121;6.7e-11)|all cancers(144;5.39e-08)|Lung(261;0.0132)|LUSC - Lung squamous cell carcinoma(224;0.0181)														---	---	---	---
TM4SF20	79853	broad.mit.edu	37	2	228243827	228243827	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:228243827G>T	uc002vpb.2	-	1	196	c.158C>A	c.(157-159)CCA>CAA	p.P53Q		NM_024795	NP_079071	Q53R12	T4S20_HUMAN	transmembrane 4 L six family member 20	53	Helical; (Potential).					integral to membrane|plasma membrane					0		Renal(207;0.025)|all_lung(227;0.123)|Esophageal squamous(248;0.23)|all_hematologic(139;0.248)		Epithelial(121;3.8e-11)|all cancers(144;2.57e-08)|Lung(261;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.0115)														---	---	---	---
SP100	6672	broad.mit.edu	37	2	231379989	231379989	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:231379989G>T	uc002vqt.2	+	25	2415	c.2274G>T	c.(2272-2274)GAG>GAT	p.E758D	SP100_uc002vqu.1_Intron|SP100_uc010fxp.1_Intron	NM_003113	NP_003104	P23497	SP100_HUMAN	nuclear antigen Sp100 isoform 2	758					DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|interspecies interaction between organisms|negative regulation of cellular component movement|negative regulation of DNA binding|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|negative regulation of transcription, DNA-dependent|negative regulation of viral transcription|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|response to cytokine stimulus|response to retinoic acid|response to type I interferon	cytoplasm|nuclear periphery|nucleolus|PML body	chromo shadow domain binding|DNA binding|identical protein binding|kinase binding|protein homodimerization activity|transcription coactivator activity|transcription corepressor activity|transcription factor binding			ovary(4)|central_nervous_system(1)	5		Renal(207;0.0112)|all_lung(227;0.0335)|all_hematologic(139;0.0749)|Lung NSC(271;0.142)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.13e-12)|all cancers(144;2.71e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)														---	---	---	---
GRIP2	80852	broad.mit.edu	37	3	14562040	14562040	+	Silent	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:14562040C>A	uc011avi.1	-	9	1008	c.1008G>T	c.(1006-1008)ACG>ACT	p.T336T	GRIP2_uc011avh.1_5'UTR	NM_001080423	NP_001073892	Q9C0E4	GRIP2_HUMAN	glutamate receptor interacting protein 2	239					synaptic transmission	cytosol|plasma membrane	protein binding			pancreas(1)	1																		---	---	---	---
SCN11A	11280	broad.mit.edu	37	3	38941492	38941492	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:38941492G>A	uc011ays.1	-	13	2114	c.1915C>T	c.(1915-1917)CGA>TGA	p.R639*		NM_014139	NP_054858	Q9UI33	SCNBA_HUMAN	sodium channel, voltage-gated, type XI, alpha	639	II.				response to drug	voltage-gated sodium channel complex	voltage-gated sodium channel activity			skin(6)|ovary(1)|haematopoietic_and_lymphoid_tissue(1)|pancreas(1)	9				Kidney(284;0.00202)|KIRC - Kidney renal clear cell carcinoma(284;0.00226)	Cocaine(DB00907)													---	---	---	---
ZNF620	253639	broad.mit.edu	37	3	40557659	40557659	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:40557659G>T	uc003ckk.2	+	5	723	c.574G>T	c.(574-576)GGT>TGT	p.G192C	ZNF620_uc003ckl.2_Missense_Mutation_p.G78C	NM_175888	NP_787084	Q6ZNG0	ZN620_HUMAN	zinc finger protein 620	192					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1				KIRC - Kidney renal clear cell carcinoma(284;0.0519)|Kidney(284;0.0653)														---	---	---	---
HHATL	57467	broad.mit.edu	37	3	42735277	42735277	+	Silent	SNP	G	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:42735277G>A	uc003clw.2	-	11	1227	c.1080C>T	c.(1078-1080)TCC>TCT	p.S360S	HHATL_uc003clx.2_Silent_p.S360S	NM_020707	NP_065758	Q9HCP6	HHATL_HUMAN	hedgehog acyltransferase-like	360					negative regulation of N-terminal protein palmitoylation	endoplasmic reticulum membrane|integral to membrane|perinuclear region of cytoplasm				ovary(3)	3				KIRC - Kidney renal clear cell carcinoma(284;0.215)														---	---	---	---
ABHD5	51099	broad.mit.edu	37	3	43756528	43756528	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:43756528C>A	uc003cmx.2	+	5	861	c.751C>A	c.(751-753)CAC>AAC	p.H251N		NM_016006	NP_057090	Q8WTS1	ABHD5_HUMAN	abhydrolase domain containing 5	251					cell differentiation|fatty acid metabolic process|negative regulation of sequestering of triglyceride|phosphatidic acid biosynthetic process|positive regulation of triglyceride catabolic process|triglyceride catabolic process	cytosol|lipid particle	1-acylglycerol-3-phosphate O-acyltransferase activity|lysophosphatidic acid acyltransferase activity			ovary(1)	1		Renal(3;0.0134)		KIRC - Kidney renal clear cell carcinoma(197;0.0546)|Kidney(197;0.0687)														---	---	---	---
COL7A1	1294	broad.mit.edu	37	3	48605932	48605932	+	Silent	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48605932C>A	uc003ctz.2	-	104	7795	c.7794G>T	c.(7792-7794)CCG>CCT	p.P2598P		NM_000094	NP_000085	Q02388	CO7A1_HUMAN	alpha 1 type VII collagen precursor	2598	Triple-helical region.				cell adhesion|epidermis development	basement membrane|collagen type VII	protein binding|serine-type endopeptidase inhibitor activity			ovary(4)|breast(3)|skin(3)|central_nervous_system(1)	11				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)														---	---	---	---
ITIH4	3700	broad.mit.edu	37	3	52858258	52858258	+	Silent	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52858258G>T	uc003dfz.2	-	9	1155	c.1119C>A	c.(1117-1119)CCC>CCA	p.P373P	ITIH4_uc011bel.1_Silent_p.P103P|ITIH4_uc003dfy.2_Silent_p.P237P|ITIH4_uc011bem.1_Silent_p.P373P|ITIH4_uc011ben.1_Silent_p.P373P	NM_002218	NP_002209	Q14624	ITIH4_HUMAN	inter-alpha (globulin) inhibitor H4	373	VWFA.				acute-phase response|hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity			ovary(2)|central_nervous_system(1)	3				BRCA - Breast invasive adenocarcinoma(193;7e-05)|Kidney(197;0.000656)|KIRC - Kidney renal clear cell carcinoma(197;0.000794)|OV - Ovarian serous cystadenocarcinoma(275;0.0496)														---	---	---	---
SLMAP	7871	broad.mit.edu	37	3	57882659	57882659	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:57882659G>T	uc003dje.1	+	15	1655	c.1450G>T	c.(1450-1452)GAT>TAT	p.D484Y	SLMAP_uc003djc.1_Missense_Mutation_p.G480C|SLMAP_uc003djd.1_Missense_Mutation_p.D467Y|SLMAP_uc003djf.1_Missense_Mutation_p.D446Y|SLMAP_uc003djg.1_Missense_Mutation_p.D78Y|SLMAP_uc011bez.1_Missense_Mutation_p.A18S|SLMAP_uc011bfa.1_Missense_Mutation_p.D18Y|SLMAP_uc003djh.2_Missense_Mutation_p.A18S|SLMAP_uc003dji.1_Missense_Mutation_p.D18Y|SLMAP_uc011bfb.1_Missense_Mutation_p.D18Y|SLMAP_uc011bfc.1_Missense_Mutation_p.A18S	NM_007159	NP_009090	Q14BN4	SLMAP_HUMAN	sarcolemma associated protein	484	Cytoplasmic (Potential).|Potential.				muscle contraction|protein folding	integral to plasma membrane|microtubule organizing center|prefoldin complex|sarcolemma|smooth endoplasmic reticulum	unfolded protein binding				0				BRCA - Breast invasive adenocarcinoma(55;0.000271)|KIRC - Kidney renal clear cell carcinoma(284;0.0602)|Kidney(284;0.0754)|OV - Ovarian serous cystadenocarcinoma(275;0.182)														---	---	---	---
GPR15	2838	broad.mit.edu	37	3	98251350	98251350	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:98251350G>T	uc011bgy.1	+	1	473	c.473G>T	c.(472-474)TGG>TTG	p.W158L		NM_005290	NP_005281	P49685	GPR15_HUMAN	G protein-coupled receptor 15	158	Helical; Name=4; (Potential).					integral to plasma membrane	purinergic nucleotide receptor activity, G-protein coupled			ovary(1)	1		Lung NSC(201;7.93e-06)|all_neural(597;0.00172)|Hepatocellular(537;0.00825)|Myeloproliferative disorder(1037;0.0255)		Lung(72;0.246)														---	---	---	---
IMPG2	50939	broad.mit.edu	37	3	100961575	100961575	+	Silent	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:100961575G>T	uc003duq.1	-	14	3182	c.2979C>A	c.(2977-2979)ACC>ACA	p.T993T	IMPG2_uc011bhe.1_Silent_p.T856T	NM_016247	NP_057331	Q9BZV3	IMPG2_HUMAN	interphotoreceptor matrix proteoglycan 2	993	Extracellular (Potential).|SEA 2.				visual perception	integral to membrane|proteinaceous extracellular matrix	extracellular matrix structural constituent|heparin binding|hyaluronic acid binding|receptor activity			ovary(2)|haematopoietic_and_lymphoid_tissue(1)	3																		---	---	---	---
IGSF11	152404	broad.mit.edu	37	3	118645024	118645024	+	Silent	SNP	C	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:118645024C>T	uc003ebw.2	-	4	751	c.504G>A	c.(502-504)GAG>GAA	p.E168E	IGSF11_uc011biv.1_Silent_p.E168E|IGSF11_uc003ebx.2_Silent_p.E168E|IGSF11_uc003eby.2_Silent_p.E167E|IGSF11_uc003ebz.2_Silent_p.E167E|IGSF11_uc010hqs.2_Silent_p.E167E	NM_001015887	NP_001015887	Q5DX21	IGS11_HUMAN	immunoglobulin superfamily, member 11 isoform b	168	Ig-like C2-type.|Extracellular (Potential).				cell adhesion|regulation of growth	integral to membrane|plasma membrane	receptor activity				0																		---	---	---	---
ARHGAP31	57514	broad.mit.edu	37	3	119112366	119112366	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:119112366C>T	uc003ecj.3	+	8	1466	c.934C>T	c.(934-936)CGT>TGT	p.R312C		NM_020754	NP_065805	Q2M1Z3	RHG31_HUMAN	Cdc42 GTPase-activating protein	312					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|focal adhesion|lamellipodium	GTPase activator activity			ovary(2)	2																		---	---	---	---
GPR156	165829	broad.mit.edu	37	3	119887107	119887107	+	Missense_Mutation	SNP	G	T	T	rs113424982		TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:119887107G>T	uc011bjf.1	-	9	1217	c.1217C>A	c.(1216-1218)CCG>CAG	p.P406Q	GPR156_uc011bjg.1_Missense_Mutation_p.P402Q	NM_153002	NP_694547	Q8NFN8	GP156_HUMAN	G protein-coupled receptor 156	406	Cytoplasmic (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity|GABA-B receptor activity			ovary(1)|skin(1)	2				GBM - Glioblastoma multiforme(114;0.19)														---	---	---	---
TMCC1	23023	broad.mit.edu	37	3	129389972	129389972	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:129389972G>T	uc003emz.3	-	5	1213	c.712C>A	c.(712-714)CAG>AAG	p.Q238K	TMCC1_uc003emy.3_5'UTR|TMCC1_uc011blc.1_Missense_Mutation_p.Q59K|TMCC1_uc010htg.2_Missense_Mutation_p.Q124K	NM_001017395	NP_001017395	O94876	TMCC1_HUMAN	transmembrane and coiled-coil domain family 1	238	Potential.					integral to membrane				skin(1)	1																		---	---	---	---
TMEM108	66000	broad.mit.edu	37	3	133114803	133114803	+	Silent	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:133114803G>T	uc003eph.2	+	6	1975	c.1701G>T	c.(1699-1701)GTG>GTT	p.V567V	TMEM108_uc003epi.2_Silent_p.V567V|TMEM108_uc003epk.2_Silent_p.V97V|TMEM108_uc003epm.2_Silent_p.V518V	NM_023943	NP_076432	Q6UXF1	TM108_HUMAN	transmembrane protein 108 precursor	567	Cytoplasmic (Potential).					integral to membrane				ovary(2)|skin(2)	4																		---	---	---	---
LRRC31	79782	broad.mit.edu	37	3	169557996	169557996	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:169557996C>A	uc003fgc.1	-	9	1510	c.1433G>T	c.(1432-1434)CGG>CTG	p.R478L	LRRC31_uc010hwp.1_Missense_Mutation_p.R422L	NM_024727	NP_079003	Q6UY01	LRC31_HUMAN	leucine rich repeat containing 31	478										ovary(2)|skin(1)	3	all_cancers(22;2.76e-22)|all_epithelial(15;4.73e-27)|all_lung(20;9.24e-17)|Lung NSC(18;3.85e-16)|Ovarian(172;0.000223)|Breast(254;0.197)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.00943)															---	---	---	---
HTR3D	200909	broad.mit.edu	37	3	183756624	183756624	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183756624G>T	uc011bqv.1	+	8	1226	c.1226G>T	c.(1225-1227)CGG>CTG	p.R409L	HTR3D_uc003fmj.2_Missense_Mutation_p.R234L|HTR3D_uc011bqu.1_Missense_Mutation_p.R359L|HTR3D_uc010hxp.2_Missense_Mutation_p.R188L	NM_001163646	NP_001157118	Q70Z44	5HT3D_HUMAN	5-hydroxytryptamine receptor 3 subunit D isoform	409	Cytoplasmic (Potential).					integral to membrane|plasma membrane	extracellular ligand-gated ion channel activity|receptor activity				0	all_cancers(143;2.33e-10)|Ovarian(172;0.0303)		Epithelial(37;6.23e-36)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)															---	---	---	---
ATP13A4	84239	broad.mit.edu	37	3	193166019	193166019	+	Silent	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:193166019G>T	uc003ftd.2	-	18	2236	c.2128C>A	c.(2128-2130)CGG>AGG	p.R710R	ATP13A4_uc003fte.1_Silent_p.R710R|ATP13A4_uc011bsr.1_Silent_p.R181R|ATP13A4_uc010hzi.2_RNA	NM_032279	NP_115655	Q4VNC1	AT134_HUMAN	ATPase type 13A4	710	Extracellular (Potential).				ATP biosynthetic process|cation transport	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|metal ion binding			ovary(2)	2	all_cancers(143;1.76e-08)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;2.72e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;0.000109)														---	---	---	---
TFRC	7037	broad.mit.edu	37	3	195802018	195802018	+	Intron	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195802018G>T	uc003fvz.3	-						TFRC_uc003fwa.3_Intron|TFRC_uc010hzy.2_Intron|TFRC_uc011btr.1_Intron	NM_003234	NP_003225			transferrin receptor						cellular iron ion homeostasis|endocytosis|interspecies interaction between organisms|proteolysis|transferrin transport|transmembrane transport	coated pit|endosome|integral to plasma membrane|melanosome	peptidase activity|transferrin receptor activity			ovary(3)	3	all_cancers(143;1.94e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		Epithelial(36;1.36e-24)|all cancers(36;3.34e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.17e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00233)				T	BCL6	NHL								---	---	---	---
REST	5978	broad.mit.edu	37	4	57797479	57797479	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:57797479G>T	uc003hch.2	+	4	2802	c.2455G>T	c.(2455-2457)GAT>TAT	p.D819Y	REST_uc003hci.2_Missense_Mutation_p.D819Y|REST_uc010ihf.2_Missense_Mutation_p.D493Y	NM_005612	NP_005603	Q13127	REST_HUMAN	RE1-silencing transcription factor	819					cardiac muscle cell myoblast differentiation|cellular response to drug|cellular response to electrical stimulus|cellular response to glucocorticoid stimulus|histone H4 deacetylation|negative regulation by host of viral transcription|negative regulation of aldosterone biosynthetic process|negative regulation of calcium ion-dependent exocytosis|negative regulation of cell proliferation|negative regulation of cortisol biosynthetic process|negative regulation of dense core granule biogenesis|negative regulation of insulin secretion|negative regulation of mesenchymal stem cell differentiation|negative regulation of neurogenesis|negative regulation of neuron differentiation|positive regulation of apoptosis|positive regulation of caspase activity|positive regulation of transcription, DNA-dependent	cytoplasm|transcriptional repressor complex	calcium channel activity|chromatin binding|core promoter proximal region sequence-specific DNA binding|core promoter sequence-specific DNA binding|outward rectifier potassium channel activity|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription|zinc ion binding			skin(5)|upper_aerodigestive_tract(1)|ovary(1)|lung(1)|central_nervous_system(1)	9	Glioma(25;0.08)|all_neural(26;0.181)																	---	---	---	---
PDHA2	5161	broad.mit.edu	37	4	96761323	96761323	+	Missense_Mutation	SNP	C	A	A	rs140695896	byFrequency	TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:96761323C>A	uc003htr.3	+	1	85	c.22C>A	c.(22-24)CGC>AGC	p.R8S		NM_005390	NP_005381	P29803	ODPAT_HUMAN	pyruvate dehydrogenase E1 alpha 2 precursor	8					glycolysis	mitochondrial matrix	pyruvate dehydrogenase (acetyl-transferring) activity			central_nervous_system(1)	1		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;1.23e-06)	NADH(DB00157)													---	---	---	---
NEK1	4750	broad.mit.edu	37	4	170327836	170327836	+	Silent	SNP	G	T	T	rs140408058	by1000genomes	TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:170327836G>T	uc003isb.1	-	30	3693	c.3201C>A	c.(3199-3201)CCC>CCA	p.P1067P	NEK1_uc003isc.1_Silent_p.P1023P|NEK1_uc003isd.1_Silent_p.P1095P|NEK1_uc003ise.1_Silent_p.P1051P|NEK1_uc003isf.1_Silent_p.P998P	NM_012224	NP_036356	Q96PY6	NEK1_HUMAN	NIMA-related kinase 1	1067					cell division|cilium assembly|mitosis	nucleus|pericentriolar material	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			lung(3)|ovary(2)|large_intestine(1)	6		Prostate(90;0.00601)|Renal(120;0.0183)		GBM - Glioblastoma multiforme(119;0.0287)|KIRC - Kidney renal clear cell carcinoma(143;0.0325)|Kidney(143;0.0385)|LUSC - Lung squamous cell carcinoma(193;0.14)														---	---	---	---
