Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	validation_status	validation_method	validation_tumor_sample	validation_alt_allele
ARHGEF16	27237	broad.mit.edu	37	1	3396111	3396112	+	Frame_Shift_Del	DEL	CA	-	-			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:3396111_3396112delCA	uc001akg.3	+	13	2093_2094	c.1845_1846delCA	c.(1843-1848)CTCACAfs	p.L615fs	ARHGEF16_uc001aki.2_Frame_Shift_Del_p.L327fs|ARHGEF16_uc001akj.2_Frame_Shift_Del_p.L327fs|ARHGEF16_uc010nzh.1_Frame_Shift_Del_p.L319fs	NM_014448	NP_055263	Q5VV41	ARHGG_HUMAN	Rho guanine exchange factor 16	615_616	PH.				activation of Cdc42 GTPase activity|activation of Rac GTPase activity|apoptosis|cell chemotaxis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|positive regulation of establishment of protein localization in plasma membrane|small GTPase mediated signal transduction	cytosol	PDZ domain binding|receptor tyrosine kinase binding|Rho GTPase binding|Rho guanyl-nucleotide exchange factor activity			ovary(1)	1	all_cancers(77;0.00276)|all_epithelial(69;0.00102)|Ovarian(185;0.0634)|Lung NSC(156;0.0969)|all_lung(157;0.101)	all_epithelial(116;7.14e-21)|all_lung(118;2.24e-08)|Lung NSC(185;3.55e-06)|Breast(487;0.000765)|Renal(390;0.00121)|Hepatocellular(190;0.0046)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|Lung SC(97;0.0847)|Medulloblastoma(700;0.211)		Epithelial(90;8.62e-38)|OV - Ovarian serous cystadenocarcinoma(86;3.62e-22)|GBM - Glioblastoma multiforme(42;2.49e-12)|Colorectal(212;4.25e-05)|COAD - Colon adenocarcinoma(227;0.000196)|Kidney(185;0.000342)|BRCA - Breast invasive adenocarcinoma(365;0.000681)|KIRC - Kidney renal clear cell carcinoma(229;0.00549)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.201)														---	---	---	---
EPHA10	284656	broad.mit.edu	37	1	38226761	38226762	+	Intron	DEL	TA	-	-	rs111733664		TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:38226761_38226762delTA	uc009vvi.2	-						EPHA10_uc001cbw.3_3'UTR	NM_001099439	NP_001092909			EPH receptor A10 isofom 3							extracellular region|integral to membrane|integral to plasma membrane	ATP binding|ephrin receptor activity|protein binding|transmembrane-ephrin receptor activity			breast(4)|stomach(3)|lung(1)	8	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)																---	---	---	---
MACF1	23499	broad.mit.edu	37	1	39545374	39545377	+	5'Flank	DEL	TTCC	-	-	rs112113087		TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39545374_39545377delTTCC	uc010ois.1	+						MACF1_uc010oir.1_5'Flank	NM_012090	NP_036222			microfilament and actin filament cross-linker						cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding			ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)															---	---	---	---
Unknown	0	broad.mit.edu	37	1	72969469	72969470	+	IGR	INS	-	CCTC	CCTC	rs138378426	by1000genomes	TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:72969469_72969470insCCTC								NEGR1 (221064 upstream) : None (None downstream)																																			---	---	---	---
NBPF9	400818	broad.mit.edu	37	1	144823576	144823577	+	Intron	DEL	TG	-	-	rs67065013		TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144823576_144823577delTG	uc009wig.1	+						NBPF9_uc010oxn.1_Intron|NBPF9_uc010oxo.1_Intron|NBPF9_uc010oxr.1_Intron|NBPF9_uc010oxt.1_Intron|NBPF9_uc001ekg.1_Intron|NBPF9_uc001ekk.1_Intron|NBPF10_uc009wir.2_Intron|NBPF9_uc010oyd.1_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc001eli.3_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|NBPF9_uc001elp.2_Intron	NM_001037675	NP_001032764			hypothetical protein LOC400818							cytoplasm					0																		---	---	---	---
GATAD2B	57459	broad.mit.edu	37	1	153790790	153790790	+	Intron	DEL	C	-	-			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153790790delC	uc001fdb.3	-							NM_020699	NP_065750			GATA zinc finger domain containing 2B							nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0	all_lung(78;1.34e-32)|Lung NSC(65;1.04e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)															---	---	---	---
Unknown	0	broad.mit.edu	37	2	90447339	90447342	+	Intron	DEL	TCTA	-	-			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:90447339_90447342delTCTA	uc010fhm.2	+											Parts of antibodies, mostly variable regions.																														---	---	---	---
Unknown	0	broad.mit.edu	37	2	91764886	91764893	+	IGR	DEL	TATGTGTG	-	-	rs4005074		TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91764886_91764893delTATGTGTG								None (None upstream) : LOC654342 (40299 downstream)																																			---	---	---	---
LYG2	254773	broad.mit.edu	37	2	99870873	99870893	+	Intron	DEL	AGATAGTATTCTCACAGGCTC	-	-	rs80345491		TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:99870873_99870893delAGATAGTATTCTCACAGGCTC	uc002szw.1	-						MRPL30_uc002szl.1_Intron|LYG2_uc010fip.1_5'Flank|LYG2_uc002szx.1_Intron	NM_175735	NP_783862			lysozyme G-like 2 precursor						cell wall macromolecule catabolic process|peptidoglycan catabolic process	extracellular region	lysozyme activity			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	122067665	122067666	+	IGR	DEL	GT	-	-			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:122067665_122067666delGT								TFCP2L1 (24887 upstream) : CLASP1 (27688 downstream)																																			---	---	---	---
PER2	8864	broad.mit.edu	37	2	239186719	239186720	+	Intron	INS	-	TCTCTCTG	TCTCTCTG	rs149341285	by1000genomes	TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:239186719_239186720insTCTCTCTG	uc002vyc.2	-						PER2_uc010znv.1_Intron|PER2_uc010znw.1_Intron|PER2_uc010fyx.1_5'Flank	NM_022817	NP_073728			period 2						circadian rhythm|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	protein binding|signal transducer activity			upper_aerodigestive_tract(1)|breast(1)	2		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0423)|all_lung(227;0.114)|all_hematologic(139;0.158)|Melanoma(123;0.203)|Lung NSC(271;0.223)|Hepatocellular(293;0.244)		Epithelial(121;6.84e-24)|OV - Ovarian serous cystadenocarcinoma(60;9.73e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.5e-08)|BRCA - Breast invasive adenocarcinoma(100;6.77e-05)|Lung(119;0.00941)|LUSC - Lung squamous cell carcinoma(224;0.0161)														---	---	---	---
P4HTM	54681	broad.mit.edu	37	3	49028467	49028468	+	Intron	INS	-	A	A			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49028467_49028468insA	uc003cvg.2	+						P4HTM_uc003cvh.2_Intron	NM_177939	NP_808808			hypoxia-inducible factor prolyl 4-hydroxylase							endoplasmic reticulum membrane|integral to membrane	calcium ion binding|iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			skin(1)|pancreas(1)	2					Vitamin C(DB00126)													---	---	---	---
CACNA2D3	55799	broad.mit.edu	37	3	54905806	54905807	+	Intron	INS	-	TTT	TTT	rs146585375	by1000genomes	TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:54905806_54905807insTTT	uc003dhf.2	+						CACNA2D3_uc011beu.1_Intron|CACNA2D3_uc003dhg.1_Intron|CACNA2D3_uc003dhh.1_Intron|CACNA2D3_uc010hmv.1_Intron	NM_018398	NP_060868			calcium channel, voltage-dependent, alpha							integral to membrane	calcium channel activity|metal ion binding|voltage-gated ion channel activity			large_intestine(3)|ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	7				KIRC - Kidney renal clear cell carcinoma(284;0.00287)|Kidney(284;0.00327)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	58687311	58687314	+	IGR	DEL	GGAA	-	-			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:58687311_58687314delGGAA								FAM3D (34750 upstream) : C3orf67 (23973 downstream)																																			---	---	---	---
PSMD2	5708	broad.mit.edu	37	3	184019125	184019125	+	Intron	DEL	A	-	-	rs112455702		TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184019125delA	uc003fnn.1	+						PSMD2_uc011brj.1_Intron|PSMD2_uc011brk.1_Intron	NM_002808	NP_002799			proteasome 26S non-ATPase subunit 2						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|regulation of protein catabolic process|S phase of mitotic cell cycle|viral reproduction	proteasome regulatory particle	enzyme regulator activity|protein binding				0	all_cancers(143;1.54e-10)|Ovarian(172;0.0339)		Epithelial(37;1.53e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)		Bortezomib(DB00188)													---	---	---	---
NUP155	9631	broad.mit.edu	37	5	37348865	37348865	+	Intron	DEL	T	-	-			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:37348865delT	uc003jku.1	-						NUP155_uc003jkt.1_Intron|NUP155_uc010iuz.1_Intron	NM_153485	NP_705618			nucleoporin 155kDa isoform 1						carbohydrate metabolic process|glucose transport|mRNA transport|nucleocytoplasmic transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear membrane|nuclear pore	protein binding|structural constituent of nuclear pore|transporter activity			ovary(1)	1	all_lung(31;0.000137)		COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)															---	---	---	---
BDP1	55814	broad.mit.edu	37	5	70828418	70828421	+	Intron	DEL	TTTG	-	-	rs34000891		TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:70828418_70828421delTTTG	uc003kbp.1	+						BDP1_uc003kbo.2_Intron|BDP1_uc003kbq.1_Intron|BDP1_uc003kbr.1_Intron	NM_018429	NP_060899			transcription factor-like nuclear regulator						regulation of transcription, DNA-dependent|transcription from RNA polymerase III promoter	nucleoplasm	DNA binding			skin(2)	2		Lung NSC(167;0.000422)|Prostate(74;0.00815)|Ovarian(174;0.0176)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;5.28e-56)|Epithelial(20;2.31e-50)														---	---	---	---
DMXL1	1657	broad.mit.edu	37	5	118507261	118507261	+	Intron	DEL	T	-	-	rs140718009		TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:118507261delT	uc003ksd.2	+						DMXL1_uc010jcl.1_Intron	NM_005509	NP_005500			Dmx-like 1											ovary(2)	2		all_cancers(142;0.0314)|all_epithelial(76;0.00559)|Prostate(80;0.11)|Breast(839;0.231)		OV - Ovarian serous cystadenocarcinoma(64;0.000563)|Epithelial(69;0.00179)|all cancers(49;0.0243)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	170261107	170261109	+	IGR	DEL	CAT	-	-	rs62392812	by1000genomes	TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:170261107_170261109delCAT								GABRP (20059 upstream) : RANBP17 (27913 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	14157275	14157278	+	IGR	DEL	TCCT	-	-			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:14157275_14157278delTCCT								CD83 (20129 upstream) : None (None downstream)																																			---	---	---	---
C6orf10	10665	broad.mit.edu	37	6	32307006	32307007	+	Intron	INS	-	G	G	rs149173441	by1000genomes	TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32307006_32307007insG	uc011dpy.1	-							NM_006781	NP_006772			chromosome 6 open reading frame 10							integral to membrane				skin(1)	1																		---	---	---	---
GUCA1B	2979	broad.mit.edu	37	6	42156624	42156625	+	Intron	INS	-	TCTA	TCTA	rs138558902	by1000genomes	TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:42156624_42156625insTCTA	uc003orz.2	-							NM_002098	NP_002089			guanylate cyclase activator 1B (retina)						body fluid secretion|cell-cell signaling|receptor guanylyl cyclase signaling pathway|visual perception	plasma membrane	calcium ion binding|calcium sensitive guanylate cyclase activator activity			skin(2)	2	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)|Epithelial(12;0.00154)|STAD - Stomach adenocarcinoma(11;0.00177)															---	---	---	---
GSTA4	2941	broad.mit.edu	37	6	52847699	52847702	+	Intron	DEL	GAGC	-	-	rs72138999	by1000genomes	TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:52847699_52847702delGAGC	uc003pbc.2	-						GSTA4_uc003pbd.2_Intron|GSTA4_uc003pbe.2_Intron|GSTA4_uc003pbf.2_Intron	NM_001512	NP_001503			glutathione S-transferase alpha 4						glutathione metabolic process|xenobiotic metabolic process	cytosol	glutathione transferase activity|protein homodimerization activity				0	Lung NSC(77;0.103)				Glutathione(DB00143)													---	---	---	---
Unknown	0	broad.mit.edu	37	6	79223581	79223582	+	IGR	INS	-	AC	AC	rs141041782	by1000genomes	TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:79223581_79223582insAC								None (None upstream) : IRAK1BP1 (353607 downstream)																																			---	---	---	---
SNX14	57231	broad.mit.edu	37	6	86251852	86251852	+	Intron	DEL	A	-	-			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:86251852delA	uc003pkr.2	-						SNX14_uc003pkp.2_Intron|SNX14_uc003pkq.2_Intron|SNX14_uc011dzg.1_Intron|SNX14_uc003pks.2_Intron|SNX14_uc003pkt.2_Intron	NM_153816	NP_722523			sorting nexin 14 isoform a						cell communication|protein transport	integral to membrane	phosphatidylinositol binding|signal transducer activity				0		all_cancers(76;4.83e-07)|Acute lymphoblastic leukemia(125;3.3e-08)|Prostate(29;2.55e-07)|all_hematologic(105;3.66e-05)|all_epithelial(107;0.000695)|Lung NSC(302;0.197)|all_lung(197;0.24)		BRCA - Breast invasive adenocarcinoma(108;0.0423)														---	---	---	---