FASTKD3	79072	broad.mit.edu	37	5	7867597	7867597	+	Silent	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:7867597C>A	uc003jeb.2	-	2	737	c.600G>T	c.(598-600)CTG>CTT	p.L200L	FASTKD3_uc011cmp.1_Intron|FASTKD3_uc003jec.2_Intron|MTRR_uc010itn.1_5'Flank|MTRR_uc003jee.3_5'Flank|MTRR_uc003jed.2_5'Flank|MTRR_uc003jef.3_5'Flank|MTRR_uc003jeg.3_5'Flank|MTRR_uc010ito.2_5'Flank	NM_024091	NP_076996	Q14CZ7	FAKD3_HUMAN	FAST kinase domains 3	200					apoptosis|cellular respiration	mitochondrion	ATP binding|protein kinase activity			ovary(2)|breast(1)|pancreas(1)	4																		---	---	---	---
FAM105B	90268	broad.mit.edu	37	5	14693066	14693066	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:14693066C>A	uc003jfk.2	+	7	1120	c.968C>A	c.(967-969)CCA>CAA	p.P323Q		NM_138348	NP_612357	Q96BN8	F105B_HUMAN	hypothetical protein LOC90268	323										ovary(2)	2	Lung NSC(4;0.00696)																	---	---	---	---
ADAMTS12	81792	broad.mit.edu	37	5	33561157	33561157	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:33561157C>A	uc003jia.1	-	20	4263	c.4100G>T	c.(4099-4101)GGC>GTC	p.G1367V	ADAMTS12_uc010iuq.1_Missense_Mutation_p.G1282V	NM_030955	NP_112217	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1	1367					proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)	9															HNSCC(64;0.19)			---	---	---	---
HEATR7B2	133558	broad.mit.edu	37	5	41054930	41054930	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:41054930C>A	uc003jmj.3	-	11	1536	c.1046G>T	c.(1045-1047)AGG>ATG	p.R349M	HEATR7B2_uc003jmi.3_Intron	NM_173489	NP_775760	Q7Z745	HTRB2_HUMAN	HEAT repeat family member 7B2	349							binding			ovary(6)|central_nervous_system(2)	8																		---	---	---	---
ZNF366	167465	broad.mit.edu	37	5	71757157	71757157	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:71757157C>A	uc003kce.1	-	2	353	c.167G>T	c.(166-168)CGG>CTG	p.R56L		NM_152625	NP_689838	Q8N895	ZN366_HUMAN	zinc finger protein 366	56					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			central_nervous_system(1)|skin(1)	2		Lung NSC(167;0.0247)|Ovarian(174;0.0908)|Prostate(461;0.155)		OV - Ovarian serous cystadenocarcinoma(47;2.51e-53)														---	---	---	---
SPZ1	84654	broad.mit.edu	37	5	79616623	79616623	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:79616623C>A	uc003kgn.2	+	1	834	c.589C>A	c.(589-591)CAG>AAG	p.Q197K	uc011ctk.1_RNA	NM_032567	NP_115956	Q9BXG8	SPZ1_HUMAN	spermatogenic leucine zipper 1	197	Basic motif (By similarity).				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding			ovary(1)	1		Lung NSC(167;0.0393)|all_lung(232;0.0428)|Ovarian(174;0.113)		OV - Ovarian serous cystadenocarcinoma(54;3.43e-47)|Epithelial(54;2.25e-41)|all cancers(79;4.19e-36)														---	---	---	---
ZFYVE16	9765	broad.mit.edu	37	5	79769675	79769675	+	Silent	SNP	C	A	A	rs145745171	byFrequency	TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:79769675C>A	uc003kgr.3	+	17	4592	c.4290C>A	c.(4288-4290)ACC>ACA	p.T1430T	ZFYVE16_uc003kgq.3_Silent_p.T1430T|ZFYVE16_uc003kgs.3_Silent_p.T1430T|ZFYVE16_uc003kgt.3_Silent_p.T518T|ZFYVE16_uc003kgu.3_Silent_p.T182T	NM_001105251	NP_001098721	Q7Z3T8	ZFY16_HUMAN	zinc finger, FYVE domain containing 16	1430					BMP signaling pathway|endosome transport|protein targeting to lysosome|regulation of endocytosis|vesicle organization	early endosome membrane	1-phosphatidylinositol binding|metal ion binding|phosphatidylinositol-3,4,5-trisphosphate binding|protein binding|protein transporter activity				0		Lung NSC(167;0.00428)|all_lung(232;0.00455)|Ovarian(174;0.0261)		OV - Ovarian serous cystadenocarcinoma(54;1.6e-46)|Epithelial(54;2.02e-41)|all cancers(79;5.05e-36)														---	---	---	---
GPR98	84059	broad.mit.edu	37	5	89938526	89938526	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:89938526C>T	uc003kju.2	+	12	2410	c.2314C>T	c.(2314-2316)CCT>TCT	p.P772S	GPR98_uc003kjt.2_5'UTR	NM_032119	NP_115495	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98 precursor	772	Extracellular (Potential).				cell communication|cell-cell adhesion|maintenance of organ identity|neuropeptide signaling pathway|photoreceptor cell maintenance	cell surface|cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(11)|central_nervous_system(3)|pancreas(2)	16		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)														---	---	---	---
FAM13B	51306	broad.mit.edu	37	5	137289940	137289940	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137289940G>T	uc003lbz.2	-	14	2101	c.1567C>A	c.(1567-1569)CGC>AGC	p.R523S	FAM13B_uc003lcb.2_Missense_Mutation_p.R427S|FAM13B_uc003lca.2_Missense_Mutation_p.R523S	NM_016603	NP_057687	Q9NYF5	FA13B_HUMAN	hypothetical protein LOC51306 isoform 1	523					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity				0																		---	---	---	---
PCDHGA1	56114	broad.mit.edu	37	5	140712464	140712464	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140712464C>T	uc003lji.1	+	1	2213	c.2213C>T	c.(2212-2214)TCG>TTG	p.S738L	PCDHGA1_uc011dan.1_Missense_Mutation_p.S738L	NM_018912	NP_061735	Q9Y5H4	PCDG1_HUMAN	protocadherin gamma subfamily A, 1 isoform 1	738	Cytoplasmic (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(1)|breast(1)|pancreas(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)															---	---	---	---
PCDHGA3	56112	broad.mit.edu	37	5	140724252	140724252	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140724252G>T	uc003ljm.1	+	1	652	c.652G>T	c.(652-654)GGC>TGC	p.G218C	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc010jfx.1_5'UTR|PCDHGA3_uc011dap.1_Missense_Mutation_p.G218C	NM_018916	NP_061739	Q9Y5H0	PCDG3_HUMAN	protocadherin gamma subfamily A, 3 isoform 1	218	Extracellular (Potential).|Cadherin 2.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)															---	---	---	---
KIAA1191	57179	broad.mit.edu	37	5	175775365	175775365	+	Intron	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:175775365C>A	uc003mdw.2	-						KIAA1191_uc003mdx.2_Intron|KIAA1191_uc003mdy.2_Intron|KIAA1191_uc003mea.2_Intron|KIAA1191_uc003mdz.2_Intron	NM_020444	NP_065177			hypothetical protein LOC57179 isoform a								protein binding			ovary(1)	1	all_cancers(89;0.00575)|Renal(175;0.000269)|Lung NSC(126;0.0105)|all_lung(126;0.0168)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	Kidney(146;0.101)														---	---	---	---
GPRIN1	114787	broad.mit.edu	37	5	176026581	176026581	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176026581G>T	uc003meo.1	-	2	430	c.255C>A	c.(253-255)GAC>GAA	p.D85E		NM_052899	NP_443131	Q7Z2K8	GRIN1_HUMAN	G protein-regulated inducer of neurite outgrowth	85						growth cone|plasma membrane				ovary(2)	2	all_cancers(89;0.00263)|Renal(175;0.000269)|Lung NSC(126;0.00902)|all_lung(126;0.0142)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)															---	---	---	---
TAP2	6891	broad.mit.edu	37	6	32797282	32797282	+	Silent	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32797282C>A	uc003occ.2	-	10	1858	c.1827G>T	c.(1825-1827)GCG>GCT	p.A609A	TAP2_uc011dqf.1_Silent_p.A609A|TAP2_uc003ocb.1_Silent_p.A609A|TAP2_uc003ocd.2_Silent_p.A609A	NM_018833	NP_061313	Q03519	TAP2_HUMAN	transporter 2, ATP-binding cassette, sub-family	609	ABC transporter.|Cytoplasmic (Potential).				antigen processing and presentation of endogenous peptide antigen via MHC class I via ER pathway, TAP-dependent|antigen processing and presentation of endogenous peptide antigen via MHC class Ib via ER pathway, TAP-dependent|antigen processing and presentation of exogenous protein antigen via MHC class Ib, TAP-dependent|cytosol to ER transport|intracellular transport of viral proteins in host cell|peptide antigen transport|positive regulation of antigen processing and presentation of peptide antigen via MHC class I|positive regulation of T cell mediated cytotoxicity	nucleus|plasma membrane|TAP complex	ATP binding|MHC class I protein binding|oligopeptide-transporting ATPase activity|peptide antigen binding|peptide antigen-transporting ATPase activity|TAP1 binding|TAP2 binding|tapasin binding				0																		---	---	---	---
HLA-DPA1	3113	broad.mit.edu	37	6	33037072	33037072	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33037072G>T	uc003ocs.1	-	3	383	c.352C>A	c.(352-354)CCT>ACT	p.P118T	HLA-DPA1_uc010juk.2_Missense_Mutation_p.P118T|HLA-DPA1_uc003oct.1_Missense_Mutation_p.P118T	NM_033554	NP_291032	P20036	DPA1_HUMAN	major histocompatibility complex, class II, DP	118	Alpha-2.|Ig-like C1-type.|Extracellular (Potential).				antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|interferon-gamma-mediated signaling pathway|T cell costimulation|T cell receptor signaling pathway	endoplasmic reticulum membrane|endosome membrane|Golgi apparatus|integral to plasma membrane|lysosomal membrane|MHC class II protein complex	MHC class II receptor activity			skin(1)	1																		---	---	---	---
VPS52	6293	broad.mit.edu	37	6	33219410	33219410	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33219410C>A	uc003odm.1	-	19	2120	c.1910G>T	c.(1909-1911)CGG>CTG	p.R637L	VPS52_uc003odn.1_Missense_Mutation_p.R448L	NM_022553	NP_072047	Q8N1B4	VPS52_HUMAN	vacuolar protein sorting 52	637					protein transport	endosome membrane|Golgi apparatus				ovary(4)|skin(1)	5																		---	---	---	---
SPDEF	25803	broad.mit.edu	37	6	34508858	34508858	+	Silent	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:34508858C>A	uc003ojq.1	-	3	952	c.537G>T	c.(535-537)GCG>GCT	p.A179A	SPDEF_uc011dsq.1_Silent_p.A179A	NM_012391	NP_036523	O95238	SPDEF_HUMAN	SAM pointed domain containing ets transcription	179	PNT.				negative regulation of survival gene product expression|negative regulation of transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			skin(3)|ovary(1)|central_nervous_system(1)	5																		---	---	---	---
ANKS1A	23294	broad.mit.edu	37	6	35051202	35051202	+	Silent	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:35051202G>T	uc003ojx.3	+	20	3058	c.2916G>T	c.(2914-2916)ACG>ACT	p.T972T	ANKS1A_uc011dss.1_Intron|ANKS1A_uc011dst.1_Silent_p.T512T|ANKS1A_uc010jvp.1_Silent_p.T346T	NM_015245	NP_056060	Q92625	ANS1A_HUMAN	ankyrin repeat and sterile alpha motif domain	972	PID.					cytoplasm	protein binding			ovary(3)|upper_aerodigestive_tract(1)	4																		---	---	---	---
CAPN11	11131	broad.mit.edu	37	6	44148203	44148203	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:44148203G>T	uc003owt.1	+	15	1685	c.1647G>T	c.(1645-1647)TTG>TTT	p.L549F	CAPN11_uc011dvn.1_Missense_Mutation_p.L203F	NM_007058	NP_008989	Q9UMQ6	CAN11_HUMAN	calpain 11	549	Domain III.				proteolysis	acrosomal vesicle	calcium ion binding|calcium-dependent cysteine-type endopeptidase activity			ovary(1)|breast(1)	2	all_cancers(18;3.19e-06)|Lung NSC(15;0.00108)|all_lung(25;0.00278)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)															---	---	---	---
DST	667	broad.mit.edu	37	6	56380299	56380299	+	Silent	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:56380299G>T	uc003pdf.2	-	66	12196	c.12168C>A	c.(12166-12168)CCC>CCA	p.P4056P	DST_uc003pcz.3_Silent_p.P3878P|DST_uc011dxj.1_Silent_p.P3907P|DST_uc011dxk.1_Silent_p.P3918P|DST_uc003pcy.3_Silent_p.P3552P	NM_001144769	NP_001138241	Q03001	DYST_HUMAN	dystonin isoform 2	5964	Spectrin 11.				cell adhesion|cell cycle arrest|cell motility|hemidesmosome assembly|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization|maintenance of cell polarity|microtubule cytoskeleton organization|response to wounding	actin cytoskeleton|axon|axon part|basement membrane|cell cortex|cell leading edge|cytoplasmic membrane-bounded vesicle|endoplasmic reticulum membrane|hemidesmosome|hemidesmosome|integral to membrane|intermediate filament|intermediate filament cytoskeleton|microtubule cytoskeleton|microtubule plus end|nuclear envelope|sarcomere|Z disc	actin binding|calcium ion binding|integrin binding|microtubule plus-end binding|protein binding|protein C-terminus binding|protein homodimerization activity			ovary(7)|central_nervous_system(6)|upper_aerodigestive_tract(1)	14	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)															---	---	---	---
KCNQ5	56479	broad.mit.edu	37	6	73900332	73900332	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:73900332G>T	uc003pgk.2	+	12	1961	c.1614G>T	c.(1612-1614)AAG>AAT	p.K538N	KCNQ5_uc011dyh.1_Missense_Mutation_p.K557N|KCNQ5_uc011dyi.1_Missense_Mutation_p.K548N|KCNQ5_uc010kat.2_Missense_Mutation_p.K529N|KCNQ5_uc011dyj.1_Missense_Mutation_p.K428N|KCNQ5_uc011dyk.1_Missense_Mutation_p.K288N	NM_019842	NP_062816	Q9NR82	KCNQ5_HUMAN	potassium voltage-gated channel, KQT-like	538					protein complex assembly|synaptic transmission	voltage-gated potassium channel complex	inward rectifier potassium channel activity			ovary(4)|large_intestine(2)|skin(1)	7		all_epithelial(107;0.116)|Lung NSC(302;0.219)		COAD - Colon adenocarcinoma(1;0.0107)|Colorectal(1;0.0583)														---	---	---	---
C6orf174	387104	broad.mit.edu	37	6	127767833	127767833	+	3'UTR	SNP	G	T	T	rs112232003		TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:127767833G>T	uc003qbd.2	-	11					C6orf174_uc003qbc.2_Missense_Mutation_p.P544Q|C6orf174_uc003qba.2_Intron|C6orf174_uc003qbb.2_Missense_Mutation_p.P427Q|KIAA0408_uc011ebs.1_Missense_Mutation_p.P544Q	NM_001012279	NP_001012279			hypothetical protein LOC387104 precursor							integral to membrane				breast(3)|ovary(2)|skin(1)	6				GBM - Glioblastoma multiforme(226;0.026)|all cancers(137;0.161)														---	---	---	---
NUP43	348995	broad.mit.edu	37	6	150067563	150067563	+	Silent	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:150067563C>A	uc003qmz.2	-	1	126	c.69G>T	c.(67-69)CCG>CCT	p.P23P	NUP43_uc011eee.1_RNA|NUP43_uc011eef.1_Silent_p.P23P	NM_198887	NP_942590	Q8NFH3	NUP43_HUMAN	nucleoporin 43kDa	23	WD 1.				carbohydrate metabolic process|cell division|chromosome segregation|glucose transport|mitotic prometaphase|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	condensed chromosome kinetochore|cytosol|Nup107-160 complex	protein binding			upper_aerodigestive_tract(1)	1		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;4.71e-13)|GBM - Glioblastoma multiforme(68;0.101)												OREG0017720	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
MAD1L1	8379	broad.mit.edu	37	7	2054198	2054198	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2054198C>A	uc003slh.1	-	13	1564	c.1298G>T	c.(1297-1299)CGG>CTG	p.R433L	MAD1L1_uc003sle.1_Missense_Mutation_p.R162L|MAD1L1_uc003slf.1_Missense_Mutation_p.R433L|MAD1L1_uc003slg.1_Missense_Mutation_p.R433L|MAD1L1_uc010ksh.1_Missense_Mutation_p.R433L|MAD1L1_uc003sli.1_Missense_Mutation_p.R341L|MAD1L1_uc010ksi.1_Missense_Mutation_p.R386L|MAD1L1_uc010ksj.2_Missense_Mutation_p.R433L	NM_001013836	NP_001013858	Q9Y6D9	MD1L1_HUMAN	MAD1-like 1 protein	433	Necessary for interaction with NEK2.|Potential.				cell division|mitotic anaphase|mitotic cell cycle spindle assembly checkpoint|mitotic metaphase|mitotic prometaphase|mitotic telophase	actin cytoskeleton|centrosome|condensed chromosome kinetochore|cytosol|mitochondrion|nucleus|spindle	protein binding			lung(1)|central_nervous_system(1)	2		Ovarian(82;0.0272)		UCEC - Uterine corpus endometrioid carcinoma (27;0.134)|OV - Ovarian serous cystadenocarcinoma(56;3.63e-14)														---	---	---	---
C7orf31	136895	broad.mit.edu	37	7	25176248	25176248	+	Silent	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:25176248G>T	uc003sxn.1	-	10	1677	c.1116C>A	c.(1114-1116)CCC>CCA	p.P372P	C7orf31_uc003sxm.1_Silent_p.P214P	NM_138811	NP_620166	Q8N865	CG031_HUMAN	hypothetical protein LOC136895	372											0																		---	---	---	---
CDK14	5218	broad.mit.edu	37	7	90747439	90747439	+	Missense_Mutation	SNP	C	T	T	rs145303395		TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:90747439C>T	uc003uky.2	+	14	1576	c.1354C>T	c.(1354-1356)CGG>TGG	p.R452W	CDK14_uc003ukz.1_Missense_Mutation_p.R434W|CDK14_uc010les.1_Missense_Mutation_p.R406W|CDK14_uc011khl.1_Missense_Mutation_p.R323W	NM_012395	NP_036527	O94921	CDK14_HUMAN	PFTAIRE protein kinase 1	452					cell division|G2/M transition of mitotic cell cycle|regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	cytoplasmic cyclin-dependent protein kinase holoenzyme complex|nucleus|plasma membrane	ATP binding|cyclin binding|cyclin-dependent protein kinase activity			lung(3)|ovary(1)	4																		---	---	---	---
OR2AE1	81392	broad.mit.edu	37	7	99474142	99474142	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99474142C>A	uc003usc.1	-	1	515	c.515G>T	c.(514-516)CGG>CTG	p.R172L		NM_001005276	NP_001005276	Q8NHA4	O2AE1_HUMAN	olfactory receptor, family 2, subfamily AE,	172	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	Esophageal squamous(72;0.0166)|Lung NSC(181;0.0211)|all_lung(186;0.0323)																	---	---	---	---
ZNF277	11179	broad.mit.edu	37	7	111977891	111977891	+	Intron	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:111977891C>A	uc003vge.2	+						ZNF277_uc003vgf.2_Intron|ZNF277_uc003vgg.2_Intron	NM_021994	NP_068834			zinc finger protein (C2H2 type) 277							nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)|breast(2)	4																		---	---	---	---
TMEM140	55281	broad.mit.edu	37	7	134849551	134849551	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:134849551C>A	uc003vsi.2	+	2	639	c.358C>A	c.(358-360)CTG>ATG	p.L120M	C7orf49_uc003vsh.2_Intron	NM_018295	NP_060765	Q9NV12	TM140_HUMAN	transmembrane protein 140	120	Helical; (Potential).					integral to membrane				large_intestine(1)	1																		---	---	---	---
KIAA1549	57670	broad.mit.edu	37	7	138583725	138583725	+	Silent	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:138583725G>T	uc011kql.1	-	9	3872	c.3823C>A	c.(3823-3825)CGA>AGA	p.R1275R	KIAA1549_uc011kqi.1_Silent_p.R59R|KIAA1549_uc003vuk.3_Silent_p.R1225R|KIAA1549_uc011kqj.1_Silent_p.R1275R|KIAA1549_uc011kqk.1_Silent_p.R59R	NM_020910	NP_065961	Q9HCM3	K1549_HUMAN	hypothetical protein LOC57670 isoform 1	1275						integral to membrane			KIAA1549/BRAF(229)	central_nervous_system(229)|pancreas(1)	230								O	BRAF	pilocytic astrocytoma								---	---	---	---
PTK2B	2185	broad.mit.edu	37	8	27291644	27291644	+	Silent	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:27291644C>A	uc003xfn.1	+	17	1948	c.1140C>A	c.(1138-1140)CCC>CCA	p.P380P	PTK2B_uc003xfo.1_Silent_p.P380P|PTK2B_uc003xfp.1_Silent_p.P380P|PTK2B_uc003xfq.1_Silent_p.P380P|PTK2B_uc010luq.1_Silent_p.P138P|PTK2B_uc003xfr.1_Silent_p.P126P	NM_173174	NP_775266	Q14289	FAK2_HUMAN	PTK2B protein tyrosine kinase 2 beta isoform a	380					apoptosis|bone resorption|positive regulation of cell proliferation|signal complex assembly	cytosol	ATP binding|non-membrane spanning protein tyrosine kinase activity|signal transducer activity			lung(3)|ovary(1)|skin(1)	5		Ovarian(32;2.72e-05)		UCEC - Uterine corpus endometrioid carcinoma (27;0.023)|Epithelial(17;6.61e-10)|BRCA - Breast invasive adenocarcinoma(99;0.226)|Colorectal(74;0.229)														---	---	---	---
C8orf80	389643	broad.mit.edu	37	8	27925065	27925065	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:27925065G>T	uc003xgm.3	-	6	820	c.677C>A	c.(676-678)CCC>CAC	p.P226H		NM_001010906	NP_001010906	Q68CJ6	SLIP_HUMAN	speckled-like pattern in the germinal center	226						nucleus	GTP binding|GTPase activity			ovary(1)|central_nervous_system(1)	2		Ovarian(32;0.0218)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0228)|KIRC - Kidney renal clear cell carcinoma(542;0.126)|Kidney(114;0.15)|Colorectal(74;0.181)														---	---	---	---
DDHD2	23259	broad.mit.edu	37	8	38109430	38109430	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38109430G>T	uc003xlb.2	+	12	1722	c.1345G>T	c.(1345-1347)GGT>TGT	p.G449C	DDHD2_uc003xlc.2_Missense_Mutation_p.G449C|DDHD2_uc003xld.2_Missense_Mutation_p.G68C	NM_015214	NP_056029	O94830	DDHD2_HUMAN	DDHD domain containing 2 isoform 1	449					lipid catabolic process	centrosome	hydrolase activity|metal ion binding			large_intestine(1)|ovary(1)	2	Colorectal(12;0.000442)	all_lung(54;0.0657)|Lung NSC(58;0.175)	BRCA - Breast invasive adenocarcinoma(5;3.76e-25)|COAD - Colon adenocarcinoma(9;0.0977)															---	---	---	---
FAM110B	90362	broad.mit.edu	37	8	59059521	59059521	+	Silent	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:59059521G>T	uc003xtj.1	+	5	1612	c.732G>T	c.(730-732)GTG>GTT	p.V244V		NM_147189	NP_671722	Q8TC76	F110B_HUMAN	hypothetical protein LOC90362	244						microtubule organizing center|mitochondrion|nucleus				large_intestine(1)	1		all_epithelial(80;0.025)|all_lung(136;0.0274)|Lung NSC(129;0.0355)																---	---	---	---
KCNS2	3788	broad.mit.edu	37	8	99440792	99440792	+	Silent	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:99440792G>T	uc003yin.2	+	2	935	c.585G>T	c.(583-585)CTG>CTT	p.L195L		NM_020697	NP_065748	Q9ULS6	KCNS2_HUMAN	potassium voltage-gated channel,	195	Helical; Name=Segment S1; (Potential).					voltage-gated potassium channel complex	voltage-gated potassium channel activity			ovary(1)	1	Breast(36;2.4e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.0448)															---	---	---	---
TG	7038	broad.mit.edu	37	8	133900554	133900554	+	Silent	SNP	G	A	A	rs138731686		TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:133900554G>A	uc003ytw.2	+	10	2543	c.2502G>A	c.(2500-2502)CCG>CCA	p.P834P		NM_003235	NP_003226	P01266	THYG_HUMAN	thyroglobulin precursor	834	Thyroglobulin type-1 7.				hormone biosynthetic process|signal transduction|thyroid gland development|thyroid hormone generation	extracellular space	hormone activity			ovary(8)|breast(4)|pancreas(1)|central_nervous_system(1)|skin(1)	15	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)														---	---	---	---
EIF2C2	27161	broad.mit.edu	37	8	141549487	141549487	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:141549487C>A	uc003yvn.2	-	16	2141	c.2101G>T	c.(2101-2103)GGG>TGG	p.G701W	EIF2C2_uc010men.2_Missense_Mutation_p.G624W|EIF2C2_uc010meo.2_Missense_Mutation_p.G701W	NM_012154	NP_036286	Q9UKV8	AGO2_HUMAN	argonaute 2 isoform 1	701	Piwi.				mRNA cleavage involved in gene silencing by miRNA|negative regulation of translation involved in gene silencing by miRNA|negative regulation of translational initiation|pre-miRNA processing|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasmic mRNA processing body|cytosol|micro-ribonucleoprotein complex|mRNA cap binding complex|nucleus|polysome|RNA-induced silencing complex	endoribonuclease activity, cleaving siRNA-paired mRNA|metal ion binding|protein binding|RNA 7-methylguanosine cap binding|siRNA binding|translation initiation factor activity				0	all_cancers(97;2.54e-14)|all_epithelial(106;5.99e-13)|Lung NSC(106;1.45e-05)|all_lung(105;2.07e-05)|Ovarian(258;0.0154)|Acute lymphoblastic leukemia(118;0.155)	Breast(495;0.159)	BRCA - Breast invasive adenocarcinoma(115;0.158)															---	---	---	---
ADAMTSL1	92949	broad.mit.edu	37	9	18706968	18706968	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:18706968G>T	uc003zne.3	+	14	1925	c.1798G>T	c.(1798-1800)GGT>TGT	p.G600C		NM_001040272	NP_001035362	Q8N6G6	ATL1_HUMAN	ADAMTS-like 1 isoform 4 precursor	600						proteinaceous extracellular matrix	metallopeptidase activity|zinc ion binding			ovary(3)|upper_aerodigestive_tract(1)|lung(1)	5				GBM - Glioblastoma multiforme(50;1.29e-17)														---	---	---	---
DNAJB5	25822	broad.mit.edu	37	9	34996681	34996681	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:34996681C>A	uc003zvt.2	+	3	769	c.631C>A	c.(631-633)CTG>ATG	p.L211M	DNAJB5_uc003zvs.2_Missense_Mutation_p.L245M|DNAJB5_uc011los.1_Missense_Mutation_p.L283M	NM_012266	NP_036398	O75953	DNJB5_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 5	211					protein folding|response to unfolded protein		heat shock protein binding|unfolded protein binding				0			LUSC - Lung squamous cell carcinoma(32;0.00575)															---	---	---	---
FRMPD1	22844	broad.mit.edu	37	9	37740876	37740876	+	Missense_Mutation	SNP	C	A	A	rs144670594		TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:37740876C>A	uc004aag.1	+	15	2395	c.2351C>A	c.(2350-2352)CCG>CAG	p.P784Q	FRMPD1_uc004aah.1_Missense_Mutation_p.P784Q|FRMPD1_uc011lqm.1_Missense_Mutation_p.P606Q|FRMPD1_uc011lqn.1_Missense_Mutation_p.P653Q	NM_014907	NP_055722	Q5SYB0	FRPD1_HUMAN	FERM and PDZ domain containing 1	784						cytoskeleton|cytosol|plasma membrane				ovary(4)|central_nervous_system(2)|skin(2)|breast(1)	9				GBM - Glioblastoma multiforme(29;0.00655)														---	---	---	---
MAMDC2	256691	broad.mit.edu	37	9	72785504	72785504	+	Silent	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:72785504C>A	uc004ahm.2	+	11	2225	c.1608C>A	c.(1606-1608)CCC>CCA	p.P536P	MAMDC2_uc004ahn.2_RNA|uc004aho.1_Intron|uc004ahp.1_RNA	NM_153267	NP_694999	Q7Z304	MAMC2_HUMAN	MAM domain containing 2 precursor	536	MAM 4.					endoplasmic reticulum|membrane				central_nervous_system(1)|pancreas(1)	2																		---	---	---	---
TRIM14	9830	broad.mit.edu	37	9	100857266	100857266	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:100857266C>A	uc004ayd.2	-	4	601	c.583G>T	c.(583-585)GGG>TGG	p.G195W	TRIM14_uc004ayf.1_Missense_Mutation_p.G102W|TRIM14_uc011luz.1_5'Flank|TRIM14_uc011lva.1_5'Flank|TRIM14_uc004ayg.1_Missense_Mutation_p.G195W|TRIM14_uc004ayh.1_Missense_Mutation_p.G195W|TRIM14_uc004ayi.1_Missense_Mutation_p.G195W|TRIM14_uc004ayj.1_Missense_Mutation_p.G102W	NM_033220	NP_150089	Q14142	TRI14_HUMAN	tripartite motif protein TRIM14 isoform alpha	195						cytoplasm|intracellular	zinc ion binding			central_nervous_system(1)	1		Acute lymphoblastic leukemia(62;0.0559)																---	---	---	---
TNC	3371	broad.mit.edu	37	9	117808831	117808831	+	Silent	SNP	A	C	C			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:117808831A>C	uc004bjj.3	-	17	5345	c.4983T>G	c.(4981-4983)TCT>TCG	p.S1661S	TNC_uc010mvf.2_Intron	NM_002160	NP_002151	P24821	TENA_HUMAN	tenascin C precursor	1661	Fibronectin type-III 12.				cell adhesion|response to wounding|signal transduction	extracellular space	receptor binding|syndecan binding			central_nervous_system(4)|upper_aerodigestive_tract(1)|ovary(1)|skin(1)	7																		---	---	---	---
LRRC8A	56262	broad.mit.edu	37	9	131671599	131671599	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131671599G>T	uc004bwl.3	+	3	2410	c.2156G>T	c.(2155-2157)CGG>CTG	p.R719L	LRRC8A_uc010myp.2_Missense_Mutation_p.R719L|LRRC8A_uc010myq.2_Missense_Mutation_p.R719L	NM_019594	NP_062540	Q8IWT6	LRC8A_HUMAN	leucine rich repeat containing 8 family, member	719	LRR 15.				pre-B cell differentiation	integral to membrane					0																		---	---	---	---
MTPAP	55149	broad.mit.edu	37	10	30615481	30615481	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:30615481T>G	uc001iva.3	-	5	927	c.864A>C	c.(862-864)TTA>TTC	p.L288F	MTPAP_uc001ivb.3_Missense_Mutation_p.L418F	NM_018109	NP_060579	Q9NVV4	PAPD1_HUMAN	PAP associated domain containing 1 precursor	288					cell death|histone mRNA catabolic process|mRNA polyadenylation|transcription, DNA-dependent	mitochondrion	ATP binding|magnesium ion binding|manganese ion binding|polynucleotide adenylyltransferase activity|protein homodimerization activity|RNA binding|UTP binding			ovary(1)	1																		---	---	---	---
RTKN2	219790	broad.mit.edu	37	10	63957802	63957802	+	Silent	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:63957802G>T	uc001jlw.2	-	12	1792	c.1695C>A	c.(1693-1695)GCC>GCA	p.A565A	RTKN2_uc009xpf.1_Intron|RTKN2_uc001jlv.2_Silent_p.A219A	NM_145307	NP_660350	Q8IZC4	RTKN2_HUMAN	rhotekin 2	565					signal transduction	intracellular					0	Prostate(12;0.0297)|all_hematologic(501;0.215)																	---	---	---	---
CCAR1	55749	broad.mit.edu	37	10	70514470	70514470	+	Splice_Site	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:70514470G>T	uc001joo.2	+	12	1464	c.1345_splice	c.e12-1	p.V449_splice	CCAR1_uc001jol.1_Splice_Site|CCAR1_uc001jom.1_Splice_Site_p.V254_splice|CCAR1_uc009xpx.1_Splice_Site_p.V423_splice|CCAR1_uc001jon.1_Splice_Site_p.V395_splice|CCAR1_uc010qiz.1_Splice_Site_p.V434_splice|CCAR1_uc010qja.1_Splice_Site_p.V434_splice|CCAR1_uc010qjb.1_Splice_Site|SNORD98_uc001jop.1_5'Flank	NM_018237	NP_060707			cell-cycle and apoptosis regulatory protein 1						apoptosis|cell cycle|nuclear mRNA splicing, via spliceosome|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleoplasm|perinuclear region of cytoplasm	calcium ion binding|nucleic acid binding|protein binding			ovary(6)|large_intestine(1)	7																		---	---	---	---
ADAMTS14	140766	broad.mit.edu	37	10	72492004	72492004	+	Intron	SNP	C	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:72492004C>T	uc001jrh.2	+						ADAMTS14_uc001jrg.2_Intron|ADAMTS14_uc001jri.1_5'Flank	NM_080722	NP_542453			ADAM metallopeptidase with thrombospondin type 1						collagen catabolic process|proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(5)|upper_aerodigestive_tract(1)	6																		---	---	---	---
SLIT1	6585	broad.mit.edu	37	10	98764541	98764541	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:98764541C>A	uc001kmw.2	-	33	3871	c.3619G>T	c.(3619-3621)GGG>TGG	p.G1207W		NM_003061	NP_003052	O75093	SLIT1_HUMAN	slit homolog 1 precursor	1207	Laminin G-like.				axon extension involved in axon guidance|forebrain morphogenesis|motor axon guidance|negative chemotaxis|negative regulation of synaptogenesis	cytoplasm|extracellular space	calcium ion binding|Roundabout binding			ovary(4)	4		Colorectal(252;0.162)		Epithelial(162;2.02e-08)|all cancers(201;1.5e-06)														---	---	---	---
CPN1	1369	broad.mit.edu	37	10	101829528	101829528	+	Silent	SNP	G	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:101829528G>A	uc001kql.2	-	3	779	c.519C>T	c.(517-519)AAC>AAT	p.N173N		NM_001308	NP_001299	P15169	CBPN_HUMAN	carboxypeptidase N, polypeptide 1 precursor	173	Catalytic.				proteolysis	extracellular space	metallocarboxypeptidase activity|zinc ion binding			central_nervous_system(3)|pancreas(1)	4		Colorectal(252;0.234)		Epithelial(162;4.77e-10)|all cancers(201;3.82e-08)														---	---	---	---
CHUK	1147	broad.mit.edu	37	10	101980440	101980440	+	Intron	SNP	A	G	G			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:101980440A>G	uc001kqp.2	-							NM_001278	NP_001269			conserved helix-loop-helix ubiquitous kinase						I-kappaB phosphorylation|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	CD40 receptor complex|cytosol|internal side of plasma membrane|nucleus	ATP binding|identical protein binding|IkappaB kinase activity			ovary(2)|central_nervous_system(2)|large_intestine(1)|lung(1)|breast(1)	7		Colorectal(252;0.117)		Epithelial(162;2.05e-10)|all cancers(201;1.91e-08)														---	---	---	---
TECTB	6975	broad.mit.edu	37	10	114045879	114045879	+	Silent	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:114045879C>A	uc001kzr.1	+	3	318	c.318C>A	c.(316-318)ACC>ACA	p.T106T		NM_058222	NP_478129	Q96PL2	TECTB_HUMAN	tectorin beta precursor	106	ZP.					anchored to membrane|plasma membrane|proteinaceous extracellular matrix					0		Colorectal(252;0.198)		Epithelial(162;0.0143)|all cancers(201;0.0242)														---	---	---	---
NRAP	4892	broad.mit.edu	37	10	115389485	115389485	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:115389485C>A	uc001laj.2	-	19	2066	c.1902G>T	c.(1900-1902)ATG>ATT	p.M634I	NRAP_uc009xyb.2_5'Flank|NRAP_uc001lak.2_Missense_Mutation_p.M599I|NRAP_uc001lal.3_Missense_Mutation_p.M634I	NM_198060	NP_932326	Q86VF7	NRAP_HUMAN	nebulin-related anchoring protein isoform S	634	Nebulin 15.					fascia adherens|muscle tendon junction	actin binding|muscle alpha-actinin binding|zinc ion binding			ovary(6)|central_nervous_system(3)|upper_aerodigestive_tract(1)	10		Colorectal(252;0.0233)|Breast(234;0.188)		Epithelial(162;0.00392)|all cancers(201;0.00569)														---	---	---	---