SYNE1	23345	broad.mit.edu	37	6	152734821	152734822	+	Intron	INS	-	G	G	rs138384898	by1000genomes	TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152734821_152734822insG	uc010kiw.2	-						SYNE1_uc003qot.3_Intron|SYNE1_uc003qou.3_Intron|SYNE1_uc010kjb.1_Intron	NM_182961	NP_892006			spectrin repeat containing, nuclear envelope 1						cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)											HNSCC(10;0.0054)			---	---	---	---
CRCP	27297	broad.mit.edu	37	7	65599533	65599533	+	Intron	DEL	T	-	-	rs146459004		TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:65599533delT	uc003tus.2	+						CRCP_uc003tuv.2_Intron|CRCP_uc011kdw.1_Intron|CRCP_uc003tut.2_Intron|CRCP_uc003tuu.2_Intron	NM_014478	NP_055293			calcitonin gene-related peptide-receptor						acrosome reaction|innate immune response|response to virus|transcription from RNA polymerase III promoter	DNA polymerase III complex|nucleus|plasma membrane	calcitonin receptor activity|DNA-directed RNA polymerase activity|nucleotide binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	68155888	68155889	+	IGR	INS	-	GAAG	GAAG	rs67864820		TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:68155888_68155889insGAAG								None (None upstream) : AUTS2 (908016 downstream)																																			---	---	---	---
CPA5	93979	broad.mit.edu	37	7	129989560	129989592	+	Intron	DEL	CAAAAATTAAAAATTACAAAAAAACCTGTATCC	-	-	rs11272432	by1000genomes	TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:129989560_129989592delCAAAAATTAAAAATTACAAAAAAACCTGTATCC	uc010lmd.1	+						CPA5_uc003vps.2_Intron|CPA5_uc003vpt.2_Intron|CPA5_uc010lme.1_Intron|CPA5_uc003vpu.1_Intron	NM_001127441	NP_001120913			carboxypeptidase A5 isoform 1						proteolysis	extracellular region	metallocarboxypeptidase activity|zinc ion binding			ovary(2)	2	Melanoma(18;0.0435)																	---	---	---	---
CHCHD3	54927	broad.mit.edu	37	7	132719268	132719269	+	Intron	INS	-	TTT	TTT	rs56769155		TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:132719268_132719269insTTT	uc003vre.2	-						CHCHD3_uc010lmi.2_Intron|CHCHD3_uc003vrf.2_Intron|CHCHD3_uc010lmj.2_Intron|CHCHD3_uc011kpn.1_Intron	NM_017812	NP_060282			coiled-coil-helix-coiled-coil-helix domain						inner mitochondrial membrane organization|mitochondrial fusion	mitochondrial inner membrane	protein complex scaffold				0																		---	---	---	---
KIAA1147	57189	broad.mit.edu	37	7	141386265	141386265	+	Intron	DEL	C	-	-	rs35707772		TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:141386265delC	uc003vwk.2	-							NM_001080392	NP_001073861			hypothetical protein LOC57189											ovary(1)	1	Melanoma(164;0.0171)																	---	---	---	---
C8orf41	80185	broad.mit.edu	37	8	33373131	33373140	+	5'Flank	DEL	TCCTTCTTCC	-	-	rs35708537		TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:33373131_33373140delTCCTTCTTCC	uc003xjl.3	-						C8orf41_uc003xjk.3_5'Flank|C8orf41_uc010lvv.2_5'Flank|C8orf41_uc003xjm.3_5'Flank|C8orf41_uc003xjn.1_5'Flank	NM_025115	NP_079391			hypothetical protein LOC80185								binding				0				KIRC - Kidney renal clear cell carcinoma(67;0.0923)|Kidney(114;0.111)														---	---	---	---
DDHD2	23259	broad.mit.edu	37	8	38092288	38092288	+	Intron	DEL	T	-	-			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38092288delT	uc003xlb.2	+						DDHD2_uc003xla.2_Intron|DDHD2_uc003xlc.2_Intron|DDHD2_uc011lbl.1_Intron	NM_015214	NP_056029			DDHD domain containing 2 isoform 1						lipid catabolic process	centrosome	hydrolase activity|metal ion binding			large_intestine(1)|ovary(1)	2	Colorectal(12;0.000442)	all_lung(54;0.0657)|Lung NSC(58;0.175)	BRCA - Breast invasive adenocarcinoma(5;3.76e-25)|COAD - Colon adenocarcinoma(9;0.0977)															---	---	---	---
EFR3A	23167	broad.mit.edu	37	8	132966046	132966046	+	Intron	DEL	T	-	-	rs112472883		TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:132966046delT	uc003yte.2	+							NM_015137	NP_055952			EFR3 homolog A							plasma membrane	binding			ovary(3)|breast(1)|central_nervous_system(1)	5	Esophageal squamous(12;0.00693)|Ovarian(258;0.00769)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000805)|LUAD - Lung adenocarcinoma(14;0.102)															---	---	---	---
TRAPPC9	83696	broad.mit.edu	37	8	140797781	140797782	+	Intron	DEL	AC	-	-	rs34501334		TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:140797781_140797782delAC	uc003yvj.2	-						TRAPPC9_uc003yvh.2_Intron	NM_001160372	NP_001153844			trafficking protein particle complex 9 isoform						cell differentiation	endoplasmic reticulum|Golgi apparatus				skin(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	8	144138673	144138674	+	IGR	INS	-	T	T			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144138673_144138674insT								C8orf31 (2953 upstream) : LY6H (100658 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	16127231	16127231	+	IGR	DEL	A	-	-			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:16127231delA								C9orf93 (155336 upstream) : BNC2 (282271 downstream)																																			---	---	---	---
HAUS6	54801	broad.mit.edu	37	9	19082754	19082760	+	Intron	DEL	AAAAAAC	-	-			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:19082754_19082760delAAAAAAC	uc003znk.2	-						HAUS6_uc011lmz.1_Intron|HAUS6_uc003znl.1_Intron|HAUS6_uc003znm.1_Intron	NM_017645	NP_060115			HAUS augmin-like complex, subunit 6						cell division|centrosome organization|mitosis|spindle assembly	centrosome|HAUS complex|microtubule|nucleus|spindle				ovary(2)	2																		---	---	---	---
FRMPD1	22844	broad.mit.edu	37	9	37736856	37736857	+	Intron	DEL	GT	-	-			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:37736856_37736857delGT	uc004aag.1	+						FRMPD1_uc004aah.1_Intron|FRMPD1_uc011lqm.1_Intron|FRMPD1_uc011lqn.1_Intron	NM_014907	NP_055722			FERM and PDZ domain containing 1							cytoskeleton|cytosol|plasma membrane				ovary(4)|central_nervous_system(2)|skin(2)|breast(1)	9				GBM - Glioblastoma multiforme(29;0.00655)														---	---	---	---
C5	727	broad.mit.edu	37	9	123781021	123781028	+	Intron	DEL	AAGGAAGG	-	-	rs13296196	by1000genomes	TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:123781021_123781028delAAGGAAGG	uc004bkv.2	-						C5_uc010mvm.1_Intron|C5_uc010mvn.1_Intron	NM_001735	NP_001726			complement component 5 preproprotein						activation of MAPK activity|chemotaxis|complement activation, alternative pathway|complement activation, classical pathway|cytolysis|G-protein coupled receptor protein signaling pathway|inflammatory response|negative regulation of macrophage chemotaxis|positive regulation of chemokine secretion|positive regulation vascular endothelial growth factor production	extracellular space|membrane attack complex	chemokine activity|endopeptidase inhibitor activity			ovary(2)	2				OV - Ovarian serous cystadenocarcinoma(323;4.98e-53)|GBM - Glioblastoma multiforme(294;0.0242)	Eculizumab(DB01257)													---	---	---	---
C5	727	broad.mit.edu	37	9	123812237	123812237	+	Intron	DEL	A	-	-	rs35925262		TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:123812237delA	uc004bkv.2	-						C5_uc010mvm.1_Intron|C5_uc010mvn.1_Intron	NM_001735	NP_001726			complement component 5 preproprotein						activation of MAPK activity|chemotaxis|complement activation, alternative pathway|complement activation, classical pathway|cytolysis|G-protein coupled receptor protein signaling pathway|inflammatory response|negative regulation of macrophage chemotaxis|positive regulation of chemokine secretion|positive regulation vascular endothelial growth factor production	extracellular space|membrane attack complex	chemokine activity|endopeptidase inhibitor activity			ovary(2)	2				OV - Ovarian serous cystadenocarcinoma(323;4.98e-53)|GBM - Glioblastoma multiforme(294;0.0242)	Eculizumab(DB01257)													---	---	---	---
EHMT1	79813	broad.mit.edu	37	9	140610840	140610842	+	Intron	DEL	TGT	-	-	rs142045955	by1000genomes	TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140610840_140610842delTGT	uc011mfc.1	+						EHMT1_uc004coa.2_Intron|EHMT1_uc004cob.1_Intron	NM_024757	NP_079033			euchromatic histone-lysine N-methyltransferase 1						DNA methylation|embryo development|peptidyl-lysine dimethylation|peptidyl-lysine monomethylation	chromosome|nucleus	histone methyltransferase activity (H3-K27 specific)|histone methyltransferase activity (H3-K9 specific)|p53 binding|zinc ion binding			breast(2)|pancreas(1)	3	all_cancers(76;0.164)			OV - Ovarian serous cystadenocarcinoma(145;0.000183)|Epithelial(140;0.000728)														---	---	---	---
C10orf96	374355	broad.mit.edu	37	10	118115947	118115947	+	Intron	DEL	G	-	-			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:118115947delG	uc001lck.2	+							NM_198515	NP_940917			hypothetical protein LOC374355											ovary(2)	2		Lung NSC(174;0.204)|all_lung(145;0.248)		all cancers(201;0.014)														---	---	---	---
E2F8	79733	broad.mit.edu	37	11	19255692	19255693	+	Intron	INS	-	A	A	rs76020624		TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:19255692_19255693insA	uc001mpm.2	-						E2F8_uc009yhv.2_Intron|E2F8_uc001mpn.3_Intron	NM_024680	NP_078956			E2F family member 8						cell cycle	transcription factor complex	DNA binding|sequence-specific DNA binding transcription factor activity			skin(1)	1																		---	---	---	---
CWF19L2	143884	broad.mit.edu	37	11	107299327	107299328	+	Intron	INS	-	A	A	rs11377816		TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:107299327_107299328insA	uc010rvp.1	-						CWF19L2_uc001pjh.3_Intron|CWF19L2_uc009yxo.2_Intron	NM_152434	NP_689647			CWF19-like 2, cell cycle control								catalytic activity				0		Melanoma(852;1.75e-05)|all_epithelial(67;6.27e-05)|Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Breast(348;0.0258)		Epithelial(105;7.18e-06)|BRCA - Breast invasive adenocarcinoma(274;1.65e-05)|all cancers(92;1.76e-05)														---	---	---	---
GPRC5D	55507	broad.mit.edu	37	12	13099300	13099300	+	Intron	DEL	T	-	-	rs55785207		TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:13099300delT	uc010shp.1	-							NM_018654	NP_061124			G protein-coupled receptor, family C, group 5,							integral to membrane|plasma membrane	G-protein coupled receptor activity				0		Prostate(47;0.183)		BRCA - Breast invasive adenocarcinoma(232;0.15)														---	---	---	---
BIN2	51411	broad.mit.edu	37	12	51720929	51720930	+	5'Flank	INS	-	T	T			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51720929_51720930insT	uc001ryg.2	-						BIN2_uc009zlz.2_5'Flank|BIN2_uc001ryh.2_5'Flank|BIN2_uc010sng.1_5'Flank	NM_016293	NP_057377			bridging integrator 2							cytoplasm	protein binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	51912780	51912781	+	IGR	INS	-	GT	GT	rs140988895	by1000genomes	TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51912780_51912781insGT								SLC4A8 (3233 upstream) : SCN8A (72239 downstream)																																			---	---	---	---
PCBP2	5094	broad.mit.edu	37	12	53836697	53836698	+	Intron	DEL	TC	-	-	rs35565249		TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53836697_53836698delTC	uc010soh.1	+						PRR13_uc001scy.3_Intron|PRR13_uc001scz.3_Intron|PRR13_uc001sda.3_Intron	NM_001128912	NP_001122384			poly(rC) binding protein 2 isoform e						innate immune response|negative regulation of defense response to virus|negative regulation of type I interferon production|nuclear mRNA splicing, via spliceosome|proteasomal ubiquitin-dependent protein catabolic process|response to virus	cytosol|nucleoplasm|ribonucleoprotein complex	DNA binding|RNA binding|ubiquitin protein ligase binding				0																		---	---	---	---
TBC1D15	64786	broad.mit.edu	37	12	72242944	72242944	+	Intron	DEL	A	-	-			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:72242944delA	uc001swu.2	+						TBC1D15_uc009zrv.2_Intron|TBC1D15_uc010stt.1_Intron|TBC1D15_uc001swv.2_Intron|TBC1D15_uc001sww.2_Intron|MRS2P2_uc010stu.1_RNA	NM_022771	NP_073608			TBC1 domain family, member 15 isoform 1								protein binding|Rab GTPase activator activity				0																		---	---	---	---
RNF17	56163	broad.mit.edu	37	13	25448552	25448553	+	Intron	INS	-	T	T	rs142376691		TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:25448552_25448553insT	uc001upr.2	+						RNF17_uc010aab.2_Intron|RNF17_uc010tde.1_Intron|RNF17_uc001ups.2_Intron|RNF17_uc010aac.2_Intron|RNF17_uc010aad.2_Intron	NM_031277	NP_112567			ring finger protein 17						multicellular organismal development	cytoplasm|nucleus	hydrolase activity, acting on ester bonds|nucleic acid binding|zinc ion binding			ovary(1)|skin(1)	2		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0114)|OV - Ovarian serous cystadenocarcinoma(117;0.0311)|Epithelial(112;0.0524)														---	---	---	---
TPTE2P1	646405	broad.mit.edu	37	13	25527490	25527491	+	Intron	INS	-	AAAAAG	AAAAAG			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:25527490_25527491insAAAAAG	uc010tdh.1	-						TPTE2P1_uc001upx.3_Intron	NR_026730				RecName: Full=C2 tensin-type domain-containing protein ENSP00000371290;												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	13	25705160	25705164	+	IGR	DEL	AAGGA	-	-			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:25705160_25705164delAAGGA								PABPC3 (32458 upstream) : FAM123A (37509 downstream)																																			---	---	---	---
COG3	83548	broad.mit.edu	37	13	46060474	46060475	+	Intron	INS	-	GGAGA	GGAGA	rs113621277		TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:46060474_46060475insGGAGA	uc001vak.2	+						COG3_uc010tfu.1_Intron|COG3_uc001vai.2_Intron|COG3_uc001vaj.1_Intron|COG3_uc010tfv.1_Intron|COG3_uc010aci.2_Intron	NM_031431	NP_113619			component of golgi transport complex 3						ER to Golgi vesicle-mediated transport|intra-Golgi vesicle-mediated transport|intracellular protein transport|protein glycosylation|protein localization to organelle|protein stabilization|retrograde vesicle-mediated transport, Golgi to ER	cis-Golgi network|Golgi cisterna membrane|Golgi transport complex	protein binding|protein transporter activity			breast(1)|skin(1)	2		Lung NSC(96;0.000145)|Breast(56;0.000596)|Prostate(109;0.00438)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000124)														---	---	---	---
NOVA1	4857	broad.mit.edu	37	14	27066708	27066713	+	5'UTR	DEL	TTTTTC	-	-			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:27066708_27066713delTTTTTC	uc001wpy.2	-	1					NOVA1_uc001wpz.2_5'UTR|NOVA1_uc001wqa.2_5'UTR|NOVA1_uc001wqb.2_5'UTR	NM_002515	NP_002506			neuro-oncological ventral antigen 1 isoform 1						locomotory behavior|RNA splicing|synaptic transmission	nucleus	RNA binding			skin(2)|upper_aerodigestive_tract(1)|breast(1)|liver(1)	5				GBM - Glioblastoma multiforme(265;0.0135)														---	---	---	---
SOS2	6655	broad.mit.edu	37	14	50628013	50628014	+	Intron	INS	-	A	A	rs113097888		TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:50628013_50628014insA	uc001wxs.3	-						SOS2_uc010tql.1_Intron|SOS2_uc010tqm.1_Intron|SOS2_uc001wxt.2_Intron	NM_006939	NP_008870			son of sevenless homolog 2						apoptosis|axon guidance|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	DNA binding|protein binding|Rho guanyl-nucleotide exchange factor activity			ovary(2)	2	all_epithelial(31;0.000822)|Breast(41;0.0065)																	---	---	---	---
RPS6KL1	83694	broad.mit.edu	37	14	75378297	75378302	+	Intron	DEL	TGTGTA	-	-	rs34121418		TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:75378297_75378302delTGTGTA	uc010tux.1	-						RPS6KL1_uc001xqx.1_5'Flank|RPS6KL1_uc001xqw.2_Intron|RPS6KL1_uc010asd.1_Intron|RPS6KL1_uc001xqy.1_Intron	NM_031464	NP_113652			ribosomal protein S6 kinase-like 1							ribosome	ATP binding|protein serine/threonine kinase activity			ovary(1)|stomach(1)|central_nervous_system(1)	3				BRCA - Breast invasive adenocarcinoma(234;0.00658)														---	---	---	---
FOXN3	1112	broad.mit.edu	37	14	89647259	89647260	+	Intron	INS	-	GCAGAGAACATGCATGGA	GCAGAGAACATGCATGGA	rs140257053	by1000genomes	TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:89647259_89647260insGCAGAGAACATGCATGGA	uc001xxo.3	-						FOXN3_uc001xxn.3_Intron|FOXN3_uc010atk.2_Intron	NM_001085471	NP_001078940			checkpoint suppressor 1 isoform 1						DNA damage checkpoint|embryo development|G2 phase of mitotic cell cycle|negative regulation of transcription, DNA-dependent|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|protein C-terminus binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			skin(2)|ovary(1)	3																		---	---	---	---
RCOR1	23186	broad.mit.edu	37	14	103192668	103192668	+	Intron	DEL	A	-	-			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:103192668delA	uc001ymb.2	+							NM_015156	NP_055971			REST corepressor 1						blood coagulation|histone H4 deacetylation|interspecies interaction between organisms	transcriptional repressor complex	protein binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription|transcription regulatory region DNA binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	32635922	32635922	+	5'Flank	DEL	T	-	-			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:32635922delT	uc001zfv.1	-						uc001zfw.1_5'Flank					Homo sapiens cDNA FLJ43588 fis, clone SKNSH2009991.																														---	---	---	---
C16orf11	146325	broad.mit.edu	37	16	614731	614731	+	Frame_Shift_Del	DEL	T	-	-			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:614731delT	uc002chk.2	+	3	1419	c.1140delT	c.(1138-1140)CCTfs	p.P380fs	NHLRC4_uc002chl.2_5'Flank|PIGQ_uc010bqw.2_5'Flank	NM_145270	NP_660313	P0CG20	CP011_HUMAN	hypothetical protein LOC146325	380	Pro-rich.									central_nervous_system(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	33942128	33942129	+	IGR	INS	-	T	T	rs76660512	by1000genomes	TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33942128_33942129insT								None (None upstream) : MIR1826 (23379 downstream)																																			---	---	---	---
SRCIN1	80725	broad.mit.edu	37	17	36696976	36696977	+	Intron	DEL	GT	-	-	rs67872749		TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:36696976_36696977delGT	uc002hqd.2	-							NM_025248	NP_079524			SNAP25-interacting protein						exocytosis|negative regulation of protein tyrosine kinase activity|positive regulation of protein tyrosine kinase activity|regulation of cell migration|regulation of dendritic spine morphogenesis|substrate adhesion-dependent cell spreading	actin cytoskeleton|axon|cell junction|cytoplasm|dendrite|postsynaptic density|postsynaptic membrane	protein kinase binding				0																		---	---	---	---
CDC6	990	broad.mit.edu	37	17	38450980	38450980	+	Intron	DEL	T	-	-			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38450980delT	uc002huj.1	+							NM_001254	NP_001245			cell division cycle 6 protein						cell division|DNA replication|DNA replication checkpoint|M/G1 transition of mitotic cell cycle|mitosis|negative regulation of cell proliferation|negative regulation of DNA replication|positive regulation of cell cycle cytokinesis|positive regulation of chromosome segregation|regulation of cyclin-dependent protein kinase activity|regulation of mitotic anaphase|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle|traversing start control point of mitotic cell cycle	cytosol|nucleoplasm|spindle midzone|spindle pole	ATP binding|kinase binding|nucleoside-triphosphatase activity			ovary(2)|breast(1)	3																		---	---	---	---
NXPH3	11248	broad.mit.edu	37	17	47655768	47655768	+	Intron	DEL	T	-	-	rs67095119		TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47655768delT	uc002ipa.2	+						NXPH3_uc010wlw.1_Intron	NM_007225	NP_009156			neurexophilin 3 precursor						neuropeptide signaling pathway	extracellular region				pancreas(1)|skin(1)	2	all_cancers(4;7.45e-14)|Breast(4;1.08e-27)|all_epithelial(4;2.27e-17)																	---	---	---	---
Unknown	0	broad.mit.edu	37	17	51991222	51991222	+	IGR	DEL	T	-	-			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:51991222delT								KIF2B (88649 upstream) : TOM1L1 (986830 downstream)																																			---	---	---	---
ICT1	3396	broad.mit.edu	37	17	73013403	73013403	+	Intron	DEL	A	-	-	rs113430634		TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73013403delA	uc002jmm.2	+							NM_001545	NP_001536			immature colon carcinoma transcript 1 precursor						mitochondrial translational termination	mitochondrial large ribosomal subunit	aminoacyl-tRNA hydrolase activity|translation release factor activity, codon nonspecific			ovary(1)|central_nervous_system(1)	2	all_lung(278;0.226)																	---	---	---	---
CELF5	60680	broad.mit.edu	37	19	3290560	3290561	+	Intron	DEL	TC	-	-			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3290560_3290561delTC	uc002lxm.2	+						CELF5_uc002lxl.1_Intron|CELF5_uc010dtj.1_Intron|CELF5_uc010xhg.1_Intron|CELF5_uc002lxn.2_Intron	NM_021938	NP_068757			bruno-like 5, RNA binding protein						mRNA processing	cytoplasm|nucleus	nucleotide binding|RNA binding			ovary(2)	2																		---	---	---	---
INSR	3643	broad.mit.edu	37	19	7149948	7149975	+	Intron	DEL	GAAGGAAGGAAGGAAGGAAGGAAGGAAG	-	-	rs8105223	by1000genomes;by1000genomes;by1000genomes;by1000genomes;by1000genomes	TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7149948_7149975delGAAGGAAGGAAGGAAGGAAGGAAGGAAG	uc002mgd.1	-						INSR_uc002mge.1_Intron	NM_000208	NP_000199			insulin receptor isoform Long precursor						activation of MAPK activity|activation of protein kinase B activity|carbohydrate metabolic process|fibroblast growth factor receptor signaling pathway|G-protein coupled receptor protein signaling pathway|glucose homeostasis|heart morphogenesis|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of cell proliferation|positive regulation of developmental growth|positive regulation of DNA replication|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of glycolysis|positive regulation of MAPKKK cascade|positive regulation of mitosis|positive regulation of nitric oxide biosynthetic process|positive regulation of protein kinase B signaling cascade|positive regulation of protein phosphorylation|positive regulation of respiratory burst|protein autophosphorylation|protein heterotetramerization|regulation of embryonic development|regulation of transcription, DNA-dependent|transformation of host cell by virus	caveola|endosome membrane|insulin receptor complex|microsome	ATP binding|GTP binding|insulin binding|insulin receptor activity|insulin receptor substrate binding|insulin-like growth factor I binding|insulin-like growth factor II binding|insulin-like growth factor receptor binding|metal ion binding|phosphatidylinositol 3-kinase binding|PTB domain binding|receptor signaling protein tyrosine kinase activity|SH2 domain binding			ovary(4)|lung(3)|central_nervous_system(2)|large_intestine(1)|stomach(1)|skin(1)	12					Insulin Glargine recombinant(DB00047)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)													---	---	---	---
CEACAM16	388551	broad.mit.edu	37	19	45207037	45207037	+	Intron	DEL	A	-	-	rs71364503		TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45207037delA	uc010xxd.1	+						CEACAM16_uc002ozq.2_Intron	NM_001039213	NP_001034302			carcinoembryonic antigen-related cell adhesion											ovary(1)	1	Lung NSC(12;0.000698)|all_lung(12;0.002)	Prostate(69;0.0376)|Ovarian(192;0.231)																---	---	---	---
MACROD2	140733	broad.mit.edu	37	20	15470813	15470816	+	Intron	DEL	TCCT	-	-			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:15470813_15470816delTCCT	uc002wou.2	+						MACROD2_uc002wot.2_Intron|MACROD2_uc002woz.2_Intron	NM_080676	NP_542407			MACRO domain containing 2 isoform 1												0		all_neural(2;0.0381)|Acute lymphoblastic leukemia(2;0.175)																---	---	---	---
BAGE2	85319	broad.mit.edu	37	21	11042402	11042406	+	Intron	DEL	AAAAC	-	-	rs112117444		TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11042402_11042406delAAAAC	uc002yit.1	-						TPTE_uc002yis.1_5'Flank	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)														---	---	---	---
C21orf81	391267	broad.mit.edu	37	21	15347257	15347258	+	Intron	INS	-	A	A	rs80199214		TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:15347257_15347258insA	uc002yji.2	-							NR_027270				Homo sapiens C21orf81 protein (C21orf81) mRNA, complete cds.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	X	3442659	3442667	+	IGR	DEL	CACCACCAC	-	-			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:3442659_3442667delCACCACCAC								MXRA5 (177975 upstream) : PRKX (79746 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	42384500	42384501	+	IGR	INS	-	A	A			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:42384500_42384501insA								CASK (602213 upstream) : PPP1R2P9 (252118 downstream)																																			---	---	---	---
PTCHD2	57540	broad.mit.edu	37	1	11579853	11579853	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11579853C>T	uc001ash.3	+	9	2254	c.2116C>T	c.(2116-2118)CGC>TGC	p.R706C	PTCHD2_uc001asi.1_Missense_Mutation_p.R706C	NM_020780	NP_065831	Q9P2K9	PTHD2_HUMAN	patched domain containing 2	706	Cytoplasmic (Potential).				cholesterol homeostasis|regulation of lipid transport|smoothened signaling pathway	endoplasmic reticulum|integral to membrane|nuclear membrane	hedgehog receptor activity			skin(3)|ovary(2)|pancreas(1)|breast(1)	7	Ovarian(185;0.249)	Lung NSC(185;4.16e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.13e-07)|COAD - Colon adenocarcinoma(227;4.83e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000325)|Kidney(185;0.000877)|KIRC - Kidney renal clear cell carcinoma(229;0.00273)|STAD - Stomach adenocarcinoma(313;0.00766)|READ - Rectum adenocarcinoma(331;0.0549)														---	---	---	---