NRAP	4892	broad.mit.edu	37	10	115409896	115409896	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:115409896C>A	uc001laj.2	-	9	952	c.788G>T	c.(787-789)AGG>ATG	p.R263M	NRAP_uc001lak.2_Missense_Mutation_p.R263M|NRAP_uc001lal.3_Missense_Mutation_p.R263M	NM_198060	NP_932326	Q86VF7	NRAP_HUMAN	nebulin-related anchoring protein isoform S	263	Nebulin 5.					fascia adherens|muscle tendon junction	actin binding|muscle alpha-actinin binding|zinc ion binding			ovary(6)|central_nervous_system(3)|upper_aerodigestive_tract(1)	10		Colorectal(252;0.0233)|Breast(234;0.188)		Epithelial(162;0.00392)|all cancers(201;0.00569)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	134671135	134671135	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134671135C>A	uc010qux.1	-	31	4711	c.4711G>T	c.(4711-4713)GGG>TGG	p.G1571W		NM_017609	NP_060079			Homo sapiens cDNA, FLJ17989.																														---	---	---	---
CDHR5	53841	broad.mit.edu	37	11	619492	619492	+	Silent	SNP	C	A	A	rs61732112	byFrequency;by1000genomes	TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:619492C>A	uc001lqj.2	-	11	1380	c.1275G>T	c.(1273-1275)GCG>GCT	p.A425A	CDHR5_uc001lqk.2_Silent_p.A425A|CDHR5_uc009ycc.2_Silent_p.A259A|CDHR5_uc009ycd.2_Silent_p.A425A|CDHR5_uc001lql.2_Silent_p.A425A|CDHR5_uc001lqm.2_Silent_p.A259A|CDHR5_uc009yce.1_Silent_p.A394A	NM_021924	NP_068743	Q9HBB8	CDHR5_HUMAN	mucin and cadherin-like isoform 1	425	Cadherin 4.|Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0																		---	---	---	---
TALDO1	6888	broad.mit.edu	37	11	755949	755949	+	Silent	SNP	C	A	A	rs2234021		TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:755949C>A	uc001lqz.2	+	2	218	c.168C>A	c.(166-168)CCC>CCA	p.P56P	TALDO1_uc010qwl.1_Silent_p.P56P|TALDO1_uc001lra.2_Silent_p.P56P	NM_006755	NP_006746	P37837	TALDO_HUMAN	transaldolase 1	56					energy reserve metabolic process|xylulose biosynthetic process	cytosol	protein binding|sedoheptulose-7-phosphate:D-glyceraldehyde-3-phosphate glyceronetransferase activity				0		all_cancers(49;1.13e-08)|all_epithelial(84;2.95e-05)|Breast(177;0.000286)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.159)|all_lung(207;0.198)		all cancers(45;4.66e-26)|Epithelial(43;2.97e-25)|OV - Ovarian serous cystadenocarcinoma(40;1.48e-19)|BRCA - Breast invasive adenocarcinoma(625;4.41e-05)|Lung(200;0.0595)|LUSC - Lung squamous cell carcinoma(625;0.0712)														---	---	---	---
AMPD3	272	broad.mit.edu	37	11	10500274	10500274	+	Silent	SNP	C	A	A	rs117002871	by1000genomes	TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:10500274C>A	uc001mio.1	+	3	758	c.423C>A	c.(421-423)GCC>GCA	p.A141A	AMPD3_uc010rbz.1_Intron|AMPD3_uc001min.1_Silent_p.A150A|AMPD3_uc009yfw.1_RNA|AMPD3_uc009yfx.1_Silent_p.A141A|AMPD3_uc009yfz.2_RNA|AMPD3_uc001mip.1_Silent_p.A148A|AMPD3_uc009yfy.2_Silent_p.A141A	NM_001025389	NP_001020560	Q01432	AMPD3_HUMAN	adenosine monophosphate deaminase 3 isoform 1B	141					AMP catabolic process|purine base metabolic process|purine ribonucleoside monophosphate biosynthetic process|purine-containing compound salvage	cytosol	AMP deaminase activity|metal ion binding			large_intestine(1)|ovary(1)	2				all cancers(16;1.14e-08)|Epithelial(150;2.83e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0291)														---	---	---	---
PDE3B	5140	broad.mit.edu	37	11	14840755	14840755	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:14840755G>T	uc001mln.2	+	7	2160	c.1807G>T	c.(1807-1809)GGT>TGT	p.G603C	PDE3B_uc010rcr.1_Missense_Mutation_p.G552C	NM_000922	NP_000913	Q13370	PDE3B_HUMAN	phosphodiesterase 3B	603					cAMP catabolic process|insulin receptor signaling pathway|negative regulation of lipid catabolic process|platelet activation	cytosol|endoplasmic reticulum|Golgi apparatus|guanyl-nucleotide exchange factor complex|integral to membrane|microsome	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity|metal ion binding|protein kinase B binding				0																		---	---	---	---
SOX6	55553	broad.mit.edu	37	11	16036526	16036526	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:16036526G>T	uc001mme.2	-	13	1766	c.1733C>A	c.(1732-1734)CCA>CAA	p.P578Q	SOX6_uc001mmd.2_Missense_Mutation_p.P541Q|SOX6_uc001mmf.2_Missense_Mutation_p.P538Q|SOX6_uc001mmg.2_Missense_Mutation_p.P565Q	NM_001145819	NP_001139291	P35712	SOX6_HUMAN	SRY (sex determining region Y)-box 6 isoform 4	565					muscle organ development	nucleus	sequence-specific DNA binding transcription factor activity			ovary(3)	3																		---	---	---	---
LRRC4C	57689	broad.mit.edu	37	11	40137715	40137715	+	Missense_Mutation	SNP	C	A	A	rs141998335		TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:40137715C>A	uc001mxa.1	-	2	2092	c.128G>T	c.(127-129)CGG>CTG	p.R43L	LRRC4C_uc001mxc.1_Missense_Mutation_p.R39L|LRRC4C_uc001mxd.1_Missense_Mutation_p.R39L|LRRC4C_uc001mxb.1_Missense_Mutation_p.R39L	NM_020929	NP_065980	Q9HCJ2	LRC4C_HUMAN	netrin-G1 ligand precursor	43					regulation of axonogenesis	integral to membrane	protein binding			ovary(4)|skin(3)|central_nervous_system(1)	8		all_lung(304;0.0575)|Lung NSC(402;0.138)																---	---	---	---
ALX4	60529	broad.mit.edu	37	11	44296944	44296944	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:44296944C>A	uc001myb.2	-	2	835	c.731G>T	c.(730-732)CGG>CTG	p.R244L		NM_021926	NP_068745	Q9H161	ALX4_HUMAN	aristaless-like homeobox 4	244	Homeobox.				hair follicle development						0																		---	---	---	---
F2	2147	broad.mit.edu	37	11	46748166	46748166	+	Silent	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:46748166G>T	uc001ndf.3	+	8	1036	c.993G>T	c.(991-993)TCG>TCT	p.S331S	F2_uc001ndg.3_RNA	NM_000506	NP_000497	P00734	THRB_HUMAN	coagulation factor II preproprotein	331					activation of caspase activity|acute-phase response|blood coagulation, intrinsic pathway|cell surface receptor linked signaling pathway|cytosolic calcium ion homeostasis|fibrinolysis|leukocyte migration|negative regulation of astrocyte differentiation|negative regulation of fibrinolysis|negative regulation of platelet activation|negative regulation of proteolysis|peptidyl-glutamic acid carboxylation|platelet activation|positive regulation of collagen biosynthetic process|positive regulation of protein phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of release of sequestered calcium ion into cytosol|post-translational protein modification|proteolysis|STAT protein import into nucleus|tyrosine phosphorylation of STAT protein	cytosol|endoplasmic reticulum lumen|extracellular space|Golgi lumen|plasma membrane|soluble fraction	calcium ion binding|growth factor activity|serine-type endopeptidase activity|thrombospondin receptor activity			ovary(3)	3		all_lung(304;0.000414)|Lung NSC(402;0.0011)		BRCA - Breast invasive adenocarcinoma(625;0.146)	Antihemophilic Factor(DB00025)|Argatroban(DB00278)|Bivalirudin(DB00006)|Coagulation Factor IX(DB00100)|Drotrecogin alfa(DB00055)|Enoxaparin(DB01225)|Heparin(DB01109)|Lepirudin(DB00001)|Menadione(DB00170)|Proflavine(DB01123)|Simvastatin(DB00641)|Suramin(DB04786)|Warfarin(DB00682)|Ximelagatran(DB04898)													---	---	---	---
CKAP5	9793	broad.mit.edu	37	11	46799806	46799806	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:46799806C>A	uc001ndi.1	-	22	2741	c.2631G>T	c.(2629-2631)AGG>AGT	p.R877S	CKAP5_uc009ylg.1_Missense_Mutation_p.R763S|CKAP5_uc001ndj.1_Missense_Mutation_p.R877S	NM_001008938	NP_001008938	Q14008	CKAP5_HUMAN	colonic and hepatic tumor over-expressed protein	877	HEAT 5.				cell division|centrosome organization|establishment or maintenance of microtubule cytoskeleton polarity|G2/M transition of mitotic cell cycle|mitotic prometaphase|RNA transport|spindle organization	centrosome|cytosol	protein binding|protein binding			ovary(1)|skin(1)	2																		---	---	---	---
MS4A7	58475	broad.mit.edu	37	11	60161301	60161301	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60161301G>T	uc001npe.2	+	7	835	c.690G>T	c.(688-690)CAG>CAT	p.Q230H	MS4A7_uc001npf.2_Missense_Mutation_p.Q230H|MS4A7_uc001npg.2_Missense_Mutation_p.Q185H|MS4A7_uc001nph.2_Missense_Mutation_p.Q185H|MS4A14_uc001npi.2_Intron	NM_206939	NP_996822	Q9GZW8	MS4A7_HUMAN	membrane-spanning 4-domains, subfamily A, member	230	Cytoplasmic (Potential).					integral to membrane	receptor activity			ovary(1)|central_nervous_system(1)	2																		---	---	---	---
VWCE	220001	broad.mit.edu	37	11	61053823	61053823	+	Silent	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61053823C>A	uc001nra.2	-	5	783	c.504G>T	c.(502-504)CCG>CCT	p.P168P	VWCE_uc001nrb.2_RNA	NM_152718	NP_689931	Q96DN2	VWCE_HUMAN	von Willebrand factor C and EGF domains	168	EGF-like 2; calcium-binding (Potential).					extracellular region	calcium ion binding			ovary(1)	1																		---	---	---	---
FERMT3	83706	broad.mit.edu	37	11	63988607	63988607	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:63988607G>T	uc001nyl.2	+	13	1826	c.1677G>T	c.(1675-1677)ATG>ATT	p.M559I	FERMT3_uc001nym.2_Missense_Mutation_p.M555I	NM_178443	NP_848537	Q86UX7	URP2_HUMAN	fermitin family homolog 3 long form	559					integrin activation|leukocyte cell-cell adhesion|platelet aggregation|regulation of cell-cell adhesion mediated by integrin	cell junction|cell projection|podosome	integrin binding			ovary(1)	1																		---	---	---	---
NUDT22	84304	broad.mit.edu	37	11	63997452	63997452	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:63997452C>A	uc001nyp.3	+	6	1082	c.902C>A	c.(901-903)CCG>CAG	p.P301Q	NUDT22_uc009ype.2_Missense_Mutation_p.P301Q|NUDT22_uc001nyq.3_Missense_Mutation_p.P268Q|NUDT22_uc010rng.1_RNA|uc001nyr.1_3'UTR|DNAJC4_uc001nys.2_5'Flank|DNAJC4_uc001nyt.2_5'Flank|DNAJC4_uc001nyu.2_5'Flank	NM_032344	NP_115720	Q9BRQ3	NUD22_HUMAN	nudix (nucleoside diphosphate linked moiety	301							hydrolase activity				0																		---	---	---	---
C11orf2	738	broad.mit.edu	37	11	64876935	64876935	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64876935C>A	uc001ocr.1	+	6	1667	c.1627C>A	c.(1627-1629)CTC>ATC	p.L543I	TM7SF2_uc001oct.2_5'Flank|TM7SF2_uc010rny.1_5'Flank|TM7SF2_uc001ocu.2_5'Flank|TM7SF2_uc001ocv.2_5'Flank|C11orf2_uc001ocs.1_Missense_Mutation_p.L419I	NM_013265	NP_037397	Q9UID3	FFR_HUMAN	chromosome 11 open reading frame 2	543					lipid transport|protein transport	Golgi apparatus|integral to membrane					0																		---	---	---	---
XRRA1	143570	broad.mit.edu	37	11	74556172	74556172	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:74556172C>A	uc009yub.2	-	16	2181	c.1849G>T	c.(1849-1851)GGC>TGC	p.G617C	XRRA1_uc001ovm.2_RNA|XRRA1_uc001ovn.2_Missense_Mutation_p.G240C|XRRA1_uc001ovo.2_Missense_Mutation_p.G225C|XRRA1_uc001ovq.3_Missense_Mutation_p.G530C|XRRA1_uc001ovp.3_Missense_Mutation_p.G342C|XRRA1_uc001ovr.2_Missense_Mutation_p.G240C|XRRA1_uc001ovs.1_Missense_Mutation_p.G219C	NM_182969	NP_892014	Q6P2D8	XRRA1_HUMAN	X-ray radiation resistance associated 1	617					response to X-ray	cytoplasm|nucleus				central_nervous_system(1)	1																		---	---	---	---
PRCP	5547	broad.mit.edu	37	11	82536019	82536019	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:82536019G>T	uc001ozs.2	-	9	1533	c.1420C>A	c.(1420-1422)CGC>AGC	p.R474S	PRCP_uc001ozr.2_Missense_Mutation_p.R495S	NM_005040	NP_005031	P42785	PCP_HUMAN	prolylcarboxypeptidase isoform 1 preproprotein	474					blood coagulation, intrinsic pathway|proteolysis	lysosome|plasma membrane	protein binding|serine-type carboxypeptidase activity			skin(1)	1																		---	---	---	---
PRCP	5547	broad.mit.edu	37	11	82536114	82536114	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:82536114G>T	uc001ozs.2	-	9	1438	c.1325C>A	c.(1324-1326)ACA>AAA	p.T442K	PRCP_uc001ozr.2_Missense_Mutation_p.T463K	NM_005040	NP_005031	P42785	PCP_HUMAN	prolylcarboxypeptidase isoform 1 preproprotein	442					blood coagulation, intrinsic pathway|proteolysis	lysosome|plasma membrane	protein binding|serine-type carboxypeptidase activity			skin(1)	1																		---	---	---	---
SYTL2	54843	broad.mit.edu	37	11	85406313	85406313	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:85406313C>A	uc010rth.1	-	18	3006	c.2730G>T	c.(2728-2730)ATG>ATT	p.M910I	SYTL2_uc010rtg.1_Missense_Mutation_p.M911I|SYTL2_uc010rti.1_Missense_Mutation_p.M886I|SYTL2_uc010rtj.1_Missense_Mutation_p.M878I|SYTL2_uc001pav.2_Missense_Mutation_p.M352I|SYTL2_uc010rte.1_Missense_Mutation_p.M312I|SYTL2_uc001pax.2_Missense_Mutation_p.M352I|SYTL2_uc001paz.2_Missense_Mutation_p.M231I|SYTL2_uc001pba.2_Missense_Mutation_p.M295I|SYTL2_uc001pay.2_Missense_Mutation_p.M341I|SYTL2_uc001paw.2_Missense_Mutation_p.M312I|SYTL2_uc009yvj.2_RNA|SYTL2_uc001pbd.2_Missense_Mutation_p.M1208I|SYTL2_uc001pbb.2_Missense_Mutation_p.M1248I|SYTL2_uc001pbc.2_Missense_Mutation_p.M1232I|SYTL2_uc010rtf.1_Missense_Mutation_p.M728I	NM_001162951	NP_001156423	Q9HCH5	SYTL2_HUMAN	synaptotagmin-like 2 isoform g	910					intracellular protein transport|vesicle docking involved in exocytosis	exocytic vesicle|extrinsic to plasma membrane|melanosome|membrane fraction	neurexin binding|phosphatidylinositol-4,5-bisphosphate binding|phosphatidylserine binding|Rab GTPase binding			ovary(2)|large_intestine(1)	3		Acute lymphoblastic leukemia(157;4.19e-06)|all_hematologic(158;0.0033)		KIRC - Kidney renal clear cell carcinoma(183;0.202)|Kidney(183;0.237)														---	---	---	---
MMP20	9313	broad.mit.edu	37	11	102496027	102496027	+	Silent	SNP	G	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:102496027G>A	uc001phc.2	-	1	37	c.24C>T	c.(22-24)GGC>GGT	p.G8G		NM_004771	NP_004762	O60882	MMP20_HUMAN	matrix metalloproteinase 20 preproprotein	8					proteolysis|regulation of enamel mineralization	extracellular space|proteinaceous extracellular matrix	calcium ion binding|metalloendopeptidase activity|protein binding|zinc ion binding			urinary_tract(1)|skin(1)	2	all_cancers(8;8.95e-05)|all_epithelial(12;0.00227)|Lung NSC(15;0.139)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0033)	Epithelial(9;0.0216)|Lung(13;0.0711)|all cancers(10;0.0889)|LUSC - Lung squamous cell carcinoma(19;0.13)	BRCA - Breast invasive adenocarcinoma(274;0.0161)														---	---	---	---
MMP8	4317	broad.mit.edu	37	11	102584178	102584178	+	Missense_Mutation	SNP	A	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:102584178A>T	uc001phe.2	-	10	1404	c.1305T>A	c.(1303-1305)CAT>CAA	p.H435Q	MMP8_uc010rut.1_3'UTR|MMP8_uc010ruu.1_Missense_Mutation_p.H412Q	NM_002424	NP_002415	P22894	MMP8_HUMAN	matrix metalloproteinase 8 preproprotein	435	Hemopexin-like 4.				collagen catabolic process|proteolysis	extracellular space|proteinaceous extracellular matrix	metalloendopeptidase activity|serine-type endopeptidase activity|zinc ion binding			ovary(3)|breast(1)	4	all_cancers(8;0.00092)|all_epithelial(12;0.00389)|Lung NSC(15;0.227)	all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)	Epithelial(9;0.0555)|Lung(13;0.0828)|LUSC - Lung squamous cell carcinoma(19;0.151)|all cancers(10;0.189)	BRCA - Breast invasive adenocarcinoma(274;0.0141)														---	---	---	---
DYNC2H1	79659	broad.mit.edu	37	11	103270478	103270478	+	Missense_Mutation	SNP	A	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:103270478A>T	uc001pho.2	+	84	12388	c.12244A>T	c.(12244-12246)AAT>TAT	p.N4082Y	DYNC2H1_uc001phn.1_Missense_Mutation_p.N4089Y|DYNC2H1_uc009yxe.1_Intron	NM_001080463	NP_001073932	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1	4082					cell projection organization|Golgi organization|microtubule-based movement|multicellular organismal development	cilium axoneme|dynein complex|Golgi apparatus|microtubule|plasma membrane	ATP binding|ATPase activity|microtubule motor activity				0		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	124120492	124120492	+	IGR	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124120492C>A								OR8G2 (24182 upstream) : OR8D1 (59245 downstream)																																			---	---	---	---
FLI1	2313	broad.mit.edu	37	11	128680436	128680436	+	Silent	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:128680436G>T	uc010sbu.1	+	9	1253	c.912G>T	c.(910-912)GGG>GGT	p.G304G	FLI1_uc010sbt.1_Silent_p.G111G|FLI1_uc010sbv.1_Silent_p.G271G|FLI1_uc009zci.2_Silent_p.G238G	NM_002017	NP_002008	Q01543	FLI1_HUMAN	Friend leukemia virus integration 1	304	ETS.				hemostasis|organ morphogenesis	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity		EWSR1/FLI1(2266)	bone(2210)|soft_tissue(48)|autonomic_ganglia(4)|central_nervous_system(4)|lung(3)|ovary(2)|pancreas(2)	2273	all_hematologic(175;0.0641)	Lung NSC(97;0.00588)|all_lung(97;0.00764)|Breast(109;0.0115)|Medulloblastoma(222;0.0523)|all_neural(223;0.0862)|all_hematologic(192;0.182)		OV - Ovarian serous cystadenocarcinoma(99;0.01)|LUSC - Lung squamous cell carcinoma(976;0.0324)|Lung(977;0.0327)				T	EWSR1	Ewing sarcoma								---	---	---	---