USP48	84196	broad.mit.edu	37	1	22079022	22079022	+	Silent	SNP	A	C	C			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22079022A>C	uc001bfb.2	-	5	901	c.663T>G	c.(661-663)ACT>ACG	p.T221T	USP48_uc010odq.1_Silent_p.T221T|USP48_uc009vqc.2_Silent_p.T221T|USP48_uc001bfc.2_Silent_p.T221T|USP48_uc001bfe.1_Silent_p.T221T|USP48_uc001bff.2_Silent_p.T221T	NM_032236	NP_115612	Q86UV5	UBP48_HUMAN	ubiquitin specific protease 48 isoform a	221					ubiquitin-dependent protein catabolic process	mitochondrion|nucleus	cysteine-type peptidase activity|ubiquitin thiolesterase activity			ovary(1)|lung(1)	2		Colorectal(325;3.46e-05)|all_lung(284;4.29e-05)|Lung NSC(340;4.66e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|OV - Ovarian serous cystadenocarcinoma(117;4.74e-26)|COAD - Colon adenocarcinoma(152;1.3e-05)|GBM - Glioblastoma multiforme(114;1.86e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000614)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(1967;0.00711)|Lung(427;0.0327)|READ - Rectum adenocarcinoma(331;0.0657)|LUSC - Lung squamous cell carcinoma(448;0.0753)														---	---	---	---
ELTD1	64123	broad.mit.edu	37	1	79404873	79404873	+	Missense_Mutation	SNP	T	A	A			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:79404873T>A	uc001diq.3	-	4	552	c.396A>T	c.(394-396)AAA>AAT	p.K132N		NM_022159	NP_071442	Q9HBW9	ELTD1_HUMAN	EGF, latrophilin and seven transmembrane domain	132	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(1)|skin(1)	2				COAD - Colon adenocarcinoma(225;0.0905)|Colorectal(170;0.103)|all cancers(265;0.105)|Epithelial(280;0.148)														---	---	---	---
COL24A1	255631	broad.mit.edu	37	1	86591429	86591429	+	Missense_Mutation	SNP	A	G	G			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:86591429A>G	uc001dlj.2	-	3	632	c.590T>C	c.(589-591)TTT>TCT	p.F197S	COL24A1_uc010osd.1_5'UTR|COL24A1_uc001dlk.2_RNA|COL24A1_uc010ose.1_RNA|COL24A1_uc010osf.1_RNA|COL24A1_uc009wcq.2_Missense_Mutation_p.F197S	NM_152890	NP_690850	Q17RW2	COOA1_HUMAN	collagen, type XXIV, alpha 1 precursor	197	TSP N-terminal.|Laminin G-like.				cell adhesion	collagen	extracellular matrix structural constituent			ovary(3)|central_nervous_system(1)|skin(1)	5				all cancers(265;0.0627)|Epithelial(280;0.0689)														---	---	---	---
HIST2H2AB	317772	broad.mit.edu	37	1	149859408	149859408	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149859408G>A	uc001ete.2	-	1	59	c.59C>T	c.(58-60)TCC>TTC	p.S20F	HIST2H2BE_uc001etc.2_5'Flank	NM_175065	NP_778235	Q8IUE6	H2A2B_HUMAN	histone cluster 2, H2ab	20					nucleosome assembly	nucleosome|nucleus	DNA binding			ovary(1)|breast(1)	2	Breast(34;0.0124)|all_hematologic(923;0.127)		STAD - Stomach adenocarcinoma(528;0.133)|LUSC - Lung squamous cell carcinoma(543;0.221)															---	---	---	---
HRNR	388697	broad.mit.edu	37	1	152187549	152187549	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152187549C>T	uc001ezt.1	-	3	6632	c.6556G>A	c.(6556-6558)GGC>AGC	p.G2186S		NM_001009931	NP_001009931	Q86YZ3	HORN_HUMAN	hornerin	2186	24.				keratinization		calcium ion binding|protein binding			skin(2)|ovary(1)	3	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)															---	---	---	---
FCRL5	83416	broad.mit.edu	37	1	157508895	157508895	+	Silent	SNP	C	T	T	rs139032379	byFrequency;by1000genomes	TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157508895C>T	uc001fqu.2	-	7	1541	c.1383G>A	c.(1381-1383)GCG>GCA	p.A461A	FCRL5_uc009wsm.2_Silent_p.A461A|FCRL5_uc010phv.1_Silent_p.A461A|FCRL5_uc010phw.1_Silent_p.A376A|FCRL5_uc001fqv.1_Silent_p.A461A|FCRL5_uc010phx.1_Silent_p.A212A	NM_031281	NP_112571	Q96RD9	FCRL5_HUMAN	Fc receptor-like 5	461	Extracellular (Potential).|Ig-like C2-type 4.					integral to membrane|plasma membrane	receptor activity			ovary(3)|breast(2)|central_nervous_system(1)	6	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.231)																---	---	---	---
OR10T2	128360	broad.mit.edu	37	1	158369259	158369259	+	5'Flank	SNP	G	A	A			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158369259G>A	uc010pih.1	-							NM_001004475	NP_001004475			olfactory receptor, family 10, subfamily T,						sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|central_nervous_system(1)	3	all_hematologic(112;0.0378)																	---	---	---	---
OR10J3	441911	broad.mit.edu	37	1	159284373	159284373	+	Missense_Mutation	SNP	A	C	C			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:159284373A>C	uc010piu.1	-	1	77	c.77T>G	c.(76-78)CTT>CGT	p.L26R		NM_001004467	NP_001004467	Q5JRS4	O10J3_HUMAN	olfactory receptor, family 10, subfamily J,	26	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2	all_hematologic(112;0.0429)																	---	---	---	---
ATP1A4	480	broad.mit.edu	37	1	160136448	160136448	+	Missense_Mutation	SNP	G	A	A	rs139315814		TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160136448G>A	uc001fve.3	+	8	1657	c.1178G>A	c.(1177-1179)CGC>CAC	p.R393H	ATP1A4_uc001fvf.3_RNA|ATP1A4_uc001fvg.2_5'UTR	NM_144699	NP_653300	Q13733	AT1A4_HUMAN	Na+/K+ -ATPase alpha 4 subunit isoform 1	393	Cytoplasmic (Potential).				ATP biosynthetic process|ATP hydrolysis coupled proton transport|regulation of cellular pH|sperm motility	sodium:potassium-exchanging ATPase complex	ATP binding|metal ion binding|sodium:potassium-exchanging ATPase activity			ovary(2)|skin(2)	4	all_cancers(52;2.56e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)															---	---	---	---
TNN	63923	broad.mit.edu	37	1	175067562	175067562	+	Silent	SNP	C	T	T			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:175067562C>T	uc001gkl.1	+	9	2063	c.1950C>T	c.(1948-1950)TAC>TAT	p.Y650Y	TNN_uc010pmx.1_Silent_p.Y561Y	NM_022093	NP_071376	Q9UQP3	TENN_HUMAN	tenascin N precursor	650	Fibronectin type-III 5.				cell growth|cell migration|signal transduction	extracellular space|proteinaceous extracellular matrix				large_intestine(5)|ovary(3)|central_nervous_system(1)	9		Breast(1374;0.000962)		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)														---	---	---	---
ASTN1	460	broad.mit.edu	37	1	176992559	176992559	+	Missense_Mutation	SNP	G	T	T			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:176992559G>T	uc001glc.2	-	7	1631	c.1419C>A	c.(1417-1419)CAC>CAA	p.H473Q	ASTN1_uc001glb.1_Missense_Mutation_p.H473Q|ASTN1_uc001gld.1_Missense_Mutation_p.H473Q|ASTN1_uc009wwx.1_Missense_Mutation_p.H473Q|ASTN1_uc001gle.3_RNA	NM_004319	NP_004310	O14525	ASTN1_HUMAN	astrotactin isoform 1	473	EGF-like 1.				cell migration|neuron cell-cell adhesion	integral to membrane				ovary(6)|skin(5)|central_nervous_system(2)|large_intestine(1)|lung(1)	15																		---	---	---	---
LAMC1	3915	broad.mit.edu	37	1	183087207	183087207	+	Missense_Mutation	SNP	T	A	A			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:183087207T>A	uc001gpy.3	+	11	2173	c.1916T>A	c.(1915-1917)CTT>CAT	p.L639H		NM_002293	NP_002284	P11047	LAMC1_HUMAN	laminin, gamma 1 precursor	639	Laminin IV type A.				axon guidance|cell migration|endoderm development|extracellular matrix disassembly|hemidesmosome assembly|positive regulation of epithelial cell proliferation|protein complex assembly|substrate adhesion-dependent cell spreading	extracellular space|laminin-1 complex|laminin-10 complex|laminin-11 complex	extracellular matrix structural constituent			ovary(3)|large_intestine(1)|kidney(1)	5					Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)													---	---	---	---
EPRS	2058	broad.mit.edu	37	1	220153467	220153467	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:220153467G>A	uc001hly.1	-	26	3941	c.3671C>T	c.(3670-3672)ACA>ATA	p.T1224I		NM_004446	NP_004437	P07814	SYEP_HUMAN	glutamyl-prolyl tRNA synthetase	1224	Prolyl-tRNA synthetase.				glutamyl-tRNA aminoacylation|prolyl-tRNA aminoacylation|protein complex assembly	cytosol|soluble fraction	ATP binding|glutamate-tRNA ligase activity|proline-tRNA ligase activity|protein binding|RNA binding			ovary(1)|skin(1)	2				GBM - Glioblastoma multiforme(131;0.0735)	L-Glutamic Acid(DB00142)|L-Proline(DB00172)													---	---	---	---
URB2	9816	broad.mit.edu	37	1	229772123	229772123	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:229772123C>T	uc001hts.1	+	4	1899	c.1763C>T	c.(1762-1764)CCG>CTG	p.P588L	URB2_uc009xfd.1_Missense_Mutation_p.P588L	NM_014777	NP_055592	Q14146	URB2_HUMAN	URB2 ribosome biogenesis 2 homolog	588						nucleolus				central_nervous_system(2)|ovary(1)	3																		---	---	---	---
NRXN1	9378	broad.mit.edu	37	2	51255085	51255085	+	Silent	SNP	A	C	C			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:51255085A>C	uc010fbq.2	-	2	1804	c.327T>G	c.(325-327)GTT>GTG	p.V109V	NRXN1_uc002rxe.3_Silent_p.V109V|NRXN1_uc002rxd.1_Silent_p.V109V	NM_001135659	NP_001129131	P58400	NRX1B_HUMAN	neurexin 1 isoform alpha2 precursor	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					angiogenesis|neuron cell-cell adhesion|neuronal signal transduction	cell surface|endocytic vesicle|integral to membrane|presynaptic membrane	cell adhesion molecule binding|receptor binding			ovary(2)	2		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)															---	---	---	---
ST6GAL2	84620	broad.mit.edu	37	2	107459775	107459775	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:107459775C>T	uc002tdq.2	-	2	778	c.659G>A	c.(658-660)CGC>CAC	p.R220H	ST6GAL2_uc002tdr.2_Missense_Mutation_p.R220H|ST6GAL2_uc002tds.3_Missense_Mutation_p.R220H	NM_001142351	NP_001135823	Q96JF0	SIAT2_HUMAN	ST6 beta-galactosamide	220	Lumenal (Potential).				growth|multicellular organismal development|oligosaccharide metabolic process|protein glycosylation	Golgi cisterna membrane|integral to Golgi membrane	beta-galactoside alpha-2,6-sialyltransferase activity			pancreas(6)|ovary(4)|skin(1)	11																		---	---	---	---
ZNF385B	151126	broad.mit.edu	37	2	180309654	180309654	+	Silent	SNP	C	T	T			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:180309654C>T	uc002unn.3	-	9	1750	c.1146G>A	c.(1144-1146)AAG>AAA	p.K382K	ZNF385B_uc002unj.2_Silent_p.K280K|ZNF385B_uc002unk.2_RNA|ZNF385B_uc002unl.2_Silent_p.K279K|ZNF385B_uc002unm.2_Silent_p.K306K	NM_152520	NP_689733	Q569K4	Z385B_HUMAN	zinc finger protein 385B isoform 1	382						nucleus	nucleic acid binding|zinc ion binding			ovary(1)	1			Epithelial(96;0.174)|OV - Ovarian serous cystadenocarcinoma(117;0.201)															---	---	---	---
DNAH7	56171	broad.mit.edu	37	2	196749409	196749409	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:196749409G>A	uc002utj.3	-	35	5764	c.5663C>T	c.(5662-5664)ACG>ATG	p.T1888M		NM_018897	NP_061720	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	1888					ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			skin(10)|ovary(2)	12																		---	---	---	---
COL6A3	1293	broad.mit.edu	37	2	238249780	238249780	+	Missense_Mutation	SNP	G	C	C	rs144249704		TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:238249780G>C	uc002vwl.2	-	38	8064	c.7779C>G	c.(7777-7779)ATC>ATG	p.I2593M	COL6A3_uc002vwo.2_Missense_Mutation_p.I2387M|COL6A3_uc010znj.1_Missense_Mutation_p.I1986M|COL6A3_uc002vwj.2_Translation_Start_Site	NM_004369	NP_004360	P12111	CO6A3_HUMAN	alpha 3 type VI collagen isoform 1 precursor	2593	Nonhelical region.				axon guidance|cell adhesion|muscle organ development	collagen type VI|extracellular space	serine-type endopeptidase inhibitor activity			ovary(8)|central_nervous_system(6)|skin(2)|upper_aerodigestive_tract(1)|pancreas(1)	18		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)														---	---	---	---
SNED1	25992	broad.mit.edu	37	2	241987861	241987861	+	Intron	SNP	C	T	T			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241987861C>T	uc002wah.1	+							NM_001080437	NP_001073906			6720455I24Rik homolog precursor						cell-matrix adhesion	extracellular region	calcium ion binding			breast(1)|central_nervous_system(1)	2		all_cancers(19;7.48e-31)|all_epithelial(40;1.35e-12)|Breast(86;0.000148)|Renal(207;0.00528)|Ovarian(221;0.104)|Esophageal squamous(248;0.131)|all_lung(227;0.17)|all_hematologic(139;0.182)|Melanoma(123;0.238)		Epithelial(32;6.46e-32)|all cancers(36;6.23e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.1e-14)|Kidney(56;6.35e-09)|KIRC - Kidney renal clear cell carcinoma(57;5.98e-08)|BRCA - Breast invasive adenocarcinoma(100;3.66e-06)|Lung(119;0.00072)|LUSC - Lung squamous cell carcinoma(224;0.00553)|Colorectal(34;0.0162)|COAD - Colon adenocarcinoma(134;0.109)														---	---	---	---
CNTN6	27255	broad.mit.edu	37	3	1337484	1337484	+	Silent	SNP	T	G	G			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:1337484T>G	uc003boz.2	+	6	921	c.654T>G	c.(652-654)ACT>ACG	p.T218T	CNTN6_uc010hbo.2_Silent_p.T213T|CNTN6_uc011asj.1_Silent_p.T146T|CNTN6_uc003bpa.2_Silent_p.T218T	NM_014461	NP_055276	Q9UQ52	CNTN6_HUMAN	contactin 6 precursor	218					axon guidance|cell adhesion|central nervous system development|Notch signaling pathway	anchored to membrane|plasma membrane				skin(3)|lung(2)|breast(2)|pancreas(1)	8		all_cancers(2;0.000164)|all_epithelial(2;0.107)		Epithelial(13;0.000233)|all cancers(10;0.0013)|OV - Ovarian serous cystadenocarcinoma(96;0.0139)														---	---	---	---
CACNA2D3	55799	broad.mit.edu	37	3	54871251	54871251	+	Silent	SNP	C	T	T			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:54871251C>T	uc003dhf.2	+	15	1512	c.1464C>T	c.(1462-1464)AAC>AAT	p.N488N	CACNA2D3_uc011beu.1_RNA|CACNA2D3_uc003dhg.1_Silent_p.N394N|CACNA2D3_uc003dhh.1_RNA|CACNA2D3_uc010hmv.1_Silent_p.N222N	NM_018398	NP_060868	Q8IZS8	CA2D3_HUMAN	calcium channel, voltage-dependent, alpha	488	Extracellular (Potential).|Cache.					integral to membrane	calcium channel activity|metal ion binding|voltage-gated ion channel activity			large_intestine(3)|ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	7				KIRC - Kidney renal clear cell carcinoma(284;0.00287)|Kidney(284;0.00327)														---	---	---	---
C3orf52	79669	broad.mit.edu	37	3	111828417	111828417	+	Missense_Mutation	SNP	T	G	G			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:111828417T>G	uc003dyq.3	+	4	497	c.424T>G	c.(424-426)TCT>GCT	p.S142A	C3orf52_uc011bhs.1_Intron|C3orf52_uc011bht.1_Intron|C3orf52_uc003dyr.1_5'Flank	NM_024616	NP_078892	Q5BVD1	TTMP_HUMAN	TPA-induced transmembrane protein	142						endoplasmic reticulum membrane|integral to membrane					0																		---	---	---	---
PODXL2	50512	broad.mit.edu	37	3	127381088	127381088	+	Nonsense_Mutation	SNP	C	A	A			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:127381088C>A	uc003ejq.2	+	4	1164	c.1140C>A	c.(1138-1140)TGC>TGA	p.C380*		NM_015720	NP_056535	Q9NZ53	PDXL2_HUMAN	podocalyxin-like 2 precursor	380	Extracellular (Potential).				leukocyte tethering or rolling	integral to plasma membrane	glycosaminoglycan binding|protein binding			ovary(1)|central_nervous_system(1)	2																		---	---	---	---
SLC26A1	10861	broad.mit.edu	37	4	984125	984125	+	Missense_Mutation	SNP	C	A	A			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:984125C>A	uc003gcb.2	-	4	980	c.602G>T	c.(601-603)GGC>GTC	p.G201V	SLC26A1_uc003gbx.2_Intron|IDUA_uc003gby.2_Intron|IDUA_uc003gbz.2_Intron|IDUA_uc003gca.2_Intron|SLC26A1_uc003gcc.2_Missense_Mutation_p.G201V	NM_213613	NP_998778	Q9H2B4	S26A1_HUMAN	solute carrier family 26, member 1 isoform a	201						integral to membrane|plasma membrane	secondary active sulfate transmembrane transporter activity			skin(1)	1			OV - Ovarian serous cystadenocarcinoma(23;0.0158)															---	---	---	---
RASGEF1B	153020	broad.mit.edu	37	4	82355019	82355019	+	Silent	SNP	G	A	A			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:82355019G>A	uc003hmi.1	-	12	1443	c.1299C>T	c.(1297-1299)CTC>CTT	p.L433L	RASGEF1B_uc003hmj.1_Silent_p.L432L|RASGEF1B_uc010ijq.1_Silent_p.L391L	NM_152545	NP_689758	Q0VAM2	RGF1B_HUMAN	RasGEF domain family, member 1B	433	Ras-GEF.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	intracellular	Ras guanyl-nucleotide exchange factor activity				0																		---	---	---	---
HNRNPA0	10949	broad.mit.edu	37	5	137089636	137089636	+	Silent	SNP	C	T	T			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137089636C>T	uc003lbt.2	-	1	404	c.120G>A	c.(118-120)GTG>GTA	p.V40V	MYOT_uc011cye.1_Intron|HNRNPA0_uc010jeo.2_Intron	NM_006805	NP_006796	Q13151	ROA0_HUMAN	heterogeneous nuclear ribonucleoprotein A0	40	RRM 1.				nuclear mRNA splicing, via spliceosome	heterogeneous nuclear ribonucleoprotein complex|nucleoplasm	nucleotide binding|RNA binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)															---	---	---	---
PCDHGB5	56101	broad.mit.edu	37	5	140779263	140779263	+	Silent	SNP	C	A	A			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140779263C>A	uc003lkf.1	+	1	1569	c.1569C>A	c.(1567-1569)ACC>ACA	p.T523T	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc011daw.1_Silent_p.T523T	NM_018925	NP_061748	Q9Y5G0	PCDGH_HUMAN	protocadherin gamma subfamily B, 5 isoform 1	523	Extracellular (Potential).|Cadherin 5.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)															---	---	---	---
GRIA1	2890	broad.mit.edu	37	5	153030042	153030042	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:153030042G>A	uc003lva.3	+	4	978	c.613G>A	c.(613-615)GAA>AAA	p.E205K	GRIA1_uc003luy.3_Missense_Mutation_p.E205K|GRIA1_uc003luz.3_Missense_Mutation_p.E110K|GRIA1_uc011dcv.1_RNA|GRIA1_uc011dcw.1_Missense_Mutation_p.E125K|GRIA1_uc011dcx.1_Missense_Mutation_p.E136K|GRIA1_uc011dcy.1_Missense_Mutation_p.E215K|GRIA1_uc011dcz.1_Missense_Mutation_p.E215K|GRIA1_uc010jia.1_Missense_Mutation_p.E185K	NM_001114183	NP_001107655	P42261	GRIA1_HUMAN	glutamate receptor, ionotropic, AMPA 1 isoform	205	Extracellular (Potential).				synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|cell junction|dendritic spine|endocytic vesicle membrane|endoplasmic reticulum membrane|neuronal cell body|postsynaptic density|postsynaptic membrane	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity|PDZ domain binding			ovary(4)|skin(2)	6		Medulloblastoma(196;0.0391)|all_neural(177;0.16)|all_hematologic(541;0.21)	Kidney(363;0.000173)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		Desflurane(DB01189)|Enflurane(DB00228)|Halothane(DB01159)|Isoflurane(DB00753)|L-Glutamic Acid(DB00142)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)													---	---	---	---
FLT4	2324	broad.mit.edu	37	5	180040051	180040051	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:180040051C>T	uc003mma.3	-	25	3470	c.3391G>A	c.(3391-3393)GGC>AGC	p.G1131S	FLT4_uc003mlz.3_Missense_Mutation_p.G1131S	NM_002020	NP_002011	P35916	VGFR3_HUMAN	fms-related tyrosine kinase 4 isoform 2	1131	Cytoplasmic (Potential).|Protein kinase.				positive regulation of cell proliferation	integral to plasma membrane	ATP binding|protein phosphatase binding|vascular endothelial growth factor receptor activity			lung(7)|skin(2)|ovary(2)|stomach(1)|central_nervous_system(1)|breast(1)|kidney(1)	15	all_cancers(89;2.21e-05)|all_epithelial(37;5.29e-06)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00245)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.134)	Sorafenib(DB00398)|Sunitinib(DB01268)									Congenital_Hereditary_Lymphedema				---	---	---	---
HIST1H2AC	8334	broad.mit.edu	37	6	26124688	26124688	+	Missense_Mutation	SNP	G	C	C			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26124688G>C	uc003ngm.2	+	1	316	c.228G>C	c.(226-228)AAG>AAC	p.K76N	HIST1H2BC_uc003ngk.3_5'Flank|HIST1H2BC_uc003ngl.2_5'Flank|HIST1H2AC_uc003ngn.2_RNA|HIST1H2AC_uc003ngo.2_RNA|HIST1H2AC_uc003ngp.2_Missense_Mutation_p.K76N	NM_003512	NP_003503	Q93077	H2A1C_HUMAN	histone cluster 1, H2ac	76					nucleosome assembly	nucleosome|nucleus	DNA binding				0																		---	---	---	---
HIST1H2AM	8336	broad.mit.edu	37	6	27860703	27860703	+	Silent	SNP	T	C	C			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:27860703T>C	uc003nkb.1	-	1	261	c.225A>G	c.(223-225)AAA>AAG	p.K75K	HIST1H3J_uc003nka.2_5'Flank|HIST1H2BO_uc003nkc.1_5'Flank	NM_003514	NP_003505	P0C0S8	H2A1_HUMAN	histone cluster 1, H2am	75					nucleosome assembly	nucleosome|nucleus	DNA binding|enzyme binding			ovary(2)	2																		---	---	---	---
LRFN2	57497	broad.mit.edu	37	6	40359893	40359893	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:40359893C>T	uc003oph.1	-	3	2624	c.2159G>A	c.(2158-2160)CGC>CAC	p.R720H		NM_020737	NP_065788	Q9ULH4	LRFN2_HUMAN	leucine rich repeat and fibronectin type III	720	Cytoplasmic (Potential).					cell junction|integral to membrane|postsynaptic membrane				ovary(2)|skin(1)	3	Ovarian(28;0.0418)|Colorectal(47;0.196)																	---	---	---	---
AUTS2	26053	broad.mit.edu	37	7	70231198	70231198	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:70231198G>A	uc003tvw.3	+	9	2310	c.1567G>A	c.(1567-1569)GAG>AAG	p.E523K	AUTS2_uc003tvx.3_Missense_Mutation_p.E523K|AUTS2_uc011keg.1_5'Flank	NM_015570	NP_056385	Q8WXX7	AUTS2_HUMAN	autism susceptibility candidate 2 isoform 1	523										ovary(2)|central_nervous_system(1)	3		all_cancers(73;0.0264)|all_epithelial(88;0.0198)|Lung NSC(55;0.0599)|all_lung(88;0.093)		LUSC - Lung squamous cell carcinoma(90;0.082)|Lung(90;0.186)														---	---	---	---
PCLO	27445	broad.mit.edu	37	7	82764926	82764926	+	Missense_Mutation	SNP	C	G	G			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:82764926C>G	uc003uhx.2	-	3	2229	c.1940G>C	c.(1939-1941)GGC>GCC	p.G647A	PCLO_uc003uhv.2_Missense_Mutation_p.G647A	NM_033026	NP_149015	Q9Y6V0	PCLO_HUMAN	piccolo isoform 1	593	Pro-rich.				cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity			ovary(7)	7																		---	---	---	---
PTPRN2	5799	broad.mit.edu	37	7	157414082	157414082	+	Silent	SNP	G	A	A			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:157414082G>A	uc003wno.2	-	15	2437	c.2316C>T	c.(2314-2316)CCC>CCT	p.P772P	PTPRN2_uc003wnp.2_Silent_p.P755P|PTPRN2_uc003wnq.2_Silent_p.P743P|PTPRN2_uc003wnr.2_Silent_p.P734P|PTPRN2_uc011kwa.1_Silent_p.P795P	NM_002847	NP_002838	Q92932	PTPR2_HUMAN	protein tyrosine phosphatase, receptor type, N	772	Cytoplasmic (Potential).|Tyrosine-protein phosphatase.					integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(4)|large_intestine(1)|pleura(1)|skin(1)	7	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)														---	---	---	---
LZTS1	11178	broad.mit.edu	37	8	20110556	20110556	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:20110556C>T	uc003wzr.2	-	2	997	c.886G>A	c.(886-888)GAG>AAG	p.E296K	LZTS1_uc010ltg.1_Missense_Mutation_p.E296K	NM_021020	NP_066300	Q9Y250	LZTS1_HUMAN	leucine zipper, putative tumor suppressor 1	296	Potential.				cell cycle|termination of RNA polymerase III transcription|transcription elongation from RNA polymerase III promoter	cell junction|dendritic spine|Golgi apparatus|nucleolus|nucleoplasm|postsynaptic density|postsynaptic membrane	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1				Colorectal(74;0.0511)|COAD - Colon adenocarcinoma(73;0.207)														---	---	---	---
CPNE3	8895	broad.mit.edu	37	8	87567198	87567198	+	Nonsense_Mutation	SNP	C	T	T			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:87567198C>T	uc003ydv.2	+	15	1402	c.1240C>T	c.(1240-1242)CAG>TAG	p.Q414*	CPNE3_uc003ydw.1_Nonsense_Mutation_p.Q130*	NM_003909	NP_003900	O75131	CPNE3_HUMAN	copine III	414	VWFA.				lipid metabolic process|vesicle-mediated transport	cytosol	calcium-dependent phospholipid binding|protein serine/threonine kinase activity|transporter activity			ovary(1)|skin(1)	2																		---	---	---	---
ASAP1	50807	broad.mit.edu	37	8	131088602	131088602	+	Missense_Mutation	SNP	G	T	T			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:131088602G>T	uc003yta.1	-	26	2721	c.2693C>A	c.(2692-2694)CCT>CAT	p.P898H	ASAP1_uc003ysz.1_Missense_Mutation_p.P709H|ASAP1_uc011liw.1_Missense_Mutation_p.P891H	NM_018482	NP_060952	Q9ULH1	ASAP1_HUMAN	development and differentiation enhancing factor	898	Pro-rich.				cilium morphogenesis|filopodium assembly|regulation of ARF GTPase activity|signal transduction	cytoplasm|membrane	ARF GTPase activator activity|cytoskeletal adaptor activity|SH3 domain binding|zinc ion binding			ovary(4)	4																		---	---	---	---
ARHGAP39	80728	broad.mit.edu	37	8	145773557	145773557	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145773557G>A	uc003zdt.1	-	6	1468	c.913C>T	c.(913-915)CGC>TGC	p.R305C	ARHGAP39_uc011llk.1_Missense_Mutation_p.R305C|ARHGAP39_uc003zds.1_Missense_Mutation_p.R305C	NM_025251	NP_079527	Q9C0H5	RHG39_HUMAN	KIAA1688 protein	305	Pro-rich.				axon guidance|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytoskeleton|cytosol|nucleus	GTPase activator activity				0																		---	---	---	---
NAA35	60560	broad.mit.edu	37	9	88632418	88632418	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:88632418C>T	uc004aoi.3	+	19	1848	c.1711C>T	c.(1711-1713)CCA>TCA	p.P571S	NAA35_uc004aoj.3_Missense_Mutation_p.P571S	NM_024635	NP_078911	Q5VZE5	NAA35_HUMAN	corneal wound healing-related protein	571					smooth muscle cell proliferation	cytoplasm|nucleus|plasma membrane				skin(2)|central_nervous_system(1)	3																		---	---	---	---
PHF2	5253	broad.mit.edu	37	9	96438029	96438029	+	Silent	SNP	C	T	T	rs148663364		TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:96438029C>T	uc004aub.2	+	20	2937	c.2790C>T	c.(2788-2790)ATC>ATT	p.I930I	PHF2_uc011lug.1_Silent_p.I813I|PHF2_uc004auc.2_Silent_p.I350I	NM_005392	NP_005383	O75151	PHF2_HUMAN	PHD finger protein 2	930					liver development|negative regulation of chromatin silencing at rDNA|transcription, DNA-dependent	nucleolus	histone demethylase activity (H3-K9 specific)|iron ion binding|methylated histone residue binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding			ovary(1)	1		Myeloproliferative disorder(762;0.0255)		OV - Ovarian serous cystadenocarcinoma(323;9.11e-28)														---	---	---	---
FAM129B	64855	broad.mit.edu	37	9	130270485	130270485	+	Intron	SNP	G	A	A			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130270485G>A	uc004brh.2	-						FAM129B_uc004bri.2_Intron|FAM129B_uc004brj.3_Intron	NM_022833	NP_073744			hypothetical protein LOC64855 isoform 1								protein binding				0																		---	---	---	---
ALOX5	240	broad.mit.edu	37	10	45938960	45938960	+	Silent	SNP	C	T	T			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:45938960C>T	uc001jce.2	+	11	1647	c.1548C>T	c.(1546-1548)TAC>TAT	p.Y516Y	ALOX5_uc009xmt.2_Silent_p.Y484Y|ALOX5_uc010qfg.1_Silent_p.Y516Y	NM_000698	NP_000689	P09917	LOX5_HUMAN	arachidonate 5-lipoxygenase	516	Lipoxygenase.				hormone biosynthetic process|leukotriene biosynthetic process|prostanoid metabolic process	cytosol|nuclear envelope lumen|nuclear matrix|nuclear membrane	arachidonate 5-lipoxygenase activity|iron ion binding|lipoxygenase activity|protein binding			ovary(1)|pancreas(1)	2		Lung SC(717;0.0257)			Diethylcarbamazine(DB00711)|Hydrocortisone(DB00741)|Leflunomide(DB01097)|Masoprocol(DB00179)|Meclofenamic acid(DB00939)|Minocycline(DB01017)|Montelukast(DB00471)|Quinacrine(DB01103)|Vitamin E(DB00163)|Zileuton(DB00744)													---	---	---	---