ERC1	23085	broad.mit.edu	37	12	1137575	1137575	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:1137575G>T	uc001qjb.2	+	2	747	c.506G>T	c.(505-507)CGG>CTG	p.R169L	ERC1_uc001qiz.2_RNA|ERC1_uc001qjc.2_Missense_Mutation_p.R169L|ERC1_uc001qja.2_RNA|ERC1_uc001qjd.2_RNA|ERC1_uc001qjf.2_Missense_Mutation_p.R169L	NM_178040	NP_829884	Q8IUD2	RB6I2_HUMAN	RAB6-interacting protein 2 isoform epsilon	169	Potential.				I-kappaB phosphorylation|multicellular organismal development|positive regulation of anti-apoptosis|positive regulation of NF-kappaB transcription factor activity|protein transport	Golgi membrane|IkappaB kinase complex|presynaptic membrane	leucine zipper domain binding			ovary(2)|lung(2)|breast(1)	5	all_epithelial(11;0.0698)|Ovarian(42;0.107)		OV - Ovarian serous cystadenocarcinoma(31;0.00239)|BRCA - Breast invasive adenocarcinoma(9;0.0567)															---	---	---	---
USP5	8078	broad.mit.edu	37	12	6975192	6975192	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6975192C>A	uc001qri.3	+	20	2587	c.2528C>A	c.(2527-2529)CCG>CAG	p.P843Q	USP5_uc001qrh.3_Missense_Mutation_p.P820Q|TPI1_uc001qrk.2_5'Flank|TPI1_uc010sfo.1_5'Flank	NM_001098536	NP_001092006	P45974	UBP5_HUMAN	ubiquitin specific peptidase 5 isoform 1	843					positive regulation of proteasomal ubiquitin-dependent protein catabolic process|protein K48-linked deubiquitination|ubiquitin-dependent protein catabolic process	lysosome	cysteine-type endopeptidase activity|omega peptidase activity|protein binding|ubiquitin thiolesterase activity|zinc ion binding			lung(2)|breast(1)|skin(1)	4																		---	---	---	---
H2AFJ	55766	broad.mit.edu	37	12	14927567	14927567	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:14927567G>T	uc009zia.2	+	1	298	c.163G>T	c.(163-165)GTG>TTG	p.V55L	H2AFJ_uc001rch.3_RNA	NM_177925	NP_808760	Q9BTM1	H2AJ_HUMAN	H2A histone family, member J	55					nucleosome assembly	nucleosome|nucleus	DNA binding			ovary(1)	1																		---	---	---	---
DDX11	1663	broad.mit.edu	37	12	31242080	31242080	+	Silent	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:31242080C>A	uc001rjt.1	+	7	1038	c.787C>A	c.(787-789)CGG>AGG	p.R263R	DDX11_uc010sjw.1_Silent_p.R263R|DDX11_uc010sjx.1_RNA|DDX11_uc001rjr.1_Silent_p.R263R|DDX11_uc001rjs.1_Silent_p.R263R|DDX11_uc001rju.1_5'UTR|DDX11_uc001rjv.1_Silent_p.R263R|DDX11_uc001rjw.1_Silent_p.R237R|DDX11_uc001rjx.1_5'UTR|DDX11_uc009zjn.1_RNA	NM_152438	NP_689651	Q96FC9	DDX11_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11	263	Helicase ATP-binding.				G2/M transition of mitotic cell cycle|interspecies interaction between organisms|mitotic sister chromatid segregation|positive regulation of cell proliferation|S phase of mitotic cell cycle|sister chromatid cohesion	midbody|nuclear chromatin|nucleolus|spindle pole	ATP binding|ATP-dependent DNA helicase activity|DNA binding|protein binding|RNA binding			breast(3)	3	all_cancers(9;1.77e-11)|all_lung(12;6.21e-11)|all_epithelial(9;6.49e-11)|Lung NSC(12;1.06e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Lung SC(12;0.0592)|Esophageal squamous(101;0.233)														Multiple Myeloma(12;0.14)			---	---	---	---
LRRK2	120892	broad.mit.edu	37	12	40671789	40671789	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:40671789T>C	uc001rmg.3	+	17	2162	c.2041T>C	c.(2041-2043)TCC>CCC	p.S681P	LRRK2_uc001rmh.1_Missense_Mutation_p.S303P	NM_198578	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	681					activation of MAPKK activity|determination of adult lifespan|exploration behavior|intracellular distribution of mitochondria|negative regulation of branching morphogenesis of a nerve|negative regulation of dendritic spine morphogenesis|negative regulation of neuroblast proliferation|negative regulation of neuron maturation|neuromuscular junction development|neuron death|peptidyl-serine phosphorylation|positive regulation of autophagy|positive regulation of dopamine receptor signaling pathway|positive regulation of programmed cell death|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein phosphorylation|positive regulation of protein ubiquitination|protein autophosphorylation|regulation of kidney size|regulation of locomotion|regulation of membrane potential|response to oxidative stress|small GTPase mediated signal transduction|tangential migration from the subventricular zone to the olfactory bulb	external side of mitochondrial outer membrane	ATP binding|GTP binding|GTP-dependent protein kinase activity|GTPase activator activity|MAP kinase kinase activity|protein homodimerization activity|tubulin binding			ovary(12)|stomach(5)|upper_aerodigestive_tract(2)|lung(2)|large_intestine(1)|urinary_tract(1)|pancreas(1)	24	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)																---	---	---	---
KRT80	144501	broad.mit.edu	37	12	52565271	52565271	+	Silent	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52565271G>T	uc001rzx.2	-	9	1368	c.1270C>A	c.(1270-1272)CGA>AGA	p.R424R	KRT80_uc001rzw.2_Silent_p.R459R|KRT80_uc001rzy.2_3'UTR	NM_182507	NP_872313	Q6KB66	K2C80_HUMAN	keratin 80 isoform a	424	Tail.					keratin filament	structural molecule activity				0				BRCA - Breast invasive adenocarcinoma(357;0.108)														---	---	---	---
LEMD3	23592	broad.mit.edu	37	12	65639954	65639954	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:65639954C>A	uc001ssl.1	+	13	2591	c.2585C>A	c.(2584-2586)ACA>AAA	p.T862K	LEMD3_uc009zqo.1_Missense_Mutation_p.T861K	NM_014319	NP_055134	Q9Y2U8	MAN1_HUMAN	LEM domain containing 3	862	Interaction with SMAD1, SMAD2, SMAD3 and SMAD5.				negative regulation of activin receptor signaling pathway|negative regulation of BMP signaling pathway|negative regulation of transforming growth factor beta receptor signaling pathway	integral to nuclear inner membrane|membrane fraction	DNA binding|nucleotide binding|protein binding			central_nervous_system(3)|ovary(1)	4			LUAD - Lung adenocarcinoma(6;0.0234)|LUSC - Lung squamous cell carcinoma(43;0.0975)	GBM - Glioblastoma multiforme(28;0.0104)														---	---	---	---
PTPRB	5787	broad.mit.edu	37	12	70988373	70988373	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:70988373C>A	uc001swb.3	-	4	766	c.736G>T	c.(736-738)GGT>TGT	p.G246C	PTPRB_uc010sto.1_Missense_Mutation_p.G246C|PTPRB_uc010stp.1_Missense_Mutation_p.G246C|PTPRB_uc001swc.3_Missense_Mutation_p.G464C|PTPRB_uc001swa.3_Missense_Mutation_p.G464C|PTPRB_uc001swd.3_Missense_Mutation_p.G463C|PTPRB_uc009zrr.1_Missense_Mutation_p.G343C|PTPRB_uc001swe.2_Missense_Mutation_p.G464C	NM_002837	NP_002828	P23467	PTPRB_HUMAN	protein tyrosine phosphatase, receptor type, B	246	Fibronectin type-III 3.|Extracellular (Potential).				angiogenesis	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(2)|skin(1)	3	Renal(347;0.236)		GBM - Glioblastoma multiforme(2;2.17e-05)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00306)|STAD - Stomach adenocarcinoma(21;0.149)															---	---	---	---
PAH	5053	broad.mit.edu	37	12	103260378	103260378	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:103260378G>T	uc001tjq.1	-	6	977	c.505C>A	c.(505-507)CGC>AGC	p.R169S	PAH_uc010swc.1_Missense_Mutation_p.R169S	NM_000277	NP_000268	P00439	PH4H_HUMAN	phenylalanine hydroxylase	169			R -> H (in PKU).		catecholamine biosynthetic process|L-phenylalanine catabolic process|neurotransmitter biosynthetic process	cytosol	phenylalanine 4-monooxygenase activity			ovary(4)	4					Epinephrine(DB00668)|L-Phenylalanine(DB00120)|Levodopa(DB01235)|Norepinephrine(DB00368)|Tetrahydrobiopterin(DB00360)													---	---	---	---
FOXN4	121643	broad.mit.edu	37	12	109719324	109719324	+	Silent	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109719324C>A	uc001toe.3	-	9	1287	c.1182G>T	c.(1180-1182)CCG>CCT	p.P394P	FOXN4_uc009zvg.2_Silent_p.P191P|FOXN4_uc001tof.3_Silent_p.P214P	NM_213596	NP_998761	Q96NZ1	FOXN4_HUMAN	forkhead box N4	394					axon extension|embryo development|organ development|pattern specification process|regulation of heart contraction|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			ovary(1)|lung(1)	2																		---	---	---	---
DNAH10	196385	broad.mit.edu	37	12	124359850	124359850	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124359850C>A	uc001uft.3	+	46	7682	c.7657C>A	c.(7657-7659)CGT>AGT	p.R2553S		NM_207437	NP_997320	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	2553	AAA 3 (By similarity).				microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(3)|skin(2)|central_nervous_system(1)	6	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)														---	---	---	---
TMEM132D	121256	broad.mit.edu	37	12	130185027	130185027	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:130185027G>T	uc009zyl.1	-	2	624	c.296C>A	c.(295-297)CCT>CAT	p.P99H		NM_133448	NP_597705	Q14C87	T132D_HUMAN	transmembrane protein 132D precursor	99	Extracellular (Potential).					integral to membrane				ovary(10)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	14	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)														---	---	---	---
COL4A1	1282	broad.mit.edu	37	13	110861227	110861227	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:110861227C>T	uc001vqw.3	-	12	784	c.662G>A	c.(661-663)GGC>GAC	p.G221D	COL4A1_uc010agl.2_Missense_Mutation_p.G221D	NM_001845	NP_001836	P02462	CO4A1_HUMAN	alpha 1 type IV collagen preproprotein	221	Triple-helical region.				angiogenesis|axon guidance		extracellular matrix structural constituent|platelet-derived growth factor binding			ovary(3)|lung(1)|central_nervous_system(1)|pancreas(1)	6	all_cancers(4;9.8e-13)|all_epithelial(4;9.66e-08)|all_lung(23;3.75e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00178)|all_neural(89;0.00459)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0604)	Breast(118;0.2)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.145)															---	---	---	---
NEDD8	4738	broad.mit.edu	37	14	24686353	24686353	+	Nonsense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24686353C>A	uc001wnn.2	-	4	329	c.226G>T	c.(226-228)GGA>TGA	p.G76*	TM9SF1_uc010tob.1_5'Flank|CHMP4A_uc010toc.1_5'Flank|CHMP4A_uc001wnj.2_5'Flank|MDP1_uc001wnk.1_5'Flank|CHMP4A_uc001wnm.1_5'Flank|MDP1_uc001wnl.1_5'Flank|NEDD8_uc001wno.2_RNA	NM_006156	NP_006147	Q15843	NEDD8_HUMAN	neural precursor cell expressed, developmentally	76					anatomical structure morphogenesis|protein neddylation|ubiquitin-dependent protein catabolic process	nucleus	ubiquitin protein ligase binding				0				GBM - Glioblastoma multiforme(265;0.0186)														---	---	---	---
G2E3	55632	broad.mit.edu	37	14	31061605	31061605	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:31061605C>A	uc001wqk.2	+	5	468	c.314C>A	c.(313-315)CCA>CAA	p.P105Q	G2E3_uc010tpe.1_Missense_Mutation_p.P59Q|G2E3_uc010tpf.1_Missense_Mutation_p.P59Q	NM_017769	NP_060239	Q7L622	G2E3_HUMAN	G2/M-phase specific E3 ubiquitin ligase	105	PHD-type 1.				apoptosis|multicellular organismal development|protein modification process	Golgi apparatus|nucleolus	acid-amino acid ligase activity|protein binding|zinc ion binding			ovary(2)|skin(1)	3																		---	---	---	---
EGLN3	112399	broad.mit.edu	37	14	34400401	34400401	+	Silent	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:34400401C>A	uc001wsa.3	-	2	704	c.378G>T	c.(376-378)CCG>CCT	p.P126P	EGLN3_uc001wry.2_Silent_p.P32P|EGLN3_uc001wrz.2_Silent_p.P126P	NM_022073	NP_071356	Q9H6Z9	EGLN3_HUMAN	egl nine homolog 3	126	Fe2OG dioxygenase.				apoptosis	cytoplasm|nucleus	iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding				0	Breast(36;0.0303)|Hepatocellular(127;0.133)		LUAD - Lung adenocarcinoma(48;0.000246)|Lung(238;0.000959)|Epithelial(34;0.155)	GBM - Glioblastoma multiforme(112;0.0118)	Vitamin C(DB00126)													---	---	---	---
NIN	51199	broad.mit.edu	37	14	51226755	51226755	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:51226755C>A	uc001wym.2	-	17	2410	c.2219G>T	c.(2218-2220)CGG>CTG	p.R740L	NIN_uc001wyi.2_Missense_Mutation_p.R740L|NIN_uc001wyj.2_RNA|NIN_uc001wyk.2_Missense_Mutation_p.R740L|NIN_uc010tqp.1_Missense_Mutation_p.R746L|NIN_uc001wyo.2_Missense_Mutation_p.R740L	NM_182946	NP_891991	Q8N4C6	NIN_HUMAN	ninein isoform 5	740	Potential.				centrosome localization	centrosome|microtubule	calcium ion binding|GTP binding|protein binding			skin(3)|ovary(1)|kidney(1)|central_nervous_system(1)	6	all_epithelial(31;0.00244)|Breast(41;0.127)							T	PDGFRB	MPD								---	---	---	---
KTN1	3895	broad.mit.edu	37	14	56086004	56086004	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:56086004G>T	uc001xcb.2	+	6	1239	c.937G>T	c.(937-939)GGT>TGT	p.G313C	KTN1_uc001xce.2_Missense_Mutation_p.G313C|KTN1_uc001xcc.2_Missense_Mutation_p.G313C|KTN1_uc001xcd.2_Missense_Mutation_p.G313C|KTN1_uc010trb.1_Missense_Mutation_p.G313C|KTN1_uc001xcf.1_Missense_Mutation_p.G313C	NM_182926	NP_891556	Q86UP2	KTN1_HUMAN	kinectin 1 isoform a	313	Lumenal (Potential).				microtubule-based movement	endoplasmic reticulum membrane|integral to plasma membrane|membrane fraction				breast(3)|ovary(2)|lung(1)|central_nervous_system(1)	7								T	RET	papillary thryoid								---	---	---	---
FUT8	2530	broad.mit.edu	37	14	66191053	66191053	+	Intron	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:66191053C>A	uc001xin.2	+						FUT8_uc001xio.2_Intron|FUT8_uc010tsp.1_Intron|FUT8_uc001xir.3_Intron|FUT8_uc001xip.2_Intron|FUT8_uc001xiq.2_Intron|FUT8_uc001xis.2_Intron	NM_178155	NP_835368			fucosyltransferase 8 isoform a						in utero embryonic development|L-fucose catabolic process|N-glycan processing|oligosaccharide biosynthetic process|post-translational protein modification|protein glycosylation in Golgi|protein N-linked glycosylation via asparagine	Golgi cisterna membrane|integral to membrane	glycoprotein 6-alpha-L-fucosyltransferase activity|SH3 domain binding			ovary(1)	1				all cancers(60;0.00109)|OV - Ovarian serous cystadenocarcinoma(108;0.00242)|BRCA - Breast invasive adenocarcinoma(234;0.0114)														---	---	---	---
GPHN	10243	broad.mit.edu	37	14	67635649	67635649	+	Splice_Site	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:67635649G>T	uc001xiy.2	+	20	2998	c.1877_splice	c.e20-1	p.G626_splice	GPHN_uc001xix.2_Splice_Site_p.G659_splice|GPHN_uc010tss.1_Splice_Site_p.G672_splice|GPHN_uc010tst.1_Splice_Site_p.G595_splice|GPHN_uc010tsu.1_Splice_Site_p.G549_splice	NM_001024218	NP_001019389			gephyrin isoform 2						Mo-molybdopterin cofactor biosynthetic process|water-soluble vitamin metabolic process	cell junction|cytoplasm|cytoskeleton|postsynaptic membrane	ATP binding|metal ion binding|nucleotidyltransferase activity			ovary(2)	2		all_cancers(7;0.0476)|all_hematologic(31;0.0116)		Epithelial(1;1.73e-08)|all cancers(60;3.15e-07)|OV - Ovarian serous cystadenocarcinoma(108;0.000275)|BRCA - Breast invasive adenocarcinoma(234;0.00323)|Colorectal(3;0.0938)|KIRC - Kidney renal clear cell carcinoma(182;0.184)				T	MLL	AL								---	---	---	---
C14orf1	11161	broad.mit.edu	37	14	76123764	76123764	+	Silent	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:76123764G>T	uc001xrt.2	-	2	528	c.82C>A	c.(82-84)CGA>AGA	p.R28R	C14orf1_uc001xru.2_RNA	NM_007176	NP_009107	Q9UKR5	ERG28_HUMAN	ergosterol biosynthetic protein 28	28					sterol biosynthetic process	endoplasmic reticulum membrane|integral to membrane|transport vesicle					0		all_epithelial(191;0.125)|all_neural(303;0.13)|Myeloproliferative disorder(585;0.163)		BRCA - Breast invasive adenocarcinoma(234;0.00147)														---	---	---	---
TC2N	123036	broad.mit.edu	37	14	92258810	92258810	+	Silent	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92258810G>T	uc001xzu.3	-	9	1139	c.948C>A	c.(946-948)CCC>CCA	p.P316P	TC2N_uc001xzt.3_Silent_p.P316P|TC2N_uc010auc.2_Intron|TC2N_uc001xzv.3_Silent_p.P316P	NM_001128595	NP_001122067	Q8N9U0	TAC2N_HUMAN	tandem C2 domains, nuclear	316						nucleus				upper_aerodigestive_tract(1)	1				COAD - Colon adenocarcinoma(157;0.218)														---	---	---	---