MYOF	26509	broad.mit.edu	37	10	95069867	95069867	+	Silent	SNP	G	A	A			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:95069867G>A	uc001kin.2	-	53	6180	c.6057C>T	c.(6055-6057)ATC>ATT	p.I2019I	MYOF_uc001kio.2_Silent_p.I2006I|MYOF_uc009xue.2_RNA	NM_013451	NP_038479	Q9NZM1	MYOF_HUMAN	myoferlin isoform a	2019	Cytoplasmic (Potential).				blood circulation|muscle contraction|plasma membrane repair	caveola|cytoplasmic vesicle membrane|integral to membrane|nuclear membrane	phospholipid binding|protein binding			ovary(3)|breast(1)	4																		---	---	---	---
ELOVL3	83401	broad.mit.edu	37	10	103988745	103988745	+	Silent	SNP	C	A	A			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:103988745C>A	uc001kut.2	+	4	712	c.549C>A	c.(547-549)ACC>ACA	p.T183T		NM_152310	NP_689523	Q9HB03	ELOV3_HUMAN	elongation of very long chain fatty acids like	183	Helical; (Potential).				fatty acid elongation, monounsaturated fatty acid|fatty acid elongation, polyunsaturated fatty acid|fatty acid elongation, saturated fatty acid|long-chain fatty-acyl-CoA biosynthetic process|triglyceride biosynthetic process|very long-chain fatty acid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	fatty acid elongase activity|protein binding			ovary(2)	2		Colorectal(252;0.207)		Epithelial(162;4.47e-08)|all cancers(201;7.96e-07)														---	---	---	---
MRGPRX1	259249	broad.mit.edu	37	11	18956197	18956197	+	Silent	SNP	G	A	A			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:18956197G>A	uc001mpg.2	-	1	353	c.135C>T	c.(133-135)AAC>AAT	p.N45N		NM_147199	NP_671732	Q96LB2	MRGX1_HUMAN	MAS-related GPR, member X1	45	Helical; Name=1; (Potential).				acute-phase response	integral to membrane|plasma membrane	G-protein coupled receptor activity			pancreas(2)|central_nervous_system(1)	3																		---	---	---	---
MUC15	143662	broad.mit.edu	37	11	26587340	26587340	+	Silent	SNP	A	G	G			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:26587340A>G	uc001mqx.2	-	2	332	c.66T>C	c.(64-66)CAT>CAC	p.H22H	ANO3_uc010rdr.1_Intron|ANO3_uc001mqt.3_Intron|ANO3_uc010rds.1_Intron|ANO3_uc010rdt.1_Intron|MUC15_uc001mqw.2_Silent_p.H49H|MUC15_uc001mqy.2_Silent_p.H49H	NM_145650	NP_663625	Q8N387	MUC15_HUMAN	mucin 15 isoform b	22						extracellular region|integral to membrane|plasma membrane				ovary(1)|central_nervous_system(1)|pancreas(1)	3																		---	---	---	---
TAF1D	79101	broad.mit.edu	37	11	93466636	93466636	+	Intron	SNP	G	A	A			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:93466636G>A	uc001pea.1	-						SNORA8_uc001pec.2_RNA|TAF1D_uc001pdz.2_RNA|SNORA25_uc001pdy.3_5'Flank|SNORA32_uc009ywc.1_5'Flank|SNORD6_uc001peb.2_5'Flank|SNORA1_uc009ywd.1_5'Flank|SNORA8_uc009ywe.2_5'Flank|SNORD5_uc009ywf.1_5'Flank|SNORA18_uc009ywg.1_RNA	NM_024116				TATA box binding protein (TBP)-associated						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding				0																		---	---	---	---
ZBTB44	29068	broad.mit.edu	37	11	130109742	130109742	+	Silent	SNP	C	T	T			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:130109742C>T	uc001qga.2	-	3	1462	c.1068G>A	c.(1066-1068)ACG>ACA	p.T356T	ZBTB44_uc001qgb.3_Silent_p.T356T|ZBTB44_uc001qfx.2_RNA|ZBTB44_uc001qgc.1_Silent_p.T356T|ZBTB44_uc001qfz.2_Silent_p.T356T	NM_014155	NP_054874	Q8NCP5	ZBT44_HUMAN	zinc finger and BTB domain containing 44	356					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1	all_hematologic(175;0.0429)	Lung NSC(97;0.000601)|Breast(109;0.000962)|all_lung(97;0.00125)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0192)|Lung(977;0.235)														---	---	---	---
LRRK2	120892	broad.mit.edu	37	12	40761559	40761559	+	Missense_Mutation	SNP	G	T	T			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:40761559G>T	uc001rmg.3	+	51	7697	c.7576G>T	c.(7576-7578)GTT>TTT	p.V2526F	LRRK2_uc009zjw.2_Missense_Mutation_p.V1364F|LRRK2_uc001rmi.2_3'UTR	NM_198578	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	2526					activation of MAPKK activity|determination of adult lifespan|exploration behavior|intracellular distribution of mitochondria|negative regulation of branching morphogenesis of a nerve|negative regulation of dendritic spine morphogenesis|negative regulation of neuroblast proliferation|negative regulation of neuron maturation|neuromuscular junction development|neuron death|peptidyl-serine phosphorylation|positive regulation of autophagy|positive regulation of dopamine receptor signaling pathway|positive regulation of programmed cell death|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein phosphorylation|positive regulation of protein ubiquitination|protein autophosphorylation|regulation of kidney size|regulation of locomotion|regulation of membrane potential|response to oxidative stress|small GTPase mediated signal transduction|tangential migration from the subventricular zone to the olfactory bulb	external side of mitochondrial outer membrane	ATP binding|GTP binding|GTP-dependent protein kinase activity|GTPase activator activity|MAP kinase kinase activity|protein homodimerization activity|tubulin binding			ovary(12)|stomach(5)|upper_aerodigestive_tract(2)|lung(2)|large_intestine(1)|urinary_tract(1)|pancreas(1)	24	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)																---	---	---	---
SRGAP1	57522	broad.mit.edu	37	12	64488927	64488927	+	Missense_Mutation	SNP	T	A	A			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:64488927T>A	uc010ssp.1	+	14	1677	c.1621T>A	c.(1621-1623)TTC>ATC	p.F541I	SRGAP1_uc001srv.2_Missense_Mutation_p.F478I	NM_020762	NP_065813	Q7Z6B7	SRGP1_HUMAN	SLIT-ROBO Rho GTPase activating protein 1	541	Rho-GAP.				axon guidance	cytosol				ovary(2)|central_nervous_system(2)	4			GBM - Glioblastoma multiforme(3;0.000139)|BRCA - Breast invasive adenocarcinoma(9;0.225)	GBM - Glioblastoma multiforme(28;0.0608)														---	---	---	---
SRGAP1	57522	broad.mit.edu	37	12	64488928	64488928	+	Missense_Mutation	SNP	T	A	A			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:64488928T>A	uc010ssp.1	+	14	1678	c.1622T>A	c.(1621-1623)TTC>TAC	p.F541Y	SRGAP1_uc001srv.2_Missense_Mutation_p.F478Y	NM_020762	NP_065813	Q7Z6B7	SRGP1_HUMAN	SLIT-ROBO Rho GTPase activating protein 1	541	Rho-GAP.				axon guidance	cytosol				ovary(2)|central_nervous_system(2)	4			GBM - Glioblastoma multiforme(3;0.000139)|BRCA - Breast invasive adenocarcinoma(9;0.225)	GBM - Glioblastoma multiforme(28;0.0608)														---	---	---	---
SRGAP1	57522	broad.mit.edu	37	12	64488929	64488929	+	Missense_Mutation	SNP	C	A	A			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:64488929C>A	uc010ssp.1	+	14	1679	c.1623C>A	c.(1621-1623)TTC>TTA	p.F541L	SRGAP1_uc001srv.2_Missense_Mutation_p.F478L	NM_020762	NP_065813	Q7Z6B7	SRGP1_HUMAN	SLIT-ROBO Rho GTPase activating protein 1	541	Rho-GAP.				axon guidance	cytosol				ovary(2)|central_nervous_system(2)	4			GBM - Glioblastoma multiforme(3;0.000139)|BRCA - Breast invasive adenocarcinoma(9;0.225)	GBM - Glioblastoma multiforme(28;0.0608)														---	---	---	---
MDM2	4193	broad.mit.edu	37	12	69233396	69233396	+	Nonsense_Mutation	SNP	G	T	T			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:69233396G>T	uc001sui.2	+	11	1548	c.1261G>T	c.(1261-1263)GAA>TAA	p.E421*	MDM2_uc009zri.2_Nonsense_Mutation_p.E376*|MDM2_uc009zqx.2_Nonsense_Mutation_p.E366*|MDM2_uc009zqw.2_Intron|MDM2_uc001suk.2_Intron|MDM2_uc001sun.3_Nonsense_Mutation_p.E240*|MDM2_uc009zqz.2_Nonsense_Mutation_p.E368*|MDM2_uc009zra.2_Nonsense_Mutation_p.E219*|MDM2_uc001sum.1_Nonsense_Mutation_p.E49*|MDM2_uc009zrd.2_Nonsense_Mutation_p.E105*|MDM2_uc009zrc.2_Nonsense_Mutation_p.E105*|MDM2_uc009zre.2_Nonsense_Mutation_p.E162*|MDM2_uc009zrf.2_Nonsense_Mutation_p.E105*|MDM2_uc001suo.2_Nonsense_Mutation_p.E215*|MDM2_uc009zrg.2_Nonsense_Mutation_p.E137*|MDM2_uc009zrh.2_Nonsense_Mutation_p.E189*	NM_002392	NP_002383	Q00987	MDM2_HUMAN	mouse double minute 2 homolog isoform MDM2	415	Necessary for interaction with USP2.				cellular response to hypoxia|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|establishment of protein localization|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell cycle arrest|negative regulation of DNA damage response, signal transduction by p53 class mediator|negative regulation of transcription from RNA polymerase II promoter|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of cell proliferation|positive regulation of mitotic cell cycle|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|protein complex assembly|protein destabilization|protein localization to nucleus|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|response to antibiotic|synaptic transmission	cytosol|endocytic vesicle membrane|insoluble fraction|nucleolus|nucleoplasm|plasma membrane|protein complex	enzyme binding|identical protein binding|p53 binding|ubiquitin-protein ligase activity|zinc ion binding			lung(2)|central_nervous_system(1)	3	all_cancers(1;8.46e-121)|all_epithelial(5;3.21e-36)|Lung NSC(4;2.16e-33)|all_lung(4;3.03e-31)|Glioma(1;1.9e-09)|Breast(13;1.59e-06)|all_neural(1;1.03e-05)|Melanoma(1;0.0171)|Renal(347;0.0684)		all cancers(2;8.67e-65)|GBM - Glioblastoma multiforme(2;8.89e-62)|BRCA - Breast invasive adenocarcinoma(5;2.43e-08)|Lung(24;1.5e-05)|LUAD - Lung adenocarcinoma(15;8.5e-05)|STAD - Stomach adenocarcinoma(21;0.00372)|Kidney(9;0.143)					A		sarcoma|glioma|colorectal|other								---	---	---	---
RSRC2	65117	broad.mit.edu	37	12	122995657	122995657	+	Silent	SNP	T	C	C			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122995657T>C	uc001ucr.2	-	7	950	c.804A>G	c.(802-804)GCA>GCG	p.A268A	RSRC2_uc001uco.2_Silent_p.A36A|RSRC2_uc001ucp.2_Silent_p.A209A|RSRC2_uc001ucq.2_Silent_p.A36A|RSRC2_uc001ucs.2_Silent_p.A36A|RSRC2_uc001uct.2_Silent_p.A220A|RSRC2_uc001ucu.2_Silent_p.A268A	NM_023012	NP_075388	Q7L4I2	RSRC2_HUMAN	arginine/serine-rich coiled-coil 2 isoform a	268	Potential.									ovary(1)	1	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;5.14e-05)|Epithelial(86;0.000183)|BRCA - Breast invasive adenocarcinoma(302;0.201)														---	---	---	---
NUPL1	9818	broad.mit.edu	37	13	25882042	25882042	+	Missense_Mutation	SNP	G	C	C			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:25882042G>C	uc001uqi.2	+	2	452	c.206G>C	c.(205-207)GGA>GCA	p.G69A	NUPL1_uc001uqg.1_Missense_Mutation_p.G69A|NUPL1_uc001uqj.2_Missense_Mutation_p.G69A	NM_014089	NP_054808	Q9BVL2	NUPL1_HUMAN	nucleoporin like 1 isoform a	69	14 X 2 AA repeats of F-G.|5.				carbohydrate metabolic process|glucose transport|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear membrane|nuclear pore					0		Lung SC(185;0.0225)|Breast(139;0.0351)		all cancers(112;0.0092)|Epithelial(112;0.0477)|OV - Ovarian serous cystadenocarcinoma(117;0.165)|GBM - Glioblastoma multiforme(144;0.244)														---	---	---	---
DCLK1	9201	broad.mit.edu	37	13	36686282	36686282	+	Missense_Mutation	SNP	G	T	T			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:36686282G>T	uc001uvf.2	-	3	680	c.447C>A	c.(445-447)AAC>AAA	p.N149K		NM_004734	NP_004725	O15075	DCLK1_HUMAN	doublecortin-like kinase 1	149					cell differentiation|central nervous system development|endosome transport|intracellular signal transduction|response to virus	integral to plasma membrane	ATP binding|protein serine/threonine kinase activity|receptor signaling protein activity			stomach(6)|ovary(2)|skin(1)	9		Breast(139;0.0147)|Lung SC(185;0.0685)|Prostate(109;0.122)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;1.72e-06)|Epithelial(112;4.24e-05)|BRCA - Breast invasive adenocarcinoma(63;0.00159)|OV - Ovarian serous cystadenocarcinoma(117;0.0158)|GBM - Glioblastoma multiforme(144;0.0638)														---	---	---	---
GPC5	2262	broad.mit.edu	37	13	92345708	92345708	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:92345708G>A	uc010tif.1	+	3	959	c.593G>A	c.(592-594)CGC>CAC	p.R198H		NM_004466	NP_004457	P78333	GPC5_HUMAN	glypican 5 precursor	198						anchored to membrane|extracellular space|integral to plasma membrane|proteinaceous extracellular matrix	heparan sulfate proteoglycan binding			ovary(2)|skin(2)|upper_aerodigestive_tract(1)	5	all_cancers(3;1.43e-07)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)	Lung NSC(4;0.00454)																---	---	---	---
ZNF219	51222	broad.mit.edu	37	14	21561022	21561022	+	Missense_Mutation	SNP	G	T	T			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21561022G>T	uc001vzr.2	-	3	855	c.434C>A	c.(433-435)GCC>GAC	p.A145D	ZNF219_uc001vzs.2_Missense_Mutation_p.A145D|ZNF219_uc010aik.1_Missense_Mutation_p.A145D	NM_016423	NP_057507	Q9P2Y4	ZN219_HUMAN	zinc finger protein 219	145					negative regulation of transcription, DNA-dependent	integral to membrane|nucleus	DNA binding|histamine receptor activity|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			central_nervous_system(1)	1	all_cancers(95;0.00185)		OV - Ovarian serous cystadenocarcinoma(11;9.86e-11)|Epithelial(56;1.27e-08)|all cancers(55;6.06e-08)	GBM - Glioblastoma multiforme(265;0.0191)												OREG0022565	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
SSTR1	6751	broad.mit.edu	37	14	38678850	38678850	+	Missense_Mutation	SNP	T	A	A			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:38678850T>A	uc001wul.1	+	3	873	c.256T>A	c.(256-258)TAT>AAT	p.Y86N	SSTR1_uc010amu.1_Intron	NM_001049	NP_001040	P30872	SSR1_HUMAN	somatostatin receptor 1	86	Cytoplasmic (Potential).				digestion|G-protein signaling, coupled to cyclic nucleotide second messenger|negative regulation of cell proliferation|response to nutrient	integral to plasma membrane	somatostatin receptor activity			central_nervous_system(3)|ovary(1)|lung(1)	5	Hepatocellular(127;0.213)|Esophageal squamous(585;0.22)		Lung(238;3.93e-06)|LUAD - Lung adenocarcinoma(48;2.62e-05)|Epithelial(34;0.187)	GBM - Glioblastoma multiforme(112;0.00444)	Octreotide(DB00104)													---	---	---	---
CLEC14A	161198	broad.mit.edu	37	14	38725167	38725167	+	Missense_Mutation	SNP	C	A	A			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:38725167C>A	uc001wum.1	-	1	408	c.61G>T	c.(61-63)GGC>TGC	p.G21C		NM_175060	NP_778230	Q86T13	CLC14_HUMAN	C-type lectin domain family 14, member A	21						integral to membrane	sugar binding			ovary(3)|skin(1)	4	Hepatocellular(127;0.213)|Esophageal squamous(585;0.22)		Lung(238;3.93e-06)|LUAD - Lung adenocarcinoma(48;2.62e-05)|Epithelial(34;0.187)	GBM - Glioblastoma multiforme(112;0.00439)														---	---	---	---
C14orf182	283551	broad.mit.edu	37	14	50472506	50472506	+	Silent	SNP	C	T	T			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:50472506C>T	uc001wxi.1	-	1	1733	c.12G>A	c.(10-12)CGG>CGA	p.R4R		NM_001012706	NP_001012724	A1A4T8	CN182_HUMAN	hypothetical protein LOC283551	4											0																		---	---	---	---
KIAA0586	9786	broad.mit.edu	37	14	58934502	58934502	+	Silent	SNP	C	G	G			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:58934502C>G	uc001xdv.3	+	15	2349	c.2076C>G	c.(2074-2076)GTC>GTG	p.V692V	KIAA0586_uc010trr.1_Silent_p.V809V|KIAA0586_uc001xdt.3_Silent_p.V724V|KIAA0586_uc001xdu.3_Silent_p.V753V|KIAA0586_uc010trs.1_Silent_p.V683V|KIAA0586_uc010trt.1_Silent_p.V628V|KIAA0586_uc010tru.1_Silent_p.V628V	NM_014749	NP_055564	E9PGW8	E9PGW8_HUMAN	talpid3 protein	692										ovary(1)	1																		---	---	---	---
PAPLN	89932	broad.mit.edu	37	14	73720679	73720679	+	Intron	SNP	C	A	A			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:73720679C>A	uc010ttx.1	+						PAPLN_uc001xnw.3_Intron|PAPLN_uc010arl.2_Intron|PAPLN_uc010ttw.1_Intron|PAPLN_uc010tty.1_Intron	NM_173462	NP_775733			papilin							proteinaceous extracellular matrix	metalloendopeptidase activity|serine-type endopeptidase inhibitor activity|zinc ion binding			ovary(1)|central_nervous_system(1)|skin(1)	3				BRCA - Breast invasive adenocarcinoma(234;0.00394)|OV - Ovarian serous cystadenocarcinoma(108;0.0468)														---	---	---	---
VIPAR	63894	broad.mit.edu	37	14	77917637	77917637	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:77917637C>T	uc001xtt.1	-	5	574	c.236G>A	c.(235-237)GGC>GAC	p.G79D	VIPAR_uc001xtu.1_Missense_Mutation_p.G79D|VIPAR_uc010tvj.1_Intron|VIPAR_uc001xtv.1_Missense_Mutation_p.G79D	NM_022067	NP_071350	Q9H9C1	VIPAR_HUMAN	hypothetical protein LOC63894	79					endosome to lysosome transport|intracellular protein transport|regulation of transcription, DNA-dependent|transcription, DNA-dependent	early endosome|late endosome|recycling endosome	protein binding			central_nervous_system(1)	1																		---	---	---	---
DEGS2	123099	broad.mit.edu	37	14	100613240	100613240	+	Missense_Mutation	SNP	C	A	A			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:100613240C>A	uc001ygx.2	-	3	918	c.830G>T	c.(829-831)CGG>CTG	p.R277L		NM_206918	NP_996801	Q6QHC5	DEGS2_HUMAN	degenerative spermatocyte homolog 2, lipid	277					fatty acid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	sphingosine hydroxylase activity				0		Melanoma(154;0.212)																---	---	---	---
C14orf73	91828	broad.mit.edu	37	14	103568595	103568595	+	Missense_Mutation	SNP	G	T	T			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:103568595G>T	uc001ymk.2	+	2	611	c.535G>T	c.(535-537)GCT>TCT	p.A179S		NM_001077594	NP_001071062	Q17RC7	EX3L4_HUMAN	hypothetical protein LOC91828	179											0		Melanoma(154;0.155)	Epithelial(46;0.221)															---	---	---	---
AP4E1	23431	broad.mit.edu	37	15	51250862	51250862	+	Missense_Mutation	SNP	A	C	C			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:51250862A>C	uc001zyx.1	+	14	1752	c.1722A>C	c.(1720-1722)TTA>TTC	p.L574F		NM_007347	NP_031373	Q9UPM8	AP4E1_HUMAN	adaptor-related protein complex 4, epsilon 1	574					intracellular protein transport|vesicle-mediated transport	COPI vesicle coat	binding|structural molecule activity				0				all cancers(107;0.000893)|GBM - Glioblastoma multiforme(94;0.00364)														---	---	---	---
IGDCC4	57722	broad.mit.edu	37	15	65678955	65678955	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65678955C>T	uc002aou.1	-	17	3095	c.2885G>A	c.(2884-2886)GGT>GAT	p.G962D	IGDCC4_uc002aot.1_Missense_Mutation_p.G550D	NM_020962	NP_066013	Q8TDY8	IGDC4_HUMAN	immunoglobulin superfamily, DCC subclass, member	962	Helical; (Potential).					integral to membrane|plasma membrane				ovary(1)|pancreas(1)|skin(1)	3																OREG0023195	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
KIAA1199	57214	broad.mit.edu	37	15	81173476	81173476	+	Silent	SNP	C	A	A			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:81173476C>A	uc002bfw.1	+	5	876	c.616C>A	c.(616-618)CGG>AGG	p.R206R	KIAA1199_uc010unn.1_Silent_p.R206R	NM_018689	NP_061159	Q8WUJ3	K1199_HUMAN	KIAA1199 precursor	206										upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3																		---	---	---	---
IQGAP1	8826	broad.mit.edu	37	15	90984881	90984881	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90984881G>A	uc002bpl.1	+	8	894	c.793G>A	c.(793-795)GCT>ACT	p.A265T		NM_003870	NP_003861	P46940	IQGA1_HUMAN	IQ motif containing GTPase activating protein 1	265					energy reserve metabolic process|regulation of insulin secretion|small GTPase mediated signal transduction	actin filament|cytoplasm|midbody|nucleus|plasma membrane	calmodulin binding|GTPase inhibitor activity|protein phosphatase binding|Ras GTPase activator activity			ovary(2)|lung(2)|central_nervous_system(2)|pancreas(1)|skin(1)	8	Melanoma(11;0.00551)|Lung NSC(78;0.0237)|all_lung(78;0.0488)		BRCA - Breast invasive adenocarcinoma(143;0.0745)|KIRC - Kidney renal clear cell carcinoma(17;0.138)|Kidney(142;0.194)															---	---	---	---
CHD2	1106	broad.mit.edu	37	15	93567880	93567880	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:93567880G>A	uc002bsp.2	+	39	6007	c.5432G>A	c.(5431-5433)AGA>AAA	p.R1811K		NM_001271	NP_001262	O14647	CHD2_HUMAN	chromodomain helicase DNA binding protein 2	1811					regulation of transcription from RNA polymerase II promoter	nucleus	ATP binding|ATP-dependent DNA helicase activity|DNA binding			ovary(1)|skin(1)	2	Lung NSC(78;0.00976)|all_lung(78;0.016)		BRCA - Breast invasive adenocarcinoma(143;0.0282)|OV - Ovarian serous cystadenocarcinoma(32;0.0814)															---	---	---	---
DNAH3	55567	broad.mit.edu	37	16	21031006	21031006	+	Missense_Mutation	SNP	C	G	G			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:21031006C>G	uc010vbe.1	-	41	5962	c.5962G>C	c.(5962-5964)GAT>CAT	p.D1988H		NM_017539	NP_060009	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	1988					ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(10)|skin(3)|large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	18				GBM - Glioblastoma multiforme(48;0.207)														---	---	---	---
SRCAP	10847	broad.mit.edu	37	16	30715408	30715408	+	Silent	SNP	C	G	G			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30715408C>G	uc002dze.1	+	4	463	c.78C>G	c.(76-78)GGC>GGG	p.G26G	SRCAP_uc002dzf.2_RNA	NM_006662	NP_006653	Q6ZRS2	SRCAP_HUMAN	Snf2-related CBP activator protein	26					interspecies interaction between organisms|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	Golgi apparatus|nucleus|protein complex	ATP binding|DNA binding|helicase activity|histone acetyltransferase activity|transcription coactivator activity			ovary(3)|skin(1)	4			Colorectal(24;0.198)															---	---	---	---
CNTNAP4	85445	broad.mit.edu	37	16	76572099	76572099	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:76572099G>A	uc002feu.1	+	21	3467	c.3082G>A	c.(3082-3084)GCT>ACT	p.A1028T	CNTNAP4_uc002fev.1_Missense_Mutation_p.A892T|CNTNAP4_uc010chb.1_Missense_Mutation_p.A955T|CNTNAP4_uc002fex.1_Missense_Mutation_p.A1031T	NM_033401	NP_207837	Q9C0A0	CNTP4_HUMAN	cell recognition protein CASPR4 isoform 1	1028	Extracellular (Potential).				cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(1)|pancreas(1)	2																		---	---	---	---
SPATA22	84690	broad.mit.edu	37	17	3349846	3349846	+	Missense_Mutation	SNP	C	G	G			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3349846C>G	uc002fvm.2	-	7	959	c.722G>C	c.(721-723)AGA>ACA	p.R241T	SPATA22_uc010vrg.1_Missense_Mutation_p.R225T|SPATA22_uc010vrf.1_Missense_Mutation_p.R241T|SPATA22_uc002fvn.2_Missense_Mutation_p.R241T|SPATA22_uc002fvo.2_Missense_Mutation_p.R241T|SPATA22_uc002fvp.2_Missense_Mutation_p.R241T|SPATA22_uc010ckf.2_Missense_Mutation_p.R198T	NM_032598	NP_115987	Q8NHS9	SPT22_HUMAN	spermatogenesis associated 22	241											0																		---	---	---	---
CDK12	51755	broad.mit.edu	37	17	37649112	37649112	+	Silent	SNP	C	T	T			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37649112C>T	uc010cvv.2	+	4	2803	c.2217C>T	c.(2215-2217)GGC>GGT	p.G739G	CDK12_uc010wef.1_Silent_p.G738G|CDK12_uc002hrw.3_Silent_p.G739G	NM_016507	NP_057591	Q9NYV4	CDK12_HUMAN	Cdc2-related kinase, arginine/serine-rich	739	ATP (By similarity).|Protein kinase.				mRNA processing|phosphorylation of RNA polymerase II C-terminal domain|protein autophosphorylation|regulation of MAP kinase activity|RNA splicing	nuclear cyclin-dependent protein kinase holoenzyme complex|nuclear speck|nucleolus	ATP binding|cyclin-dependent protein kinase activity|protein binding|RNA polymerase II carboxy-terminal domain kinase activity			ovary(10)|lung(4)|breast(2)|skin(2)|large_intestine(1)	19															TCGA Ovarian(9;0.13)			---	---	---	---
KRTAP9-2	83899	broad.mit.edu	37	17	39383275	39383275	+	Silent	SNP	C	G	G			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39383275C>G	uc002hwf.2	+	1	376	c.369C>G	c.(367-369)CCC>CCG	p.P123P		NM_031961	NP_114167	Q9BYQ4	KRA92_HUMAN	keratin associated protein 9.2	123	17 X 5 AA repeats of C-C-[RQVSGE]-[SPTQ]- [TASP].					keratin filament	protein binding			upper_aerodigestive_tract(1)	1		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000397)															---	---	---	---
TRIM37	4591	broad.mit.edu	37	17	57109276	57109276	+	Silent	SNP	A	T	T			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:57109276A>T	uc002iwy.3	-	18	2373	c.1929T>A	c.(1927-1929)GCT>GCA	p.A643A	TRIM37_uc002iwz.3_Silent_p.A643A|TRIM37_uc002ixa.3_Silent_p.A521A|TRIM37_uc010woc.1_Silent_p.A609A	NM_001005207	NP_001005207	O94972	TRI37_HUMAN	tripartite motif-containing 37 protein	643						perinuclear region of cytoplasm|peroxisome	ligase activity|protein binding|zinc ion binding			lung(2)|pancreas(2)|ovary(1)|skin(1)|breast(1)	7	Medulloblastoma(34;0.0922)|all_neural(34;0.101)													Mulibrey_Nanism				---	---	---	---
EVI5L	115704	broad.mit.edu	37	19	7914143	7914143	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7914143C>T	uc002min.2	+	5	708	c.554C>T	c.(553-555)GCA>GTA	p.A185V	EVI5L_uc010xjz.1_Missense_Mutation_p.A185V|EVI5L_uc002mio.1_5'Flank	NM_145245	NP_660288	Q96CN4	EVI5L_HUMAN	ecotropic viral integration site 5-like isoform	185	Rab-GAP TBC.					intracellular	protein binding|Rab GTPase activator activity			ovary(1)	1																		---	---	---	---
CARM1	10498	broad.mit.edu	37	19	11022906	11022906	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11022906C>T	uc002mpz.2	+	5	731	c.605C>T	c.(604-606)GCC>GTC	p.A202V	CARM1_uc010dxn.2_RNA|CARM1_uc002mqa.2_5'UTR	NM_199141	NP_954592	Q86X55	CARM1_HUMAN	coactivator-associated arginine	202					cellular lipid metabolic process|histone H3-R2 methylation|interspecies interaction between organisms|pathogenesis|positive regulation of fat cell differentiation|regulation of estrogen receptor signaling pathway|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|nucleoplasm	beta-catenin binding|histone acetyl-lysine binding|histone methyltransferase activity (H3-R17 specific)|ligand-dependent nuclear receptor transcription coactivator activity|protein-arginine omega-N asymmetric methyltransferase activity|transcription regulatory region DNA binding				0																		---	---	---	---