PPP4R4	57718	broad.mit.edu	37	14	94712764	94712764	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94712764G>T	uc001ycs.1	+	14	1653	c.1499G>T	c.(1498-1500)TGG>TTG	p.W500L		NM_058237	NP_478144	Q6NUP7	PP4R4_HUMAN	HEAT-like repeat-containing protein isoform 1	500						cytoplasm|protein serine/threonine phosphatase complex	protein binding			skin(3)|upper_aerodigestive_tract(1)	4																		---	---	---	---
EML1	2009	broad.mit.edu	37	14	100317368	100317368	+	Silent	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:100317368C>A	uc001ygs.2	+	2	315	c.246C>A	c.(244-246)ACC>ACA	p.T82T	EML1_uc010avt.1_Silent_p.T69T|EML1_uc010tww.1_Silent_p.T51T|EML1_uc001ygq.2_Silent_p.T82T|EML1_uc001ygr.2_Silent_p.T82T	NM_004434	NP_004425	O00423	EMAL1_HUMAN	echinoderm microtubule associated protein like 1	82						cytoplasm|microtubule|microtubule associated complex	calcium ion binding|protein binding			large_intestine(2)|pancreas(1)|ovary(1)|skin(1)	5		Melanoma(154;0.0879)|all_epithelial(191;0.216)																---	---	---	---
ASPG	374569	broad.mit.edu	37	14	104570831	104570831	+	Intron	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:104570831C>A	uc001yoq.1	+						ASPG_uc001yoo.1_Intron|ASPG_uc001yop.1_Intron|ASPG_uc001yor.1_Intron	NM_001080464	NP_001073933			60 kDa lysophospholipase						lipid catabolic process		1-alkyl-2-acetylglycerophosphocholine esterase activity|asparaginase activity|lysophospholipase activity				0																		---	---	---	---
ATP10A	57194	broad.mit.edu	37	15	25953436	25953436	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25953436C>A	uc010ayu.2	-	11	2462	c.2356G>T	c.(2356-2358)GGG>TGG	p.G786W		NM_024490	NP_077816	O60312	AT10A_HUMAN	ATPase, class V, type 10A	786	Cytoplasmic (Potential).				ATP biosynthetic process|regulation of cell shape	integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			pancreas(2)|ovary(1)|breast(1)|liver(1)	5		all_cancers(20;5.16e-25)|all_lung(180;1.51e-14)|Acute lymphoblastic leukemia(1;2.53e-05)|all_hematologic(1;0.000267)|Breast(32;0.00125)		all cancers(64;9.48e-07)|Epithelial(43;1.69e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0252)|Lung(196;0.244)														---	---	---	---
MTMR15	22909	broad.mit.edu	37	15	31206255	31206255	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:31206255G>T	uc001zff.2	+	5	2063	c.1772G>T	c.(1771-1773)CGG>CTG	p.R591L	MTMR15_uc001zfe.2_Missense_Mutation_p.R196L	NM_014967	NP_055782	Q9Y2M0	FAN1_HUMAN	myotubularin related protein 15 isoform a	591					double-strand break repair via homologous recombination|nucleotide-excision repair, DNA incision	nucleus	5'-3' exonuclease activity|5'-flap endonuclease activity|DNA binding|magnesium ion binding|phosphodiesterase I activity|ubiquitin binding				0		all_lung(180;2.23e-09)		all cancers(64;4.72e-15)|Epithelial(43;5.4e-11)|GBM - Glioblastoma multiforme(186;0.000136)|BRCA - Breast invasive adenocarcinoma(123;0.00402)|Lung(196;0.168)									Direct_reversal_of_damage|Editing_and_processing_nucleases					---	---	---	---
SLC12A1	6557	broad.mit.edu	37	15	48527094	48527094	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:48527094T>G	uc001zwn.3	+	9	1324	c.1108T>G	c.(1108-1110)TTT>GTT	p.F370V	SLC12A1_uc010uew.1_Missense_Mutation_p.F176V|SLC12A1_uc010bem.2_Missense_Mutation_p.F370V|SLC12A1_uc010uex.1_Missense_Mutation_p.F370V|SLC12A1_uc001zwq.3_Missense_Mutation_p.F141V|SLC12A1_uc001zwr.3_Missense_Mutation_p.F97V	NM_000338	NP_000329	Q13621	S12A1_HUMAN	sodium potassium chloride cotransporter 2	370					potassium ion transport|sodium ion transport	integral to membrane|membrane fraction	sodium:potassium:chloride symporter activity			ovary(1)|central_nervous_system(1)	2		all_lung(180;0.00219)		all cancers(107;1.76e-09)|GBM - Glioblastoma multiforme(94;1.48e-06)	Bumetanide(DB00887)|Chlormerodrin(DB00534)|Chlorthalidone(DB00310)|Ethacrynic acid(DB00903)|Furosemide(DB00695)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Metolazone(DB00524)|Potassium Chloride(DB00761)|Torasemide(DB00214)|Trichlormethiazide(DB01021)													---	---	---	---
AP4E1	23431	broad.mit.edu	37	15	51233738	51233738	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:51233738C>A	uc001zyx.1	+	9	1073	c.1043C>A	c.(1042-1044)CCT>CAT	p.P348H	AP4E1_uc010ufi.1_Missense_Mutation_p.P348H|AP4E1_uc010ufj.1_RNA|AP4E1_uc010ufk.1_RNA|LOC100132724_uc010ufl.1_5'Flank	NM_007347	NP_031373	Q9UPM8	AP4E1_HUMAN	adaptor-related protein complex 4, epsilon 1	348					intracellular protein transport|vesicle-mediated transport	COPI vesicle coat	binding|structural molecule activity				0				all cancers(107;0.000893)|GBM - Glioblastoma multiforme(94;0.00364)														---	---	---	---
RFX7	64864	broad.mit.edu	37	15	56388002	56388002	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:56388002C>A	uc010bfn.2	-	9	1924	c.1924G>T	c.(1924-1926)GGT>TGT	p.G642C	RFX7_uc010ugk.1_RNA|RFX7_uc002adn.1_Missense_Mutation_p.G456C	NM_022841	NP_073752	Q2KHR2	RFX7_HUMAN	regulatory factor X domain containing 2	545					regulation of transcription, DNA-dependent	nucleus	DNA binding				0																		---	---	---	---
DENND4A	10260	broad.mit.edu	37	15	65983706	65983706	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65983706G>T	uc002aph.2	-	22	3472	c.3094C>A	c.(3094-3096)CGT>AGT	p.R1032S	DENND4A_uc002api.2_Missense_Mutation_p.R1075S|DENND4A_uc002apj.3_Missense_Mutation_p.R1032S	NM_005848	NP_005839	Q7Z401	MYCPP_HUMAN	DENN/MADD domain containing 4A isoform 2	1032					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	4																		---	---	---	---
LRRC49	54839	broad.mit.edu	37	15	71329532	71329532	+	Missense_Mutation	SNP	G	T	T	rs149509591		TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:71329532G>T	uc002asw.2	+	15	1965	c.1718G>T	c.(1717-1719)CGG>CTG	p.R573L	LRRC49_uc002asu.2_Missense_Mutation_p.R563L|LRRC49_uc002asx.2_Missense_Mutation_p.R529L|LRRC49_uc010ukf.1_Missense_Mutation_p.R578L|LRRC49_uc002asy.2_Missense_Mutation_p.R279L|LRRC49_uc002asz.2_Missense_Mutation_p.R545L	NM_017691	NP_060161	Q8IUZ0	LRC49_HUMAN	leucine rich repeat containing 49	573						cytoplasm|microtubule				ovary(1)	1																		---	---	---	---
STARD5	80765	broad.mit.edu	37	15	81610813	81610813	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:81610813G>T	uc002bgm.2	-	5	515	c.431C>A	c.(430-432)CCG>CAG	p.P144Q	STARD5_uc002bgn.2_Missense_Mutation_p.P37Q	NM_181900	NP_871629	Q9NSY2	STAR5_HUMAN	StAR-related lipid transfer protein 5	144	START.				C21-steroid hormone biosynthetic process|lipid transport	cytosol	lipid binding			ovary(1)	1																		---	---	---	---
LRRK1	79705	broad.mit.edu	37	15	101549122	101549122	+	Silent	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:101549122G>T	uc002bwr.2	+	7	1162	c.843G>T	c.(841-843)ACG>ACT	p.T281T	LRRK1_uc010usb.1_RNA|LRRK1_uc010usc.1_RNA	NM_024652	NP_078928	Q38SD2	LRRK1_HUMAN	leucine-rich repeat kinase 1	281	LRR 1.				small GTPase mediated signal transduction	mitochondrion	ATP binding|GTP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			ovary(4)|lung(4)|central_nervous_system(3)|large_intestine(1)	12	Melanoma(26;0.00505)|Lung NSC(78;0.00793)|all_lung(78;0.0094)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)													OREG0023521	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
MLST8	64223	broad.mit.edu	37	16	2258520	2258520	+	Silent	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2258520G>T	uc002coz.2	+	8	887	c.768G>T	c.(766-768)ACG>ACT	p.T256T	MLST8_uc002coy.2_Silent_p.T256T|MLST8_uc002cpa.2_Silent_p.T72T|MLST8_uc002cpb.2_Silent_p.T255T|MLST8_uc010uvx.1_Silent_p.T190T|MLST8_uc002cpc.2_Silent_p.T256T|MLST8_uc002cpd.2_Silent_p.T190T|MLST8_uc002cpe.2_Silent_p.T256T|MLST8_uc002cpg.2_Silent_p.T275T|MLST8_uc002cph.2_RNA|MLST8_uc002cpf.2_Silent_p.T256T	NM_022372	NP_071767	Q9BVC4	LST8_HUMAN	G protein beta subunit-like	256	WD 6.				insulin receptor signaling pathway|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of TOR signaling cascade|T cell costimulation	cytosol	protein binding				0																		---	---	---	---
ZNF597	146434	broad.mit.edu	37	16	3490843	3490843	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3490843C>A	uc002cvd.2	-	3	308	c.124G>T	c.(124-126)GGT>TGT	p.G42C	NAT15_uc002cvh.3_5'Flank|NAT15_uc010uxb.1_5'Flank	NM_152457	NP_689670	Q96LX8	ZN597_HUMAN	zinc finger protein 597	42	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0																		---	---	---	---
ITPRIPL2	162073	broad.mit.edu	37	16	19126666	19126666	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:19126666C>A	uc002dfu.3	+	1	1413	c.883C>A	c.(883-885)CGC>AGC	p.R295S	ITPRIPL2_uc002dft.2_5'UTR	NM_001034841	NP_001030013	Q3MIP1	IPIL2_HUMAN	inositol 1,4,5-triphosphate receptor interacting	295	Cytoplasmic (Potential).					integral to membrane				skin(2)	2																OREG0023657	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
EEF2K	29904	broad.mit.edu	37	16	22262558	22262558	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:22262558G>T	uc002dki.2	+	6	1018	c.533G>T	c.(532-534)CGG>CTG	p.R178L	EEF2K_uc002dkh.2_RNA	NM_013302	NP_037434	O00418	EF2K_HUMAN	elongation factor-2 kinase	178	Alpha-type protein kinase.				insulin receptor signaling pathway|translational elongation	cytosol	ATP binding|calcium ion binding|calmodulin binding|elongation factor-2 kinase activity|translation factor activity, nucleic acid binding			large_intestine(1)	1				GBM - Glioblastoma multiforme(48;0.0223)														---	---	---	---
SCNN1B	6338	broad.mit.edu	37	16	23366787	23366787	+	Silent	SNP	C	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:23366787C>T	uc002dln.2	+	4	929	c.753C>T	c.(751-753)TTC>TTT	p.F251F		NM_000336	NP_000327	P51168	SCNNB_HUMAN	sodium channel, nonvoltage-gated 1, beta	251	Extracellular (By similarity).				excretion|sensory perception of taste	apical plasma membrane	ligand-gated sodium channel activity|WW domain binding			ovary(3)|breast(2)|large_intestine(1)|pancreas(1)	7				GBM - Glioblastoma multiforme(48;0.0465)	Amiloride(DB00594)|Triamterene(DB00384)													---	---	---	---
SLC5A2	6524	broad.mit.edu	37	16	31500611	31500611	+	Silent	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31500611C>A	uc002ecf.3	+	12	1636	c.1617C>A	c.(1615-1617)CTC>CTA	p.L539L	SLC5A2_uc010car.2_RNA|C16orf58_uc002ecg.2_RNA	NM_003041	NP_003032	P31639	SC5A2_HUMAN	solute carrier family 5 (sodium/glucose	539	Helical; (Potential).				carbohydrate metabolic process	integral to membrane	low-affinity glucose:sodium symporter activity			ovary(1)	1																		---	---	---	---
RPGRIP1L	23322	broad.mit.edu	37	16	53671740	53671740	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:53671740C>A	uc002ehp.2	-	21	3151	c.3087G>T	c.(3085-3087)GAG>GAT	p.E1029D	RPGRIP1L_uc002eho.3_Missense_Mutation_p.E995D|RPGRIP1L_uc010vgy.1_Missense_Mutation_p.E1029D|RPGRIP1L_uc010cbx.2_Missense_Mutation_p.E995D|RPGRIP1L_uc010vgz.1_Missense_Mutation_p.E1029D	NM_015272	NP_056087	Q68CZ1	FTM_HUMAN	RPGRIP1-like isoform a	1029					negative regulation of G-protein coupled receptor protein signaling pathway	cell-cell junction|centrosome|cilium axoneme|microtubule basal body	thromboxane A2 receptor binding			ovary(1)	1		all_cancers(37;0.0973)																---	---	---	---
OGFOD1	55239	broad.mit.edu	37	16	56510089	56510089	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:56510089G>T	uc002ejb.2	+	13	1702	c.1601G>T	c.(1600-1602)TGG>TTG	p.W534L	OGFOD1_uc002ejc.2_Missense_Mutation_p.W394L	NM_018233	NP_060703	Q8N543	OGFD1_HUMAN	2-oxoglutarate and iron-dependent oxygenase	534							iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			skin(1)	1					Vitamin C(DB00126)													---	---	---	---
NLRC5	84166	broad.mit.edu	37	16	57115521	57115521	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57115521C>A	uc002ekk.1	+	48	5713	c.5488C>A	c.(5488-5490)CGC>AGC	p.R1830S	NLRC5_uc010ccr.1_RNA|NLRC5_uc010ccs.1_RNA|NLRC5_uc002eko.1_RNA|NLRC5_uc002ekq.1_Missense_Mutation_p.R372S|NLRC5_uc002ekr.1_Missense_Mutation_p.R717S	NM_032206	NP_115582	Q86WI3	NLRC5_HUMAN	nucleotide-binding oligomerization domains 27	1830					defense response to virus|innate immune response|negative regulation of NF-kappaB transcription factor activity|negative regulation of type I interferon production|negative regulation of type I interferon-mediated signaling pathway|positive regulation of interferon-gamma-mediated signaling pathway|positive regulation of MHC class I biosynthetic process|positive regulation of transcription from RNA polymerase II promoter|positive regulation of type I interferon-mediated signaling pathway|regulation of kinase activity	cytosol|nucleus	ATP binding|protein binding|RNA polymerase II core promoter sequence-specific DNA binding			ovary(4)|skin(2)|breast(1)	7		all_neural(199;0.225)																---	---	---	---
FAM192A	80011	broad.mit.edu	37	16	57188396	57188396	+	Nonsense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57188396C>A	uc010vhk.1	-	7	830	c.571G>T	c.(571-573)GGA>TGA	p.G191*	FAM192A_uc002ekz.3_Nonsense_Mutation_p.G190*|FAM192A_uc002ekv.3_Nonsense_Mutation_p.G113*|FAM192A_uc002ekw.3_Nonsense_Mutation_p.G190*|FAM192A_uc002ekx.3_Nonsense_Mutation_p.G190*|FAM192A_uc002eky.3_Nonsense_Mutation_p.G190*	NM_024946	NP_079222	Q9GZU8	F192A_HUMAN	NEFA-interacting nuclear protein NIP30	191						nucleus					0																		---	---	---	---
TUBB3	10381	broad.mit.edu	37	16	90002056	90002056	+	Silent	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:90002056G>T	uc002fph.1	+	4	1262	c.1197G>T	c.(1195-1197)ACG>ACT	p.T399T	TUBB3_uc002fpf.2_Silent_p.T746T|TUBB3_uc010ciz.1_Silent_p.T327T|TUBB3_uc002fpg.1_Silent_p.T253T|TUBB3_uc002fpi.1_Silent_p.T327T|TUBB3_uc002fpj.1_Silent_p.T327T|TUBB3_uc010cjb.1_Silent_p.T253T|TUBB3_uc002fpk.1_Silent_p.T253T	NM_006086	NP_006077	Q13509	TBB3_HUMAN	tubulin, beta, 4	399					'de novo' posttranslational protein folding|axon guidance|microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|structural molecule activity			ovary(2)|pancreas(1)	3		all_cancers(9;1.69e-11)|Lung NSC(15;8.94e-06)|all_lung(18;1.39e-05)|all_neural(9;0.00581)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.0273)														---	---	---	---
TIMM22	29928	broad.mit.edu	37	17	904323	904323	+	Silent	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:904323C>A	uc002fsc.2	+	4	606	c.580C>A	c.(580-582)CGG>AGG	p.R194R		NM_013337	NP_037469	Q9Y584	TIM22_HUMAN	translocase of inner mitochondrial membrane 22	194					transmembrane transport	integral to membrane|mitochondrial inner membrane	protein transporter activity				0				UCEC - Uterine corpus endometrioid carcinoma (25;0.022)														---	---	---	---
RAP1GAP2	23108	broad.mit.edu	37	17	2908679	2908679	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:2908679G>T	uc010ckd.2	+	15	1307	c.1217G>T	c.(1216-1218)CGG>CTG	p.R406L	RAP1GAP2_uc010cke.2_Missense_Mutation_p.R391L	NM_015085	NP_055900	Q684P5	RPGP2_HUMAN	RAP1 GTPase activating protein 2 isoform 1	406	Rap-GAP.				regulation of small GTPase mediated signal transduction	centrosome|cytosol|perinuclear region of cytoplasm	GTPase activator activity			ovary(1)	1																		---	---	---	---
ALOX12	239	broad.mit.edu	37	17	6902654	6902654	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:6902654G>A	uc002gdx.3	+	6	729	c.676G>A	c.(676-678)GAG>AAG	p.E226K		NM_000697	NP_000688	P18054	LOX12_HUMAN	arachidonate 12-lipoxygenase	226	Lipoxygenase.				anti-apoptosis|cellular component movement|fatty acid oxidation|leukotriene biosynthetic process|positive regulation of cell adhesion|positive regulation of cell growth|positive regulation of cell proliferation|superoxide anion generation	cytosol|sarcolemma	arachidonate 12-lipoxygenase activity|hepoxilin-epoxide hydrolase activity|iron ion binding|lipoxygenase activity|protein binding			central_nervous_system(1)	1																		---	---	---	---