LDLR	3949	broad.mit.edu	37	19	11218184	11218184	+	Nonsense_Mutation	SNP	G	T	T			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11218184G>T	uc002mqk.3	+	6	1102	c.934G>T	c.(934-936)GAG>TAG	p.E312*	LDLR_uc010xlk.1_Nonsense_Mutation_p.E312*|LDLR_uc010xll.1_Nonsense_Mutation_p.E271*|LDLR_uc010xlm.1_Nonsense_Mutation_p.E165*|LDLR_uc010xln.1_Nonsense_Mutation_p.E185*|LDLR_uc010xlo.1_Nonsense_Mutation_p.E144*	NM_000527	NP_000518	P01130	LDLR_HUMAN	low density lipoprotein receptor precursor	312	Extracellular (Potential).|LDL-receptor class A 7.				cholesterol homeostasis|cholesterol metabolic process|interspecies interaction between organisms|intestinal cholesterol absorption|low-density lipoprotein particle clearance|receptor-mediated endocytosis	clathrin-coated endocytic vesicle membrane|coated pit|early endosome|endosome membrane|external side of plasma membrane|integral to plasma membrane|low-density lipoprotein particle|lysosome	calcium ion binding|low-density lipoprotein receptor activity|protein binding|very-low-density lipoprotein particle receptor activity			ovary(2)|skin(2)	4		Lung NSC(9;0.000245)|Renal(1328;0.0007)|Hepatocellular(1079;0.0524)		GBM - Glioblastoma multiforme(1328;1.36e-05)|STAD - Stomach adenocarcinoma(1328;0.000766)|Lung(535;0.197)	Methyl aminolevulinate(DB00992)|Porfimer(DB00707)													---	---	---	---
CYP4F8	11283	broad.mit.edu	37	19	15730439	15730439	+	Intron	SNP	G	A	A			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15730439G>A	uc002nbi.2	+						CYP4F8_uc010xoi.1_3'UTR|CYP4F8_uc010xoj.1_Intron	NM_007253	NP_009184			cytochrome P450, family 4, subfamily F,						prostaglandin metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	alkane 1-monooxygenase activity|aromatase activity|electron carrier activity|heme binding|oxygen binding|protein binding			large_intestine(1)	1																		---	---	---	---
PSG1	5669	broad.mit.edu	37	19	43372329	43372329	+	Silent	SNP	G	A	A	rs142917150		TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43372329G>A	uc002ovb.2	-	5	1305	c.1167C>T	c.(1165-1167)AGC>AGT	p.S389S	PSG3_uc002ouf.2_Intron|PSG1_uc002oug.1_Intron|PSG11_uc002ouw.2_Intron|PSG7_uc002ous.1_Intron|PSG7_uc002out.1_Intron|PSG10_uc002ouv.1_Intron|PSG1_uc002oun.2_Intron|PSG1_uc002our.1_Silent_p.S389S|PSG1_uc010eio.1_Silent_p.S389S|PSG1_uc002oux.1_Silent_p.S318S|PSG1_uc002ouy.1_Silent_p.S296S|PSG1_uc002ouz.1_Silent_p.S389S|PSG1_uc002ova.1_Silent_p.S296S|PSG1_uc002ovc.2_Silent_p.S296S|PSG1_uc002ovd.1_Silent_p.S389S	NM_006905	NP_008836	P11464	PSG1_HUMAN	pregnancy specific beta-1-glycoprotein 1	389	Ig-like C2-type 3.				female pregnancy	extracellular region				ovary(2)	2		Prostate(69;0.00682)																---	---	---	---
LRRC4B	94030	broad.mit.edu	37	19	51021716	51021716	+	Silent	SNP	G	A	A			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51021716G>A	uc002pss.2	-	3	1391	c.1254C>T	c.(1252-1254)GAC>GAT	p.D418D		NM_001080457	NP_001073926	Q9NT99	LRC4B_HUMAN	leucine rich repeat containing 4B precursor	418	Extracellular (Potential).|Ig-like C2-type.					cell junction|integral to membrane|presynaptic membrane				central_nervous_system(1)|skin(1)	2		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00284)|GBM - Glioblastoma multiforme(134;0.0188)														---	---	---	---
SIGLEC14	100049587	broad.mit.edu	37	19	52148732	52148732	+	Missense_Mutation	SNP	G	C	C			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52148732G>C	uc002pxf.3	-	4	872	c.752C>G	c.(751-753)ACA>AGA	p.T251R		NM_001098612	NP_001092082	Q08ET2	SIG14_HUMAN	sialic acid binding Ig-like lectin 14 precursor	251	Extracellular (Potential).|Ig-like C2-type 2.				cell adhesion	integral to membrane|plasma membrane	protein binding|sugar binding			ovary(1)	1		all_neural(266;0.0299)		GBM - Glioblastoma multiforme(134;0.000965)|OV - Ovarian serous cystadenocarcinoma(262;0.0195)														---	---	---	---
HAS1	3036	broad.mit.edu	37	19	52220238	52220238	+	Missense_Mutation	SNP	C	G	G			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52220238C>G	uc002pxo.1	-	3	946	c.911G>C	c.(910-912)TGC>TCC	p.C304S	HAS1_uc010epc.1_5'UTR|HAS1_uc010epd.1_Missense_Mutation_p.C269S|HAS1_uc002pxn.1_Missense_Mutation_p.C311S|HAS1_uc002pxp.1_Missense_Mutation_p.C303S	NM_001523	NP_001514	Q92839	HAS1_HUMAN	hyaluronan synthase 1	304	Cytoplasmic (Potential).				cell adhesion	integral to plasma membrane	hyaluronan synthase activity|protein binding			ovary(1)|pancreas(1)	2		all_neural(266;0.0189)|Medulloblastoma(540;0.146)		GBM - Glioblastoma multiforme(134;0.00102)|OV - Ovarian serous cystadenocarcinoma(262;0.0177)														---	---	---	---
OTOR	56914	broad.mit.edu	37	20	16730657	16730657	+	Splice_Site	SNP	T	C	C			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:16730657T>C	uc002wpj.2	+	3	407	c.363_splice	c.e3+2	p.T121_splice	OTOR_uc002wpk.2_Splice_Site	NM_020157	NP_064542			otoraplin precursor						sensory perception of sound	extracellular region				ovary(1)|central_nervous_system(1)	2																		---	---	---	---
CST8	10047	broad.mit.edu	37	20	23472436	23472436	+	Silent	SNP	C	T	T	rs150145986		TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:23472436C>T	uc002wth.1	+	2	489	c.132C>T	c.(130-132)AAC>AAT	p.N44N		NM_005492	NP_005483	O60676	CST8_HUMAN	cystatin 8 precursor	44						extracellular region	cysteine-type endopeptidase inhibitor activity				0	Colorectal(13;0.0431)|Lung NSC(19;0.235)																	---	---	---	---
ELMO2	63916	broad.mit.edu	37	20	44999980	44999980	+	Intron	SNP	A	T	T			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44999980A>T	uc002xrt.1	-						ELMO2_uc010zxq.1_Intron|ELMO2_uc002xrs.1_Intron|ELMO2_uc002xru.1_Intron|ELMO2_uc010zxr.1_Intron|ELMO2_uc010zxs.1_Intron|ELMO2_uc002xrv.1_Intron	NM_133171	NP_573403			engulfment and cell motility 2						apoptosis|cell chemotaxis|phagocytosis	cytoskeleton|cytosol|membrane	lyase activity|receptor tyrosine kinase binding|SH3 domain binding			ovary(1)	1		Myeloproliferative disorder(115;0.0122)																---	---	---	---
PTGIS	5740	broad.mit.edu	37	20	48124559	48124559	+	Missense_Mutation	SNP	G	C	C			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:48124559G>C	uc002xut.2	-	10	1455	c.1401C>G	c.(1399-1401)ATC>ATG	p.I467M	PTGIS_uc010zyi.1_Missense_Mutation_p.I328M	NM_000961	NP_000952	Q16647	PTGIS_HUMAN	prostaglandin I2 synthase	467					hormone biosynthetic process|prostaglandin biosynthetic process|xenobiotic metabolic process	endoplasmic reticulum lumen|endoplasmic reticulum membrane|integral to membrane	electron carrier activity|heme binding|monooxygenase activity|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen|prostaglandin-I synthase activity			skin(2)|ovary(1)	3			BRCA - Breast invasive adenocarcinoma(12;2.37e-05)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)		Phenylbutazone(DB00812)													---	---	---	---
KCNJ6	3763	broad.mit.edu	37	21	39086934	39086934	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:39086934C>T	uc011aej.1	-	3	579	c.526G>A	c.(526-528)GTG>ATG	p.V176M	KCNJ6_uc002ywo.2_Missense_Mutation_p.V176M	NM_002240	NP_002231	P48051	IRK6_HUMAN	potassium inwardly-rectifying channel J6	176	Helical; Name=M2; (By similarity).				synaptic transmission	Golgi apparatus|voltage-gated potassium channel complex	G-protein activated inward rectifier potassium channel activity|protein binding			skin(1)	1					Halothane(DB01159)													---	---	---	---
MCM3AP	8888	broad.mit.edu	37	21	47664820	47664820	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47664820G>A	uc002zir.1	-	23	4975	c.4939C>T	c.(4939-4941)CTT>TTT	p.L1647F	MCM3APAS_uc002zim.2_Intron|MCM3APAS_uc002zin.2_Intron|MCM3AP_uc002zio.1_Missense_Mutation_p.L142F|MCM3AP_uc002zip.1_Missense_Mutation_p.L388F|MCM3AP_uc002ziq.1_Missense_Mutation_p.L574F|MCM3APAS_uc002zis.1_Intron	NM_003906	NP_003897	O60318	MCM3A_HUMAN	minichromosome maintenance complex component 3	1647					DNA replication|protein import into nucleus	cytosol|nucleus	DNA binding|nucleotide binding			large_intestine(2)|lung(1)|ovary(1)|skin(1)	5	Breast(49;0.112)																	---	---	---	---
SUSD2	56241	broad.mit.edu	37	22	24583266	24583266	+	Missense_Mutation	SNP	T	G	G			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24583266T>G	uc002zzn.1	+	11	1783	c.1739T>G	c.(1738-1740)GTG>GGG	p.V580G		NM_019601	NP_062547	Q9UGT4	SUSD2_HUMAN	sushi domain containing 2 precursor	580	VWFD.|Extracellular (Potential).				immune response	integral to membrane	polysaccharide binding|protein binding|scavenger receptor activity			skin(1)	1																		---	---	---	---
GGT1	2678	broad.mit.edu	37	22	25011062	25011062	+	Missense_Mutation	SNP	C	G	G	rs138472970	by1000genomes	TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:25011062C>G	uc003aan.1	+	7	837	c.350C>G	c.(349-351)ACC>AGC	p.T117S	GGT1_uc003aas.1_Missense_Mutation_p.T117S|GGT1_uc003aat.1_Missense_Mutation_p.T117S|GGT1_uc003aau.1_Missense_Mutation_p.T117S|GGT1_uc003aav.1_Missense_Mutation_p.T117S|GGT1_uc003aaw.1_Missense_Mutation_p.T117S|GGT1_uc003aax.1_Missense_Mutation_p.T117S	NM_013430	NP_038347	P19440	GGT1_HUMAN	gamma-glutamyltransferase 1 precursor	117	Extracellular (Potential).				glutathione biosynthetic process	integral to membrane	acyltransferase activity|gamma-glutamyltransferase activity|protein binding				0					Glutathione(DB00143)													---	---	---	---
FOXRED2	80020	broad.mit.edu	37	22	36902292	36902292	+	Nonsense_Mutation	SNP	C	A	A			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:36902292C>A	uc003apn.3	-	1	286	c.178G>T	c.(178-180)GAG>TAG	p.E60*	FOXRED2_uc003apo.3_Nonsense_Mutation_p.E60*|FOXRED2_uc003app.3_Nonsense_Mutation_p.E60*	NM_024955	NP_079231	Q8IWF2	FXRD2_HUMAN	FAD-dependent oxidoreductase domain containing 2	60					ER-associated protein catabolic process	endoplasmic reticulum lumen	flavin adenine dinucleotide binding|oxidoreductase activity|protein binding			lung(1)|kidney(1)	2																		---	---	---	---
ACO2	50	broad.mit.edu	37	22	41923306	41923306	+	Silent	SNP	G	A	A			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:41923306G>A	uc003bac.2	+	16	1990	c.1968G>A	c.(1966-1968)AGG>AGA	p.R656R	ACO2_uc003bad.2_Silent_p.R681R|POLR3H_uc003bae.2_RNA|POLR3H_uc003baf.2_3'UTR|POLR3H_uc003bag.2_3'UTR|POLR3H_uc003bai.2_3'UTR	NM_001098	NP_001089	Q99798	ACON_HUMAN	aconitase 2, mitochondrial precursor	656					citrate metabolic process|tricarboxylic acid cycle	mitochondrial matrix|nucleus	4 iron, 4 sulfur cluster binding|aconitate hydratase activity|citrate hydro-lyase (cis-aconitate-forming) activity|iron ion binding|isocitrate hydro-lyase (cis-aconitate-forming) activity			breast(2)|ovary(1)|lung(1)	4																OREG0026589	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
PKDREJ	10343	broad.mit.edu	37	22	46658193	46658193	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:46658193C>T	uc003bhh.2	-	1	1027	c.1027G>A	c.(1027-1029)GAT>AAT	p.D343N		NM_006071	NP_006062	Q9NTG1	PKDRE_HUMAN	receptor for egg jelly-like protein precursor	343	Extracellular (Potential).|REJ.				acrosome reaction|neuropeptide signaling pathway	integral to membrane	calcium ion binding|ion channel activity			breast(3)|ovary(2)	5		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00459)														---	---	---	---
CPT1B	1375	broad.mit.edu	37	22	51014761	51014761	+	Missense_Mutation	SNP	G	T	T			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:51014761G>T	uc003bmk.3	-	5	727	c.565C>A	c.(565-567)CTA>ATA	p.L189I	CPT1B_uc003bml.2_Missense_Mutation_p.L189I|CPT1B_uc003bmm.2_Missense_Mutation_p.L189I|CPT1B_uc003bmo.2_Missense_Mutation_p.L189I|CPT1B_uc011asa.1_Missense_Mutation_p.L155I|CPT1B_uc003bmn.2_Missense_Mutation_p.L189I|CPT1B_uc011asb.1_Missense_Mutation_p.L189I|CHKB-CPT1B_uc003bmp.2_5'UTR	NM_001145137	NP_001138609	Q92523	CPT1B_HUMAN	carnitine palmitoyltransferase 1B isoform a	189	Cytoplasmic (Potential).				carnitine shuttle|fatty acid beta-oxidation|regulation of fatty acid oxidation	integral to membrane|mitochondrial outer membrane	carnitine O-palmitoyltransferase activity			ovary(1)|central_nervous_system(1)	2		all_cancers(38;8.8e-15)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		all cancers(3;3.56e-77)|OV - Ovarian serous cystadenocarcinoma(4;5.39e-74)|Epithelial(4;5.58e-70)|GBM - Glioblastoma multiforme(4;5.59e-08)|LUAD - Lung adenocarcinoma(64;0.0016)|Lung(4;0.00942)|BRCA - Breast invasive adenocarcinoma(115;0.207)												OREG0026685	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
STARD8	9754	broad.mit.edu	37	X	67941878	67941878	+	Intron	SNP	G	A	A			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:67941878G>A	uc004dxa.2	+						STARD8_uc004dxb.2_Intron|STARD8_uc004dxc.3_Intron	NM_014725	NP_055540			StAR-related lipid transfer (START) domain						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|focal adhesion	GTPase activator activity			breast(3)|ovary(2)|pancreas(1)	6																		---	---	---	---
CYLC1	1538	broad.mit.edu	37	X	83128123	83128123	+	Missense_Mutation	SNP	G	C	C			TCGA-CG-4304-01A-01D-1158-08	TCGA-CG-4304-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:83128123G>C	uc004eei.1	+	4	428	c.407G>C	c.(406-408)GGT>GCT	p.G136A	CYLC1_uc004eeh.1_Missense_Mutation_p.G135A	NM_021118	NP_066941	P35663	CYLC1_HUMAN	cylicin, basic protein of sperm head	136					cell differentiation|multicellular organismal development|spermatogenesis	acrosomal matrix|cytoskeletal calyx	structural molecule activity			ovary(4)|skin(1)	5																		---	---	---	---