TP53	7157	broad.mit.edu	37	17	7578271	7578271	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7578271T>C	uc002gim.2	-	6	772	c.578A>G	c.(577-579)CAT>CGT	p.H193R	TP53_uc002gig.1_Missense_Mutation_p.H193R|TP53_uc002gih.2_Missense_Mutation_p.H193R|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.H61R|TP53_uc010cng.1_Missense_Mutation_p.H61R|TP53_uc002gii.1_Missense_Mutation_p.H61R|TP53_uc010cnh.1_Missense_Mutation_p.H193R|TP53_uc010cni.1_Missense_Mutation_p.H193R|TP53_uc002gij.2_Missense_Mutation_p.H193R|TP53_uc010cnj.1_Intron|TP53_uc002gin.2_Missense_Mutation_p.H100R|TP53_uc002gio.2_Missense_Mutation_p.H61R|TP53_uc010vug.1_Missense_Mutation_p.H154R	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	193	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		H -> D (in sporadic cancers; somatic mutation).|H -> Q (in sporadic cancers; somatic mutation).|H -> Y (in sporadic cancers; somatic mutation).|QH -> HN (in a sporadic cancer; somatic mutation).|H -> N (in sporadic cancers; somatic mutation).|QH -> HY (in a sporadic cancer; somatic mutation).|H -> L (in sporadic cancers; somatic mutation).|H -> P (in sporadic cancers; somatic mutation).|H -> R (in LFS; germline mutation and in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.H193R(67)|p.H193L(31)|p.H193Y(26)|p.H193P(12)|p.0?(7)|p.H193D(7)|p.H193N(4)|p.A189_V197delAPPQHLIRV(4)|p.H193fs*16(3)|p.H193H(2)|p.P191fs*53(2)|p.K164_P219del(1)|p.P191fs*15(1)|p.P191fs*6(1)|p.H100L(1)|p.H61L(1)|p.H193_I195delHLI(1)|p.H193_I195>AP(1)|p.A189fs*53(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)			111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			---	---	---	---
ULK2	9706	broad.mit.edu	37	17	19699025	19699025	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:19699025C>A	uc002gwm.3	-	20	2520	c.2011G>T	c.(2011-2013)GGG>TGG	p.G671W	ULK2_uc002gwn.2_Missense_Mutation_p.G671W	NM_001142610	NP_001136082	Q8IYT8	ULK2_HUMAN	unc-51-like kinase 2	671					signal transduction		ATP binding|protein binding|protein serine/threonine kinase activity			skin(2)|large_intestine(1)|stomach(1)	4	all_cancers(12;4.97e-05)|all_epithelial(12;0.00362)|Breast(13;0.186)																	---	---	---	---
NOS2	4843	broad.mit.edu	37	17	26105786	26105786	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26105786T>C	uc002gzu.2	-	11	1475	c.1211A>G	c.(1210-1212)CAC>CGC	p.H404R	NOS2_uc010crh.1_Missense_Mutation_p.H404R|NOS2_uc010wab.1_Missense_Mutation_p.H404R	NM_000625	NP_000616	P35228	NOS2_HUMAN	nitric oxide synthase 2A	404					arginine catabolic process|defense response to Gram-negative bacterium|innate immune response in mucosa|nitric oxide biosynthetic process|peptidyl-cysteine S-nitrosylation|platelet activation|positive regulation of killing of cells of other organism|positive regulation of leukocyte mediated cytotoxicity|regulation of cellular respiration|regulation of insulin secretion|superoxide metabolic process	cytosol|nucleus	arginine binding|calmodulin binding|flavin adenine dinucleotide binding|FMN binding|heme binding|NADP binding|nitric-oxide synthase activity|protein homodimerization activity|tetrahydrobiopterin binding			skin(2)|ovary(1)|breast(1)	4					Dexamethasone(DB01234)|Hydrocortisone(DB00741)|L-Arginine(DB00125)|L-Citrulline(DB00155)													---	---	---	---
PSMD11	5717	broad.mit.edu	37	17	30781647	30781647	+	Intron	SNP	A	G	G			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:30781647A>G	uc010cta.1	+						PSMD11_uc010wbz.1_Intron|PSMD11_uc002hhm.2_Intron	NM_002815	NP_002806			proteasome 26S non-ATPase subunit 11						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	proteasome complex	protein binding			ovary(1)	1		Breast(31;0.159)|Ovarian(249;0.182)	BRCA - Breast invasive adenocarcinoma(9;0.109)															---	---	---	---
PSMB3	5691	broad.mit.edu	37	17	36916765	36916765	+	Silent	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:36916765C>A	uc002hqr.2	+	4	456	c.378C>A	c.(376-378)CTC>CTA	p.L126L		NM_002795	NP_002786	P49720	PSB3_HUMAN	proteasome beta 3 subunit	126					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|interspecies interaction between organisms|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	cytoplasm|nucleus|proteasome core complex	protein binding|threonine-type endopeptidase activity				0																		---	---	---	---
EFCAB3	146779	broad.mit.edu	37	17	60484458	60484458	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:60484458G>T	uc002izu.1	+	8	830	c.752G>T	c.(751-753)GGG>GTG	p.G251V	EFCAB3_uc010wpc.1_Missense_Mutation_p.G303V	NM_173503	NP_775774	Q8N7B9	EFCB3_HUMAN	EF-hand calcium binding domain 3 isoform b	251							calcium ion binding			skin(1)	1			BRCA - Breast invasive adenocarcinoma(2;2.27e-11)															---	---	---	---
ACE	1636	broad.mit.edu	37	17	61559937	61559937	+	Missense_Mutation	SNP	G	T	T	rs145172277	byFrequency	TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61559937G>T	uc002jau.1	+	8	1251	c.1229G>T	c.(1228-1230)CGG>CTG	p.R410L	ACE_uc010wpi.1_Missense_Mutation_p.R410L|ACE_uc010ddu.1_Missense_Mutation_p.R227L|ACE_uc002jav.1_5'Flank|ACE_uc010ddv.1_5'Flank|ACE_uc010wpj.1_5'Flank|ACE_uc002jaw.1_5'Flank|ACE_uc010wpk.1_5'Flank	NM_000789	NP_000780	P12821	ACE_HUMAN	angiotensin I converting enzyme 1 isoform 1	410	Extracellular (Potential).|Peptidase M2 1.				arachidonic acid secretion|hormone catabolic process|kidney development|peptide catabolic process|regulation of smooth muscle cell migration	endosome|external side of plasma membrane|extracellular space|integral to membrane|membrane fraction|plasma membrane	actin binding|bradykinin receptor binding|carboxypeptidase activity|chloride ion binding|drug binding|metallopeptidase activity|peptidyl-dipeptidase activity|zinc ion binding			ovary(2)|upper_aerodigestive_tract(1)|pancreas(1)	4					Benazepril(DB00542)|Captopril(DB01197)|Deserpidine(DB01089)|Enalapril(DB00584)|Fosinopril(DB00492)|Lisinopril(DB00722)|Moexipril(DB00691)|Perindopril(DB00790)|Quinapril(DB00881)|Ramipril(DB00178)|Rescinnamine(DB01180)|Spirapril(DB01348)|Trandolapril(DB00519)													---	---	---	---
PSMD12	5718	broad.mit.edu	37	17	65362549	65362549	+	Silent	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:65362549G>T	uc002jfy.2	-	1	173	c.87C>A	c.(85-87)CCC>CCA	p.P29P	PSMD12_uc002jga.2_Silent_p.P29P|PSMD12_uc002jfz.2_5'UTR|PSMD12_uc010det.1_Silent_p.P29P	NM_002816	NP_002807	O00232	PSD12_HUMAN	proteasome 26S non-ATPase subunit 12 isoform 1	29					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	proteasome regulatory particle	protein binding				0	all_cancers(12;2.38e-11)|all_epithelial(3;8.27e-13)																	---	---	---	---
TSHZ1	10194	broad.mit.edu	37	18	72998359	72998359	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:72998359C>A	uc002lly.2	+	2	1425	c.862C>A	c.(862-864)CAG>AAG	p.Q288K		NM_005786	NP_005777	Q6ZSZ6	TSH1_HUMAN	teashirt family zinc finger 1	333						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		Esophageal squamous(42;0.129)|Prostate(75;0.142)|Melanoma(33;0.211)		Colorectal(1;0.000501)|READ - Rectum adenocarcinoma(2;0.00226)|BRCA - Breast invasive adenocarcinoma(31;0.246)														---	---	---	---
ZNF236	7776	broad.mit.edu	37	18	74607031	74607031	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:74607031C>A	uc002lmi.2	+	10	1672	c.1474C>A	c.(1474-1476)CGC>AGC	p.R492S	ZNF236_uc002lmj.2_RNA	NM_007345	NP_031371	Q9UL36	ZN236_HUMAN	zinc finger protein 236	492	C2H2-type 10.				cellular response to glucose stimulus	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(4)	4		Prostate(75;0.0405)|Esophageal squamous(42;0.129)|Melanoma(33;0.132)		OV - Ovarian serous cystadenocarcinoma(15;4.36e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0686)														---	---	---	---
REXO1	57455	broad.mit.edu	37	19	1819035	1819035	+	Silent	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1819035G>T	uc002lua.3	-	8	2841	c.2746C>A	c.(2746-2748)CGG>AGG	p.R916R	REXO1_uc010dsq.2_Silent_p.R225R|REXO1_uc010xgs.1_5'UTR|MIR1909_hsa-mir-1909|MI0008330_5'Flank|REXO1_uc010dsp.1_RNA	NM_020695	NP_065746	Q8N1G1	REXO1_HUMAN	transcription elongation factor B polypeptide 3	916						nucleus	exonuclease activity|nucleic acid binding				0		Ovarian(11;1.78e-06)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)														---	---	---	---
TBXA2R	6915	broad.mit.edu	37	19	3600596	3600596	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3600596G>A	uc002lyg.1	-	2	251	c.37C>T	c.(37-39)CGG>TGG	p.R13W	TBXA2R_uc002lye.1_Missense_Mutation_p.R13W	NM_001060	NP_001051	P21731	TA2R_HUMAN	thromboxane A2 receptor isoform alpha	13	Extracellular (Potential).				platelet activation	integral to plasma membrane	guanyl-nucleotide exchange factor activity|protein binding|thromboxane A2 receptor activity				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00253)|STAD - Stomach adenocarcinoma(1328;0.18)	Ridogrel(DB01207)													---	---	---	---
MATK	4145	broad.mit.edu	37	19	3789316	3789316	+	5'Flank	SNP	T	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3789316T>A	uc002lyt.2	-						MATK_uc002lyv.2_Missense_Mutation_p.R10S|MATK_uc002lyu.2_5'Flank|MATK_uc010dtq.2_5'Flank	NM_139355	NP_647612			megakaryocyte-associated tyrosine kinase isoform						cell proliferation|mesoderm development|positive regulation of cell proliferation	cytoplasm|nucleus	ATP binding|non-membrane spanning protein tyrosine kinase activity			stomach(2)|ovary(1)|lung(1)|large_intestine(1)	5		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00461)|STAD - Stomach adenocarcinoma(1328;0.18)														---	---	---	---
MUC16	94025	broad.mit.edu	37	19	9057759	9057759	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9057759G>C	uc002mkp.2	-	3	29891	c.29687C>G	c.(29686-29688)GCA>GGA	p.A9896G		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	9898	Ser-rich.|Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57																		---	---	---	---
MUC16	94025	broad.mit.edu	37	19	9060801	9060801	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9060801C>A	uc002mkp.2	-	3	26849	c.26645G>T	c.(26644-26646)CGG>CTG	p.R8882L		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	8884	Ser-rich.|Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57																		---	---	---	---
AKAP8	10270	broad.mit.edu	37	19	15483885	15483885	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15483885G>T	uc002nav.2	-	5	699	c.638C>A	c.(637-639)CCC>CAC	p.P213H	AKAP8_uc010dzy.2_5'UTR|AKAP8_uc010dzz.1_RNA|AKAP8_uc010xog.1_Missense_Mutation_p.P27H	NM_005858	NP_005849	O43823	AKAP8_HUMAN	A-kinase anchor protein 8	213					signal transduction	nuclear matrix				ovary(1)|breast(1)	2																		---	---	---	---
FAM129C	199786	broad.mit.edu	37	19	17641671	17641671	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17641671G>A	uc010xpr.1	+	3	394	c.256G>A	c.(256-258)GGA>AGA	p.G86R	FAM129C_uc010xpq.1_Missense_Mutation_p.G86R|FAM129C_uc010xps.1_Missense_Mutation_p.G55R|FAM129C_uc010xpt.1_Intron	NM_173544	NP_775815	Q86XR2	NIBL2_HUMAN	B-cell novel protein 1 isoform a	86											0																		---	---	---	---
PTH2	113091	broad.mit.edu	37	19	49926533	49926533	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49926533G>C	uc002pnn.1	-	1	166	c.64C>G	c.(64-66)CTG>GTG	p.L22V		NM_178449	NP_848544	Q96A98	TIP39_HUMAN	parathyroid hormone 2 preproprotein	22					neuropeptide signaling pathway	extracellular region					0				OV - Ovarian serous cystadenocarcinoma(262;0.0015)|GBM - Glioblastoma multiforme(486;0.044)|Lung(386;0.0785)|LUSC - Lung squamous cell carcinoma(496;0.0836)														---	---	---	---
ZNF665	79788	broad.mit.edu	37	19	53669357	53669357	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53669357C>T	uc010eqm.1	-	4	486	c.386G>A	c.(385-387)AGA>AAA	p.R129K		NM_024733	NP_079009	Q9H7R5	ZN665_HUMAN	zinc finger protein 665	64					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2				GBM - Glioblastoma multiforme(134;0.0196)														---	---	---	---
SIRPA	140885	broad.mit.edu	37	20	1903284	1903284	+	Silent	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:1903284C>A	uc002wfq.2	+	5	1440	c.1080C>A	c.(1078-1080)ACC>ACA	p.T360T	SIRPA_uc010zps.1_Silent_p.T340T|SIRPA_uc002wfr.2_Silent_p.T360T|SIRPA_uc002wfs.2_Silent_p.T360T|SIRPA_uc002wft.2_Silent_p.T360T	NM_001040022	NP_001035111	P78324	SHPS1_HUMAN	signal-regulatory protein alpha precursor	360	Extracellular (Potential).				blood coagulation|cell adhesion|cell junction assembly|leukocyte migration	integral to membrane|plasma membrane	SH3 domain binding			ovary(1)	1				Colorectal(46;0.018)|READ - Rectum adenocarcinoma(1;0.0556)														---	---	---	---
SLC4A11	83959	broad.mit.edu	37	20	3211459	3211459	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3211459C>A	uc002wig.2	-	10	1297	c.1249G>T	c.(1249-1251)GGG>TGG	p.G417W	SLC4A11_uc010zqe.1_Missense_Mutation_p.G444W|SLC4A11_uc002wih.2_RNA|SLC4A11_uc010zqf.1_Missense_Mutation_p.G401W	NM_032034	NP_114423	Q8NBS3	S4A11_HUMAN	solute carrier family 4 member 11	417	Helical; (Potential).|Membrane (bicarbonate transporter).				cellular cation homeostasis|fluid transport|phosphoenolpyruvate-dependent sugar phosphotransferase system	basolateral plasma membrane|integral to membrane	bicarbonate transmembrane transporter activity|borate transmembrane transporter activity|hydrogen ion channel activity|inorganic anion exchanger activity|sodium channel activity|sugar:hydrogen symporter activity			ovary(1)	1																		---	---	---	---
BFSP1	631	broad.mit.edu	37	20	17475023	17475023	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:17475023C>A	uc002wpo.2	-	8	1733	c.1694G>T	c.(1693-1695)CGG>CTG	p.R565L	BFSP1_uc002wpp.2_Missense_Mutation_p.R440L|BFSP1_uc010zrn.1_Missense_Mutation_p.R426L|BFSP1_uc010zro.1_Missense_Mutation_p.R426L	NM_001195	NP_001186	Q12934	BFSP1_HUMAN	filensin isoform 1	565	Tail.					cytoplasm|intermediate filament|membrane	structural constituent of cytoskeleton|structural constituent of eye lens			central_nervous_system(1)	1																		---	---	---	---
C20orf70	140683	broad.mit.edu	37	20	31768358	31768358	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31768358C>A	uc002wyo.1	+	8	813	c.742C>A	c.(742-744)CTC>ATC	p.L248I		NM_080574	NP_542141	Q96DR5	SPLC2_HUMAN	chromosome 20 open reading frame 70 precursor	248						extracellular region	lipid binding			ovary(1)|central_nervous_system(1)	2																		---	---	---	---
ITCH	83737	broad.mit.edu	37	20	33012331	33012331	+	Missense_Mutation	SNP	G	T	T	rs112357913		TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33012331G>T	uc010geu.1	+	8	836	c.644G>T	c.(643-645)AGA>ATA	p.R215I	ITCH_uc002xak.2_Missense_Mutation_p.R174I|ITCH_uc010zuj.1_Missense_Mutation_p.R64I	NM_031483	NP_113671	Q96J02	ITCH_HUMAN	itchy homolog E3 ubiquitin protein ligase	215					apoptosis|entry of virus into host cell|inflammatory response|innate immune response|negative regulation of apoptosis|negative regulation of defense response to virus|negative regulation of JNK cascade|negative regulation of NF-kappaB transcription factor activity|negative regulation of type I interferon production|protein K29-linked ubiquitination|protein K48-linked ubiquitination|protein K63-linked ubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of cell growth|regulation of protein deubiquitination|response to virus	cytosol|nucleus|plasma membrane	CXCR chemokine receptor binding|ribonucleoprotein binding|ubiquitin-protein ligase activity			breast(4)|lung(1)|central_nervous_system(1)	6																		---	---	---	---
C20orf152	140894	broad.mit.edu	37	20	34560550	34560550	+	Splice_Site	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:34560550G>T	uc002xes.1	+	2	208	c.52_splice	c.e2-1	p.G18_splice	C20orf152_uc002xer.1_Splice_Site_p.G18_splice|C20orf152_uc010gfp.1_Splice_Site					SubName: Full=C20orf152 protein;												0	Breast(12;0.00631)																	---	---	---	---
GHRH	2691	broad.mit.edu	37	20	35879622	35879622	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35879622C>A	uc002xgr.2	-	4	321	c.321G>T	c.(319-321)CAG>CAT	p.Q107H	GHRH_uc002xgs.2_Missense_Mutation_p.Q107H|GHRH_uc002xgt.2_Missense_Mutation_p.Q106H	NM_021081	NP_066567	P01286	SLIB_HUMAN	growth hormone releasing hormone preproprotein	107					activation of adenylate cyclase activity by G-protein signaling pathway|adenohypophysis development|growth hormone secretion|positive regulation of cAMP biosynthetic process|positive regulation of cell proliferation|positive regulation of circadian sleep/wake cycle, REM sleep|positive regulation of growth hormone secretion|positive regulation of insulin-like growth factor receptor signaling pathway|positive regulation of multicellular organism growth|response to food	extracellular space|terminal button	growth hormone-releasing hormone activity|growth hormone-releasing hormone receptor binding			ovary(1)	1		Myeloproliferative disorder(115;0.00878)																---	---	---	---
FAM83D	81610	broad.mit.edu	37	20	37580887	37580887	+	Silent	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37580887C>A	uc002xjg.2	+	4	1613	c.1572C>A	c.(1570-1572)CCC>CCA	p.P524P		NM_030919	NP_112181	Q9H4H8	FA83D_HUMAN	hypothetical protein LOC81610	494	Ser-rich.				cell division|mitosis	cytoplasm|spindle pole				ovary(3)	3		Myeloproliferative disorder(115;0.00878)																---	---	---	---
RBPJL	11317	broad.mit.edu	37	20	43945435	43945435	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:43945435G>T	uc002xns.2	+	12	1462	c.1390G>T	c.(1390-1392)GGG>TGG	p.G464W	RBPJL_uc002xnt.2_Missense_Mutation_p.R467L	NM_014276	NP_055091	Q9UBG7	RBPJL_HUMAN	recombining binding protein L	464	IPT/TIG.				signal transduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1		Myeloproliferative disorder(115;0.0122)																---	---	---	---
PIGT	51604	broad.mit.edu	37	20	44045146	44045146	+	Intron	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44045146C>A	uc002xoh.1	+						PIGT_uc010ghb.1_Intron|PIGT_uc010zwt.1_Intron|PIGT_uc010ghd.1_Intron|PIGT_uc010ghc.1_Intron|PIGT_uc010ghe.1_Intron|PIGT_uc010ghf.1_Intron|PIGT_uc002xoj.1_Intron|PIGT_uc002xok.1_Intron|PIGT_uc010zwu.1_Intron|PIGT_uc002xoi.1_Intron|PIGT_uc010zwv.1_Intron|PIGT_uc010zww.1_Intron|PIGT_uc010zwx.1_Intron|PIGT_uc010zwy.1_Intron|PIGT_uc010zwz.1_Intron|PIGT_uc010zxa.1_Intron|PIGT_uc002xol.1_5'Flank	NM_015937	NP_057021			phosphatidylinositol glycan anchor biosynthesis,						attachment of GPI anchor to protein|C-terminal protein lipidation	GPI-anchor transamidase complex	protein binding			pancreas(1)	1		Myeloproliferative disorder(115;0.0122)																---	---	---	---
GTPBP5	26164	broad.mit.edu	37	20	60770880	60770880	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60770880G>T	uc002yce.3	+	3	265	c.227G>T	c.(226-228)CGG>CTG	p.R76L	GTPBP5_uc011aab.1_5'UTR|GTPBP5_uc011aac.1_5'UTR|GTPBP5_uc011aad.1_5'UTR|GTPBP5_uc011aae.1_5'UTR|GTPBP5_uc011aaf.1_Missense_Mutation_p.R76L|GTPBP5_uc011aag.1_Missense_Mutation_p.R76L	NM_015666	NP_056481	Q9H4K7	GTPB5_HUMAN	GTP binding protein 5	76	Localized in the mitocondria.|Not localized in the mitocondria.				ribosome biogenesis	mitochondrion	GTP binding|GTPase activity|magnesium ion binding				0	Breast(26;3.52e-09)		BRCA - Breast invasive adenocarcinoma(19;2.5e-08)															---	---	---	---
PPDPF	79144	broad.mit.edu	37	20	62153190	62153190	+	Silent	SNP	C	A	A	rs113534342	byFrequency;by1000genomes	TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62153190C>A	uc002yff.2	+	4	443	c.303C>A	c.(301-303)CCC>CCA	p.P101P		NM_024299	NP_077275	Q9H3Y8	PPDPF_HUMAN	pancreatic progenitor cell differentiation and	101					cell differentiation|multicellular organismal development						0																		---	---	---	---
PRIC285	85441	broad.mit.edu	37	20	62200806	62200806	+	Silent	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62200806C>A	uc002yfm.2	-	5	1675	c.783G>T	c.(781-783)CCG>CCT	p.P261P	PRIC285_uc002yfl.1_5'Flank	NM_001037335	NP_001032412	Q9BYK8	PR285_HUMAN	PPAR-alpha interacting complex protein 285	261					cellular lipid metabolic process|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleoplasm	ATP binding|DNA binding|helicase activity|ribonuclease activity|RNA binding|transcription coactivator activity|zinc ion binding			central_nervous_system(2)	2	all_cancers(38;2.51e-11)|all_epithelial(29;8.27e-13)		Epithelial(9;1.27e-08)|all cancers(9;7.32e-08)|BRCA - Breast invasive adenocarcinoma(10;5.15e-06)															---	---	---	---
KRTAP21-1	337977	broad.mit.edu	37	21	32127495	32127495	+	Silent	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:32127495G>T	uc011adi.1	-	1	202	c.202C>A	c.(202-204)CGG>AGG	p.R68R		NM_181619	NP_853650	Q3LI58	KR211_HUMAN	keratin associated protein 21-1	68						intermediate filament				breast(1)	1																		---	---	---	---
KRTAP10-4	386672	broad.mit.edu	37	21	45994736	45994736	+	Silent	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45994736C>A	uc002zfk.1	+	1	1131	c.1101C>A	c.(1099-1101)CCC>CCA	p.P367P	C21orf29_uc002zfe.1_Intron|C21orf29_uc010gpv.1_Intron	NM_198687	NP_941960	P60372	KR104_HUMAN	keratin associated protein 10-4	367	36 X 5 AA repeats of C-C-X(3).					keratin filament					0																		---	---	---	---
PITPNB	23760	broad.mit.edu	37	22	28292625	28292625	+	Intron	SNP	C	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:28292625C>T	uc003adk.2	-						PITPNB_uc011akh.1_Intron|PITPNB_uc003adl.2_Intron	NM_012399	NP_036531			phosphatidylinositol transfer protein, beta						lipid metabolic process|transport	Golgi apparatus	lipid binding			skin(1)	1																		---	---	---	---
SCUBE1	80274	broad.mit.edu	37	22	43610231	43610231	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:43610231C>A	uc003bdt.1	-	16	2006	c.1918G>T	c.(1918-1920)GGT>TGT	p.G640C		NM_173050	NP_766638	Q8IWY4	SCUB1_HUMAN	signal peptide, CUB domain, EGF-like 1	640					adult heart development|blood coagulation|endothelial cell differentiation|inflammatory response|post-embryonic development|protein homooligomerization	external side of plasma membrane|extracellular space|extrinsic to plasma membrane	calcium ion binding|identical protein binding|protein heterodimerization activity			central_nervous_system(2)|ovary(1)|lung(1)|skin(1)	5		all_neural(38;0.0414)|Ovarian(80;0.07)																---	---	---	---
SFRS17A	8227	broad.mit.edu	37	X	1719899	1719899	+	Silent	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1719899G>T	uc004cqa.2	+	5	1696	c.1500G>T	c.(1498-1500)CCG>CCT	p.P500P	SFRS17A_uc004cqb.2_RNA|ASMT_uc004cqd.2_Intron	NM_005088	NP_005079	Q02040	AK17A_HUMAN	DNA segment on chromosome X and Y (unique) 155	500				P -> A (in Ref. 1; AAA61303 and 4; AAI10497).	B cell activation|mRNA processing|regulation of transcription, DNA-dependent|RNA splicing|signal transduction	nuclear speck|spliceosomal complex	nucleotide binding|protein binding|RNA binding				0		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)																---	---	---	---
APOO	79135	broad.mit.edu	37	X	23886763	23886763	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:23886763G>T	uc004dax.2	-	5	566	c.335C>A	c.(334-336)CCG>CAG	p.P112Q	APOO_uc004daw.2_RNA|APOO_uc004day.3_RNA	NM_024122	NP_077027	Q9BUR5	APOO_HUMAN	apolipoprotein O precursor	112	Helical; (Potential).				lipid transport	high-density lipoprotein particle|integral to membrane|low-density lipoprotein particle|very-low-density lipoprotein particle					0																		---	---	---	---
MAGEB10	139422	broad.mit.edu	37	X	27840456	27840456	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:27840456C>A	uc004dbw.2	+	3	1260	c.1033C>A	c.(1033-1035)CAA>AAA	p.Q345K		NM_182506	NP_872312	Q96LZ2	MAGBA_HUMAN	melanoma antigen family B, 10	345										lung(1)|breast(1)|central_nervous_system(1)	3																		---	---	---	---
SYTL5	94122	broad.mit.edu	37	X	37985932	37985932	+	Silent	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:37985932C>A	uc004ddu.2	+	18	2676	c.2142C>A	c.(2140-2142)CCC>CCA	p.P714P	SYTL5_uc004ddv.2_Silent_p.P714P|SYTL5_uc004ddx.2_Silent_p.P736P	NM_001163335	NP_001156807	Q8TDW5	SYTL5_HUMAN	synaptotagmin-like 5 isoform 1	714					intracellular protein transport	membrane	metal ion binding|Rab GTPase binding			skin(1)	1																		---	---	---	---
USP9X	8239	broad.mit.edu	37	X	41010251	41010251	+	Silent	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:41010251C>A	uc004dfb.2	+	13	2337	c.1704C>A	c.(1702-1704)CCC>CCA	p.P568P	USP9X_uc004dfc.2_Silent_p.P568P	NM_001039590	NP_001034679	Q93008	USP9X_HUMAN	ubiquitin specific protease 9, X-linked isoform	568					BMP signaling pathway|cell division|chromosome segregation|female gamete generation|mitosis|protein deubiquitination|transforming growth factor beta receptor signaling pathway|ubiquitin-dependent protein catabolic process	cytoplasm	co-SMAD binding|cysteine-type endopeptidase activity|ubiquitin thiolesterase activity			lung(3)|breast(2)|ovary(1)	6																		---	---	---	---
ZNF81	347344	broad.mit.edu	37	X	47755321	47755321	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:47755321C>A	uc010nhy.1	+	5	627	c.259C>A	c.(259-261)CCA>ACA	p.P87T		NM_007137	NP_009068	P51508	ZNF81_HUMAN	zinc finger protein 81	87	KRAB.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		all_lung(315;0.0973)																---	---	---	---
ZXDB	158586	broad.mit.edu	37	X	57619829	57619829	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:57619829G>T	uc004dvd.2	+	1	1561	c.1348G>T	c.(1348-1350)GGC>TGC	p.G450C		NM_007157	NP_009088	P98169	ZXDB_HUMAN	zinc finger, X-linked, duplicated B	450	Required for interaction with ZXDC (By similarity).				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding|zinc ion binding				0																		---	---	---	---
STARD8	9754	broad.mit.edu	37	X	67943490	67943490	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:67943490G>A	uc004dxa.2	+	12	2954	c.2582G>A	c.(2581-2583)CGG>CAG	p.R861Q	STARD8_uc004dxb.2_Missense_Mutation_p.R941Q|STARD8_uc004dxc.3_Missense_Mutation_p.R861Q	NM_014725	NP_055540	Q92502	STAR8_HUMAN	StAR-related lipid transfer (START) domain	861	START.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|focal adhesion	GTPase activator activity			breast(3)|ovary(2)|pancreas(1)	6																		---	---	---	---
KIF4A	24137	broad.mit.edu	37	X	69637775	69637775	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:69637775G>T	uc004dyg.2	+	29	3420	c.3293G>T	c.(3292-3294)GGG>GTG	p.G1098V	KIF4A_uc010nkw.2_Missense_Mutation_p.G1098V	NM_012310	NP_036442	O95239	KIF4A_HUMAN	kinesin family member 4	1098	Globular.|Interaction with PRC1.				anterograde axon cargo transport|axon guidance|blood coagulation|organelle organization	chromosome|cytosol|midbody|nuclear matrix|spindle microtubule	ATP binding|DNA binding|microtubule motor activity|protein binding			ovary(4)	4																		---	---	---	---
FLJ44635	392490	broad.mit.edu	37	X	71380091	71380091	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:71380091C>A	uc004eal.1	+	2	760	c.412C>A	c.(412-414)CAG>AAG	p.Q138K		NM_207422	NP_997305	Q56UQ5	TPT1L_HUMAN	hypothetical protein LOC392490	138										lung(1)	1	Renal(35;0.156)																	---	---	---	---
ERCC6L	54821	broad.mit.edu	37	X	71427358	71427358	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:71427358C>A	uc004eaq.1	-	2	1356	c.1259G>T	c.(1258-1260)CGG>CTG	p.R420L	PIN4_uc004eao.1_Intron|ERCC6L_uc004eap.1_Missense_Mutation_p.R297L	NM_017669	NP_060139	Q2NKX8	ERC6L_HUMAN	excision repair protein ERCC6-like	420					cell division|mitotic prometaphase	condensed chromosome kinetochore|cytosol	ATP binding|DNA binding|helicase activity|protein binding			ovary(3)	3	Renal(35;0.156)																	---	---	---	---
POF1B	79983	broad.mit.edu	37	X	84634245	84634245	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:84634245C>A	uc004eer.2	-	2	361	c.215G>T	c.(214-216)CGG>CTG	p.R72L	POF1B_uc004ees.2_Missense_Mutation_p.R72L	NM_024921	NP_079197	Q8WVV4	POF1B_HUMAN	premature ovarian failure, 1B	72							actin binding				0																		---	---	---	---
CENPI	2491	broad.mit.edu	37	X	100383802	100383802	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:100383802G>T	uc004egx.2	+	11	1442	c.1172G>T	c.(1171-1173)TGG>TTG	p.W391L	CENPI_uc011mrg.1_Missense_Mutation_p.W391L|CENPI_uc004egy.2_Missense_Mutation_p.W391L	NM_006733	NP_006724	Q92674	CENPI_HUMAN	centromere protein I	391					CenH3-containing nucleosome assembly at centromere|mitotic prometaphase	cytosol|kinetochore|nucleoplasm	protein binding			skin(1)	1																		---	---	---	---
RGAG1	57529	broad.mit.edu	37	X	109695526	109695526	+	Silent	SNP	T	C	C			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:109695526T>C	uc004eor.1	+	3	1927	c.1681T>C	c.(1681-1683)TTG>CTG	p.L561L	RGAG1_uc011msr.1_Silent_p.L561L	NM_020769	NP_065820	Q8NET4	RGAG1_HUMAN	retrotransposon gag domain containing 1	561										lung(2)|upper_aerodigestive_tract(1)|ovary(1)	4																		---	---	---	---
THOC2	57187	broad.mit.edu	37	X	122744807	122744807	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:122744807A>G	uc004etu.2	-	38	4794	c.4762T>C	c.(4762-4764)TCC>CCC	p.S1588P	THOC2_uc004etv.3_RNA	NM_001081550	NP_001075019	Q8NI27	THOC2_HUMAN	THO complex 2	1588	Lys-rich.				intronless viral mRNA export from host nucleus|mRNA processing|RNA splicing	THO complex part of transcription export complex	protein binding|RNA binding			ovary(3)	3																		---	---	---	---
RAB33A	9363	broad.mit.edu	37	X	129318434	129318434	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:129318434C>A	uc004evl.2	+	2	698	c.434C>A	c.(433-435)CCC>CAC	p.P145H	RAB33A_uc010nre.2_RNA	NM_004794	NP_004785	Q14088	RB33A_HUMAN	Ras-related protein Rab-33A	145					protein transport|small GTPase mediated signal transduction	plasma membrane	GTP binding|GTPase activity|protein binding				0																		---	---	---	---
PHF6	84295	broad.mit.edu	37	X	133527606	133527606	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:133527606C>A	uc004exj.2	+	4	518	c.316C>A	c.(316-318)CAC>AAC	p.H106N	PHF6_uc004exk.2_Missense_Mutation_p.H106N|PHF6_uc011mvk.1_Missense_Mutation_p.H72N|PHF6_uc004exh.2_Missense_Mutation_p.H106N|PHF6_uc010nrr.2_Missense_Mutation_p.H106N|PHF6_uc004exi.2_Missense_Mutation_p.H106N	NM_001015877	NP_001015877	Q8IWS0	PHF6_HUMAN	PHD finger protein 6 isoform 1	106	PHD-type 1; degenerate.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleolus	zinc ion binding			ovary(1)	1	Acute lymphoblastic leukemia(192;0.000127)																	---	---	---	---
ARHGEF6	9459	broad.mit.edu	37	X	135772764	135772764	+	Intron	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:135772764C>A	uc004fab.2	-						ARHGEF6_uc011mwd.1_Intron|ARHGEF6_uc011mwe.1_Intron	NM_004840	NP_004831			Rac/Cdc42 guanine nucleotide exchange factor 6						apoptosis|cell junction assembly|induction of apoptosis by extracellular signals|JNK cascade|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|Rho guanyl-nucleotide exchange factor activity				0	Acute lymphoblastic leukemia(192;0.000127)																	---	---	---	---
MTM1	4534	broad.mit.edu	37	X	149814302	149814302	+	Silent	SNP	C	A	A			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:149814302C>A	uc004fef.3	+	9	901	c.825C>A	c.(823-825)ACC>ACA	p.T275T	MTM1_uc011mxx.1_RNA|MTM1_uc011mxy.1_Silent_p.T238T|MTM1_uc011mxz.1_Silent_p.T160T|MTM1_uc010nte.2_Silent_p.T143T	NM_000252	NP_000243	Q13496	MTM1_HUMAN	myotubularin	275	Myotubularin phosphatase.				endosome to lysosome transport|intermediate filament organization|mitochondrion distribution|mitochondrion morphogenesis|phosphatidylinositol dephosphorylation|protein transport|regulation of vacuole organization	filopodium|late endosome|plasma membrane|ruffle	intermediate filament binding|phosphatidylinositol binding|phosphatidylinositol-3,5-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein tyrosine phosphatase activity			upper_aerodigestive_tract(1)|ovary(1)|kidney(1)	3	Acute lymphoblastic leukemia(192;6.56e-05)																	---	---	---	---
GABRQ	55879	broad.mit.edu	37	X	151808925	151808925	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-6456-01A-11D-1800-08	TCGA-BR-6456-11A-01D-1800-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:151808925G>T	uc004ffp.1	+	2	256	c.236G>T	c.(235-237)GGA>GTA	p.G79V		NM_018558	NP_061028	Q9UN88	GBRT_HUMAN	gamma-aminobutyric acid (GABA) receptor, theta	79	Extracellular (Potential).					cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity|neurotransmitter transporter activity			ovary(2)|pancreas(1)	3	Acute lymphoblastic leukemia(192;6.56e-05)																	---	---	---	---
